FEMS Microbiology Reviews 26 (2003) 419^432

www.fems-microbiology.org

PCR-based identi¢cation of Bacillus thuringiensis

pesticidal crystal genes


Manuel Porcar 1 , Victor Jua¤rez-Pe¤rez
Laboratoire des Bacte¤ries et Champignons Entomopathoge'nes, Institut Pasteur, 25 rue du Dr. Roux, 75724, Paris Cedex 15, France

Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021

Received 26 July 2002; received in revised form 13 September 2002; accepted 24 September 2002

First published online 28 October 2002

Abstract

The polymerase chain reaction (PCR) is a molecular tool widely used to characterize the insecticidal bacterium Bacillus thuringiensis.
This technique can be used to amplify specific DNA fragments and thus to determine the presence or absence of a target gene. The
identification of B. thuringiensis toxin genes by PCR can partially predict the insecticidal activity of a given strain. PCR has proven to be a
rapid and reliable method and it has largely substituted bioassays in preliminary classification of B. thuringiensis collections. In this work,
we compare the largest B. thuringiensis PCR-based screenings, and we review the natural occurrence of cry genes among native strains.
We also discuss the use of PCR for the identification of novel cry genes, as well as the potential of novel technologies for the
characterization of B. thuringiensis strains.
8 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.

Keywords : Biopesticide; cry gene; cyt gene; N-Endotoxin ; Polymerase chain reaction; Bacillus thuringiensis

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 419
2. Use of PCR for the prediction of insecticidal activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . 420
2.1. Identi¢cation of N-endotoxins by PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 420
2.2. Limitations of insecticidal activity prediction by PCR . . . . . . . . . . . . . . . . . . . . . . . . 423
3. Natural occurrence of cry genes among B. thuringiensis strains . . . . . . . . . . . . . . . . . . . . . 425
3.1. Relative frequency of cry genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 425
3.2. Genetic diversity and geographic variation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 425
3.3. Occurrence within serovars . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 426
4. Identi¢cation of novel cry genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 427
4.1. DNA-based methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 427
4.2. Other analytical methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 428
5. The prediction of toxicity of B. thuringiensis: future prospects . . . . . . . . . . . . . . . . . . . . . 429

Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 430

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 430

1. Introduction
* Corresponding author. Present address: U.P. Interactions Mole¤cu-
laires Flavivirus-Ho“tes, Institut Pasteur, 25 rue du Dr. Roux, 75724, Paris The entomopathogenic bacterium Bacillus thuringiensis
Cedex 15, France. Tel. : +33 (1) 40 61 31 80; Fax : +33 (1) 40 61 37 74.
was ¢rst isolated by the Japanese scientist S. Ishiwata, in
E-mail address : vicjua@pasteur.fr (V. Jua¤rez-Pe¤rez).
1901, from silkworm larvae exhibiting the sotto disease [1].
1
Present address: U.P. Interactions Mole¤culaires Flavivirus-Ho“tes, Ten years later, E. Berliner [2] formally described the spe-
Institut Pasteur, 25 rue du Dr. Roux, 75724, Paris Cedex 15, France. cies from an isolate originating from Anagasta kuehniella,
0168-6445 / 02 / $22.00 8 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
PII : S 0 1 6 8 - 6 4 4 5 ( 0 2 ) 0 0 1 2 8 - 6

FEMSRE 757 21-1-03

420 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
collected in the German region of Thuringia, which gave
the name to the species. Due to its insecticidal properties,
B. thuringiensis has been used commercially in the biolog-
ical control of insect pests for the last four decades. Its
toxicity was ¢rst supposed to be limited to Lepidoptera,
but interest increased after discovering a dipteran-active
strain belonging to serovar israelensis [3] and a morrisoni
strain active against Chrysomelidae (Coleoptera) which
was named as subspecies tenebrionis [4]. Currently, bioin-
secticides based on B. thuringiensis are used world-wide for
the control of many insects within the orders Lepidoptera,
Diptera and Coleoptera. Novel toxicities against Hyme-
noptera as well as non-insect organisms, such as mites,
nematodes, protozoa, and plathelmintes have also been
reported [5].
The insecticidal activity of B. thuringiensis is due mainly
to its ability to synthesize, during the sporulation phase,
large amounts of proteins that form a parasporal crystal.
When a susceptible insect ingests these crystalline proteins,
known as N-endotoxins, they are solubilized and proteo-
lytically digested to yield the active toxic form. Toxins
speci¢cally bind to protein receptors in the epithelial insect
midgut [6,7] and produce pores, leading to the loss of
normal membrane function [8]. As a result of membrane
permeability, epithelial cells lyse and feeding activity is
paralyzed. Finally, insects die of starvation, septicemia
or a combination of both.
A N-endotoxin can be de¢ned as a major protein com-
ponent of a parasporal crystal showing ‘signi¢cant se-
quence similarity to one or more toxins within the estab-
lished nomenclature or as a B. thuringiensis parasporal
inclusion protein that exhibits pesticide activity or some
experimentally veri¢able toxic e¡ect to a target organism’
(see B. thuringiensis toxin nomenclature (N. Crickmore
et al.) at www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/
index.html). There are two types of N-endotoxins: the highly
speci¢c Cry (from crystal) toxins which act via speci¢c
receptors and the non-speci¢c Cyt (cytolytic) toxins, with
no known receptors. Both families of toxins are classi¢ed
exclusively on the basis of their amino acid sequence iden-
tity. Four ranks have been de¢ned, and the boundaries are
45, 78 and 95%. The degree of similarity among Cry pro-
teins is highly variable and some Cry proteins as well as
the Cyt toxins do not cluster with the main Cry lineage.
Some Cry proteins are even more closely related to Bacil-
lus sphaericus mosquitocidal toxins (Mtx and Bin) than to
other B. thuringiensis toxins. cry genes, often located in
plasmids, encode the Cry proteins. B. thuringiensis strains
can harbor several cry genes, and some isolates can con-
tain up to eight di¡erent cry genes [9]. In general, the type
of cry and cyt genes present in a strain correlates to some
extent with its insecticidal activity. Thus, the identi¢cation
of the gene content in a B. thuringiensis strain can be used
to predict its insecticidal potential. To simplify the diver-
sity of terms used to de¢ne each rank of the current clas-
si¢cation, we will use two designations throughout:
FEMSRE 757 21-1-03
(i) subfamily, including all the members of the ¢rst rank
of genes belonging to the cry or cyt families (cry1 subfam-
ily, cry2 subfamily, cyt1 subfamily, etc.) and (ii) group,
including all those genes belonging to the second rank of
the classi¢cation (cry1C group, cyt2B group, etc.).
After many years of successful use in the ¢eld, the ¢rst
cases of resistance to B. thuringiensis appeared, renewing
interest in the search for novel toxins to delay or overcome
this phenomenon. However, the search for novel toxin-
encoding genes is di⁄cult and time-consuming. Tradition-
ally, it was approached by testing B. thuringiensis collec-
tions against di¡erent insect species. If a new toxic activ-
ity, in terms of host range or insecticidal potency, was
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
detected, the gene (or genes) involved was identi¢ed,
cloned, and expressed in vitro. Because this strategy is
time-consuming, other procedures were developed to de-
tect putative new genes present in B. thuringiensis strains.
The advent of molecular techniques facilitated, initially,
the identi¢cation of the known cry genes. DNA hybridi-
zation as well as the use of monoclonal and polyclonal
antibodies were the ¢rst molecular approaches used to
identify previously unreported toxins. These methods
made it possible to test a greater number of strains and
reduced the time and cost of the analysis. However, they
are fairly insensitive.
A milestone in the analysis of B. thuringiensis collections
was the advent of the polymerase chain reaction (PCR).
This technique, originally proposed by Kleppe et al. [10]
and independently conceived and developed by Mullis and
coworkers [11] can be used to amplify speci¢c DNA frag-
ments and thus to determine the presence or absence of a
target gene. The identi¢cation of B. thuringiensis N-endo-
toxin genes by PCR has proven to be a very useful method
for strain characterization and its use as a preliminary
selection step o¡ers many advantages in terms of rapidity
and reproducibility. Although it is likely that only a frac-
tion of the PCR-based identi¢cations of cry and cyt genes
have been published, the available reports provide a con-
siderable amount of data that we have reviewed and ana-
lyzed. The most important PCR-based screenings of
B. thuringiensis collections (in terms of the number of
strains and genes identi¢ed) are compared in this work;
the use of PCR for the identi¢cation of both known and
unknown genes is described, and a comparative analysis of
the geographical diversity of cry gene occurrence is shown.
We also suggest the use of novel techniques obtained from
recent developments in molecular analysis, to further the
study of B. thuringiensis collections.
2. Use of PCR for the prediction of insecticidal activity
2.1. Identi¢cation of N-endotoxins by PCR
The PCR-based identi¢cation of B. thuringiensis cry
genes was ¢rst developed by Carozzi et al. [12], who in-
 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
troduced this technique as a tool to predict insecticidal
activity. These authors designed 12 oligonucleotides from
cry1Ab, cry3A and cry4A genes and used them as primers
in PCRs directed toward the identi¢cation of Lepidoptera-
, Coleoptera-, and Diptera-active strains, respectively. Us-
ing bioassays, they determined the biological activity of 28
strains and found correspondence with the toxicity pre-
dicted on the basis of the ampli¢cation product pro¢les.
Carozzi et al. proposed PCR as an accurate, fast method-
ology for the identi¢cation of novel strains and the pre-
diction of insecticidal activity of new isolates, and they
also forecast the possible use of PCR for the discovery
of previously unknown cry genes. They suggested that
strains yielding unusual PCR pro¢les could be selected
for further analyses leading to the identi¢cation and char-
acterization of hypothetical novel cry genes.
Over the last decade, PCR has been widely exploited to
determine the cry gene content of many B. thuringiensis
strain collections [13^18]. The screening has also been per-
formed to identify cyt genes, although to a lesser extent
[17,19^21]. The PCR screening programs have increased
our knowledge concerning the natural occurrence of single
cry and cyt genes among strains, their combinations within
the strains and their occurrence in di¡erent geographic
locations. Since PCR allows quick and simultaneous
screening of many strains, it has partially substituted bio-
assays in preliminary characterization of B. thuringiensis
collections. Today, PCR has become a routine screening
step for large strain collections, in both public and private
research laboratories. However, prediction of insecticidal
activity by PCR must always be corroborated by bioas-
says, in order to assess the potential of promising isolates
as biopesticides [22].
The e⁄cacy of PCR in identifying the large family of
cry genes, with amino acid identities ranging from less
than 45% to more than 95%, is based on the presence of
conserved regions. Most of the B. thuringiensis protoxin
crystal genes share conserved nucleotide blocks, in a num-
ber that varies from ¢ve, for naturally truncated genes
such as cry1I or cry3A, to eight for the largest genes
with encoded proteins of 1000 residues or more [23]. The
e⁄cacy of PCR for cry gene identi¢cation relies on the
alternation of conserved and variable nucleotide regions.
By designing oligonucleotides to be used as primers either
from conserved blocks or from variable regions, it is pos-
sible to recognize either entire gene subfamilies or speci¢c,
individual genes. An intermediate approach is the selection
of regions that are highly conserved among several genes
from di¡erent subfamilies but usually exhibiting the same
host range [12].
The easiest strategy to identify cry or cyt genes by PCR
is the use of a primer pair that speci¢cally recognizes a
single cry gene that will yield an amplicon as large as the
distance separating the primer annealing sites. This can be
done with a pair of speci¢c primers or by combining a
universal primer selected from a conserved block and
FEMSRE 757 21-1-03
421
thus able to anneal to the entire gene family, and a speci¢c
primer selected from a variable region. However, the high
number of cry genes known so far makes this gene-by-
gene strategy inapplicable for large-scale screening pur-
poses. For practical reasons, primer pairs designed from
highly conserved regions and recognizing entire cry gene
subfamilies are often used in a preliminary screening prior
to performing a second PCR with speci¢c primers. The
¢rst step saves much time and e¡ort by avoiding the
need to test all the speci¢c primers, as only those corre-
sponding to the group of genes ampli¢ed in the ¢rst PCR
are used in the second reaction [16].
Another strategy to expedite the screening is based on
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
the use of a mixture of more than two primers (multiplex
PCR) in the same reaction [14,24,25]. Usually, a single
universal primer is combined with several speci¢c oligonu-
cleotides that recognize individual genes. In this situation,
the PCR ampli¢cation yields as many ampli¢ed gene frag-
ments as can be recognized by the primers, which can be
easily identi¢ed on the basis of their size, as determined
from their electrophoretic mobility. To date, more than 80
primer pairs speci¢cally recognizing both entire groups
(i.e. cry1 genes) and individual cry genes have been de-
signed. Primer size varies from 17 to more than 30 nucleo-
tides, and some ‘universal’ oligonucleotides, directed to the
identi¢cation of a group or subfamily of genes, are degen-
erate. An updated list of primers used in the identi¢cation
of cry and cyt genes is shown in Table 1.
The identi¢cation of B. thuringiensis cry and cyt genes
by PCR is performed under di¡erent conditions, as re-
ported by the di¡erent authors. The concentration of the
PCR mixture components varies as follows : primers, 0.1^
1 WM; MgCl2 , 1.5^3 mM; dNTPs, about 0.2 mM; and
0.25^2.5 U of DNA polymerase per reaction [14,26^28].
The DNA used as template is obtained either by the typ-
ical lysis extraction and puri¢cation methods [14,18,29], or
by simple time-saving lysis of a cell suspension using phys-
ical methods. In the latter case, DNA is usually released
by boiling the suspension for 2^10 min [13,15,30], or by
alternate freezing (370‡C) and boiling steps [17,24,26].
Template is added to the reaction mixture (¢nal volume
50^100 Wl) and the three-step ampli¢cation cycles are per-
formed 25^35 times. Typically, a 10^30% aliquot of the
reaction mixture is analyzed by agarose gel electrophore-
sis.
Due to the extreme sensitivity of PCR, false positive
ampli¢cations may result from contamination of the
PCR reactions. Also, false negative ampli¢cations may
be expected, as the amount of target DNA might be at
the limit of detection, or due to the presence of inhibitors
in the reaction mixture. The theoretical limit of sensitivity
in a PCR using bacterial cells with a single-copy target
gene is as low as one cell. Although a single bacterial
colony from an overnight culture (on solid media) may
contain up to several million cells, the release of DNA
by boiling methods may be very ine⁄cient. Studies with
422 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432

