Journal of Insect Physiology 58 (2012) 726–736

Contents lists available at SciVerse ScienceDirect

Journal of Insect Physiology

journal homepage: www.elsevier.com/locate/jinsphys

Molecular characterization of cytochrome P450 CYP6B47 cDNAs and 50 -flanking

sequence from Spodoptera litura (Lepidoptera: Noctuidae): Its response to lead stress
Jialiang Zhou, Guren Zhang, Qiang Zhou ⇑
State Key Laboratory of Biological Control and Institute of Entomology, Sun Yat-sen University, Guangzhou 510275, China

a r t i c l e i n f o a b s t r a c t

Article history: In insects, P450s are responsible for the oxidative metabolism of structurally diverse endogenous and
Received 15 November 2011 exogenous compounds including plant allelochemicals and insecticides. A novel full-length P450 cDNA,
Received in revised form 22 February 2012 CYP6B47, was cloned from Spodoptera litura (Lepidoptera: Noctuidae). The sequence is 1718 bp in length
Accepted 22 February 2012
with an ORF of 1509 bp encoding 503 amino acid residues. The phylogenetic analysis indicated that
Available online 3 March 2012
CYP6B47 belongs to CYP3 clan and second clade of CYP6Bs which contain 11 P450s from Noctuidae. Quan-
titative real-time PCR showed that CYP6B47 was expressed only in larvae stages and had a high level of
Keywords:
transcription in the midgut and fat body. In addition, we cloned a 2141-bp 50 -flanking regions and pre-
Cytochrome P450
50 -Flanking sequence
sented the basal luciferase activities of promoter. We also predicted multiple putative elements for tran-
Lead (Pb) scription factors binding in the 50 -flanking region. Interestingly, the expression of CYP6B47 significantly
Developmental expression increased in the midgut and fat body after lead (Pb) exposure for 5 generations. Larvae tolerance to
the alpha-cypermethrin (35% increased in LC50) and fenvalerate (52% increased in LC50) were improved
after pre-exposure to 50 mg/kg Pb. These dates suggested that lead increased tolerance of larvae to insec-
ticides mainly through transcriptional induction of detoxification genes including CYP6B47.
Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction 2003) and insecticides [cypermethrin (pyrethroid), diazinon (orga-

Cytochrome P450 monooxygenases (P450 or CYP), constituting
an ancient and complex superfamily of heme-thiolate proteins, are
found in all domains of life such as animals, plants, fungi, protists,
bacteria and archaea, even in Viruses (Mimivirus) (Nelson, 2011).
The insects contain four large clans of P450s: three of them
displaying a relationship to the microsomal CYP2, CYP3 and CYP4
clans, and one exhibiting similarity to mitochondrial P450s
(Feyereisen, 2006).
In insects, P450s are responsible for the oxidative metabolism of
structurally diverse endogenous and exogenous compounds
including steroid hormones (Bernhardt and Waterman, 2007) and
fatty acids (Hlavica and Lehnerer, 2010), but are also well known
for their roles in the detoxification of xenobiotics (Scott, 1999).
In fact, P450 enzymes are involved in processes including insect
growth, development, and reproduction, ecdysteroid and juvenile
hormone biosynthesis and ecdysteroid degradation, as well as
metabolism and detoxification of plant allelochemicals and insec-
ticides (Feyereisen, 2005). In Lepidoptera, CYP6Bs have been impli-
cated in detoxifying a variety of plant allelochemicals e.g.
furanocoumarins in the Papilionidae, xanthotoxin in Helicoverpa
(Hung et al., 1995; Li et al., 2000; Ma et al., 1994; Wen et al.,
⇑ Corresponding author. Tel.: +86 20 84112259; fax: +86 20 84112297.
E-mail address: lsszhou@mail.sysu.edu.cn (Q. Zhou).
nophosphate), and aldrin (cyclodiene)] (Li et al., 2004; Rupasinghe
et al., 2007). In particular, exogenous compounds can induce the
expression of CYP6Bs including plant allelochemicals (Zeng et al.,
2007), plant signal molecules jasmonate and salicylate (Li et al.,
2002b) and heavy metal in the mosquito Aedes aegypti (Poupardin
et al., 2008). In Drosophila, under conditions of copper deprivation,
five cytochrome P450 genes were induced, while another four
were downregulated between 5.3- and 1.6-fold by the copper che-
lator treatment. Also, eight P450s are induced after Zn exposures
(Yepiskoposyan et al., 2006). CYP6g1, previously identified as the
dichlorodiphenyl trichloroethane resistance allele in flies, was
the most highly expressed and responsive to MeHg (Mahapatra
et al., 2010). However, only limited data are available in the liter-
ature with regard to the relationship between lead and P450.
A number of transcription factors have been implicated in the
regulation of cytochrome P450 genes expression. In mammals,
the xenobiotic triggers inducing molecules or ligands to enter the
cell and activate key transcription factors (TFs) such as pregnane
X receptor (PXR), constitutive androstane receptor (CAR) and aryl
hydrocarbon receptor (AhR) (Timsit and Negishi, 2007). These
TFs then bind to retinoid X receptor (RXR) or ‘‘ARNt’’ (AhR nuclear
translocator) resulting in heterodimers of PXR-RXR, CAR-RXR and
AhR-ARNt, respectively, which in turn bind to 50 -flanking regions
called xenobiotic response elements (XREs) and activate transcrip-
tion of regulated P450s (Janosek et al., 2006; Sueyoshi and Negishi,

