Test Bank For Genetics and Genomics in Nursing and Health Care 2nd Edition by Beery

Stuvia.
com - The Marketplace to Buy and Sell your Study Material
TEST BANK FOR

GENETICS AND
GENOMICS IN
NURSING AND
HEALTH CARE
Downloaded
Downloadedby:
by:
SuperA
Ariah || abbieclin@gmail.com
abiekay12@gmail.com
Distribution of this document is illegal
Stuvia.com - The Marketplace to Buy and Sell your Study Material
2ND EDITION
BY BEERY
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 1: DNA Structure and Function
Multiple Choice
Identify the choice that best completes the statement or answers the question.
__A.__ 1. In which body or cell area are most genes in humans located?
A. Nucleus
B. Mitochondrion
C. Cytoplasm
D. Plasma membrane
__A.__ 2. Which condition or statement exemplifies the concept of genomics rather than genetics?
A. The gene for insulin is located on chromosome 11 in all people.
B. Expression of any single gene is dependent on inheriting two alleles.
C. Sex-linked recessive disorders affect males more often than females.
D. One allele for each gene is inherited from the mother, and one is inherited from the
father.
__A.__ 3. What is the purpose of phosphorous in a DNA strand?
m
A. Linking the nucleotides into a strand
er as
B. Holding complementary strands together
co
C. Ensuring that a purine is always paired with a pyrimidine
eH w
D. Preventing the separation of double-stranded DNA into single-stranded DNA
o.
rs e
__A.__ 4. What is the term used to define alternative forms of a gene that may result in different expression
ou urc
of the trait coded for by that gene?
A. Alleles
B. Bases
C. Centromeres
o
D. Diploids
aC s
vi y re
__D.__ 5. What percentage of bases in a stretch of double-stranded DNA that contains 30% guanine (G)
bases would be adenine (A)?
A. 70%
B. 60%
ed d
C. 30%
ar stu
D. 20%
__C.__ 6. What is the term used to describe the organized picture of the paired chromosomes within a cell
used to determine whether chromosome numbers, structures, and banding patterns are normal?
is
A. Pedigree
Th
B. Phenotype
C. Karyotype
D. Autotype
sh
__D.__ 7. What would be the sequence of DNA that is complementary to a DNA section with the base
sequence of GGTCAATCCTTAG?
A. GATTCCTAACTGG
B. TTGACCGAAGGCT
C. AACTGGCTTCCGA
D. CCAGTTAGGAATC
This study source was downloaded by 100000821881636 from CourseHero.com on 04-15-2021 15:47:17 GMT -05:00
https://www.coursehero.com/file/62130156/DNA-Structure-and-Function-Practice-Questions-CH1docx/
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
__B.__ 8. Which of these complementary base pairs form the strongest or “tightest” association?
A. Adenine and thymine
B. Cytosine and guanine
C. Guanine and thymine
D. Cytosine and adenine
__A__ 9. What activity occurs during M phase of the cell cycle?

A. The cell undergoes cytokinesis.
B. Activity stops, and the cell “sleeps.”
C. All DNA is completely replicated.
D. The cell greatly increases protein synthesis.
__B.__10. Which chromosome number represents the euploid state for normal human somatic cells?
A. 44
B. 46
C. 47
D. 48
__A.__11. How does the proteome differ from the genome?
m
A. The proteome changes in response to intracellular and extracellular signals.
er as
B. The genome changes in response to intracellular and extracellular signals.
co
C. The proteome is stable in somatic cells and unstable in germ cells, whereas the
eH w
genome is stable in both somatic cells and germ cells.
o.
D. The genome is stable in somatic cells and unstable in germ cells, whereas the
rs e
proteome is stable in both somatic cells and germ cells.
ou urc
__C.__12. What is the most outstanding feature of a mature haploid cell?
A. It is usually homozygous.
B. The sex chromosomes are missing.
o
C. Only one chromosome of each pair is present.

aC s
D. DNA synthesis occurs after mitosis instead of before.

vi y re
__D.__13. At what phase of the cell cycle are chromosomes visible as separate structures?
A. G1
B. G2
ed d
C. S
ar stu
D. M
__B.__14. Which statement about the cell cycle phase of G0 is true?

A. Hyperplastic growth in place of hypertrophic growth
is
B. Performance of specific differentiated functions

Th
C. Initiation and completion of nucleokinesis

D. Replication of DNA
__B.__15. What is the result of normal DNA replication?

sh
A. Formation of two new daughter cells

B. Formation of two identical sets of DNA
C. Disappearance of the original parent cell
D. Activation and attachment of spindle fibers
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
__A.__16. Which statement regarding chromosome structure or function is true?

A. The chromatids of any single chromosome are known as “sister chromatids.”
B. The genes located on the telomeres of chromosomes are identical to the genes in
the centromeres.
C. Immediately before the mitosis phase of cell division, the chromosomes of all
somatic cells are haploid.
D. A specific gene allele on one chromosome has a complementary allele on the other
chromosome of a pair.
__C.__17. Why does a person with normal chromosomes only have two alleles for any single gene trait?
A. A minimum of two alleles is required for the expression of monogenic traits.
B. When a dominant allele is paired with a recessive allele, only the dominant allele is
expressed, and the recessive allele is silent.
C. One allele for the monogenic trait is on the paternally derived chromosome, and
the other allele is on the maternally derived chromosome.
D. Expression of more than two alleles of any single-gene trait results in enhanced
expression of recessive alleles and suppressed expression of dominant alleles.
__C__ 18. Under what normal condition are genotype and phenotype always the same?
m
A. Euploidy of alleles
er as
B. Aneuploidy of alleles
co
C. Homozygosity of alleles
eH w
D. Heterozygosity of alleles
o.
__D.__19. What would be the expected result of a drug that affected a particular tissue by causing new
rs e
DNA to form with covalent bonds instead of hydrogen bonds?
ou urc
A. None of the cells in the affected tissue would be able to leave G0 and enter the cell
cycle.
B. Replication of DNA would result in identical DNA strands instead of
o
complementary strands.
aC s
C. Mitosis of cells in the tissue would result in the production of three new daughter
vi y re
cells instead of just two.

D. The new cells that formed within this tissue would not be able to complete the next
round of mitosis successfully.
ed d
__B.__20. How does the DNA enzyme topoisomerase contribute to DNA replication?
ar stu
A. Unwinds the double helix and separates the double-stranded DNA

B. Creates a “nick” in the DNA supercoils, allowing them to straighten before
replication
C. Initiates DNA synthesis in multiple sites down the strand, making the process more
is
efficient
Th
D. Connects and links the individual pieces of newly synthesized DNA to form a
single strand
__A.__21. Where is telomeric DNA located?
sh
A. At the tips of the p and q arms of chromosomes.

B. In the mitochondria of all somatic cells
C. Only in the germ cells (ova and sperm)
D. Within the histones of the solenoid
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
__A.__22. What is the purpose of a chromosome centromere?

A. Connecting sister chromatids to form a chromosome
B. Preventing the chromosome arm tips from unraveling
C. Allowing chromatids to separate during DNA replication
D. Ensuring that DNA replication proceeds only in the 3'-to-5' direction
__C.__23. Which genetic process would be disrupted in one cell if it could not form chromosomes?
A. DNA replication
B. Gene-directed protein synthesis
C. Delivery of genetic information to new cells
D. Conversion of a nucleoside into a nucleotide
__B.__24. What are the expected expressed blood types of children born to a mother who is B/O for blood
type and a father who is A/B for blood type?
A. 25% A, 25% B, 25% O, 25% AB
B. 25% A, 50% B, 0% O, 25% AB
C. 50% A, 25% B, 25% O, 0% AB
D. 50% A, 25% B, 0% O, 25% AB
m
er as
__A.__25. A person’s karyotype shows 44 autosomes and one X chromosome. What is the best
co
interpretation of this karyotype?
eH w
A. The karyotype is aneuploid, and the individual has only one allele for each of the
o.
genes on the X chromosome.
rs e
B. The karyotype is aneuploid, and the individual is experiencing the pathologic
ou urc
condition of haploidy.
C. The karyotype is euploid, making the individual a genotypic female and a
phenotypic male.
o
D. The karyotype is euploid, making the individual a genotypic male and a

aC s
phenotypic female.
vi y re
ed d
ar stu
is
Th
sh
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
References
Beery, T. A., Workman, M. L., & Eggert, J. A. (2018). Genetics and Genomics in Nursing and
Health Care 2nd Edition. Retrieved from Davis Plus:
https://davisplus.fadavis.com/ProductDetail/ProductDetail?urls=nursing-advanced-
practice-genetics-genomics-health-care-beery-workman-2
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh
Powered by TCPDF (www.tcpdf.org)
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 2: Protein Synthesis
Multiple Choice
__C.__ 1. What is the relationship among genes, DNA, and proteins?

A. DNA is composed of a series of amino acids that provide the directions for
synthesizing proteins.
B. Protein is composed of DNA that is organized into specific gene sequences called
amino acids.
C. A gene is a section of DNA that provides the directions for synthesizing a specific
protein.
D. Proteins are the nitrogenous bases that form double strands of DNA in its helical
shape.
__B.__ 2. What is the best meaning for the term gene expression?
A. The location of a specific gene allele on a specific autosomal chromosome
B. The specific trait or protein coded for by a single gene is actually present
m
C. The ability of a single gene to code for more than one trait or characteristic
er as
D. The loss of a trait or characteristic from one family generation to the next
co
generation
eH w
__D.__ 3. What is the difference between DNA transcription for DNA synthesis and DNA transcription for
o.
protein synthesis?
rs e
A. Transcription for DNA synthesis is rapidly followed by the process of translation.
ou urc
B. Transcription for protein synthesis has “greater fidelity” than does transcription for
DNA synthesis.
C. Transcription for protein synthesis occurs only in cells undergoing mitosis, and
o
transcription for DNA synthesis occurs in both dividing and nondividing cells.
aC s
D. Transcription for DNA synthesis occurs with both the “sense” and the “antisense”
vi y re
strands, while transcription for protein synthesis occurs with only the “antisense”
strand.
__A__ 4. Which mature messenger RNA strand correctly reflects the accurate transcription of the
ed d
following segment of DNA, in which large letters represent introns and small letters represent
ar stu
exons? tTGCGaAccaGaCTtaaAAtTAAA
A. AUGGUUAUUA
B. ACGCTCGATTATTT
C. CGCUCGAUUAUUU
is
D. AACGCUUGGUCUGAAUUUUAAUUU
Th
__B.__ 5. What is the function of ribosomes (also known as ribosomal RNA) in protein synthesis?
A. Allow interpretation of the two strands of DNA to determine which is the “sense”
strand and which is the “antisense” strand
sh
B. Serve as the coordinator mechanism to allow proper reading of the mRNA and
placement of the correct amino acid in the sequence by the tRNAs
C. Allow further processing of synthesized proteins (posttranslational modification)
in order to ensure that the final product is physiologically active
D. Serve as transport molecules able to move a specific amino acid to the site of
protein synthesis (peptide chain elongation) in the correct sequence
https://www.coursehero.com/file/62130136/Protein-Synthesis-Practice-Questions-CH2docx/
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
__D.__ 6. A strand of recently transcribed mRNA contains the following components: intron (1), intron (2),
exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to
appear in the mature mRNA?
A. 1, 2, 3, 4, 5, 6, 7, 8
B. 2, 3, 4, 5, 6, 7
C. 1, 2, 4, 8
D. 3, 5, 6, 7
__D.__ 7. Which process occurs outside of the nucleus?

A. DNA transcription
B. RNA transcription
C. Splicing out of introns
D. Translation of mRNA
__C.__ 8. What would be the consequence for protein synthesis if only limited amounts of adenine were
available in a cell?
A. Increased rate of mRNA degradation
B. Increased formation of mutation “hot spots”
C. Decreased production of cellular proteins
m
er as
D. Decreased amounts of uracil in the cytoplasm
co
eH w
__A.__ 9. Which process would be directly inhibited by a lack of conversion of thymine to uracil?
A. Translation
o.
B. Transcription
C. MicroRNA silencing rs e
ou urc
D. Posttranscriptional modification
__C.__10. What would be the sequence of RNA complementary to single-stranded DNA with the base
o
sequence of ACCTGAACGTCGCTA?
aC s
A. TGGACTTGCAGCGAT
vi y re
B. ACCTGAACGTCGCTA
C. UGGACUUGCAGCGAU
D. ACCUGAACGUCGCUA
ed d
__A.__11. Which events, structures, or processes are likely to trigger transcription of the beta-globin gene?
A. Anemia and TATA boxes upstream from the beta-globin gene
ar stu
B. Anemia and polyadenylation downstream from the beta-globin gene

C. Polycythemia and TATA boxes upstream from the beta-globin gene
D. Polycythemia and polyadenylation downstream from the beta-globin gene
is
__C.__12. After a protein is synthesized during translation, what further process or processes is/are needed
Th
for it to be fully functional?

A. No further processing beyond the linear arrangement of amino acids is required.
B. Although minimal function can occur in the linear form, the protein is more active
when it undergoes mitosis.
sh
C. The protein first twists into a secondary structure and then “folds” into a specific
tertiary structure for activation and function.
D. The initial protein produced is a “preprotein” that requires a series of
depolarizations by electrical impulses for conversion to an active protein.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
__C.__13. How does an “anticodon” participate in protein synthesis?

A. Splicing out the introns to form a functional and mature messenger RNA
B. Identifying which DNA strand is the “sense” strand to transcribe into RNA
C. Ensuring the appropriate tRNA places the correct amino acid into the protein
D. Interpreting the correct “stop” triplet or codon that signals for translation
termination
__C.__14. The protein glucagon contains 29 amino acids in its active linear form. What is the minimum
number of bases present in the mature messenger RNA for this protein?
A. 29
B. 58
C. 87
D. 116
__B.__15. Which feature or characteristic is most critical for protein function or activity?
A. The number of amino acids
B. The sequence of amino acids
C. Deletion of all active exons
D. Transcription occurring after translation
m
er as
__D.__16. How does a “codon” participate in protein synthesis?
co
A. Carrying amino acid for peptide bond attachment
eH w
B. Ensuring that ribosomal RNA is securely wrapped around the mature mRNA
C. Preventing microRNA from binding to mRNA and prematurely degrading it
o.
rs e
D. Indicating which amino acid is to be placed within the growing protein chain
ou urc
__A.__17. How does replacement of thymine with uracil in messenger RNA help in the process of protein
synthesis?
A. Allowing messenger RNA to leave the nucleus
o
B. Ensuring only the “antisense” strand of DNA is transcribed

aC s
C. Determining the placement of the “start” signal for translation

vi y re
D. Promoting posttranslational modification for conversion to an active protein
__D.__18. How does the process of polyadenylation affect protein synthesis?

A. Binding to the antisense DNA strand to prevent inappropriate transcription
ed d
B. Promoting attachment of ribosomes to the correct end of messenger RNA

ar stu
C. Linking the exons into the mature messenger RNA

D. Signaling the termination of mRNA translation
__A.__19. Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis?
is
A. These enzymes prevent overexpression of critical proteins.

B. Without ribonucleases, messenger RNA could leave one cell type and lead to
Th
excessive protein synthesis in a different cell type.

C. When ribonucleases degrade RNA, the degradation products are recycled, making
protein synthesis more energy efficient.
sh
D. The activity of these enzymes promotes increased translation of individual

messenger RNAs so that fewer RNA molecules are needed for protein production.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
__D.__20. Which statement about the introns within one gene is correct?
A. These small pieces of DNA form microRNAs that regulate gene expression.
B. They are part of the desert DNA composing the noncoding regions.
C. When expressed, they induce posttranslational modifications.
D. The introns of one gene may be the exons of another gene.
__B.__21. Which DNA segment deletion would cause a frameshift mutation?

A. TCT
B. GAGTC
C. TACTAC
D. GCATGACCC
__C.__22. A person who is worried that he may have inherited the gene mutation for Huntington disease is
told that he has the “wild-type” form of this gene. What is the best interpretation of this finding?
A. His gene for Huntington disease (HD) has more “hot spots” for mutations than the
general population.
B. His Huntington disease has unusual mutations of unknown significance.
C. His Huntington disease gene is considered normal.
D. He has no Huntington disease gene.
m
er as
__C.__23. What is the expected result of a “nonsense” point mutation?
co
A. Total disruption of the gene reading frame, no production of protein
eH w
B. Replacement of one amino acid with another in the final gene product
C. Replacing an amino acid codon with a “stop” codon, resulting in a truncated
o.
protein product
rs e
ou urc
D. No change in amino acid sequence and no change in the composition of the protein
product
__D.__24. What makes a frameshift mutational event more serious than a point mutational event?
o
A. Frameshift mutations occur primarily in germline cells, and point mutations occur
aC s
only in somatic cells.

vi y re
B. Frameshift mutations result in the deletion or addition of whole chromosomes

(aneuploidy), and point mutations are undetectable at the chromosome level.
C. The rate of frameshift mutations increases with aging because DNA repair
mechanisms decline, whereas the rate of point mutations is unchanged with age.
ed d
D. When the mutations occur in expressed genes, frameshift mutations always result
ar stu
in disruption of the gene function, whereas a point mutation can be silent.

__A.__25. What is the expected outcome when a person (twin A) experiences a large deletion of DNA in
one of his noncoding regions and his monozygotic twin (twin B) does not?
is
A. DNA identification of each twin will be more specific.

Th
B. Only their somatic cells will remain identical at all loci.

C. Only their germline cells will remain identical at all loci.
D. They will now be dizygotic twins instead of monozygotic twins.
sh
__D.__26. Which statement about single-nucleotide polymorphisms (SNPs) is true?

A. SNPs can change an exon sequence into an intron sequence.
B. SNPs can change an intron sequence into an exon sequence.
C. SNPs are generally responsible for frameshift mutations.
D. SNPs are generally responsible for point mutations.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
__B.__27. Why are people who have poor DNA repair mechanisms at greater risk for cancer development?
A. Their cancers are usually resistant to chemotherapy.
B. Their somatic mutations are more likely to be permanent.
C. They have greater exposure to environmental carcinogens.
D. They have sustained a mutational event in all cells and tissues.
__B.__28. How does an acquired mutation in a somatic cell gene leading to cancer development affect a
person’s ability to pass on a predisposition for that cancer type to his or her children?
A. The predisposition can only be passed on if the person with the somatic cell
mutation is female.
B. There is no risk of passing on a cancer predisposition to one’s children from a
somatic cell mutation.
C. The risk for predisposition is dependent on which tissue type experienced the
somatic mutation.
D. Multiple somatic mutations are required for passing on a predisposition to cancer
development.
__C.__29. Which factor has the greatest influence on protein tertiary structure?
A. The presence of a poly-A tail
m
B. The specific amino acids that are in close proximity to each other
er as
C. Bond formation between amino acids that are distant from each other
co
D. The number and position of additional proteins needed to form the complex
eH w
structure
o.
rs e
__C.__30. Jack and Jill go up a hill that has high levels of gamma radiation emission. Jack suffers 10 point
ou urc
mutational events in a noncoding region, and Jill suffers only one frameshift mutation in the
insulin gene–coding region of all her pancreatic beta cells. What are the possible and probable
outcomes of these events for both people?
A. Jack will have major deficiencies in the production of 10 proteins; Jill will have
o
reduced insulin activity.

aC s
B. Jack will have less functional proteins and an increased risk for cancer; Jill will
vi y re
have type 2 diabetes mellitus.

C. Jack will have few, if any, effects on protein synthesis but will have more personal
DNA markers; Jill will not produce any functional insulin and will have type 1
ed d
diabetes mellitus.
D. Jack will not have any change in protein synthesis or function; Jill will have an
ar stu
increased risk for developing type 1 diabetes mellitus and can pass this risk on to
her children.
is
__A.__31. A new experimental drug has been developed that reduces the activity of microRNA in the beta
cells of the pancreas of people with type 2 diabetes mellitus. If this drug was specific only for
Th
pancreatic beta cells, what would be its effect?

A. Increased production of insulin
B. Decreased production of insulin
sh
C. Increased degradation of insulin

D. Decreased degradation of insulin
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
References
Beery, T. A., Workman, M. L., & Eggert, J. A. (2018). Genetics and Genomics in Nursing and
Health Care 2nd Edition. Retrieved from Davis Plus:
https://davisplus.fadavis.com/ProductDetail/ProductDetail?urls=nursing-advanced-
practice-genetics-genomics-health-care-beery-workman-2
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 3: Genetic Influences on Cell Division, Cell Differentiation, and Gametogenesis

• Genetic influences for normal cell growth control:
o When cell division occurs
o The extent to which it occurs
o Whether cells grow by hyperplasia or hypertrophy
o When cells perform their specific differentiated functions
o When cells should undergo apoptosis
• Hyperplasia
o Mitotic cell growth in which the tissue or organ increases in size by increasing the number of cells within it
o More common among the cells of tissues that are exposed to environmental changes that result in damage or
cell death
• Hypertrophy
o The expansion of the size of each individual cell rather than by generating new cells to increase the number
of cells
• Genetic control over hypertrophy involves expressing those gene products that prevent mitosis and expressing those
gene products that are needed to perform its functions
o Genetic control over hyperplasia involves maintaining a balance among the processes of cell division, cell
performance of differentiated functions, and cellular suicide (apoptosis)
m
• Life Choices of a Normal Cell Capable of Mitosis
er as
o Signals:
 Growth factors
co
 Growth inhibitors
eH w
 Steroid hormones
 Cell–cell
o.
 Interactions
•
rs e
Characteristics of Normal Cells
ou urc
o Orderly, well-regulated growth
o Specific morphology
o Smaller nuclear: cytoplasmic ratio
o Differentiated functions
o
o Tightly adherent
o Nonmigratory
aC s
o Euploid
vi y re
o Respond to signals for apoptosis

• Have many cell adhesion molecules (CAMs) that keep normal cells tightly adherent to each other and nonmigratory
• Cell division (mitosis) only occurs when:
o Cells are needed for normal growth/development
ed d
o Cells are needed to replace dead or damaged cells

o Cell surfaces are not contacted on all sides by other cells
ar stu
o Sufficient nutrients are present to support the processes of cell division and the addition of more cells
• The Ultimate Balancing Act

is
o Pro-cell division
 Knowing when to divide
Th
 Knowing to what extent to divide

o Control of cell division
 Knowing when not to divide
 Knowing when to stop dividing
o Apoptosis
sh
 Knowing when to take a cell out of the “workforce”
• Mitosis
o Cell division in which there is a duplication of a parent cell, resulting in two new daughter cells that are
identical to each other and to the parent cell
• Mitosis
o Entering the cell cycle from the state of G0 requires overcoming “checkpoint” controls
https://www.coursehero.com/file/71754878/Genetics-Chapter-3docx/
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
o Progressing through the cell cycle also requires overcoming checkpoint controls
o Genes that produce the mitosis-inhibitory proteins of the checkpoints are suppressor genes
o Genes that produce premeiotic proteins are oncogenes
• When cell division is needed, conditions external to the cell that indicate more cells are needed are transmitted to the
nucleus through various signal transduction pathways to inhibit suppressor gene activity, activate transcription factors,
and enhance oncogene activity
o Such conditions include:
o Cell membranes not touching other cells
o Presence of growth factors binding to receptors
o Stimulation of ligands
• Signal Transduction
o Method of communication that allows events, conditions, and substances outside of the cell (interacting with
the cell’s membrane) to influence the cell’s decisions:
o To divide (or not to divide)
o To synthesize one or more proteins
o To become quiescent
m
o To undergo cellular “suicide”
er as
• When external conditions indicate cell division is not needed, the information is transmitted to the nucleus through
various signal transduction pathways to enhance suppressor gene activity and inhibit oncogene activity
co
eH w
o Cell membranes touching other cells
o.
o Presence of growth factor receptors unbound
rs e
o Ligands unstimulated
o Drugs bound to membranes disrupt promitotic signals
ou urc
• When internal cell conditions indicate cell division is not needed, the information is transmitted to the nucleus more
o
directly to enhance suppressor gene activity and inhibit oncogene activity

aC s

o Low cellular energy levels
vi y re
o Inadequate cellular nutrition

o Reduced transcription factors
o Increased suppressor gene presence or activity
ed d
ar stu
• Loss of or Reduced Suppressor

Gene Function
o When mutations or other problems reduce the functions of one or more of the many suppressor genes,
oncogene products are overexpressed, and cell division is not well controlled
is
 Potential outcomes:
 Inappropriate growth of normal tissues
Th
 Abnormal growth of scar tissue and benign tumors

 Cancer development
• Apoptosis
o The process of “programmed cell death” or “cellular suicide” used by normal cells to:
sh
o “Sculpt” normal structures during embryonic development

o Maintain functional tissues and organs
o Protect from cancer development or progression
• Apoptosis Facts
o Each differentiated cell capable of mitosis has a specific normal life span measured in time or in number of
mitotic cell divisions
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
o Once the cell has reached the normal end of this life span, it essentially “commits suicide,” resulting in its
own death
o This normal process allows replacement with new cells for assurance of continuing optimum organ or tissue
function
• Apoptosis Facts
o The timing and induction of apoptosis are genetically determined by numerous genes
o One factor in initiating apoptosis is the progressive loss of telomeric DNA and unraveling of chromosomes
o Problems in apoptosis can be caused by defective genes or by the presence of infectious microorganisms
• Apoptosis Facts
o Increased rates of apoptosis result in premature aging of the individual as cells die faster than they can be
replaced
o Slowed or halted apoptosis allows cells to be “immortal,” not responding to environmental conditions (a
feature of cancer cells)
o Characteristics of
Early Embryonic Cells
o Rapid, continuous cell division; re-enter cell cycle immediately after mitosis
o Anaplastic morphology (all small and round)
o Larger nuclear: cytoplasmic ratio
o No differentiated functions
m
o Loosely adherent (no CAMs present)
er as
o Able to migrate
co
o Euploid (only feature in common with mature differentiated normal cells)
eH w
• Cell Differentiation
o For a functional person to result from conception, early embryonic cells must undergo commitment to
o.
specific maturational pathways
rs e
o At day 8 after conception, early embryonic cells each commit to a differentiation pathway
o Pluripotency is lost
ou urc
o Cells begin to position themselves within the embryo in areas that will eventually become specific organs or
tissues
• Cell Differentiation
o
o Suppressor gene activity increases

aC s
o Oncogene activity becomes more regulated

vi y re
o Variable gene expression occurs in different cells to allow cellular differentiation

o No genes are lost in this process
o All cells retain all genes
o Selective expression and suppression determine final maturation fate for each cell
ed d
• Gametogenesis
o Very specific type of differentiation
ar stu
o Process of reducing the chromosome number from 2N to 1N in ova and mature sperm
o Necessary for fertilization to result in a 2N zygote
o Requires one round of DNA replication followed by two meiotic cell divisions
is
• Spermatogenesis
o Conversion of diploid precursor male sex cells (spermatogonia) into mature haploid sperm
Th
o Begins at puberty and continues until death

o Occurs in the seminiferous tubules
o Total process to mature sperm: 8 to 10 weeks
o One spermatogonium results in four mature sperm
sh
• Spermatogenesis Facts
o In meiosis I, the primary spermatocyte first undergoes a round of DNA replication
o Each pair of chromosomes is duplicated, 4N for chromosome number and DNA content (each pair has four
chromatids)
o Then a division occurs, but each whole pair with four chromatids segregates to the two secondary
spermatocytes instead of having the four chromosomes split at the centromere so that four different
chromatids segregate to the two new cells (which is what happens in mitosis)
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
• Spermatogenesis Facts
o After DNA replication and before the first meiotic division, synapsis occurs in prophase
o Synapsis involves the two chromosomes of the pair entering the two secondary spermatocytes to touch each
other all along the lengths of the four chromatids, allowing extensive crossing over of the material from the
maternal and paternal chromosomes
o This mixture of chromosome material increases potential diversity
• Oogenesis
o Conversion of diploid precursor female sex cells (oogonia) into mature haploid ova
o Begins in fetal life and continues until menopause
o Occurs in the ovaries
o Total process to mature ova: decades
o One oogonium results in one mature ovum capable of being fertilized
• Oogenesis Facts
o In meiosis I, the primary oocyte first undergoes a round of DNA replication
o Each pair of chromosomes is duplicated, 4N for chromosome number and DNA content (each pair has four
chromatids)
o Then a division occurs, but each whole pair with four chromatids segregates to the two secondary
spermatocytes instead of having the four chromosomes split at the centromere so that four different
chromatids segregate to the two new cells (which is what happens in mitosis)
• Oogenesis Facts
m
o After DNA replication and before the first meiotic division, synapsis occurs in prophase, but prophase is
er as
years long
o Synapsis involves the two chromosomes of the pair entering the two secondary spermatocytes to touch each
co
eH w
other all along the lengths of the four chromatids, allowing for very extensive crossing over of the material
from the maternal and paternal chromosomes
o This mixture of chromosome material increases potential diversity
o.
• Oogenesis Facts
rs e
o Oogenesis starts in fetal life
ou urc
o Prophase starts in fetal life and lasts until ovulation
o Secondary oocytes are trapped in prophase for years
o More crossing over occurs in oogenesis than in spermatogenesis
o Mature ova do not complete meiosis II until fertilization occurs
o
o One oogonium produces only one mature ovum

aC s
o A polar body cannot become an embryo

vi y re
ed d
ar stu
is
Th
sh
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 4: Patterns of Inheritance
Multiple Choice
____ 1. Which factor allows inheritance patterns for a specific trait or health problem to be traced from one
family generation to another?
A. Pleiotropy
B. Allele segregation
C. Regression to the mean
D. Gene–environment interaction
____ 2. If there are 10 possible alleles for the single-gene trait of nose shape, how many alleles can a person
with euploid chromosomes inherit from his or her biological parents?
A. 1
B. 2
C. 4
D. 5
____ 3. An infant with type B blood is born to parents who both have type O blood. What genetic action or
phenomenon is responsible for this unusual blood type expression?
A. Decreased penetrance of a dominant trait
B. Variable expressivity of a recessive trait
C. Inactivation of both parents’ X chromosomes
D. Failure of one parent’s blood-type gene alleles to segregate
____ 4. Is it possible for two parents with achondroplasia to have a child who is of normal stature?
A. Yes, because the disorder is autosomal dominant, and if both parents are
heterozygous, the child could inherit two normal stature gene alleles.
B. Yes, if the parent who is homozygous for the gene mutation demonstrates variable
expressivity of the health problem.
C. No, because the disorder is autosomal recessive, and the child can only inherit two
mutated gene alleles for the health problem.
D. No, because homozygosity for this health problem is lethal.
____ 5. What is the risk for a person to inherit an autosomal-dominant genetic disease–causing allele from a
parent who is heterozygous if the disorder has a penetrance factor of 75%?
A. 100%
B. 75%
C. 50%
D. 25%
____ 6. Which statement reflects the criterion for autosomal-dominant transmission of single-gene traits?
A. The risk for a person who is homozygous for the trait to transmit the trait to his or
her children is 100% with each pregnancy.
B. The trait often remains unexpressed within a kindred for many generations until a
Copyright © 2018 F. A. Davis Company
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
change in environment promotes its expression.