Table 1
Speci¢c primer pairs directed to the identi¢cation of cry and cyt genes
Genea Forward primer (5P^3P)b Reverse primer (5P^3P)b Source
cry1Aa IAa (TTCCCTTTATTTGGGAATGC) I(3) (MDATYTCTAKRTCTTGACTA) [24]
SB-1 (TGCATAGAGGCTTTAAT) U815c (CAGGATTCCATTCAAGG) [26]
TYIAA (GAGCCAAGCAGCTGGAGCAGTTTACACC) TYIUN12 (ATCACTGAGTCGCTTCGCATGTTTGACTTTCTC) [29]
CJ1 (TTATACTTGGTTCAGGCCC) CJ2 (TTGGAGCTCTCAAGGTGTAA) [28]
cry1Ab IAb (CGGATGCTCATAGAGGAGAA) I(3) [24]
SB-2 (TCGGAAAATGTGCCCAT) U3-18c (AATTGCTTTCATAGGCT) [26]
CJ4 (AACAACTATCTGTTCTTGAC) CJ5 (CTCTTATTATACTTACACTAC) [28]
TY6 (GGTCGTGGCTATATCCTTCGTGTCACAGC) TY14 (GAATTGCTTTCATAGGCTCCGTC) [29]
cry1Ac RB-19 (GGGACTGCAGGAGTGAT) U8-15C [26]
IAc (GGAAACTTTCTTTTTAATGG) I(3) [24]
CJ6 (GTTAGATTAAATAGTAGTGG) CJ7 (TGTAGCTGGTACTGTATTG) [28]
CJ4 CJ5 [28]

Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021

TYIAC (TCACTTCCCATCGACATCTACC) TYIUN12 [29]
cry1Ad IAd (ACCCGTACTGATCTCAACTA) I(3) [24]
CJ1 CJ2 [28]
CJ3 (CAGCCGATTTACCTTCTA) CJ2 [28]
cry1Ae IAe (CTCTACTTTTTATAGAAACC) I(3) [22]
cry1B CJ8 (CTTCATCACGATGGAGTAA) CJ9 (CATAATTTGGTCGTTCTGTT) [28]
IB (GGCTACCAATACTTCTATTA) I(3) [24]
TYIB (GTCAACCTTATGAGTCACCTGGGCTTC) TYIUN12 [29]
cry1C CJ10 (AAAGATCTGGAACACCTTT) CJ11(CAAACTCTAAATCCTTTCAC) [28]
IC (ATTTAATTTACGTGGTGTTG) I(3) [24]
TYIC (CAACCTCTATTTGGTGCAGGTTC) TYIUN12 [29]
cry1D CJ12 (CTGCAGCAAGCTATCCAA) CJ13 (ATTTGAATTGTCAAGGCCTG) [28]
ID (CAGGCCTTGACAATTCAAAT) I(3) [24]
TYID (GGTACATTTAGATATTCACAGCCAC) TYIUN12 [29]
cry1E CJ14 (GGAACCAAGACGAACTATTGC) CJ15 (GGTTGAATGAACCCTACTCCC) [15]
IE (TAGGGATAAATGTAGTACAG) I(3) [24]
TYIE (CTTAGGGATAAATGTAGTACAG) TYIUN12 [29]
cry1F CJ16 (TGAGGATTCTCCAGTTTCTGC) CJ17 (CGGTTACCAGCCGTATTTCG) [15]
IF (GATTTCAGGAAGTGATTCAT) I(3) [24]
TYIF (CCGGTGACCCATTAACATTCCAATC) TYIUN12 [29]
cry1G G (GCTTCTCTCCAAACAACG) I(3) Porcar et al.,
unpubl.
cry1H H (ACTCTTTTCACACCAATAAC) I(-) Porcar et al.,
unpubl.
cry1I V(+) (ATGAAACTAAAGAATCCAGA) V(3) (AGGATCCTTGTGTTGAGATA) [22]
I-FW (ACAATTTACAGCTTATTAAG) I-RV (CTACATGTTACGCTCAATAT) Porcar et al.,
unpubl.
cry1J J (GCGCTTAATAATATTTCACC) I(3) Porcar et al.,
unpubl.
cry1K K (TGATATGATATTTCGTAACC) I(3) Porcar et al.,
unpubl.
cry2A Un2(d) (GTTATTCTTAATGCAGATGAATGGG) Un2(r) (CGGATAAAATAATCTGGGAAATAGT) [16]
II(+) (TAAAGAAAGTGGGGAGTCTT) II(3) (AACTCCATCGTTATTTGTAG) [22]
2-FW (CGATATGTTAGAATTTAGAAC) 2-RV (TACCGTTTATAGTAACTCG) Porcar et al.,
unpubl.
cry3A Col1A (GTCCGCTGTATATTCAGGTG) Col1B (CACTTAATCCTGTGACGCCT) [12]
Un3 (CGTTATCGCAGAGAGATGACATTAAC) EE-3Aa (TGGTGCCCCGTCTAAACTGAGTGT) [16]
CJIIIcte22 (CAATCCCAGTGTTTACTTGGAC) CJIIIA23 (CCCCGTCTAAACTGAGTGT) [15]
cry3B Un3 EE-3Ba (ACGAAAGATTCTGCTCCTAT) [16]
cry3C Un3 EE-3C (ATTTTGGTACCTCCTGTACCCACC) [16]
CJIIIcte22 CJIIID27 (CGAAATACGAAATACTATGAG) [15]
cry4A Dip2A (GGTGCTTCCTATTCTTTGGC) Dip2B (TGACCAGGTCCCTTGATTAC) [12]
EE-4A (GGGTATGGCACTCAACCCCACTT) Un4 (GCGTGACATACCCATTTCCAGGTCC) [16]
cry4B EE-4B (GAGAACACACCTAATCAACCAACT) Un4 [16]
cry5 (TAAGCAAAGCGCGTAACCTC) (GCTCCCCTCGATGTCAATG) [21]
cry6 VI(+) (TAYGGTTTTAAAKKTGCTGG) VI(3) (TRAATYCTATTRAACAATCCTA) [22]
(TGGCGTAGAGGCTGTTCAAGTA) (TGTCGAGTTCATCATTAGCAGTGT) [21]
cr7A B1-7A (CATCTAGCTTTATTAAGAGATTC) B5-7A (GATAAATTCGATTGAATCTAC) [66]
B2-7A (GCTGTATTTCCTATTTATGACCC) B5-7A [66]
B3-7A (GGGCCTGGATTTACAGGTGG) B5-7A [66]
B4-7A (GTTAGAGTTCGATACGCTAC) B5-7A [66]
EE-7Aa (GCGGAGTATTACAATAGAATCTATCC) Un7,8 (CTTCTAAACCTTGACTACTT) [16]

