Cent. Eur. J. Biol.

• 9(9) • 2014 • 901-908

DOI: 10.2478/s11535-014-0323-0

Central European Journal of Biology

The relationship of glycerol and glycolysis

metabolism patway under hyperosmotic stress
in Dunaliella salina

Research Article

Bing-Bing Xia, Shuang-Hui Wang, Jing-Bo Duan, Lin-Han Bai*

Key Laboratory of Bio-Resources and Eco-environment of Ministry

of Education, College of Life Sciences, Sichuan University,
Chengdu 610064, Sichuan, People’s Republic of China
Received 16 September 2013; Accepted 22 April 2014

Abstract: This study detected the upstream and downstream key genes of glycolysis in Dunaliella Salina by using Real-time Fluorescence
Quantitative PCR assays and measurement of enzyme activity. The results were as follows: the levels of transcription, enzyme activity,
and protein of D. salina PFK were up-regulated under hyperosmotic stress while D. salina ENO were down-regulated. At the same time
we monitored the change of intracellular degradation of starch, the synthesis of glycerol and PEP concentration in Dunaliella Salina
under hyperosmotic stress. We found that lower expression of DsENO reduced the concentration of intracellular PEP which promoted
the degradation of starch, and decreased the flow of carbon into the tricarboxylic acid cycle which would favor the synthesis of glycerol.
Keywords: Dunaliella salina • Glycolysis • Phosphofructokinase • Enolase • Cooperative regulation
© Versita Sp. z o.o.

1. Introduction phosphate, the main raw material of the production of

Dunaliella salina is one of the most salt-tolerant
photosynthetic eukaryotic organisms in the world.
The adaption to high salt environments occurs by
means of glycerol synthesis to balance external osmotic
pressure. Intracellular glycerol content has been found to
increase with increasing content of NaCl in media [1-3].
It has been confirmed that yeast and other microorganisms
also balance external osmotic pressure by synthesizing
glycerol under hyperosmotic stress [4-7].
The starch stored in chloroplast by D. salina could
degrade rapidly under hyperosmotic stress. A pivotal
precursor of glycerol, glyceraldehyde-3-phosphate,
could be transformed through the glycolysis pathway,
resulting in glycerol being synthesized in two steps.
Glycerol production is coupled to the glycolysis
pathway by means of glyceraldehyde-3-phosphate,
which is the isomeric compound of dihydroxyacetone
phosphate (DHAP). The mutual transformation of
the two isomers do not require enzymatic catalysis,
and occur in a natural balance. Dihydroxyacetone
glycerol, could be catalyzed by glycerol 3-phosphate
dehydrogenase to eventually generate glycerol.
The content of intracellular dihydroxyacetone phosphate
determines the rate and amount of the production of
glycerol. Phosphofructokinase (PFK) [8] and glycerol-
3-phosphate dehydrogenase (GPD) [9-11] are two key
enzymes of this process. PFK catalyzes the conversion
of fructose-6-phosphate to fructose-1,6-bisphosphate
[12,13], and has the characteristics of allosteric
modulation in bacteria, plants, and animals, keeping
consistent with the activity of glycolysis [14]. Earlier
reports point out that the activity of PFK is strongly
inhibited by phosphoenolpyruvate (PEP) in some
photosynthetic eukaryotic organisms [15-18].
Enolase (ENO) lies further downstream in the
glycolysis pathway, and catalyzes the last reversible
reaction: the unique dehydration of 2-phosphoglycerate
to PEP [19].
We prepared the gene chip for the the expression
profile of Dunaliella Salina and found that expression
of DsENO was significantly down-regulated at the