C. Males in a kindred are more likely to express the trait when the mother has the
trait, and females in a kindred are more likely to express the trait when the father
has the trait.
D. Females in a kindred are more likely to express the trait when the mother has the
trait, and males in a kindred are more likely to express the trait when the father has
the trait.
____ 7. In which situation are phenotype and genotype always the same?
A. X-linked-recessive traits
B. X-linked-dominant traits
C. Autosomal-recessive traits
D. Autosomal-dominant traits
____ 8. A girl of normal stature is born to two parents with achondroplasia who have very short stature,
especially disproportionately short arms and legs. What is the probability (by Punnett square
analysis) that any pregnancy this girl eventually has will result in the birth of an infant with
achondroplasia if her partner also has normal stature?
A. Three out of four (75%)
B. Two out of four (50%)
C. One out of four (25%)
D. Zero out of four (0%)
____ 9. Which statement or factor is a criterion for autosomal-recessive transmission of single-gene traits?
A. About 25% of the members of a large kindred with an autosomal-recessive trait
will express the trait.
B. There is no carrier status; if the allele for the trait is present, it is expressed,
although the degree of expression can be variable.
C. Individuals who are heterozygous for an autosomal-recessive trait have minimal
risk for transmitting the allele to their offspring.
D. The degree of expression of an autosomal-recessive trait or disorder in a
homozygous individual is directly related to the penetrance of the trait.
____ 10. Which person is an obligate carrier of an autosomal-recessive single-gene trait or disorder without
expressing the trait or disorder?
A. The son of a man with classic hemophilia
B. The daughter of a woman with Marfan syndrome
C. The son of a man who expresses a widow’s peak hairline
D. The daughter of a woman who expresses attached earlobes
____ 11. With which type of inheritance pattern does the trait or disorder usually first appear among siblings
rather than in parents of affected children?
A. Autosomal dominant
B. Autosomal recessive
C. X-linked dominant
D. Codominant
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 12. Which type of genetic transmission promotes the continued existence of genetic mutations in single
genes?
A. Autosomal dominant
B. Autosomal recessive
C. Codominant
D. Sex-linked
____ 13. On a five-generation pedigree, which feature distinguishes an X-linked-dominant disorder in which
males and females are equally affected from an autosomal-recessive pattern of inheritance?
A.The disorder is not apparent until adulthood.
B.Unaffected individuals do not have affected children.
C.There are no instances of an affected father transmitting the disorder to his son.
D.Unaffected parents (who do not express the disorder) do have affected children.
____ 14. A woman whose father does not have hemophilia gives birth to a son with classic hemophilia. This
woman is found to have only 15% of the normal amount of clotting factor VIII (the clotting factor
males with hemophilia are missing) and does have abnormal blood-clotting issues. Which
phenomenon or factor is most likely responsible for her abnormal clotting factor expression?
A. The X chromosome most commonly inactivated in her bone marrow is paternally
derived.
B. The X chromosome most commonly inactivated in her bone marrow is maternally
derived.
C. This woman is demonstrating reduced penetrance of an X-linked-recessive
disorder.
D. This woman is demonstrating full penetrance of an X-linked-recessive disorder.
____ 15. Which statement regarding inheritance of an autosomal-dominant gene allele with known variability
in expressivity is true?
A. A person with low expressivity of the trait has a higher probability of having a
child who does not express the trait at all.
B. A person with high expressivity of the trait has a greater risk of having a child who
expresses the trait to an even greater degree.
C. The degree of expressivity of a given autosomal-dominant trait with known
variability cannot be predicted by analyzing parental expression.
D. The degree of expressivity of a given autosomal-dominant trait with known
variability is greater when the transmitting parent is the same sex as the child.
____ 16. A man whose parents both have brown hair claims that his red beard was inherited from his maternal
uncle. Why is this claim incorrect?
A. The Y chromosome has no role in scalp, facial, or body hair color.
B. Genetic traits are transmitted in only a direct vertical direction.
C. Females cannot transmit facial hair color to their sons.
D. Hair color is a polygenic trait, not a single-gene trait.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 17. Mating of a yellow male parakeet with a blue female parakeet resulted in 18 offspring. Four (two
males; two females) had blue feathers, and 14 (eight females and six males) had yellow feathers.
What allelic combinations and mode of inheritance can you determine from the evidence of the
feather colors expressed?
A. Yellow allele dominant; blue allele recessive; autosomal
B. Yellow allele recessive; blue allele dominant; autosomal
C. Yellow allele dominant; blue allele recessive; sex-linked
D. Yellow allele recessive; blue allele dominant; sex-linked
____ 18. Mating of a female rabbit with a long tongue with a male rabbit that had a short tongue resulted in 12
offspring. Two had long tongues, two had short tongues, and eight had medium-length tongues.
Which allele combinations explains the tongue lengths of the offspring?
A. Short tongue dominant; long tongue recessive
B. Short tongue recessive; long tongue dominant
C. Short tongue dominant; long tongue dominant
D. Short tongue dominant; long tongue X-linked recessive
____ 19. Which trait or disorder has both an autosomal-dominant form and an autosomal-recessive form?
A. Widow’s peak
B. Diabetes mellitus type 2
C. Polycystic kidney disease
D. Taste sensitivity to phenylthiocarbamate (PTC)
____ 20. What is the most likely explanation for the expression of responses related to pleiotropy?
A. The same gene may have more than one chromosome locus.
B. The protein coded for by the single gene is an important component of more than
one tissue.
C. The silencing of a gene allele inherited from one parent is expressed differently
depending on which parent contributed the silenced allele.
D. The same disorder may have an autosomal-dominant inheritance pattern, an
autosomal-recessive inheritance pattern, and an X-linked-recessive inheritance
pattern.
____ 21. Which statement is a criterion for an autosomal-dominant pattern of inheritance of a specific trait or
characteristic that is highly penetrant?
A. Carriers for the trait may express it but do not necessarily express the trait.
B. Unaffected family members do not transmit the trait to their children.
C. Genotypes of individuals expressing the trait must be homozygous.
D. The trait appears only among male offspring of female carriers.
____ 22. Which statement or condition best reflects multifactorial inheritance?
A. A mutation in a single gene results in the expression of problems in a variety of
tissues and organs.
B. The susceptibility to a problem is an inherited trait, but development of the
problem is related to environmental conditions.
C. A mutated gene is inherited, but the results of expression of that gene are not
evident until middle or late adulthood.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Several genes are responsible for the mechanism of hearing, and a mutation in any
one of them results in hearing impairment.
____ 23. What is the expected outcome of any pregnancy or child produced by two parents who are each
heterozygous for the Huntington disease allele?
A. The couple cannot produce children who are unaffected.
B. Homozygous offspring will express the disease in childhood instead of as an adult.
C. A child who is homozygous for the mutated alleles is not likely to transmit the
disorder to his or her children.
D. Because of the possibility of incomplete or low penetrance, an unaffected offspring
could have an affected child.
____ 24. A baby boy is born with six toes (polydactyly) on his right foot, a trait that neither parent has but one
that the paternal grandfather has. What is the best explanation for this occurrence?
A. The baby’s grandfather is really his father.
B. The baby inherited a recessive allele for this trait from each parent.
C. The father’s phenotype results from incomplete penetrance of a dominant allele.
D. The baby’s phenotype demonstrates a higher level of expressivity than his father’s
phenotype.
____ 25. What can be inferred about a genetic disorder that, when it occurs in monozygotic twins, affects one
twin 80% of the time and affects both twins only 20% of the time?
A. Expression of homologous genes is influenced by the gender of the parent who
contributed them.
B. Nongenetic factors can influence the expression of identical alleles.
C. The mutation occurred in a somatic cell rather than a germ cell.
D. Mutation repair is incompletely penetrant.
____ 26. A woman (Adele) has three daughters (Barbara, Brenda, Beverly) with a man (Adam) who is color-
blind. Barbara has a daughter (Carol) and a son (Cliff) who have normal color vision. Brenda has no
children. Beverly has two sons (Carl, Charlie) who are both color-blind. To which genetic generation
do Carl and Charlie belong?
A. P1
B. P2
C. F1
D. F2
____ 27. What is the expected expression of a monogenic trait that has its locus on the Y chromosome?
A. Females never inherit the trait.
B. Females inheriting the trait will be carriers.
C. Males inherit the trait in a dominant pattern of expression; females inherit the trait
in a recessive pattern of expression.
D. Females inherit the trait in a dominant pattern of expression; males inherit the trait
in a recessive pattern of expression.
____ 28. Which genetic disorder has both an autosomal-dominant and an autosomal-recessive form?
A. Syndactyly
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
B. Phenylketonuria
C. Long QT syndrome
D. Retinitis pigmentosa
____ 29. Which situation most closely represents an example of “regression to the mean”?
A. Two hearing-impaired parents produce a child who has normal hearing.
B. A 40-year-old man whose father developed type 2 diabetes mellitus at age 50 is
diagnosed with the disorder.
C. The three children of a mother who has an intelligence quotient (IQ) of 170 all
have IQs in the 110 to 120 range.
D. A child whose biologic parents are thin is adopted by a family whose members are
obese and eventually becomes overweight.
____ 30. Why are dizygotic twins less likely to show concordance for a monogenic trait than monozygotic
twins?
A. Dizygotic twins share fewer allele sequences in common than monozygotic twins.
B. It is possible for dizygotic twins to have different fathers, and monozygotic twins
always have the same father.
C. Gene expression in monozygotic twins is less influenced by environmental factors
than that of dizygotic twins.
D. Because of their identical appearance, monozygotic twins are more likely to be
raised together and share a common environment than are dizygotic twins.
____ 31. When calculating the recurrence risk for a complex, possibly polygenic disorder with a couple who
already have one child with the disorder, which additional factor has the greatest impact on
increasing this risk?
A. The child with the disorder is male, and the overall incidence of the disorder is
twice as high in males than females.
B. Both the mother and the father are heavily exposed to a variety of chemicals in
their workplaces.
C. The father has a nephew with a mild form of the same disorder.
D. The mother has a brother who also has the same disorder.
____ 32. Which common health problem has the highest heritability estimate?
A. Hypertension
B. Peptic ulcer disease
C. Congenital heart disease
D. Schizophrenic behavior
____ 33. Which statement about the X chromosome is true?

A. Most of the X chromosome genes encode proteins that have no role in female
sexual development.
B. Heterozygous females are more severely affected by X-linked-dominant disorders
than heterozygous males.
C. When dominant alleles are present on the X chromosome, they are expressed in a
recessive manner in the hemizygous state.
D. When males have the unusual condition of two Y chromosomes and are missing
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
the X chromosome, all physiologic function remains normal.

____ 34. If a man with classic hemophilia (X-linked recessive) has children with a woman who is a carrier for
the disorder, what is the expected risk pattern?
A. All sons will be unaffected; all daughters will be carriers.
B. All sons will be carriers; all daughters will be affected.
C. All sons have a 50% risk of the disorder; daughters will all either be affected or
carriers.
D. All sons will be carriers; daughters have a 50% chance of being a carrier and a
50% chance of being unaffected.
____ 35. What is the significance of a shift to the left in the threshold value of liability in a threshold of
liability model for the expression of a complex health problem with genetic influences?
A. The threshold required for disease expression increases as the population ages.
B. The number of affected individuals within the population has decreased.
C. The population examined for the potential problem is getting larger.
D. The threshold required for disease expression is lower.
____ 36. Which situation is an example of modifier gene action?
A. A mother and father both have type O blood, and their son is born with type B
blood.
B. Two children in the same family both have sickle cell disease, but one child has
more severe symptoms than the other.
C. Monozygotic twins separated at birth and raised in two different countries are of
different heights (3 inches) and different weights (25 pounds).
D. A woman who has a gene mutation for diabetes mellitus type 2 delays the onset of
the disease by exercising and maintaining a normal weight.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 4: Patterns of Inheritance

Answer Section
MULTIPLE CHOICE
1. ANS: B
Monogenic traits can be inherited from remote ancestors as well as more directly from our parents.
Expression of monogenic traits is determined by the input of the two alleles (one from each parent)
of a single gene. Because alleles segregate, meaning that normally only one allele of a pair is
transmitted from each parent to any child, a single gene remains distinct and does not combine with
alleles from other genes, inheritance patterns from one family generation to another can be traced.
PTS: 1
2. ANS: B
A single-gene trait is one in which the expression is determined by the input of two alleles for the
gene. One allele for the single-gene trait is inherited randomly from father’s two alleles and one is
inherited randomly from the mother’s two alleles for that same single-gene trait. A person with the
normal number of chromosomes only inherits two alleles (one from each parent) regardless of how
many possible alleles are present in the human population for this single-gene trait.
PTS: 1
3. ANS: A
Penetrance is how often a gene is expressed within a population when it is present. Some AD genes
have greater penetrance than others, but it is never completely 100%. Some dominant gene alleles
have “reduced” penetrance. In this case (with parentage proven by other means), one parent had to
have a genotype of B/O for blood type. With reduced penetrance of the B allele, he or she did not
express it in his or her phenotype. However, the gene is normal and can be transmitted to the infant
who did express it in the blood type phenotype.
PTS: 1
4. ANS: A
Achondroplasia is an autosomal-dominant trait that is lethal when the genotype is homozygous.
Thus, both parents must be heterozygous A/n (with an A allele for achondroplasia and an n allele for
normal stature). Normal stature (n allele) is recessive. Thus, for a child to have a normal-stature
phenotype from these two parents, her or her genotype would have to be n/n. As shown by the
Punnett square, the chances for this couple to have a child with normal stature is 25% with each
pregnancy.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
5. ANS: C
The risk for inheriting an autosomal-dominant allele from a parent who has the allele is always 50%.
The inheritance risk is not changed by penetrance, but expression can be.
PTS: 1
6. ANS: A
With homozygosity of the autosomal-dominant trait, the parent only has a dominant allele to
transmit. Therefore, any child this person produces will have received the trait allele and is likely to
express it. Dominant traits are usually expressed and do not remain unexpressed from one generation
to another. For autosomal-dominant transmission, the genders of the parent and of the child are
unimportant. Both males and females transmit the allele equally to sons and daughters.
PTS: 1
7. ANS: C
Autosomal-recessive traits are only expressed in the homozygous state in which the genotype
matches the phenotype. Autosomal-dominant traits can be expressed in either the homozygous or the
heterozygous state. Thus, with autosomal-dominant expression, phenotype and genotype do not have
to match. In X-linked-recessive traits, males express the trait in a dominant manner. In X-linked-
dominant traits, females express the trait in either the homozygous or heterozygous state.
PTS: 1
8. ANS: D
Achondroplasia is an autosomal-dominant trait that is lethal when the genotype is homozygous.
Thus, both parents must be heterozygous A/n (with an A allele for achondroplasia and an n allele for
normal stature). Normal stature (n allele) is recessive. Thus, for the child to have a normal-stature
phenotype from these two parents, her genotype is n/n. Because she does not have an A allele as her
genotype, she can only transmit an n allele. The Punnett square would show:
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
9. ANS: A
Because autosomal-recessive traits or disorders are only expressed in the homozygous state,
expression of the trait or disorder within a large kindred remains at a relatively constant level of no
greater than about 25%. The heterozygous individual is a carrier who has a 50% chance with each
pregnancy of transmitting the allele to his or her offspring. There is no evidence to support the
presence of the concept of “penetrance” in autosomal-recessive traits and disorders. This issue
appears to be associated only with dominant traits and disorders.
PTS: 1
10. ANS: D
Attached earlobes (versus free-swinging earlobes) is an autosomal-recessive trait. A person who
expresses this trait is homozygous for the allele and transmits the allele to all his or her children
regardless of the type of earlobes any of them express. This makes them obligate carriers of the
allele for earlobe attachment. The hemophilia gene mutation is on the X chromosome, which a father
cannot transmit to his son. Marfan syndrome and widow’s peak are autosomal-dominant traits for
which there is no carrier status. If the allele is present, it is expressed.
PTS: 1
11. ANS: B
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Autosomal-recessive traits and disorders must be homozygous to be expressed. Two carrier parents
may be phenotypically normal although they have a heterozygous genotype because the recessive
allele is not expressed in either of them. However, each can transmit the recessive allele. Any child
who inherits both recessive alleles would then express the trait or disorder. The chances for
expression of the trait/disorder from parents who are heterozygous is 25% with each pregnancy.
PTS: 1
12. ANS: B
Recessive traits and disorders require two alleles (homozygosity) for expression. A person who has
only one allele does not express the trait or disorder. Thus, the trait can “hide” for many generations
but still be present in a population, although people may not be aware of its existence. When it is
finally expressed because a heterozygous carrier of the trait or disorder has children with another
heterozygous carrier of the same trait or disorder, it might be considered a “random” event,
especially if the couple does not have another affected child. Dominant traits are more frequently
expressed because one affected allele results in expression, and they are more obvious. Therefore, if
the trait or disorder is expressed in early childhood in more than one family member, people consider
the possibility that it is inherited. If the trait or disorder also is considered “undesirable,” the affected
individual may not be chosen as a mate for the purposes of having children. So, the key to the
continued existence of recessive traits/disorders is the fact that problems are not obviously expressed
in the heterozygous individual.
PTS: 1
13. ANS: C
With X-linked-dominant transmission of a trait or disorder, an affected father transmits the disorder
to all of his daughters (who then express the disorder) and to none of his sons. An affected woman
generally has unaffected daughters, affected daughters, unaffected sons, and affected sons in equal
proportions. The most notable feature that distinguishes this transmission from that of autosomal
recessive is the complete lack of father-to-son transmission because a father cannot transmit an X
chromosome to his son (if he did, his son would be his daughter).
PTS: 1
14. ANS: A
It is most likely the woman’s mother (grandmother of the infant with hemophilia) who is the carrier
of this X-linked abnormal gene. For autosomes, the expected percentages of maternal and paternal
chromosomes inherited in any cell, organ, or tissue is 50% for each. However, because women
inactivate one X chromosome randomly in all cells, which becomes “fixed” early in embryonic
development, genes from the X chromosome can be unequally expressed when percentages are
different for maternally derived and paternally derived X chromosomes. This woman has only 15%
expression of the genes that are from paternally derived X chromosomes in the tissues that make
clotting factor VIII and 85% expression of the genes that are from the maternally derived X
chromosome (with the abnormal and nonfunctional gene).
PTS: 1
15. ANS: C
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
When an autosomal-dominant gene with variable expressivity is inherited, the gene is always
expressed, but some people have more severe problems than do other people. For example, the gene
mutation for one form of neurofibromatosis (NF1) is dominant. Some people with this gene mutation
express it as only a few areas of light-brown skin tone known as café au lait spots. Other people,
even within the same family, who have the same gene mutation develop hundreds of tumors
(neurofibromas) that protrude through the skin. A person with low expression of this problem can
transmit the gene to his or her child, who then may have high expression of the problem. The reverse
also is true. A person with high expression can transmit the gene to his or her child, who then may
have low expression of the problem. Thus, the degree of expressivity of the trait in the transmitting
parent does not predict the degree of trait expressivity in the inheriting child.
PTS: 1
16. ANS: B
Choices A, C, and D have no bearing on the correct response. Regardless of whether A, C, or D are
true statements or not (hair color actually is an autosomal single-gene trait), a person can only inherit
traits from his or her father and mother, not from parents’ siblings. Both a person and his uncle may
have inherited the same trait from a more remote common vertical ancestor (grandparent, great-
grandparent) but not from horizontal ancestors (siblings, aunts, uncles, cousins).
PTS: 1
17. ANS: A
The fact that males and females are nearly equally represented within the two colors of the offspring
indicates that feather color is not sex-linked (thus choices C and D are not correct) but is autosomal.
If the blue allele were dominant and the yellow allele were recessive, there would be approximately
three times more blue offspring (of both sexes) than yellow offspring (of both sexes). Because the
yellow color is expressed in nearly a 3-to-1 ratio in the offspring, the colors follow Mendel’s rules
for yellow being a dominant allele (expressed in either the homozygous state [y/y] or the
heterozygous state [y/b]) and blue being a recessive allele (expressed only in the homozygous state
[b/b]). Ask the students how you can determine that these two feather colors are not codominant.
Answer: the offspring would all either be green (blue and yellow make green) or a combination of
blue and yellow feathered.
PTS: 1
18. ANS: C
The pattern demonstrates codominant inheritance in which both alleles are expressed equally. The
phenotype accurately expresses the genotype. Short tongues must have two short gene alleles
(homozygous), medium-length tongues must have one short-tongue gene allele and one long-tongue
gene allele (heterozygous), and long tongues must have two long-tongue gene alleles (homozygous).
PTS: 1
19. ANS: C
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Widow’s peak and taste sensitivity to PTC are inherited only in an autosomal-dominant pattern and
are expressed in the homozygous and heterozygous condition. Diabetes type 2 is a complex disorder.
Polycystic kidney disease has both an autosomal-dominant form and an autosomal-recessive form
(more severe).
PTS: 1
20. ANS: B
Pleiotropy occurs with some single genes that have effects in more than one tissue or organ. Usually,
the pleiotropic gene codes for a substance or a structure that is found in more than one tissue or
organ. Thus, a problem with that gene will result in changes that are expressed in more than one
organ or body area.
PTS: 1
21. ANS: B
A highly penetrant autosomal-dominant gene is expressed close to 100% of the time and can be
expressed in the homozygous or heterozygous genotype. Thus, only family members who do not
express the trait or characteristic do not have the allele and cannot transmit it to their offspring. An
autosomal-dominant gene is expressed equally among males and females.
PTS: 1
22. ANS: B
Multifactorial disease results from the actions of several genes working together (polygenic) or the
combined influences of genes (sometimes even single genes) and environment. Often, multifactorial
traits and disorders are not dominant or recessive. Each gene variant adds to or takes away from the
actual expression of the trait (phenotype). Sometimes the contributions of a particular gene variant
are large, and sometimes they are small. The expression of the gene or genes is strongly affected by
the environment.
PTS: 1
23. ANS: C
Huntington disease is an autosomal-dominant disorder with very high penetrance. A heterozygous
person always develops the disorder, but the age of onset and the rate of disease progression can
vary. This disorder does not show homozygous genotypes because homozygosity appears lethal,
with loss at the embryonic or fetal pregnancy stages or within the first 12 months after birth. Thus,
even if a child is born who is homozygous for the Huntington disease mutation, he or she will not
live long enough to transmit the allele.
PTS: 1
24. ANS: C
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Polydactyly is an autosomal-dominant single-gene trait. Thus, this baby boy did not inherit a
recessive allele from each parent to express the trait. It is possible that the baby’s grandfather could
be his father, but this is not the best explanation. In expressivity, the trait is always expressed, but the
degree to which it is expressed can vary. This means that the baby’s father might have more than one
extra digit, but if expressivity were the actual problem, the father would definitely also have an extra
digit. With variation in penetrance, the gene is present but not always expressed. For polydactyly, the
penetrance is about 80%. So, the father most likely does have the allele, but it is not expressed in
him. However, because the allele is present, he can transmit it (with a probability of 50% for each
pregnancy) to his children.
PTS: 1
25. ANS: B
When twins are monozygotic (identical), they share identical genomes at all loci. If one twin has a
disease that is completely due to genetic variants, then the likelihood of the other twin having the
same disease is 100%. If environment or nongenetic factors play a role, the likelihood of the second
twin having the disease goes down, especially if the role of the environmental influence on the
disorder is much stronger than the genetic influence.
PTS: 1
26. ANS: D
The P1 generation indicates the initial parental generation of a family or group being observed for a
specific trait or traits. So, Adele and Adam are the P1 generation. The F generations are the
succeeding generations of offspring or progeny produced from the parental generation. Each
succeeding generation is designated by a numeric subscript. The F1 is the first-generation offspring
or progeny after the parental generation (Barbara, Brenda, and Beverly). The F2 indicates the second-
generation offspring or progeny (Carol, Cliff, Carl, and Charlie). The description of this family does
not include the F3 or third generation.
PTS: 1
27. ANS: A
True females have a pair of X chromosomes that determine their genetic sexual identity and do not
have a Y chromosome. Therefore, females cannot inherit traits or disorders that are coded only for
genes on the Y chromosome.
PTS: 1
28. ANS: D
Retinitis pigmentosa exists as genetic disorders that can be inherited in an autosomal-dominant, an
autosomal-recessive, or even an X-linked-recessive mode of transmission. Syndactyly and long QT
syndrome are inherited only in an autosomal-dominant transmission pattern. Phenylketonuria is
inherited only in an autosomal-recessive transmission pattern.
PTS: 1
29. ANS: C
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Extremes of a condition or trait tend to become more average over time in successive generations.
An IQ of 170 is very high. The average IQ is considered to be between 100 and 110.
PTS: 1
30. ANS: A
Dizygotic twins have no more common allele sequences than do any other pair of siblings, whereas
monozygotic twins initially have all allele sequences in common, although some changes do occur
over time. There is no overall difference in the influence of the environment over gene expression
between the two twin types. Although it is possible for dizygotic twins to have different fathers, this
is a very rare event and is not the main factor in the decreased concordance for expression of a
monogenic trait.
PTS: 1
31. ANS: D
Having a close relative (in this case a first-degree relative) who also expresses the disorder increases
the likelihood that the disorder is more the result of genetic influences than environmental influences
and that more risk alleles are present.
PTS: 1
32. ANS: D
The heritability estimates for these health problems are hypertension, 62%; peptic ulcer disease,
37%; congenital heart disease, 35%; schizophrenic behavior, 85%.
PTS: 1
33. ANS: A
The X chromosome is large and has about 1,500 single-gene alleles, most of which are not present
on the Y chromosome or on any autosome. A few of these genes are specific for female sexual
development, but there are also hundreds of gene alleles on the X chromosome that code for
nonsexual functions for both males and females. Recessive alleles on the X chromosome are
expressed as dominant in normal hemizygous males. The YY genotype with no X chromosome is
not compatible with life. Heterozygous females are less severely affected by X-linked-dominant
disorders than are males.
PTS: 1
34. ANS: C
Because the disorder is X-linked recessive, sons cannot inherit the gene or the disorder from their
fathers (their fathers gave them a Y chromosome). Sons can inherit the gene from their carrier
mothers, making their risk for having the disorder 50%. All daughters will at least be carriers
because they must inherit the gene from their fathers. If the daughters also inherit the gene for the
disorder from their mothers, they will be affected. There is no “carrier status” for sons. They are
either affected or do not have the gene.
PTS: 1
35. ANS: D
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A model of the liability threshold for a complex trait indicates how high the risk is in the general
population and at what point risk is high enough so that having the disease or trait is likely. The top
of the bell curve represents the mean of the population, or the liability (risk) of most of the
population. The dotted line represents the average number of risk alleles carried by most of the
population. For every trait there is a theoretical threshold, which indicates the point at which the
number of risk alleles needed to express the disorder has just been met. All points to the right of the
threshold line are designated as “affected.” As the line shifts to the left, more people within the study
population meet the minimum threshold for expression of the complex problem.
PTS: 1
36. ANS: B
A gene’s degree of expression (disease severity) and timing of expression can be affected by
modifier genes and other conditions. Although the gene abnormality that causes sickle cell disease is
exactly the same for everyone with the disorder, how severely it is expressed can be changed by
modifier genes (which are not always known).
PTS: 1
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 5: Epigenetic Influences on Gene Expression
Multiple Choice
____ 1. Which term or phrase is used to describe the ability of the environment to cause different phenotypes
to develop from the same genotype?
A. Developmental plasticity
B. Histone modification
C. Phenotype variability
D. Nutrigenomics
____ 2. How is alcohol consumption thought to increase methylation in cancer suppressor genes to increase
the risk for head and neck cancer?
A. Preventing DNA repair
m
B. Enhancing cell division
er as
C. Acting as a methyl donor
co
D. Activating select oncogenes
eH w
____ 3. What would be the expected outcome for a person who has a normal gene allele and an abnormal
o.
rs e
gene allele for insulin and the area around the abnormal gene allele is heavily methylated?
ou urc
A. Normal insulin is produced in normal amounts.
B. Normal insulin is produced in lower-than-normal amounts.
C. Abnormal insulin is produced in normal amounts.
o
D. Abnormal insulin is produced in higher-than-normal amounts.

aC s
____ 4. Which statement regarding the influence of epigenetic changes on gene expression is always true?
vi y re
A. The change must be inherited from the parent of the same gender as the child for
expression to be affected.
B. Although gene expression is changed by inheriting these changes, the gene’s DNA
ed d
sequence remains unaffected.

ar stu
C. Epigenetic changes must first occur in the parental somatic cells in order to be
inherited.
D. These changes occur throughout the genome rather than in the area of any single
specific gene.
is
____ 5. What part of a chromosome’s DNA is altered by histone modification?

Th
A. Complementary base pairing

B. Attachment of phosphate groups
C. Development of telomeric “caps”
sh
D. The degree of tension in helical tightness
____ 6. What would be the expected result when the area around an oncogene is hypomethylated?
A. Cell division increases; cancer risk increases.
B. Cell division increases; cancer risk decreases.
C. Cell division decreases; cancer risk decreases.

https://www.coursehero.com/file/43071182/Ch05rtf/
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Cell division decreases; cancer risk increases.
____ 7. By which mechanism does microRNA “silence” gene expression?

A. Preventing cytoplasm from coming into contact with the gene
B. Surrounding mRNA and preventing attachment of ribosomes
C. Binding to mRNA and keeping it double stranded
D. Substituting a thymine for uracil
____ 8. Which statement about the microbiome is true?

A. The microbiome does not undergo further changes after development is complete.
B. With aging, its influence on health is reduced.
C. The microbiome is necessary for good health.
D. Identical twins have identical microbiomes.
____ 9. How is eating a diet high in broccoli thought to reduce cancer risk?
A. Increasing the excretion rate of foods known to be methyl donors
m
B. Increasing histone acetylation, turning on anticancer genes
er as
C. Decreasing the rate of microDNA synthesis and activity
co
D. Decreasing the exposure of carcinogens to nuclear DNA
eH w
____ 10. How does histone modification alter gene expression?
o.
A. Modified histones result in increased DNA methylation, which increases the
rs e
transcription of genes in that area.
ou urc
B. In areas where histones are modified, the DNA is more tightly wound, and genes
are not transcribed.
C. Histone modification results in an increase in microRNA production, which
o
inhibits gene expression by preventing translation.

aC s
D. Histone modification results in an increase in microRNA production, which

vi y re
promotes gene expression by enhancing translation.

____ 11. In fragile X syndrome, only noncoding regions within the gene for a protein that directs and
maintains brain development are heavily methylated, resulting in decreased cognitive ability and
ed d
behavioral problems. What is the most likely mechanism of this abnormal expression?
ar stu
A. Increased microRNA molecules reducing the synthesis of the gene product

B. Failure of the methylated regions to undergo translation
C. Suppression of the “splicing out” action for introns
is
D. Suppression of promoter function

Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 5: Epigenetic Influences on Gene Expression

Answer Section
MULTIPLE CHOICE
1. ANS: A
Developmental plasticity is the ability of the environment to cause different phenotypes to develop
from the same genotype. Histone modification is the changes of proteins around the double helix.
Phenotype variability is associated with changes in gene sequences compared with “wild-type”
genes. Nutrigenomics is the study of the interaction between nutrition and the genome.
PTS: 1
2. ANS: C
Alcohol for consumption, ethyl alcohol, does have unstable methyl groups that can be donated to
DNA. When these groups bind with cancer suppressor genes, their production of growth-controlling
m
er as
proteins is prevented, allowing oncogene products to be unregulated.
co
eH w
PTS: 1
3. ANS: B
o.
rs e
Methylation of the abnormal gene is likely to suppress its transcription, effectively blocking its
ou urc
production of abnormal insulin. This would allow the normal insulin allele to be expressed
exclusively, which would result in the production of normal insulin. However, with only one allele
active, the person would produce lower amounts of insulin.
o
aC s
PTS: 1
vi y re
4. ANS: B
Epigenetic events affect gene expression but do not change DNA sequences. These influences are
not related to the gender of the parent transmitting them. Most likely, changes occurring in the
gametes (ova and sperm) or in all body cells are the events that can be transmitted to the next
ed d
generation. Thus, the changes can occur throughout the genome or in areas of single genes.
ar stu
PTS: 1
5. ANS: D
is
Histones are the proteins that DNA uses to wind around and condense to form chromosomes. In
some modifications, the chromatin material keeps the DNA strands wound together so tightly, the
Th
strands cannot separate for transcription to occur. Genes in these tightly wound areas are effectively
silenced and not expressed.
sh
PTS: 1
6. ANS: A
Oncogenes produce proteins that increase cell division. If oncogenes are hypomethylated, they may
not respond to suppressor gene products and be overexpressed. This action leads to excessive cell
division and increases the risk for cancer development.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
7. ANS: C
Short pieces of microRNA can bind with complementary areas of mRNA, making it double stranded.
Then areas of the gene do not get “read” during translation because the ribosomes can only bind to
single-stranded RNA. This results in no functional protein being synthesized.
PTS: 1
8. ANS: C
A person’s microbiome is protective in nature and is important for good health, such as helping with
food digestion, keeping some pathogenic organisms in check, and stimulating immune function. The
microbiome is constantly manipulated by the environment, and its influence on health does not
decrease (it may, in fact, increase). Identical twins share the same genome as well as the same
microbiome at birth. Most identical twins share the same environment both in utero and shortly after
birth, but as they grow older, their environments differ.
m
PTS: 1
er as
9. ANS: B
co
Broccoli contains sulforaphane. This substance increases histone acetylation that can turn on cancer
eH w
suppressor genes. Increased activity of these genes can prevent oncogene overexpression and reduce
o.
cancer risk.
rs e
ou urc
PTS: 1
10. ANS: B
Histone modification involves changes to the protein structures that allow organized winding of the
o
DNA double helix to form chromosomes. Chemical tags attach to the “tails” of the histones and can
aC s
alter how tightly the DNA is packaged by adjusting the tension with which it winds. When the DNA
vi y re
is wound tightly around the histones, some sequences of DNA may not be available for transcription,
so no protein will be made from that sequence. As a result, the gene is not expressed.
ed d
PTS: 1
11. ANS: D
ar stu
Noncoding regions of some genes contain promoters that signal appropriate transcription. When
promoters are silenced by methylation, the protein is not produced even though the sequence of
gene-coding regions is normal. In this case, with less (if any) production of the protein that is
is
important for brain development and maintenance, brain development is abnormal.

Th
PTS: 1
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 6: Family History and Pedigree Construction
Multiple Choice
____ 1. What is the primary purpose of a pedigree?

A. To identify family members’ places within a kindred and describe their medical
history
B. To establish which person within a kindred is responsible for introducing a genetic
mutation into the family
C. To determine the specific risk of any one family member to develop or pass on a
genetic-based health problem
D. To establish which person within a kindred is responsible for bringing the family
to the attention of a genetics professional
____ 2. Why is a pedigree considered an “unstable” product?
m
er as
A. The person collecting the information may not be a genetics professional.
B. Some family members may have lied about their reproductive history.
co
eH w
C. The memories of older family members may be inaccurate.
D. The health of living family members continues to evolve.
o.
____
rs e
3. Which issue is considered a “red flag” for the need for referral to a genetics professional?
ou urc
A. A family history of both breast and colon cancer
B. Myocardial infarction in several parents or grandparents older than 64 years of age
C. The presence of brothers and sisters who do not resemble any known family
o
member
aC s
D. The presence of neurodevelopmental disorders in one or more members of the

vi y re
kindred
____ 4. When constructing a pedigree around a specific health problem, what is the minimal number of
generations needed to accurately assess the presence or absence of a genetic factor in disease
ed d
development?
A. 1
ar stu
B. 2
C. 3
D. 4
is
____ 5. What does a double horizontal line between a circle symbol and a square symbol as the only line
Th
connecting directly connecting two individual’s lines signify on a pedigree?

A. The individuals are parent and child.
B. The individuals are related by blood.
C. The individuals are brother and sister.
sh
D. The individuals have mated without being married.