FEMSRE 757 21-1-03

 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432 423

Table 1 (Continued).
Genea Forward primer (5P^3P)b Reverse primer (5P^3P)b Source
cry8A EE-8A (GAATTTACTCTATACCTTGGCGAC) Un7,8 [16]
spe-cry8A(d) (ATGAGTCCAAATAATCTAAATG) spe-cry8A(r) (TCTCCCCATATATCTACGCTC) [17]
CJIIIE28 (TGACAAGTACTGGATTCTGCAA) CJIIIE29 (GTTGTTGATGAGGTTCCCCTT) [15]
B3-8A (GGTCCTGGATTTACAGGAGGAGAT) B5-8A (GATGAATTCGATTCGGTCTAT) [66]
cry8B EE-8B (GACCGCATCGGAAGTTGTGAG) Un7,8 [16]
spe-cry8B(d)c spe-cry8B(r) (GAACATCTCGTAAGGCTC) [17]
B3-8B (GGGCGTGGTTATACAGGGGGAGAC) B5-8B (GATGAATTCGATTCGGTCTAA) [66]
cry8C spe-cry8C(d)c spe-cry8C(r) (GGTACTCGATTGTCCAGT) [17]
EE-8C (GGTGCTGCTAACCTTTATATTGATAG) Un7,8 [16]
B3-8C (GAAGGTCTATATAATGGAGGAC) B5-8C (AATAAATTCAATTCTATCAAT) [66]
cry9A CJ18 (ATATGGAGTGAATAGGGCG) CJ19 (TGAACGGCGATTACATGC) [15]
spe-cry9A(d) (GTTGATACCCGAGGCACA) spe-cry9A(r) (CCGCTTCCAATAACATCTTTT) [17]
CJ18 (ATATGGAGTGAATAGGGCG) CJ19 (TGAACGGCGATTACATGC) [15]

Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021

IG (GGTTCTCAAAGATCCGTGTA) I(3) [24]
cry9B spe-cry9B(d) (TCATTGGTATAAGAGTTGGTGATAGAC) spe-cry9B(r)d [17]
cry9C spe-cry9C(d) (CTGGTCCGTTCAATCC) spe-cry9C(r)d [17]
cry9D CCGAGCTCTATGAATCGAAATAATCAAAATGAATe CCTCCTAGACACAGGGATGATTTCAATTCe [67]
cry10A 10A5 (ATATGAAATATTCAATGCTC) 10A3 (ATAAATTCAAGTGCCAAGTA) [68]
cry11A EE11A(d) (CCGAACCTACTATTGCGCCA) EE11A(r) (CTCCCTGCTAGGATTCCGTC) [16]
11A5 (CCAGCATTAATAGCAGTAGC) 11A3 (TGTACACATTTGAGTAAAAA) [68]
cry12 (CTCCCCCAACATTCCATCC) (AATTACTTACACGTGCCATACCTG) [21]
cry13A spe-cry13(d) (CTTTGATTATTTAGGTTTAGTTCAA) spe-cry13(r) (TTGTAGTACAGGCTTGTGATTC) [17]
cry14 (ATAATGCGCGACCTACTGTTGT) (TGCCGTTATCGCCGTTATT) [21]
cry15A 34C (AGATATCATGGCAATTATGAATGATAT) 34D (ACCCGGGTTATTCTTTATCATAATCGC) [69]
cry16A DA5c (TCAAAAGGTGTGGCAAG) CR3c (ATAAGCCCAATATCATG) [70]
cry17A CR8 (AAGTAAAGATTTCTGGG) OX7as (CTGAGGTATTTTGTGGA) [70]
cry18 (CCGAGGCGATTTGGATAGAT) (TGCCGGTGTAAACAAAGAAGG) [21]
cry19 (AGGGGAGTCCAGGTTATGAGTTAC) (ATTTCCCTAGTTAGTTCGGTTTTT) [21]
cry20 (CAATCCCTGGCTTCACTCGT) (CCGCGGGCATTAGGATT) [21]
cry21 (ATACAGGGATAGGATTTCAAG) (ATCCCCATTTTCTATAAGTGTCT) [21]
cry22 (CAGATGAGATAGATGGGGATTTGA) (ATTCGCTTCTATACTTGGCTGTC) [21]
cry24 (AGGGGGCGATGGATACGAC) (GGCCCTGCTACAACCGAAACTA) [21]
cry25 (CGTTTTCCGCATTATCATTAGG) (ACGCCCCGGCTGTCTTA) [21]
cry26 (CGCGCTGTTCAATTATCAAGTGC) (ATATGGAAAGAAAAGGCGTGTGGA) [21]
cry27 (GTGGCATATAGACTAAGGGAGGAA) (TTGCAGGCCATATAAGAGGTGTT) [21]
cry28 (GTATTGGACCGAGGAGATGAAAGT) (GTACGGCAAAGCGACAGAACA) [21]
cyt1A Gral-cyt(d) (AACCCCTCAATCAACAGCAAGG) Gral-cyt(r) (GGTACACAATACATAACGCCACC) [17]
cyt2 upper (AATACATTTCAAGGAGCTA) lower (TTTCATTTTAACTTCATATC) [19]
(ATCCGCCCATAATACAAG) (GATACGGTTCACAGACG) [21]
a
cry and cyt genes recognized by the speci¢c primers shown to the right. Listing up to the secondary rank is given, except for cry1A genes, which are
listed up to the tertiary rank. Primers may not always perfectly match all alleles of each gene, and thus some alleles may not be identi¢ed. Cross-ampli-
¢cation of related genes may also occur.
b
Primer names are those given in the original report. Super£uous designations such as ‘d’ or ‘r’ have been omitted unless necessary to distinguish be-
tween forward and reverse primers. The sequences of primers listed several times are given in the ¢rst citation. Degenerate bases are designated as fol-
lows: B = C, G or T; D = A, G or T; H = A, C or T; K = G or T; M = A or C; R = A or G; and Y = T or C.
c
Primers sharing the sequence of spe-cry8A(d).
d
Primers sharing the sequence of spe-cry9A(r).
e
Unnamed cloning primers.

other bacteria, such as Staphylococcus aureus, have shown
that the sensitivity of PCR is in practice much reduced by
a set of complex factors, and experimental values of the
detection limit are about 1000-fold higher than the theo-
retical limit [31]. PCR with boiled B. thuringiensis vegeta-
tive cells as template needs a minimum of 102 ^103 cells,
depending on the strain and primers, for reproducible re-
sults (M. Porcar, unpublished observation). With regard
to reaction inhibitors, many di¡erent substances usually
present in a laboratory, such as laboratory plasticware,
cellulose or glove powder are known to inhibit the PCR
reaction. Additionally, non-target DNA and cell com-
pounds may also inhibit polymerase activity [32], espe-
cially when lysed cells are used as the source of template.
As for the contamination that may yield false positives,
the exhaustive use of controls and standardization of the
PCR conditions are imperative to guarantee reproducibil-
ity [33].
2.2. Limitations of insecticidal activity prediction by PCR
The ability of PCR-mediated N-endotoxin gene identi¢-
cation to predict insecticidal activity depends largely on
several factors that can make the prediction erroneous.