* E-mail: bailinhan@scu.edu.cn
901
Unauthenticated
Download Date | 10/6/16 1:47 AM

transcription level under hyperosmotic stress. This
suggests that reduced expression of DsENO and its
activity could decrease the amount of available carbon
for the tricarboxylic acid cycle and also increase the rate
of glycerol synthesis.
The present study describes the effects of
cooperative regulation of two key enzymes lying in
upstream and downstream positions in the glycolysis
pathway in Dunaliella salina: PFK, which is characterized
by allosteric modulation, and ENO, which is involved in
the last reversible reaction.
2. Materials and methods
2.1 Algae strain, growth conditions and
analytical methods
D. salina strain FACHB 435 was obtained from the
Freshwater Algae Culture Collection of the Institute
of Hydrobiology (Wuhan, China). The cells were
maintained and cultured in Pick medium [20] under
conditions described previously (8.766% salinity [w/v]
and 16h: 8h light-dark cycle). Cell number was
determined as described previously [21].
The hyperosmotic stress experiment was performed
with exponentially growing Dunaliella culture (2.5×105
cells mL-1) and salinity level (w/v) was adjusted with
NaCl to 17.532%.
2.2 Extraction of RNA
The total RNA was isolated from the cells using TRIZOL
reagent (Takara, Japan) according to the manual.
The extracted RNA was treated with DNase to eliminate
genomic DNA contamination. The RNA preparations
were quantitated by absorbance at 260 nm, and integrity
was assessed via 1.5% agarose gel electrophoresis and
Green View staining electrophoresis. Extracted total
RNAs were stored at –80°C.
2.3 mRNA expression studies by real-time
quantitative PCR (qPCR)
Total RNA was used to synthesize oligo (dT)-primed
cDNA with the reverse transcription kit (Takara, Japan)
following the manufacturer’s instructions. Real-Time
primer Forword primer (5’-3’)
DsENO TGTTGCTTGGTGGAAATGTTG
DsPFK GCCAGTGGAAACCCCATCCT
18S TTGGGTAGTCGGGCTGGTC
Table 1. Primer of Real-time Fluorescence quantitative PCR.
902
The relationship of glycerol and glycolysis metabolism
patway under hyperosmotic stress in Dunaliella salina
Quantitative PCR was performed in an iCycler iQ (BIO-
RAD, USA) using SYBR RT-PCR Kit (Takara,Japan)
according to the manual. The primers of DsPFK,
DsENO and 18SrRNA were show in the Table 1.
The amplification conditions were: 10 s at 95°C,
40 cycles of 5 s at 95°C and 30 s at 55°C, 72°C,
20 s. The amplification conditions were: 10 s at 95°C,
40 cycles of 5 s at 95°C and 30 s at 55°C, 72°C, 20 s.
The PCR products were verified by gel electrophoresis
and confirmed by sequencing. Data analysis was
carried out using the comparative Ct (2–ΔΔCt) method
(Livak et al., 2001).
2.4 Determination of enzymatic activity
Under the same stress conditions as those in the
qPCR studies, the PFK (EC 2.7.1.11) activity was
measured using the Phosphofructokinase Activity
Assay Kit (Genmed, Shanghai, China) according to the
manufacturer’s instructions and read plate absorbance
at 340 nm in a microplate reader (Biotek μQuant).
Each experiment was replicated three times. Protein
concentrations were determined by Bradford assay
using BSA to generate a standard curve.
2.5 Detection of intracellular PEP by high
performance liquid chromatography
(HPLC)
All HPLC eluants and standards were prepared using
water with a specific resistance of at least 18 mΩ.
The PEP were purchased from Sigma (P/N 860077).
The Dionex DX-600 ion chromatography system
contained a Dionex GS50 gradient pump. Samples
were automatically injected using a Dionxe AS50
autosampler. After enhancing the signal-to-noise ratio
by means of an anion self regenerating suppressor
(ASRS 300) that was operating in the auto suppression
mode, the eluant’s conductivity was determined using
a Dionex ED50 electrochemical detector equipped with
a conductivity cell. Chromatograms were analyzed by
Dionex Chromeleon® software. The HPLC column used
was a Dionex IonPac AS11-HC 2-mm Analytical Column
(P/N 052961) equipped with a guard column (AG11).
The gradient profile was shown in Table 2. A 10 μL
injection loop was used for all runs. A re-equilibration
Recerse primer (5’-3’)
TATCCGATTAACCCACGAGACAC
TGTCGCAGTTACCCTTCAAGTAA
CGCTGCGTTCTTCATCGTT
Unauthenticated
Download Date | 10/6/16 1:47 AM
Bing-Bing Xia et al.
Time (min) 0 8 30 30.1
NaOH (mM) 7.5 20 50 7.5
Table 2. Gradient profile.
period of 15 min was sufficient to achieve stable baseline
conditions. All eluents were sparged with purified