____ 6. Martha has Alzheimer’s disease. She and her daughter Melanie provided care for Martha’s mother
Margaret when she had severe Alzheimer’s disease. Now Melanie, age 57, is showing signs of
impaired memory. Melanie’s daughter Megan is pregnant with her first child and has contacted a
genetic counselor to discuss Alzheimer’s risk in her family. Who in this family is the proband?
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A. Margaret
B. Martha
C. Melanie
D. Megan
____ 7. Which activity would a general registered nurse be expected to perform as part of genomic care?
A. Calculating recurrence risk for parents who have just had a child with
nondisjunction Down syndrome.
B. Informing a patient that his test results are positive for a genetic disorder.
C. Obtaining an accurate family history and physical assessment data.
D. Requesting a consultation visit from a clinical geneticist.
____ 8. Which demographic information could have an important influence on susceptibility to disorders
that have a strong genetic component?
A. Ethnicity
B. Education
m
C. Profession
er as
D. Nutrition status
co
eH w
____ 9. What is the significance of a pedigree symbol consisting of a square with a diagonal slash mark
through it?
o.
A. Affected female
B. Affected male rs e
ou urc
C. Deceased female
D. Deceased male
o
____ 10. Why is a legend necessary when constructing a pedigree that includes a health history?
aC s
A. Gender-altering surgeries require either the drawing of both male and female
vi y re
symbols for the same person or the use of a diamond instead of a circle or square.
B. When a pedigree includes more than three generations, the relationships of
members in older (more remote) generations are less clear and must be explained.
C. The gender of individuals lost in the first trimester of pregnancy cannot be
ed d
established.
ar stu
D. Health problems do not have standard symbols.
____ 11. How are Punnett Squares and pedigrees different?

A. Pedigrees represent genotypes and Punnett Squares represent phenotypes.
is
B. Punnett Squares represent genotypes and pedigrees represent phenotypes.

C. Pedigrees can identify actual carriers of genetic mutations, whereas Punnett
Th
Squares only suggest carrier status.

D. Punnett Squares can identify actual carriers of genetic mutations, whereas
pedigrees only suggest carrier status.
sh
____ 12. What is the risk for disease expression among the offspring of a woman who has an autosomal
recessive disorder when her partner is a carrier for the same disorder?
B. All children have a 50% risk for being affected and a 50% risk for being a carrier.
C. Daughters have a 50% risk for being affected; all sons will either be affected or
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
carriers.
D. Each child of either gender has a 50% risk of being a carrier, a 25% risk of having
the disease, and a 25% risk of neither being a carrier nor having the disease.
____ 13. Which observations in a pedigree indicate a probable autosomal dominant (AD) trait transmission?
A. Affected males and females appear in every generation.
B. The pedigree shows only one affected individual.
C. The trait appears to “skip” generations.
D. Only males are affected.
____ 14. Marjory tells a nurse that she has three aunts with cancer. The two on her father’s side were
diagnosed with breast and ovarian cancers at ages 42 and 36. She also has one aunt on her mother’s
side who was diagnosed with breast cancer at age 70. Marjory asks if she should have genetic
testing. What should the nurse tell her?
A. “Your family history indicates a high risk and you should definitely have genetic
testing.”
m
B. “Because no men in your family are affected it is not inherited cancer, so you
er as
don’t need mammograms or any special screening practices.”
co
C. “Because your aunts were older when they got breast cancer it was probably
eH w
sporadic and you should just have regular mammograms like everyone else.”
D. “Your family history may indicate an increased risk for breast cancer, and a
o.
rs e
genetic counselor could help determine whether you could benefit from genetic
testing.”
ou urc
____ 15. A man with syndactyly, an autosomal dominant condition, has one child who also has syndactyly.
His unaffected wife states “Since the risk for having a child with this problem is 50% and our first
o
child has the problem, the next child will not be affected.” What is the best response to this
aC s
statement?
vi y re
A. “That is not quite true because the risk is 50% with each pregnancy, so all future
children you have would have a 50% risk.”
B. “That is not quite true because you could also have the mutation but not show the
problem if there is variable expressivity.”
ed d
C. “That is correct but if you have more than two children half of them will have
ar stu
syndactyly, and 50% will not have it.”

D. “That is correct and if you only have two children, the second one will not have
syndactyly.”
is
____ 16. Which pair of relatives represents a first-degree relationship?

Th
A. Grandfather and grandson

B. Aunt and nephew
C. Sister and brother
D. Cousins
sh
____ 17. How are twins indicated on a pedigree?

A. The two gender symbols are placed on top of each other.
B. Each of the gender symbols is surrounded by an inward-facing set of brackets.
C. The vertical lines to each twin begin at the same point on parents’ horizontal
mating line.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. The one born first has a vertical line connected to the parents’ horizontal mating
line; the twin born second has a vertical line extending down from the first twin’s
gender symbol.
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com

Answer Section
MULTIPLE CHOICE
1. ANS: A
A pedigree is a pictorial or graphic illustration of family members’ places within a family and their
medical history. It can be used as one tool to begin to identify health issues that may have a genetic
component. It is not used to determine “blame” for a genetic mutation. The person within a kindred
who is responsible for bringing the family to the attention of a genetics professional is a member of
the pedigree, but his or her identification is not the purpose of a pedigree.
PTS: 1
2. ANS: D
Completing a family history is an easy and affordable way to begin genetic screening; however,
family history is not a stable thing. On the day you take your patient’s family history, there may be
m
er as
no one with cardiac problems. The next day your patient’s 35-year-old brother or sister could have a
co
myocardial infarction, changing your patient’s genetic risk for cardiovascular disease from low to
eH w
high.
o.
PTS: 1
3. ANS: D rs e
ou urc
Neurodevelopmental disorders and extreme presentations of common conditions are worth
investigating by a genetics professional. Breast cancer, colon cancer, and myocardial infarction in
the family history may require a genetics referral but usually only when they appear early. As
o
discussed in Chapter 3, physical traits from remote parents can be passed down and expressed many
aC s
generations later, enabling some siblings to not resemble each other or their parents.
vi y re
PTS: 1
4. ANS: C
Unless a pedigree shows at least three generations, no supportable conclusions regarding
ed d
transmission patterns can be made.

ar stu
PTS: 1
5. ANS: B
A double line indicates consanguinity, or relationship by blood. It indicates a mating between two
is
related family members. Brother and sister are connected by sibship lines and parents and children
Th
are indicated by lines of descent. A single horizontal line between a circle and a square indicates a
mating but not marital status between the two.
PTS: 1
sh
6. ANS: D
The proband is the person within a family who brought the potential genetic issue to the attention of
a health-care professional or genetics professional. Megan, even though she does not have
Alzheimer’s but wishes to discuss whether the disorder has a genetic component because three
related parental individuals have expressed the problem, is the proband.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
7. ANS: C
Being able to organize a family history into a pedigree is an important skill for all health
professionals and an expectation for registered nurses with a bachelor’s degree in nursing (BSN).
The American Association of Colleges of Nursing have included in their document Essentials of
Baccalaureate Education for Professional Nursing Practice 2008 that all BSN graduates must be
able to “generate a pedigree from a three-generation family history using standardized symbols and
terminology.” It is important that the nurse not attempt to provide genetic counseling as this is
beyond his or her scope of practice; however, it is helpful to have a good sense of when referral
should be considered even though a general registered nurse does not directly perform referrals to
genetic professionals.
PTS: 1
8. ANS: A
Ethnicity is critical personal information to determine because some genetic diseases are more
common in people who are from certain ethnic groups. For example, Tay-Sachs disease and Gaucher
m
disease are at least 10 times more common among people of Ashkenazi Jewish heritage (regardless
er as
of what religion they practice) than among non-Jews. A person’s ethnicity does not change and
co
cannot be modified. Education, profession, and nutrition status have little, if any, influence on the
eH w
expression of a genetic disorder.
o.
PTS: 1
rs e
ou urc
9. ANS: D
Circles are used to represent women, and squares represent men. A diagonal slash through a gender
symbol indicates that the person is deceased.
o
PTS: 1
aC s
10. ANS: D
vi y re
The standardized symbols for pedigrees include gender, relationships, birth order, adoption (in or
out), and matings. There are no standard symbols for any specific type of genetic, sporadic, or
environmental-related health problem. The person developing the pedigree is obligated to provide a
ed d
legend so that anyone who reads the pedigree will know the family’s health history.
ar stu
PTS: 1
11. ANS: B
Punnett Squares are diagrams that are used to determine the risk of offspring being affected when the
is
mode of transmission and the parents’ carrier status are known. It is based on genotype. Pedigrees
show relationships and expressed traits or disorders, the phenotype. Neither pedigrees nor Punnett
Th
Squares by themselves can identify actual carrier status. Pedigrees can suggest carrier status but not
prove it. Punnett Squares require the genotypes for a specific trait be known for both parents to
demonstrate probabilities.
sh
PTS: 1
12. ANS: B
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
With an autosomal disorder, males and females are affected equally. The mother has two mutated
alleles and therefore will transmit a mutated allele to all offspring. The father has only one mutated
allele and has one normal allele. Each of his children has a 50% risk for inheriting his mutated allele
and a 50% risk for inheriting his normal allele. Because all of the children will have a mutated allele
from the mother, all children have a 50% risk for being affected and a 50% risk for being a carrier.
PTS: 1
13. ANS: A
Finding representation in each generation and both males and females are affected provides strong
evidence that the trait is being transmitted in an AD manner. When only males are affected, the trait
is more likely to be X-linked recessive with some women being carriers. Recessive traits tend to
appear on a pedigree as “skipped generations” because carriers typically do not have the phenotype.
A single affected person is more likely found with an autosomal recessive transmission, where two
unaffected carriers have mated. The trait may not appear anywhere else in the pedigree. Of course, a
new mutation of an AD trait could also cause only one person to be affected, but we are looking for
the most probable answer.
m
er as
PTS: 1
co
14. ANS: D
eH w
Marjory’s aunts on her father’s side were much younger than average and premenopausal when they
o.
were affected. This would raise concern that there might be genetic risk factors in the family. The
rs e
fact that they are on her father’s side makes no difference in genetics risk, and it is unclear whether
ou urc
or not Marjory should have genetic testing until she speaks with a genetics professional who can take
a thorough family history and accurately discuss her risk.
o
PTS: 1
15. ANS: A
aC s
Many parents believe that the probability of transmitting an autosomal dominant trait to their
vi y re
children is 50% for the total number of children, rather than for each pregnancy. Thus, the statement
the mother made is incorrect. Having the first child express an autosomal dominant health problem
does not mean there is no risk for the second child also expressing it. Also, only the risk or
ed d
probability is 50%. If they had three more children it is possible that all three could have the
ar stu
problem, that all three could not have the problem, or that some may have it and not the other(s).
PTS: 1
16. ANS: C
is
First-degree relatives are those that have a direct, single line blood relationship within a pedigree
(vertical or horizontal) with no other relative between them. Grandfather and grandson have a parent
Th
in between them. Aunt and nephew have a sibling/parent in between them. Cousins have two sibling
parents in between them.
sh
PTS: 1
17. ANS: C
The vertical lines connecting each twin to the parents begin at the same point on the parents’
horizontal mating line, making an upside-down “V” shape. When the twins are monozygotic, there is
a small horizontal line connecting the twins’ vertical lines.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 7: Sex Chromosome and Mitochondrial Inheritance and Disorders
Multiple Choice
____ 1. Which feature is common among people who have Klinefelter syndrome (47,XXY) or a karyotype
with 47,XXX but not among people who have Down syndrome or Edward syndrome?
A. Severely reduced cognition
B. Cleft palate
C. Tall stature
D. Infertility
____ 2. Which single physical feature is most often associated with a 47,XXX karyotype?
A. Infertility
B. Large breasts
m
C. Female-pattern baldness
er as
D. Height greater than siblings
co
eH w
____ 3. What is the risk for a man with a 47,XYY karyotype to produce a child with a 47,XYY karyotype?
A. 100%
o.
B. 50%
rs e
ou urc
C. 25%
D. 0%
____ 4. Why is the incidence of an extra Y chromosome in the general population unknown?
o
A. The phenotype is that of a normal male.

aC s
B. Most conceptions with 47,XYY are spontaneously aborted.

vi y re
C. The life expectancy for males with 47,XYY is often short.

D. The majority of males with this sex chromosome abnormality are institutionalized.
____ 5. A male patient is tall and has some gynecomastia along with a low sperm count. During infertility
ed d
testing, he was found to have a 47,XXY karyotype. Which disorder is consistent with these findings?
ar stu
A. Normal male
B. Turner syndrome
C. Klinefelter syndrome
is
D. Testicular feminization syndrome

Th
____ 6. Which health screening activity is most important for girls and women with Turner syndrome?
A. Mammography
B. Test for osteoarthritis
C. Blood pressure screening
sh
D. Pulmonary function testing
____ 7. What is the most likely mechanism for a 45,X karyotype?

A. Anticipation
B. Nondisjunction
C. Expansion

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Heteroplasmy
____ 8. Which of the following definitions accurately represents the concept of expansion?
A. The phenotype of a genetic condition is expressed with greater severity and at
earlier ages with succeeding generations.
B. The number of trinucleotide repeat sequences within the noncoding region of a
specific gene allele is increased.
C. The number of copies of a specific gene allele is amplified on one chromosome of
a homologous pair.
D. A specific gene allele has at least two copies of every exon within the gene.
____ 9. What is the function of the FMR1 gene?

A. Promoting brain development and maintaining neuronal synapses
B. Ensuring the expression of all other genes present on the X chromosome
C. Preventing amyloid plaque deposits and formation of neuronal tangles in the brain
D. Maintaining the structural integrity of the histone proteins surrounding the X
m
chromosome
er as
co
____ 10. At what specific location on an X chromosome is a break most likely to occur in fragile X
eH w
syndrome?
o.
A. The centromere
B. End of the p arm
rs e
ou urc
C. End of the q arm
D. Within the nucleosome
____ 11. Which of the following mechanisms in fragile X syndrome (FXS) leads to expression of the
o
disorder?
aC s
A. Trinucleotide repeat sequences interspersed with the exons of the FMR1 gene,
vi y re
resulting in the production of an abnormal protein

B. Trinucleotide repeat sequences causing methylation of the FMR1 gene, thus
silencing its expression
ed d
C. Increased production of microRNA molecules that interfere with the transcription

ar stu
of the FMR1 gene

D. Increased production of microRNA molecules that interfere with the translation of
the FMR1 gene
is
____ 12. Which condition or health problem is more common in women who have an FMR1 mutation?
Th
A. Emotional instability with inappropriate expression of anger

B. Patchy areas of decreased skin pigmentation
C. Progressive skeletal muscle weakness
D. Menopause before age 40 years
sh
____ 13. What would be the expected consequence to two daughter cells after mitosis if the ability to produce
mitochondria was lost?
A. Cell commitment and differentiation would fail to occur.
B. The process of protein synthesis could not be controlled.
C. The rate and amount of ATP production would be limited.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Future cell division would result in an uneven number of cells.
____ 14. Which clinical feature in a newborn baby girl suggests the possibility of Turner syndrome?
A. Absence of Babinski reflex
B. Presence of a webbed neck
C. Presence of epicanthal folds
D. Absence of irises of both eyes
____ 15. Which trait or characteristic in a 10-year-old-girl would lead her pediatrician to consider the
possibility of androgen insensitivity syndrome?
A. Her ears are large and stick out.
B. She is color-blind, and her father is not.
C. She is an inch taller than her siblings were at age 10.
D. Her nipples and breasts have not started to change and develop.
____ 16. Which type of problem results from mutations in mitochondrial DNA (mtDNA)?
m
A. Reduced cellular energy
er as
B. Balanced translocations
co
C. Excessive “crossing over”
eH w
D. Single-nucleotide polymorphisms
o.
____ 17. What factor most strongly influences the development of the paramesonephric tissue into female sex
organs? rs e
ou urc
A. Proper positioning of the bipotential gonad
B. The presence of estrogen during puberty
C. The presence of two X chromosomes
o
D. The absence of a Y chromosome

aC s
vi y re
____ 18. Which process can cause a person with an XY genotype to have a female phenotype?
A. Pregnancy resulting from artificial insemination in which the semen donor is
homosexual
B. Mating of a man who has Klinefelter syndrome with a woman who has Turner
ed d
syndrome
ar stu
C. An epigenetic disorder in which the X chromosome inactivates the Y chromosome

D. Failure of gene expression resulting in a complete absence of androgen receptors
is
____ 19. On which chromosome is the androgen receptor (AR) gene located?
A. 1
Th
B. 21
C. X
D. Y
sh
____ 20. A man and his sister are both affected with a mitochondrial disorder. Because the sister has two
children who also have the disorder, the man is concerned about the possibility of also having
children with the disorder. What is the estimated risk for each pregnancy of this man producing a
child with the same mitochondrial disorder that he has if his wife does not have a mitochondrial
disorder?

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A. 100%
B. 50%
C. 25%
D. 0%
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 7: Sex Chromosome and Mitochondrial Inheritance and Disorders

Answer Section
MULTIPLE CHOICE
1. ANS: C
In childhood, the only phenotypic manifestation of Klinefelter syndrome is that the boy usually has
long legs and is taller than siblings at the same ages. Often, his final height is taller than that of either
parent. The most outstanding and consistent feature is that 47,XXX women are taller than average
and are taller than most family members. Although 47,XXY males are infertile, women with
47,XXX are not. Neither is associated with severely reduced cognition or cleft palate. Both Down
syndrome and Edward syndrome result in shorter-than-average stature.
PTS: 1
2. ANS: D
m
er as
A karyotype of 47,XXX produces a physically normal phenotype, and the individual is fertile. The
co
most outstanding and consistent feature is that these women are taller than average and are taller
eH w
than most family members. Breast development is not affected by the extra X chromosome, and
o.
neither is hair loss.
rs e
ou urc
PTS: 1
3. ANS: B
Men with a 47,XYY karyotype are fertile. Because the extra Y chromosome is likely to be present in
o
approximately 50% of mature spermatozoa, the risk for a man with this karyotype to produce a child
aC s
who is also 47,XYY is also 50%.

vi y re
PTS: 1
4. ANS: A
There are no consistent and specific variations in the phenotype to indicate any type of chromosomal
ed d
aberration.
ar stu
PTS: 1
5. ANS: C
is
This patient has a phenotype and karyotype consistent with Klinefelter syndrome. This is not a
normal karyotype, but the patient is male. Turner syndrome karyotype is 45,X. The karyotype for
Th
testicular feminization (an old term) is 46,XY.
PTS: 1
sh
6. ANS: C
The incidence of osteoarthritis, lung problems, and breast cancer is not increased in this population.
Other health problems are common and can be significant for the person who has Turner syndrome,
especially long-term hypertension and hyperlipidemia, which may be present even in early
childhood.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
7. ANS: B
Inheriting only one chromosome of a pair is monosomy, which most likely occurs as a result of
nondisjunction during meiosis for gamete formation. (Recall that with nondisjunction of a
chromosome pair, the pair fails to separate during meiosis. Thus, there is no segregation; both
chromosomes of the pair move into one gamete, and the other gamete does not receive a
chromosome from this pair.) This results in an ovum with two X chromosomes and an ovum with no
X chromosome. If the ovum with no X is fertilized and results in a pregnancy, the product of the
pregnancy would have Turner syndrome with a karyotype of 45,X. Nondisjunction appears to occur
more often with the sex chromosome, particularly the X.
PTS: 1
8. ANS: B
Expansion is an increase, usually of trinucleotide repeat sequences within a gene. The definition of
response A is that of anticipation. The definition of response C is amplification.
m
Response D is just a mutation that would result in either an inappropriate protein or no protein
er as
produced.
co
eH w
PTS: 1
o.
9. ANS: A
rs e
The FMR1 gene, which is located on the X chromosome, codes for a protein that is critical in brain
ou urc
development and maintenance of neural synapses. If this protein is not produced in sufficient
amounts or is abnormal, reduced cognition occurs, especially in males. FMX1 stands for fragile X
mental retardation 1. Mutations are not responsible for the amyloid plaques and neuronal tangles that
o
develop in Alzheimer’s disease.

aC s
vi y re
PTS: 1
10. ANS: C
The term fragile X comes from the fact that when chromosomal analysis is performed under certain
ed d
laboratory conditions, the X chromosome often has a small break or gap at the end of the long arm.
ar stu
PTS: 1
11. ANS: B
In FXS, the FMR1 gene-coding regions are normal, but the gene’s expression is silenced by large
is
numbers of the trinucleotide sequence of CGG being repeated within the noncoding regions of the
Th
gene.
PTS: 1
12. ANS: D
sh
Women with FMR1 mutations or trinucleotide repeat sequences that categorizes them as premutation
carriers can develop fragile X–associated primary ovarian insufficiency syndrome (FXPOI), which is
an early onset of ovarian failure causing the onset of menopause in women who are premutation
carriers at ages under 40 years.
PTS: 1

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
13. ANS: C
Mitochondria are organelles within a cell’s cytoplasm that are responsible for most of the generation
of a high-energy chemical substance used to power cellular work. Thus, they are the “power plants”
of cellular energy production. Without mitochondria in the newly generated cell, ATP production
would be profoundly reduced.
PTS: 1
14. ANS: B
Girls with Turner syndrome are often identified at birth because of the presence of “classic”
phenotypic features. These include a smaller-than-expected size at full-term pregnancy, neck
webbing, pedal edema, and cardiac abnormalities. These children have a normal early neurologic
response, including Babinski reflex. Although epicanthal folds often occur in Turner syndrome, they
are not unique to this syndrome. Aniridia is associated with WGAR syndrome and is not found in
Turner syndrome.
m
PTS: 1
er as
15. ANS: B
co
The gene for color vision is on the X chromosome and is recessive. Thus, color-blindness is an X-
eH w
linked-recessive disorder resulting from a mutation in the gene. If a male inherits this gene from his
o.
mother, he will express color-blindness. If a girl inherits this gene from her mother, she will only
rs e
express color-blindness if her father is color-blind.
ou urc
PTS: 1
16. ANS: A
o
Mitochondria produce most of the adenosine triphosphate (ATP) to use as the energy source to drive
aC s
cellular actions. Mutations in mitochondrial DNA reduce the amount of ATP produced and affect the
vi y re
function of highly metabolic cells, tissues, and organs. Crossing over and translocations do not occur
in mtDNA. Although single-nucleotide polymorphisms can occur in mtDNA, they are not the
problem caused by mutated mtDNA.
ed d
PTS: 1
ar stu
17. ANS: D
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The early embryonic tissue capable of developing into male sex organs, including the penis, scrotum,
prostate, and the tubular system connecting the testis to the urinary system, is the mesonephric ductal
tissue (wolffian glands). The tissue capable of developing into female sex organs is the
paramesonephric ductal tissue (müllerian ducts). Both types of tissues are present in embryos that
are 46,XX and those that are 46,XY. Under the influence of testosterone and anti-müllerian factor,
which are normally secreted in the 46,XY embryo, mesonephric ductal tissue differentiates into
anatomic male sex structures, and the paramesonephric ductal tissue regresses and degenerates so
that anatomic female sex structures do not develop. Without the presence of Y-chromosome-
influenced testosterone and anti-müllerian factor, the mesonephric ducts regress and degenerate. The
lack of anti-müllerian factor together with the genetic influence of autosomal gene products causes
the development of the paramesonephric ductal tissues into complete anatomic female sex structures.
Although the absence of the Y chromosome is not the only reason that female structures develop, it
appears to be the strongest.
PTS: 1
m
er as
18. ANS: D
The situation resulting in a person with an XY genotype having a naturally occurring female
co
eH w
phenotype is complete androgen insensitivity or androgen insensitivity syndrome (AIS). In this
condition, all tissues, including the masculine tissues (mesonephric ductal tissues), are missing
o.
androgen receptors. The presence of the Y chromosome starts the organization of the bipotential
rs e
gonad into a testis with the secretion of testosterone; however, the testosterone has no developmental
ou urc
influence on the mesonephric ductal tissues because they lack the receptors for binding and allowing
the testosterone to change the gene activity of these cells. Thus, the mesonephric ducts regress, and
the paramesonephric ducts undergo partial growth. At birth, the child has very clear female external
o
genitalia, and this phenotype continues throughout life. The girl does go through her adolescent
aC s
growth spurt and starts to develop hip curves and breasts but does not begin menstruation. She
vi y re
cannot become pregnant but is female in every other sense. The position of the bipotential gonad
does not influence its function. Klinefelter men and Turner women are infertile. The X chromosome
does not inactivate the Y chromosome.
ed d
ar stu
PTS: 1
19. ANS: C
Even though men have more androgen receptors than do women, the AR gene is located on the X
is
chromosome, not the Y. Women do produce small amounts of androgens in the adrenal gland, which
need to bind to the AR receptors in order to produce their effects.
Th
PTS: 1
20. ANS: D
sh
All mitochondria at conception come from the egg because they are located in the egg’s cytoplasm.
The sperm has no cytoplasmic mitochondria. Therefore, most mitochondrial disorders can only be
inherited from a woman with the disorder and not from a man with the disorder.
PTS: 1

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Multiple Choice
____ 1. What is the primary purpose of a pedigree?

A. To identify family members’ places within a kindred and describe their medical
history.
B. To establish which person within a kindred is responsible for introducing a genetic
mutation into the family.
C. To determine the specific risk of any one family member to develop or pass on a
genetic-based health problem.
D. To establish which person within a kindred is responsible for bringing the family to
the attention of a genetics professional.
m
____ 2. Why is a pedigree considered an “unstable” product?
er as
A. The person collecting the information may not be a genetics professional.
co
B. Some family members may have lied about their reproductive history.
eH w
C. The memories of older family members may be inaccurate.
o.
D. The health of living family members continues to evolve.
rs e
ou urc
____ 3. What is the significance of a horizontal dashed line drawn between a male and a female?
A. The two siblings are both adopted.
B. The individuals have a casual sexual relationship and are not married.
o
C. The individuals have a third-degree (or later) blood relationship with each other.
D. Neither of the two individuals is a first- or second-degree relative of the proband.
aC s
vi y re
____ 4. What is the best way to ensure completeness and accuracy in constructing a pedigree?
A. Eliminating the contributed information from any family member who is
cognitively impaired.
ed d
B. Asking the oldest person in the kindred to provide the familial information.
ar stu
C. Having several family members work together to develop the pedigree.

D. Using a template for drawing the symbols.
____ 5. In the acronym “SCREEN” for formulating questions to ask that may indicate a heritable trait or
is
health problem, what does the second “E” signify?

A. The ethnicity of family members
Th
B. That the problem or trait is present in every generation of the family

C. That the onset of the problem is present only among elderly family members
D. That the trait or problem is equally represented by male and female family
sh
members
____ 6. Which issue is considered a “red flag” for the need for referral to a genetics professional?
A. A family history of both breast and colon cancer
B. Myocardial infarction in several parents or grandparents older than 64 years of age
C. The presence of brothers and sisters who do not resemble any known family

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
member
D. The presence of neurodevelopmental disorders in one or more members of the
kindred
____ 7. When constructing a pedigree around a specific health problem, what is the minimal number of
generations needed to accurately assess the presence or absence of a genetic factor in disease
development?
A. One
B. Two
C. Three
D. Four
____ 8. What does a double horizontal line between a circle symbol and a square symbol as the only line
directly connecting two individuals signify on a pedigree?
A. The individuals are parent and child.
B. The individuals are related by blood.
m
C. The individuals are brother and sister.
er as
D. The individuals have mated without being married.
co
eH w
____ 9. Lois has Alzheimer’s disease. She and her daughter Linda provided care for Lois’s mother Leona
o.
when she had severe Alzheimer’s disease. Now Linda, age 57, is showing signs of impaired memory.
rs e
Linda’s daughter Lucy is pregnant with her first child and has contacted a genetic counselor to
ou urc
discuss Alzheimer’s risk in her family. Who in this family is the proband?
A. Leona
B. Lois
o
C. Linda
aC s
D. Lucy
vi y re
nondisjunction Down syndrome
ed d
B. Informing a patient that his test results are positive for a genetic disorder
ar stu
C. Obtaining an accurate family history and physical assessment data

D. Requesting a consultation visit from a clinical geneticist
____ 11. Which demographic information could have an important influence on susceptibility to disorders
is
that have a strong genetic component?

Th
A. Ethnicity
B. Education
C. Profession
D. Nutrition status
sh
____ 12. What is the significance of a pedigree symbol consisting of a square with a diagonal slash mark
through it?
A. Affected female
B. Affected male
C. Deceased female

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Deceased male
____ 13. Why is a legend necessary when constructing a pedigree that includes a health history?
A. Gender-altering surgeries require either the drawing of both male and female
symbols for the same person or the use of a diamond instead of a circle or square.
B. When a pedigree includes more than three generations, the relationships of
members in older (more remote) generations are less clear and must be explained.
C. The gender of individuals lost in the first trimester of pregnancy cannot be
established.
D. Health problems do not have standard symbols.
____ 14. How are Punnett squares and pedigrees different?

A. Pedigrees represent genotypes, and Punnett squares represent phenotypes.
B. Punnett squares represent genotypes, and pedigrees represent phenotypes.
C. Pedigrees can identify actual carriers of genetic mutations, whereas Punnett
squares only suggest carrier status.
m
D. Punnett squares can identify actual carriers of genetic mutations, whereas
er as
pedigrees only suggest carrier status.
co
eH w
____ 15. What is the risk for disease expression among the offspring of a woman who has an autosomal-
o.
recessive disorder when her partner is a carrier for the same disorder?
rs e
ou urc
B. All children have a 50% risk for being affected and a 50% risk for being a carrier.
carriers.
o
aC s
vi y re
____ 16. Which observations in a pedigree indicate a probable autosomal-dominant (AD) trait transmission?
A. Affected males and females appear in every generation.
B. The pedigree shows only one affected individual.
ed d
C. The trait appears to “skip” generations.

ar stu
D. Only males are affected.
____ 17. Marjory tells a nurse that she has three aunts with cancer. The two on her father’s side were
diagnosed with breast and ovarian cancers at ages 42 and 36. She also has one aunt on her mother’s
is
side who was diagnosed with breast cancer at age 70. Marjory asks if she should have genetic
Th

A. “Your family history indicates a high risk, and you should definitely have genetic
testing.”
B. “Because no men in your family are affected, it is not inherited cancer, so you
sh

C. “Because your aunts were older when they got breast cancer, it was probably
sporadic, and you should just have regular mammograms like everyone else.”
D. “Your family history may indicate an increased risk for breast cancer, and a genetic
counselor could help determine whether you could benefit from genetic testing.”