FEMSRE 757 21-1-03

424 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
Very often, strains sharing the same cry and cyt gene con-
tent di¡er greatly in their insecticidal potency. The main
causes of this lack of correspondence between cry/cyt ge-
notype (as determined by PCR), and biological activity (as
determined by bioassays) are described below.
2.2.1. Gene identity
Primer design is a key factor in PCR. The 3P-end of
primer is critical in the ampli¢cation procedure. Indeed,
if a mismatch between the primer and the template occurs
at this region, the ampli¢cation e⁄cacy could be drasti-
cally diminished and may even result in the absence of an
amplicon [34]. In consequence, any variation in one or two
bases at this region may lead to closely related genes not
being detected. In contrast, a substitution at the 5P-end or
on the middle of the primer will not signi¢cantly a¡ect the
ampli¢cation and thus di¡erent genes (i.e. alleles di¡ering
in the quaternary rank of the classi¢cation but also other
cry genes less closely related) can be equally ampli¢ed.
Due to the high diversity of the cry gene family as well
as the increasing number of novel genes described, primer
design often requires a compromise between recognition of
the whole pool of alleles and the absence of undesired
cross-ampli¢cations. For example, the speci¢c primer
pair SB-1 and U8-15C, designed in 1993 for the identi¢-
cation of the cry1Aa gene [26], would amplify only nine
out of the 11 cry1Aa alleles known at that time. Alleles
cry1Aa6 and cry1Aa8, reported in 1994 and 1998, respec-
tively, may not be ampli¢ed because the 3P-end of one of
the primer annealing sites is not conserved. By contrast,
the gene cry1Ag (NCBI entry AFO81248) will be recog-
nized, as it shares the sequences of the cry1Aa SB-1 and
U8-15C primers.
Minor amino acid changes can in£uence insecticidal ac-
tivity. Reports show that a few changes of certain residues
within a loop region of the protein can a¡ect both speci¢c
binding to membrane receptors and toxicity [35^37].
Such limitations hamper the use of conventional PCR to
identify speci¢c cry genes, and particularly to search for
novel, previously undescribed cry genes. Theoretically,
novel genes would only be detected if amplicons signi¢-
cantly di¡ered in size from those expected. However, to
date, no new cry genes have been described in this way.
2.2.2. Expression level
Crystal proteins are synthesized in large amounts during
stationary phase and accumulate in one or several para-
sporal crystals, accounting for up to 30% of the dry weight
of sporulated cells. However, the expression level of indi-
vidual cry genes present in any one strain can vary greatly.
B. thuringiensis subsp. aizawai strain HD-133 is a good
example of such variation. This strain is known to contain
six cry genes, although only three proteins (Cry1Ab,
Cry1C, and Cry1D) are expressed in detectable amounts
in HD-133 parasporal crystals, at relative ratios of
60:37:3, respectively [22]. The three remaining genes are
FEMSRE 757 21-1-03
either silent due to an insertion within the coding sequence
(cry1Aa), or expressed at undetectable levels if at all (cry2
and cry1I). This poor expression is probably due to the
presence of a weak promoter upstream from the cry2 op-
eron and, as suggested by Kostichka et al. [38], and to the
secretion of the Cry1I protein during the early sporulation
phase. In addition to the relative expression of each cry
gene borne by a strain, a serovar-dependent regulation
system of individual cry genes has been described. Cheng
et al. [39] found a 3- to 4-fold decrease in expression of a
cry1Ab-lacZ fusion within strains of serovar aizawai, as
compared to those of serovars kurstaki or tolworthi. Re-
gardless of the cause, the diverse expression levels of in-
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
dividual cry genes obviously weaken the correlation be-
tween cry gene content and toxicity.
2.2.3. Protein interactions
Another cause of interference in the prediction of insec-
ticidal activity from the identi¢cation of toxic genes is a
series of protein interactions among N-endotoxins. The
toxicity of B. thuringiensis parasporal crystals depends
not only on the activity of their individual components
but also on the interactions between such proteins. These
interactions were ¢rst described by Wu and Chang [40]
and Ibarra and Federici [41] who reported that some in-
dividual protein components from the inclusion body of
the dipteran-active B. thuringiensis subsp. israelensis
showed lower activity against Aedes aegypti larvae, than
did the native composite crystal suspensions.
The synergistic role of the Cyt toxins in the overall
toxicity of B. thuringiensis israelensis has been largely dem-
onstrated [42]. cyt genes have been used to transform an-
other dipteran-active bacterium, B. sphaericus, resulting in
a recombinant strain with expanded host range as a con-
sequence of the synergism between Cyt1A and the
B. sphaericus binary toxin [43]. Until now, Cyt proteins
have only been identi¢ed in strains active on Diptera,
with a unique exception: EA10192, belonging to serovar
andaluciensis, which is PCR-positive in a screening with
cyt2 primers, but with no known toxicity [20]. The syner-
gistic e¡ect between Cry and Cyt toxins may not be lim-
ited to Diptera since recombinant bacteria expressing
Cyt1Aa together with the Coleoptera-active Cry3Aa sup-
press resistance to the latter toxin [44].
Another case of Cry protein interaction was described
when three Cry1A proteins were tested against Lymantria
dispar [45]. In this species, synergism was found between
proteins Cry1Aa and Cry1Ac, whereas Cry1Aa and
Cry1Ab interacted antagonistically. Other protein interac-
tions involve the di¡erential solubility of crystal compo-
nents. Aronson et al. [46] demonstrated the importance of
Cry1Ab in the solubilization and toxicity of HD-133 crys-
tals, when crystals of HD-133 mutants, containing only
Cry1C and Cry1D, required higher pH conditions to dis-
solve, causing a decrease in toxicity against Plodia inter-
punctella and other lepidopteran species. Finally, antago-
 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
nistic interactions can also occur with Cry and Cyt toxins
expressed together in recombinant strains. One example is
the antagonism between Cry1Ac and Cyt1A when tested
against Trichoplusia ni [47].
2.2.4. Other virulence factors
Even if the detection of the cry and cyt content of a
B. thuringiensis strain may allow, to certain extent (see
above), the prediction of the insecticidal activity of its
puri¢ed parasporal crystals, the complete pathogenic e¡ect
of a strain may involve other factors. It is known that a
series of extracellular compounds synthesized by B. thu-
ringiensis, such as L-exotoxins, phospholipases, proteases,
chitinases and the secreted VIPs (vegetative insecticidal
proteins) contribute to virulence. Additionally, spores are
also known to synergize with the toxic e¡ect of crystals
when tested against some insect species, probably due to
the invasion of hemocele through the ulcerated midgut,
and the subsequent development of septicemia. The high-
est contribution of the spore to the pathogenicity of
B. thuringiensis was reported in wax moth (Galleria mello-
nella) larvae. The addition of as low as 0.001% spores to a
crystal suspension from a serovar aizawai strain greatly
increased larval mortality [48]. Other studies have reported
spore^crystal synergism against other Lepidoptera, such as
Plutella xylostella [49] and P. interpunctella [50]. In sum-
mary, only bioassays with puri¢ed crystals are expected to
correlate with the Cry and Cyt protein content of each
strain, and partially with the cry and cyt gene content.
3. Natural occurrence of cry genes among B. thuringiensis
strains
Ten years of PCR-based identi¢cation of cry genes from
hundreds of B. thuringiensis strains isolated from samples
collected world-wide, have resulted in a large collection of
data. We have reviewed the frequency, regional distribu-
tion and combinations of individual cry genes from the six
largest PCR screenings of natural occurring strains (Table
2). These screenings analyzed from 58 to almost 500
strains, and screened a large number of genes (at least
eight di¡erent cry1 genes).
3.1. Relative frequency of cry genes
The largest collection of B. thuringiensis subjected to
PCR screening of cry genes published to date contained
isolates from around 500 soil samples [17]. These samples
were obtained from ¢ve very di¡erent macroecological re-
gions of Mexico. A total of 496 strains were subjected to
PCR and enzyme-linked immunosorbent assay (ELISA) to
identify cry1, cry3, cry5, cry7, cry8, cry9, cry11, cry12,
cry13, cry14, cry21, and cyt genes. None of these genes
were detected in 14% of the strains. In other studies based
solely on PCR analysis, the percentage of strains that
FEMSRE 757 21-1-03
425
failed to produce amplicons of the expected sizes ranged
from 16% [30] to more than 40% [16]. These strains may
contain cry genes not recognized by the set of primers
used, or contain unknown genes.
The most common cry genes found in nature are those
within the cry1 subfamily, with about half of the strains or
more bearing these genes. The cry2 genes are also very
frequent, especially among cry1-containing strains [16].
The occurrence of cry1 groups varies greatly. Some, such
as the cry1A genes, are very frequent, being present usu-
ally in more than half of the strains; whereas other genes,
such as cry1Fs, are rare. As mentioned, the most common
cry1 genes are those belonging to the cry1A group, fol-
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
lowed by the cry1C and cry1D groups. On the other hand,
cry1B, cry1E and cry1F are usually found at low frequen-
cies, although there are some exceptions, such as the high
frequency with which cry1E genes were found in a Chinese
collection (Table 2). Also, cry1B genes have been found at
a relatively high frequency (30% of the strains) in some
screenings [15]. The occurrence of cry1I genes among
B. thuringiensis strains, as deduced from PCR-based stud-
ies, is very high [13,18,51]. Hybridization with speci¢c
probes and reverse transcription (RT)-PCR analysis [27]
con¢rm that these genes are widely distributed among
B. thuringiensis strains.
Several reports show a high frequency of certain combi-
nations of cry1 genes. For example, cry1I genes frequently
occur when other cry1-type genes are present. This obser-
vation is consistent with the physical location of cry1I
genes, which have been reported to be in close vicinity
to other genes of the cry1 subfamily [13,27,52,53]. Another
frequent combination found almost world-wide is the link-
age cry1C^cry1D [15,17,18,51,54]. In fact, only Kim et al.
[30] reported the common presence of cry1C alone. How-
ever, in the rest of the studies, cry1D was found alone at a
relatively high frequency, but cry1C was almost always
associated with cry1D. This cry1C^cry1D linkage may be
explained by their location on the same replicon, as de-
scribed by Sanchis et al. [53] for a B. thuringiensis subsp.
aizawai strain in which the genes were separated by only
3 kb. Regarding the cry1D-containing strains that lack
cry1C, an evolutionary event could be involved, as pro-
posed by Ferrandis et al. [18], who suggested that the
absence of cry1C may be the consequence of a deletion
or the negative selection of cry1C from an ancestral
cry1C^cry1D linkage. The fact that the cry1C gene is lo-
cated downstream of an IS sequence [55] may account for
this hypothetical mobility.
3.2. Genetic diversity and geographic variation
Although a great collection of data is available from the
PCR-mediated cry gene screening studies reported to date,
there are several factors that limit their comparison: (i) the
use of di¡erent primer pairs ; (ii) the variation in PCR
conditions; and (iii) the number of strains and genes an-
426 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432

Table 2
Diversity of cry gene content in several B. thuringiensis isolates collected and characterized in screening programs carried out world-wide
Geographic Isolates with cry Number of cry Number of cry1 Percentage of strains bearing a given cry1 geneb Reference
area surveyed genes/total isolates genes analyzed pro¢lesa
cry1Aa cry1Ab cry1Ac cry1B cry1C cry1D cry1E cry1F
Taiwan 225/NS 8 4 78 59 78 0 18 20 0 0 [14]
Asiac 126/215 21 10 17 17 10 0 7 18 0 0 [16]
Korea 49/58 19 13 28 45 9 2 57 17 0 0 [30]
Mexico 423/496 24 27 22 15 13 9 6 17 1 2 [17]d
Spain 171/223 13 v9 26 18 31 9 17 22 4 61 [18,25]e
China 122/NS 10 18 31 59 69 1 19 25 44 0 [54]
a
Note that pro¢les are set on the basis of combinations of only eight genes (cry1Aa, cry1Ab, cry1Ac, cry1B, cry1C, cry1D, cry1E, and cry1F).
b
Refers to the total number of strains analyzed, except in the studies in which this value is not shown in the publication (NS).
c
Includes Israel, Kazakhstan and Uzbekistan.

Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021

d
The detection of cry genes was by PCR and ELISA.
e
Both reports refer to the same collection. The percentage of strains is that of Jua¤rez-Pe¤rez [25]; the number of cry1 pro¢les is based on Ferrandis et
al. [18]. In this latter report, cry1A-containing pro¢les were grouped regardless of the type of gene present (cry1Aa, cry1Ab, or cry1Ac); the number of
cry1 pro¢les is thus probably arti¢cially diminished.

alyzed. Another important limitation is the lack of pre-
liminary characterization of isolates. The selection of rep-
licas during the isolation procedure is a frequent occur-
rence if basic characterization procedures (such as sodium
dodecyl sulfate^polyacrylamide gel electrophoresis (SDS^
PAGE), serotyping crystal morphology, etc.) are not fol-
lowed, especially when several isolates come from the
same sample. However, some collections do not follow
this preliminary step, and this may have a strong in£uence
on the apparent gene diversity of the collection.
An attempt to compare the six main PCR screening
programs published to date is summarized in Table 2.
The number of cry genes analyzed in these programs
ranges from eight to 24. Most of them are cry1 genes
but some other subfamilies are also represented. Since
most of the information concerns cry1 genes, we focused
on this subfamily. In order to understand the diversity of
cry1 genes within and between collections, the pro¢les
(combinations of genes) of eight cry1 genes are compared.
If other genes were analyzed, they have not been taken
into account to calculate the number of pro¢les. Diversity
in terms of cry gene content of a B. thuringiensis collection
is in£uenced by the pre-selection procedure and may only
partially re£ect the real genetic diversity of naturally oc-
curring strains. The environmental diversity of the geo-
graphic area surveyed may also account for the high num-
ber of di¡erent cry gene pro¢les with respect to the
number of samples analyzed. However, and due to the
low number of studies combining all these aspects, further
studies in this ¢eld are needed to obtain stronger conclu-
sions. Those studies should combine a large number of
samples analyzed with a high diversity of natural habitats
surveyed.
3.3. Occurrence within serovars
B. thuringiensis strains can be serologically classi¢ed ac-
cording to the £agellar (H) antigens. To date, a total of 82
di¡erent serovars have been described [56] and it is likely
that the number of serovars will grow due to the expand-
ing native strain isolation and screening programs. It is
generally accepted that serological characterization does
not directly re£ect the toxicity (potency or host range) of
a given strain. However, Dulmage [57] found a certain
correlation between toxicity and serovars and their results
revealed that serological grouping of B. thuringiensis
strains partially describes their toxicity spectra, although
a signi¢cant variation within serovars occurs (data re-
viewed by Glare and O’Callaghan [58]). The archetypical
example of the correlation between serovar and toxicity
may be the B. thuringiensis serovar israelensis strains,
which have an almost exclusive toxic spectrum against
Nematocera.
Because of the variation in the expression level of cry
genes between strains, the combination of PCR with the
serological identi¢cation of strains appears to be very use-
ful to test the genetic robustness of the serological classi-
¢cation, and to resolve any correlation between cry con-
tent and serovar. A few studies have combined PCR-based
identi¢cation of cry genes and serology [18,30,51,54] and
all of them show a high diversity in gene distribution with-
in and among serovars. Hongyu et al. [54] analyzed the
relationship between gene composition and serology of
122 strains isolated from natural samples in China, and
concluded that although a direct relationship between gene
content and serovar was not established, some association
was observed. Particularly, some cry1E-containing combi-
nations such as cry1Ab-1Ac-1E and cry1Ac-1E were very
frequent among strains within the serotype H4 (sotto-ken-
yae). However, other cry1E-containing combinations, such
as cry1Aa-1Ab-1Ac-1E were absent within serotype H4. In
another analysis of B. thuringiensis strains isolated in
Spain [51], a serovar-dependent distribution of cry1C
and cry1D was suggested, as these genes were very fre-
quent in serovar aizawai. Also, the distribution of cry1B
in this collection was restricted to serovar thuringiensis.