0022-1910/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.jinsphys.2012.02.008
 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736
2001). There is a degree of conservation for xenobiotic induction
mechanisms between mammals and insects (King-Jones et al.,
2006). Drosophila melanogaster nuclear receptor hormone
receptor-like in 96 (HR96) which represents the single orthologue
corresponding to mammalian nuclear receptors CAR and PXR
(King-Jones and Thummel, 2005; Laudet and Bonneton, 2005) has
been considered to be important for regulating transcription in re-
sponse to Phenobarbital (PB). The AhR-XRE pathway was also
shown to be conserved in insects as the black swallowtail caterpil-
lar (Papilio polyxenes) responds to xanthotoxin by inducing CYP6B1
via XRE-like binding sites (McDonnell et al., 2004). RNA interfer-
ence treatment of S2 cells in conjunction with CYP6D1 promoter
assays showed that suppression of Drosophila Broad-Complex
(BR-C) transcription in S2 cells resulted in a significant increase
of PB induction, suggesting that Drosophila BR-C can act as a
repressor (Lin et al., 2010). The NF-E2-related factor 2 ortholog
cap ‘n’ collar isoform-C is a central regulator of xenobiotic re-
sponses in Drosophila (Misra et al., 2011). Besides, the induction re-
sponse of the P450 gene CYP6g1 to the xenobiotic phenobarbital
requires the presence of both tissue specific enhancers and a dis-
tinct cis-regulatory element (Chung et al., 2011).
In this study, we isolated a P450 gene focusing on the CYP6B
family from Spodoptera litura, which has a rapid development of
resistance to insecticides due to its wide range of food resources
and huge appetite (Hemingway et al., 2002). Quantitative real-time
PCR (Q-RT PCR) was used to investigate the developmental and tis-
sue specific expression of the gene to provide a base of gene
expression data for future experiments on the regulation of this
gene. Moreover, we cloned the 50 -flanking regions, predicted mul-
tiple putative elements for transcription factors binding and pre-
sented the basal luciferase activities of the promoter. To identify
P450 genes potentially involved in insecticides metabolism accord-
ing to heavy metal (lead) induction, we investigated the expression
of P450 in larvae exposed to Pb by Q-RT PCR and the relationship
between Pb exposure and insect tolerance to insecticides.
2. Materials and methods
2.1. Insect and tissue collection
S. litura were provided by the Insectarium of the Institute of
Entomology, Sun Yat-sen University (Chen et al., 2000). The rearing
was carried out at constant conditions of 27 °C, 65% relative
humidity and a 12 h dark/12 h light photoperiod in a climatic
chamber.
Males and females were separated during the pupal stage,
based on the morphology of abdominal terminal segments. After
emergence, moths (5 females and 5 males) were caged in an open
glass container (10 cm in diameter and 12 cm in height), given
unlimited access to 10% honey solution, and allowed to copulate
for a period of two nights. Mated females were allowed to lay their
eggs on wax paper. The paper with egg masses was changed every
other day, surface sterilized and transferred to a plastic box. Be-
tween 12 and 24 h prior to egg hatching, a conventional artificial
diet was offered (Chen et al., 2000). After hatching of the eggs,
1st instar larvae were collected and reared in individual 42 ml
plastic cups until pupation.
Fat body and hemolymph samples were collected from 5th in-
star larvae. Each measurement was performed in triplicate. Fat
bodies were frozen immediately in liquid nitrogen and stored at
80 °C until used for RNA extraction. The hemolymph was centri-
fuged for 10 min at 10,000g and 4 °C to remove debris, and then
stored at 80 °C until used for electrophoresis analysis. In addition,
other tissues (such as the ovary, cuticle, midgut and brain) of 5th
instar larvae were dissected in phosphate buffered saline (PBS;
727
137 mM NaCl; 2.7 mM KCl; 8 mM Na2HPO4; 1.5 mM KH2PO4; pH
7.5). Some tissues were frozen immediately in liquid nitrogen
and stored at 80 °C until used for RNA extraction. Others were
homogenized in PBS, followed by centrifugation for 20 min at
12,000g and 4 °C. The supernatants were freeze-dried and stored
at 80 °C until used for analysis of the tissue-specific distribution
of CYP6B47. The whole body of 2 day old stages of 1st, 2nd, 3rd, 4th
5th and 6th (last) instar larvae, pupae, and adults were used for
analysis of the stage-specific distribution of CYP6B47.
2.2. RNA isolation, cDNA synthesis and degenerate PCR
Midgut, fat bodies, brain, ovary, hemolymph and cuticle of two-
day-old fifth-instar larvae, the whole body of the 2 day old stages
of 1st, 2nd, 3rd, 4th 5th and 6th (last) instar larvae, pupae, and
adults were used for extraction of total RNA using Trizol (Invitro-
gen, USA), based on the manufacturer’s instructions. The quality
and concentration of RNA samples were examined by agarose gel
electrophoresis and spectrophotometer analysis. RNA was digested
by DNase I (Takara, Japan) in order to eliminate the genomic DNA
contamination. The total RNA (A260/A280 = 1.9) was dissolved in
30 ml DEPC-treated H2O and stored at 80 °C for future use. cDNA
was synthesised by reverse transcription in 20 ll reactions con-
taining 1 lg of total RNA, 200 U PrimeScript™ reverse transcrip-
tase (Takara, Japan), 20 U RNase inhibitor, 1 ll dNTP mixture
(10 mM each) and 1 ll oligo(dT)18 primer (50 lM) at 42 °C for
1 h. Three independent RNA preparations representing three bio-
logical replicates were used for cDNA synthesis. The reaction mix-
ture was stored at 20 °C for future use.
CYP6B-F and CYP6B-R used in degenerate PCR were designed
utilizing Primer Premier 5.0 (http://www.PremierBiosoft.com, Ta-
ble 1). They are based on conserved amino acid sequences specific
to the CYP6 families of P450 genes of Bombyx mori. Degenerate PCR
was carried out on cDNA extracted from susceptible S. litura strains
and was conducted using a Veriti 96 well Thermal Cycler (Applied
Biosystems, USA) and rTaq™ polymerase (Takara, Japan). The total
volume of the reaction system was 25 ll, including 1 ll cDNA tem-
plates, 1 ll each primer (10 mM), 2.5 ll dNTP (2.5 mM), and 2.5 ll
10 PCR buffer (Mg2+ plus). The PCR program included an initial
denaturation step of 3 min at 94 °C. Then, 30 cycles of 94 °C for
30 s, 50 °C for 30 s, and 72 °C for 1.5 min with a final extension
of 10 min at 72 °C were performed. The PCR products (25 ll) were
separated by 1.5% agarose gel electrophoresis and stained with
ethidium bromide (EB). The band of the expected size (1226 bp)
was excised and the fragment was recovered with the Gel Extrac-
tion Mini Kit (Tiangen, China). The purified 1226-bp fragment was
cloned into a pMD18-T vector (Takara, Japan). After transformation
into DH5a competent cells (Tiangen, China), the DNA inserts of the
recombinant clones were confirmed by PCR with the degenerate
primers used before and by sequencing in both directions (Invitro-
gen Life Technologies).
2.3. Rapid amplification of cDNA ends (RACE)
For 50 - and 30 -RACE, cDNA was synthesized according to the
manufacturer’s instructions (SMART™ kit, Clontech, USA). Based
on DNA sequence data obtained from the PCR product, the gene-
specific primers 6B47-5GSP1 and 6B47-5GSP2 (Table 1) were syn-
thesized for 50 -RACE, 6B47-3GSP1 and 6B47-3GSP2 (Table 1) were
synthesized for 30 -RACE. The amplification conditions used were
5 min at 94 °C, followed by 33 cycles of 30 s at 94 °C, 25 s at
60 °C, and 1 min at 72 °C, then 10 min at 72 °C for 50 -RACE;
5 min at 94 °C, followed by 33 cycles of 30 s at 94 °C, 25 s at
63 °C, and 40 s at 72 °C, then 10 min at 72 °C for 30 -RACE. After
PCR, products were separated by electrophoresis. DNA bands cor-
responding to approximately 900 bp (for 50 -RACE) and 450 bp
728 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736

Table 1
PCR primers used in this study.