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 18. A man with syndactyly, an autosomal-dominant condition, has one child who also has syndactyly.
His unaffected wife states, “Because the risk for having a child with this problem is 50% and our
first child has the problem, the next child will not be affected.” What is the best response to this
statement?
A. “That is not quite true because the risk is 50% with each pregnancy, so with all
future children, you would have a 50% risk.”
B. “That is not quite true because you could also have the mutation but not show the
problem if there is variable expressivity.”
C. “That is correct, but if you have more than two children, half of them will have
syndactyly, and 50% will not have it.”
D. “That is correct, and if you only have two children, the second one will not have
syndactyly.”
____ 19. Which pair of relatives represents a first-degree relationship?
A. Grandfather and grandson
m
B. Aunt and nephew
er as
C. Sister and brother
co
D. Two cousins
eH w
____ 20. How are twins indicated on a pedigree?
o.
A. The two gender symbols are placed on top of each other.
rs e
B. Each of the gender symbols is surrounded by an inward-facing set of brackets.
ou urc
C. The vertical lines to each twin begin at the same point on the parents’ horizontal
mating line.
D. The one born first has a vertical line connected to the parents’ horizontal mating
o
line; the twin born second has a vertical line extending down from the first twin’s
aC s
gender symbol.
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com

Answer Section
MULTIPLE CHOICE
1. ANS: A
A pedigree is a pictorial or graphic illustration of family members’ places within a family and their
medical history. It can be used as one tool to begin to identify health issues that may have a genetic
component. It is not used to determine “blame” for a genetic mutation. The person within a kindred
who is responsible for bringing the family to the attention of a genetics professional is a member of
the pedigree, but his or her identification is not the purpose of a pedigree.
PTS: 1
2. ANS: D
Completing a family history is an easy and affordable way to begin genetic screening; however,
m
er as
family history is not a stable thing. On the day you take your patient’s family history, there may be
co
no one with cardiac problems. The next day, your patient’s 35-year-old brother or sister could have a
eH w
myocardial infarction, changing your patient’s genetic risk for cardiovascular disease from low to
o.
high.
rs e
ou urc
PTS: 1
3. ANS: B
A horizontal dashed line between two people in a pedigree indicates that the individuals have a
o
casual sexual relationship with each other and are not married to each other. They each could be
aC s
married to someone else. This union may or may not produce offspring.
vi y re
PTS: 1
4. ANS: D
The best way for a family history to be as complete and accurate as possible is for as many family
ed d
members as possible to construct it together using their memories, documents, and pictures. Even
ar stu
those who have some cognitive impairment may remember incidents or stories that trigger memories
of events in other family members.
is
PTS: 1
5. ANS: A
Th
The acronym SCREEN stands for some concern about diseases that might run in the family,
especially problems with reproduction, early disease or death in family members, ethnicity (some
genetic diseases are more common in people who are from certain ethnic groups), and nongenetic
sh
risk factors for disease.
PTS: 1
6. ANS: D

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Neurodevelopmental disorders and extreme presentations of common conditions are worth

investigating by a genetics professional. Breast cancer, colon cancer, and myocardial infarction in
the family history may require a genetics referral, but usually only when they appear early. As
discussed in Chapter 3, physical traits from remote parents can be passed down and expressed many
generations later, enabling some siblings to not resemble each other or their parents.
PTS: 1
7. ANS: C
Unless a pedigree shows at least three generations, no supportable conclusions regarding
transmission patterns can be made.
PTS: 1
8. ANS: B
A double line indicates consanguinity, or relationship by blood. It indicates a mating between two
related family members. Brother and sister are connected by “sibship lines,” and parents and
m
children are indicated by lines of descent. A single horizontal line between a circle and a square
er as
indicates a mating but not marital status between the two.
co
eH w
PTS: 1
o.
9. ANS: D
rs e
The proband is the person within a family who brought the potential genetic issue to the attention of
ou urc
a health-care professional or genetics professional. Lucy, even though she does not have Alzheimer’s
but wishes to discuss whether the disorder has a genetic component because three related parental
individuals have expressed the problem, is the proband.
o
aC s
PTS: 1
vi y re
10. ANS: C
Being able to organize a family history into a pedigree is an important skill for all health
professionals and an expectation for registered nurses with a bachelor’s degree in nursing (BSN).
ed d
The American Association of Colleges of Nursing has included in its document Essentials of
Baccalaureate Education for Professional Nursing Practice 2008 that all BSN graduates must be
ar stu
able to “generate a pedigree from a three-generation family history using standardized symbols and
terminology.” It is important that the nurse not attempt to provide genetic counseling, as this is
beyond his or her scope of practice; however, it is helpful to have a good sense of when referral
is
should be considered even though a general registered nurse does not directly perform referrals to
Th
genetic professionals.
PTS: 1
11. ANS: A
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Ethnicity is critical personal information to determine because some genetic diseases are more
common in people who are from certain ethnic groups. For example, Tay–Sachs disease and
Gaucher disease are at least 10 times more common among people of Ashkenazi Jewish heritage
(regardless of what religion they practice) than among non-Jews. A person’s ethnicity does not
change and cannot be modified. Education, profession, and nutrition status have little, if any,
influence on the expression of a genetic disorder.
PTS: 1
12. ANS: D
Circles are used to represent women, and squares represent men. A diagonal slash through a gender
symbol indicates that the person is deceased.
PTS: 1
13. ANS: D
The standardized symbols for pedigrees include gender, relationships, birth order, adoption (in or
m
out), and matings. There are no standard symbols for any specific type of genetic, sporadic, or
er as
environmental-related health problem. The person developing the pedigree is obligated to provide a
co
legend so that anyone who reads the pedigree will know the family’s health history.
eH w
o.
PTS: 1
14. ANS: B rs e
ou urc
Punnett squares are diagrams that are used to determine the risk of offspring being affected when the
mode of transmission and the parents’ carrier status are known. It is based on genotype. Pedigrees
show relationships and expressed traits or disorders, the phenotype. Neither pedigrees nor Punnett
o
squares by themselves can identify actual carrier status. Pedigrees can suggest carrier status but not
aC s
prove it. Punnett squares require the genotypes for a specific trait to be known for both parents to
vi y re
demonstrate probabilities.
PTS: 1
ed d
15. ANS: B
With an autosomal disorder, males and females are affected equally. The mother has two mutated
ar stu
alleles and therefore will transmit a mutated allele to all offspring. The father has only one mutated
allele and has one normal allele. Each of his children has a 50% risk for inheriting his mutated allele
and a 50% risk for inheriting his normal allele. Because all of the children will have a mutated allele
is
from the mother, all children have a 50% risk for being affected and a 50% risk for being a carrier.
Th
PTS: 1
16. ANS: A
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Finding representation in each generation and that both males and females are affected provides
strong evidence that the trait is being transmitted in an AD manner. When only males are affected,
the trait is more likely to be X-linked recessive, with some women being carriers. Recessive traits
tend to appear on a pedigree as “skipped generations” because carriers typically do not have the
phenotype. A single affected person is more likely found with an autosomal-recessive transmission,
where two unaffected carriers have mated. The trait may not appear anywhere else in the pedigree.
Of course, a new mutation of an AD trait could also cause only one person to be affected, but we are
looking for the most probable answer.
PTS: 1
17. ANS: D
Marjory’s aunts on her father’s side were much younger than average and premenopausal when they
were affected. This would raise concern that there might be genetic risk factors in the family. The
fact that they are on her father’s side makes no difference in genetic risk, and it is unclear whether or
not Marjory should have genetic testing until she speaks with a genetics professional who can take a
m
thorough family history and accurately discuss her risk.
er as
co
PTS: 1
eH w
18. ANS: A
o.
Many parents believe that the probability of transmitting an autosomal-dominant trait to their
rs e
children is 50% for the total number of children, rather than for each pregnancy. Thus, the statement
ou urc
the mother made is incorrect. Having the first child express an autosomal-dominant health problem
does not mean there is no risk for the second child also expressing it. Also, only the risk or
probability is 50%. If they had three more children, it is possible that all three could have the
o
problem, that all three could not have the problem, or that some may have it and not the other(s).
aC s
vi y re
PTS: 1
19. ANS: C
First-degree relatives are those that have a direct, single-line blood relationship within a pedigree
ed d
(vertical or horizontal) with no other relative between them. Grandfather and grandson have a parent
ar stu
in between them. Aunt and nephew have a sibling/parent in between them. Cousins have two sibling
parents in between them.
PTS: 1
is
20. ANS: C
Th
The vertical lines connecting each twin to the parents begin at the same point on the parents’
horizontal mating line, making an upside-down “V” shape. When the twins are monozygotic, there is
a small horizontal line connecting the twins’ vertical lines.
sh
PTS: 1

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 9: Congenital Anomalies, Basic Dysmorphology, and Genetic Assessment
Multiple Choice
____ 1. Which ear location is considered “low set”?

A. The earlobes are aligned with the highest point of the upper lip.
B. The earlobes are aligned with the highest point of the bottom lip.
C. The roots of the ears are aligned with the outer canthus of the eyes.
D. The roots of the ears are aligned an inch below the outer canthus of the eyes.
____ 2. Which term is used to describe the condition of widely spaced eyes?
A. Hypertelorism
B. Hypotelorism
C. Hyperoculoci
m
D. Hypo-oculoci
er as
co
____ 3. What mechanism results in the malformation of cleft lip?
eH w
A. An abnormal developmental process
B. An abnormal organization of cells
o.
C. A mechanical process
rs e
D. The breakdown of an originally normal developmental process
ou urc
____ 4. How is a congenital anomaly that requires intervention or management categorized?
A. A dysmorphology
o
B. A major anomaly
aC s
C. A minor anomaly
vi y re
D. A disruption
____ 5. What type of problem is Pierre-Robin, in which micrognathia begins a series of events that can result
in an obstructed airway?
ed d
A. A syndrome
ar stu
B. An association
C. A sequence
D. A dysplasia
is
____ 6. Which condition in a newborn should be described as a deformation if it is the only abnormal
Th
finding?
A. A unilateral clubfoot
B. A sealed (imperforate) anus
C. The absence of a thyroid gland
sh
D. The presence of six toes on each foot

____ 7. Which anomaly constitutes clinodactyly?
A. An extra toe on one foot
B. A laterally curved fifth finger
C. Complete absence of fingers and toes

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Fusion of two fingers on the right hand
____ 8. What is the best description of a drug prescribed to control acne that also causes severe birth defects
when it is taken during pregnancy?
A. Pleiotropic
B. Teratogenic
C. Carcinogenic
D. Geneticomimetic
____ 9. How does genetic assessment differ from routine physical assessment?
A. Routine physical assessment relies on personal history, and genetic assessment
relies on the recorded family history.
B. Genetic assessment requires only inspection, and routine physical assessment
involves inspection, palpation, and auscultation.
C. Genetic assessment encompasses routine physical assessment and always adds the
consideration of genetic causes for findings.
m
D. Routine physical assessment is performed by all health-care professionals, and
er as
genetic assessment is performed only by genetic professionals.
co
eH w
____ 10. What is the most important action to take when assessing an infant for possible dysmorphic features?
o.
A. Assess the phenotypes of first-degree relatives.
rs e
B. Count the number of minor anomalies present.
ou urc
C. Use an atlas that includes globally diverse populations.
D. Determine whether an identified dysmorphic feature is a malformation or a
deformation.
o
____ 11. You are working in a clinic, and a 4-year-old child is brought in with a history of cleft palate repair.
aC s
His parents say they want to have another child and ask you if their other children will have the same
vi y re
problem. They mention that Mom’s uncle Bob had a cleft lip. What do you say?
A. “There is a 3% to 5% risk that your next child will be affected.”
B. “Looking at your family history, I can tell that there is a 20% risk that your next
ed d
child will be affected.”

ar stu
C. “Let’s make an appointment with a genetic counselor who will help determine your
next child’s risk.”
D. “You should have carrier testing to find out if your next child is at risk.”
is
____ 12. Naomi and her sister have the same allele for the gene of interest; however, Naomi has cleft lip,
Th
whereas her sister has only lip pits. What genetic process explains this difference?
A. Genomic imprinting
B. Decreased penetrance
C. Genetic heterogeneity
sh
D. Variable expressivity
____ 13. When geneticists assess dysmorphology, what do they consider?
A. The “gestalt”
B. The general feel and overall appearance of the patient
C. Specific dysmorphic features, such as the shape of the face and the position of the

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
ears
D. All of the above
____ 14. What is the significance of the presence of frontal bossing in one parent and two children within a
family as the only physical or developmental abnormality?
A. It is an inherited normal variation of an anatomical feature.
B. All three family members should be referred to a geneticist for a formal evaluation.
C. The family is most likely descended from Neanderthal ancestors rather than from
Cro-Magnon ancestors.
D. This physical anatomical malformation is a type of deformation caused by prenatal
compression of soft skull areas.
____ 15. Why should a tall teenager with Marfan syndrome avoid joining the high school basketball team?
A. The excessively long limbs have reduced bone density, increasing the risk for
fractures.
B. The disorder is associated with weakened blood vessel walls that could rupture
m
during strenuous activity.
er as
C. The disorder is associated with glycogen storage deficiency, and the individual
co
eH w
could become seriously hypoglycemic during strenuous activity.
D. Although people with Marfan syndrome are tall, they also have poor balance that
o.
impairs gross motor coordination, increasing the risk for injury.
rs e
ou urc
____ 16. Which statement regarding cleft lip (CL) with or without cleft palate (CP) is correct?
A. It is the rarest facial anomaly.
B. These features are not found in isolation.
o
C. The causes are both genetic and environmental.

aC s
D. CL without CP is a minor anomaly, and CL with CP is a major anomaly.

vi y re
____ 17. What is the best action to take when you observe the presence of a smooth philtrum on a young
child?
A. Obtain a genetics referral as soon as possible.
ed d
B. Assess for the presence of any other dysmorphic features.

ar stu
C. Document the finding in the medical record as the only action.

D. Gently explain to the parents that this finding is cause for concern.
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 9: Congenital Anomalies, Basic Dysmorphology, and Genetic Assessment

Answer Section
MULTIPLE CHOICE
1. ANS: D
The usual anatomic position for the ear is having the root of the ear located on an imaginary
horizontal line extending from the outer canthus to the side of the head. Thus selection C is the
“normal” anatomic position for the ears, and the position described in selection D is considered low
set. Earlobe location is not used to determine ear position because it varies with ear size (length).
PTS: 1
2. ANS: A
Hypertelorism describes eyes (or any paired organ) as being too far apart or widely spaced.
Hypotelorism, which is not a medical term, would indicate too short a distance between two paired
m
er as
organs. Neither hyperoculoci nor hypo-oculoci is a real medical term.
co
eH w
PTS: 1
3. ANS: A
o.
rs e
Cleft lip/palate is caused by the failure of the lip and/or palate tissues to fuse during development.
ou urc
This mechanism is considered a malformation because it is due to a developmental problem during
facial formation. The tissues making up the lip do not fuse properly, leaving a gap (or cleft).
Although a cleft lip, with or without cleft palate, is usually caused by a combination of genetic and
o
environmental factors, it is the result of an abnormal developmental process.

aC s
vi y re
PTS: 1
4. ANS: B
Major anomalies are serious and usually require medical or surgical attention because they can have
life-threatening implications or have a serious cosmetic effect. A minor anomaly does not have
ed d
serious functional or cosmetic consequences and may or may not be surgically corrected. A
ar stu
dysmorphology is usually categorized as a minor anomaly. A disruption is a process, not an anomaly.
PTS: 1
is
5. ANS: C
In a sequence, one anomaly starts a chain reaction that causes another problem that then causes
Th
another and then sometimes another. The anomaly that starts out Pierre-Robin is micrognathia (a
small jaw, which is caused by shortening and narrowing of the mandible) in the developing fetus.
This small jaw causes the tongue to be positioned backward into the throat. The posteriorly
sh
positioned tongue can cause a cleft palate and sometimes respiratory obstruction. It is a sequence of
events that started with the poorly formed jaw. Although all of these features (small jaw, posteriorly
displaced tongue, respiratory obstruction, and cleft palate) occur together, they were all caused by
the chain of events that started with the jaw problem.
PTS: 1

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
6. ANS: A
Although clubfeet can be part of a syndrome, a unilateral clubfoot is often associated with
mechanical pressure in the uterus before birth, especially among large babies. The absence of a
thyroid gland and the imperforate anus are disruptions of development. The presence of six toes
(polydactyly) is a malformation.
PTS: 1
7. ANS: B
Clinodactyly is a laterally curved digit, most often the fifth digit. An extra digit is polydactyly, and
fused digits are syndactyly. Absence of fingers and/or toes is adactylia.
PTS: 1
8. ANS: B
A teratogen is any agent that can cause birth defects when taken or exposed to during pregnancy. A
carcinogen is any agent that can cause cancer. Pleiotropy refers to the ability of a single gene
m
mutation to cause problems in more than one tissue. Geneticomimetic is not an official term.
er as
co
PTS: 1
eH w
9. ANS: C
o.
All parts of a routine physical assessment are included in a genetic assessment and can be performed
rs e
by general health-care professionals as well as by genetic professionals. Both routine physical
ou urc
assessment and genetic assessment include obtaining a personal and a family history. A genetic
assessment always includes consideration of a genetic cause for findings.
o
PTS: 1
aC s
10. ANS: A
vi y re
Sometimes what seem to be minor anomalies may not be caused by any disorder but may simply
reflect an inherited group of unusual features. Although an atlas representing globally diverse
populations is helpful, a first step before you say an infant or child has a dysmorphic feature or is
“funny looking” is to check the appearance of other family members.
ed d
ar stu
PTS: 1
11. ANS: C
As a nurse, you are expected be able to recognize basic dysmorphic features and structural anomalies
is
that should trigger referral. However, your background is not sufficient to allow you to make risk
determinations or direct what type of testing a patient or family should consider.
Th
PTS: 1
12. ANS: D
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The fact that two children in the same family have lip abnormalities strongly suggests a genetic
cause. In this case, a gene mutation responsible for lip abnormalities is found and is autosomal
dominant in transmission, with a reduced penetrance of 80% to 90%. (Recall from Chapter 4 that
80% to 90% penetrance means that out of 100 people who have the gene variant that causes the
disease, between 10 and 20 of them will show no clinical signs.) For the mutation in this case, about
70% of people with lip pits also have cleft lip (CL) or cleft palate (CP). Some family members with
the same gene variant can have only lip pits, whereas others have CL/CP, and still others have just
CP. This is an example of the variable expressivity.
PTS: 1
13. ANS: D
An accurate dysmorphology assessment must consider every one of the listed factors.
PTS: 1
14. ANS: A
m
With no other physical abnormalities or developmental issues, the presence of frontal bossing in a
er as
parent and offspring represents only anatomic variation that is heritable. The issue does not require
co
genetic counseling or investigation. It is not caused by prenatal compression or post-birth
eH w
positioning. Although Neanderthal prehistoric people had very prominent foreheads and brow ridges,
o.
frontal bossing is found in people of all races, origins, and ethnicities.
rs e
ou urc
PTS: 1
15. ANS: B
Marfan syndrome (MFS) is an inherited genetic connective tissue disorder in which the gene for the
o
glycoprotein fibrillin is mutated, affecting the strength of many connective tissues. The most
aC s
common manifestations include tall, lanky stature; loose or lax joints; severe myopia; and
vi y re
cardiovascular problems, especially mitral valve prolapse, widened aorta, and aortic aneurysm.
The cardiovascular problems can significantly shorten the individual’s life span. Dissecting aortic
aneurysms and death can even occur in childhood. Strenuous exercise and heavy lifting must be
ed d
avoided, as should any activity in which the chest could be hit. Thus, contact sports and those that
ar stu
involve running or catching a ball should be avoided.
PTS: 1
16. ANS: C
is
CL and/or CP can be a feature of more than 400 different conditions, making it a very common facial
Th
anomaly. The malformations can be the result of a combination of genetic and environmental factors.
For example, a maternal diet low in folic acid or when the mother takes certain anticonvulsant drugs
during pregnancy increases the risk for CL with or without CP. Sometimes CL/CP is found with no
other anomalies. Because either CL or CP can cause significant feeding problems and also have
sh
cosmetic implications, they are both considered major anomalies.
PTS: 1
17. ANS: B

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A smooth philtrum is a minor anomaly, and there is a wide range of normal variations in this
structure, so the parents should not be informed that this is a cause for concern. However, it is
important to continue your careful examination to see if any other dysmorphic features are present in
the child. Finding multiple dysmorphic features should trigger a genetics referral; however, the
presence of a smooth philtrum as the only unusual finding is not a reason for a genetics referral.
PTS: 1
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 10: Enzyme and Collagen Disorders
Multiple Choice
____ 1. Why does a newborn with a genetic enzyme deficiency have a normal phenotype at birth?
A. Metabolism during prenatal life is too slow to require full enzyme activity.
B. The deficient enzyme’s activity was performed by maternal enzymes before birth.
C. During the fetal phase of life, the newborn was not exposed to the protein that the
enzyme is responsible for degrading.
D. Although the newborn cannot synthesize the enzyme after birth, the initially stored
enzyme performs its functions until the level is fully depleted.
____ 2. Which dietary alterations are necessary to help reduce the complications of phenylketonuria (PKU)?
A. Increased intake of phenylalanine; decreased intake of tyrosine
B. Increased intake of phenylalanine; increased intake of tyrosine
C. Decreased intake of phenylalanine; decreased intake of tyrosine
D. Decreased intake of phenylalanine; increased intake of tyrosine
____ 3. Which ethnic group has the highest incidence of a mutation in the PAH gene?
A. Ashkenazi Jews
B. French Canadians from the Quebec area
C. Celts from Ireland and Scotland
D. Africans from equatorial areas
____ 4. Which manifestation is a characteristic feature of untreated phenylketonuria (PKU)?

A. Increased skin pigmentation
B. Excessive urination
C. Fragile bones
D. Small stature
____ 5. Which action or behavior is considered an “executive function”?

A. Hopping on one foot
B. Learning the names of animals
C. Deciding what to give as a present
D. Counting the number of objects in a picture
____ 6. What is the expected outcome of pregnancy for women with phenylketonuria (PKU) when the blood
levels of phenylalanine are high throughout the pregnancy?
A. Most births are post-mature.
B. There is a high incidence of infertility.
C. The infant develops PKU.
D. There is a high incidence of cardiovascular birth defects.
____ 7. Which statement regarding lysosomal storage diseases is true?
A. A gene defect makes lysosomes unable to store degraded compounds.
B. Accumulation of stored iron results in cell, tissue, and organ dysfunction.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
C. Defective enzymes result in the accumulation of potentially toxic substances.

D. Mutations in the genes coding for different types of collagen produce substances
that are toxic to brain cells.
____ 8. If a man with Gaucher type 1 has children with a woman who is a carrier for the disorder, what is the
expected risk pattern?
B. All sons will be carriers; all daughters will be affected.
C. All children will have one mutated allele and will at least be carriers; each child of
either gender has a 50% risk of having the disease.
____ 9. Which ethnic group has the highest incidence of Gaucher disease?
A. Ashkenazi Jews
B. Asian Americans
C. American Indians
D. Individuals of Mediterranean descent
____ 10. Why is it important to diagnose Gaucher type 1 disease as soon as possible after birth?
A. Enzyme therapy can reduce complications for some patients.
B. When proper dietary management is instituted early, complications can be
prevented.
C. Insulin therapy can result in prevention of the development of type 2 diabetes
mellitus.
D. Prophylactic therapy with antibiotics can prevent early death from pneumonia and
other infections.
____ 11. How does intravenous enzyme-replacement therapy for Gaucher disease reduce the organ storage of
glucosylceramide?
A. The enzyme increases the destruction of glucosamine-filled macrophages.
B. The drug acts as a cofactor, increasing the activity of the mutated enzyme.
C. The drug increases production of all blood cells in the bone marrow, including
white blood cells, which have not stored glucosylceramide.
D. The enzyme is absorbed through the plasma membranes of affected cells and
converts the stored glucosylceramide into its constituent molecules.
____ 12. Which assessment finding in a 6-month-old child suggests a possible lysosomal storage disease?
A. Enlarged, palpable liver
B. Weight in the 95th percentile
C. Does not yet say “mama” or “dada”
D. Skin tone appears slightly lighter than that of either parent
____ 13. Which therapeutic option has been found beneficial for patients with Gaucher type 1 disease?
A. Daily ingestion of oral sapropterin hydrochloride (Kuvan)
B. Intravenous enzyme replacement with alpha-L iduronidase
C. Weekly phlebotomy with removal of excess red blood cells
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Intravenous enzyme replacement with imiglucerase (Cerezyme)
____ 14. For which disorder is the drug idursulfase (Elaprase) appropriate for enzyme-replacement therapy?
A. Hurler syndrome
B. Hunter syndrome
C. Gaucher type 2
D. Tay–Sachs disease
____ 15. How are the two mucopolysaccharide disorders Hurler syndrome and Hunter syndrome different?
A. Hurler syndrome is an autosomal-dominant disorder, and Hunter syndrome is
autosomal recessive.
B. Hunter syndrome is an autosomal-dominant disorder, and Hurler syndrome is
autosomal recessive.
C. Individuals with Hurler syndrome become cognitively impaired in early childhood,
whereas those with Hunter syndrome often retain intellectual ability until later in
life.
D. Individuals with Hunter syndrome become cognitively impaired in early
childhood, whereas those with Hurler syndrome often retain intellectual ability
until later in life.
____ 16. Why does a person with Hurler syndrome have an enlarged abdomen?
A. The excess mucopolysaccharides accumulate inside the lysosomes within the liver
cells.
B. The excess mucopolysaccharides accumulate inside the cells of the liver and the
spleen.
C. The excess glycosaminoglycans weaken the muscles of the abdomen, and all
contents move forward.
D. The excess glycosaminoglycans cause the person to develop type 2 diabetes, with
greatly increased abdominal fat.
____ 17. A pair of unrelated 4-year-olds (Lester and Lucy) have mucopolysaccharidosis 1 (MPS1). Lester has
severe dysmorphic features and many skeletal anomalies. Lucy has only mildly coarse features and
slight developmental delay. What is the best explanation for these differences?
A. Skewed X inactivation allowed more paternal X expression for Lucy and more
maternal X expression for Lester.
B. Lucy’s mother had better prenatal care, including good diet, exercise, and vitamins,
than Lester’s mother.
C. It is likely that Lucy has been misdiagnosed and really has MPS2.
D. The disorder has wide variability in expression of severity.
____ 18. If a man with Fabry disease has children with a woman who is a carrier for the disorder, what is the
expected risk pattern?
B. Sons have a 50% risk for being affected; all daughters will either be affected or
carriers.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
carriers.
____ 19. A woman who is a carrier for Fabry disease has children with a man who does not have the disorder.
Their son has the disease, and their daughter also has some symptoms of Fabry disease even though
she could only have inherited one affected allele. What is the explanation for the daughter having
some symptoms of Fabry disease?
A. The girl must have a different father than her brother.
B. The daughter is seeking the same attention that is given to her brother.
C. The inactivation of one X chromosome in female cells is a totally random event.
D. In addition to inheriting one affected allele, the daughter has developed a somatic
mutation.
____ 20. What is the pathologic basis of Fabry disease?
A. Increased degradation of globotriaosylceramide
B. Increased accumulation of globotriaosylceramide
C. Deficiency in the number of liver lysosomes
D. Excessive number of liver lysosomes
____ 21. Which manifestation in a teenage boy whose mother is a carrier for Fabry disease suggests the boy
may have the disorder?
A. Hearing is hyperacute.
B. Opacity is present in both eyes.
C. Fasting blood glucose level is elevated.
D. Growth spurt results in a height 6 inches taller than his siblings.
____ 22. Couples from which ethnic group would derive the greatest benefit from genetic testing for Tay–
Sachs disease?
A. Ashkenazi Jews
B. Asian Americans
C. French Canadians from Quebec
D. Individuals of Mediterranean descent
____ 23. Which clinical manifestation in a 6-month-old infant is most diagnostic for Tay–Sachs disease?
A. Anemia and bruising
B. Enlarged liver and spleen
C. Cherry red spot on the retina
D. Progressive cognitive impairment
____ 24. Which substance fails to form normally in individuals with Marfan syndrome?
A. Elastin
B. Glycogen
C. Collagen
D. Fibrillin
____ 25. Which health problem could be expected as a result of a gene mutation that affects the correct
production and function of type 1 collagen?
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A. Failure of blood to clot after minor trauma

B. Increased incidence of arterial and venous aneurysms
C. Increased incidence of hearing loss among children and adults
D. Restrictive lung disease from excessive stiffening of alveolar walls
____ 26. A son with osteogenesis imperfecta is born to parents with no family history of the disease. What is
the most likely explanation for the son’s disorder?
A. The son is not biologically related to the mother.
B. The son is not biologically related to the father.
C. The gamete of one parent had a spontaneous mutation.
D. The son’s DNA underwent a spontaneous mutation during the second trimester of
pregnancy.
____ 27. Which manifestation is most common among individuals with osteogenesis imperfecta type I?
A. Short stature
B. Premature birth
C. Skull deformities
D. Blue-tinged sclerae
____ 28. The mother of a teenager recently diagnosed with osteogenesis imperfecta type I (OI) asks if the
problem is related to the fact that she adhered to a vegetarian diet during pregnancy. What is the
most appropriate response?
A. Your diet is not related to this disease because it is an inherited disorder.
B. Although this problem can be inherited, low calcium levels are a major cause.
C. That is one possibility, especially because collagen requires proteins to form.
D. More likely, it is related to the fact that you were older than 35 years of age when
you became pregnant.
____ 29. What is the most common cause of death among individuals with vascular Ehlers–Danlos (Ehlers–
Danlos type IV)?
A. Respiratory impairment from kyphosis
B. Skin cancer (melanoma)
C. Intestinal rupture
D. Liver failure
Multiple Response
Identify one or more choices that best complete the statement or answer the question.
____ 30. A 12-year-old boy with Marfan syndrome complains to his nurse-practitioner, “My mother won’t let
me play football or do anything else. Isn’t there something I can do besides sitting and playing video
games?” Which of the following activities may be considered less risky for this child to perform?
Select all that apply.
A. Soccer (not the goalie position)
B. Riding his bike with his friends
C. Playing table tennis
D. Competitive swimming
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
E. Archery
F. Recreational ice-skating
G. Hiking low- to moderate-difficulty trails
H. Basketball
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 10: Enzyme and Collagen Disorders

