Dat e Theme 3: Characteristics of nucleic acids Types of Size Function

cellular
RNA
Messenger RNA 300-3000 messenger RNA (mRNA) carries the protein
blueprint from a cell's DNA to its ribosomes,
Task 1. Study the structure of DNA (m-RNA) nucleotides which are the "machines" that drive protein
synthesis. Transfer RNA (tRNA) then carries the
appropriate amino acids into the ribosome for
inclusion in the new protein.
Transfer RNA 75-95 Transfer ribonucleic acid (tRNA) helps decode a
messenger RNA (mRNA) sequence into a
(t-RNA) nucleotides protein. tRNAs function at specific sites in the
ribosome during translation, which is a process that
synthesizes a protein from an mRNA molecule.
Ribosomal RNA 3000-5000 Ribosomal RNA (rRNA) associates with a set of
proteins to form ribosomes., catalyze the assembly
(r-RNA) nucleotides of amino acids into protein chains. They also bind
tRNAs and various accessory molecules necessary
for protein synthesis.
90-220  play important roles in splicing of introns from
Small nuclear RNA primary genomic transcripts.
nucleotides
(snRNA)
Task 3. Write down the types of RNA.
mRNA,tRNA,snRNA,tmRNA,dsRNA

1- Amino acid
2- Ester bond
Task 2. Complete the table below “Forms of DNA”.
3- Intra molecular base pairing
Characteristic A-DNA B-DNA Z-DNA 4- Anti codon
Coiling right-handed right-handed  a left-handed 5-
double helix double helix double helix
Base pair per 11 10 12 Task 4. Give a definition of the terms
turn
“replication”, reparation”.
Task 3. Write down the functions of different types of cellular RNA.
Replication — molecule is copied to produce two identical
molecules or strands
Reparation — action of repairing

Task 5. Study the scheme of DNA replication. Fill the table below

Enzyme Function
Topoisomerase Enzyme that cuts and rejoins DNA strands.
Topoisomerase is essential during DNA
replication.
Helicase Enzyme that helps unwind the DNA double
helix during replication.
Destabilizing fundamental to the mechanisms of replication,
proteins recombination and gene expression.
RNA-primase RNA primase lays down an RNA primer to start
DNA replication.

RNA-primer Primer RNA is RNA that initiates DNA synthesis.

Primers are required for DNA synthesis 
DNA-polymerase  responsible for forming new copies of DNA, in
the form of nucleic acid molecules. ... DNA
polymerase is responsible for the process of DNA
replication

Okazaki fragment Allows replication of 5 to 3 strands

DNA-ligase  facilitates the joining of DNA strands together
by catalyzing the formation of a phosphodiester
bond. DNA ligase is used in both DNA repair and
DNA replication 

Scheme of DNA replication

 3

Task 6. Study Chargaff’s rules that reflect principle of complementary Task 8. Study a scheme that explains an algorithm of solving of the
correspondence between nucleotides A and T, C and G.
problems in molecular biology.
Chargaff’s rules

1) The ratio of A to T is 1 to 1 and of G to C is 1 to 1.

2) Quantities of purine nitrogenous bases and pirimidine nitrogenous
bases are equal.
3) Wide variations exist in the (A+T)/(G+C) ratio.
4) A + T + G + C = 100%

Task 7. Complete the table Differences between DNA and RNA”.

Features DNA RNA

Strands Usually Double Usually one, rarely two
Sugar Deoxyribose
 Adenine,  Adenine,
Nitrogenous
 Guanine,  Guanine,
bases
 Cytosine,  Cytosine,
 …………………  Uracil
A=T A=U
Pairing
G C=G
=C .
Site in the Mostly in chromosomes, Mostly in Cytoplasm and
some in mitochondria and ribosomes
cell
chloroplasts
Reparation Yes Damaged DNA repaired No reparation once
by repair pathways damaged
Self replicating Needs cellular engymes
Replication
A-DNA,B-DNA,Z-DNA mRNA,tRNA,snRNA,tmRN
Types A,dsRNA
 Task 9. Solve the problems.
Problem 1. Write the complementary of a daughter strand of DNA
replicated from the following parental base sequences:
5’
T C G A C G A T T G A A T C T A C G G C A3’
3’AGTGCTAACTTAGATGCCGT’5…………………………………
……………………………..
Calculate the percentage of thymine and guanine in the region of DNA
molecule.
Problem 4. 1078 cytidylic nucleotides in DNA molecule are 22 % from
the general amount of nucleotides. To define:
1) How many adenylic, guanylic and thymidylic nucleotides are there
in this DNA fragment?
2) What is the length of this fragment in DNA molecule?
3) What is the mass of this fragment in DNA molecule?
4) What is the mass of corresponding fragment in mRNA molecule?
5) How many amino acids will be present in the polypeptide strand if
350 nucleotides in mRNA are introns?

Solving:
Thymine is 30%
Guanine is 25% 1) G-1078,A-1372,T-1372
2) 1470 nm
3) 1.5925*10 power 6 Daltons
Problem 2. Write the sequence of the m-RNA strand from the
4) 7.9625*10 power 5 Daltons
following parental DNA bases sequences:
5) 700 Amino acids
5’
T A A C T C A A G G A C A T A G C C A A T T 3’
3’AUUGAGUUCCUGUACGGUUAA’5……………………………
…………………………………………..
Calculate the percentage of adenine and thymine in the region of RNA
molecule.
Adenine is 20%
Thymine is 0%

Problem 3. The DNA fragment is 510 nm long. How many nitrogenous

bases are there?
Solving:
150 base pairs=300 bases

Date Signature