Name sequence (50 –30 ) Usage

CYP6B-F AYTAYTGGAARRAWMGAAATGT Degenerate PCR
CYP6B-R AATGGWAWRTARGCRCASGGGT Degenerate PCR
NUP AAGCAGTGGTATCAACGCAGAGT RACE
UPM CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE
6B47-3GSP1 GAAGCCTGTGGAAATAACACCCGA 30 RACE
6B47-3GSP2 CCCCAAGAGGCATACACTACGATGAGAA 30 RACE
6B47-5GSP1 GGGTGTTATTTCCACAGGCTTCGC 50 RACE
6B47-5GSP2 CGTCACCGTAGTAGCACTGGTCTCATAG 50 RACE
6B47VF ATGTCGGCCTTATATTTCCT cDNA Full-length confirmation
6B47VR TCAAGCCTTCAACTTTCTAGGAAC cDNA Full-length confirmation
QActinF TGAGACCTTCAACTCCCCCG Real-time PCR
QActinR GCGACCAGCCAAGTCCAGAC Real-time PCR
QCYP6B47F ACTTCACCTTGTCTCCTTATCCGA Real-time PCR
QCYP6B47R AAAGCTGTCCATGTTTCTCCATC Real-time PCR
AP1 GTAATACGACTCACTATAGGGC Cloning 5’-flanking regions
AP2 ACTATAGGGCACGCGTGGT Cloning 5’-flanking regions
PCYP6B471 TGAGTTGGTGTTTAGGCGGTGTAGG Cloning 5’-flanking regions
PCYP6B472 CTAACACTGGGACTGCTGCGAGG Cloning 5’-flanking regions
CYP6B47+189 ggcctcgagCAACCGATTCCTTGATGTTTC Promoter-pGL3 constructs
CYP6B4722 gccgctagcATCGTCGAGTTATTTACAA Promoter-pGL3 constructs
CYP6B47129 gccgctagcACACCGCCTAAACACCA Promoter-pGL3 constructs
CYP6B47377 gccgctagcTAGACGCATTGCTCGCCCC Promoter-pGL3 constructs
CYP6B47487 gccgctagcTACCTCTAAACCGCTAAAGA Promoter-pGL3 constructs
CYP6B47593 gccgctagcAACAATTACAGGTTATCATCAGA Promoter-pGL3 constructs
CYP6B47703 gccgctagAGCTACATATATCCGTTTTGTC Promoter-pGL3 constructs
CYP6B47847 gccgctagcAGTGGGTGGGTAACCTATCAG Promoter-pGL3 constructs
CYP6B47990 gccgctagcCAATAAGTTGTGTGAATGTAACA Promoter-pGL3 constructs
CYP6B471178 gccgctagcTCTACAGGAGTAATACCACGG Promoter-pGL3 constructs
CYP6B471296 gccgctagcCAAGCAAGACTTTTCCCAGA Promoter-pGL3 constructs