nitrogen gas prior to use. The eluants were stored in
coated bottles (to prevent washout of anions by the high
NaOH concentrations used) in a nitrogen atmosphere
(preventing generation of carbonate ions).
Standard solution of the PEP (10 mM L-1) was
prepared in deionized water, 10 μL of which was further
chromatographed in order to determine retention time.
This peak was integrated to determine the peak area for
each sample.
Under the same stress conditions as those in the
qPCR studies, the D. salina cells (300 ml at each time)
were harvested by centrifugation at 10000g for 10 min
at 4°C, and the pellet was resuspended in 5 volume
of ice cold water with a specific resistance of at least
18 mΩ. Cells were disrupted by sonication on ice for
4 min, 3 s each with 2 s cooling between successive
bursts in a Sonics VibrocellTM VCX750. The homogenate
was centrifuged at 13000g for 20 min at 4°C and the
supernatant was injected into the HPLC following
filtering through an acrodisc syringe filter (0.45 µm HT
Tuffryn membrane, Gelman Laboratory, Ann Arbor, MI),
eliminating cell debris. Peaks were identified by their
retention times as well as by using co-chromatography
with standard.
2.6 The effect of PEP on recombinant DsPFK
activity
The purified recombinant DsPFK activity was
measured in both the presence and absence of PEP
at concentration of 0.5, 2.0 mM L-1 using the method
mentioned previously. Each experiment was replicated
three times. Protein concentrations were determined
by Bradford assay using BSA to generate a standard
curve.
2.7 Determination of glycerol concentration
Algal cells in the logarithmic growth phase in 1.5 M L-1
NaCl media were transferred to 3 M L-1 NaCl media.
At 5min, 30 min, 1 h, 2 h, 3 h,4 h and 7 h, the same
amount of algal cells were collected for the determination
of glycerol. Algal cells were centrifuged at 5000 g for
3 minutes to remove supernatant. 1 mL of distilled water
and 0.5 mL 30% trichloroacetic acid were added to the
sediments for 3 min and then centrifuged to remove
protein precipitate. 30 μL supernatant and 0.2 mL
distilled water were added into the tube containing 1 mL
sodium periodate reagent mixture at room temperature.
After sitting for 5 minutes, 2.5 mL acetylacetone reagent
was added, and tubes were placed in a water bath for
30 min at 60°C. The optical density was measured
at 410nm.
2.8 Determination of Starch concentration
Algal cells in the logarithmic growth phase in 1.5 M L-1
NaCl media were transferred to 3 M L-1 NaCl media.
At 5 min, 30 min, 1 h, 2 h, 3 h, 4 h and 7 h, the same
amount of algal cells were collected for the determination
of starch. Algal cells were collected in 1.5 mL tubes,
adding 80% Ca(NO3)24H2O solution for ultrasonic
wave breaking for 10 min. Cells were centrifuged
at 13000g 4°C, for 10 minutes. 100 μL of supernatant
were combined with 1.8 mL 80% Ca(NO3)24H2O
solution and 100mL I2-KI solution, which were inhaled
in a cuvette to measure optical density at 620nm.
3. Results
3.1 DsPFK and DsENO expression profile under
hyperosmotic stress
This experiment was performed to examine the
expression pattern of DsPFK on mRNA levels under
hyperosmotic stress, a condition known to involve high
glycerol production in D. salina [1-3]. In Figure 1A,
the relative level of DsPFK mRNA gradually increased
from 90 min to 6 h under hyperosmotic stress with
a highest level at 6 h, suggesting that expression of
DsPFK was salinity-dependent. In Figure 1B, the relative
level of DsENO mRNA had a significant descending
trend from 5 min to 12 h under hyperosmotic stress
with a highest level at 10 min. This indicates that the
down-regulation of DsENO took priority over the up-
regulation of DsPFK at the transcriptional level.
3.2 Changes in enzymatic activity following
hyperosmotic stress
Confirmation of the hyperosmotic-induced changes
in glycerol metabolism was obtained by determining
the activity of DsPFK during glycolysis. As shown in
Figure 2A, during the first 12 h of hyperosmotic stress,
the activity of DsPFK increased. This effect was most
obvious after 30 min and 3 h of stress, which increased
above the initial level by 411%, but dropped after 3 h
and decreased past control levels by 24 h. In Figure 2B,
the level of activity of DsENO had a decreasing
trend from 0 min to 9 h under hyperosmotic stress
with a lowest level at 3 h.
903
Unauthenticated
Download Date | 10/6/16 1:47 AM
 The relationship of glycerol and glycolysis metabolism
patway under hyperosmotic stress in Dunaliella salina

