Ecotoxicology and Environmental Safety 133 (2016) 146–156

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety

journal homepage: www.elsevier.com/locate/ecoenv

Salicylic acid mediates antioxidant defense system and ABA pathway

related gene expression in Oryza sativa against quinclorac toxicity
Jian Wang a, Mengting Lv a, Faisal Islam a, Rafaqat A. Gill a, Chong Yang a, Basharat Ali a,b,
Guijun Yan c, Weijun Zhou a,n
a
Institute of Crop Science and Zhejiang Key Laboratory of Crop Germplasm, Zhejiang University, Hangzhou 310058, China
b
Institute of Crop Science and Resource Conservation (INRES), Abiotic Stress Tolerance in Crops, University of Bonn, 53115 Bonn, Germany
c
School of Plant Biology, Faculty of Science and The UWA Institute of Agriculture, The University of Western Australia, Perth, WA 6009, Australia

art ic l e i nf o a b s t r a c t

Article history: The auxin herbicide quinclorac is widely used for controlling weeds in transplanted and direct-seeded
Received 4 May 2016 rice fields. However, its phytotoxic responses on rice are still unknown. Therefore, in the present in-
Received in revised form vestigation we studied the effects of different concentrations (0, 0.1 and 0.5 g/L) of quinclorac herbicide
28 June 2016
on the physiological and biochemical changes of two rice cultivars (XS 134 and ZJ 88) and further
Accepted 4 July 2016
Available online 21 July 2016
analyzed the ameliorating role of salicylic acid (SA) on quinclorac toxicity in rice plants. The results
revealed that exogenous application of SA significantly increased plant biomass and total chlorophyll
Keywords: contents in herbicide stressed plants. The lipid peroxidation and ROS (H2O2, O2
.,
OH) production were
Salicylic acid significantly increased in roots and leaves of both rice cultivars under quinclorac stress, demonstrating an
Quinclorac stress
oxidative burst in rice plants. Whereas, application of SA significantly lowered ROS contents under
Rice
quinclorac stress. Further, exogenous SA treatment significantly modulated antioxidant enzymes and
Oxidative stress
Glutathione transferases enhanced GSH concentration in stress plants. Anatomical observations of leaf and root revealed that
OsABA8oxs genes herbicide affected internal structures, while SA played a vital role in protection from toxic effects. Ex-
OsNCEDs genes pression analysis of stress hormone ABA genes (OsABA8oxs, OsNCEDs) revealed that quinclorac applica-
tion enhanced stress condition in cultivar ZJ 88, while SA treatment downregulated ABA genes more in
cultivar XS 134, which correlated with the enhanced tolerance to quinclorac induced oxidative stress in
this cultivar. The present study delineated that SA played a critical role under quinclorac stress in both
rice cultivars by regulating antioxidant defense system, reducing ROS formation and preventing the
degradation of internal cell organelles.
& 2016 Elsevier Inc. All rights reserved.

1. Introduction dicotyledonous and monocotyledonous weeds, particularly bar-

Rice (Oryza sativa L.) plays a dominant role in food production
in the world. In China, it accounts for one third of the total area of
cereal crops, approaching 30 million ha. In recent decades, with
the increasing population, food production becomes a profound
issue all over the world. Crop production is challenged by many
biotic and abiotic stresses, among which, weeds are considered as
a serious threat that impairs the production and quality of crops
(Kudsk and Streibig, 2003).
The quinolinecarboxylic acid quinclorac (3,7-dichloro-8-qui-
nolinecarboxylic acid), is a new class of highly selective auxin
herbicides that have been used as pre- and post-application in
transplanted and directly seeded rice. It is effective to control
n
Corresponding author.
E-mail address: wjzhou@zju.edu.cn (W. Zhou).
nyardgrass (Echinochloa crus-galli) in paddy fields (Grossmann,
1998). Quinclorac herbicide causes the symptoms of epinasty,
chlorosis, necrosis, growth inhibition under high concentration in
susceptible dicots. Its mode of action occurs through the induction
of ethylene biosynthesis in barnyardgrass. Overproduction of ABA
appears to be a crucial factor in growth inhibition and phytotoxic
response to herbicide (Grossmann, 2003). The key step regulating
ABA biosynthesis is catalysed by the plastid enzyme NCED en-
coded by a family of NCED genes (Schwartz et al., 2003). The level
of ABA is catabolized by ABA 8′-hydroxylase, a cytochrome P450
monooxygenase which isomerizes ABA into phaseic acid (PA)
(Krochko et al., 1998). Although, rice has relative higher resistance
to this herbicide, excessive use of herbicides can cause higher risks
to the growth of rice at early stage.
Quinclorac herbicide is widely used for the control of bar-
nyardgrass in China since 1990. Rice farmers started reporting the

http://dx.doi.org/10.1016/j.ecoenv.2016.07.002
0147-6513/& 2016 Elsevier Inc. All rights reserved.

Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156
failure of barnyardgrass control in 2000. Quinclorac-resistant
barnyardgrass is now a problem in some rice farming areas of
China (Li et al., 2016) and farmers apply quinclorac more than the
recommended dose to control barnyardgrass. Recently, Resgalla
et al. (2007) detected quinclorac as most frequent agrochemical
residue in five of seven hydrographic basins of State of Santa
Catarina (Brazil), additionally it was also detected in rivers flowing
through irrigated paddy field areas. Therefore, the investigation of
quinclorac induced toxic effects and its tolerance in rice plants
under such conditions are necessary to suggest resistant cultivar
under high dosage application areas. The normal metabolism of
herbicides detoxification includes several stages; i) Oxidation by
P450s and hydrolyses by carboxylesterases, ii) Bonds with mole-
cules such as reduced glutathione (GSH) or glucose, catalyzation
by glutathione transferases (GSTs), iii) Conjugates transportation
into the vacuole, and iv) Processing of conjugates involving partial
degradation, secondary conjugations and incorporation into cell
wall components (Riechers et al., 2010).
Besides these reactions, reactive oxygen species (ROS) have
been found associated with herbicide toxicity. At high concentra-
tions, quinclorac induces oxidative injuries in plants. Previously,
antioxidant enzyme activities i.e. superoxide dismutase (SOD),
catalase (CAT), ascorbic acid peroxidase (APX), and glutathione
reductase (GR) were studied in tolerant rice (Oryza sativa L. cv.
Nipponbare) and a particularly susceptible grass weed, Echinochloa
oryzicola Vasing (Sunohara and Matsumoto, 2004).
Salicylic acid (SA) has been found to play a vital role in plant
defense system. It can induce heat acclimation, improve drought
and chilling tolerance and increase chlorophyll contents (Horváth
et al., 2007). SA induces basic β-1,3-glucanase (Glu2) and chitinase
isozymes effectively in sugar beet (Burketová et al., 2003). SA as a
signaling molecule also mediates oxidative accumulation which
leads to a hypersensitive response and cell death (Horváth et al.,
2007). In addition, according to the study of Sunohara and Mat-
sumoto (2008), Dayan et al. (2010) and Grossmann (2010), quin-
clorac induced phytotoxicity in susceptible grass weeds such as
Echinochloa, Digitaria, and Setaria, through ethylene and its bio-
synthetic pathway-related substances including cyanide, while in
crop plants quinclorac-induced cell death is due to the ROS accu-
mulation and lipid peroxidation. Therefore, the objective of this
study was to investigate the ameliorating role of SA on morpho-
logical, physio-biochemical processes and ABA pathway related
gene expression under quinclorac stress, in order to understand
the mechanisms regarding the alleviation of SA-induced herbicide
stress tolerance in two rice cultivars.
2. Materials and methods
2.1. Plant materials and treatments
Two Japonica rice (Oryza sativa L.) cultivars i.e. Xiushui 134 (XS
134) and Zhejing 88 (ZJ 88) that are widely used in southeast
China were selected for the present study. Mature and healthy
seeds were surface-sterilized in 0.1% NaClO for 15 min, then rinsed
and soaked with distilled water for further 20 min. Seeds were
sown in plastic germination boxes (18  12  10 cm) with double
filter papers wetted by half-strength Hoagland solution. Under
dark for two days, germinated seeds with uniform size radicals
were selected and cultured in a growth chamber under the fol-
lowing conditions: 300 μmol m
2 s
1 active photon flux density,
25/20 °C (day/night) temperature, 70–80% relative humidity, and
14/10 h (light/dark) photoperiod. The solution was renewed after
every 5 days with half-strength Hoagland solution. Experimental
design was completely randomized with three replications. When
the height of the seedlings reached 10–12 cm, uniform size plants
Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
147
were transferred into full-strength Hoagland solution. 20 days
later, the quinclorac herbicide (with the concentration of 10%, in
wet powder form) was applied in a solution at different con-
centrations (0, 0.1, 0.5 g/L) at four-leaf stage. The treatment con-
centrations were based on pre-experimental studies, in which
several lower and higher levels of herbicide were used, i.e., 0.05,
0.1, 0.2, 0.3, 0.4, 0.5 and 0.6 g/L of quinclorac. The herbicide
quinclorac at 0.1 g/L showed a little damage on plant growth and
0.5 g/L imposed a significant damage to plant growth, while those
higher than 0.5 g/L were too toxic for plant growth. SA treatment
at 10 mg/L was applied in a solution two days before quinclorac
treatment. Ten days after treatment, plants were harvested and
separated into shoots and roots to carry out the morphological,
biochemical and ultrastructural examinations.
2.2. Determination of morphological changes
Five plants were taken for the measurement of plant height and
biomass 10 days after treatment. Chlorophyll contents in leaves
were determined according to the method of Porra et al. (1989).
2.3. Analysis of lipid peroxidation and reactive oxygen species (ROS)
Malondialdehyde (MDA) content was determined by 2-thio-
barbituric acid (TBA) reactive metabolites to express the level of
peroxidation of polyunsaturated fatty acids (Zhou and Leul, 1999).
For the analysis of hydrogen peroxide (H2O2), leaves and roots
(0.5 g) were homogenized in 5 mL trichloroacetic acid (TCA) (0.1%,
w/v) in an ice bath and centrifuged at 12,000g for 15 min (Velikova
et al., 2000). Then 0.5 mL supernatant was added into the reaction
mixture with 0.5 mL 10 mM potassium phosphate buffer (pH 7.0)
and 1 mL 1 M KI. The absorbance was measured at 390 nm and the
H2O2 level was calculated by the standard curve. Superoxide ra-
dical (O2
.) was assayed according to Jiang and Zhang (2001). The
fresh tissues (0.5 g) were homogenized in 3 mL 65 mM potassium
phosphate buffer (pH 7.8) and then centrifuged at 5000g for
10 min at 4 °C. 1 mL supernatant was extracted to mix with 0.9 mL
of 65 mM potassium phosphate buffer (pH 7.8) and 0.1 mL of
10 mM hydroxylamine hydrochloride, and then incubated at 25 °C
for 24 h. After the incubation, 1 mL sulphanilamide (17 mM) and
1 mL a-naphthylamine (7 mM) were mixed in 1 mL solution for
further 20 min at 25 °C. After that, n-butanol in the same volume
was added and centrifuged at 1500 g for 5 min. The absorbance in
the supernatant was read at 530 nm. Standard curve was used to
calculate the generation rate of O2
(Jiang and Zhang, 2001).
For estimation of extra-cellular hydroxyl radicals (-OH), fresh
samples (0.1 g) were homogenized in 1 mL 10 mM Na-phosphate
buffer (pH 7.4) consisting of 15 mM 2-deoxy-D-ribose (SRL,
Mumbai) at 37 °C for 2 h (Halliwell and Gutteridge, 1990). Fol-
lowing incubation, an aliquot of 0.7 mL from the above mixture
was added to reaction mixture containing 3 mL 0.5% (w/v) thio-
birbuteric acid (TBA) (Hi Media, Mumbai, 1% stock solution made
in 5 mM NaOH) and 1 mL glacial acetic acid, heated at 100 °C in a
water bath for 30 min and cooled down to 41 °C for 10 min before
measurement. The absorbance was measured at 550 nm.
2.4. GSH and oxidized glutathione (GSSG) contents
GSSG and GSH were measured according to Law et al. (1983)
with some modifications. Fresh leaves and roots (0.3 g) were
ground in 5 mL 10% (w/v) TCA and centrifuged at 15,000g for
15 min 1 mL reaction mixture comprised of 150 mL supernatant,
100 mL of 6 mM 5,5′-dithiobis-2-nitrobenzoic acid (DTNB), 50 mL of
glutathione reductase (10 units mL
1), and 700 mL of 0.3 mM
NADPH was used to evaluate the total glutathione. All of the re-
agents were kept in 125 mM NaH2PO4 buffer, containing 6.3 mM
148 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156
EDTA (pH 7.5). To measure GSSG, 120 mL crude extract was added
to 10 mL 2-vinylpyridine followed by 20 mL 50% (v/v) triethanola-
mine. The solution was vortexed for 30 s and incubated at 25 °C for
25 min. Calibration curve was developed by using GSSG samples
treated exactly above and GSH was determined by subtracting
GSSG from the total glutathione content.
2.5. Measurement of antioxidant enzyme activities
Antioxidant enzyme activities including peroxidase (POD, EC
1.11.1.7), catalase (CAT, EC 1.11.1.6), peroxidase (APX, EC 1.11.1.11)
and superoxide dismutase (SOD, EC 1.15.1.1) were measured ac-
cording to the protocol given below through the spectro-
photometer (UV-2450, Shimadzu Co. Ltd., Japan). Total 0.5 g
samples were ground and homogenized in 10 mL of 50 mM po-
tassium phosphate buffer (pH 7.8) under ice cold conditions. The
homogenized was centrifuged at 10,000g (Centrifuge 5810R, Ep-
pendorf) for 15 min at 4 °C and the supernatant was used for the
determination of the following enzymes. POD activity was ana-
lyzed by the guaiacol reduction method with some modifications
(Zhou and Leul, 1999). CAT activity was determined by the reaction
with H2O2 (extinction coefficient 39.4 mM cm
1) for 1 min at A240
in 3 mL reaction mixture containing 50 mM potassium phosphate
buffer (pH 7.0), 2 mM EDTA-Na2, 10 mM H2O2 and 100 mL enzyme
extract (Aebi, 1984).
APX activity was assayed according to Nakano and Asada
(1981) with the use of H2O2 (extinction coefficient 2.8 mM cm
1)
in a 3-mL mixture containing 100 mM phosphate (pH 7), 0.1 mM
EDTA-Na2, 0.3 mM ascorbic acid, 0.06 mM H2O2 and 100 mL en-
zyme extract. SOD activity was assayed by using the photo-
chemical nitro blue tetrazolium (NBT) method of Zhang et al.
(2008). The enzyme extract was reacted with 3 mL of 50 mM
phosphate buffer (75 NBT, 13 mM methionine, 2 μΜ riboflavin,
0.1 mM EDTA, pH 7.8). SOD activity was defined as the absorbance
of causing 50% inhibition of the NBT reduction per gram fresh
weight per unit. To measure GR, extract of fresh samples (0.2 g)
were prepared according to Jiang and Zhang (2002). Enzyme ac-
tivity was assayed by following the oxidation of NADPH at 340 nm
(extinction coefficient 6.2 mM cm
1) for 1 min in 2.5 mL reaction
mixture containing 50 mM potassium phosphate buffer (pH 7.0),
2 mM EDTA-Na2, 0.15 mM NADPH, 0.5 mM GSSG and 100 mL en-
zyme extract in a 1 mL volume.
2.6. Analysis of glutathione transferases activity
Glutathione transferases (GSTs; EC 2.1.5.18) activity was mea-
sured with 1-chloro-2,4-dinitrobenzene (CDNB) as described by
Habig and Pabst (1974). CDNB was used as substrate. Each sample
was homogenized on ice with a mixture of 1.4 mM dithioerythritol
(DTE), 1 mM EDTA, and 20% glycerol in 0.1 M sodium phosphate
buffer (pH 6.5). The homogenates were centrifuged at 10,000  g
for 10 min. The supernatants were used for the protein assay and
determining GSTs activity. Protein concentration was determined
by the method of Bradford (1976).
2.7. Histochemical analysis
Hydrogen peroxide (H2O2) accumulation in roots was visually
detected by staining with 3,3-diaminobenzidine (DAB). The O2
.
accumulation was visualized using the NBT staining procedure.
NBT and DAB-stained roots were observed under a light micro-
scope (model Leica, MZ 95).
2.8. Transmission electron microscopy
Ten days after treatment, leaf fragments without veins and root
Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
tips (1–3 mm in length) were collected from randomly selected
plants and then fixed overnight in 2.5% glutaraldehyde (v/v) in
0.1 M PBS (sodium phosphate buffer, pH 7.4) and rinsed three
times with the same PBS. Then the samples were post-fixed in 1%
OsO4 [osmium (VIII) oxide] for 1 h and washed three times in
0.1 M PBS (pH 7.4), with 10 min intervals between each washing.
Samples were dehydrated in a graded series of ethanol (50%, 60%,
70%, 80%, 90%, 95% and 100%) with 15–20 min intervals and at the
end washed by absolute acetone for 20 min. The samples were
then infiltrated and embedded in Spurr's resin overnight. After
heating at 70 °C for 9 h, ultrathin sections (80 nm) of specimens
were prepared and mounted on copper grids for viewing by a
transmission electron microscope (JEOLTEM-1230EX, Tokyo, Ja-
pan) at an accelerating voltage of 60.0 kV.
2.9. Extraction of total RNA and qRT-PCR
Total RNA was extracted from frozen leaf samples with RNAiso
Plus (TaKaRa, Japan). One mg total RNA was reverse transcripted
using TaKaRa PrimeScriptTM RT reagent Kit with gDNA Eraser
(Perfect for Real Time). PCRs were performed using SYBRs Premix
Ex TaqⅡ(Tli RNaseH Plus) (TaKaRa) in CFX96TM Real-Time System
(BIO-RAD). Primers used for RT-PCR are listed in Table 1. Triplicate
replications were performed for analysis.
2.10. Statistical analysis
All of the data were subjected to statistical analysis using SPSS
v16.0 (SPSS, Inc., Chicago, IL, USA). Duncan's multiple range tests
were applied to compare the treatment means and P-value r0.05
was considered as significant.
3. Results
3.1. Effects of SA and quinclorac stress on plant growth
Results delineated that addition of quinclorac herbicide in nu-
trient media showed adverse effects on rice growth. All morpho-
logical parameters including leaf area, root length, fresh and dry
weight and total chlorophyll were decreased under quinclorac
toxicity in both rice cultivars XS 134 and ZJ 88 as compared to
control (Table 2). Lower concentration (0.1 g/L) of quinclorac
showed a slight difference than control in all observed parameters.
However, higher concentration (0.5 g/L) of quinclorac significantly
decreased the chlorophyll contents in leaves (Table 2). Further, it
was found that exogenously applied SA (10 mg/L) alleviated the
adverse effects of quinclorac toxicity and improved plant growth
under stress conditions. Similarly, SA-alone treatment accounted
for the enhancement of plant growth in both cultivars as
Table 1
Primers used for RT-PCR.
Target gene Sequence (5′-3′) Accession no.
OsABA8ox1-F AAGCTGGCAAAACCAACATC NM_001186202
OsABA8ox1-R CCGTGCTAATACGGAATCCA
OsABA8ox2-F CTACTGCTGATGGTGGCTGA NM_001068556
OsABA8ox2-R CCCATGGCCTTTGCTTTAT
OsABA8ox3-F AGTACAGCCCATTCCCTGTG NM_001069901
OsABA8ox3-R ACGCCTAATCAAACCATTGC
OsNCED1-F AGCCTCGGTCTTCCAATTTT AY838897
OsNCED1-R CACCCAACACAAAAGCTACG
OsNCED2-F TCATTCCAAAACACCTTCCA AY838898
OsNCED2-R TCCGGGGACCTCCTATGTAT
OsNCED3-F CGCAACAGTAAAAAGAATTAACAGC AY838899
OsNCED3-R TATACACACACGCGGTCGTT
 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156 149