(for 30 -RACE) were excised from the agarose gel and purified using
a DNA gel extraction kit (Tiangen, China). These PCR products were
cloned into the pGEM-T-easy vector (Promega, USA) and se-
quenced by the dideoxynucleotide method (Invitrogen Life
Technologies).
After the 5’-end and 3’-end sequences were obtained, contigs
were assembled to produce putative full-length P450 sequences
by using the DNAMAN software (DNAMAN 5.2.2, Lynnon BioSoft,
Pointe-Claire, Quebec, Canada). To verify the full-length of putative
P450 cDNAs, primers (6B47VF and 6B47VR, see Table 1) were used
to amplify the open reading frame (ORF) of CYP6B47 cDNAs. To
eliminate potential error created by Taq DNA polymerase, a ther-
mal-stable high-fidelity PrimeSTAR™ HS DNA polymerase (Takara,
Japan) was used to amplify the cDNAs. All the PCR reactions were
performed under the following conditions: an initial denaturation
at 94 °C for 3 min, followed by 33 cycles of 94 °C for 20 s, 55 °C for
25 s, and 72 °C for 2 min and a final extension at 72 °C for 10 min.
2.4. Cloning and sequencing the 50 -flanking regions
Four adaptor-ligated S. litura genomic DNA libraries were con-
structed using the Universal GenomeWalker Kit as described by
the manufacturer (Clontech, USA). S. litura genomic DNAs were iso-
lated as described by Sambrook (Sambrook and Russell, 2001) and
then were digested with four different restriction enzymes (pro-
vide by the Kit) to generate four pools of blunt-end fragments of
S. litura genomic DNAs. For each pool, the genomic DNA fragments
were ligated to GenomeWalker adaptors with T4 DNA ligase, (re-
ferred to as a Genomewalker library). The adaptor ligated DNA
fragments in the Genomewalker library were amplified by PCR
with LATaq polymerase (Takara, Japan), two antisense primers
(PCYP6B471 and PCYP6B472, Table 1) based on the 50 coding re-
gions of P450 genes, and two sense primers (AP1 and AP2, Table 1)
based on sequences of the adaptor. The PCR products were cloned
into the pGEM-T-easy vector (Promega, USA) and sequenced by
automated sequencing (Invitrogen Life Technologies).
2.5. Bioinformatics analysis
The sequence of S. litura CYP6B47 cDNA was compared with
those of other CYP6B47 sequences deposited in GenBank using
the ‘‘BLAST-N’’ or ‘‘BLAST-X’’ tools available on the National Center
for Biotechnology Information (NCBI) website. The amino-acid se-
quence of S. litura CYP6B47 was deduced from the corresponding
cDNA sequence using the translation tool at the ExPASy Proteomics
website (http://www.expasy.org/tools/dna.html). Motifs were
confirmed by scanning the Prosite database (http://www.
expasy.ch/tools/scnpsit1.html). Signal peptides were predicted
with the SignalP 3.0 program using the neural networks method
(http://www.cbs.dtu.dk/services/SignalP/). Protein structure pre-
diction was performed with the PHYRE server: http://www.
sbg.bio.ic.ac.uk/~phyre/. A phylogenetic tree was constructed by
MEGA 5.0 applying the Neighbor-Joining method. TFsearch of the
TRANSFAC database (v. 1.3) (http://www.cbrc.jp/research/db/
TFSEARCH.html) was used to identify putative transcription factor.
Promoter elements search was performed with TESS software
(http://www.cbil.upenn.edu/cgi-bin/tess/tess). Search parameters
were as follows: maximum allowed string mismatch = 20%, mini-
mum log-likelihood ratio score = 8, minimum string length = 5
and minimum Lg-likeihood ratio = 6. Only sites showing Lg above
0.85 were considered significant. The sequence upstream of the
putative transcriptional start site was predicted at the website
(http://www.fruitfly.org/seq_tools/promoter.html).
2.6. Quantitative real time PCR (Q-RT PCR)
Q-RT PCR analysis was used to study tissue-specific, stage-
specific and Pb stress expression of CYP6B47. Total RNA were con-
ducted with Trizol reagent (Invitrogen, USA). According to the
manufacturer’s instructions, 1 lg of total RNA was used for the first
strand synthesis of cDNA in a total volume of 10 ll using the
PrimeScript™ cDNA synthesis system (Takara, Japan). Gene-
specific primers were designed in terms of S. litura CYP6B47:
 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736
QCYP6B47F and QCYP6B47R (Table 1). Primers of the housekeeping
gene b-actin were used as endogenous controls: QActinF and QAc-
tinR (Table 1). Q-RT PCR was performed on the BioRad iCycler iQ5
(BioRad, Hercules, CA, USA) with SYBR Premix Ex Taq (Perfect Real
Time) Kit (Takara, Japan) under the following thermal program: 1
cycle of 95 °C for 10 s, 40 cycles of 95 °C for 5 s and 60 °C for
30 s. After PCR, the homogeneity of the PCR product was confirmed
by a melting curve analysis. The ratios of P450/b-actin levels of
gene expression were calculated. The relative copy number of
CYP6B47 mRNA was calculated according to the 2DDCT method
(Livak and Schmittgen, 2001). The threshold cycle value difference
(DCT) between P450 mRNA and b-actin RNA of each reaction was
used to normalize the level of total RNA. Reactions with DEPC
water instead of cDNA templates served as negative controls. The
assay was repeated three times with separately extracted total
RNA samples. Three replicates were performed for each reaction
to account for intra experiment variation.
2.7. Construction of CYP6B47 promoter-pGL3 constructs
A series of stepwise deletion fragments of the CYP6B47 regulatory
sequence starting at position +1 bp and extending to 22, 129,
377, 487, 593, 703, 847, 990, 1178 and 1296 bp were
generated by PCR amplification using the S. litura genomic DNAs
as template, and deletion constructs were obtained by PCR using
the following forward primers: CYP6B4722, CYP6B47129,
CYP6B47377, CYP6B47487, CYP6B47593, CYP6B47703,
CYP6B47847, CYP6B47990, CYP6B471178, CYP6B471296
(Table 1).The amplified ten DNA fragments were ligated to the
pMD-18T vectors (TaKaRa, Japan) for sequencing to confirm identity
of the fragments. The fragments were then transferred to the
luciferase reporter plasmid, pGL3-basic vector (Promega, USA),
between the NheI and xhoI restriction sites.
2.8. Cell culture and transfection
Trichoplusia ni (Hi5) cells were maintained in Grace’s medium
(Gibco BRL, Gaithersburg, USA) supplemented with 10% fetal bo-
vine serum (FBS, Hyclone, Beijing, China). For transfection, the cells
were at a density of 105 cells/ml in 24-well tissue culture plates for
12 h. A mixture of 100 ll containing 0.25 lg of the reporter plas-
mid DNA, 0.1 lg internal control plasmid (pRL-TK vector, Promega)
and 3 ll cellfectin (Invitrogen, USA) in the Grace’s medium without
FBS was used to transfect the Hi5 cells. After culture for 6 h, the
transfection mixture was replaced with 500 ll fresh Grace’s med-
ium with 10% FBS. The cells were cultured for an additional 48 h
and harvested for luciferase expression analysis. Transfections
were repeated three times (n = 3) independently and the results
of the average expression level of the target genes was expressed
as mean ± SE.
2.9. Measurement of luciferase activity
For measurement of luciferase activity, the treated cells were
washed twice in 1 PBS. Two hundred microlitres of lysis buffer
(Promega) was added to each well and the cells were collected. A
Dual-Luciferase Reporter Assay was conducted using the manufac-
turer’s protocol (Promega, USA) in a Tecan Infinite M200 Pro
instrument (Tecan Group Ltd., Switzerland). Luciferase activity of
the constructs was normalized to the Renilla luciferase activity
and reported as means ± SE.
2.10. Pb treatment and Insecticides treatment
Upon hatching, first instar larvae were fed on artificial diet with
different doses of Pb nitrate (Merck, Germany). The final concentra-
729
tions of Pb in the diet were 0, 12.5, 25 and 50 mg/kg. Eggs laid by the
first generation adults of each treatment were used as the starting
point of the next generation with the same Pb concentration. Other
generations were treated in the same way. The fat body and midgut
samples were collected from 5th star larvae of the five generation.
The collection method was performed as described in Section 2.1.
Q-RT PCR (performed as described in Section 2.6) was used to inves-
tigate the expression of P450 in exposed insects.
Larvae (0.35–0.45 g) from the fifth generation were applied in a
larval bioassay conducted with two insecticides including alpha-
cypermethrin and fenvalerate (95%, Rongcheng Chemical Corpora-
tion of Jiangsu, China). Larvae fed on the artificial diet without Pb
were used as the control (Ck). Bioassays were performed in
triplicate with 20 larvae in each bioassay. Four different insecticide
concentrations resulted in mortality of control larvae ranging from
5% to 95%. Insecticides used included alpha-cypermethrin and
fenvalerate, at 12.5, 10, 6.25, 3.125 lg/ml, respectively. Larval
mortality was recorded after 48 h of contact with the insecticide.
For each insecticide, the mean LC50 was determined and tolerance
ratios for larvae exposed to Pb comparatively with unexposed
larvae were calculated and expressed as%-increased tolerance.
Because comparisons of LC50 values may not well represent differ-
ential tolerance across all doses of insecticide used for bioassays,
differential insecticide tolerance between larvae exposed to Pb
and controls was further analyzed by generating a Generalized
Linear Model (GLM) from dose–mortality data followed by a
likelihood ratio test.
2.11. Statistical analysis
Statistical analysis was performed by the SAS program (version
8.1, 1999–2000, SAS Institute Inc, Cary, NC). LC50 values and 95%
confidence interval were determined by probit analysis. The data
of dosage-mortality in Pb treated larvae and normal larvae were
compared by generalized linear models. The SAS program was used
for statistical analysis of differences in mRNA expression and lucifer-
ase activity of promoter by analysis of variance (ANOVA) and Tukey’s
studentized range test (P = 0.05) using the PROC GLM program.
3. Results
3.1. Identification and characterization of the CYP6B47
The cDNA sequence, with the deduced amino acid below the
nucleotide sequence (GenBank accession No. GQ465039.2), is
shown in Fig. 1. The sequence has been submitted to the P450
nomenclature committee, and named CYP6B47. The sequence is
1718 bp in length with an ORF of 1509 bp, a 47 bp 50 non-coding re-
gion (50 UTR) and a 209 bp with a polyadenylation signal of the 3
‘non-coding region (30 UTR) encoding 503 amino acid residues with
a predicted molecular weight of 57.44 kDa and a theoretical pI of
8.24. Further analysis of the CYP6B47 nucleotide sequence indi-
cated that the start codon, ATG, is located at positions 48–50,
and the termination codon, TGA, at positions 1510–1512.
By scanning the Prosite database (http://www.expasy.ch/tools/
scnpsit1.html), the deduced amino acid sequence of CYP6B47
shares a number of common characteristics with other members
of the P450 superfamily. For instance, the classic heme-binding se-
quence motif F   G    C  G (residues 436–445, in which C is
the hemeiron ligand) that is conserved among most P450 enzymes,
and the cysteine which is present in all P450 sequences. The other
important motif the EXXR (residues 479–482) in the K helix
around the cysteine of the heme-binding domain is almost identi-
cal in all aligned cytochrome P450 sequences (Fig. 1).
Signal peptide prediction with the SignalP 3.0 program
using Neural-networks method (http://www.cbs.dtu.dk/services/
730 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736

Fig. 1. The full-length cDNA sequence of CYP6B47 and its deduced amino acid sequence. The start codon ATG is indicated with bold and the stop codon, TGA, is indicated with
bold and by an asterisk. The polyadenylation signal, AATAAA, is shown in bold italic lowercase letters. The conserved regions of P450 enzymes including substrate recognition
sites (SRSs) and the heme-binding sequence motif F   G    C  G are indicated by the boxed amino acid. The amino acid thickly underlined is the position of the
transmembrane region, which also belongs to the region of Signal P prediction.
 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736 731

Fig. 2. Phylogenetic relationship based on the amino acid sequence alignment of cytochrome P450s from 4 clans. The phylogenetic tree was inferred using the Neighbor-
Joining method. Bootstrap values in percent from 1000 replicates are shown. The GenBank accession numbers of the protein sequences are shown in parentheses. Note: Am:
Apis mellifera; Bm: Bombyx mori; Dm: Drosophila melanogaster; Ha: Helicoverpa armigera; Hz: Helicoverpa zea; Ms: Manduca sexta; Nv: Nasonia vitripennis; Pc: Papilio
canadensis; Pg: Papilio glaucus; Pp: Papilio polyxenes; Px: Plutella xylostella; Sl: Spodoptera litura.