Figure 1. Changes in the transcription of DsPFK(A) and DsENO(B) to hyperosmotic stress. qPCR assay of the accumulation of DsPFK and DsENO
transcript in response to hyperosmotic stress. The expression levels were normalized to 18S rRNA, and the level of DsPFK and DsENO
transcript in the control was set at 1.0. Error bars represent SD for three independent experiments.

Figure 2. PFK(A)and ENO(B) activity in D. salina during hyperosmotic stress. Error bars represent SD for three independent experiments.

3.3 Changes in PEP concentration following

hyperosmotic stress
PEP concentrations decreased during the first 3h period,
followed by recovery after 6h. PEP concentrations
after 12h stress increased higher than its original level
at 0 min (Figure 3).

3.4 Changes in starch and glycerol concentration

following hyperosmotic stress
As shown in Figure 4A, the concentration of glycerol
gradually increased from 5 min to 3 h under hyperosmotic
stress with a highest level at 3h, and decreased from 3 h
to 7 h. In Figure 4B, the concentration of starch gradually
decreased from 5 min to 12 h under hyperosmotic stress Figure 3. Changes in the concentration of PEP in D. salina before
(0 min) and during hyperosmotic stress. Error bars
with a lowest level at 12 h. represent SD for three independent experiments.

904
Unauthenticated
Download Date | 10/6/16 1:47 AM
Bing-Bing Xia et al.
Figure 4. Changes in the concentration of starch(A) and glycerol(B) in D. salina during hyperosmotic stress. Error bars represent SD for three
independent experiments.
4. Discussion
In D. salina, glycerol is the major compatible solute
for maintaining osmotic balance. Sources of carbon
for glycerol synthesis come from photosynthetic CO2
fixation and from the products of reserved starch
decomposition [11,22,23]. Under hyperosmotic stress,
glycerol is massively accumulated, and the source
of carbon for glycolysis comes mainly from reserved
starch decomposition [11,23]. During glycolysis, PFK
converts glucose to Fructose-1,6-BP, which is then
converted to DHAP and glycerol-3-phosphate (Glycerol-
3-P) by glycerol-3-phosphate dehydrogenase (GPD).
Glycerol-3-P is then converted into glycerol by glycerol-
3-phosphate phosphatase (GPP).
PFK is a key regulatory enzyme early in the glycolytic
pathway [24]. Alhough many studies have examined
PFK in plants and animals, PFK in algae remains poorly
understood. In this current study, the expression of
DsPFK was induced by hyperosmotic stress (17.532%
NaCl) resulting in a 6-fold increase in transcription
levels during the third and sixth hour of treatment
compared to controls at 8.766% NaCl (Figure 1).
Down-regulation of DsENO both reduced the amount
of carbon available for the tricarboxylic acid cycle, and
also decreased the formation of PEP. These results
suggest that either the transcriptional up-regulation of
DsPFK or the down-regulation of DsENO may cause
the carbon accumulation in the middle of glycolysis,
which is conducive to the synthesis of glycerol.
This indicates that the, up-regulation of DsPFK
expression occurs in order to satisfy the requirement of
the massive synthesis of glycerol under hyperosmotic
stress. The response of DsPFK to hyperosmotic stress
is similar to that of DsFAD-GPDH and DsGPI [9,25].
Transcription levels first increased significantly and then
decreased significantly, suggesting that the functions of
DsPFK, DsFAD-GPDH and DsGPI are coordinated.
In Figure 2, DsPFK gene transcription levels lagged
behind induction of PFK activity. This discrepancy
may indicate that the rapid stimulation of PFK activity
occurs through another mechanism than transcriptional