Answer Section
MULTIPLE CHOICE
1. ANS: B
The newborn with a genetic enzyme deficiency does not have symptoms of the deficiency at birth.
The reason that symptoms often are not apparent in the newborn is that the maternal enzymes cross
the placenta and perform their specific functions in the cells of the fetus. When the child is born, its
access to effective maternal enzymes stops, and the enzyme deficiency begins to affect the child’s
metabolism.
PTS: 1
2. ANS: D
The phenylalanine hydroxylase (PAH) is responsible for converting the amino acid phenylalanine
into tyrosine. The result of a deficiency of PAH is an excess of phenylalanine and a deficiency of
tyrosine. To prevent complications, phenylalanine in the diet must be reduced and carefully
controlled. Because very little tyrosine is made in the body as a result of PKU, more is needed in the
diet.
PTS: 1
3. ANS: C
A mutation in the PAH gene is responsible for the metabolic disease phenylketonuria (PKU).
Although this disease is more common among people whose ancestors came from Northern Europe,
it is especially common among Celts from Ireland and Scotland. PKU is most rare among those
whose ancestors came from Africa. There is no particular increase in PKU incidence among either
Ashkenazi Jews or French Canadians.
PTS: 1
4. ANS: D
When the level of phenylalanine is not managed, brain dysfunction results in severe cognitive
deficiencies and diminished motor skills. Growth retardation is present, and the skin, eyes, and hair
color are lighter than those of parents or unaffected siblings, rather than increased pigmentation. The
urine contains large amounts of phenylalanine, but urine volume is not increased above normal.
Bone density is not affected by the disorder.
PTS: 1
5. ANS: C
Executive functions are those behavioral functions associated with prefrontal-lobe brain activity and
include problem solving, impulse control, planning, and goal-directed actions. Learning names,
hopping, and counting are not related to problem solving, impulse control, planning, or goal-directed
activities.
PTS: 1
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
6. ANS: D
With increasing life spans and cognition among people with PKU, a newer issue is the problem of an
increased incidence of a variety of health problems and birth defects among infants born to PKU
mothers. The infants do not have PKU; however, abnormal blood levels of amino acids, especially
during embryonic life, result in a wide variety of birth defects, most commonly of the cardiovascular
system. The best pregnancy outcomes for PKU mothers are achieved when phenylalanine levels are
well controlled before, as well as during, pregnancy.
PTS: 1
7. ANS: C
The pathologic problem in lysosomal storage diseases is that either an enzyme is not present in the
correct amounts (deficiency) or the enzyme is defective and cannot perform its functions. As a result,
degradation and elimination of potentially toxic substances do not occur, and these products
accumulate. Neither collagen nor iron is relevant to lysosomal storage diseases.
PTS: 1
8. ANS: C
The GBA gene, which is mutated in Gaucher type 1, is located on chromosome 1q21, and the disease
is transmitted in an autosomal-recessive pattern. Therefore, there is no gender difference in risk
between sons and daughters.
PTS: 1
9. ANS: A
Gaucher disease is the most common of the lysosomal storage diseases and occurs most often among
the Ashkenazi Jewish population (incidence approximately 1 in 450 births) compared with non-
Jewish populations (incidence approximately 1 in 40,000 to 1 in 100,000 births). It is also more
common among French Canadians in the Quebec area.
PTS: 1
10. ANS: A
Early diagnosis of Gaucher type 1 disease and treatment with enzyme-replacement therapy can
reduce some of the severe complications of the disorder, especially hepatosplenomegaly. The
enzyme-replacement therapy is expensive and must continue throughout life. Dietary management is
not appropriate for the disorder. Diabetes is not a common complication of the disease, and neither is
pneumonia.
PTS: 1
11. ANS: D
In Gaucher disease there is a deficiency of the GBA gene product, an enzyme that normally breaks
down glucosylceramide into sugar and fat that can be recycled for other metabolic uses. The enzyme
deficiency results in the accumulation of glucosylceramide in macrophages and some other white
blood cells. Enzyme replacement acts like the naturally occurring enzyme, breaking down
glucosylceramide into the usual sugar and fats. Drugs for enzyme-replacement therapy are
imiglucerase (Cerezyme), taliglucerase (ELELYSO), and velaglucerase (VPRIV),
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
12. ANS: A
The liver contains an enormous number of lysosomes. With lysosomal storage disorders, the
deficient enzyme causes products to accumulate in all lysosomes, especially those of the liver, which
greatly enlarges the organ. Weight in the 95th percentile is above average but is not suggestive of
lysosomal storage disease. Most infants do not say specific words by 6 months of age. Skin tone is
not affected by lysosomal storage diseases, and often, the skin tone of infants is initially lighter than
that of parents until the child has more exposure to sunshine.
PTS: 1
13. ANS: D
Enzyme-replacement therapy with imiglucerase (Cerezyme), which is infused intravenously every 2
weeks once a blood level has been achieved, can reduce liver size, spleen size, and bone pain within
a few weeks of beginning the therapy, although each patient’s response is variable. It is one of three
drugs used for enzyme-replacement therapy in Gaucher type 1. The other two drugs are taliglucerase
(ELELYSO), and velaglucerase (VPRIV),
PTS: 1
14. ANS: B
The enzyme defective or missing in the MPS disorder Hunter syndrome is iduronate sulfatase. Use
of the drug Elaprase can replace this enzyme. The deficient or missing enzymes in the other three
disorders are not iduronate sulfatase. Thus, administering Elaprase would have no benefit.
PTS: 1
15. ANS: C
The actual pathophysiology of Hunter syndrome with regard to poor degradation of
mucopolysaccharides is identical to that of Hurler syndrome. Major differences are that people with
Hunter syndrome have a slower onset of symptoms, and the effect on intellectual ability is more
variable. In mild forms, loss of intellectual ability is minimal. In more severe forms, the loss of
intellectual ability is more severe but occurs much later than in Hurler syndrome. Hurler syndrome is
an autosomal-recessive disorder resulting in deficient function of the enzyme alpha-L iduronidase,
and Hunter syndrome is an X-linked recessive disorder with deficient function of the enzyme
iduronate sulfatase.
PTS: 1
16. ANS: B
The excess mucopolysaccharides accumulate in all tissues and cells, accounting for the widespread
changes associated with the disease. In the liver and spleen, this accumulation leads to organ
enlargement, causing the abdomen to increase in size.
PTS: 1
17. ANS: D
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
There are over 100 different mutations in the gene that can cause Hurler syndrome (MPSI). This is
responsible for the wide variations in disease severity. MPS1 is an autosomal-recessive disease, and
prenatal care does not appear to have an impact on disease severity. Because the gene is not on the X
chromosome, skewed X inactivation is not a plausible explanation for the difference in severity.
Clinical testing for MPS1 and MPS2 is accurate. Misdiagnosis is not likely.
PTS: 1
18. ANS: B
Fabry disease is an X-linked recessive disorder resulting in a deficiency of the enzyme alpha-
galactosidase. Boys do not inherit an X chromosome from their fathers, only from their mothers.
Therefore, an affected father cannot transmit the gene to his son. All daughters of an affected father
will inherit an affected gene from him. Thus, they will all be at least carriers. If a daughter also
inherits an affected X chromosome from her carrier mother, she will actually have the disorder.
PTS: 1
19. ANS: C
Although the girl may be seeking attention, she can have real symptoms of Fabry disease. In order to
prevent a “double dose” of alleles on the X chromosome, one X chromosome in all somatic cells of a
female is inactivated. Although Fabry disease is much more common among males, female carriers
may have significant symptoms of the disorder as a result of skewed X-chromosome inactivation in
different tissues, which results in greater expression of the maternal X (with the mutated allele) than
the paternal X (with the normal allele). It is possible that the son’s father is not the daughter’s father,
but the more likely explanation is the presence of greater inactivation of the father’s X chromosome
than the mother’s X chromosome. A somatic mutation does not affect the expression of this enzyme.
PTS: 1
20. ANS: B
Fabry disease is a genetic lysosomal storage disease in which there is a deficiency of the enzyme
alpha-galactosidase A (also known as ceramide trihexosidase) that results in the accumulation of
globotriaosylceramide (GL-3) within the lysosomes of many tissues and organs. It does not change
the number of lysosomes present in the liver (just their function).
PTS: 1
21. ANS: B
The onset of signs and symptoms usually begins later in childhood. At first, symptoms are related to
poor perfusion and include cold intolerance, insufficient sweating in hot environments, and pain
episodes of unknown origin. In adolescents, the symptoms worsen, with opacities developing in the
eye. Deafness often occurs, not hyperacute hearing. Height is not affected or is shorter than that of
unaffected siblings. Diabetes is not commonly associated with the disorder.
PTS: 1
22. ANS: A
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The incidence of Tay–Sachs disease is highest among people of Ashkenazi Jewish ethnicity
worldwide (1 in 3,900 births). The incidence among all other non-Jewish populations is much less
frequent, about 1 in 320,000 births. French Canadians from Quebec have a higher incidence of
Gaucher disease than the general population, but not of Tay–Sachs disease.
PTS: 1
23. ANS: C
During the first few months of life, the infant with Tay–Sachs disease progresses normally, learning
to control the head, recognize parental faces, socially smile, and roll over. At this point, normal
development slows or stops, and physical development and cognitive development regress. The
retinal cells have filled with GM2 and become pale. This makes the fovea centralis stand out as a
cherry red spot against the pale retinal background. This is a hallmark of the disease. Although
cognitive ability regresses over time, this is not limited to Tay–Sachs disease. Anemia and
hepatosplenomegaly are not common manifestations of the disorder.
PTS: 1
24. ANS: D
Marfan syndrome (MFS) is an inherited genetic connective tissue disorder in which the gene for the
glycoprotein fibrillin is mutated. The collagen and elastin produced are normal, although the recoil
strength of tissues during and after stretching is not normal because healthy fibrillin is not present to
interact with the collagen and elastin. The structure and function of glycogen are not affected by the
gene mutation that causes Marfan syndrome.
PTS: 1
25. ANS: B
Type 1 collagen is a major component of bones, the dermal layer of skin, tendons, ligaments,
corneas, intervertebral disks, and the walls of arteries and other blood vessels. It is critical in
providing strength to blood vessel walls. With insufficient or poor-quality type 1 collagen, these
blood vessel walls are flabby and can balloon out and rupture.
PTS: 1
26. ANS: C
There are four major types of osteogenesis imperfecta that occur as results of mutations in a gene for
type 1 collagen. All follow an autosomal-dominant transmission pattern, although spontaneous
mutations are responsible about 35% of the time.
PTS: 1
27. ANS: D
The clinical manifestations of osteogenesis imperfecta type I are relatively mild and can easily be
missed because the collagen produced is normal, but the amount is reduced. Usually, the person has
no increase in fractures during infancy. Fractures of long bones do occur in response to relatively
minor trauma throughout childhood, adolescence, and adulthood, although the skull is not often
involved. In women, more fractures are seen after menopause. The most common feature is the blue-
tinged coloration of the sclerae.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
28. ANS: A
The primary problem with OI is failure to produce at least one functional chain of procollagen that is
needed to associate with other molecules and form functional collagen in bone tissue. As a result, the
developing bones have less structural integrity and strength, increasing the risk for fractures. The
problem is a mutation in the gene coding for type 1 collagen. It is inherited in an autosomal-
dominant transmission pattern, although spontaneous mutations are responsible about 35% of the
time. Diet during pregnancy does not affect the development of the disorder in a fetus who has the
gene mutation.
PTS: 1
29. ANS: C
Vascular Ehlers–Danlos is severe and leads to premature death. The individual has very thin, fragile
skin and short stature. Problems are associated with the thin connective tissue in mid-sized and large
arteries, as well as in the intestinal tract. All of these tissues become thinner as the child grows. The
most common causes of death are hemorrhage from arterial rupture and sepsis from intestinal
rupture, often before the age of 30.
PTS: 1
MULTIPLE RESPONSE
30. ANS: B
C, E, F, G
A balance of physical activity is needed to be physically fit without placing strain on the
cardiovascular system. Strenuous exercise and heavy lifting must be avoided, as should any activity
in which the chest could be hit. Thus, contact sports and those that involve running or catching a ball
should be avoided. Walking is encouraged, as are less physically aggressive sports, such as golfing,
bowling, recreational swimming, or low-intensity bicycling. Competitive swimming is too intense.
PTS: 1
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 11: Common Childhood-Onset Genetic Disorders
Multiple Choice
____ 1. Which ethnic group has the highest incidence of sickle cell disease (SCD)?
A. Ashkenazi Jews
B. Asian Americans
C. African Americans
D. French Canadians from Quebec
____ 2. Which type of testing is most commonly used to diagnose sickle cell disease?
A. Hematocrit and hemoglobin levels
B. Hemoglobin electrophoresis
C. Genetic mutation analysis
D. Sweat chloride analysis
____ 3. Which specific type of genetic problem causes sickle cell disease?
A. Deletion of an exon
B. Deletion of an intron
C. Unbalanced translocation
D. Single-nucleotide polymorphism
____ 4. How is sickle cell trait different from sickle cell disease?
A. People with sickle cell disease are homologous for the mutation, whereas those
with sickle cell trait are heterozygous for the mutation.
B. People with sickle cell trait are homologous for the mutation, whereas those with
sickle cell disease are heterozygous for the mutation.
C. Sickle cell disease results from an inherited mutation, and sickle cell trait results
from an acquired mutation.
D. Sickle cell trait results from an inherited mutation, and sickle cell disease results
from an acquired mutation.
____ 5. Which feature or factor is the best predictor for delay of complications in a person who has sickle
cell disease (SCD)?
A. Male gender
B. 20% or greater of HbF
C. Having survived malaria
D. Living in a geographic area that has cold winters
____ 6. How does the drug Endari reduce the manifestations of sickle cell disease?
A. Promoting faster red blood cell production
B. Increasing the concentration of fetal hemoglobin (HbF)
C. Reducing oxidate stress and increasing the life span of red blood cells
D. Correcting the mutation of one allele so that the person has sickle cell trait instead
of sickle cell disease
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 7. What health advantage does sickle cell trait or disease confer on the person who has it?
A. Decreased risk for type 1 diabetes mellitus
B. Decreased risk for hypercholesterolemia
C. Decreased risk for fulminating cholera
D. Decreased risk for malaria
____ 8. A woman whose hemoglobin S levels are less than 1% has a brother with sickle cell disease, and
both parents have been diagnosed as carriers for the disorder. She asks what her risks are of having a
child with sickle cell disease. What is the best response?
A. “Because you do not have the trait, you cannot have a child with sickle cell disease
regardless of your partner’s sickle cell status.”
B. “Because both your parents have the trait, it is possible for you to have a child with
sickle cell disease if your partner actually has the disease.”
C. “Because your brother actually has sickle cell disease, the risk for your children
having sickle cell disease is 50% with each pregnancy.”
D. “Because you are a woman, your daughters will each have a 50% risk for having
the disease, and all of your sons will be carriers of the trait.”
____ 9. Which ethnic group has the highest incidence of cystic fibrosis (CF)?
A. Asian Americans
B. African Americans
C. Hispanic Americans
D. European Americans
____ 10. Which type of testing is most commonly used to diagnose cystic fibrosis (CF)?
A. Mucus protein electrophoresis
B. Genetic mutation analysis
C. Sweat chloride analysis
D. Stool analysis
____ 11. Which relative of a patient who has cystic fibrosis has the correct risk for being a cystic fibrosis
carrier?
A. Sister 0%
B. Mother 50%
C. Father 100%
D. Brother 100%
____ 12. Which tissues are most commonly affected by mutation of the CFTR gene?
A. Eyes and ears
B. Brain and intestines
C. Lungs and pancreas
D. Kidneys and long bones
____ 13. What is the most likely explanation for the variability in expression of disease severity for cystic
fibrosis?
A. The ethnicity of the patient
B. The specific CFTR gene mutation inherited
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
C. The presence of other nongenetic lung or pancreatic problems

D. The length of trinucleotide repeat sequences in the first exon of the CFTR gene
____ 14. What health advantage does cystic fibrosis confer on the person who has it?
A. Decreased risk for type 1 diabetes mellitus
B. Decreased risk for tuberculosis
C. Decreased risk for anemia
D. Decreased risk for typhoid
____ 15. Which statement regarding Duchenne muscular dystrophy (DMD) is true?
A. Females are not affected.
B. Because DMD is X-linked recessive, females are affected, and males are carriers.
C. Because DMD is X-linked recessive, males are affected, and females are carriers.
D. The sons of women who are older than age 40 when pregnant are at an increased
risk for DMD.
____ 16. Why does Duchenne muscular dystrophy (DMD) have poor reproductive fitness?
A. Most affected individuals typically do not have children.
B. Fifty percent of mutations of the dystrophin gene are deletions.
C. The loss of functional adhesion proteins prevents reproduction.
D. The expression of disease severity is highly variable among adults
____ 17. What is the explanation for creatine kinase (CK) levels in a 14-year-old boy with Duchenne
muscular dystrophy being much lower now than they were 5 years ago?
A.His disease is improving.
B.He now performs passive rather than active exercise.
C.Most of the muscle tissue has already been destroyed.
D.The disease is probably Becker muscular dystrophy (BMD) rather than Duchenne
muscular dystrophy.
____ 18. Which additional health problem commonly develops in boys with Duchenne muscular dystrophy?
A. Arthritis
B. Hypertension
C. Diabetes mellitus
D. Chronic heart failure
____ 19. A 21-year-old woman who has two brothers with Duchenne muscular dystrophy asks whether carrier
status testing is appropriate for her. What is the best response?
A. “Testing could be beneficial because your risk for being a carrier is nearly 100%.”
B. “Testing could be beneficial because your risk for being a carrier is approximately
50%.
C. “Testing is not necessary because you would have expressed some symptoms of
the disease by this time if you were a carrier.”
D. “Testing is not necessary because the spontaneous mutation rate for this genetic
problem is high and likely to be why your brothers have the disease.”
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 20. Zoe, a 20-year-old woman, shows signs of mild muscle weakness. She has two first cousins on her
mother’s side who died of Duchenne’s muscular dystrophy (DMD). Which explanation regarding
Zoe’s situation is most likely?
A. Zoe is a heterozygote showing partial expression
B. Zoe and her cousins shared similar environmental risks.
C. The muscle weakness is related to Zoe’s lack of exercise in her “girly-girl”
lifestyle.
D. Zoe is homozygous for DMD, with a defective dystrophin gene inherited from
both parents.
____ 21. How is hemophilia A (classical hemophilia) different from hemophilia B?
A. Symptoms of hemophilia B are not present at birth, but those of hemophilia A are.
B. In hemophilia B, the affected gene is on an autosome instead of the X
chromosome.
C. The clotting factor problem in hemophilia B is a deficiency of factor IX rather than
factor VIII.
D. The physiologic effect on the partial thromboplastin time is more profound with
hemophilia than with hemophilia B.
____ 22. Which statement regarding classic hemophilia is true?
A. Females are not affected.
B. Because hemophilia is X-linked recessive, females are affected, and males are
carriers.
C. Because hemophilia is X-linked recessive, males are affected, and females are
carriers.
D. The sons of women who are older than age 40 when pregnant are at an increased
risk for hemophilia.
____ 23. Which type of testing is most commonly used to diagnose classic hemophilia?
A. Hematocrit and hemoglobin levels
B. X-chromosome inactivation
C. Genetic mutation analysis
D. Factor VIII levels
____ 24. A 12-year-old girl was diagnosed with von Willebrand disease (VWD) when she developed profound
anemia from very heavy menstrual periods. Her levels of von Willebrand (vWf) factor are normal.
What specific type of von Willebrand disease is she most likely to have?
A. Type 1 VWD
B. Type 2 VWD
C. Type 3 VWD
D. Type 4 VWD
____ 25. Which statement regarding type 1 von Willebrand disease (VWD) is true?
A. Incomplete penetrance is common.
B. It represents the female form of hemophilia.
C. Carriers can transmit the disease to their children.
D. Males are affected twice as frequently as females.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 26. Which form of von Willebrand disease (VWD) is most often diagnosed in early childhood?
A. Type 1 VWD
B. Type 2 VWD
C. Type 3 VWD
D. Type 4 VWD
____ 27. Which statement about achondroplasia is true?

A. Females are affected twice as often as males.
B. The affected infant’s appearance at birth is normal.
C. The protein impaired by the mutation is the receptor for fibroblast growth factor.
D. Transmission is less of a problem among males with achondroplasia because they
are usually infertile.
____ 28. Which health problem occurs at a higher rate among children with achondroplasia than among the
general population?
A. Cognitive impairment
B. Hearing impairment
C. Color blindness
D. Sudden infant death syndrome
____ 29. A son with achondroplasia is born to parents with no family history of the disease. What is the most
likely explanation for the son’s disorder?
A. The son is not biologically related to the mother.
B. The son is not biologically related to the father.
C. The gamete of one parent had a spontaneous mutation.
D. The son’s DNA underwent a spontaneous mutation during the second trimester of
pregnancy.
____ 30. Which phenotypic feature associated with achondroplasia has variable expression?
A. Disproportionally short extremities
B. Larger-than-average head size
C. Prominent forehead
D. Hydrocephaly
____ 31. Which factor has the greatest genetic influence in the development of type 1 diabetes mellitus?
A. Inheritance of the HLA-DR or HLA-DQ tissue types
B. Sedentary lifestyle coupled with childhood obesity
C. Mutation in the gene for pancreas development
D. Advanced maternal age at conception
____ 32. For individuals who have increased genetic susceptibility for type 1 diabetes, what is the most
common environmental trigger for disease expression?
A. Obesity and a sedentary lifestyle
B. Exposure to radiation
C. Premature birth
D. Viral infection
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 33. Which problem or symptom is associated with type 1 diabetes but not with type 2 diabetes?
A. Insulitis
B. Polydipsia
C. Weight gain
D. Hyperglycemia
____ 34. Which result of genetic/genomic variation has the most support as a cause of asthma?
A. Decreased resistance to infectious microorganisms
B. Early childhood exposures to inhalation irritants (air pollution)
C. Increased inflammatory responses to environmental triggers
D. Mutations in frontal-lobe genes controlling attention-getting behavior
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 11: Common Childhood-Onset Genetic Disorders

Answer Section
MULTIPLE CHOICE
1. ANS: C
The disorder is inherited as an autosomal-recessive single-gene trait and is most common among
people with African or other equatorial ancestry. The incidence of SCD in the United States among
African Americans is about 1 in 400 live births. Carrier status, in which a person has only one
mutated beta-globin gene allele, is estimated at 1 in 15 African Americans. Both SCD and sickle cell
trait have a far greater incidence in East Africa and other equatorial countries.
PTS: 1
2. ANS: B
Genetic mutation testing is not used to diagnose SCD. It is diagnosed based on the large percentage
of hemoglobin S (HbS) seen on electrophoresis. A person who has SCD usually has 80% to 90%
HbS, and a person with sickle cell trait usually has less than 40% HbS. Although hemoglobin and
hematocrit levels may be abnormal, they alone are not diagnostic for sickle cell disease. Sweat
chloride levels are abnormal in people with cystic fibrosis and normal in people with sickle cell
disease.
PTS: 1
3. ANS: D
Sickle cell disease (SCD) is a genetic disorder caused by a single-nucleotide polymorphism in both
alleles of a single gene, which results in the abnormal formation of the beta chain of hemoglobin
(beta globin). In the classic form of sickle cell disease, both beta-globin alleles have a mutation in
which the DNA triplet coding for glutamic acid has adenine substituted for thymine (instead of CTC,
the triplet now reads CAC). This mutation results in valine as the sixth amino acid in the protein
sequence. There is no deletion of introns or exons, nor is there a translocation (balanced or
unbalanced).
PTS: 1
4. ANS: A
When only one beta-globin allele has the mutation, the person is heterozygous for the mutation and
has sickle cell trait. In this disorder, the percentage of hemoglobin S (HbS) in the red blood cells
(RBCs) is usually less than 40%. When both alleles of the beta-globin gene are mutated, the person
is homozygous for the mutation and has sickle cell disease. The RBCs have a high percentage, close
to 90%, of HbS rather than HbA.
PTS: 1
5. ANS: B
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
One of the best predictors for which patients who have SCD will have delayed complications is the
percentage of fetal hemoglobin (HbF) that remains in circulation. HbF is a type of hemoglobin
normally expressed at high levels only during fetal life, where all oxygen is derived secondhand
from the maternal circulation. It tolerates low-oxygen conditions well without sickling. Higher
percentages of HbF dilute the percentage of HbS and result in better tolerance of conditions that
could cause sickling.
PTS: 1
6. ANS: C
Endari is a new drug that increases the amount of glutamine present in many cells. The increased
glutamine appears to reduce the amount of oxidative stress the cells experience, which increases
their functional life spans. The drug does not correct genetic mutations, nor does it promote faster
red blood cell production or vascular smooth muscle relaxation. It does not affect the percentage of
HbF within the red blood cells.
PTS: 1
7. ANS: D
The hemoglobin change caused by the genetic mutation of SCD does reduce the susceptibility to
severe malaria on exposure to or infection with the organism. This benefit occurs in both those who
are homozygous for the gene mutation and in those who are heterozygous. The disorder does not
provide a benefit or reduce risk for development of type 1 diabetes, hypercholesterolemia, or
cholera.
PTS: 1
8. ANS: A
Sickle cell disease is an autosomal-recessive genetic disorder. This woman does not have either
sickle cell disease or sickle cell trait, as evidenced by the fact that her HbS levels are less than 1%.
Thus, regardless of her partner’s sickle cell status, she will not have a child with actual sickle cell
disease. However, if her partner is a carrier, any child she has with this partner has a 50% risk of
having sickle cell trait. If her partner has sickle cell disease, any child she has will be a carrier of
sickle cell trait.
PTS: 1
9. ANS: D
The disorder is inherited as an autosomal-recessive single-gene trait and is most common among
Caucasians of Northern and Western European heritage, although it can be found among people of
all races and ethnicities. The incidence of CF in the United States among Caucasians is about 1 in
3,000 live births. Carrier status, in which a person has only one mutated gene allele, is estimated at 1
in 20 to 30 Caucasian Americans.
PTS: 1
10. ANS: C
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Genetic testing is not used to diagnose the homozygous expression of CF. It is diagnosed on the
basis of physical manifestations and the results of the sweat chloride test. Positive results are those
indicating a high concentration of sodium chloride in the person’s sweat (60 to 200 mEq/L or
mmol/L) compared with the normal value (5 to 35 mEq/L). Genetic testing by direct sequencing of
the CFTR gene is useful for establishing carrier status, identifying affected children prenatally, and,
to some degree, predicting disease severity but is not used as primary diagnostic testing.
PTS: 1
11. ANS: B
Cystic fibrosis is inherited as an autosomal-recessive single-gene trait. Therefore, in virtually all
cases, both parents are carriers. A patient’s brother and sister would each have a 50% risk for being
carriers.
PTS: 1
12. ANS: C
The two main organ systems affected involve epithelial cells and are the lungs and the pancreas. The
epithelial cells in these tissues produce a thick, sticky mucus as a result of poor chloride transport
that, over time, plugs up the glands in these organs, causing glandular atrophy and organ dysfunction
or failure. Other organs that are affected to a far lesser degree include the liver, salivary glands, and
testes.
PTS: 1
13. ANS: B
The specific mutation inherited in cystic fibrosis (CF) can make a big difference in the severity of
symptoms. There are well over 1,000 different mutations, and some cause milder clinical signs and
symptoms. The ethnicity of the patient is not relevant. CF is an autosomal-recessive single-gene trait,
making triplet repeats not relevant. Although nongenetic liver or pancreatic problems in a person
with CF could make some symptoms worse, this is not a common cause of variability in the severity
of CF symptoms.
PTS: 1
14. ANS: D
The high frequency of the heterozygous carrier state for cystic fibrosis (CF) among Caucasians from
Northern and Western Europe suggests that being a CF carrier might have a potential advantage.
Scientists now believe people who are heterozygous or homozygous for specific common CFTR
mutations have greater resistance to typhoid and to cholera toxin when exposed to these disease-
causing microorganisms.
PTS: 1
15. ANS: C
DMD is an X-linked recessive disorder, and females with the gene mutation are carriers. These
women often have reduced muscle strength and cardiac problems related to random X-inactivation
in these tissues even though they only have one mutated gene allele. The disorder is not affected by
advanced maternal age.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
16. ANS: A
Most patients with DMD will die in the late teenage years or early adulthood, and they do not
typically have children. There is little variability in the severity of DMD. Those with milder cases
are thought to have Becker muscular dystrophy. Although deletions are possible, the dystrophin gene
is so large that it is an easy target for a variety of mutations. Adhesion proteins are not involved.
PTS: 1
17. ANS: C
Children with DMD have hugely elevated blood levels of the enzyme creatine kinase (CK) and the
protein myoglobin during their early childhood years. Both are normally present inside intact muscle
cells. When the cells are damaged or die, CK and myoglobin are released into the blood. These
levels decrease as the child ages because there is a limit to how much muscle is available to be
destroyed. Therefore, lower levels in older children indicate disease progression, not disease
improvement. Switching to passive exercise does not decrease muscle damage. BMD has a slower
rate of muscle destruction with a more consistent level of blood CK over time.
PTS: 1
18. ANS: D
Most boys with DMD develop cardiac muscle problems because these cells also rely on dystrophin
to maintain their integrity. The most common problems are dilated cardiomyopathy and chronic
heart failure. There are fewer problems with smooth muscle. Those that are present do not cause
vasoconstriction. Thus, hypertension is not a common problem. The muscles rather than joints are
affected, and arthritis does not develop. There is no known association of DMD with the
development of diabetes.
PTS: 1
19. ANS: B
The genetic mutation for Duchenne muscular dystrophy is on the X chromosome and is transmitted
in an X-linked recessive manner. Although the spontaneous mutation rate for this disease is
relatively high, the fact that she has two brothers with the disorder, rather than just one, strongly
suggests this mutation was inherited, not spontaneous. Thus, her mother is a carrier of an X-linked
recessive genetic mutation. This young woman’s risk for having inherited the mutation on her
maternally derived X chromosome is 50%, not 100%. If she were a carrier, she may or may not have
any symptoms of the disorder depending on which X is inactivated in her skeletal muscle and
cardiac muscle tissues. The absence of symptoms does not clearly rule out a carrier status for her.
PTS: 1
20. ANS: A
Some female carriers of DMD show partial gene expression and can demonstrate symptoms of the
disease. It is very likely that she is a carrier because this X-linked recessive disease has been seen in
her family. It is highly unlikely that she would have received two defective dystrophin genes from
her parents because men with DMD tend not to father children.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
21. ANS: C
Hemophilia B is a less common form of the disorder resulting from a mutation in the gene for
clotting factor IX rather than for clotting factor VIII. This gene is also located on the X chromosome,
and the inheritance pattern is the same as for hemophilia A. Both disorders show few if any problems
right after birth because maternal clotting factors are still circulating in the newborn. Other
symptoms and issues are essentially the same.
PTS: 1
22. ANS: C
The F8 gene is located on the X chromosome (Xq28). Because males have only one X chromosome,
which is inherited exclusively from their mothers, hemophilia has a sex-linked (X-linked)
transmission pattern. Males are either affected or unaffected; they cannot be carriers. Few females
are born with classic hemophilia because the disease is so severe in the homozygous state that these
individuals die during early embryonic life. Females can be carriers. Most female carriers of classic
hemophilia have reduced levels of factor VIII and have excessive bruising and bleeding. Although
the spontaneous mutation rate for the gene causing this disorder is relatively high, it is not related to
advanced maternal age.
PTS: 1
23. ANS: D
Genetic testing is not used to diagnose classic hemophilia. It is diagnosed on the basis of physical
manifestations and low levels of factor VIII. Hematocrit and hemoglobin levels are not specifically
diagnostic for hemophilia. X-chromosome inactivation does not occur in males. Carriers can be
identified by the presence of lower-than-normal levels of factor VIII, longer-than-average PTT, and
F8 gene sequencing to determine the presence or absence of the specific mutation identified within
the family.
PTS: 1
24. ANS: B
Type 2 VWD type is associated with abnormal or defective vWf, even though the amount produced
is normal. Types 1 and 3 have lower circulating levels of vWf. Currently, no type 4 VWD has been
identified.
PTS: 1
25. ANS: A
The VWF gene is located on an autosome, chromosome 12. Type 1 VWD is inherited in an
autosomal-dominant pattern; however, because of reduced penetrance, at times, a family pedigree
can give the appearance of an autosomal-recessive pattern, although there is not a true carrier status.
With reduced penetrance, a person who does not manifest the disorder can transmit the affected gene
to his or her children, who then may express the disorder. Males and females are affected equally.
PTS: 1
26. ANS: C
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Type 3 VWD results in extremely low levels of von Willebrand factor (vWf), and bleeding is so
excessive that the infant or child may first be thought to have hemophilia. For both types 1 and 2,
affected individuals may not be diagnosed during childhood because symptoms are not viewed as
serious, others in the family have the same problems and have learned how to manage them, or too
few serious bleeding episodes have occurred in the younger years. Currently, no type 4 VWD has
been identified.
PTS: 1
27. ANS: C
The gene mutation causing achondroplasia is the FGFR3 gene that codes for the fibroblast growth
factor receptor 3. This gene is on chromosome 4, which is an autosome. This means that the
incidence is equal for males and females. The appearance at birth is very obvious, with
disproportionately short arms and legs. These proportions are maintained throughout life. The
fertility of males and females with achondroplasia is not affected by the disorder.
PTS: 1
28. ANS: D
The neck is very short, with an abnormal junction between the posterior head and neck. This
abnormality can compress the cervical spinal cord and is believed to be a factor in the common
occurrence of sleep apnea in these individuals. In addition, infants with achondroplasia have a higher
incidence of sudden infant death syndrome (SIDS) than children without achondroplasia, which may
be attributable to the abnormal head and neck junction or to stenosis of the opening in the skull
through which the spinal cord exits (foramen magnum). Cognitive impairment, hearing impairment,
and color blindness are not consistent features of achondroplasia.
PTS: 1
29. ANS: C
Achondroplasia follows an autosomal-dominant transmission pattern, although spontaneous
mutations are responsible about 75% to 80% of the time. It is very common for a child with
achondroplasia to be born to parents without the disorder and who have no other family members
with the problem.
PTS: 1
30. ANS: D
Most of the physical features of achondroplasia, including disproportionately short extremities, large
head, and prominent forehead, are present in all individuals who have the disorder. One variable
feature is hydrocephaly. This occurs in some but not all children with the disorder.
PTS: 1
31. ANS: A
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Susceptibility to development of type 1 diabetes mellitus (DM) as an autoimmune problem is