Table 2
Effects of different treatments of quinclorac herbicide and salicylic acid (SA) on leaf area (cm2), root length (cm), biomass (g) and total chlorophyll [mg g
1(FM)] of two rice
cultivars.

Cultivar SA conc. Quinclorac conc. Leaf area Root length Leaf FW (5 Root FW (5 Leaf DW (5 Root DW (5 Total Chl
(mg/L) (g/L) plants) plants) plants) plants)

XS 134 0 0 40.417 2.71ab 18.6770.29ab 3.56 7 0.25a 1.50 70.10a 0.487 0.03ab 0.137 0.02a 1.94 7 0.12a
0.1 38.137 1.28bc 17.167 0.72b 3.45 7 0.14a 1.42 70.16ab 0.43 7 0.02c 0.117 0.02bc 1.83 7 0.14ab
0.5 26.417 1.68d 12.90 7 0.36d 2.78 7 0.28b 0.89 7 0.15c 0.23 7 0.02e 0.0770.01d 1.077 0.24c

10 0 42.117 1.11a 19.30 7 1.45a 3.577 0.17a 1.497 0.08a 0.497 0.03a 0.147 0.01a 1.93 7 0.12a
0.1 40.717 2.60ab 18.107 0.16ab 3.517 0.09a 1.45 70.07ab 0.45 7 0.02bc 0.137 0.02ab 1.87 7 0.13a
0.5 35.12 71.26c 15.26 7 1.37c 3.23 7 0.12a 1.23 70.16b 0.3570.01d 0.107 0.01c 1.58 7 0.13b

ZJ 88 0 0 41.75 7 1.49a 17.617 0.67ab 3.55 7 0.13a 1.497 0.13a 0.46 7 0.02ab 0.12 70.02a 1.89 7 0.13a
0.1 37.58 7 2.29b 15.60 7 0.78bc 3.357 0.14a 1.42 70.17a 0.41 70.03c 0.107 0.01b 1.72 70.13a
0.5 18.79 71.16d 9.59 7 0.57d 2.20 7 0.26c 0.677 0.12c 0.137 0.02e 0.047 0.01d 0.52 7 0.11c

10 0 41.777 1.39a 19.46 7 1.45a 3.56 7 0.22a 1.53 70.12a 0.487 0.01a 0.147 0.02a 1.917 0.12a
0.1 38.077 2.37b 17.377 0.60b 3.38 7 0.14a 1.46 70.23a 0.43 7 0.02bc 0.12 70.02a 1.93 7 0.13a
0.5 25.59 7 1.67c 13.80 7 2.50c 2.55 7 0.14bc 0.95 7 0.10b 0.22 7 0.03d 0.0770.01c 0.85 7 0.22b

Values show the means of three replicates 7 SD. Means followed by same lower case letters are not significantly different at P r0.05.

compared to control. Cultivar ZJ 88 was more sensitive to quin-
clorac stress as compared to XS 134 (Table 2).
3.2. SA reduces quinclorac-induced MDA and reactive oxygen species
Quinclorac stress caused a significant increase in the contents
of MDA, H2O2,
OH and O2
, especially in cultivar ZJ 88 (Table 3).
However, a different pattern of response was detected when plants
were treated with SA, either in the presence or absence of quin-
clorac stress conditions. The accumulation of MDA increased sig-
nificantly in the leaves of ZJ 88. However, MDA accumulation in
roots was approximately twice higher than leaves even in normal
conditions. Exogenous application of SA significantly reduced the
MDA contents in both rice cultivars under quinclorac stress.
Moreover, significant increase in the contents of ROS (H2O2, O2
,