regulation. Activity differences of these two enzymes
would be conducive to the accumulation of glycerol.
PEP catalyzed by ENO has an allosteric inhibition
effect on PFK [17]. According to early work [16], PEP
is the most efficient inhibitor for Dunaliella marina PFK.
Our previous in vitro experiments showed that when the
concentration of PEP was 0.5 mM L-1, the relative activity
of PFK was 0.52. However, when the concentration of
PEP was increased to 1mM L-1, the activity of PFK was
completely inhibited.
The cellular metabolites were identified
by an effective extraction procedure that did not activate
hydrolytic enzymes, and by a sensitive analytical
separation technique. To assess the possible reason
for hyperosmotic-induced DsPFK activity changes,
the concentration of intracellular PEP was measured by
HPLC. Figure 3 indicates that readily changing levels
of PEP correspond to downstream DsENO activity [26].
This serves as an effective regulator in the PFK step.
When the activity of recombinant DsPFK was measured
in the presence of exogenous PEP, it was significantly
inhibited. Therefore, the level of the regulator and other
metabolites, rather than the amount of the mRNA, may
be responsible for the rapid fluctuations in DsPFK activity
under hyperosmotic stress. The significant increase in
PFK activity following hyperosmotic stress indicated that
it played a major role in regulating glycerol synthesis from
starch. Moreover, PFK were isolated from chloroplasts
of Dunaliella and on the basis of kinetic properties it
has been proposed as a likely candidate for regulation
905
Unauthenticated
Download Date | 10/6/16 1:47 AM
 The relationship of glycerol and glycolysis metabolism
patway under hyperosmotic stress in Dunaliella salina

of glycerol production [16]. This prediction was
consistent with the reported drop in ATP (a substrate
for the enzyme) following hyperosmotic stress [27,28]
and with the dependence of glycerol synthesis on
intracellular concentrations of ATP in Dunaliella [29].
As show in Figure 4, starch concentrations descended
during 5 min ~ 12 h, which suggests that rapid synthesis of
glycerol could balance osmolarity, and that the degradation
of starch could provid a carbon source glycerol synthesis.
The concentration of glycerol gradually decreased from
3 h to 7 h under hyperosmotic stress in Figure 4A.
The change of concentration of glycerol showed that
glycerol may work as a precursor factor under high-salt
stress. Eventually, other pathways involved with high-salt
stress may replace glycerol, resulting in a recovery to
normal non-stress concentrations.
Both upstream and downstream enzyme genes
involved in glycolysis cooperatively regulate the rapid
glycerol synthesis in D. salina under hyperosmotic
stress. The reduction of the DsENO expression and its
activity restrict the flow of carbon which would otherwise
enter the tricarboxylic acid cycle and concurrently
relieve the feedback inhibition of PFK activity by PEP.
This would improve the synthesis of DHAP and promote
the accumulation of glycerol (Figure 5). The cooperative
upstream and downstream regulation of glycolysis under
hyperosmotic stress in D. salina plays an important role
in rapid glycerol synthesis.
Acknowledgements
This work was supported by the National Science
Foundation of China (Grant number 30970043,
30500006). The authors would like to thank Liping Chen
from QA Centre, Swellfun Co., Ltd, for helping with
HPLC manipulation.
Conflict of Interest Statement
The authors report no conflicts of interest. The authors
alone are responsible for the content and writing
of the paper.