partially determined by inheritance of the human leukocyte antigen (HLA) genes coding for the
HLA-DR and HLA-DQ tissue types located on chromosome 6. However, this complex disorder also
requires an environmental interaction, most often in the form of a viral infection. Sedentary lifestyle
and childhood obesity are not associated with type 1 DM, just type 2. The disorder is not related to
faulty pancreatic development of genetic origin. It is not related to advanced maternal age.
PTS: 1
32. ANS: D
Type 1 diabetes is an autoimmune disorder. The risk for developing the disease is increased but
appears to require an additional environmental contribution within a susceptible developmental
window. Most often, that environmental trigger is a viral infection.
PTS: 1
33. ANS: A
Insulitis is a problem resulting from the cause of type 1 diabetes. It is infiltration of the islet cells by
white blood cells, resulting in inflammation of the islet cells. This problem does not occur in type 2
diabetes because it is not an autoimmune disease. Hyperglycemia is a feature of both types and leads
to polydipsia in both types. Patients with type 1 diabetes are often underweight or normal weight.
Weight gain is associated with type 2 diabetes.
PTS: 1
34. ANS: C
Common areas of identified genomic variation associated with atopic asthma include those areas that
contain genes coding for proteins that are important in regulating inflammatory reactions and
immune responses. One of the strongest associations currently identified with susceptibility to
asthma involves 8 to 12 different single-nucleotide polymorphisms at the 1q31 locus, encoding the
gene DENND1B, which produces a protein strongly active in the work of two dendritic-type cells of
the immune system, the macrophage and the mast cell. Both of these cell types are involved in
nonspecific inflammatory responses and in acquired (adaptive) immune responses that develop
individually in susceptible people when they are exposed to an allergen.
PTS: 1
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 12: Common Adult-Onset Genetic Disorders
Multiple Choice
____ 1. Why are complex or multifactorial disorders more commonly expressed among adults than
among children?
A. As adults age there is more time for environmental factors to influence the
expression of a genetic disorder.
B. Gene expression in adults is greater than in childhood as a result of age-related
amplification of gene copy numbers.
C. Children have better DNA repair mechanisms than adults and are more likely to
correct a predisposition for a complex disorder.
D. In order for a complex or multifactorial disorder to be expressed in childhood, the
child must be homozygous for the genetic mutation.
____ 2. Why is predictive testing for Huntington disease avoided for a 4-year-old child who has one
grandparent with the disorder?
A. Unless one of the parents is positive for the gene mutation, a negative finding
would be noninformative.
B. The Huntington disease mutation is poorly penetrant and may never be expressed
even when inherited.
C. A 4-year-old child cannot understand or participate in the genetic counseling
process.
D. There are no effective primary or secondary prevention strategies for this disorder.
____ 3. Why do the clinical signs and symptoms of hereditary hemochromatosis not appear until
middle adulthood?
A. The adult over 50 has had more exposures to environmental insults over time.
B. Prolonged dietary exposure to toxins produces clinical symptoms.
C. Hereditary hemochromatosis has age-related penetrance.
D. Stored iron builds up over time causing organ damage.
____ 4. Why are women usually older than men before symptoms of hereditary hemochromatosis
manifest? A. Women have a counterbalancing normal gene on their second X chromosome.
B. Women lose some iron with normal menstruation during childbearing years.
C. Men have a larger muscle mass and more iron-storing capability than women.
D. Men have greater expression of the gene for hemoglobin than do women.
____ 5. If a man with hereditary hemochromatosis has children with a woman who is a carrier for the
disorder, what is the expected risk pattern?
A. All sons will be affected; all daughters will be carriers.
B. Daughters have a 50% risk for being affected; all sons will either be affected or
carriers.
C. Each child of either gender has a 50% risk of being a carrier and a 50% risk of having
the disease.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 6. What do each of the genes involved in Maturity-Onset Diabetes of the Young (MODY) have in
common?
A. They are all located on the long arm of chromosome 6.
B. They each play a role in metabolism of glucose, or insulin action and release.
C. Although they are of different sizes, they all contain the same exon and intron
sequences.
D. The genes that cause MODY are expressed only in the young and suppressed during
adulthood.
____ 7. What factors increase the clinical severity of alpha-1 antitrypsin (ATT) deficiency?
1. Whether or not the person smokes
2. Whether or not the person uses alcohol
3. The severity of disease in affected relatives
4. The specific alleles of the genes inherited
A. 1 and 4
B. 2 and 3
C. 2 and 4 D. 4 only
____ 8. A 31-year-old man has been diagnosed with chronic obstructive pulmonary disease (COPD) as a
result of being homozygous for the ZZ mutation of the alpha1-antitrypsin (AAT) gene alleles. His
wife has been tested and does not have a mutation of her AAT gene alleles. The man is worried
that his three children may eventually develop COPD. What is your best response?
A. “Because your wife does not have the mutation and neither of your parents have the
disease, your children will not be affected.”
B. “Because your wife is not affected nor is a carrier, your children will have normal levels
of AAT and their risk is the same as for the general population.”
C. “Because you have the mutations and your wife does not, your son will be at an
increased risk for developing COPD but your daughter will only be a carrier.”
D. “Because your children will each have only one mutated gene allele, their risk for
COPD is primarily dependent on chronic environmental exposure to inhalation
irritants.”
____ 9. Which factor is consistent with Multifactorial (Complex) Genetic
Disease? A. Expression of the trait often involves mutations in several genes.
B. Monozygotic (identical) twin concordance is 100%.
C. Genotype consistently predicts phenotype.
D. It tends to be autosomal dominant.
____ 10. What can be interpreted about type 2 diabetes mellitus in monozygotic twins when it
affects only one twin 70% of the time and affects both twins 30% of the time? A. The trait is
recessive.
B. Mutation repair is incompletely penetrant.
C. Nongenetic factors can influence expression.
D. Homologous genes can undergo chromatid exchanges.
____ 11. An obese patient (Body Mass Index of 35) states “There is no point in changing how I eat
because it is all genetics anyway.” What is the best response?
A. “Even with a large genetic component, obesity can be reduced by sensible diet and
exercise.”
B. “Let’s gather some more family history about body height, weight, and eating patterns.”
C. “You are right, you can’t change your genes. There is no point in dieting.”
D. “With your genetics, your best bet would be a low-carb Atkins-type diet.”
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 12. Which condition or factor most strongly supports a genetic basis for development of type 2
diabetes mellitus?
A. Type 2 diabetes occurring in two cousins before age 30 years
B. The disease developing in a person whose parents also have type 2 diabetes
C. The incidence of disease concordance is higher in dizygotic twins than in monozygotic
twins
D. The fact that type 2 diabetes is more prevalent in one city than it is in another similar
size city
____ 13. Which statement best explains the “thrifty genotype” for the high incidence of type 2
diabetes?
A. The person with a thrifty genotype has an efficient metabolism that generates
more energy from less food and is more likely to survive famine.
B. The person with a thrifty genotype conserves the energy lost from the body as
heat and requires less rest to perform the same amount of work.
C. The person with a thrifty genotype stores energy rather than expends energy so
that more energy is available for survival when food is scarce.
D. The person with a thrifty genotype feels satiety with smaller amounts of food and
is less likely to become obese, thus increasing longevity.
____ 14. Which genetic disorder is associated with an increased risk for type 2 diabetes?
A. Achondroplasia
B. Down syndrome
C. Huntington disease
D. Hereditary hemochromatosis
____ 15. Which statement regarding autoimmune diseases is true?
A. Autoimmune disorders and diseases are more common among females than among
males.
B. Autoimmune disorders and diseases are more common among males than among
females.
C. The main characteristics of an autoimmune disorder are a reduced inflammatory
response and increased susceptibility to infection.
D. The main characteristics of an autoimmune disorder are a reduced inflammatory
response and increased resistance to infection.
MULTIPLE CHOICE
1. ANS: A
Complex or multifactorial disorders are not single gene conditions. They are the result of polygenic
input and environmental interactions. Thus, the longer a person has been exposed to the
environment, the more input the environment has on the expression of a polygenic problem. DNA
repair efficiency has no relationship to age; it is related to the quality of the repair mechanisms a
person inherits. Although gene amplification can occur, it is neither an age-related phenomenon nor
a cause of adult-onset complex disorders.
PTS: 1
2. ANS: D
The Huntington disease mutation has a high penetrance, which means that a person who inherits
the mutation will eventually express the disease. It also means that if a person is negative for this
mutation, he or she will never develop this disease. At the present time, there is no way to prevent
the disorder in a person who has the mutation. Identifying the child at this age as having the
mutation provides no benefit. Although it is true that a child of this age could not understand or
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
participate in the genetic counseling, if a treatment was possible, it would be worth performing the
test anyway.
PTS: 1
3. ANS: D
The cause of organ damage and symptoms in hereditary hemochromatosis is the buildup of stored
iron over time. This is a single gene disorder and environmental factors such as diet and
environmental insults do not play a significant role. Hereditary hemochromatosis does not have
agerelated penetrance.
PTS: 1
4. ANS: B
Women with hereditary hemochromatosis do not show signs of iron overload until a later age than
men, often not until well after menopause, because the menstrual cycle provides natural and
regular blood iron loss every month. The gene for hereditary hemochromatosis is on an autosome,
not on the X chromosome.
PTS: 1
5. ANS: C
The disease is expressed in an autosomal recessive pattern of inheritance and the individual must
be homozygous to express the disease. Although males express the disorder at earlier ages than
females, both genders are equally expressed. Because the man is homozygous for the mutation and
the woman is heterozygous, any children he fathers have a 4 out of 4 chance (100% risk) to inherit a
mutated allele from him. Each child has a 2 out of 4 chance (50% risk) to inherit a mutated allele
from the carrier woman. There is no chance for children of this couple to not inherit at least one
mutated allele.
PTS: 1
6. ANS: B
All the genes causing MODY are involved in metabolism of glucose, or insulin action. They are not all
located on chromosome 6 and are expressed throughout life. They have different exon and intron
sequence.
PTS: 1
7. ANS: A
Some ATT genotypes (such as the SZ and ZZ genotypes) confer higher risk of clinical disease. Risk for
severe disease is increased by smoking, as well as by the specific gene alleles inherited. The severity
of disease in relatives and the use of alcohol have not been shown to increase risk.
PTS: 1
8. ANS: D
Although all of this man’s children have inherited one mutated AAT allele from him, because his
wife is not a carrier, the children are heterozygous for this mutation. The production of sufficient
quantities of AAT is dependent on the inheritance of a pair of normal gene alleles because the AAT
gene is recessive. When one of the pair of gene alleles is missing or mutated and the other gene
allele is normal, the person makes enough AAT to prevent COPD unless there is significant exposure
to cigarette smoke and other precipitating factors. When two mutated alleles are inherited, COPD
develops at a fairly young age even when the person is not exposed to cigarette smoke or other
irritants.
PTS: 1
9. ANS: A
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Multifactorial (Complex) Genetic Disease involves the actions of several gene variants contributing a
small amount of risk and/or the combination of genetic and environmental risk factors. If
monozygotic twin concordance is 100%, then the risk is entirely genetic and the disorder has a
single gene cause. If genotype consistently predicts phenotype, the trait has a single gene cause and
autosomal dominant disorders also have a single gene cause.
PTS: 1
10. ANS: C
Type 2 diabetes mellitus is a complex or multifactorial disorder. Although there is a genetic
predisposition, which both members of a set of monozygotic twins would inherit equally,
environmental influences (especially obesity and sedentary lifestyle) greatly influence the
development of this disease.
PTS: 1
11. ANS: A
Although genetic factors can influence metabolism and food satiety, increasing energy output and
decreasing energy (calorie) intake causes weight loss.
PTS: 1
12. ANS: B
Although type 2 diabetes does not strictly follow Mendelian patterns of inheritance, the evidence
for genetic input is strong. About 7% of people in the general population will get T2DM at some
point in their lives, but 30% to 40% of people who have one affected parent will become affected.
The risk is 70% for people who have two affected parents. Higher concordance among dizygotic
twins than among monozygotic twins supports more environmental input than genetic input.
Incidence between two cities is not related to genetic influences. Cousins are not first-degree
relatives. The presence of the same relatively common disorder only in two cousins within a kindred
does not provide strong support of genetic influence.
PTS: 1
13. ANS: C
During historical times when populations experienced periods of plenty followed by times of
famine, those people who were better at storing fat survived to pass on their genes to their
offspring. People who were not metabolically “thrifty” would be less able to store fat and they
would not survive during times when there was little food.
PTS: 1
14. ANS: B
Genetic syndromes or disorders that include an increased risk of DM are Down syndrome, Turner
syndrome, and Klinefelter syndrome. The risk for diabetes among the other three genetic disorders
listed is not greater than that for the general population.
PTS: 1
15. ANS: A
Women are much more vulnerable to autoimmune diseases than men. For example, systemic lupus
erythematosus (SLE) is eight times more common among women than among men. One possible
explanation for this gender difference in disease expression is the inactive X chromosome that all
women carry in each cell as a potential epigenetic effect on gene expression in the genome.
Autoimmune diseases are over actions of the immune system and inflammatory responses, not
reduced activity.
PTS: 1
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Powered by TC PDF ( www.tc pdf.org)
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 13: Cardiovascular Disorders
Multiple Choice
__C.__ 1. Which condition or factor for coronary artery disease (CAD) suggests a greater genetic contribution
than environmental contribution to its development?
A. When a person develops CAD 5 years after quitting smoking
B. When CAD occurs in a person who has normal blood pressure
C. When CAD is diagnosed in a person who is younger than 50 years
D. When low-density lipoprotein levels can be reduced by dietary changes alone
__C.__ 2. The process in which gene variants interact with other gene variants to cause disease can be
described by what word/phrase?
A. Phenotype variation
B. Reduced penetrance
C. Epistasis
m
D. Variable expressivity
er as
__C.__ 3. What is the most accurate classification of the common forms of coronary artery disease and
co
eH w
hypertension?
A. Secondary disorders caused by lifestyle choices
o.
B. Sequential genetic disorders related to age, ethnicity, and gender
rs e
C. Complex disorders resulting from gene–environment interactions
ou urc
D. Primary disorders with an autosomal-dominant pattern of inheritance
__A.__ 4. What is the genetic contribution to the development of the most common forms of atherosclerosis?
o
A. Variation in a variety of genes, with each exerting a small effect

aC s
B. Disordered mitochondrial function reducing energy production

vi y re
C. Genetic predisposition expressed after exposure to a viral trigger

D. Single-gene mutation following autosomal-dominant inheritance
__A.__ 5. Your 40-year-old patient is hospitalized for a myocardial infarction, but her lipid levels are normal.
ed d
She says that she would like to have a genetic test to see why she was affected at such a young age.
What do you say?
ar stu
A. “Heart attacks seem to be caused by a combination of many affected genes

working together as well as environmental factors. There is no single gene test that
will be able to identify why this happened to you.”
is
B. “Let’s talk with your nurse practitioner about scheduling a test for familial
hypercholesterolemia.”
Th
C. “You really shouldn’t be concerned about your genetic risk. Because you are
female, it is very low.”
D. “It was just bad luck combined with the fact that you were once a smoker.”
sh
__B.__ 6. Which variable in a person with coronary artery disease (CAD) increases the likelihood of a strong
genetic influence in its expression?
A. The disorder is not present in the person’s dizygotic twin.
B. The disorder is present in a woman whose father had CAD.
C. The affected person has eaten a vegetarian diet for the past 5 years.

https://www.coursehero.com/file/66383431/Cardiovascular-Disorders-Practice-Questions-CH13docx/
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. The disorder is present in about 5% of the person’s maternal family members.
__D.__ 7. Which total plasma cholesterol levels are most likely to be present in people who are homozygous
for an allele that causes familial hypercholesterolemia?
A. 100 mg/dL to 200 mg/dL
B. 200 mg/dL to 300 mg/dL
C. 400 mg/dL to 500 mg/dL
D. 600 mg/dL to 1,200 mg/dL
__C.__ 8. Which problem associated with Tangier disease increases the risk for coronary artery disease?
A. Low levels of triglycerides
B. High levels of triglycerides
C. Low levels of high-density lipoproteins (HDLs)
D. High levels of low-density lipoproteins (LDLs)
__B.__ 9. Which physical finding in a 30-year-old man suggests the possibility of familial
hypercholesterolemia?
A. Lipomas
m
B. Xanthomas
er as
C. Osteoarthritis
co
D. Hemangiomas
eH w
__D.__10. For patients who have familial hypercholesterolemia, what should be the focus of teaching for blood
o.
cholesterol reduction?
rs e
A. Eliminating animal fats from the diet
ou urc
B. Increasing the amount of fruit in the diet
C. Exercising at least 4 to 5 hours every week
D. Taking the lipid-lowering drug as prescribed
o
aC s
__B.__11. What is true about the gene variants that cause hypertension?
vi y re
A. A few genes with major contributions have been identified.

B. Genes that code for proteins in the RAAS pathways are often involved.
C. Hypertension is always secondary to another genetic disease.
D. Polymorphisms have little or no impact on the hypertensive phenotype.
ed d
__B.__12. Your patient has been diagnosed with long QT syndrome (LQTS). What do you know about this
ar stu
heart rhythm problem?

A. LQTS is a congenital genetic disease that will be evident during the first 2 years of
life.
is
B. It is relatively rare and often caused by private mutations.

C. LQTS is treated in the same way, no matter the cause.
Th
D. Deafness always accompanies LQTS.
__B.__13. Which health problem is the most frequent cause of sudden cardiac death among young athletes?
sh
A. Atrial fibrillation
B. Hypertrophic cardiomyopathy
C. Familial hypercholesterolemia type 1
D. Romano-Ward form of long QT syndrome
__A.__14. Why is the mitochondrial disease MELAS, which results in stroke-like episodes in addition to
encephalopathy and lactic acidosis, only transmitted by a mother and not by an affected father?

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A. The mitochondria are in the cytoplasm, and virtually all the cytoplasm comes from
the egg and is thus maternally inherited.
B. This is an X-linked-recessive condition, so the father can only transmit the gene to
his daughters and not to his sons.
C. Mitochondria are in the cytoplasm and are not equally divided during gamete
formation in meiosis.
D. MELAS reduces the percentage of Y-carrying sperm in affected males.
__D.__15. How does factor V Leiden increase the likelihood of stroke?

A. Factor V Leiden activates protein C.
B. Factor V Leiden increases thrombin formation.
C. People affected with factor V Leiden have increased blood viscosity.
D. Affected people have a type of factor V that is resistant to activated protein C.
__C.__16. Which ethnic group is at higher risk for stroke caused by factor V Leiden?
A. Ashkenazi Jews
B. African Americans
C. Caucasians from Northern Europe
m
D. French Canadians from the Quebec area
er as
co
__B.__17. Why is factor V Leiden disorder considered a form of thrombophilia?
eH w
A. Platelet activity is impaired.
B. Blood clots form more easily.
o.
rs e
C. Atherosclerosis development is accelerated.
ou urc
D. Excessive bleeding episodes occur in response to minor trauma.
__A.__18. Why is determining the genetic contribution to the onset of stroke difficult?
A. Stroke classification and phenotype remain heterogeneous.
o
B. Comorbidities mask the symptoms and delay the diagnosis.

aC s
C. Environmental risk factors have equal contribution to the problem.

vi y re
D. Often the person with a stroke cannot provide accurate family information.
__A.__19. Which lysosomal storage disease is associated with an increased risk for stroke?
A. Fabry disease
ed d
B. Gaucher disease
ar stu
C. Hurler syndrome
D. Tay–Sachs disease
__A.__20. What term is used to describe the gene-to-gene interaction in which the action of one gene modifies
is
the expression of a different gene?

A. Epistasis
Th
B. Heterogeneity
C. Genomic imprinting
D. Epigenetic penetrance
sh
__C.__21. What do the known monogenic disorders that result in the expression of hypertension have in
common?
A. An error in the ability of vascular smooth muscle to contract
B. An error in the ability of vascular smooth muscle to relax
C. Excessive kidney reabsorption of sodium

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Excessive kidney excretion of potassium
__B.__22. Which statement about atrial fibrillation is correct?

A. It is the most common genetic cardiac disorder worldwide.
B. A variety of different genes can contribute to its expression.
C. It is found exclusively in adults over 60 years old.
D. When severe, it leads to long QT syndrome.
__D.__23. Which lethal cardiac arrhythmia can occur as a complication of long QT syndrome?
A. Atrial node reentry tachycardia
B. Prolonged atrial fibrillation
C. Mitral valve prolapse
D. Torsade de pointes
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
References
Beery, T. A., Workman, M. L., & Eggert, J. A. (2018). Genetics and Genomics in Nursing and Health Care
2nd Edition. Retrieved from Davis Plus: https://davisplus.fadavis.com/ProductDetail/ProductDe-
tail?urls=nursing-advanced-practice-genetics-genomics-health-care-beery-workman-2
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 14: The Genetics of Cancer
Multiple Choice
____ 1. A patient states that she has heard that the origin of most cancers is “genetic.” What is the best
response?
A. “The development of most cancers is predetermined and not affected by
environmental factors.”
B. “Cancers arise in cells that have alterations in the genes.”
C. “Cancer is more common among males than females.”
D. “The majority of cancers are inherited.”
____ 2. Which theory of carcinogenesis has the most support?

A. DNA damage, which permits overexpression of oncogenes
B. RNA damage, which results in incomplete protein formation
C. Autoantibodies, which attack specific “self” tissues and organs
D. The failure of embryonic tissues to undergo normal differentiation
____ 3. By which process does “promotion” assist in cancer development?

A. Inflicting mutations at specific sites on the exposed cell’s DNA
B. Stimulating or enhancing cell division of cells damaged by a carcinogen
C. Increasing the transformed cell’s capacity for error-free DNA repair
D. Making cancer cells appear more normal and escaping immunosurveillance
____ 4. How is progression different from metastasis?

A. Progression cannot occur unless the process of metastasis occurs first.
B. Metastasis occurs in both benign and malignant cells, whereas progression is a
feature that is unique to malignant cells.
C. Metastasis is dependent on gene mutations in suppressor genes, and progression is
dependent on gene mutations in oncogenes.
D. Progression involves continual gene changes in a cancer cell that enhance its
degree of malignancy, whereas metastasis is the ability of the cell to invade other
tissues.
____ 5. Which of the following benign tumors usually express aneuploidy?
A. Lipomas
B. Leiomyomas
C. Neurofibromas
D. Neuroblastomas
____ 6. How is a complete carcinogen different from an incomplete carcinogen?

A. Complete carcinogens damage oncogenes, and incomplete carcinogens damage
suppressor genes.
B. Complete carcinogens damage suppressor genes, and incomplete carcinogens
damage oncogenes.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
C. Incomplete carcinogens are more likely to induce sporadic cancers.

D. Complete carcinogens are more likely to induce sporadic cancers.
____ 7. Which statement regarding the biology of cancer is always true?

A. Cancer cells arise from normal cells.
B. Testicular cancer is strongly associated with excessive masturbation.
C. When cancer cells are exposed to air, their growth rate becomes uncontrolled.
D. The biggest risk factor for cancer development is having a first-degree relative
with cancer.
____ 8. Which of these qualities is common to cancer cells?
A. Apoptosis of damaged cancer cells occurs at a high rate.
B. Telomeres of cancer cells have pronounced shortening.
C. Their production of cell adhesion molecules is excessive.
D. They continue to grow even when surrounded by other cells.
____ 9. How are malignant tumors different from benign tumors?

A. Malignant tumors grow by expansion, and benign tumors grow by invasion.
B. Malignant tumors lose plasma membranes, and benign tumors continue to produce
them.
C. Benign tumors retain parental cell functions, and malignant tumors lose parental
cell functions.
D. Benign tumors have totally normal features, and malignant tumors have totally
abnormal features.
____ 10. Which feature is considered anaplastic?
A. Loss of a distinctive appearance
B. Having a larger nuclear-to-cytoplasmic ratio
C. Failure to undergo apoptosis at the appropriate time
D. The ability to undergo mitosis when nutrition is poor
____ 11. Which cancer type is associated with a 9;22 translocation t(9;22)?
A. Acute promyelocytic leukemia
B. Acute lymphocytic leukemia
C. Chronic lymphocytic leukemia
D. Chronic myelogenous leukemia
____ 12. By which process does “initiation” assist in cancer development?

A. Enhancing the cell division of cells damaged by a carcinogen
B. Inflicting mutations at specific sites on the exposed cell’s DNA
C. Increasing the transformed cell’s capacity for error-free DNA repair
D. Making cancer cells appear more normal and escaping immunosurveillance
____ 13. Which statement best describes the role of tumor suppressor genes in cancer development?
A. Tumor suppressor genes control or modify the activity of oncogenes, reducing the
risk for cancer development.
B. The presence of tumor suppressor genes increases the risk for gene damage by
environmental carcinogens.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
C. Tumor suppressor genes reduce/suppress immune function, increasing the risk for
cancer development.
D. Tumor suppressor genes are a type of oncogene that is only active in germline cells
and tissues.
____ 14. Which type of body tissue has the highest risk for cancer development?
A. Bone tissue because its absorption of radiation is cumulative
B. Connective tissue that remains functional throughout life
C. Brain tissue because it does not respond well to injury
D. Any tissue that retains the ability to divide
____ 15. What event occurring during the latency period of carcinogenesis is most likely to contribute to
cancer development?
A. Cellular apoptosis
B. Error-free DNA repair
C. Exposure to promoters
D. Oncogene inactivation
____ 16. What is the result of a mutation occurring in a suppressor gene?
A. Gain of a new function
B. Loss of an existing function
C. Increased “error-prone” DNA repair
D. Increased unequal “crossing over” during meiosis I
____ 17. Which statement regarding general cancer development is true?

A. The risk for cancer development increases with age.
B. Cancers usually develop in tissues that are missing a nucleus.
C. Children of older mothers have a greater risk for cancer development.
D. Most mutations leading to cancer development occur in structural genes.
____ 18. How does an MSH2 gene mutation contribute to the development of colon cancer?
A. Suppressor gene function is enhanced.
B. DNA mutations are incorrectly repaired.
C. Trinucleotide repeat sequences are enhanced.
D. Drug resistance genes undergo amplification.
____ 19. Why are people who have poor DNA repair mechanisms at greater risk for cancer development?
A. Their cancers are usually resistant to chemotherapy.
B. They have sustained the initial “hit” in all cells and tissues.
C. Their somatic mutations are more likely to be permanent.
D. They have greater exposure to environmental carcinogens.
____ 20. How does an acquired mutation in a somatic cell gene leading to cancer development affect a
person's ability to pass on a predisposition for that cancer type to his or her children?
A. The predisposition can only be passed on if the person with the somatic cell
mutation is female.
B. The risk for predisposition is dependent upon which tissue type experienced the
somatic mutation.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
C. Multiple somatic mutations are required for passing on a predisposition to cancer

development.
D. There is no risk of passing on a cancer predisposition from a somatic cell mutation.
____ 21. What is the function of a normal BRCA1 gene?

A. Enhances overall cell growth during puberty
B. Directs the development of normal breast tissue
C. Increases the expression of cytochrome P450 enzymes
D. Suppresses the growth potential of a variety of oncogenes
____ 22. Which feature is associated exclusively with sporadic cancer?

A. The cause is unknown.
B. It usually affects both bilateral organs.
C. It occurs at the same frequency within a kindred as in the general population.
D. It is more likely to occur in younger people with few environmental risks than in
older people.
____ 23. What percentage of common cancers appears to be hereditary?
A. 1% to 3%
B. 5% to 15%
C. 20% to 25%
D. About 35%
____ 24. Which characteristic(s) is/are associated with an inherited predisposition for a cancer type?
A. Cancers tend to appear at an earlier age than do “sporadic” cancers.
B. These cancers are not picked up by routine cancer screening methods.
C. The carcinogenesis stage of “promotion” is not required for cancer development.
D. They are passed on only to the children of the same gender as the parent with the
predisposition.
____ 25. Juliet tells a nurse that she has three aunts (two on her father’s side, ages 42 and 56, and one on her
mother’s side, age 62) who were diagnosed with breast cancer. She asks if she should have genetic
A. “Your family history indicates a high risk, and you should definitely have genetic
testing.”
B. “Because no men in your family are affected, it is not inherited cancer, so you
C. “Because your aunts were older when they got breast cancer, it was probably
sporadic, and you should just have regular mammograms like everyone else.”
D. “Your family history may indicate an increased risk for breast cancer, and a genetic
counselor could help determine whether you could benefit from genetic testing.”
____ 26. A 40-year-old man who has a mother who was diagnosed with breast cancer at age 45, a father who
was diagnosed with smoking-related lung cancer at age 55, a 33-year-old sister with breast cancer,
and a 38-year-old sister with ovarian cancer asks if he should be concerned for his cancer risk. What
is the best response?
A. “Your risk is not affected by this family history because most of the cancers arose
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
in female sex–associated tissues.”

B. “You have two first-degree relatives and two second-degree relatives with cancer,
which increases your general risk for cancer.”
C. “Your risk for breast cancer may be increased and requires more investigation;
however, your risk for lung cancer is not affected by this history.”
D. “Your risk for cancer is affected by your parents’ cancer development, and you
should have genetic counseling on that basis; however, your sisters’ cancers have
no bearing on your risk.”
____ 27. Which statement about a “germline” mutation in either a cancer suppressor gene or an oncogene is
accurate?
A. Cancer risk is increased only in sex hormone–sensitive tissues.
B. The gene now has expressive potential but not penetrant potential.
C. Cancer risk increases, but additional mutations are required for cancer
development.
D. A person inheriting such a mutation has a 100% risk for developing a specific
cancer type.
____ 28. A 22-year-old college student tells his nurse practitioner in the student health center that his mother
died of colon cancer at age 32. He asks if this could have an impact on his health. What is your best
response?
A. “Yes, you need to have yearly stool tests for occult blood.”
B. “Yes, it would be good for you to talk with a genetics counselor.”
C. “No, because colon cancer is considered a type of sporadic cancer.”
D. “No, your risk would only be increased if your father had the colon cancer.”
Multiple Response
____ 29. Which personal factors indicate the possibility of a person having a BRCA1 or BRCA2 mutation?
Select all that apply.
A. The person has an adopted sister with ovarian cancer.
B. The person’s brother was diagnosed with breast cancer.
C. The person has always been 20 lb overweight as an adult.
D. The patient’s father died of pancreatic cancer at age 44.
E. The person is of Ashkenazi Jewish ethnicity.
F. The person’s 78-year-old grandmother was just diagnosed with breast cancer.
____ 30. Mutations in which of the following genes are now known to greatly increase the risk for developing
breast cancer? Select all that apply.
A. APC
B. CDH1
C. CHEK2
D. DCC
E. PALB2
F. PTEN
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 14: The Genetics of Cancer

Answer Section
MULTIPLE CHOICE
1. ANS: B
Cancer development involves changes in the genes that regulate cell division. Although cancer is
inherited from one cell generation to the next, most cancers and the risk for cancer development are
not inherited from one’s parents; however, there are exceptions.
PTS: 1
2. ANS: A
Damage to the DNA can reduce the function of suppressor genes or enhance the function of
oncogenes. Both types of damage reduce the regulation of cell growth, allowing growth-promoting
oncogenes to be overexpressed.
PTS: 1
3. ANS: B
Initiation changes the structure or location of specific genes, usually oncogenes or tumor suppressor
genes, altering their function. However, if cell division and growth do not occur, a cancer does not
develop. Although promoters do not affect gene structure or location, they are growth-promoting
factors that allow the mutations to be expressed as some form of abnormal cell growth.
PTS: 1
4. ANS: D
Metastasis only occurs in malignant cells. Progression also occurs only in malignant cells and
involves further changes in genes that confer advantages to the cancer, causing it to lose more
differentiated functions and become more highly malignant. Progression is a process that allows
metastasis, not the other way around.
PTS: 1
5. ANS: A
Aneuploidy is having abnormal chromosome numbers and/or structures. Most benign tumors have
normal chromosomes, a condition known as euploidy. Lipomas, which are benign fatty tumors, most
often have structural rearrangements of chromosomes 6, 12, or 13. Leiomyomas and neurofibromas
are benign tumors that are euploid. Although neuroblastoma is aneuploid, it is a malignant tumor.
PTS: 1
6. ANS: D
Complete carcinogens damage DNA for both suppressor genes and oncogenes and do not require
additional exposure for promotion. They are most commonly associated with sporadic cancers rather
than targeting genes that have already undergone a genetic change that increases predisposition to
cancer development. Incomplete carcinogens do not have promoting capabilities and require that the
initiated cells be exposed to a promoter before cancer can occur.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
7. ANS: A
A key concept in cancer development is that cancer cells arise from normal cells through changes in
genes that control cell division. (So, cancers are not alien beings from the planet carcinoma that just
happened to invade the body.) Exposure to air does not change a cancer cell’s growth rate.
Masturbation is not related to testicular cancer development. Having a first-degree relative with
cancer is only a risk factor for those cancers that have an inherited or familial pattern. These make up
only a very small percentage of cancers.
PTS: 1
8. ANS: D
A major feature of cancer cells is their lack of contact inhibition when membranes are touched on all
sides by other cells. The telomeres do not shorten but are maintained by higher levels of telomerase.
They stop producing cell adhesion molecules and become migratory. Apoptosis does not occur
among cancer cells.
PTS: 1
9. ANS: C
Over time, malignant cells express fewer and fewer functions of the parental cells, whereas benign
tumor cells retain parental cell functions. All cells must have plasma membranes for the life of the
cell. Benign tumors grow by expansion, and malignant tumors are invasive. Although benign tumor
cells retain many normal features and characteristics, they are not totally normal, or they would not
form a tumor. The mere existence of benign tumor cells indicates that the strict regulation of growth
has been overcome to some degree.
PTS: 1
10. ANS: A
Anaplasia is the loss of the specific differentiated appearance (morphology) of mature cells. Having
a large nuclear-to-cytoplasmic ratio is a feature of cancer cells but does not constitute anaplasia. Loss
of apoptosis and being able to divide when nutrition is poor are both functional changes rather than
appearance changes.
PTS: 1
11. ANS: D
As cancer cells become more malignant, they usually become aneuploid, with gains or losses of
whole chromosomes, chromosome breakage, and the structural rearrangements of chromosomes.
Some chromosomal rearrangements are unique to a cancer type and can be used to identify it as a
specific cancer type. A chromosome rearrangement in which the ends of the q arms of chromosome
22 are translocated to the q arms of chromosome 9 results in the activation of a special tyrosine
kinase that converts bone marrow cells into chronic myelogenous leukemia.
PTS: 1
12. ANS: B
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The initial step or initiation in cancer development is mutating the DNA in such a way that either
suppressor genes cannot perform their functions in cell growth regulation or oncogenes become
resistant to suppressor gene control. Any substance or event that can damage DNA has the potential
to mutate suppressor genes or oncogenes and is a carcinogen. Initiation is an irreversible event that
can lead to cancer development if the cell’s mitotic ability remains intact.
PTS: 1
13. ANS: A
Suppressor gene regulation of cell division appears lost or defective in cancer cells, and oncogenes
are then overexpressed, which leads to uncontrolled mitosis. They are not a type of oncogene, and
they do not regulate immune function.
PTS: 1
14. ANS: D
Most cancers arise in tissues that have retained mitotic ability. The chance that these tissues will
undergo spontaneous DNA replication error is greater than that for nondividing tissue. Also, most
tissue types that remain mitotically active are located in body areas where tissue injury and exposure
to environmental carcinogens are more common.
PTS: 1
15. ANS: C
Not all initiation events lead to cancer development. A major factor in having an initiated cell or
tissue undergo malignant transformation is continuing exposure to promoters or promoting events
during the latency period. DNA repair, apoptosis, and oncogene inactivation are more likely to lead
to correction of the gene damage that occurred during initiation or suppression of cell division than
they are to carcinogenesis.
PTS: 1
16. ANS: B
The most common way initiation leads to excessive oncogene expression and cancer development is
by damaging any one of many suppressor genes. When a suppressor gene is damaged, it loses some
or all of its function and can no longer express its products in the proper amounts to control
oncogene expression.
PTS: 1
17. ANS: A
Although the risk for cancer development is higher in some families, most cancers are the result of
exposure to environmental carcinogens. As a person ages, his or her exposures increase, and the
damage is cumulative. Aging is the biggest risk factor for cancer development.
PTS: 1
18. ANS: B
The MSH2 gene is a DNA repair gene. When it is mutated, damaged DNA is either incorrectly
repaired or not repaired. This problem can result in either mutations in suppressor genes or mutations
in oncogenes. In either case, oncogene expression is increased, and cell growth is unregulated.
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
19. ANS: C
DNA damage occurs on a daily basis for any person. Most of this damage is repaired by DNA repair
mechanisms before cancer can develop. For those people who have poor DNA repair mechanisms,
these constant and random DNA mutations do not get repaired and are permanent, often constituting
initiation.
PTS: 1
20. ANS: D
Somatic mutations occur after conception in somatic tissues rather than germline tissues. Because
only germline tissues are passed to one’s children, mutations in somatic cells only affect the
individual who developed them and are not passed on to the next human generation.
PTS: 1
21. ANS: D
The BRCA1 gene is a suppressor gene that is normally active in people of both genders. Its function
is to control the expression of many oncogenes. It has no role in normal breast development, puberty,
or enzyme function.
PTS: 1
22. ANS: C
Sporadic cancers usually occur as a result of environmental exposure or unknown factors and do not
have any observable pattern of inheritance within a kindred, nor do they have an increased frequency
within a kindred. At the cell level, mutations through carcinogenesis have occurred, disrupting the
normal regulation of cell division, usually among somatic cells. These cancers are not present in
higher-than-expected levels within three or more family generations. Although the cause of the
cancer is not always known (making primary prevention difficult), there is no genetic predisposition
for it.
PTS: 1
23. ANS: B
Overall, the percentage of cancers that occur as a result of the inheritance of a germline gene
mutation ranges between 5% and 15%. Although this is a low percentage, people who have these
mutations are at great risk for cancer development.
PTS: 1
24. ANS: A
Inherited cancers tend to appear at earlier ages because the process of initiation of one allele
occurred at conception. So, these cells essentially have already gone halfway through initiation at
conception and only require one additional allele mutation followed by promotion for a malignancy
to occur. They are autosomal mutations and can be inherited by children of either gender and are
detected by the same screening methods used for sporadic cancers.
PTS: 1
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
25. ANS: D
Juliet’s aunts on her father’s side were younger than 60 when they were affected. This would raise
concern that there might be genetic risk factors in the family. The fact that they are on her father’s
side makes no difference in genetic risk, and it is unclear whether or not Juliet should have genetic
testing until she speaks with a genetics professional who can take a thorough family history and
accurately discuss her risk.
PTS: 1
26. ANS: C
This man has four first-degree relatives with cancer (not just two). Those affected by breast cancer
meet several criteria for inherited cancer. Even though the concerned patient is male, if he is BRCA1
positive, his risk for breast cancer (and some other types of cancers) would be increased. Most lung
cancer is sporadic, with a strong environmental component, although a familial susceptibility can
exist (but the genetic input is not known).
PTS: 1
27. ANS: C
There are a number of inherited germline mutations of suppressor genes or oncogenes that greatly
increase the risk for cancer development. These cells essentially have already gone halfway through
initiation at conception and only require one additional allele mutation followed by promotion for a
malignancy to occur. This is why the cancer tends to appear at earlier ages than expected. Although
its presence does not absolutely mean that the person will go on to develop cancer, the risk is much
higher than for people who do not carry such a mutation.
PTS: 1
28. ANS: B
Death from colon cancer in early adulthood is a red flag for a genetic predisposition. However, this
risk needs to be assessed by a genetics professional, not a general nurse practitioner. Although
checking stools for occult blood once yearly is a good idea, it is not sufficient surveillance if this
student does have an increased risk for colon cancer. Colon cancer, either the sporadic type or one
with a genetic predisposition, affects both genders equally.
PTS: 1
MULTIPLE RESPONSE
29. ANS: B, D, E
The indications of a possible BRCA1 or BRCA2 mutation in a family are as follows:
o Cancers occurring at younger than 50 years of age
o Breast cancer in male relatives
o Breast cancer in both breasts
o Triple-negative breast cancer (no estrogen, progesterone, or human epithelial
growth receptors [HER2] on the surface of the cellular membrane)
o Presence of a second primary cancer in the same patient
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
o Ashkenazi Jewish ethnicity

o Presence of family members with both breast and ovarian cancers
o History of pancreatic cancer in any family member
o Confirmation of a BRCA1/2 genetic mutation in the family
PTS: 1
30. ANS: B, C, E, F
Along with BRCA1 and BRAC2, these four genes are associated with an increased risk for breast
cancer development. APC is associated with an increased risk for colon cancer, stomach cancer, and
pancreatic cancer. DCC is associated with an increased risk for colorectal cancers.
PTS: 1
Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 15: Genetic Contributions to Psychiatric and Behavioral Disorders
Multiple Choice
____ 1. What is meant by the phrase “behavioral genetics”?