FEMSRE 757 21-1-03

 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
Despite the apparent correlation shown in these reports,
the number of strains analyzed may still be insu⁄cient to
determine whether the apparent non-random distribution
of some cry genes among serovars corresponds to geo-
graphical variation, re£ects an inherent serovar-dependent
occurrence, or plasmid compatibility/incompatibility inter-
actions.
4. Identi¢cation of novel cry genes
4.1. DNA-based methods
4.1.1. PCR
As mentioned above, the PCR ampli¢cation of frag-
ments of unexpected size when gene-speci¢c primers are
used may lead to the detection of new cry genes. To date,
only Cero¤n et al. [15] have reported an ampli¢ed fragment
that may correspond to a new cry gene, when using a
multiplex PCR with speci¢c primers. Unfortunately, no
further information concerning the identity of this putative
cry-like gene is available to date.
Due to the intrinsic limitation of ‘classical’ PCR screen-
ing of B. thuringiensis collections to identify novel cry
genes, several PCR-based methods to detect and charac-
terize unknown cry genes have been developed. In 1993,
Kalman et al. [29] proposed a strategy to identify variants
of the cry1C group. Their experimental design can be con-
sidered as ‘PCR walking’, because a series of primers were
designed to anneal throughout the cry1Ca1 sequence. In a
single multiplex PCR reaction the entire gene was ampli-
¢ed, obtaining a characteristic ampli¢cation pro¢le. If a
new cry1C-related gene was present in a strain, at least
one of the corresponding PCR products was supposed
either to be lacking or to exhibit an unexpected size. In
either case, a modi¢cation of the predicted PCR pro¢le
would indicate the presence of a new cry1C gene. With
this method they successfully detected the gene now
known as cry1Cb1. Unfortunately, this methodology is
restricted to closely related genes within the same group.
There are other disadvantages, such as the large number
of primers required to analyze each group of genes, and
the fact that the putative variant may not be more inter-
esting, in terms of toxicity, than the genes of the same
group already described.
Subsequently, two further PCR-based methods were de-
veloped to determine the presence of known cry genes and
also of putative new cry genes. In both cases, the tech-
niques were adapted to ¢t a wider spectrum of genes,
rather than to ¢t just one group. Multiple alignment of
the DNA coding sequences of members of di¡erent sub-
families allows the detection of conserved regions that are
unique for each subfamily. This characteristic opened a
new scenario in the study and analysis of the cry gene
content of a B. thuringiensis strain because ‘universal’ sub-
family primers could be designed. Kuo et al. [59] reported
FEMSRE 757 21-1-03
427
the ¢rst primer pair able to recognize all the members of
the cry1 gene subfamily known at that time, as well as
some other genes coding for the actual cry4, cry3 and
cry7. Jua¤rez-Pe¤rez et al. [24], Jua¤rez-Pe¤rez [25], and Mas-
son et al. [22] also used the same concept of universal
primers to amplify all the members of di¡erent subfamilies
of the cry genes. Moreover, they introduced the use of
degenerate primers in order to increase the probability of
amplifying novel group members that did not exactly
match the putative conserved region of the subfamilies
from which the oligonucleotides were designed.
The ¢rst method speci¢cally designed to detect new cry
genes was based on the combination of PCR and restric-
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
tion fragment length polymorphism (RFLP). This is a
two-step strategy where group-speci¢c primers are used
¢rst, followed by enzymatic digestion of the produced am-
plicon(s). With this method, a particular RFLP pattern is
expected for each gene and, consequently, also for a given
combination of genes. If a di¡erent pro¢le is obtained due
to the absence or presence of a given restriction site, the
corresponding fragment(s) may be easily cloned and se-
quenced, and then used as a probe for the cloning of the
entire putative new cry gene. This strategy was used by
Kuo and Chak [60] and by Jua¤rez-Pe¤rez [25] who used
di¡erent universal primers and restriction enzymes. How-
ever, when more than four cry genes are present in a
strain, as is frequently observed in wild-type strains, the
restriction pro¢le is often too complex and the identi¢ca-
tion of the corresponding genes becomes di⁄cult. Further-
more, due to the high similarity between members of the
cry1 subfamily, the PCR-RFLP analysis conducted by
Kuo and Chak [60] was unable to detect di¡erences be-
tween the cry1Ca, cry1Cb, cry1Ea and cry1Fa genes. To
overcome this problem, a second PCR cycle, using alter-
native forward primers, was proposed to amplify other
regions of the genes involved, followed by a second enzy-
matic reaction. A long electrophoresis run was also re-
quired in order to achieve a better resolution of restriction
fragments. When this technique was tested with well-
known standard strains as well as wild isolates (20
B. thuringiensis isolates) it produced the expected pro¢les
from the former and some few unexpected variants from
the latter. Cloning and sequencing of new cry genes cor-
roborated the e⁄cacy of this technique [60].
Another approach to detect new cry genes is based on
the use of two sequential PCR reactions, using a multiplex
PCR with speci¢c and universal primers [24]. This strat-
egy, called exclusive-PCR (E-PCR), starts with the ampli-
¢cation of already described cry1 genes, followed by a
second conditional ampli¢cation that will occur only if a
new putative cry1 gene(s) is present in the strain. This
method is, in fact, a combination of several techniques
available at that time : (i) the use of speci¢c primers de-
signed to recognize only one type of gene; (ii) the use of
universal primers designed to detect entire groups ; and
(iii) the use of multiplex PCR. Also, the use of universal
428 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
degenerate primers was introduced to increase the proba-
bility of amplifying sequences with low homology within
the subfamily.
The authors [24] used the cry1 subfamily as a model to
test this technique because it is the largest cluster of the
cry family. For the ¢rst ampli¢cation reaction, a reverse
universal primer for the entire cry1 group and a speci¢c
primer for each subgroup were designed. This ¢rst step
identi¢es the known cry1 genes contained in the strain.
This information is essential for the second PCR step,
which is conducted with forward and reverse universal
primers designed to amplify a 1.5^1.6 kb fragment of all
known and unknown cry1-related genes, combined with
each of the speci¢c primers that showed ampli¢cation in
the ¢rst step. It is well known that when a mixture of two
forward primers and one reverse primer (or vice versa) is
used, the smaller fragment is ampli¢ed preferentially over
the larger amplicon. It is even possible to exclude the
ampli¢cation of the larger fragment by modifying the
PCR conditions. With this technique, the universal prim-
ers used in the second reaction were designed to amplify
the larger amplicon, called the ‘family band’, whereas the
use of the speci¢c primer and one universal forward prim-
er ampli¢es a smaller fragment called the ‘type band’. The
authors modi¢ed the PCR conditions of this second multi-
plex PCR to eliminate the family band, obtaining only the
expected amplicons of the known genes. Therefore, if a
new cry gene related to the cry1 group is present in a given
strain, it is revealed by the presence of the so-called family
band. On the other hand, if no new cry genes are present
in the strain, the family band is not expected to be ampli-
¢ed. To experimentally demonstrate the e⁄cacy of this
methodology, they used the well-known B. thuringiensis
strain HD-133. In the ¢rst step, all the genes already de-
scribed were detected. In the second reaction, and by omit-
ting one primer, they simulated the presence of a new cry
gene resulting in the ampli¢cation of the family band.
These results encouraged the analysis of a large B. thu-
ringiensis collection. The application of the E-PCR meth-
odology resulted in the detection of a new member of the
cry1B subgroup [24]. We (Jua¤rez-Pe¤rez, unpublished re-
sults) have applied E-PCR to cry gene subfamilies other
than cry1. Taking into account that cry1 is the largest cry
subfamily, this suggests that E-PCR may be suitable for
the entire family of cry genes.
4.1.2. Hybridization
Even though the homology between two cry sequences
within the same group can be as low as 45%, the homol-
ogy of some speci¢c regions within the sequences can be as
high as 95%. Because of this homology between cry gene
sequences, the development of speci¢c probes was used
earlier to detect and characterize putative new cry genes,
using hybridization techniques [61]. With the advent of
faster and more reliable technologies and, especially,
with the increasing number of characterized cry genes,
FEMSRE 757 21-1-03
this methodology was abandoned due to its low speci¢city
and the high number of probes required. Despite this, a
strategy was recently developed to identify novel cry genes
using two mixtures of hybridizing probes that are used
separately in two di¡erent DNA^DNA hybridization re-
actions [62]. The rationale is also composed of two steps.
The conserved sequence mixture was directed towards the
identi¢cation of all the genes from eight selected cry sub-
families and was used in a ¢rst hybridization step. In this
way, if a gene belongs to one of the subfamilies tested, the
low level of speci¢city of the hybridization method permits
its identi¢cation. The second mixture made it possible to
identify new variants of the cry groups tested when low
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
stringency hybridization conditions are used. Since the
variable regions of the genes can form duplex structures,
even if the matching between the probe and the test DNA
is not perfect, related genes can be recognized. Using low
stringency hybridization conditions and comparing the hy-
bridization pro¢les produced by the two mixtures with the
same membrane (ensuring identical DNA digestion and
transfer conditions), they were able to detect di¡erent hy-
bridization pro¢les for the strains tested. Using this meth-
od, they reported the discovery of a new gene having 80%
identity with the cry family, placing this sequence as a
putative new member of an already known group of cry
genes. They also mentioned the isolation of several other
new genes using the same approach. However, this meth-
odology is not time-saving because it does not, unlike the
PCR-based approaches, produce a fragment of the puta-
tive new gene that would simplify its cloning. Despite
these constraints, this method could be useful to identify
new subfamilies of cry genes. The use of entire gene se-
quences (all those presenting the characteristic conserved
blocks of the cry family of genes), a probe mixture of only
the conserved regions within a subfamily and in combina-
tion with a non-speci¢c reaction (hybridization), could
permit the detection of distantly related (unknown) cry
subfamilies.
4.2. Other analytical methods
Another analytical technique to identify new B. thurin-
giensis toxins was used by a Russian group [63]. Rather
than analyzing the gene content of a strain, they studied in
