Professional Documents
Culture Documents
Theme 3: Characteristics of Nucleic Acids: Types of Cellular RNA Size Function
Theme 3: Characteristics of Nucleic Acids: Types of Cellular RNA Size Function
cellular
RNA
Messenger RNA 300-3000 messenger RNA (mRNA) carries the protein
blueprint from a cell's DNA to its ribosomes,
Task 1. Study the structure of DNA (m-RNA) nucleotides which are the "machines" that drive protein
synthesis. Transfer RNA (tRNA) then carries the
appropriate amino acids into the ribosome for
inclusion in the new protein.
Transfer RNA 75-95 Transfer ribonucleic acid (tRNA) helps decode a
messenger RNA (mRNA) sequence into a
(t-RNA) nucleotides protein. tRNAs function at specific sites in the
ribosome during translation, which is a process that
synthesizes a protein from an mRNA molecule.
Ribosomal RNA 3000-5000 Ribosomal RNA (rRNA) associates with a set of
proteins to form ribosomes., catalyze the assembly
(r-RNA) nucleotides of amino acids into protein chains. They also bind
tRNAs and various accessory molecules necessary
for protein synthesis.
90-220 play important roles in splicing of introns from
Small nuclear RNA primary genomic transcripts.
nucleotides
(snRNA)
Task 3. Write down the types of RNA.
mRNA,tRNA,snRNA,tmRNA,dsRNA
1- Amino acid
2- Ester bond
Task 2. Complete the table below “Forms of DNA”.
3- Intra molecular base pairing
Characteristic A-DNA B-DNA Z-DNA 4- Anti codon
Coiling right-handed right-handed a left-handed 5-
double helix double helix double helix
Base pair per 11 10 12 Task 4. Give a definition of the terms
turn
“replication”, reparation”.
Task 3. Write down the functions of different types of cellular RNA.
Replication — molecule is copied to produce two identical
molecules or strands
Reparation — action of repairing
Task 5. Study the scheme of DNA replication. Fill the table below
Enzyme Function
Topoisomerase Enzyme that cuts and rejoins DNA strands.
Topoisomerase is essential during DNA
replication.
Helicase Enzyme that helps unwind the DNA double
helix during replication.
Destabilizing fundamental to the mechanisms of replication,
proteins recombination and gene expression.
RNA-primase RNA primase lays down an RNA primer to start
DNA replication.
Task 6. Study Chargaff’s rules that reflect principle of complementary Task 8. Study a scheme that explains an algorithm of solving of the
correspondence between nucleotides A and T, C and G.
problems in molecular biology.
Chargaff’s rules
Solving:
Thymine is 30%
Guanine is 25% 1) G-1078,A-1372,T-1372
2) 1470 nm
3) 1.5925*10 power 6 Daltons
Problem 2. Write the sequence of the m-RNA strand from the
4) 7.9625*10 power 5 Daltons
following parental DNA bases sequences:
5) 700 Amino acids
5’
T A A C T C A A G G A C A T A G C C A A T T 3’
3’AUUGAGUUCCUGUACGGUUAA’5……………………………
…………………………………………..
Calculate the percentage of adenine and thymine in the region of RNA
molecule.
Adenine is 20%
Thymine is 0%
Date Signature