A. Identification of the single gene that corresponds to a specific undesired behavior
B. An area of research aimed at controlling behavior by genetic manipulation
C. The study of the behavior of genes in diverse settings
D. The examination of gene variants that influence behaviors
____ 2. Which statement regarding behavioral genetics is accurate?

A. Genes and gene products have been discovered that directly control behavior.
B. A genetic predisposition toward a specific behavior can be modified by altering
environmental influences.
m
C. The genotypes and phenotypes of behavioral problems or deviations follow
er as
Mendelian autosomal-recessive inheritance patterns.
co
D. The genetic susceptibility to or predisposition toward a behavioral disorder
eH w
requires the trigger of an infectious disease for expression.
o.
____
rs e
3. Why is direct-to-consumer marketing of diagnostic tests for mental illness and behavioral problems
ou urc
a dangerous practice?
A. Because the tests are expensive and not ordered by a health-care provider, they are
not covered by insurance.
o
B. The tests are not predictive of which psychiatric medications are most likely to be
aC s
beneficial to a specific individual.

vi y re
C. People using such tests may not receive professional counseling for interpretation
of results and accurate risk assessment.
D. These tests are often misused by employers to support the dismissal of employees
who express opinions that are different from those of the company.
ed d
ar stu
____ 4. Which statement about attention deficit hyperactivity disorder (ADHD) is true?
A. The problem is more common among girls whose fathers also had the disorder.
B. By the time a person with ADHD reaches adulthood, all symptoms have resolved.
C. It is a complex disorder caused by gene variants along with environmental
is
contributions.
Th
D. Symptoms of the disorder are ameliorated when the person sleeps more soundly as
a result of pharmacologic intervention.
____ 5. What is the best description of the genetic contribution to the onset of autism?
sh
A. Autism spectrum is caused by a single-gene mutation in most, but not all, cases.
B. Exposure to a teratogen can be a cause of autism spectrum in many cases.
C. Known causes of autism spectrum include copy-number variants and chromosomal
problems.
D. Autism spectrum disorders have a much stronger environmental input than genetic
input to expression of the phenotype.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 6. Which condition provides the greatest support for a strong genetic contribution to autism spectrum
disorders (ASDs)?
A. Concordance among dizygotic twins is 10%.
B. Males are affected four times more frequently than females.
C. People with some neurologic disorders also have features of ASDs.
D. ASDs are more likely to occur in children of parents who are over 35 at the time of
conception.
____ 7. Which assessment finding in a 3-year-old child increases the suspicion for a possible diagnosis of
autism spectrum disorder?
A. Language skills are delayed.
B. The child is very near-sighted.
C. Height is below the 5th percentile.
D. The child does not sit still during the assessment interview.
m
____ 8. Why is pharmacogenetics/pharmacogenomics of particular interest in treating patients with
er as
psychiatric/mental health problems?
co
A. Psychiatric medications may be effective in only a small group of patients.
eH w
B. Genetics restricts patients to only one drug in each classification.
o.
C. Most psychiatric illnesses are single-gene disorders with predictable drug
responses.
rs e
ou urc
D. Psychotropic medications have few side effects.
____ 9. Which condition or behavior suggests attention deficit hyperactivity disorder (ADHD)?
A. A 5-year-old who does not want to go to bed at 8:00 p.m. and begs to be allowed to
o
stay up later
aC s
B. An 8-year-old who can hop on one foot but cannot ride a bicycle without training
vi y re
wheels
C. A 9-year-old who does not focus on a favorite story or game for longer than 3
minutes
ed d
D. A 10-year-old who prefers to play basketball rather than chess

ar stu
____ 10. Why are single-nucleotide polymorphisms (SNPs), which have been associated with schizophrenia
and bipolar disorder, currently not used to diagnose either of these disorders?
A. The changes in gene activity caused by the SNPs is not sufficient to cause disease
is
expression.
Th
B. SNPs are associated with nicotine dependence but not with schizophrenia or
bipolar disorder.
C. The SNPs are too small to result in either a frameshift mutation or a point
mutation.
sh
D. These SNP-induced gene changes cannot be altered by pharmacologic therapy.
____ 11. Schizophrenia is reported to have a heritability estimate as high as 80%. What does this mean?
A. If a parent has schizophrenia, each child has an 80% risk of getting schizophrenia.
B. If we look at a population, 80% of the risk for schizophrenia comes from genetics.
C. If your patient’s sibling has schizophrenia, her risk of getting schizophrenia is

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
80%.
D. Genetics contributes 20% to the risk of schizophrenia.
____ 12. At what point in human development is the phenotype of schizophrenia most likely to manifest?
A. Between birth and 10 years
B. At the onset of puberty
C. At adolescence or early adulthood
D. With the onset of the physical decline associated with older age
____ 13. An adult daughter whose mother has bipolar disorder is concerned that she may also have the
disorder because she engages in all of the following behaviors. Which behavior should be explored
further as a manifestation of bipolar disorder?
A. Crying whenever she looks at a picture of a close friend who died 3 months ago
B. Refusing to allow her husband to participate in general housekeeping chores
C. Having a strong sense of sleepiness daily in the middle of the afternoon
D. Making frequent purchases of expensive clothing that she never wears
m
er as
____ 14. A 48-year-old woman reports that her 50-year-old brother has severe bipolar disorder, and she is
co
concerned that her two teenage daughters may be predisposed to the problem. She has no manic or
eH w
depressive symptoms. How should you respond to her concerns?
o.
A. “If your household is stable and loving, your daughter’s increased risk can be
minimized.”
rs e
ou urc
B. “If your husband also has no symptoms of the disorder, your daughters have the
same risk as the general population.”
C. “Because the heritability of bipolar disorder is 50%, it is likely that only one of
o
your two daughters will develop the disorder.”

aC s
D. “Because your brother is a blood relative, your daughters have a risk for bipolar
vi y re
disorder that is two to three times greater compared with the general population.”
____ 15. What is the heritability estimate for addiction to alcohol in both males and females?
A. 10% to 20%
ed d
B. 20% to 40%
ar stu
C. 50% to 60%
D. 60% to 80%
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 15: Genetic Contributions to Psychiatric and Behavioral Disorders

Answer Section
MULTIPLE CHOICE
1. ANS: D
Behavioral genetics is the area of study that focuses on the gene variants that influence behaviors.
Behaviors are unlikely to be caused by single-gene problems, and it is unlikely that behaviors will be
controlled by genetic manipulation.
PTS: 1
2. ANS: B
The interaction of genes, environments, and behaviors is very complex, and a genetic predisposition
for a certain behavior may be altered over time with changes in diet and parenting. Genes and/or
gene products may influence behavior but do not directly control it. No mental illness or behavior
m
er as
disorder always follows autosomal-recessive inheritance patterns. At the present time, although an
co
environmental trigger has been speculated to result in the expression of a predisposition to a
eH w
behavioral disorder, no trigger has been identified.
o.
PTS: 1
rs e
ou urc
3. ANS: C
Although it is true that the tests can be expensive and not covered by insurance, and they are not
predictive of which drugs would be most beneficial, the biggest danger is that the person testing at
o
home does not have resources to interpret results and assess risk. The outcomes of such testing could
aC s
have a devastating effect on a person who tested positive but did not have appropriate access to a
vi y re
counselor for interpretation of this result. Testing of any person for any reason without his or her
knowledge and assent is illegal.
PTS: 1
ed d
4. ANS: C
ar stu
Genome-wide association studies (GWASs) provide substantial support that ADHD is a complex
(multifactorial) disorder caused by the actions of many gene variants along with environmental
contributions. GWASs have found regions on more than 10 chromosomes that are associated with
is
ADHD in some people. The disorder is much more prevalent among males and is not dependent on
which parent may also have had the problem. More sleep does not ameliorate the problem. Although
Th
many adults who had ADHD as a child have fewer symptoms in adulthood, about 2% to 4% retain
most symptoms into adulthood.
sh
PTS: 1
5. ANS: C
Autism is a diverse disorder associated with a variety of genetic and environmental issues. Genetic
causes of autism include chromosomal problems and copy-number variants. Exposure to teratogens
is the cause in a small number of cases, and single-gene causation is rare. Between 1% and 3% of
people with autism have fragile X syndrome.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
6. ANS: A
Dizygotic (fraternal) twin concordance is about 10%. This may not seem very high at first glance,
but it is about 100 times higher than the risk of autism in someone from the general population. That
is a huge difference and indicates that autism is probably highly heritable. The increased incidence
of ASD among males compared with females suggests a possible biologic contribution but not
necessarily a genetic contribution. Because some features of ASD indicate neurological problems or
deficits, people who have known neurologic problems may share these characteristics, but the origin
can be different. Advanced parental age has not been consistently associated with ASD.
PTS: 1
7. ANS: A
Delay of language skills in early childhood is a hallmark of autism spectrum disorders (ASDs),
although they also are associated with other problems. Visual disorders do not consistently
m
accompany ASDs, and neither does short stature. Most 3-year-olds have difficulty sitting still during
er as
any type of interview.
co
eH w
PTS: 1
o.
8. ANS: A
rs e
Many psychiatric patients are prescribed a variety of drugs before they find one that works well for
ou urc
them. PGx promises to help clinicians find the right drug for the right patient by drug-response
genetic testing. Most psychiatric diseases are not single-gene problems, and psychotropic
medications tend to have significant numbers of side effects.
o
aC s
PTS: 1
vi y re
9. ANS: C
The hallmark of ADHD is not just being physically active, which many healthy children are, but not
being able to focus on anything, even those events or activities the child really enjoys.
ed d
PTS: 1
ar stu
10. ANS: A
Schizophrenia, bipolar disorder, and nicotine dependence have been found to have single-nucleotide
polymorphisms (SNPs) that alter a single DNA base. However, so far, these SNPs have not been
is
shown to be significant enough to bring about a psychiatric disorder. Instead, they increase or
Th
decrease the risk by a small fraction, much less than twofold, so testing one of these does not warrant
developing it as a diagnostic test. SNPs do cause a point mutation and can cause a frameshift
mutation. At this time, no gene changes in psychiatric or behavioral disorders can be altered by
pharmacologic therapy.
sh
PTS: 1
11. ANS: B

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The heritability estimate for schizophrenia is about 80%, which refers to the cause of the variation of
the phenotype within a population and not causes within a given family. Even though the heritability
estimate is 80%, that does not mean that if a mother is schizophrenic that each of her children has an
80% risk of being schizophrenic. It does mean that examination of the variations in phenotype in
specific populations demonstrates that about 80% can be attributed to genetics and about 20% can be
attributed to environment.
PTS: 1
12. ANS: C
Environmental and genetic factors both have roles in the development of schizophrenia, although the
exact nature of the genetic influence has yet to be determined. Copy-number variants appear to play
the most important role in risk for the disorder. The most common age of onset is early adulthood.
Monozygotic (identical) twin concordance is between 40% and 50%. It is likely that there are
epigenetic contributions as well. There is no laboratory test that can determine if someone has
schizophrenia, and sometimes the variability in the phenotype makes diagnosis based on clinical
m
observation and self-report difficult.
er as
co
PTS: 1
eH w
13. ANS: D
o.
Bipolar disorder (BPD) is characterized by episodes of mania and depression that usually follow
rs e
each other in cycles. The manic episodes consist of at least 1 week of elated or irritable mood that is
ou urc
accompanied by racing thoughts and highly pressured speech. The person is easily distracted and
agitated and may engage in hypersexuality and out-of-control spending. Crying when reminded of
the recent death of a loved one is not true depression, and neither is afternoon sleepiness. Insisting
o
on performing all housekeeping chores more likely indicates an issue with role identification or
aC s
association than manic behavior.

vi y re
PTS: 1
14. ANS: B
ed d
The risk for the disorder increases when an affected person is a first-degree relative. If neither parent
ar stu
has the disorder, this risk for the two daughters does not increase above that for the general
population because an uncle is a second-degree relative. The heritability estimate suggests that the
risk is about even between genetic and environmental factors.
is
PTS: 1
Th
15. ANS: C
It appears that nearly equal genetic and environmental influences contribute to addiction to alcohol.
The heritability estimate is between 50% and 60%.
sh
PTS: 1

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 16: Genetic and Genomic Testing
Multiple Choice
____ 1. How is cell-free DNA (cdDNA) testing being used clinically?

A. To determine a person’s risk for developing breast cancer
B. As an inexpensive alternative to standard paternity testing
C. As a less invasive way to determine the characteristics of cancer cells
D. As a way to determine whether a specific suspect has committed a rape
____ 2. Genetic testing that examines an asymptomatic person’s DNA sequence, looking for mutations that
increase a person’s susceptibility to a disease, is an example of which type of testing?
A. Diagnostic testing
B. Predispositional testing
m
C. Presymptomatic testing
er as
D. Cytogenetic testing
co
eH w
____ 3. Which tissue is most likely to provide an adequate DNA sample for genetic testing?
A. Distal ends of hair shafts
o.
B. Mature red blood cells
rs e
ou urc
C. Nasal epithelial cells
D. A mummy's tooth
____ 4. What type of genetic test provides information about an asymptomatic person’s risk for having a
o
child with a specific autosomal-recessive disorder in the future?

aC s
A. Carrier test
vi y re
B. Diagnostic test
C. Newborn screening
D. Predictive test
ed d
____ 5. Under which condition can preimplantation genetic testing be performed?

ar stu
A. During in vitro fertilization

B. Between 4 to 6 weeks’ gestation
C. When paternity is unknown
is
D. When an ultrasound indicates the fetus has a structural abnormality

Th
____ 6. Genetic testing of an asymptomatic woman whose sister is positive for the mutation that is
responsible for an autosomal-dominant disorder that has a 70% penetrance rate would fall into which
testing category?
A. Diagnostic predisposition
sh
B. Diagnostic presymptomatic
C. Predictive predisposition
D. Predictive presymptomatic
____ 7. Which type of genetic testing is the most sensitive method for detecting any mutation in a specific
gene?

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A. Immunohistochemistry
B. Direct DNA sequencing
C. Banded chromosomal analysis
D. Fluorescence in situ hybridization
____ 8. Which type of genetic testing examines a person’s chromosomes for variations in number or
structure?
A. Cytogenetic testing
B. Preimplantation testing
C. Predictive testing
D. Electropherogram testing
____ 9. How is the polymerase chain reaction (PCR) helpful in the process of genetic testing?
A. Preserving genetic material within a sample so that more sophisticated tests can be
performed as they become available with future technologic advancements
B. Separating exons from introns and establishing which DNA strand is the “sense”
m
strand
er as
C. Determining whether a small amount of DNA is paternal or maternal in origin
co
D. Increasing the amount of DNA being tested, thus promoting accuracy
eH w
o.
____ 10. What is the major disadvantage to the fluorescence in situ hybridization (FISH) method of genetic
testing?
rs e
ou urc
A. Single-nucleotide mutations cannot be detected.
B. Depending on the skill of the technician, the rate of false positives is high.
C. The sample for testing must be obtained from living tissue rather than from a
o
preserved specimen.
aC s
D. Results are not available quickly because cells must first be grown in culture before
vi y re
testing can be performed.

____ 11. When is fluorescence in situ hybridization (FISH) most likely to be used?
A. To find a gene associated with a particular disease
ed d
B. To determine whether a stillborn infant has trisomy 13

ar stu
C. To determine the carrier status of a child whose sister has cystic fibrosis
D. To establish a diagnosis for a possible adult-onset single-gene disorder
____ 12. A woman whose sister tested positive for a specific mutation in the BRCA1 gene, which increases
is
the risk for breast and ovarian cancer, is found not to have that mutation but does have a mutation of
unknown significance near the known mutation site. How should this woman be counseled?
Th
A. She should be informed that her risk for breast cancer is greater than that of the
general population but not as great as her sister’s risk.
B. She should be informed that because she does not have the mutation, her risk for
sh
breast cancer is not greater than that of the general population.

C. She should be informed that she does not have the specific mutation but that
because another mutation is present, she should be vigilant about screening.
D. She should be informed of her gene-mutation status and be presented with all the
available prophylaxis options and reconstruction options.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 13. A patient is 34 years old and concerned about possibly being a carrier for HNPCC because his father
died of colon cancer at 39, his father’s sister died of colon cancer at age 41, and his brother (aged 37)
now has colon cancer. The brother’s testing is negative for all the known mutations associated with
inherited forms of colon cancer. How should this patient be counseled about his risk for colon
cancer?
A. Explain that because the brother with cancer is negative for these gene mutations,
this cancer is most likely sporadic, and his risk is the same as that for the general
population.
B. Explain that he could benefit from testing even though his brother is negative for
these mutations because reduced penetrance might account for his negative status.
C. Explain that testing for him would be of no benefit because of the current test
limitations but that his family history does place him at high risk.
D. Explain that his risk is not related to his brother’s diagnosis because he did not
inherit any genes from him, but because his father is a first-degree relative, testing
should be considered.
m
er as
co
Multiple Response
eH w
o.
rs e
____ 14. Which genetic-based disorders can be initially identified by the most common types of newborn
ou urc
blood screening? Select all that apply.
A. Congenital hypothyroidism
B. Cystic fibrosis
o
C. Galactosemia
D. Hereditary hemochromatosis
aC s
E. Phenylketonuria
vi y re
F. Sickle cell disease

ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 16: Genetic and Genomic Testing

Answer Section
MULTIPLE CHOICE
1. ANS: C
Cell-free DNA is small pieces of nongenomic DNA circulating in the blood that can be collected
from plasma or urine. These very small pieces of circulating cfDNA originate from the fetus in
pregnant women or tumors in cancer patients. Because this technology is noninvasive, it offers a
reduced risk of complications compared with the currently used invasive technologies. It can be used
for some types of fetal testing. In oncology, cfDNA is being used to identify information about the
tumor, including the genetics, amount of burden, mechanisms of progression, and drug resistance.
Another advantage of this developing technology is that it costs much less.
PTS: 1
m
er as
2. ANS: B
co
Predispositional testing is done when having a gene variant increases the likelihood that a person
eH w
will develop a genetic disease, but that does not mean that the person is certain to get it. Diagnostic
o.
testing is done to confirm or rule out a particular diagnosis in a symptomatic person. Presymptomatic
rs e
testing indicates that the individual will develop the disease he or she was tested for at some point in
ou urc
the future. Cytogenetic testing is the examination of chromosomes for markers, structural
rearrangements, and abnormalities of number.
o
PTS: 1
aC s
3. ANS: C
vi y re
Any tissue with a true nucleus, such as nasal epithelial cells, can provide DNA for genetic testing.
The distal ends of hair shafts do not contain cells with a nucleus; only the hair root does. Mature red
blood cells have no nucleus (and no mitochondria). A mummy’s tooth would have enamel with no
cells, and the tooth pulp would be long gone.
ed d
ar stu
PTS: 1
4. ANS: A
A carrier test indicates if a person is heterozygous for a mutation that can cause an autosomal-
is
recessive disease. A predictive test provides information about an asymptomatic person’s risk of
getting a genetic disease in the future. Newborn screening provides information about whether or not
Th
a baby is likely to have the disease being tested for, and a diagnostic test indicates whether or not a
person currently has a given disease.
sh
PTS: 1
5. ANS: A

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Preimplantation genetic diagnosis is a process only done in conjunction with in vitro fertilization
because it is performed on early embryonic cells that are in a petri dish and have never been in the
mother’s body. A group of embryos generated by in vitro fertilization is removed from the eight-cell
blastocyst. Cells from each embryo can be tested to find gene variants causing single-gene disorders
or chromosomal problems, or to determine sex. One or two “healthy” embryos are then selected for
implantation.
PTS: 1
6. ANS: C
The test is predictive rather than diagnostic because the woman does not have any symptoms of the
disorder. So, the test is not being performed to confirm or rule out a disorder diagnosis. The test is
also considered “predisposition” testing rather than “presymptomatic” testing because the disorder
has a 70% penetrance rate. This means that even if the woman is positive, she has a 30% chance of
never developing symptoms but has a genetic predisposition to the disorder.
m
PTS: 1
er as
7. ANS: B
co
DNA sequencing is the analysis of the bases in a stretch of DNA. This type of testing is considered
eH w
the most sensitive because it can even detect a difference in one base within a sequence. It is also
o.
expensive and is not used unless no other type of test can provide appropriate critical and accurate
information. rs e
ou urc
PTS: 1
8. ANS: A
o
The type of test that examines chromosomes is cytogenetic testing. Preimplantation testing examines
aC s
an embryo generated by in vitro fertilization before it is implanted. Predictive testing tests an

vi y re
asymptomatic person to determine future genetic risk. An electropherogram is a graphic illustration

of the nucleotide sequence in a sample.
ed d
PTS: 1
9. ANS: D
ar stu
The polymerase chain reaction precisely expands or amplifies a specific segment DNA so that more
of it is available for testing. PCR itself does not test the DNA directly for anything, cannot itself
determine whether DNA or a gene is paternal or maternal, and does not preserve specimens.
is
However, because of amplification, PCR can help ensure that enough DNA is present to reliably
Th
perform an accurate analysis. This amplification may allow more of a specimen to be preserved but
does not actually preserve the specimen.
PTS: 1
sh
10. ANS: A

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
FISH examines portions of chromosomes, not the sequence of individual nucleotides. The test can
determine the number of chromosome copies, areas of duplication, or deletions; however, even with
microdeletions, the test cannot detect changes in segments that are smaller than 100 nucleotides.
FISH can be performed on preserved tissue as well as living tissue specimens. It is an accurate test
with great specificity and a low risk for either false positives or false negatives.
PTS: 1
11. ANS: B
FISH is often used to identify chromosomal variations in number or structure and to identify
deletions or duplications. The goal is to determine the presence or absence of a chromosomal type of
genetic variation.
PTS: 1
12. ANS: C
Inconclusive test results can be confusing to patients. These results mean that a known mutation has
m
not been identified, but some gene variant has been found. It is unknown at this time whether or not
er as
it can result in increased cancer risk. This patient should continue with recommended screening
co
guidelines based on her family history.
eH w
o.
PTS: 1
13. ANS: C rs e
ou urc
Further testing for common mutations would be of no benefit to this patient. His risk is not known
but should be considered high on the basis of family history. Although some of the more common
single-gene mutations responsible for serious health problems have been identified, not all have been
o
identified. In addition, some mutations may be specific for a family and not present in the general
aC s
population. When a disorder can be identified by family history as following autosomal-dominant

vi y re
inheritance patterns, but no known mutation has been identified, all first-degree relatives should be
managed in terms of surveillance, screening, and prophylaxis as if they had a known mutation.
ed d
PTS: 1
ar stu
MULTIPLE RESPONSE
is
14. ANS: A, C, E, F
Newborn screening is done to identify those infants at high risk of a variety of disorders for which
Th
immediate treatment or intervention is available. The tests are usually biochemical rather than gene
based, but results can indicate the likelihood of a genetic disorder being present. Although testing
varies somewhat by state, every state tests for these autosomal-recessive disorders: phenylketonuria,
sh
congenital hypothyroidism, galactosemia, and sickle cell disease.
PTS: 1

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 17: Assessing Genomic Variation in Drug Response
Multiple Choice
____ 1. Which of the following is a goal of pharmacogenetics?

A. Producing “blockbuster drugs” that will work equally well for everyone
B. Bringing down the cost of pharmaceutical manufacturing
C. Developing drugs that will treat very rare diseases
D. Reducing adverse reactions
____ 2. Which processes of drug response are most subject to genetic variation?
A. Drug dissolution in body fluids and drug binding to plasma proteins
B. Rates of drug movement into and through the gastrointestinal tract
C. Drug activation or deactivation and duration of drug actions
m
D. Drug binding with receptors and drug blocking of receptors
er as
co
____ 3. Which statement about agonist and antagonist drugs is true?
eH w
A. Both drugs types must interact with receptors to produce their intended responses.
B. The primary target tissues for these types of drugs are invading bacteria and
o.
viruses.
rs e
ou urc
C. Antagonists drugs produce only intended responses, and agonist drugs produce
both intended responses and side effects.
D. These types of drugs are less likely to cause allergic responses than drugs that are
o
neither agonists nor antagonists.

aC s
____ 4. What is the expected heart-rate response when a patient is taking a drug that is an adrenaline
vi y re
antagonist?
A. Heart rate is unchanged.
B. Heart rate decreases.
ed d
C. Heart rate increases.

D. Heart rate is irregular.
ar stu
____ 5. How do genetic/genomic issues influence individual variation in the response to a specific drug?
A. Polymorphisms of genes encoding metabolizing enzymes
is
B. Age-related loss of alleles within the cells lining the intestinal tract
C. Single-gene disorders that reduce the function of the kidneys or the liver
Th
D. Genetic-based behavior problems that promote poor adherence to prescribed drug

regimens
____ 6. Which organ has the greatest concentration of cytochrome P (CYP) 450 enzymes?
sh
A. Stomach
B. Kidney
C. Brain
D. Liver

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 7. How are the actions of naturally occurring estrogen changed when a patient is taking a drug that is
an estrogen agonist?
A. Actions are increased.
B. Actions are decreased.
C. Actions are eliminated.
D. Actions are unchanged.
____ 8. Which type of parent compound must undergo first-phase metabolism to produce the intended
response after it enters the body?
A. A prodrug
B. An active metabolite
C. An inactive metabolite
D. A sustained-released drug
____ 9. What would be the patient’s response to a normal drug dose that, because of a genetic variation in an
enzyme that prepares the drug for elimination, results in a blood drug level that is below the
m
minimum effective concentration (MEC)?
er as
A. Drug entry exceeds drug elimination.
co
B. The risk for toxic side effects is increased.
eH w
C. The intended response fails to be produced.
o.
D. The drug’s duration of action is longer than expected.
rs e
ou urc
____ 10. A patient has a very high concentration of insulin receptors on cells that require insulin for glucose
to enter. How should insulin dosages be adjusted for this patient to have blood glucose levels within
the normal range?
o
A. Insulin dosages should be given less frequently because the drug will remain bound
aC s
to receptors longer.
vi y re
B. Insulin dosages should be decreased because the drug will exert its actions at lower
concentrations.
C. Insulin dosages should be given more frequently because the drug will be
eliminated at a faster rate.
ed d
D. Insulin dosages should be increased because cells will be less sensitive to the
ar stu
presence of active insulin.

____ 11. Which condition or factor improves the initial bioavailability of a drug agonist that has extensive
is
first-pass loss as a result of the patient’s enhanced liver enzyme activity?

A. Increasing the patient’s fluid intake
Th
B. Co-administering the drug with an antagonist

C. Administering the drug by the intravenous route
D. Crushing the oral form of the drug before administration
sh
____ 12. A patient with a fractured elbow in the emergency department states that he needs morphine for pain
rather than codeine because the last time he had a painful injury, codeine was not effective in
managing his pain. What is the nurse’s best response or action?
A. Ask the patient how much alcohol he ingests daily.
B. Communicate this information to the admitting physician.
C. Alert the health-care provider that this patient is “drug-seeking.”

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
D. Reassure the patient that he will receive progressively higher dosages of codeine
until his pain is controlled.
____ 13. A patient is identified as an ultra-rapid metabolizer for drugs that are prepared for elimination by
CYP2D6. What effect will this have on the patient’s ability to benefit from any active drug that is
metabolized by this enzyme?
A. Intended responses increase, whereas side effects decrease.
B. Intended responses decrease, whereas side effects increase.
C. Both intended responses and side effects increase.
D. Both intended responses and side effects decrease.
____ 14. What is the most likely outcome for a patient with glucose-6-phosphate dehydrogenase (G6PD)
deficiency when he or she takes aspirin or an antimalarial drug?
A. Rapid elimination of the drug with no benefit
B. Liver damage or failure
C. Hemolytic anemia
m
D. Fluid retention
er as
co
____ 15. An Asian American man and his Caucasian wife are both taking warfarin (Coumadin) daily because
eH w
of atrial fibrillation. The husband asks why he is prescribed a much-smaller-than-average dose of the
o.
drug to keep his international normalized ratio (INR) at 2.0, whereas his wife takes the average dose,
rs e
even though he is taller and heavier than she is. What is the nurse’s best response?
ou urc
A. “Body size is not important for warfarin, but gender differences are because
testosterone improves its action.”
B. “You are probably anemic, which would reduce your ability to form blood clots, so
o
your doses can be lower.”

aC s
C. “Many Asian Americans do not break down warfarin as fast as Caucasians, so the
vi y re
drug is more effective at lower dosages.”

D. “Caucasians have higher levels of the enzyme that breaks down warfarin, requiring
higher dosages for the same effect on INR.”
ed d
____ 16. Your patient has been identified as a poor metabolizer of a drug that has just been ordered, and the
ar stu
drug is formulated as an active compound. What will be the most likely result if you give this active
drug at the standard dose?
A. No therapeutic response
is
B. Increased adverse reactions and possible toxicity

C. Therapeutic response as expected in the general population
Th
D. Drug inactivation occurs more rapidly, and the therapeutic response is limited.
____ 17. You are caring for a child with acute lymphoblastic leukemia. She has been genotyped and is
homozygous for a TPMT polymorphism, producing very little of the enzyme needed for this drug's
sh
metabolism. How would you expect this to affect dosing of the drug 6-mercaptopurine?
A. This child should receive only a small fraction of the standard dose.
B. This child should receive the drug intravenously rather than orally.
C. This child should receive higher doses than the standard dose.
D. This child should receive the standard dose.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 17: Assessing Genomic Variation in Drug Response

Answer Section
MULTIPLE CHOICE
1. ANS: D
The pharmacogenetic variations in individual drug response are based on polymorphisms in genes
coding for metabolizing enzymes, transporters, and receptors. The clinical responses to these
differences can range from life-threatening adverse reactions to a complete lack of therapeutic effect.
About 20% of drugs produce adverse reactions that were unknown when the drugs first came to
market, and adverse drug reactions are considered one of the leading causes of death. A main goal of
pharmacogenomics is the reduction of adverse reactions to medications.
PTS: 1
2. ANS: C
m
er as
Drug activation and deactivation are part of the pharmacodynamics, which involves drug
co
metabolism and elimination. The enzymes involved in these processes influence the duration of drug
eH w
actions. These responses are controlled by specific genes and thus are most subject to genetic
o.
variation. Drug dissolution is related to the chemical structure of the drug. Binding with plasma
rs e
proteins is related to the amount of plasma proteins and the structure of the drug rather than genetic
ou urc
influences. The rate of drug movement within the gastrointestinal tract is variable, but the variation
is physical rather than genetic. Although the number of receptors is genetically controlled, the ability
of a drug to bind with a receptor functionally or nonfunctionally (blocking it) is mostly related to the
o
structure of the drug.

aC s
vi y re
PTS: 1
3. ANS: A
These drugs must interact with cell receptors to produce an effect. Some drugs activate receptors,
working as “agonists” that increase the cells’ responses and activities. Other drugs block receptors,
ed d
working as antagonists, which then reduces the effects of naturally occurring body substances on the
ar stu
cells’ responses and activities.
PTS: 1
is
4. ANS: B
Adrenaline (epinephrine) is made in the body and normally binds to heart receptors and increases the
Th
heart rate. A drug that is an adrenaline antagonist binds to heart cell receptors nonfunctionally and
blocks naturally occurring adrenaline from binding to these cells. As a result, heart rate decreases
(and often becomes more regular).
sh
PTS: 1
5. ANS: A

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The variations in individual drug response are based on polymorphisms in genes coding for
metabolizing enzymes, transporters, and receptors. These polymorphisms are very common, whereas
single-gene disorders of any type are not common. Loss of alleles has not been associated with the
aging process. Behavioral problems are poorly understood, as are the genetic bases of specific
behaviors.
PTS: 1
6. ANS: D
Although CYP-450 enzymes are present in many body tissues/cells, the liver has the greatest
concentration. This organ is the tissue most actively involved in drug metabolism.
PTS: 1
7. ANS: A
An agonist drug has the same effects as the naturally occurring drug. So, taking a drug that is an
estrogen agonist increases the effects of the patient’s naturally occurring estrogen.
m
er as
PTS: 1
co
8. ANS: A
eH w
A prodrug is an inactive parent compound that must undergo first-phase metabolism to become an
o.
active drug that is capable of inducing an intended response. A sustained-release drug can be an
rs e
active compound without first-phase metabolism, but the drug formulation allows slow and
ou urc
continuous release of the drug from its tablet or capsule. A parent compound is the actual drug as it
enters the body and is not a metabolite.
o
PTS: 1
aC s
9. ANS: C
vi y re
In order for a drug to produce its intended response, its blood levels must reach the minimum
effective concentration. When enzymes responsible for metabolizing and preparing drugs for
elimination are more active as a result of a genetic variation, sensitive drugs are eliminated more
ed d
rapidly, and a “normal” dose may not be high enough to allow the drug to be retained long enough to
reach the MEC.
ar stu
PTS: 1
10. ANS: B
is
For insulin or any drug that requires interaction with a receptor to agonize a cell and induce its
Th
intended response, an increase in the number of receptors specific to the drug increases the cell’s
sensitivity to the drug. A smaller dose is needed to produce the response of a lower blood glucose
level. Normal dosages could easily cause severe hypoglycemia.
sh
PTS: 1
11. ANS: C

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Bioavailability is the percentage of drug present in the bloodstream. When a drug is administered
intravenously, it is all (100%) bioavailable initially. Increasing fluid intake does not affect
bioavailability regardless of whether the fluid is taken orally or administered intravenously.
Administering an antagonist along with a drug agonist would only cancel out or negate the agonist
action, not improve the bioavailability. Crushing an oral drug does not prevent first-pass loss or
improve bioavailability.
PTS: 1
12. ANS: B
A significant number of people have low or absent levels of the enzyme that converts the prodrug
codeine to the active compound morphine at the cellular level. These people have no pain relief from
any dose, even high doses, of codeine but do achieve pain control with usual dosages of morphine.
In the past, such individuals have been labeled drug-seekers. Although individuals who consume
large amounts of alcohol often metabolize opioids very quickly and need higher dosages for pain
control, this factor affects both codeine and morphine and is not selective just for codeine.
m
er as
PTS: 1
co
13. ANS: D
eH w
A person who is an “ultra-metabolizer” for an active drug breaks down and eliminates the drug very
o.
quickly, often not achieving the minimum effective blood concentration. As a result, both the
rs e
beneficial intended responses and the risks for side effects are greatly reduced at normal drug
ou urc
dosages.
PTS: 1
o
14. ANS: C
aC s
G6PD is an enzyme needed for red blood cells (erythrocytes) to maintain integrity during oxidative
vi y re
stress. Certain drugs, such as aspirin, antimalarials, probenecid, and vitamin K, increase the level of
oxidative stress on red blood cells. With a deficiency of G6PD, the increased oxidative stress caused
by these drugs leads to rapid destruction of red blood cells that is greater than the rate at which they
ed d
can be produced by the bone marrow, resulting in hemolytic anemia.

ar stu
PTS: 1
15. ANS: C
Polymorphisms in the CYP2C9 metabolizing enzyme are common in Asians and Asian Americans.
is
As a result, the drug warfarin remains in the body longer. These individuals require lower dosages to
Th
maintain the prescribed INR and avoid serious bleeding. This response is not related to gender or
body size.
PTS: 1
sh
16. ANS: B

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Active-compound drugs work as soon as they enter the bloodstream, without further processing.
They must undergo metabolism to be made ready for elimination. In people who are poor
metabolizers, the blood drug levels are higher, and the drug remains active much longer. As a result,
the patient is at higher risk for continued drug actions, including adverse effects and toxic responses.
This person would need lower drug doses given less frequently.
PTS: 1
17. ANS: A
Drugs such as azathioprine (Imuran), mercaptopurine, and thioguanine used to treat childhood
leukemias, rheumatoid arthritis, or inflammatory bowel disease require metabolism by the enzyme
thiopurine methyltransferase (TPMT). The activity of TPMT is trimodal, meaning three different
levels of enzyme activity exist among groups of people. About 90% of people have high TPMT
activity. They have faster drug metabolism, which results in lower exposure of leukemic cells to
active thiopurines. About 10% of people have intermediate activity, and a very small fraction of
people (about 0.3%) have low activity. Those who have low TPMT activity are homozygous for
m
variations in the gene coding for TPMT, so they produce nonfunctional protein. People with low
er as
TPMT activity risk myelosuppression, secondary cancers, and possibly fatal toxicity when they are
co
eH w
given chemotherapeutic agents requiring metabolism by TPMT. They must either have the dose of
their chemotherapeutic agents reduced eight- to tenfold or be placed on drugs that do not use TPMT
o.
for metabolism and elimination.
rs e
ou urc
PTS: 1
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 18: Health Professionals and Genomic Care
Multiple Choice
____ 1. Which action reflects promotion of genomic care as part of comprehensive health care?
A. Calculating the odds ratios and recurrence risks of common complex health
problems for all people
B. Ensuring that genomic issues potentially influencing a person’s health are
incorporated into routine care
C. Encouraging all people to undergo genetic testing as part of a proactive health
screening and prevention program
D. Instructing patients who undergo genetic testing about their obligation to inform
family members regarding test results
m
____ 2. Why are general physicians and surgeons not considered to be genetics professionals?
er as
A. The typical patients seen by these health-care providers have acute conditions
co
rather than chronic conditions, and thus genetic influence is irrelevant.
eH w
B. Most of today’s physicians and surgeons were educated before completion of the
o.
human genome research project.
rs e
C. These health-care professionals have minimal experience with genetics laboratory
ou urc
techniques.
D. The focus of their professional education is the study of medicine rather than
genetics.
o
aC s
____ 3. How do genetics counselors provide genetic/genomic information to patients and families in a
vi y re
nondirective manner?
A. Providing only the information the patient or family specifically requests
B. Skillfully directing the patient and family toward the best choice that is supported
by appropriate research
ed d
C. Presenting all facts and available options in a manner that neither promotes nor
ar stu
excludes any legally permitted decision or action

D. Filtering management options and focusing on the information that will support the
decision they believe is right for the individual patient/family
is
____ 4. A certified family nurse practitioner with an MSN degree in family practice who works in a clinic
Th
serving patients who have connective tissue disorders refers to himself as a clinical geneticist. Is this
title appropriate?
A. Yes, he is an advanced-practice nurse.
sh
B. Yes, he is a clinician employed in a setting specializing in patients with genetic-

based health problems.
C. No, a clinical geneticist must be certified as a genetic counselor.
D. No, a clinical geneticist is a physician who has completed a fellowship in clinical
genetics.
____ 5. Why do genetic counseling programs include extensive courses on laboratory methods in genetics?