SignalP/) indicated that CYP6B47 is a membrane protein. It revealed
that the amino acid residue from the initiation of Met amino acid
to 17 amino acids is predicted to be the signal peptide and sug-
gested that CYP6B47 may be involved in oxidative metabolism of
exogenous compounds.
3.2. Phylogenetic relationship of CYP6B47 with other CYP families
To investigate relationship of CYP6B47 with other CYP families,
a phylogenetic analysis of their deduced protein sequences was
performed using the neighbor-joining method. CYP6B47 and
CYP6B48 are closest in amino acid sequences to P450s in the CYP6B
family and belong to the CYP3 clan. Phylogenetic analysis indicates
that these CYP6Bs form two distinct clades. The first clade includes
three familys (18 P450s from Papilionidae, 1 P450 from Bombyci-
dae and 2 P450s from Sphingidae). The second clade includes 11
P450s from Noctuidae (CYP6B47, CYP6B48 and CYP6B50 from S.
litura, 1 P450 from Heliothis virescens, 3 P450s from Helicoverpa
armigera and 4 P450s from Helicoverpa zea). The comparative anal-
ysis of the CYP6Bs gene showed high homology (Fig. 2).
732 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736

3.4. Developmental and tissue specific expression of S litura CYP6B47

Using the Q-RT PCR, the relative expression pattern of mRNAs of

CYP6B47 from 2 day old 1st, 2nd, 3rd, 4th 5th and 6th (last) instar
larvae, pupae, and adults is shown Fig. 4A. The CYP6B47 transcripts
levels were present in larvae, but were absent in pupae and adults.
The CYP6B47 expression was insignificantly different among 1st,
2nd and 3rd instar larvae. Compared to 1st instar larvae, the tran-
scripts levels in 4th instar larvae were less than half, whereas that
in 6th instar was increased by 66%.
By Q-RT PCR detection, CYP6B47 in the midgut and fat body had
a high level of transcription, while a small amount of transcription
was observed in brain and cuticle. Expression of CYP6B47 from 5th
instar larvae was present in the order of fat body, midgut, brain
and cuticle from high to low but was absent in ovary and hemo-
lymph (Fig. 4B).

3.5. Sequence analysis of the 50 -flanking region of CYP6b47

We predicted multiple putative elements for transcription fac-

tors binding in the 50 -flanking region (Fig. 5). The sequence up-
stream of the putative transcriptional start site conforms to
arthropod promoter initiators (Inr) consensus sequence YYANTY,
where adenine is the start of transcription. A conserved element
(TCATTC) of Inr was present between 39 and 43 upstream of
Fig. 3. Predicted three-dimensional structures of CYP6B47 based on homology the ATG translation start codon. The TATA box consensus sequence
modeling. The black arrows indicate putative binding sites of heme and SRSs. Image (TATAAA) lies in close proximity upstream to the ATG translation
colored by rainbow N ? C terminus. (For interpretation of the references to color in start codon between 25 and 30. The consensus sequence, TAG-
this figure legend, the reader is referred to the web version of this article.) CGTG, between 54 and 60 in CYP6b47 perfectly matched the
xenobiotic-responsive element, XRE-AhR, (TA/TGCGTG). A consen-
3.3. Three-dimensional computer modeling of CYP6B47
sus sequence of a cAMP responsible element, CRE for the binding of
the cAMP response element binding protein (CREB) is located be-
Prediction of three-dimensional structures of CYP6B47 was car-
tween 1219 and 1225 (TTACGTAT), 847 and 854 (TAACCT-
ried out on the basis of homology modeling. The tertiary structure
CA) and 291 to 298 (TGACCTCA). There are five putative GATA
of CYP6B47 was modeled on cytochrome p450 of humans at 100%
binding sites (T/AGATAA/G) in the 50 -flanking region of CYP6b47.
confidence such as 2a6 (c3ebsA_), 2e1 (c3e4eA_), 1a2 (c2hi4A_),
In addition, other putative regulatory elements for the binding of
2d6 (c2f9qA_) etc. PDB accession numbers of these templates are
the general transcription factor such as EcR (ecdysone receptor),
shown in parentheses. 465 residues (92% of sequence) have been
Dfd (Deformed), Broad-Complex (BR-C) and Oct-1 (Octamer
modeled with 100.0% confidence by the single highest scoring tem-
binding proteins) were analyzed with TESS software and TFsearch
plate (d1tqna_).
of the TRANSFAC database.
The three-dimensional structure is the ultimate goal of protein
structure prediction and it is necessary to fully understand protein
function. The characteristic motif and substrate recognition sites 3.6. Basal luciferase activities of 50 -flanking sequence
(SRSs) of P450s were analysed (Fig. 3). SRS1 positions in the loop.
F, G and I helices contain SRS2 SRS3 and SRS4, respectively. SRS5 We previously cloned a 2141-bp 50 -flanking sequence of
and SRS6 form b-sheet. The SRS1, SRS4 and SRS5 above the CYP6B47 from a laboratory strain of S. litura by genome walking
heme-banding site form the bulk of the catalytic pocket. (GenBank accession No. JN862817). In order to determine the basal

5 16
A B
fold expression relative to controls

fold expression relative to controls

a
14
a
4
12

10 b
3 b
b b
b
8

2 6

c 4 c
1
2
d

0 0
1st 2nd 3rd 4th 5th 6th Pupae Adult cuticle brain midgut fat body ovary hemolymph

Developmental stages Tissues

Fig. 4. Q-RT-PCR analysis expression of CYP6B47 in S. litura at different life stages and tissues. Different letters on the error bars show significant differences (P < 0.05, Tukey’s
HSD tests) among the developmental stages and tissues.
 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736 733

Fig. 5. Sequence analysis of the 5’-flanking region of CYP6b47. The nucleotides are numbered from the transcription start point (tsp) as +1. The tsp is in bold and italics.
Sequences known for binding of regulatory factors are underlined with the factor name. The left and right arrows indicate the primers used in the investigation of basal
luciferase activities of the promoter.
734 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736

+1

P(-1296/+189) luc a

P(-1178/+189) luc b
P(-990/+189) luc b
P(-847/+189) luc d
P(-703/+189) luc c

P(-593/+189) luc c
P(-487/+189) luc c
P(-377/+189) luc c

P(-129/+189) luc f
P(-22/+189) luc f
PGL3-basic luc e

0 1 2 3 4 5 6

Relative Luciferase Activities

Fig. 6. The basal luciferase activities of 50 -flanking sequence. The name of each CYP6B47 promoter-PGL3 construct is composed of a ‘‘P’’ and a pair of parentheses that contain
two numerals, separated by a dash, to specify the 50 and 30 positions of the corresponding promoter fragment. The names and schematic diagrams of the corresponding set of
CYP6B47 promoter-PGL3 constructs are shown on the left side, with a white horizontal box representing the luciferase open reading frame and a bent arrow plus +1
representing the transcription start site +1. The error bars represent and standard errors of at least three independent transfections. Values sharing the same letter are not
significantly different at P < 0.05 (Tukey’s HSD tests).