Figure 5. The pathway of glycerol metabolism and the upper and lower part cooperative regulation of glycolysis under hyperosmotic stress
in D. salina. Glucose-6-P, glucose-6-phosphate; Ribulose-5-P, ribulose-5-phosphate; DHA, dihydroxyacetone; Glyceraldehyde-3-P,
glyceraldehyde-3-phosphate; 3-PGA, 3-phosphoglycerate; Ribulose-1,5-BP, ribulose-1,5-bisphosphate; GCY, glycerol dehydrogenase;
DAK, dihydroxyacetone kinase. The rapid induction of the PFK activity could due to the relief of feedback inhibition of the downstream
product of glycolysis, such as PEP.

906
Unauthenticated
Download Date | 10/6/16 1:47 AM
Bing-Bing Xia et al.
References
[1] Casey, E., Mosier, N.S., Adamec, J., Stockdale,
Z., Ho, N., Sedlak, M., Effect of salts on the Co-
fermentation of glucose and xylose by a genetically
engineered strain of Saccharomyces cerevisiae,
Biotechnology for Biofuels., 2013, 6(1): 83
[2] Chen, H., Chen, S.L., Jiang, J.G., Effect of
Ca2+ Channel Block on Glycerol Metabolism
in Dunaliella salina under Hypoosmotic and
Hyperosmotic Stresses, Plos one., 2011, 6(12):
e28613
[3] Oliveira, B.M., Barrio, E., Querol, A., Pérez-
Torrado, R., Enhanced Enzymatic Activity of
Glycerol-3-Phosphate Dehydrogenase from the
Cryophilic Saccharomyces kudriavzevii, Plos one,
2014, 9(1): e87290
[4] Lin, H., Fang, L., Low, C.S., Chow, Y.,
Lee, Y.K., Occurrence of glycerol uptake
in Dunaliella tertiolecta under hyperosmotic stress,
FEBS Journal, 2013, 280(4): 1064-1072.
[5] Dihazi, H., Kessler, R., Eschrich, K., High Osmolarity
Glycerol (HOG) Pathway-induced Phosphorylation
and Activation of 6-Phosphofructo-2-kinase Are
Essential for Glycerol Accumulation and Yeast Cell
Proliferation under Hyperosmotic Stress, Journal of
Biological Chemistry, 2004, 279(23): 23961-23968
[6] Muzzey, D., Gómez-Uribe, C.A., Mettetal,
J.T., Oudenaarden, A., A systems-level analysis of
perfect adaptation in yeast osmoregulation, Cell,
2009, 138(1): 160-171
[7] O’Rourke, S.M., Herskowitz, I., O’Shea, E.K., Yeast
go the whole HOG for the hyperosmotic response,
TRENDS in Genetics, 2002, 18(8): 405-412
[8] Wang, L., Hatzimanikatis, V., Metabolic
engineering under uncertainty—II: Analysis of
yeast metabolism, Metabolic engineering, 2006,
8(2): 142-159
[9] Yang, W., Cao, Y., Sun, X., Huang, F., He Q., Qiao
D., et al., Isolation of a FAD-GPDH gene encoding
a mitochondrial FAD-dependent glycerol-3-
phosphate dehydrogenase from Dunaliella salina,
J. Basic Microbiol., 2007, 47, 266-274
[10] He, Q., Qiao, D., Bai, L., Zhang, Q., Yang, W., Li, Q., et
al., Cloning and characterization of a plastidic glycerol
3-phosphate dehydrogenase cDNA from Dunaliella
salina, J. Plant Physiol., 2007, 164, 214-220
[11] Chen, H., Jiang, J.G., Osmotic responses of
Dunaliella to the changes of salinity, J. Cell Physiol.,
2009, 219, 251-258
[12] Wu, C., Khan, S.A., Peng, L.J., Lange, A.J., Roles
for fructose-2,6-bisphosphate in the control of
fuel metabolism: Beyond its allosteric effects on
glycolytic and gluconeogenic enzymes, Advances
in enzyme regulation, 2006, 8(2): 142-159
[13] Mor, I., Cheung, E.C., Vousden, K.H., Control
of Glycolysis through Regulation of PFK1: Old
Friends and Recent Additions, Cold Spring Harbor
symposia on Quantitative Biology, 2011, 76: 211-
216
[14] Nielsen, T.H., Rung, J.H., Villadsen, D.,
Fructose-2, 6-bisphosphate: a traffic signal
in plant metabolism, Trends in plant science,
2004, 9(11): 556-563
[15] Smith, S.R., Abbriano, R.M., Hildebrand, M.,
Comparative analysis of diatom genomes reveals
substantial differences in the organization of
carbon partitioning pathways, Algal Research,
2012, 1(1): 2-16
[16] Traut, T., Phosphofructokinase, Allosteric
Regulatory Enzymes, 2008
[17] Muñoz, E., Ponce, E., Pyruvate kinase: current
status of regulatory and functional properties,
Comparative Biochemistry and Physiology Part
B: Biochemistry and Molecular Biology, 2003,
135(2): 197-218
[18] Voll, L.M., Hajirezaei, M.R., Czogalla, C., Lein, W.,
Stitt, M., Sonnewald, U., et al., Antisense inhibition
of enolase strongly limits the metabolism of
aromatic amino acids, but has only minor effects
on respiration in leaves of transgenic tobacco
plants, New Phytologist , 2009, 184(3): 607-618
[19] Liu, K.J., Shih, N.Y., The Role of Enolase in Tissue
Invasion and Metastasis of Pathogens and Tumor
Cells, J. Cancer Mol., 2007, 3(2): 45-48
[20] Dondini, L., Bonazzi, S., Del Duca, S., Bregoli,
A.M., Acclimation of chloroplast transglutaminase
to high NaCl concentration in a polyamine-
deficient variant strain of Dunaliella salina and
in its wild type, J. Plant Physiol., 2001, 158, 185
-197
[21] Ramos, A., Coesel, S., Marques, A., Rodrigues, M.,
Baumgartner, A., Noronha, J., et al., Isolation and
characterization of a stress-inducible Dunaliella
salina Lcy-β gene encoding a functional lycopene
beta-cyclase, Appl. Microbiol. Biotechnol., 2008,
79, 819-828
[22] Oren, A., A hundred years of Dunaliella research:
1905-2005. Saline Systems, 2005, 1(2): 1-14
[23] Goyal, A., Osmoregulation in Dunaliella, part Ⅱ:
photosynthesis and starch contribute carbon for
glycerol synthesis during a salt stress in Dunaliella
tertiolecta, Plant Physiol Biochem., 2007, 45(9):
705-710
907
Unauthenticated
Download Date | 10/6/16 1:47 AM