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A. So that the certified genetics counselor can serve as a backup genetics technician in
small laboratories
B. So that the certified genetics counselor can perform standard karyotyping on
routine blood specimens
C. So that the certified genetics counselor can help patients understand testing
procedures and results
D. So that the certified genetics counselor is able to draw blood proficiently and safely
____ 6. Which genetics professional has the defined responsibility for overseeing the work in a cytogenetic
laboratory?
A. Clinical laboratory geneticist
B. Genetic laboratory technician
C. Cytogenetics technician
D. Medical geneticist
____ 7. A woman’s family history for breast cancer includes two paternal aunts who developed breast cancer
m
before age 45. Which genetics professional would be most appropriate for assistance in helping this
er as
patient understand the health risk posed by this family history?
co
eH w
A. Medical geneticist
B. Genetic counselor
o.
C. Clinical geneticist
rs e
D. Clinical laboratory geneticist
ou urc
____ 8. Which statement or criterion is a required component for certification as an Advanced-Practice
Nurse in Genetics (APNG)?
o
A. A 2-year residency in clinical genetics

aC s
B. An earned PhD or DNP with coursework focusing on genetics

vi y re
C. Completion of 500 hours of direct bedside care for patients with genetic disorders
D. Completion of a 50-case log describing the nurse’s actions that reflect the standards
of clinical genetic nursing practice
ed d
____ 9. The patient who has been found to have a mutation in a gene allele that greatly increases her risk for
ar stu
a serious health problem has asked a generalist nurse to be present when she discloses this
information to her family. What is the nurse’s role in this situation?
A. Primary health-care provider
B. Genetic counselor
is
C. Patient advocate
Th
D. Patient support
sh
nondisjunction Down syndrome

B. Informing a patient that his test results are positive for a genetic disorder
C. Obtaining an accurate family history and physical assessment data
D. Requesting a consultation visit from a clinical geneticist

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 11. Jessica (aged 32) is BRCA1 positive, which is known to greatly increase the risk for breast and
ovarian cancer. She was tested because her mother, who had ovarian cancer, was BRCA1 positive.
Jessica has decided to have both of her ovaries removed because she believes that, in her family,
being BRCA1 positive increases the risk for ovarian cancer only. How should a genetic counselor
respond to Jessica’s statement?
A. Encourage her to consider a bilateral mastectomy.
B. Accept Jessica’s explanation as a manifestation of her autonomy and remain
nondirective in the interactions with her.
C. Clarify that a BRCA1 mutation does not preferentially express ovarian cancer over
breast cancer in any given family.
D. Discuss Jessica’s responsibility to inform all the other female members of her
family about her BRCA1 status and cancer risk.
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 18: Health Professionals and Genomic Care

Answer Section
MULTIPLE CHOICE
1. ANS: B
Genomic care is ensuring that the influence of a person’s genetic history on health and disease is
considered as part of general assessment information for all patients and families. This does not
mean that all patients should have some sort of genetic testing. Rather, it means that all health-care
professionals are obligated to avoid overlooking genetic issues that may affect an individual’s health
or risk for health problems. The patient determines with whom, if anyone, to share genetic test
results. Calculation of odds ratios and recurrence risks is not part of general health care.
PTS: 1
2. ANS: D
m
er as
The title of genetics professional implies that the individual has extensive education and often,
co
special credentialing in some aspect of the broad genetics field. By these criteria, a person with an
eH w
entry-level degree in a health-care profession, such as registered nurse, registered dietitian, physical
o.
therapist, pharmacist, or physician/surgeon, is not a genetics professional because genetics was not
rs e
the focus of his or her professional education. Although knowledge of genetics laboratory techniques
ou urc
is helpful to genetics professionals, clinical geneticists are not expert technicians. Acute health
problems often have a genetic input to the disorder, as does the patient’s response to therapy.
o
PTS: 1
aC s
3. ANS: C
vi y re
Nondirective counseling provides all the relevant facts and options available and allows the
patient/family to make the decision that is right for them. The counselor does not recommend any
course of action but supports whatever action the patient and/or family decides to take. This type of
counseling almost always provides more information than the patient requests because most patients
ed d
have little background in genetics.

ar stu
PTS: 1
4. ANS: D
is
Only a physician who has completed training in a clinical specialty residency, such as pediatrics,
internal medicine, obstetrics/gynecology, or another relevant specialty, and completed a clinical
Th
genetics fellowship in a program accredited by the American Board of Medical Genetics can be
called a clinical geneticist. Additionally, the clinical geneticist must acquire initial certification and
continue to remain current within the specialty to maintain certification. An MSN-prepared nurse
sh
practitioner, even with a certified specialty in genetics, is not a clinical geneticist.
PTS: 1
5. ANS: C

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Genetic counseling programs do include extensive laboratory methods courses, not because a
certified genetic counselor (CGC) is expected to perform these tests as part of his or her role, but to
ensure that the counselor has adequate background to help patients and families understand testing
procedures and results. This is especially important for those tests that require weeks to complete.
Genetic counselors do not draw blood, nor do they perform any laboratory techniques, including
generating a karyotype, unless they have also completed additional training and are officially
certified for such actions.
PTS: 1
6. ANS: A
A clinical laboratory geneticist is either a physician with an MD or a DO (doctor of osteopathy)
degree or a PhD degree in genetics or relevant biological science. Specialty training for certification
is an additional 24-month fellowship in a program approved by the American Board of Medical
Genetics (ABMG). These individuals can then be certified by examination through the ABMG in at
least one of three subspecialties: cytogenetics, molecular genetics, or biochemical genetics. A
m
technician (laboratory or cytogenetic) performs the actual test under the direction of a clinical
er as
laboratory geneticist but does not interpret the tests or warrant the quality of the work. A medical
co
eH w
geneticist does not perform or oversee genetic testing.
o.
PTS: 1
7. ANS: B rs e
ou urc
A genetic counselor focuses on direct communication with and counseling of patients and families at
potential risk for genetic problems. Even though a clinical geneticist may also provide genetic
counseling, his or her primary responsibilities are diagnosing and clinically managing patients with a
o
wide variety of genetic disorders. A medical geneticist has a doctorate (PhD), most commonly in
aC s
population genetics or epidemiology. These individuals often work along with genetic counselors to
vi y re
provide accurate recurrence risk information for affected families but have little, if any, preparation
in counseling. A clinical laboratory geneticist also has minimal, if any, counseling preparation or
experience.
ed d
ar stu
PTS: 1
8. ANS: D
One of the minimum criteria is the completion of a log of 50 cases within 5 years of the application
and four written case studies that reflect the standards of clinical genetics nursing practice developed
is
by the International Society of Nurses in Genetics (ISONG). The candidate must also complete 300
Th
hours of supervised genetic practicum experiences as a clinical genetic nurse, with the genetic
practice component being greater than 50%. A master’s degree in nursing from an accredited
program is required, but a DNP or PhD and a 2-year residency are not.
sh
PTS: 1
9. ANS: D
The nurse is supporting the client emotionally while she tells the family the information she learned
about the test results. The nurse is neither interpreting the results nor counseling the patient and
family about what steps to take next. This situation does not require an advocate role.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
PTS: 1
10. ANS: C
A genetics professional has extensive education and, often, special credentialing in some aspect of
the broad genetics field. Such a professional is an expert in one or more areas of genetics. By this
criterion, a person with an entry-level degree in a health-care profession, such as a registered nurse,
is not a genetics professional because genetics was not the focus of her or his professional education.
However, all health-care professionals are expected to have at least a basic understanding of the
general patterns of inheritance and genetic terminology as well as to be able to construct an accurate
three-generation pedigree from assessment information.
PTS: 1
11. ANS: C
Clarifying misconceptions is a responsibility that can be met while still being nondirective. Jessica
can still choose to have only her ovaries removed, but she does need to know her risk for breast
m
cancer in order to come to an informed decision. Encouraging her to have a mastectomy is directive
er as
rather than nondirective. Only Jessica can determine whom in her family to inform.
co
eH w
PTS: 1
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 19: Financial, Ethical, Legal, and Social Considerations
Multiple Choice
____ 1. Preimplantation genetic diagnosis provides parents with which options?

A. The ability to screen normally fertilized embryos for genetic traits after the first
trimester
B. The ability to select embryos for implantation that test negative for a familial
disease mutation
C. The opportunity to determine how many children they will conceive
D. The ability to guarantee that they will have a healthy baby
____ 2. Your patient, Maggie, insists that her mother have genetic testing to determine if her breast cancer is
connected to a mutation in the BRCA1/2 genes. Maggie is concerned about her own risk for getting
m
breast cancer and that of her children, but Maggie’s mom does not want to be tested. What ethical
er as
principle is one of several that must be considered in evaluating this case?
co
A. Maggie’s “autonomy”
eH w
B. Maggie’s mother’s “right to know”
o.
C. The nurse’s “duty to warn”
rs e
D. Maggie’s mother’s “right to privacy”
ou urc
____ 3. A patient asks you whether the Genetic Information and Nondiscrimination Act (GINA) means that
his insurance company is required to pay for his genetic testing if he elects to have it done. What is
o
your best response?

aC s
A. “Yes, if you agree to share the test results with your family, your health-care
vi y re
provider, and your insurance company.”

B. “Yes, if other family members have already been found positive for a disease-
causing mutation.”
C. “No, unless testing finds a specific disorder for which a current medical
ed d
intervention has been proven effective.”

ar stu
D. “No, it only protects against discrimination and does not require insurance
companies to pay for testing.”
4. You are caring for a college professor who has been offered testing for her family’s mutation in
is
____
BRCA1. She expresses fear of genetic discrimination as a reason for refusing genetic testing. What
Th
do you tell her?

A. “There is no need to be concerned about genetic discrimination.”
B. “I appreciate your concern, but there is no way your insurance company or
sh
employer will ever be able to get your genetic testing results.”

C. “There is now federal legislation banning genetic discrimination, and in addition,
we will do everything we can to keep your results confidential.”
D. “There have been no instances of documented genetic discrimination in insurance
or employment. This concern is overblown.”

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
____ 5. Under which condition(s) would genetic testing for predisposition to an inherited disorder in a minor
child be considered reasonable?
A. When the family pedigree indicates an autosomal-dominant pattern of inheritance
B. When the risk is high and prophylaxis to reduce the severity of the disorder is
available
C. When penetrance is high and the expected onset is middle adulthood
D. When the mutation within a family is known and is specific
____ 6. A patient whose mother has Huntington disease is considering genetic testing but is not sure whether
she really wants to know if she has the mutation. She asks you what you would do if your mother
had the disease. What is your best response?
A. “I would have the test so that I could decide whether to have children or to use
adoption.”
B. “I can only tell you the benefits and the risks of testing; you must make this
decision yourself.”
C. “Because there is no cure for this disease and testing would not be beneficial, I
m
er as
would not have the test.”
co
D. “You need to check with your brothers and sisters to determine whether testing for
eH w
this disease would be appropriate for you.”
o.
____ 7. A scientist is working to develop a genetic test that will screen embryos so that only those producing
rs e
tall children with beautiful features will be implanted. What area of genetic work or studies does this
ou urc
example represent?
A. Eugenics
B. Cybernetics
o
C. Cytogenetics
aC s
D. Genetic imprinting
vi y re
____ 8. What should be told to the patient who has been found to have a genetic mutation that increases the
risk for colon cancer and says he does not want any of his family to know about this result?
A. “It is required by law that you inform your siblings and your children about this
ed d
result so that they also can be tested and monitored for colon cancer.”
ar stu
B. “It is not necessary to tell your siblings because they are adults, but you should tell
your children so that they can be tested before they decide to have children of their
own.”
is
C. “It is not required that you tell anyone about this result; however, because your
siblings and children may also be at risk for colon cancer, you should think about
Th
how this information might help them.”

D. “It is your decision to determine with whom, if anyone, you share this test result;
however, if you do not tell any of your family members and they get colon cancer,
sh
you would be responsible for their development of the disease.”

____ 9. Sometimes health-care providers with information about family members’ genetic risk are
confronted by conflicting ethical principles. Which principle is least likely to conflict with the
health-care provider’s “duty to warn”?
A. Autonomy

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
B. Beneficence
C. Right to privacy
D. Genetic discrimination
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 19: Financial, Ethical, Legal, and Social Considerations

Answer Section
MULTIPLE CHOICE
1. ANS: B
Preimplantation genetic diagnosis is a process only done in conjunction with in vitro fertilization
because it is performed on early embryonic cells that are in a petri dish and have never been in the
mother’s body. A group of embryos generated by in vitro fertilization is removed at the eight-cell
blastocyst stage. Cells from each embryo can be tested to find gene variants causing single-gene
disorders or chromosomal problems, or to determine sex. One or two embryos without the identified
familial disease are then selected for implantation. This procedure does not guarantee the infant will
be otherwise healthy, only that he or she will not have the specific disorder.
PTS: 1
m
er as
2. ANS: D
co
Maggie’s mother has a right to keep her genetic information private even though Maggie would like
eH w
to know if her mother carries a BRCA1/2 mutation. The nurse’s duty to warn does not play a role
o.
here, and Maggie’s mother is not interested in her right to know. Although Maggie wants to make an
rs e
autonomous decision and have her mother tested, her autonomy does not extend to testing done on
ou urc
her mother.
PTS: 1
o
3. ANS: D
aC s
Title I of GINA makes it illegal for health insurers to use clients’ genetic information to make
vi y re
decisions about their eligibility for insurance, the size of their premiums, or the extent of their
coverage. Health insurers also cannot use genetic information as evidence of a preexisting condition,
and they cannot require that a client have genetic testing. Title II makes it illegal for employers to
use genetic information to make decisions about hiring, promoting, or terminating employees.
ed d
Neither provision requires insurers to pay for testing; however, some insurance companies have
ar stu
chosen to do so.
PTS: 1
is
4. ANS: C
This person’s fears are real and probably based on her knowledge of someone having been
Th
discriminated against for an identified genetic problem. With the passage of Genetic Information and
Nondiscrimination Act (GINA) by the U.S. federal government, this type of discrimination is illegal.
Title I of GINA makes it illegal for health insurers to use clients’ genetic information to make
sh
decisions about their eligibility for insurance, the size of their premiums, or the extent of their
coverage. Health insurers also cannot use genetic information as evidence of a preexisting condition,
and they cannot require that a client have genetic testing. Title II makes it illegal for employers to
use genetic information to make decisions about hiring, promoting, or terminating employees.
PTS: 1

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
5. ANS: B
Predisposition testing of children is not routinely performed unless there is beneficial treatment
available. Just having the parents “want to know” is not enough. In most instances, the
recommendations are for the child to make his or her own decision regarding genetic testing as an
adult. However, when the risk for the disorder is high and beneficial treatment is available, testing
may be done in childhood to begin treatment for prevention of the disorder or for severity reduction.
An example is the autosomal-dominant disorder of familial adenomatous polyposis (FAP). People
who have the genetic mutation develop thousands of colon polyps and have a 90% or greater risk of
having early-onset colon cancer. If a child tests positive for this genetic mutation, he or she has
yearly screening for colon cancer. After adolescent growth is complete, the recommendation is that
the child have a total colon resection to greatly reduce the risk for colon cancer. If the number of
polyps is so high even in early childhood that cancer surveillance is too difficult, the colon is
removed in childhood.
PTS: 1
m
6. ANS: B
er as
Any level of genetic counseling requires the counselor to be “nondirective.” The counselor must
co
ensure that the client has adequate and accurate information upon which to base the decision but
eH w
cannot suggest or direct the client to test or not to test. The client may wish to discuss the issue with
o.
his or her family, but ultimately, the decision about testing can only be made by the client.
rs e
ou urc
PTS: 1
7. ANS: A
Eugenics has been defined as working to improve humankind by selectively breeding people who
o
have genes that society would consider “good” and not allowing reproduction of people with genes
aC s
that society would consider “bad.” If you are selecting only embryos that will produce beautiful
vi y re
children, you are striving for the same purpose. Cybernetics is concerned with the merger of persons
and machine. Cytogenetics is the study of chromosomes. Genetic imprinting refers to the chemical
silencing of gene expression.
ed d
ar stu
PTS: 1
8. ANS: C
This situation represents an ethical dilemma. The patient does have the right to disclose or not
disclose the information discovered through genetic testing. However, in this instance, disclosure
is
could allow other people to check their health status and take preventive actions against the
Th
development of cancer. The patient cannot be forced to disclose the results but should be encouraged
to consider disclosure. The response described in C keeps the issue open for discussion later. There
is no national or final legal point of view on the resolution of this controversy.
sh
PTS: 1
9. ANS: D

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The ethical principles of “right to privacy,” “autonomy,” and “beneficence” can all conflict with the
health-care provider’s duty to warn. If we support a patient’s wishes not to share his or her genetic
information with family members, we are respecting the patient’s “right to privacy” and “autonomy.”
What is “good” for the patient (respecting the right to privacy) may conflict with what is “good” for
the family members (being warned). This creates a problem for respecting beneficence. Genetic
discrimination is a social problem but not an ethical principle.
PTS: 1
m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 20: Genetic and Genomic Variation
Multiple Choice
____ 1. What is the main purpose of population genetics?

A. Determining the factors that allow allelic frequencies to change over time
B. Determining the geographic origins of specific genetic-based disorders
C. Assessing the effects of assortive mating on natural selection and evolution
D. Assessing the differences between race and ethnicity for susceptibility and
resistance to infectious diseases
____ 2. What factors could increase genetic diversity in a particular population?
A. Genetic drift
B. The population effect
m
C. The bottleneck effect
er as
D. Increased number of haplotypes
co
eH w
____ 3. What criteria must a population meet in order to stay in Hardy–Weinberg equilibrium?
A. Random mating, no migration, and no mutation
o.
rs e
B. Founding commonalities and no haplotype differences
ou urc
C. Assortative mating, migration, and frequent mutation
D. Limited procreation, no diet change
____ 4. What pieces of genetic information tend to be passed down from generation to generation with the
o
least variation?
aC s
A. Mitochondrial DNA
vi y re
B. Nuclear DNA
C. Ribosomal DNA
D. Histone proteins
ed d
____ 5. Why is it important to consider population genetics?

ar stu
A. Natural selection can increase genetic diversity.

B. Accurate assessment of a person’s ethnicity can be identified from DNA.
C. Disease risk can vary as a result of the geographic origin of one’s ancestors.
is
D. Knowing ethnicity allows accurate prediction of Huntington disease risk.

Th
____ 6. Which practice is most likely to result in a change in the Hardy–Weinberg equilibrium of a
population or geographic area?
A. Random mating from within the established population
B. Geographic isolation of the established population
sh
C. Assimilation of immigrants into the existing population

D. Preponderance of autosomal-dominant traits in the existing population
____ 7. A group of eight space travelers, four men and four women, settled on the planet Zebulon. Their
descendants had a very high rate of the autosomal-dominant disorder moonophilia distractens. What
factor could explain this phenomenon?

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
A. Equal exposure to an environmental mutagen

B. Hardy–Weinberg equilibrium
C. Variable expressivity
D. Founder effect
____ 8. A small group of people left their homeland and set sail for a tropical island. They settled there, and
their descendants lived for many generations. Unfortunately, a relatively high proportion of this new
population is afflicted with an autosomal-recessive disease. What would explain this?
A. They encouraged immigration of people from the mainland.
B. An unidentified environmental radiation source was present on the island.
C. One of the original group members had the gene mutation from conception.
D. Their lack of genetic diversity made them more vulnerable to new mutations.
____ 9. The Black Death was a pandemic spreading across Europe between 1348 and 1350. Estimates state
that 30% to 60% of Europe’s population died from the Black Death. If we look at Europe’s
population before the pandemic and compare it to the population several generations later, what are
m
we likely to find?
er as
A. More genetic diversity in later generations
co
B. Less genetic diversity in later generations
eH w
C. Less genetic diversity in earlier generations
o.
D. The same degree of genetic diversity in later as in earlier generations
rs e
ou urc
____ 10. Why are people of Ashkenazi Jewish descent more likely to be carriers of the mutations that cause
Tay–Sachs and Gaucher disease?
A. The environment of Eastern Europe increased their risk of developing a mutation.
o
B. The common diet shared by these people has reduced their genetic diversity.
aC s
C. Bottleneck effects have reduced the genetic diversity in this population.

vi y re
D. Being heterozygous for these diseases allowed them to survive cholera.

____ 11. Which term refers to a random change in allele frequencies, not based on natural selection?
A. Population bottleneck
ed d
B. Genetic drift
ar stu
C. Founder effect
D. Migration effect
____ 12. Which statement regarding genetic diversity is most accurate?

is
A. Larger genes are more likely to display diversity than small genes.
B. Genetic diversity is significant only when a population is isolated.
Th
C. Genetic disorders are more common in populations that have greater genetic
diversity.
D. Population bottlenecks result in loss of alleles that provide minimal selection
sh
advantage.

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Chapter 20: Genetic and Genomic Variation

Answer Section
MULTIPLE CHOICE
1. ANS: A
The field of population genetics examines the ways in which allele frequencies change in human
populations over time, including those events that keep the frequencies the same and those events
that change them.
PTS: 1
2. ANS: D
Haplotypes are groups of genes or gene variations that are inherited together as genetic
neighborhoods. As the number of these haplotypes within a given population increases, so does the
genetic diversity.
m
er as
co
PTS: 1
eH w
3. ANS: A
The requirements for populations to stay in Hardy–Weinberg equilibrium are as follows:
o.
 People mate randomly.
rs e
ou urc
 The population is extremely large.
 Everyone has children.
 There are no mutations.
o
PTS: 1
aC s
4. ANS: A
vi y re
Mitochondrial DNA and the DNA on the Y chromosomes tend to be passed down from generation to
generation with very little variation. Processes such as independent assortment of alleles during
meiosis and crossing over of segments of homologous chromosomes result in increased genetic
ed d
diversity.
ar stu
PTS: 1
5. ANS: C
Disease risk can vary depending on the geographic origin of one’s ancestors. For example, people of
is
Ashkenazi Jewish descent are more likely to be carriers of a number of autosomal-recessive

Th
diseases. We cannot accurately identify a person’s race from his or her DNA, and knowing ethnicity
does not accurately predict Huntington disease risk. Natural selection decreases genetic diversity.
sh
PTS: 1
6. ANS: C

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
The first criterion for Hardy–Weinberg equilibrium is no migration (out from or into the existing
population. Thus, the arrival of a group of immigrants who are assimilated into the established
population represents a loss of the first criterion. As assimilation occurs, even with random mating,
the new population adds to the existing gene pool. Geographic isolation of the established population
contributes to Hardy–Weinberg equilibrium by reducing the chances for migration. A preponderance
of autosomal-dominant traits neither contributes to nor takes away from equilibrium.
PTS: 1
7. ANS: D
Founder effect occurs when a small group of people leave a larger population and settle somewhere
else and are the main people who end up populating an area. Hardy–Weinberg equilibrium exists
when allele frequencies in a population meeting certain criteria remain the same. Heterozygosity
refers to the proportion of a population who are heterozygous at a particular locus. Variable
expressivity refers to differences in disease severity among people who have the same genotype at
the locus of interest.
m
er as
PTS: 1
co
8. ANS: C
eH w
Even if only one member of the original group was heterozygous for a specific disease-causing gene
o.
allele, children from this limited population were likely to intermarry, increasing the incidence of
rs e
that particular haplotype. By the fourth generation and beyond, so many of the population would be
ou urc
carriers of this disease-causing allele that its expression increased. Some modern examples of this
process include groups who have socially isolated themselves and intermarried to such an extent that
recessive disorders appear dominant because of the increased incidence, such as the old-order
o
Amish, Ashkenazi Jews, and French Canadians from the Quebec area.
aC s
vi y re
PTS: 1
9. ANS: B
We would find less genetic diversity in later generations. The Black Death caused a population
ed d
bottleneck, reducing genetic diversity in subsequent generations.

ar stu
PTS: 1
10. ANS: C
At different times in history, the Jewish population of the world was decreased deliberately, causing
is
a population bottleneck. The holocaust of World War II is just the most recent example. With
Th
reduced numbers of people within that population, only the traits of the survivors were passed on
(fewer haplotypes), limiting the genetic diversity and increasing the likelihood for expression of
recessive genes.
sh
PTS: 1
11. ANS: B

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com
Genetic drift is defined as a random change in allele frequencies not based on natural selection. A
population bottleneck occurs when some event severely reduces the number of individuals in a
population. The founder effect occurs when there is a reduction in genetic variability that comes
from the separation of a population subgroup and the reproduction of that less diverse subgroup. The
migration effect is not a term commonly used in population genetics.
PTS: 1
12. ANS: A
Genetic diversity in the form of single-nucleotide polymorphisms is much more common in alleles
of larger genes than those of smaller genes (one sequence variation for every 200 to 500
nucleotides). Lack of genetic diversity occurs in isolated populations. Genetic disorders are more
common in populations with less genetic diversity. When diversity is greater, there are more alleles
for genes, reducing the likelihood of inheriting two alleles that cause disease or disorders. When
population bottlenecks occur, alleles are lost randomly, without regard to whether the allele confers a
selection advantage or not.
m
er as
PTS: 1
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

Downloaded
Downloadedby:
by:
SuperA
abiekay12@gmail.com

Test Bank For Genetics and Genomics in Nursing and Health Care 2nd Edition by Beery

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Test Bank For Genetics and Genomics in Nursing and Health Care 2nd Edition by Beery

Uploaded by

Copyright:

Available Formats

Stuvia.

com - The Marketplace to Buy and Sell your Study Material

TEST BANK FOR

Chapter 1: DNA Structure and Function

__A__ 9. What activity occurs during M phase of the cell cycle?

__A.__11. How does the proteome differ from the genome?

C. Only one chromosome of each pair is present.

D. DNA synthesis occurs after mitosis instead of before.

__B.__14. Which statement about the cell cycle phase of G0 is true?

B. Performance of specific differentiated functions

C. Initiation and completion of nucleokinesis

__B.__15. What is the result of normal DNA replication?

A. Formation of two new daughter cells

__A.__16. Which statement regarding chromosome structure or function is true?

cells instead of just two.

A. Unwinds the double helix and separates the double-stranded DNA

A. At the tips of the p and q arms of chromosomes.

__A.__22. What is the purpose of a chromosome centromere?

D. The karyotype is euploid, making the individual a genotypic male and a

Chapter 2: Protein Synthesis

__C.__ 1. What is the relationship among genes, DNA, and proteins?

__D.__ 7. Which process occurs outside of the nucleus?

B. Anemia and polyadenylation downstream from the beta-globin gene

for it to be fully functional?

__C.__13. How does an “anticodon” participate in protein synthesis?

B. Ensuring only the “antisense” strand of DNA is transcribed

C. Determining the placement of the “start” signal for translation

D. Promoting posttranslational modification for conversion to an active protein

__D.__18. How does the process of polyadenylation affect protein synthesis?

B. Promoting attachment of ribosomes to the correct end of messenger RNA

C. Linking the exons into the mature messenger RNA

A. These enzymes prevent overexpression of critical proteins.

excessive protein synthesis in a different cell type.

D. The activity of these enzymes promotes increased translation of individual

__B.__21. Which DNA segment deletion would cause a frameshift mutation?

only in somatic cells.

B. Frameshift mutations result in the deletion or addition of whole chromosomes

in disruption of the gene function, whereas a point mutation can be silent.

A. DNA identification of each twin will be more specific.

B. Only their somatic cells will remain identical at all loci.

__D.__26. Which statement about single-nucleotide polymorphisms (SNPs) is true?

reduced insulin activity.

have type 2 diabetes mellitus.

pancreatic beta cells, what would be its effect?

C. Increased degradation of insulin

Chapter 3: Genetic Influences on Cell Division, Cell Differentiation, and Gametogenesis

o Respond to signals for apoptosis

o Cells are needed to replace dead or damaged cells

• The Ultimate Balancing Act

 Knowing to what extent to divide

 Knowing when to take a cell out of the “workforce”

directly to enhance suppressor gene activity and inhibit oncogene activity

o Such conditions include:

o Inadequate cellular nutrition

• Loss of or Reduced Suppressor

 Abnormal growth of scar tissue and benign tumors

o “Sculpt” normal structures during embryonic development

o Suppressor gene activity increases

o Oncogene activity becomes more regulated

o Variable gene expression occurs in different cells to allow cellular differentiation

o Begins at puberty and continues until death

o One oogonium produces only one mature ovum

o A polar body cannot become an embryo

A 9. What activity occurs during M phase of the cell cycle?

A.11. How does the proteome differ from the genome?

B.14. Which statement about the cell cycle phase of G0 is true?

B.15. What is the result of normal DNA replication?

A.16. Which statement regarding chromosome structure or function is true?

A.22. What is the purpose of a chromosome centromere?

C. 1. What is the relationship among genes, DNA, and proteins?

D. 7. Which process occurs outside of the nucleus?

C.13. How does an “anticodon” participate in protein synthesis?

D.18. How does the process of polyadenylation affect protein synthesis?

B.21. Which DNA segment deletion would cause a frameshift mutation?

D.26. Which statement about single-nucleotide polymorphisms (SNPs) is true?