Table 2
Differential tolerance of S. litura larvae to three pyrethroids after exposure to lead for 5 generations.a

Treatment Alpha-cypermethrin Fenvalerate

LC50 (CI95%) Increased tolerance (%) P-value LC50 (CI95%) Increased tolerance (%) P-value
Controls 6.0 (4.9–7.4) – – 3.1 (2.5–3.8) – –
**
Pb1 6.6 (4.8–7.2) 10 ns 4.3 (3.0–5.4) 38
**
Pb2 5.3 (4.1–6.8) 12 ns 4.3 (3.0–6.1) 38
* ***
Pb3 8.1 (6.4–10.3) 35 4.7 (3.7–5.9) 52

ns: Non significant.

a
Larvae were exposed for 5 generations to low concentration of lead (Pb1, Pb2 and Pb3). The final concentrations of Controls, Pb1, Pb2 and Pb3 in the diet were 0, 12.5, 25
and 50 mg/kg, respectively. For each treatment, tolerance of larvae exposed to two pyrethroids (alpha-cypermethrin and fenvalerate) comparatively to unexposed larvae
(controls) was calculated by comparing LC50 values. For each comparison, a Generalized Linear Model (GLM) followed by a likelihood ratio test was used for statistical
comparisons of larval tolerance to each insecticide.
*
P < 0.05.
**
P < 0.01.
***
P < 0.001.

luciferase activities of the 50 -flanking sequence, a set of 10 CYP6B47
promoter 50 progressive deletion constructs [P(1296/+189),
P(1178/+189), P(990/+189), P(847/+189), P(703/+189),
P(593/+189), P(487/+189), P(377/+189), P(129/+189),
P(22/+189)] (see Fig. 5 for their boundaries) were co-transfected
into Hi5 cells with a pRL-TK control plasmid. Relative to the pro-
moter plus 50 UTR construct P(703/+189), 50 deletions to 1296,
1178, and 990 significantly increased basal promoter activity,
whereas a 50 deletion to 847 significantly reduced and to 129
and 22 abolished it (Fig. 6). A 50 deletion to 593 somewhat in-
creased it (by 15%, not significant), whereas a 50 deletion to 487
and 377 all slightly reduced it (not significant).
3.7. Effect of S. litura exposed to Pb stress
Larvae were exposed to low concentration of lead (0, 12.5, 25
and 50 mg/kg) for 5 generations to research the long-term effect
of Pb on the tolerance of larvae to pyrethroid insecticides. Larvae
tolerance to alpha-cypermethrin (35% increase in LC50) and
fenvalerate (52% increase in LC50) were improved after exposure
to Pb3 for 5 generation. Larvae tolerance to fenvalerate was mod-
erately improved after exposure to Pb1 and Pb2 (all 38% increase
in LC50) for 5 generation (Table 2).
After Pb exposure for 5 generations, a significant enhancement
in the expression levels of CYP6B47 genes was detected in the fat
body of S. litura from Pb2 and Pb3 treatments (Fig. 7A). Compared
to Ck, CYP6b47 transcripts were induced approximately 1.5-fold in
Pb2 treatment and 3.3-fold in Pb3 treatment. After Pb3 treatment
for 5 generations, the expression level of CYP6B47 in the midgut of
S. litura was significantly higher (2.4) than that of control
(Fig. 7B).
4. Discussion
Substrate recognition sites (SRSs) have been identified in site-
directed mutagenesis experiments as important for substrate
metabolism (Gotoh, 1992). We predicted secondary structure and
three-dimensional molecular structure of CYP6B47 with the PHYRE
server and also found 1–6 SRS. A comparative analysis of the SRS
with the CYP6B8 gene of H. zea, which belongs to the category of
‘‘generalists’’, showed high homology. The homology for SRS1,
SRS4 and SRS5, which were predicted to be of major importance
in contacts with fatty acids (Hlavica, 2011), was 100%, 78.9% and
100%, respectively. By contrast the homologies for SRS2, SRS3
and SRS6 were low: 62.5%, 62.5% and 66.7%, respectively. The met-
abolic profile of CYP6B8 extends from natural allelochemicals such