Quinclorac stress alone to rice plants exhibited significant al-
OH) was also observed in both rice cultivars under their re-
spective controls (Table 3). However, ROS contents were found to
be higher in cultivar ZJ 88 than XS 134 under both quinclorac
concentrations. Exogenous SA inhibited the production of ROS in
the leaves and roots of both rice cultivars under quinclorac stress
(Table 3). These findings proved that application of SA (10 mg/L)
was effective to reduce the levels of MDA and ROS in rice plants
under quinclorac toxicity.
3.3. SA ameliorates quinclorac-induced histochemical changes
DAB and NBT staining results showing the production of H2O2
and O2
in the leaves and roots of two rice cultivars are presented
in Fig. 1. Higher accumulation of H2O2 and O2
contents was ob-
served under 0.5 g/L of quinclorac treatment (Fig. 1b and e).
However, in SA treated plants (Fig. 1c and f), less production of
H2O2 and O2
was observed in both rice cultivars. The root tissues
exhibited intense dark coloration at higher concentration of
quinclorac (0.5 g/L), represented in burst of ROS accumulation as
compared to the control (Fig. 1a and d). However, exogenous SA
showed prominent effects in reducing the production of ROS un-
der quinclorac stress conditions (Fig. 1c and f).
3.4. Changes in antioxidant enzymes activities
ternations in antioxidant enzyme activities (CAT, POD, APX, SOD,
GR) as compared to control (Fig. 2). Application of SA to stressed
plants caused significant increase in these activities of both roots
and leaves. After 10 days of herbicide exposure, a considerable
increase in the activity of POD was observed in rice plants except
in roots, where a marginal decrease in the activity of POD was
observed at 0.5 g/L quinclorac which was significantly enhanced
with addition of SA (Fig. 2A-B). The quinclorac toxicity significantly

Table 3
Effects of different treatments of quinclorac herbicide and salicylic acid (SA) on malondialdehyde (MDA) (nmol mg
1 protein), hydrogen peroxide (H2O2) (mmol g
1 FW),
superoxide radical (O2
.) (nmol min
1 g
1 FW) and hydroxyl radicals (
OH) (μmol g
1 FW) in the leaves and roots of two rice cultivars.

Cultivar SA conc. Quinclorac MDA H2O2 O2
.

OH
(mg/L) conc. (g/L)
Leaf Root Leaf Root Leaf Root Leaf Root

XS 134 0 0 13.177 1.35c 22.80 71.01c 24.227 0.77cd 8.65 7 0.43de 10.047 0.90d 9.047 0.27cd 8.95 7 1.14d 12.20 7 1.02e
0.1 14.39 7 0.73c 24.58 71.10bc 28.30 7 2.63c 10.45 7 0.91c 12.677 1.88c 10.90 71.31c 12.02 70.80c 16.78 7 0.25c
0.5 26.41 71.80a 31.117 2.21a 65.247 4.56a 16.167 1.392a 23.17 72.26a 23.50 7 1.48a 20.28 7 0.99a 32.577 1.64a

10 0 12.117 0.65c 22.23 71.31c 22.317 0.94d 7.29 7 0.38e 9.357 0.41d 8.28 7 0.35d 9.177 0.60d 11.25 7 0.90e
0.1 12.87 7 0.39c 23.79 71.34c 25.217 0.44cd 9.02 7 0.22cd 11.42 7 0.14cd 9.82 7 0.22cd 10.50 7 1.37cd 14.87 7 0.84d
0.5 21.317 2.70b 27.017 1.13b 55.86 7 4.48b 13.38 7 1.16b 16.377 1.00b 16.28 71.65b 15.81 7 1.73b 25.94 7 0.67b

ZJ 88 0 0 14.28 7 0.26c 23.147 1.13cd 28.197 2.28cd 10.08 7 0.30c 11.497 0.82d 11.3370.83de 10.87 7 1.75d 13.42 7 0.64d
0.1 15.007 1.22c 27.38 72.06c 32.007 1.08c 10.94 7 1.57c 14.56 7 1.67c 13.96 70.46c 14.23 7 0.88c 15.517 0.68c
0.5 33.83 72.01a 41.87 7 2.87a 98.477 2.93a 20.28 7 1.56a 36.89 7 2.44a 24.2071.67a 28.42 7 0.52a 40.357 0.65a

10 0 13.30 7 0.70c 22.727 1.49d 23.58 7 1.78d 8.81 7 0.65c 9.90 7 0.42fd 10.90 70.49e 10.40 7 0.40d 11.767 0.97d
0.1 14.357 0.33c 25.25 72.34cd 25.007 1.96d 9.44 70.24c 12.75 7 1.38cd 13.007 0.24cd 13.25 7 1.49c 13.05 7 1.24d
0.5 28.157 2.49b 32.137 3.31b 64.007 3.93b 15.277 1.62b 21.617 1.84b 18.737 1.57b 20.58 7 1.88b 35.117 1.65b

Values show the means of three replicates 7 SD. Means followed by same small letters with in the column are not significant at Pr 0.05.

Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
150 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156

Fig. 1. Staining of reactive oxygen species with DAB (A) indicating accumulation of H2O2 in plants of XS 134 (a, b, c), ZJ 88 (d, e, f) as well as staining of NBT (B) indicating
accumulation of O2
. The upper half is leaf results (Scale bar¼ 2 cm) and lower half is root results (Scale bar ¼2 mm) taken with LEICA MZ 95 microscope equipped with
LECIA DFC 300 FX camera. (a and d): control; (b and e): 0.5 g/L quinclorac; (c and f): 10 mg/L SA þ 0.5 g/L quinclorac.

increased the APX activity in rice plants, while application of SA
further enhanced the activity of APX in both rice cultivars. At
higher concentration of quinclorac, the APX activity in plants was
1.5 fold higher in cultivar XS 134 as compared to ZJ 88.
The activity of CAT seemed to be dose-dependent and it de-
creased as quinclorac level was increased in the solution. Higher
concentration of quinclorac significantly decreased the CAT activ-
ity by 61% and 44% in cultivar ZJ 88% and 48% and 34% in cultivar
XS 134 in both roots and leaves, respectively. Interestingly, the SA
application significantly induced the CAT activity under quinclorac
toxicity in both rice cultivars (Fig. 2E-F). Lower concentration of
quinclorac (0.1 g/L) did not show any change in SOD activity
however higher concentration (0.5 g/L) significantly decreased
SOD activity as compared to control. Contrastingly, exogenous SA
significantly improved SOD activity under quinclorac stress as
compared to its respective control. Results further showed that
quinclorac stress had no significant effect on GR activity in roots,
while GR activity was significantly enhanced in the leaves of both
rice cultivars under quinclorac treatment. The ratio of glutathione
reduced/glutathione oxidized (GSH/GSSG) had similar response
pattern as with GSH activity. Data implied that GSH/GSSG ratio in
two rice cultivars showed a significant difference under quinclorac
stress as compared to control. Application of SA significantly re-
duced GSH/GSSG ratio in both leaves and roots of two rice culti-
vars under both quinclorac treatments (Table 3). Moreover, mod-
ulation of antioxidant enzyme activities under SA application was
better in cultivar XS 134 than ZJ 88.
3.5. Glutathione S-transferases contents
It is well known that glutathione S-transferases (GSTs) involves
in herbicide detoxification process. In the present study, cultivar
XS 134 had relative higher GSTs activity in the leaves and roots as
compared to ZJ 88. Higher concentration of quinclorac alone sig-
nificantly increased GSTs contents in both rice cultivars as com-
pared to their respective controls. However, application of exo-
genous SA significantly further enhanced the GSTs activity in both
rice cultivars under higher level of quinclorac.
3.6. SA elevates non-antioxidants activities under quinclorac stress
Effects of different concentrations of quinclorac herbicide and

Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156 151

Fig. 2. Effects of different treatments of quinclorac herbicide and salicylic acid (SA) on the activities of (A-B) guaiacol peroxidase (POD), (C-D) ascorbate peroxidase (APX), (E-
F) catalase (CAT), (G-H) superoxide dismutase (SOD), and (I-J) glutathione transferases (GSTs) in leaves and roots of two rice cultivars respectively.
SA: non SA treated;
þ SA: 10 mg/L SA treated; QC: quinclorac; 0.1, 0.5 ¼0.1, 0.5 g/L quinclorac treatment respectively.

Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
152 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156

Table 4
Effects of different treatments of quinclorac herbicide and salicylic acid (SA) on the contents (mmol min
1 mg
1 protein) of reduced glutathione (GSH), oxidized glutathione
(GSSG), GR activity and glutathione reduced/glutathione oxidized (GSH/GSSG) ratio in the leaves and roots of two rice cultivars.

Cultivar SA conc. (mg/ Quinclorac conc. (g/ GSH GSSG GR GSH/GSSG

L) L)
Leaf Root Leaf Root Leaf Root Leaf Root

XS 134 0 0 9.89 70.71a 4.53 7 0.37b 5.707 0.15c 2.29 70.18cd 10.36 70.44c 7.59 7 0.26b 1.747 0.17b 1.98 7 0.10b
0.1 8.54 70.46b 3.617 0.17d 7.107 0.49b 3.14 70.07b 12.98 7 0.27b 7.54 7 0.31b 1.217 0.14c 1.157 0.08d
0.5 3.417 0.13d 1.03 7 0.01e 9.667 0.59a 3.83 70.43a 14.92 70.53a 7.39 7 0.14b 0.357 0.02e 0.277 0.03e

10 0 10.247 0.55a 5.337 0.23a 4.85 70.38d 2.007 0.14d 10.067 0.89c 8.05 70.15a 2.127 0.26a 2.677 0.09a
0.1 9.48 70.28a 4.107 0.22c 5.81 70.30c 2.50 70.30c 12.137 0.68b 7.40 7 0.30b 1.63 70.11b 1.667 0.26c
0.5 5.65 70.16c 3.45 7 0.23d 7.7770.46b 2.54 70.12c 13.007 0.34b 6.28 70.15c 0.737 0.05d 1.36 7 0.15d

ZJ 88 0 0 10.417 0.15a 5.477 0.25a 8.58 70.30c 2.577 0.27c 13.29 70.49d 8.52 70.26ab 1.217 0.05c 2.13 70.14b
0.1 9.86 70.50b 4.00 70.11c 9.687 0.19b 3.34 70.21b 15.50 70.23b 8.417 0.14ab 1.02 70.03d 1.20 7 0.04c
0.5 6.46 70.28d 2.98 7 0.11d 11.25 70.32a 4.48 7 0.38a 16.647 0.19a 8.69 70.15a 0.57 7 0.03f 0.677 0.05d

10 0 10.46 7 0.28a 5.59 7 0.17a 6.747 0.24e 1.89 7 0.30d 12.93 7 0.26d 7.747 0.21c 1.55 70.05a 3.017 0.50a
0.1 9.84 70.12b 4.58 7 0.36b 7.40 7 0.31d 2.50 70.15c 14.067 0.49c 8.007 0.68bc 1.337 0.06b 1.84 7 0.10b
0.5 7.6770.05c 3.83 7 0.16c 8.50 70.27c 2.917 0.16bc 14.62 70.43c 7.56 7 0.16c 0.90 7 0.02e 1.32 7 0.12c

Values show the means of three replicates 7 SD. Means followed by same small letters with in the column are not significant at Pr 0.05.

SA on the contents of GSH and GSSG in the leaves and roots of two
rice cultivars have been delineated in Table 3. GSH contents were
found to be higher in cultivar ZJ 88 than XS 134 under quinclorac
toxicity (Table 4). The contents of GSH were linearly decreased as
quinclorac concentration was increased in the solution. Applica-
tion of SA significantly recovered GSH contents in both rice culti-
vars under different quinclorac concentrations. However, SA alone
did not show any significant change in GSH contents as compared
to control. GSSG contents were significantly increased in both
leaves and roots of two rice cultivars under different quinclorac
concentrations. Exogenously applied SA significantly reduced
these contents under quinclorac stress conditions. GSH/GSSG ratio
under quinclorac stress remarkably decreased in both leaves and
roots of two cultivars (Table 4). Application of SA significantly
improved GSH/GSSG ratio by 35% and 44% in XS 134, while 30%
and 53% in ZJ 88 under 0.1 g/L quinclorac treatment as compared
to their respective controls.
3.7. SA improves the quinclorac-induced ultrastructural changes
Ultrastructural changes in leaf mesophyll cells of two rice cul-
tivars (ZJ 88 and XS 134) are shown in Fig. 3. The leaf mesophyll
cell structures of ZJ 88 and XS 134 at control showed integrated
chloroplasts and mitochondria. The cell wall and cell membrane
were clean and smooth (Fig. 3A and D). The grana lamella in
thylakoid membrane as well as cristae inside the mitochondrion
was legible. Under 0.5 g/L quinclorac treatment (Fig. 3B and E), the
chloroplast was totally damaged in cultivar ZJ 88. Moreover, cell
wall and cell membrane were dissolved. At this level, an increase
in the number of plastoglobuli structures was also found. Further,
damaged mitochondria and disruption of cell wall and thylakoid
membranes can be observed in micrographs (Fig. 3B and E). The
TEM micrographs of leaf mesophyll cells of both rice cultivars at
10 mg/L SA under 0.5 g/L quinclorac treatment showed that SA
alleviated the effect of quinclorac toxicity in rice leaves (Fig. 3C

Fig. 3. Electron micrographs of leaf mesophyll of two rice cultivars (cvs. ZJ 88, XS 134) under control, quinclorac 0.5 g/L and quinclorac 0.5 g/L and 10 mg/L salicylic acid (SA)
combined treatment. (A) TEM micrograph of leaf mesophyll cells of ZJ 88 under control shows well developed chloroplasts (Chl), mitochondria (MC), nucleus (N) and starch
grains (S). (B) TEM micrographs of leaf mesophyll cells of ZJ 88 under 0.5 g/L QC shows melted cell walls (CW), ruptured chloroplasts (Chl) and mitochondria (MC). (C) TEM
micrographs of leaf mesophyll cells of ZJ 88 under 0.5 g/L QC with 10 mg/L SA treatment exhibits clear cell walls (CW), thylakoid membranes (Thy), chloroplast (Chl) and
plastoglobuli (P). (D) TEM micrograph of leaf mesophyll cells of XS 134 under control shows a clear cell wall (CW), thylakoid membranes (Thy), chloroplasts (Chl), plas-
toglobule (P) structures and starch grains (S). (E) TEM micrographs of leaf mesophyll cells of XS 134 under 0.5 g/L QC shows melted cell well (CW), vague thylakoid
membranes (Thy) and a lot of expanded plastoglobuli (P). (F) TEM micrographs of leaf mesophyll cells of XS 134 under 0.5 g/L QC with 10 mg/L SA treatment exhibits intact
chloroplasts (Chl), distinct cell walls (CW) increased the size and number of mitochondria (MC) as compared to only quinclorac treatment.

Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156 153

Fig. 4. Electron micrographs of root tip cells of two rice cultivars (cvs. ZJ 88, XS 134) under control, quinclorac 0.5 g/L and quinclorac 0.5 g/L and 10 mg/L salicylic acid (SA)
combined treatment. (A) TEM micrographs of root tip cells of ZJ 88 under control (CK) shows a clear cell wall (CW) and cell membrane (CM), oval shape mitochondria
(M) with distinct cristea inside, large size nucleus (N) with nucleoli (Nue) and nuclear membrane (NM). (B) TEM micrographs of root tip cells of ZJ 88 at 0.5 g/L QC shows
damaged nucleoli (Nue), nucleus (N) with decomposed nuclear membrane (NM), destroyed mitochondria (MC) and melted cell wall (CW). (C) TEM micrographs of root tip
cells of ZJ 88 under 0.5 g/L QC with 10 mg/L SA treatment shows clear nucleus (N) with nucleoli (Nue), cell wall (CW), recovered mitochondria (M) and cell membrane (CM).
(D) TEM micrographs of root tip cells of XS 134 under control shows large well developed nucleus (N) with nucleoli (Nue), a clear visible nuclear membrane (NM), cell wall
(CW), numerous mitochondria (MC) and small vacuoles (V). (E) TEM micrographs of root tip cells of XS 134 under 0.5 g/L QC shows clear cell walls (CW), decomposed
nucleus (N) with nucleoli (Nue) and shrinked mitochondria (M). (F) TEM micrographs of root tip cells of XS 134 under 0.5 g/L QC with 10 mg/L SA shows oval shape nucleus
(N) with intact nucleoli (Nue), well developed mitochondria (MC) and smooth cell walls (CW) with some vacuoles (V).

and F). The structure of chloroplast and mitochondrion was less
damaged and became visible at this level.
The TEM micrographs of root tip cells of two rice cultivars (ZJ
88 and XS 134) have been shown in Fig. 4. At control, there was
well developed nucleus with nucleolus and nuclear membrane
(Fig. 4A and D). At this level, no deformation was observed in the
cell wall and cell membrane. Moreover, there were many mi-
tochondria with smooth cell wall and cristae can be observed in
the micrographs. Quinclorac concentration at 0.5 g/L exhibited
obvious ultrastructural changes over control in both rice cultivars
(Fig. 4B and E). Quinclorac toxicity severely damaged the root tip
cells with decomposition of nucleus and nuclear membrane. At
this level, cell wall was broken as well as mitochondrion was
immature. Moreover, nucleolus was disappeared in cultivar XS 134
and was remarkable in ZJ 88 under quinclorac toxicity. Further,
exogenously applied SA alleviated the damages caused by quin-
clorac toxicity in both rice cultivars (Fig. 4C and F). Application of
SA under quinclorac stress presented well developed nucleus and
nucleus membrane. Exogenous SA also improved the cell structure
of root tips and showed a number of developed mitochondria
(Fig. 4C and F).

Fig. 5. Effects of different treatments of quinclorac herbicide and salicylic acid (SA) on expression of ABA related genes OsABA8ox1 (A), OsABA8ox2 (B), OsABA8ox3 (C),
OsNCED1 (D), OsNCED2 (E), OsNCED3 (F) in the leaves of two cultivars. The data show the averages and the SD of three independent samples.
SA: non SA treated; þSA:
10 mg/LSA treated; QC: quinclorac; 0.1, 0.5 ¼0.1, 0.5 g/L quinclorac treatment respectively.

Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
154 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156
3.8. SA decreases the expression of ABA related genes
Effects of different treatments of quinclorac herbicide and SA
on expression of ABA related genes OsABA8ox1, OsABA8ox2, OsA-
BA8ox3, OsNCED1, OsNCED2 and OsNCED3 in the leaves of two
cultivars after 6 h treatment have been shown in Fig. 5. Under
quinclorac stress, the ABA biosynthetic genes (OsNCED1, OsNCED3)
(Fig. 5D and F) and ABA 8′-hydroxylase genes (OsABA8ox1, OsA-
BA8ox2) (Fig. 5A-B) were up-regulated within 6 h. Both the culti-
vars presented different transcriptional levels of above mentioned
genes as compared to their respective control. Expression of
OsABA8ox1 was more than 10 folds greater in ZJ 88 while 3 folds in
XS 134 under 0.5 g/L quinclorac stress. OsABA8ox3 gene was en-
hanced in XS 134, however down-regulated in ZJ 88 under quin-
clorac stress. Quinclorac stress alone only inhibited the expression
of OsNCED2 gene. Application of SA had obvious effects on all these
genes and inhibited the expression of OsABA8ox1, OsABA8ox2,
OsABA8ox3, OsNCED1, OsNCED2 and OsNCED3 as compared to
quinclorac stress alone. The application of SA alone even reduced
the mRNA levels of OsABA8ox2 and OsNCED2 (Fig. 5).
4. Discussion
In the present research, we tried to investigate SA mediated
morphological changes, oxidative damages and ultrastructural
changes of Oryza sativa (cvs. XS 134 and ZJ 88) under quinclorac
toxicity. SA is a phenolic compound that controls plant growth and
development, photosynthesis, respiration, flowering, senescence
and induces changes in leaf anatomy and chloroplast ultra-
structure (Rivas-San Vicente and Plasencia, 2011). Induction of
1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity
involves in the selectivity of quinclorac between barnyard grass
and rice. However, SA has been characterized as an inhibitor of the
conversion of ACC to ethylene (Leslie and Romani, 1988). That's
why in the present study, we have selected SA to observe its
ameliorative effects on rice seedlings under quinclorac stress.
The decrease in biomass production might be related to dif-
ferential absorption, translocation, metabolism and foliar spray
retention. Probably, the reduction in plant growth owes to sto-
matal closure, paralleled by reduced transpiration, carbon assim-
ilation and starch formation, and overproduction of reactive oxy-
gen species (ROS) (Grossmann and Kwiatkowski, 2001). A con-
tinuous stimulation of plant metabolism in rice was thought to
elicit a deregulation of growth (Table 2) through distorted cell
division and expansion, leading to the collapse of cell structure.
Previously, it was stated that SA application alleviated the parquet
induced growth retardation in barley plants (Ananieva et al.,
2004). The present study also showed similar findings that SA
treatment significantly enhanced the growth parameters of rice
plants under quinclorac stress (Table 2). These findings are con-
sistent with the similar increase in the growth of soybean seed-
lings (Gutiérrez-Coronado, 1998) and in the leaf area of sugarcane
plants (Zhou et al., 1999).
In the present study, ROS contents were significantly elevated
at higher quinclorac level (0.5 g/L) in both leaves and roots of two
rice cultivars (Table 3). The cultivar ZJ 88 contained higher ROS
accumulation than XS 134 so that the plants sustained much more
oxidative stress. Further, ROS accumulation was also confirmed the
results of staining and DAB methods. Previously, Grossmann and
Kwiatkowski (2001) demonstrated that auxin herbicides induced
H2O2 overproduction and tissue damage in cleavers (Galium
aparine L.). However, exogenously applied SA significantly lowered
ROS contents in both rice cultivars. It has been proposed that up-
regulated DELLAs is mediated by SA signaling resulting in reduced
ROS levels (Grant and Jones, 2002). Similarly, in the present study
Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
exogenous SA diminished the toxic effect of quinclorac in rice
plants. The observed protection from quinclorac induced oxidative
stress conferred by SA could be the result of rapid detoxification of
ROS. It has been demonstrated in different plants species that
exogenous application of SA enhances tolerance toward most
kinds of abiotic stresses due to an enhanced antioxidant capacity
(Horváth et al., 2007).
We also found an enhancement in antioxidant enzyme activ-
ities in both rice cultivars under quinclorac stress (Fig. 2). SOD is a
vital enzyme which involves in cellular defense system. APX is
responsible for the mediation of reactive oxygen intermediates
(ROIs) for signal transduction, while CAT is responsible for the
scavenging of excess ROIs during stress (Mittler, 2002). H2O2 is
metabolized by peroxidases and catalase family in plant cells
(Ananieva et al., 2002). Results indicated that accumulation of
H2O2 increased in the plants at high concentration of quinclorac
(Table 3) as well as POD activity also enhanced both in leaves and
roots (Fig. 2). H2O2 concentration was higher in the leaves than
roots which might be due to that quinclorac translocated from
roots to leaves, so that POD activity showed a reduction in the
roots. Glutathione S-transferases (GSTs) have a family of multi-
functional enzymes that exist in plants. They reduce the toxicity of
various substrates by catalyzing the conjugation of GSH (Dixon
et al., 1998). Similarly, GSTs increased in both rice cultivars as the
level of herbicide was increased (Fig. 2I and J). GSTs content was
much higher in cultivar XS 134 than ZJ 88, especially in roots,
which suggested their role in degradation of herbicides or their
storage in vacuole (García-Garijo et al., 2014). Results delineated
that application of SA strengthen the defense ability of plants by
increased antioxidant enzyme activities and also lowered the le-
vels of MDA, H2O2 and O2
in rice, thereby provided additional
tolerance to the plants against oxidative stress generated by her-
bicide. These findings suggested that the activities of these en-
zymes are directly or indirectly influenced by SA, thus, SA played a
critical role in cellular redox homeostasis in quinclorac stressed
plant.
Glutathione (GSH) is found in all living cells and participates in
many biochemical reactions by inhibiting oxidation. The oxidized
glutathione (GSSG) may be converted back to the reduced glu-
tathione (GSH) by the activity of the enzyme GR. GSH is trans-
formed to GSSG with scavenging H2O2 by glutathione peroxidase
(GPX) (Mittler, 2002). In the present study, higher production of
ROS under quinclorac stress (Table 3) resulted in rapid conversion
of GSH into GSSG in both the leaves and roots (Table 4). Moreover,
GSH concentration was decreased; however GSSG contents were
increased under quinclorac toxicity in both rice cultivars. Thus, GR
activity did not show any significant difference among density
gradient of herbicide in roots of both cultivars. Exogenous SA ap-
plication restored the normal concentration of reduced GSH in rice
cultivars. This may be due to the exogenous SA application which
helps to protect photosynthesis through increase in ascorbate-
glutathione metabolism, which would enhance the production of
glutathione and increase antioxidant enzymes activity in stressed
plants (Nazar et al., 2015) (Fig. 2).
In the present study, quinclorac stress alone exhibited sig-
nificant damages in different plant organelles, including the dis-
ruption of nuclear membrane, melted cell wall and ruptured
chloroplast. Similarly, Koo et al. (1996, 1997) found that quinclorac
inhibited cellulose biosynthesis. Interestingly, we found that
polylamellated cell wall still existed in the micrograph (Fig. 3E),
although the increasing the large number of plastoglobuli revealed
that the cells were under quinclorac stress. It may be another
evidence to justify that XS 134 is more tolerant to quinclorac than
ZJ 88. However, exogenously applied SA significantly improved cell
organelles structures under quinclorac toxicity. It is mainly due to
that SA application prevents the loss of unsaturated lipid species,
 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156
which lead to the increase in stability of membrane proteins which
helps in chlorophyll membranes stability under stress conditions
(Popova et al., 2003). Thus, exogenous application of SA under
quinclorac prevents the intracellular organelle damages due to its
upregulation of ROS scavenging enzymes (Horváth et al., 2007).
The overproduction of ABA is also an important aspect of herbi-
cides induced growth inhibition and phytotoxic response. ABA is
regarded as an important hormone which promotes leaf senes-
cence and affects plant growth by influencing stomatal movement,
cell division and expansion. Romero-Puertas et al. (2004) de-
monstrated that overproduction of ABA and ROS paralleled by
tissue damage were the ordinary effects to all herbicides. In our
results, OsNECD genes (OsNECD1 and OsNECD3) related to the
biosynthesis of ABA were up-regulated under quinclorac stress
alone within 6 h (Fig. 5D and F). As the expression of OsNECD
genes was increased, the mRNA levels of OsABAox1 (Fig. 5A) and
OsABAox2 (Fig. 5B) were also increased in leaves of both cultivars;
whereas mRNA level of OsABAox3 (Fig. 5C) was enhanced in cul-
tivar XS 134. Mohr and Cahill (2007) found the ABA as a sup-
pressor of SA and lignin production in Arabidopsis. Further, it was
suggested that SA application also inhibited the vital enzymes
involved in the synthesis of ABA as we found in the present study
(Fig. 5). Previously, Leslie and Romani (1988) found that SA in-
hibited ethylene formation which triggered biosynthesis of ABA
under stress conditions (Hansen and Grossmann, 2000).
5. Conclusion
In the present study, SA application was established to mitigate
quinclorac stress, which was illustrated by significantly improved
physio-biochemical and ultrastructural attributes. However, exo-
genous application of SA markedly enhanced the antioxidant en-
zyme activities and down-regulated the expression level of ABA
pathway genes (OsNECD and OsABAox). In addition, this study also
revealed that cultivar XS 134 was proved to be more tolerant to
quinclorac toxicity than cultivar ZJ 88. Furthermore, the in-
vestigation also showed the effective involvement of SA under
herbicide stress which represents its essential role in stress ame-
lioration. These results provide a base for the subsequent studies
to investigate possible use of SA to alleviate herbicide induced
toxicity in crops. Besides, continued advancement in this area will
also enhance the understanding of SA effects on weeds growth
along with herbicide application and overall ecosystem health.
Author contributions
Conceived and designed the experiments: J. Wang, W.J. Zhou
and B. Ali. Performed the experiments: J. Wang, M.T. Lv, R.A. Gill
and F. Islam. Analyzed the data: J. Wang, M.T. Lv, C. Yang, G. Yan
and W.J. Zhou. Contributed reagents/materials/analysis tools: J.
Wang, R.A. Gill, F. Islam and W.J. Zhou. Wrote and revised the
paper: J. Wang, G. Yan, B. Ali and W.J. Zhou.
Acknowledgments
This study was supported by the Special Fund for Agro-Scien-
tific Research in the Public Interest (201303022), National Natural
Science Foundation of China (31170405, 31171863 and 31570434),
and China Postdoctoral Science Foundation (2015M570512).
References
Aebi, H., 1984. Catalase in vitro. Method Enzymol. 105, 121–126.
Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i
155
Ananieva, E.A., Alexieva, V.S., Popova, L.P., 2002. Treatment with salicylic acid de-
creases the effects of paraquat on photosynthesis. J. Plant Physiol. 159, 685–693.
Ananieva, E.A., Christov, K.N., Popova, L.P., 2004. Exogenous treatment with salicylic
acid leads to increased antioxidant capacity in leaves of barley plants exposed
to paraquat. J. Plant Physiol. 161, 319–328.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of protein-dye binding. Anal.
Biochem. 72, 248–254.
Burketová, L., Štillerová, K., Feltlova, M., Šindelářová, M., 2003. Immunohistological
analysis of chemically induced proteins in sugar beet. Biol. Plant. 47, 243–251.
Dayan, F.E., Duke, S.O., Grossmann, K., 2010. Herbicides as probes in plant biology.
Weed Sci. 58, 340–350.
Dixon, D.P., Cummins, I., Cole, D.J., Edwards, R., 1998. Glutathione-mediated de-
toxification systems in plants. Curr. Opin. Plant Biol. 1, 258–266.
García-Garijo, A., Tejera, N.A., Lluch, C., Palma, F., 2014. Metabolic responses in root
nodules of Phaseolus vulgaris and Vicia sativa exposed to the imazamox her-
bicide. Pest. Biochem. Phys. 111, 19–23.
Grant, M., Jones, J., 2002. Hormone (dis) harmony moulds plant health and disease.
Science 324, 750–752.
Grossmann, K., 1998. Quinclorac belongs to a new class of highly selective auxin
herbicides. Weed Sci. 46, 707–716.
Grossmann, K., 2003. Mediation of herbicide effects by hormone interactions. J.
Plant Growth Regul. 22, 109–122.
Grossmann, K., 2010. Auxin herbicides: current status of mechanism and mode of
action. Pest Manag. Sci. 66, 113–120.
Grossmann, K., Kwiatkowski, J., 2001. Auxin herbicides induce H2O2 over-
production and tissue damage in cleavers (Galium aparine L.). J. Exp. Bot. 52,
1811–1816.
Gutiérrez-Coronado, M.A., 1998. Effects of salicylic acid on the growth of roots and
shoots in soybean. Plant Physiol. Biochem. 36, 563–565.
Habig, W.H., Pabst, M.J., 1974. Glutathione S-transferases the first enzymatic step in
mercapturic acid formation. J. Biol. Chem. 249, 7130–7139.
Halliwell, B., Gutteridge, J., 1990. Role of free radicals and catalytic metal ions in
human disease: an overview. Method Enzymol. 186, 1–85.
Hansen, H., Grossmann, K., 2000. Auxin-induced ethylene triggers abscisic acid
biosynthesis and growth inhibition. Plant Physiol. 124, 1437–1448.
Horváth, E., Szalai, G., Janda, T., 2007. Induction of abiotic stress tolerance by sal-
icylic acid signaling. J. Plant Growth Regul. 26, 290–300.
Jiang, M., Zhang, J., 2001. Effect of abscisic acid on active oxygen species, anti-
oxidative defence system and oxidative damage in leaves of maize seedlings.
Plant Cell Physiol. 42, 1265–1273.
Jiang, M., Zhang, J., 2002. Water stress-induced abscisic acid accumulation triggers
the increased generation of reactive oxygen species and up-regulates the ac-
tivities of antioxidant enzymes in maize leaves. J. Exp. Bot. 53, 2401–2410.
Koo, S.J., Neal, J.C., DiTomaso, J.M., 1996. 3, 7-Dichloroquinolinecarboxylic acid in-
hibits cell-wall biosynthesis in maize roots. Plant Physiol. 1996 (112),
1383–1389.
Koo, S.J., Neal, J.C., DiTomaso, J.M., 1997. Mechanism of action and selectivity of
quinclorac in grass roots. Pestic. Biochem. Physiol. 57, 44–53.
Krochko, J.E., Abrams, G.D., Loewen, M.K., Abrams, S.R., Cutler, A.J., 1998. ( þ)-Ab-
scisic acid 8′-hydroxylase is a cytochrome P450 monooxygenase. Plant Physiol.
118, 849–860.
Kudsk, P., Streibig, J.C., 2003. Herbicides-a two-edged sword. Weed Res. 43, 90–102.
Law, M., Charles, S.A., Halliwell, B., 1983. Glutathione and ascorbic acid in spinach
(Spinacia oleracea) chloroplasts. The effect of hydrogen peroxide and of Para-
quat. Biochem. J. 210, 899–903.
Leslie, C.A., Romani, R.J., 1988. Inhibition of ethylene biosynthesis by salicylic acid.
Plant Physiol. 88, 833–837.
Li, G., Xu, M.F., Chen, L.P., Cai, L.M., Bai, L.Y., Wu, C.X., 2016. A novel EcGH3 gene with
a different expression pattern in quinclorac-resistant and susceptible bar-
nyardgrass (Echinochloa crus-galli). Plant Gene 5, 65–70.
Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant
Sci. 7, 405–410.
Mohr, P.G., Cahill, D.M., 2007. Suppression by ABA of salicylic acid and lignin ac-
cumulation and the expression of multiple genes, in Arabidopsis infected with
Pseudomonas syringae pv. tomato. Funct. Integr. Genom. 7, 181–191.
Nakano, Y., Asada, K., 1981. Hydrogen peroxide is scavenged by ascorbate-specific
peroxidase in spinach chloroplasts. Plant Cell Physiol. 22, 867–880.
Nazar, R., Umar, S., Khan, N.A., 2015. Exogenous salicylic acid improves photo-
synthesis and growth through increase in ascorbate-glutathione metabolism
and S assimilation in mustard under salt stress. Plant Signal Behav. 10,
e1003751.
Popova, L., Ananieva, E., Hristova, V., Christov, K., Georgieva, K., Alexieva, V., Stoi-
nova, Z.H., 2003. Salicylic acid-and methyl jasmonate-induced protection on
photosynthesis to paraquat oxidative stress. Bulg. J. Plant Physiol. 133, 152.
Porra, R., Thompson, W., Kriedemann, P., 1989. Determination of accurate extinction
coefficients and simultaneous equations for assaying chlorophylls a and b ex-
tracted with four different solvents: verification of the concentration of chlor-
ophyll standards by atomic absorption spectroscopy. BBA Bioenerg. 975,
384–394.
Resgalla, J.C., Noldin, J.A., Tamanaha, M.S., Deschamps, F.C., Eberhardt, D.S., Rörig, L.
R., 2007. Risk analysis of herbicide quinclorac residues in irrigated rice areas,
Santa Catarina, Brazil. Ecotoxicology 16, 565–571.
Riechers, D.E., Kreuz, K., Zhang, Q., 2010. Detoxification without intoxication: her-
bicide safeners activate plant defense gene expression. Plant Physiol. 153, 3–13.
Romero-Puertas, M.C., Mccarthy, I., Gómez, M., Sandalio, L.M., Corpas, F.J., Del Rio, L.
156 J. Wang et al. / Ecotoxicology and Environmental Safety 133 (2016) 146–156