detail the Cry composition of the parasporal body from
several B. thuringiensis strains (representing perhaps the
¢rst proteomic-type work on B. thuringiensis). By purify-
ing and micro-sequencing the major peptides resulting
from trypsin digestion of the solubilized parasporal
body, they were able to ¢nd that B. thuringiensis subspe-
cies galleriae VKPM B-1757 and wuhanensis VKPM
B-1226 parasporal bodies were composed of six and seven
proteins, respectively. Comparison of the protein sequen-
ces with those of known Cry proteins showed that most of
them were already described. However, for each strain two
protein sequences lacked complete homology with the
 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
known Cry proteins, suggesting possible new toxins. Addi-
tionally, this strategy determines the proteins that are ac-
tually synthesized and present in the parasporal body,
which is an advantage compared with the PCR-based
technologies used for toxicity prediction.
5. The prediction of toxicity of B. thuringiensis : future
prospects
There is no doubt that the use of PCR has greatly im-
proved the screening of the increasing number of B. thu-
ringiensis strains isolated world-wide; however, it is mostly
limited to the detection within a strain of previously
known genes. Although some strategies have already
been developed to detect new genes, they are time-consum-
ing when a great number of isolates are studied. Further-
more, even if a new gene is successfully detected, its toxic
activity has to be tested directly by bioassay against a
series of insect species. Additionally, the supposition that
the expected size of an amplicon implies the detection of a
known cry gene is not necessarily true. Furthermore, the
detection of a cry gene by PCR is no direct proof of its
expression (or level of expression).
The advent of new biological tools to analyze the gene
and/or protein expression may help to overcome some of
the problems described above. The automation of several
routine duties in laboratories and the development of the
genomic and proteomic technologies could be used in the
analysis of large collections of B. thuringiensis. Macroar-
rays are the low-cost version of DNA chips and are widely
used in gene expression studies. If we take into account the
present state of this technology, probes can be designed to
speci¢cally identify genes up to the third rank of the cry
gene classi¢cation, and macroarrays may therefore im-
prove the e⁄ciency of detection of known cry genes
present in a given strain. Additionally, the use of cDNA
to hybridize the spotted probes enables the detection of
only those cry genes that are expressed in the strain. The
cDNA can be obtained from a multiplex RT-PCR with
universal primers for each cry group or by mixing the RT-
PCR products of individual reactions. However, a major
inconvenience with this kind of technology may be the
non-speci¢c reactions or cross-reactions of the immobi-
lized oligonucleotides in the macroarray membrane with
the ampli¢ed cDNA. A good compromise between the size
of the cDNA and oligonucleotide design will be a major
determinant in the successful implementation of this
powerful analytical tool.
Additionally, it may be of interest to quantify the rela-
tive amount of each cry transcript by real time RT-QPCR
(reverse transcription-quantitative PCR) at di¡erent stages
of spore development. This information may have both
practical and basic applications. A better understanding
of the proportion of each Cry protein in the crystal can
predict more accurately the toxicity spectrum and potency
FEMSRE 757 21-1-03
429
of a strain. Also, this approach may contribute to our
understanding of the cry gene transcription and regulation
processes under di¡erent culture conditions, even if post-
transcriptional and translational factors, that play an im-
portant role on the Cry protein accumulation in crystals,
are not considered by this approach. This information
may be important for a basic understanding of the regu-
lation of cry gene expression and for monitoring the in-
dustrial production of B. thuringiensis-based products.
It is clear that only the direct study of the Cry protein
content of a strain can lead to precise information con-
cerning its toxicity spectrum. The automation and techno-
logical improvements of the last few years in the study of
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
protein complexes at a cellular level (proteomics) will con-
tribute to further characterization of the B. thuringiensis
parasporal crystal. Chestukhina and coworkers [63] dem-
onstrated that such studies could be successfully carried
out. The technical problems with the current state of pro-
teomics lie in the achievement of digested products pure
enough to be easily recognized by peptide mapping and/or
mass spectrometry [64] and the separation of Cry proteins
(Goar, personal communication). If this restriction was
solved, we would be able to rapidly and reliably identify
the protein content of the parasporal crystal of a given
B. thuringiensis strain. Proteomic studies might be the
key to determining the relative proportion of Cry proteins
forming the crystal, which, to some extent, correlates with
the strain’s toxic spectrum. This methodology may also
provide information concerning the interactions among
Cry proteins. Protein ratios can be used to calculate the
expected toxicity of the whole crystal with a simple for-
mula [65]. Since the expected LD50 (dose needed to kill
50% of the insects) is
LD50 ¼ ½ra=LD50 ðaÞ þ rb=LD50 ðbÞ þ rc=LD50 ðcÞ31
where ra, rb, and rc are the relative proportions of toxins
a, b, and c, respectively, one can easily evaluate synergism
among toxins if the exact protein content (three toxins in
this example) of the parasporal crystal body is determined.
In summary, the relatively modest success of the PCR-
based methods in the identi¢cation of novel B. thuringien-
sis crystal genes is probably related to technical problems
concerning either the complexity of PCR-RFLPs of multi-
genic cry-bearing strains or the adaptation to each labo-
ratory of the E-PCR. Unfortunately, owing to its sensitiv-
ity, E-PCR can lead to di¡erent results depending on the
type of thermocycler and/or consumables used. We suggest
that PCR-RFLP may be a useful methodology if it is
restricted to the detection of new genes within existing
cry groups, since the pro¢les will be less complex and
more restriction enzymes could be used to con¢rm this
di¡erence. E-PCR may be more useful to analyze those
strains whose toxicity cannot be explained by the putative
gene content of the strain where only known genes were
identi¢ed. Finally, proteomic technology is a very prom-
ising tool that could be adapted to the study of the
430 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
B. thuringiensis crystal. The presence of each Cry protein,
both known and unknown, would be revealed by new
peptide pro¢les or sequences, opening a new age in the
understanding of the still fabulous mystery that is the in-
secticidal parasporal body of B. thuringiensis.
Acknowledgements
We are indebted to Jeroen Van Rie and Jorge E. Ibarra
for critical reading of the manuscript and to Cristina Pa-
tricio and Patricia Davis for assistance with English lan-
guage.
References
[1] Ishiwata, S. (1901) On a kind of severe £acherie (sotto disease).
Dainihon Sanshi Kaiho 114, 1^5.
[2] Berliner, E. (1911) U º ber die Schla¡sucht der Mehlmottenraupe.
Z. Gesamte Getreidewes. (Berlin) 3, 63^70.
[3] Goldberg, L.H. and Margalit, J. (1977) A bacterial spore demonstrat-
ing rapid larvicidal activity against Anopheles sergentii, Uranotaenia
unguiculata, Culex univitatus, Aedes aegypti and Culex pipiens. Mosq.
News 37, 355^358.
[4] Krieg, A., Huger, A.M., Langenbruch, G.A. and Schnetter, W.
(1983) Bacillus thuringiensis var. tenebrionis : ein neuer gegenuber
arven von Coleopteren wirksamer athotyp. Z. Ang. Ent. 96, 500^508.
[5] Feitelson, J.S. (1993) The Bacillus thuringiensis family tree. In: Ad-
vanced Engineered Pesticides (Kim, L., Ed.), pp. 63^71. Marcel Dek-
ker, New York.
[6] Ho«fte, H. and Whiteley, H.R. (1989) Insecticidal crystal proteins of
Bacillus thuringiensis. Microbiol. Rev. 53, 242^255.
[7] Lu«thy, P. and Wolfersberger, M.G. (2000) Pathogenisis of Bacillus
thuringiensis toxins. In: Entomopathogenic Bacteria: From Labora-
tory to Field Application (Charles, J.F., Dele¤cluse, A. and Nielsen-
LeRoux, C., Eds.), pp. 167^180. Kluwer Academic Publishers, Dor-
drecht.
[8] Schwart, J.L. and Laprade, R. (2000) Membrane permeabilization by
Bacillus thuringiensis toxins: protein formation and pore insertion.
In: Entomopathogenic Bacteria: From Laboratory to Field Applica-
tion (Charles, J.F., Dele¤cluse, A. and Nielsen-LeRoux, C., Eds.), pp.
199^218. Kluwer Academic Publishers, Dordrecht.
[9] Mart|¤nez, C. (2002) Biological and Genetic Characterization of Ba-
cillus thuringiensis Strains Toxic against Helicoverpa armigera, 573
pp. UPNA, Pamplona.
[10] Kleppe, K., Ohtsuka, E., Kleppe, R., Molineaux, I. and Khorana,
H.G. (1971) Studies on polynucleotides. XCVI. Repair replications of
short synthetic DNA’s catalyzed by DNA polymerases. J. Mol. Biol.
56, 341^361.
[11] Saiki, R.K., Gelfand, D.H., Sto¡el, S., Scharf, S.J., Higuchi, R.,
Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer-directed
enzymatic ampli¢cation of DNA with a thermostable DNA polymer-
ase. Science 239, 487^489.
[12] Carozzi, N.B., Kramer, V.C., Warren, G.W., Evola, S. and Koziel,
M.G. (1991) Prediction of insecticidal activity of Bacillus thuringiensis
strains by polymerase chain reaction product pro¢les. Appl. Environ.
Microbiol. 57, 3057^3061.
[13] Gleave, A.P., Williams, R. and Hedges, R.J. (1993) Screening by
polymerase chain reaction of Bacillus thuringiensis serotypes for the
presence of cryV-like insecticidal protein genes and characterization
of a cryV gene cloned from B. thuringiensis subsp. kurstaki. Appl.
Environ. Microbiol. 59, 1683^1687.
FEMSRE 757 21-1-03
[14] Chak, K.-F., Chao, D.-C., Tseng, M.-Y., Kao, S.-S., Tuan, S.-J. and
Feng, T.-Y. (1994) Determination and distribution of cry-type genes
of Bacillus thuringiensis isolates from Taiwan. Appl. Environ. Micro-
biol. 60, 2415^2420.
[15] Cero¤n, J., Ort|¤z, A., Quintero, R., Gu«ereca, L. and Bravo, A. (1995)
Speci¢c PCR primers directed to identify cryI and cryIII genes within
a Bacillus thuringiensis strain collection. Appl. Environ. Microbiol.
61, 3826^3831.
[16] Ben-Dov, E., Zaritsky, A., Dahan, E., Barak, Z., Sinai, R., Mana-
sherob, R., Khamraev, A., Troitskaya, E., Dubitsky, A., Berezina, N.
and Margalith, Y. (1997) Extended screening by PCR for seven cry-
group genes from ¢eld-collected strains of Bacillus thuringiensis.
Appl. Environ. Microbiol. 63, 4883^4890.
[17] Bravo, A., Sarabia, S., Lopez, L., Ontiveros, H., Abarca, C., Ortiz,
A., Ortiz, M., Lina, L., Villalobos, F.J., Pen‹a, G., Nun‹ez-Valdez,
M.E., Soberon, M. and Quintero, R. (1998) Characterization of cry
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
genes in a Mexican Bacillus thuringiensis strain collection. Appl. En-
viron. Microbiol. 64, 4965^4972.
[18] Ferrandis, M.D., Jua¤rez-Pe¤rez, V.M., Frutos, R., Bel, Y. and Ferre¤,
J. (1999) Distribution of cryI, cryII and cryV genes within Bacillus
thuringiensis isolates from Spain. Syst. Appl. Microbiol. 22, 179^185.
[19] Guerchico¡, A., Ugalde, R.A. and Rubinstein, C.P. (1997) Identi¢-
cation and characterization of a previously undescribed cyt gene in
Bacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 63,
2716^2721.
[20] Guerchico¡, A., Dele¤cluse, A. and Rubinstein, C.P. (2001) The Ba-
cillus thuringiensis cyt genes for hemolytic endotoxins constitute a
gene family. Appl. Environ. Microbiol. 67, 1090^1096.
[21] Ejiofor, A.O. and Johnson, T. (2002) Physiological and molecular
detection of crystalliferous Bacillus thuringiensis strains from habitats
in the South Central United States. J. Indian Microbiol. Biotechnol.
28, 284^290.
[22] Masson, L., Erlandson, M., Puzstai-Carey, M., Brousseau, R., Jua¤-
rez-Pe¤rez, V. and Frutos, R. (1998) A holistic approach for determin-
ing the entomopathogenic potential of Bacillus thuringiensis strains.
Appl. Environ. Microbiol. 64, 4782^4788.
[23] Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J.,
Feitelson, J., Zeigler, D.R. and Dean, D.H. (1998) Bacillus thurin-
giensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev.
62, 775^806.
[24] Jua¤rez-Pe¤rez, V.M., Ferrandis, M.D. and Frutos, R. (1997) PCR-
based approach for detection of novel Bacillus thuringiensis cry genes.
Appl. Environ. Microbiol. 63, 2997^3002.
[25] Jua¤rez-Pe¤rez, V. (1998) Caracte¤risation de Nouveaux Ge'nes d’Endo-
toxines de Bacillus thuringiensis Berliner, 156 pp. ENSA/AGRO,
Montpellier.
[26] Bourque, S.N., Valero, J.R., Mercier, J., Lavoie, M.C. and Levesque,
R.C. (1993) Multiplex polymerase chain reaction for detection and
di¡erentiation of the microbial insecticide Bacillus thuringiensis. Appl.
Environ. Microbiol. 59, 523^527.
[27] Shin, B.-S., Park, S.-H., Choi, S.-K., Koo, B.-T., Lee, S.-T. and Kim,
J.-I. (1995) Distribution of cryV-type insecticidal protein genes in
Bacillus thuringiensis and cloning of cryV-type genes from Bacillus
thuringiensis subsp. kurstaki and Bacillus thuringiensis subsp. entomo-
cidus. Appl. Environ. Microbiol. 61, 2402^2407.
[28] Cero¤n, J., Covarrubias, L., Quintero, R., Ort|¤z, A., Ort|¤z, M., Ara-
nda, E., Lina, L. and Bravo, A. (1994) PCR analysis of the cryI
insecticidal family genes from Bacillus thuringiensis. Appl. Environ.
Microbiol. 60, 353^356.
[29] Kalman, S., Kiehne, K.L., Libs, J.L. and Yamamoto, T. (1993) Clon-
ing of a novel cryIC-type gene from a strain of Bacillus thuringiensis
subsp. galleriae. Appl. Environ. Microbiol. 59, 1131^1137.
[30] Kim, H.S., Lee, D.W., Woo, S.D., Yu, Y.M. and Kang, S.K. (1998)
Distribution, serological identi¢cation, and PCR analysis of Bacillus
thuringiensis isolated from soils of Korea. Curr. Microbiol. 37, 195^
200.
[31] Wilson, I.G., Cooper, J.E. and Gilmour, A. (1991) Detection of en-
 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432
terotoxigenic Staphylococcus aureus in dried skimmed milk: use of
the polymerase chain reaction for ampli¢cation and detection of
staphylococcal enterotoxin genes entB and entC1 and the thermonu-
clease gene nuc. Appl. Environ. Microbiol. 57, 1793^1798.
[32] Wilson, I.G. (1997) Inhibition and facilitation of nucleic acid ampli-
¢cation. Appl. Environ. Microbiol. 63, 3741^3751.
[33] Roux, K.H. (1995) Optimization and troubleshooting in PCR. PCR
Methods Appl. 4S, 185^194.
[34] Kwok, S., Seng-Yung, C., Sninsky, J.J. and Wang, A. (1994) A guide
to design and use of mismatched and degenerated primers. PCR
Methods Appl. 4S, 39^47.
[35] Aronson, A.I., Wu, D. and Zhang, C. (1995) Mutagenesis of speci-
¢city and toxicity regions of a Bacillus thuringiensis protoxin gene.
J. Bacteriol. 177, 4059^4065.
[36] Dean, D.H., Rajamohan, F., Lee, M.K., Wu, S.J., Chen, X.J., Al-
cantara, E. and Hussain, S.R. (1996) Probing the mechanism of ac-
tion of Bacillus thuringiensis insecticidal proteins by site-directed mu-
tagenesis : a minireview. Gene 179, 111^117.
[37] Barboza-Corona, J.E., Lopez-Meza, J.E. and Ibarra, J.E. (1998)
Cloning and expression of the cry1Ea4 gene of Bacillus thuringiensis
and the comparative toxicity of its gene product. World J. Microbiol.
Biotechnol. 14, 437^441.
[38] Kostichka, K., Warrren, G.W., Mullins, M., Mullins, A.D., Craig,
J.A., Koziel, M.G. and Estruch, J.J. (1996) Cloning of a cryV-type
insecticidal protein gene from Bacillus thuringiensis : the cryV-en-
coded protein is expressed early in stationary phase. J. Bacteriol.
178, 2141^2144.
[39] Cheng, P., Wu, L., Ziniu, Y. and Aronson, A.I. (1999) Subspecies-
dependent regulation of Bacillus thuringiensis protoxin genes. Appl.
Environ. Microbiol. 65, 1849^1853.
[40] Wu, D. and Chang, F.N. (1985) Synergism in mosquitocidal activity
of 26 and 65 kDa proteins from Bacillus thuringiensis subsp. israel-
ensis crystal. FEBS Lett. 190, 232^236.
[41] Ibarra, J.E. and Federici, B.A. (1986) Parasporal bodies of Bacillus
thuringiensis subsp. morrisoni (PG-14) and Bacillus thuringiensis
subsp. israelensis are similar in protein composition and toxicity.
FEMS Microbiol. Lett. 34, 79^84.
[42] Dele¤cluse, A., Jua¤rez-Pe¤rez, V. and Berry, C. (2000) Vector-active
toxins: structure and diversity. In: Entomopathogenic Bacteria :
From Laboratory to Field Application (Charles, J.F., Dele¤cluse, A.
and Nielsen-LeRoux, C., Eds.), pp. 101^125. Kluwer Academic Pub-
lishers, Dordrecht.
[43] Wirth, M.C., Walton, W.E. and Federici, B.A. (2000) Cyt1A from
Bacillus thuringiensis restores toxicity of Bacillus sphaericus against
resistant Culex quinquefasciatus (Diptera : Culicidae). J. Med. Ento-
mol. 37, 401^407.
[44] Federici, B.A. and Bauer, L.S. (1998) Cyt1Aa protein of Bacillus
thuringiensis is toxic to the cottonwood leaf beetle, Chrysomela scrip-
ta, and suppresses high levels of resistance to Cry3Aa. Appl. Environ.
Microbiol. 64, 4368^4371.
[45] Lee, M.K., Curtiss, A., Alcantara, E. and Dean, D.H. (1996) Syner-
gistic e¡ect of the Bacillus thuringiensis toxins Cry1Aa and Cry1Ac
on the gypsy moth, Lymantria dispar. Appl. Environ. Microbiol. 62,
583^586.
[46] Aronson, A.I., Han, E.-S., McGaughey, W. and Johnson, D. (1991)
The solubility of inclusion proteins from Bacillus thuringiensis is de-
pendent upon protoxin composition and is a factor in toxicity to
insects. Appl. Environ. Microbiol. 57, 981^986.
[47] Del Rinco¤n-Castro, M.C., Barajas-Huerta, J. and Ibarra, J.E. (1999)
Antagonism between Cry1Ac1 and Cyt1A1 toxins of Bacillus thurin-
giensis. Appl. Environ. Microbiol. 65, 2049^2053.
[48] Li, R.S., Jarrett, P. and Burges, H.D. (1987) Importance of spores,
crystals, and delta-endotoxins in the pathogenicity of di¡erent varie-
ties of Bacillus thuringiensis in Galleria mellonella and Pieris brassicae.
J. Invertebr. Pathol. 50, 277^284.
[49] Miyasono, M., Inagaaki, S., Yamamoto, M., Ohba, K., Ishiguro, T.,
Takeda, R. and Hayashi, Y. (1994) Enhancement of N-endotoxin
FEMSRE 757 21-1-03
431
activity by toxin-free spore of Bacillus thuringiensis against the Dia-
mondback Moth, Plutella xylostella. J. Invertebr. Pathol. 63, 111^
112.
[50] Johnson, D.E. and McGaughey, W.H. (1996) Contribution of Bacil-
lus thuringiensis spores to toxicity of puri¢ed Cry proteins towards
indianmeal moth larvae. Curr. Microbiol. 33, 54^59.
[51] Porcar, M., Mart|¤nez, C. and Caballero, P. (2000) Host range and
gene contents of Bacillus thuringiensis strains toxic towards Spodo-
ptera exigua. Entomol. Exp. Appl. 97, 339^346.
[52] Chambers, J.A., Jelen, A., Gilbert, M.P., Jany, C.S., Johnson, T.B.
and Gawron-Burke, C. (1991) Isolation and characterization of a
novel insecticidal crystal protein gene from Bacillus thuringiensis
subsp. aizawai. J. Bacteriol. 173, 3966^3976.
[53] Sanchis, V., Lereclus, D., Menou, G., Chaufaux, J. and Lecadet, M.
-M. (1988) Multiplicity of N-endotoxin genes with di¡erent speci¢cities
in Bacillus thuringiensis aizawai 7.29. Mol. Microbiol. 2, 393^404.
Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021
[54] Hongyu, Z., Ziniu, Y. and Wangxi, D. (2000) Composition and eco-
logical distribution of Cry proteins and their genotypes of Bacillus
thuringiensis isolates from warehouses in China. J. Invertebr. Pathol.
76, 191^197.
[55] Lereclus, D., Dele¤cluse, A. and Lecadet, M.-M. (1993) Diversity of
Bacillus thuringiensis toxins and genes. In: Bacillus thuringiensis and
Environmental Biopesticide: Theory and Practice (Entwistle, P.S.,
Cory, J.S., Bailey, M.J. and Higgs, S.R., Eds.), pp. 309^329. Wiley,
London.
[56] Lecadet, M.M., Frachon, E., Dumanoir, V.C., Ripouteau, H., Ha-
mon, S., Laurent, P. and Thie¤ry, I. (1999) Updating the H-antigen
classi¢cation of Bacillus thuringiensis. J. Appl. Microbiol. 86, 660^
672.
[57] Dulmage, H.T. (1981) Insectidal activity of isolates of Bacillus thu-
ringiensis and their potential for pest control. In: Microbial Control
of Pests and Plant Diseases (Burges, H.D., Ed.), pp. 193^223. Aca-
demic Press, London.
[58] Glare, T.R. and O’Callaghan, M. (2000) A case study: toxicity of
Dipal, Bt kurstaki produced by Abbatt Laboratories. In: Bacillus
thuringiensis : Biology, Ecology and Safety, pp. 311^316. Wiley, Chi-
chester.
[59] Kuo, W.S., Lin, J.H., Tzeng, C.C., Kao, S.S. and Chak, K.F. (2000)
Cloning of two new cry genes from Bacillus thuringiensis subsp wu-
hanensis strain. Curr. Microbiol. 40, 227^232.
[60] Kuo, W.S. and Chak, K.F. (1996) Identi¢cation of novel cry-type
genes from Bacillus thuringiensis strains on the basis of restriction
fragment length polymorphism of the PCR-ampli¢ed DNA. Appl.
Environ. Microbiol. 62, 1367^1377.
[61] Crickmore, N., Zeigler, D.R., Feitelson, J., Schnepf, E., Van Rie, J.,
Lereclus, D., Baum, J. and Dean, D.H. (1998) Revision of the no-
menclature for the Bacillus thuringiensis pesticidal crystal proteins.
Microbiol. Mol. Biol. Rev. 62, 807^813.
[62] Beard, C.E., Ranasinghe, C. and Akhurst, R.J. (2001) Screening for
novel cry genes by hybridization. Lett. Appl. Microbiol. 33, 241^245.
[63] Chestukhina, G.C., Kostina, L.I., Mikahilova, S.A., Tyurin, F., Kle-
pikova, S. and Stepanov, M. (1994) Production of multiple N-endo-
toxins by Bacillus thuringiensis : N-endotoxins produced by strains of
the subspecies galleriae and wuhanensis. Can. J. Microbiol. 40, 1026^
1034.
[64] Rabilloud, T. (2002) Two-dimensional gel electrophoresis in proteo-
mics : old, old-fashioned but it still climbs up the mountains. Proteo-
mics 2, 3^10.
[65] Tabashnik, B.E. (1992) Evaluation of synergism among Bacillus thu-
ringiensis toxins. Appl. Environ. Microbiol. 58, 3343^3346.
[66] Ben-Dov, E., Manasherob, R., Zaritsky, A., Barak, Z. and Marga-
lith, Y. (2001) PCR analysis of cry7 genes in Bacillus thuringiensis by
the ¢ve conserved blocks of toxins. Curr. Microbiol. 42, 96^99.
[67] Wasano, N., Ohba, M. and Miyamoto, K. (2001) Two N-endotoxin
genes, cry9Da and a novel related gene, commonly occurring in Lep-
idoptera-speci¢c Bacillus thuringiensis Japanese isolates that produce
spherical parasporal inclusions. Curr. Microbiol. 42, 129^133.
432 M. Porcar, V. Jua¤rez-Pe¤rez / FEMS Microbiology Reviews 26 (2003) 419^432

[68] Porcar, M., Iriarte, J., Dumanoir, V.C., Ferrandis, M.D., Lecadet,
M.M., Ferre¤, J. and Caballero, P. (1999) Identi¢cation and character-
ization of the new Bacillus thuringiensis serovars pirenaica (serotype
H57) and iberica (serotype H59). J. Appl. Microbiol. 87, 640^648.
[69] Rang, C. (1996) Etude des relations structure ^ Fonction chez les
endotoxins de Bacillus thuringiensis. University of Montpellier II,
Montpellier, 145 pp.
[70] Barloy, F., Lecadet, M.M. and Dele¤cluse, A. (1998) Distribution of
clostridial cry-like genes among Bacillus thuringiensis and Clostridium
strains. Curr. Microbiol. 36, 232^237.

Downloaded from https://academic.oup.com/femsre/article/26/5/419/537673 by guest on 11 November 2021

FEMSRE 757 21-1-03