4 TGCGTG). This element has also been found in the promoter re-
A a
fold expression relative to controls
3 sely related to transcription factors which bind to DNA sequences.
2
c
c
1 transcription (Montminy et al., 1990). There are one CREs and
0 genes (Petersen et al., 2001). A chimeric protein consisting of
0 12.5
3.0
B a
fold expression relative to controls
2.5
2.0
1.5
b b
1.0
.5
0.0
0 12.5
Pb treament (mg/kg)
Fig. 7. Differential expressions of CYP6B47 of S. litura after exposed to Pb for 5
generations. After different Pb for 5 generations, expression levels of CYP6B47 were
detected in S. litura fat body (A) and midgut (B). Significant differences (P < 0.05,
using Tukey’s HSD tests) among treatments in a group were indicated by different
small letters above the bars.
as flavones, indoles, furanocoumarins and chlorogenic acid to di-
verse classes of synthetic insecticides represented by a-cyper-
methrin, aldrin or diazinon (Li et al., 2004). Because of high
homology of SRS between CYP6B8 and CYP6B47, we hypothesize
that CYP6B47 also could metabolize plant allelochemicals, insecti-
cides and fatty acids in particular.
Tissue-specific expression suggested potential roles in specific
biological functions (Chung et al., 2009). For instance, CYP15a1
from the cockroach Diploptera punctata is expressed selectively in
the corpora allata and encodes a P450 enzyme that catalyses the
conversion of methyl farnesoate to JH III (Helvig et al., 2004).
CYP6B9 in H. zea, which metabolizes host plant allelochemicals,
shows high expression only in midgut tissue (Li et al., 2002a). Be-
cause of a high level of transcription in the midgut and fat body,
which are major sites of detoxification in insects (Hodgson, 1985;
Scott and Lee, 1993), CYP6B47 has potential roles in detoxification
processes.
Inr (Initiator Elements) co-ordinates expression from upstream
enhancers the TATA box (Cherbas and Cherbas, 1993; Smale, 1997;
Zhou and Chiang, 2001). There is a nonconsensus TATA box -30
from the transcription start site of CYP6B47, which is within the
preferred location (29 to 32, measured from the first thymine)
(Ponjavic et al., 2006). Between 54 and 60 in CYP6b47 perfectly
matches the xenobiotic-responsive element, XRE-AhR, (TA/
J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736 735
gions of insect CYP6B genes that are involved in metabolism of
host plant allelochemicals (Hung et al., 1996).
The basal luciferase activitie of the 50 -flanking sequence is clo-
The GATA transcription factors are zinc-finger proteins known to
bind DNA and transactivate target genes (Latinkić et al., 2004)
and to activate of Drosophila alcohol dehydrogenase (Adh) in
b embryonic and larval fat bodies (Abel et al., 1993). CREB regulates
gene transcription by binding to CRE, a cis-acting element in the
regulatory region of various genes, resulting in activation of gene
one GATA binding sites between 377 and 129 of the CYP6B47
promoter. The CREs and the GATA binding sites have also been
reported in the promoter regions of insect CYP6B1 and CYP6B3
25 50 Deformed with a substituted Abdominal-B homeodomain exhibits
significant activation activity when fused to a heterologous DNA
binding domain (Zhu and Kuziora, 1996). The region between
847 and 1296 in CYP6b47 contains five Dfd binding sites. Rela-
tive to the promoter construct P(847/+189), 50 deletions to
1296, 1178, and 990 significantly increased basal promoter
activity. The Oct-1 element that represses vertebrate CYP1A genes
(Sterling and Bresnick, 1996) and BR-C acts as a negative transcrip-
tional regulator for PB induction through the CYP6D1 promoter in
Drosophila S2 cells (Lin et al., 2010). This is a reason that the pro-
b
moter of CYP6B47 decreases luciferase activity such as P(847/
+189) and P(129/+189).
Heavy metal copper with the highest effect on increasing mos-
quito larvae tolerance to insecticides was also the best inducer of
P450 activities (Poupardin et al., 2008). Our study showed that lar-
val pre-exposure to Pb can lead to significant increases in tolerance
to insecticides and the expression of CYP6B47. This trend supports
25 50 the central role of P450 in the increased tolerance of larvae to
insecticides through their induction by heavy metal (Korashy and
El-Kadi, 2005). There is also tissue specificity of the induction re-
sponse for P450 (Giraudo et al., 2010; Willoughby et al., 2006).
Induction of a detoxification gene in D. melanogaster requires an
interaction between tissue specific enhancers and a novel cis-
regulatory element (Chung et al., 2011). Pb can modulate gene
expression through the transcription factor (zinc finger) GATA
(Ghering et al., 2005), which is important for gene expression in
the midgut and fat body as a tissue-specific enhancer (Chung
et al., 2011; Petersen et al., 1999; Senger et al., 2006). We found
that expression of CYP6B47 significantly increased in the midgut
and fat body after lead (Pb) exposure in S. litura. The induction of
CYP6B1 upon exposure to xanthotoxin also occurs in the midgut
and fat body in P. polyxenes (Petersen et al., 2001).
In conclusion, this study has demonstrated the molecular char-
acterization and expression patterns of CYP6B47 in S. litura. The
putative cytochrome P450 belongs to the CYP3 clan and the second
clade of CYP6Bs. Tissue- and stage-specific expression and phylo-
genetic analysis of CYP6B47 suggest that CYP6B47 may be involved
in oxidative metabolism of plant allelochemicals and insecticides.
In addition, sequence analysis and basal luciferase activity of the
50 -flanking region of CYP6B47 could contribute to understand the
transcriptional mechanisms. Future studies that test the predicted
transcription factor binding sites and determine the mechanisms
responsible of induction by Pb may allow us to further understand
regulation of CYP6B47.
Acknowledgements
This research was financially supported by the National 973
Project of China (2010CB126205), the National Natural Science
Foundation of China (31071680) and the Open Project of the State
736 J. Zhou et al. / Journal of Insect Physiology 58 (2012) 726–736
Key Laboratory of Biocontrol (SKLBC2010K01). The authors would
like to thank Dr. David Nelson for naming the P450 genes.
References
Abel, T., Michelson, A.M., Maniatis, T., 1993. A Drosophila GATA family member that
binds to Adh regulatory sequences is expressed in the developing fat body.
Development 119, 623–633.
Bernhardt, R., Waterman, M.R., 2007. Cytochrome P450 and steroid hormone
biosynthesis: metal ions in life sciences. John Wiley & Sons Ltd.
Chen, Q.J., Li, J., Pang, H., 2000. A simple artificial diet for mass rearing of some
noctuid species. Entomological Knowledge 6, 325–327.
Cherbas, L., Cherbas, P., 1993. The arthropod initiator: the capsite consensus plays
an important role in transcription. Insect Biochemistry and Molecular Biology
23, 81–90.
Chung, H., Sztal, T., Pasricha, S., Sridhar, M., Batterham, P., Daborn, P.J., 2009.
Characterization of Drosophila melanogaster cytochrome P450 genes.
Proceedings of the National Academy of Sciences of the United States of
America 106, 5731–5736.
Chung, H., Boey, A., Lumb, C., Willoughby, L., Batterham, P., Daborn, P.J., 2011.
Induction of a detoxification gene in Drosophila melanogaster requires an
interaction between tissue specific enhancers and a novel cis-regulatory
element. Insect Biochemistry and Molecular Biology 41, 863–871.
Feyereisen, R., 2005. Insect cytochrome P450. In: Gilbert, L.I., Iatrou, K., Gill, S.S.
(Eds.), Comprehensive Molecular Insect Science. Elsevier, Oxford, pp. 1–77.
Feyereisen, R., 2006. Evolution of insect P450. Biochemical Society Transactions 34,
1252–1255.
Ghering, A.B., Jenkins, L.M.M., Schenck, B.L., Deo, S., Mayer, R.A., Pikaart, M.J.,
Omichinski, J.G., Godwin, H.A., 2005. Spectroscopic and functional
determination of the interaction of Pb2+ with GATA proteins. Journal of the
American Chemical Society 127, 3751–3759.
Giraudo, M., Unnithan, G.C., Le Goff, G., Feyereisen, R., 2010. Regulation of
cytochrome P450 expression in Drosophila: genomic insights. Pest
Biochemistry and Physiology 97, 115–122.
Gotoh, O., 1992. Substrate recognition sites in cytochrome P450 family 2 (CYP2)
proteins inferred from comparative analyses of amino acid and coding
nucleotide sequences. Journal of Biological Chemistry 267, 83–90.
Helvig, C., Koener, J., Unnithan, G., Feyereisen, R., 2004. CYP15A1, the cytochrome
P450 that catalyzes epoxidation of methyl farnesoate to juvenile hormone III in