A., Palma, J.M., 2004. Reactive oxygen species-mediated enzymatic systems
involved in the oxidative action of 2, 4-dichlorophenoxyacetic acid. Plant Cell
Environ. 27, 1135–1148.
Schwartz, S.H., Qin, X., Zeevaart, J.A.D., 2003. Elucidation of the indirect pathway of
abscisic acid biosynthesis by mutants, genes, and enzymes. Plant Physiol. 131,
1591–1601.
Sunohara, Y., Matsumoto, H., 2004. Oxidative injury induced by the herbicide
quinclorac on Echinochloa oryzicola Vasing. and the involvement of anti-
oxidative ability in its highly selective action in grass species. Plant Sci. 167,
597–606.
Sunohara, Y., Matsumoto, H., 2008. Quinclorac-induced cell death is accompanied
by generation of reactive oxygen species in maize root tissue. Phytochemistry
69, 2312–2319.
Velikova, V., Yordanov, I., Edreva, A., 2000. Oxidative stress and some antioxidant
systems in acid rain-treated bean plants. Plant Sci. 151, 59–66.
Rivas-San Vicente, M., Plasencia, J., 2011. Salicylic acid beyond defence: its role in
plant growth and development. J. Exp. Bot. 62, 3321–3338.
Zhang, W., Zhang, F., Raziuddin, R., Gong, H., Yang, Z., Lu, L., Ye, Q.F., Zhou, W.J.,
2008. Effects of 5-aminolevulinic acid on oilseed rape seedling growth under
herbicide toxicity stress. J. Plant Growth Regul. 27, 159–169.
Zhou, W., Leul, M., 1999. Uniconazole-induced tolerance of rape plants to heat
stress in relation to changes in hormonal levels, enzyme activities and lipid
peroxidation. Plant Growth Regul. 27, 99–104.
Zhou, X., Mackenzie, A., Madramootoo, C., Smith, D., 1999. Effects of stem-injected
plant growth regulators, with or without sucrose, on grain production, biomass
and photosynthetic activity of field-grown corn plants. J. Agron. Crop Sci. 183,
103–110.

Please cite this article as: Wang, J., et al., Salicylic acid mediates antioxidant defense system and ABA pathway related gene expression
in Oryza sativa against quinclorac toxicity. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.002i