[24] Cloutier, M., Wellstead, P., The control systems
structures of energy metabolism, J. R. Soc.
Interface., 2010, 7, 651-665
[25] Cui, L., Xue, L., Li, J., Zhang, L., Yan, H.,
Characterization of the glucose-6-phosphate
isomerase (GPI) gene from the halotolerant alga
Dunaliella salina, Mol. Biol. Rep., 2010, 37, 911-
916
[26] Ruan, K., Duan, J.B., Bai, F.W., Lemair, M., Ma,
X.Z., Bai, L.H., Function of Dunaliella salina
(Dunaliellaceae) enolase and its expression during
stress, Eur. J. Phyco., 2009, 44, 207-214
908
The relationship of glycerol and glycolysis metabolism
patway under hyperosmotic stress in Dunaliella salina
[27] Ehrenfeld, J., Cousin, J.L., Ionic regulation of
the unicellular green alga Dunaliella tertiolecta:
Response to hypertonic shock, J. Membr. Biol.,
1984, 77, 45-55
[28] Belmans, D., Van, Laere, A., Glycerol cycle
enzymes and intermediates during adaption of
Dunaliella teriolecta cells to hyperosmotic stress,
Plant Cell Environ., 1987, 10, 185-190
[29] Belmans, D., Van, Laere, A., Effect of Ionophores
on the ATP-pool and Glycerol Content in Cells of
the Halotolerant Green Alga Dunaliella tertiolecta,
Microbiology, 1988, 134, 2261-2268
Unauthenticated
Download Date | 10/6/16 1:47 AM