cockroach corpora allata. Proceedings of the National Academy of Sciences of
the United States of America 101, 4024–4029.
Hemingway, J., Field, L., Vontas, J., 2002. An overview of insecticide resistance.
Science 298, 96–97.
Hlavica, P., 2011. Insect cytochromes P450: topology of structural elements
predicted to govern catalytic versatility. Journal of Inorganic Biochemistry
105, 1354–1364.
Hlavica, P., Lehnerer, M., 2010. Oxidative biotransformation of fatty acids by
cytochromes P450: predicted key structural elements orchestrating substrate
specificity, regioselectivity and catalytic efficiency. Current Drug Metabolism
11, 85–104.
Hodgson, E., 1985. Microsomal monooxygenases. In: Kerkut, G.A., Gilbert, L.I. (Eds.),
Comprehensive Insect Physiology. Biochemistry and Pharmacology. Pergamon,
Oxford, pp. 225–331.
Hung, C.F., Harrison, T., Berenbaum, M., Schuler, M., 1995. CYP6B3: a second
furanocoumarin-inducible cytochrome P450 expressed in Papilio polyxenes.
Insect Molecular Biology 4, 149–160.
Hung, C.F., Holzmacher, R., Connolly, E., Berenbaum, M.R., Schuler, M.A., 1996.
Conserved promoter elements in the CYP6B gene family suggest common
ancestry for cytochrome P450 monooxygenases mediating furanocoumarin
detoxification. Proceedings of the National Academy of Sciences 93, 12200–
12205.
Janosek, J., Hilscherova, K., Blaha, L., Holoubek, I., 2006. Environmental xenobiotics
and nuclear receptors-Interactions, effects and in vitro assessment. Toxicology
in Vitro 20, 18–37.
King-Jones, K., Horner, M.A., Lam, G., Thummel, C.S., 2006. The DHR96 nuclear
receptor regulates xenobiotic responses in Drosophila. Cell Metabolism 4, 37–
48.
King-Jones, K., Thummel, C.S., 2005. Nuclear receptors-a perspective from
Drosophila. Nature Reviews Genetics 6, 311–323.
Korashy, H.M., El-Kadi, A.O.S., 2005. Regulatory mechanisms modulating the
expression of cytochrome P450 1A1 gene by heavy metals. Toxicological
Sciences 88, 39–51.
Latinkić, B.V., Cooper, B., Smith, S., Kotecha, S., Towers, N., Sparrow, D., Mohun, T.J.,
2004. Transcriptional regulation of the cardiac-specific MLC2 gene during
Xenopus embryonic development. Development 131, 669–679.
Laudet, V., Bonneton, F., 2005. Evolution of nuclear hormone receptors in insects.
Comprehensive Molecular Insect Science 3, 287–318.
Li, X., Baudry, J., Berenbaum, M.R., Schuler, M.A., 2004. Structural and functional
divergence of insect CYP6B proteins: from specialist to generalist cytochrome
P450. Proceedings of the National Academy of Sciences of the United States of
America 101, 29–39.
Li, X., Berenbaum, M.R., Schuler, M.A., 2000. Molecular cloning and expression of
CYP6B8: a xanthotoxin-inducible cytochrome P450 cDNA from Helicoverpa zea.
Insect Biochemistry and Molecular Biology 30, 75–84.
Li, X., Berenbaum, M.R., Schuler, M.A., 2002a. Plant allelochemicals differentially
regulate Helicoverpa zea cytochrome P450 genes. Insect Molecular Biology 11,
343–351.
Li, X., Schuler, M.A., Berenbaum, M.R., 2002b. Jasmonate and salicylate induce
expression of herbivore cytochrome P450 genes. Nature 419, 712–715.
Lin, G., Kozaki, T., Scott, J., 2010. Hormone receptor-like in 96 and Broad-Complex
modulate phenobarbital induced transcription of cytochrome P450 CYP6D1 in
Drosophila S2 cells. Insect Molecular Biology 20, 87–95.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2-DDCT method. Methods 25, 402–408.
Ma, R., Cohen, M.B., Berenbaum, M.R., Schuler, M.A., 1994. Black swallowtail (Papilio
polyxenes) alleles encode cytochrome P450s that selectively metabolize linear
furanocoumarins. Archives of Biochemistry and Biophysics 310, 332–340.
Mahapatra, C.T., Bond, J., Rand, D.M., Rand, M.D., 2010. Identification of
methylmercury tolerance gene candidates in Drosophila. Toxicological
Sciences 116, 225–238.
McDonnell, C.M., Brown, R.P., Berenbaum, M.R., Schuler, M.A., 2004. Conserved
regulatory elements in the promoters of two allelochemical-inducible
cytochrome P450 genes differentially regulate transcription. Insect
Biochemistry and Molecular Biology 34, 1129–1139.
Misra, J.R., Horner, M.A., Lam, G., Thummel, C.S., 2011. Transcriptional regulation of
xenobiotic detoxification in Drosophila. Genes & Development 25, 1796–1806.
Montminy, M.R., Gonzalez, G.A., Yamamoto, K.K., 1990. Regulation of cAMP-
inducible genes by CREB. Trends in Neurosciences 13, 184–188.
Nelson, D.R., 2011. Progress in tracing the evolutionary paths of cytochrome P450.
Biochimica et Biophysica Acta (BBA)-Proteins & Proteomics 1814, 14–18.
Petersen, R.A., Zangerl, A.R., Berenbaum, M.R., Schuler, M.A., 2001. Expression of
CYP6B1 and CYP6B3 cytochrome P450 monooxygenases and furanocoumarin
metabolism in different tissues of Papilio polyxenes (Lepidoptera: Papilionidae).
Insect Biochemistry and Molecular Biology 31, 679–690.
Petersen, U.M., Kadalayil, L., Rehorn, K.P., Hoshizaki, D.K., Reuter, R., Engstrom, Y.,
1999. Serpent regulates Drosophila immunity genes in the larval fat body
through an essential GATA motif. EMBO Journal 18, 4013–4022.
Ponjavic, J., Lenhard, B., Kai, C., Kawai, J., Carninci, P., Hayashizaki, Y., Sandelin, A.,
2006. Transcriptional and structural impact of TATA-initiation site spacing in
mammalian core promoters. Genome Biology 7, R78.
Poupardin, R., Reynaud, S., Strode, C., Ranson, H., Vontas, J., David, J.P., 2008. Cross-
induction of detoxification genes by environmental xenobiotics and insecticides
in the mosquito Aedes aegypti: impact on larval tolerance to chemical
insecticides. Insect Biochemistry and Molecular Biology 38, 540–551.
Rupasinghe, S.G., Wen, Z., Chiu, T.L., Schuler, M.A., 2007. Helicoverpa zea CYP6B8 and
CYP321A1: different molecular solutions to the problem of metabolizing plant
toxins and insecticides. Protein Engineering Design and Selection 20, 615–624.
Sambrook, J., Russell, D., 2001. Molecular Cloning: A Laboratory Manual. Cold spring
Harbor Laboratory press, New York.
Scott, J.G., 1999. Cytochromes P450 and insecticide resistance. Insect Biochemistry
and Molecular Biology 29, 757–777.
Scott, J.G., Lee, S.S., 1993. Tissue distribution of microsomal cytochrome P450
monooxygenases and their inducibility by phenobarbital in the insecticide
resistant LPR strain of house fly, Musca domestica L. Insect Biochemistry and
Molecular Biology 23, 729–738.
Senger, K., Harris, K., Levine, M., 2006. GATA factors participate in tissue-specific
immune responses in Drosophila larvae. Proceedings of the National Academy of
Sciences of the United States of America 103, 15957–15962.
Smale, S.T., 1997. Transcription initiation from TATA-less promoters within
eukaryotic protein-coding genes. Biochimica et Biophysica Acta (BBA)-Gene
Structure and Expression 1351, 73–88.
Sterling, K., Bresnick, E., 1996. Oct-1 transcription factor is a negative regulator of
rat CYP1A1 expression via an octamer sequence in its negative regulatory
element. Molecular Pharmacology 49, 329–337.
Sueyoshi, T., Negishi, M., 2001. Phenobarbital Response Elements of Cytochrome
P450 Genes and Nuclear Receptors. Annual Review of Pharmacology and
Toxicology 41, 123–143.
Timsit, Y.E., Negishi, M., 2007. CAR and PXR: the xenobiotic-sensing receptors.
Steroids 72, 231–246.
Wen, Z., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Metabolism of linear and
angular furanocoumarins by Papilio polyxenes CYP6B1 co-expressed with
NADPH cytochrome P450 reductase. Insect Biochemistry and Molecular
Biology 33, 937–947.
Willoughby, L., Chung, H., Lumb, C., Robin, C., Batterham, P., Daborn, P.J., 2006. A
comparison of Drosophila melanogaster detoxification gene induction responses
for six insecticides, caffeine and phenobarbital. Insect Biochemistry and
Molecular Biology 36, 934–942.
Yepiskoposyan, H., Egli, D., Fergestad, T., Selvaraj, A., Treiber, C., Multhaup, G.,
Georgiev, O., Schaffner, W., 2006. Transcriptome response to heavy metal stress
in Drosophila reveals a new zinc transporter that confers resistance to zinc.
Nucleic Acids Research 34, 4866–4877.
Zeng, R.S., Wen, Z., Niu, G., Schuler, M.A., Berenbaum, M.R., 2007. Allelochemical
induction of cytochrome P450 monooxygenases and amelioration of xenobiotic
toxicity in Helicoverpa zea. Journal of Chemical Ecology 33, 449–461.
Zhou, T., Chiang, C.M., 2001. The Intronless and TATA-less Human TAFII55 Gene
Contains a Functional Initiator and a Downstream Promoter Element. Journal of
Biological Chemistry 276, 25503–25511.
Zhu, A., Kuziora, M.A., 1996. Functional domains in the deformed protein.
Development 122, 1577–1587.