Physiology & Behavior 157 (2016) 170–177

Contents lists available at ScienceDirect

Physiology & Behavior

journal homepage: www.elsevier.com/locate/phb

Effect of hyperprolactinemia on PRL-receptor expression and activation

of Stat and Mapk cell signaling in the prostate of long-term
sexually-active rats
Luz I. Pascual-Mathey a, Fausto Rojas-Duran b, Gonzalo E. Aranda-Abreu b, Jorge Manzo b,
Deissy Herrera-Covarrubias b, David A. Muñoz-Zavaleta c, Luis I. Garcia b, Ma. Elena Hernandez b,⁎
a
Facultad de QFB, Universidad Veracruzana, Xalapa, Ver., Mexico
b
Centro de Investigaciones Cerebrales, Universidad Veracruzana, Xalapa, Ver., Mexico
c
Doctorado en Investigaciones Cerebrales, Universidad Veracruzana, Xalapa, Ver., Mexico

H I G H L I G H T S

• Prostatic alterations precede copulatory deficits in males with HyperPRL.

• HyperPRL produces constant expression of the short PRL receptor at the prostate.
• HyperPRL produces sustained reduction of the long PRL receptor at the prostate.
• HyperPRL induces increased activity of cell signal pathways at the prostate.

a r t i c l e i n f o a b s t r a c t

Article history: The abnormal elevation of serum PRL, referred to as hyperprolactinemia (HyperPRL), produces alterations in
Received 1 September 2015 several reproductive parameters of male rats such as penile erection or decreased tendency to reach ejaculation.
Received in revised form 3 February 2016 Additionally, this situation produces a significant modification of prostate histology, as observed in the epithelial
Accepted 7 February 2016
structure and alveolar area, which could reach a level of hyperplasia in the long-term. In this tissue, HyperPRL
Available online 9 February 2016
produces an increase in expression of PRL receptors and activation of the Stat3 signaling pathway that is
Keywords:
correlated with the evolution of prostate pathologies. However, the impact of HyperPRL in long-term sexually
Serum prolactin active male rats is unknown. In this work, using constantly copulating Wistar male rats with induced HyperPRL,
Signaling pathways we analyzed the level of serum PRL, the effect on prostate PRL receptors, and activation of pStat3, pStat5
Sexual behavior and Mapk signaling pathways. Two procedures to induce HyperPRL were employed, comprising daily IP
Prostate pathology administration or adenohypophysis transplant, and although neither affected the execution of sexual behavior,
the serum PRL profile following successive ejaculations was affected. Messenger RNA expression of the short
and long isoforms of the PRL receptor at the ventral prostate was affected in different ways depending on the
procedure to induce HyperPRL. The ventral prostate did not show any modification in terms of activation of
the pStat5 signaling pathway in subjects with daily administration of PRL, although this was significantly
increased in ADH transplanted subjects in the second and fourth consecutive ejaculation. A similar profile was
found for the pStat3 pathway which additionally showed a significant increase in the third and fourth ejaculation
of daily-injected subjects. The Mapk signaling pathway did not show any modifications in subjects with daily
administration of PRL, but showed a significant increase in the second and third ejaculations of subjects with
ADH transplants. Thus, although sexual behavior was not modified, HyperPRL modified the expression of PRL
receptors and the activation of signal pathways in the prostate tissue. Hence, it is probable that prostatic
alterations precede the sexual behavioral deficits observed in subjects with HyperPRL.
© 2016 Elsevier Inc. All rights reserved.

1. Introduction

⁎ Corresponding author at: Centro de Investigaciones Cerebrales, Calle Roma No. 73,
Monte Magno, Xalapa, Ver. 91193, Mexico.
E-mail address: elenahernandez@uv.mx (M.E. Hernandez).
In male rats, prolactin (PRL) in serum has a daily basal level with
peaks at each transition of the dark-light cycle [1]. There are several
physiological reasons for this fluctuation, and one of the functions is to
regulate cell mechanisms at the prostate gland. In the prostate, PRL

http://dx.doi.org/10.1016/j.physbeh.2016.02.011
0031-9384/© 2016 Elsevier Inc. All rights reserved.
 L.I. Pascual-Mathey et al. / Physiology & Behavior 157 (2016) 170–177
controls zinc uptake, citrate synthesis, and expression of androgen
receptors and cathepsin D [2,3]. Furthermore, as PRL is a hormone that
shows additional peaks when a subject displays behavioral parameters
related to sexual encounters, it has been shown that it also serves to
trigger the synthesis and release of the contents of the gland to produce
sufficient semen to expel per ejaculation [4].
The influence of PRL on the prostate begins after the hormone acti-
vates its receptor (PRL-R) at the membrane of gland epithelial cells. Ex-
pression of the long and short forms of PRL-R, in turn, shows fluctuation
depending on the behavioral situation of the subject. Hence, the balance
between serum PRL and the long and short forms of PRL-R has a partic-
ular profile. In long-term sexually active male rats displaying consecu-
tive ejaculations, expression of long PRL-R at the ventral prostate
increases significantly after the second and third ejaculation, while ex-
pression of short PRL-R increases immediately after the first ejaculation
and remains high up until the third ejaculation. By the fourth ejacula-
tion, the level of both receptor types returns to precopulatory levels
[5]. This fluctuation of the receptors occurs even when the serum level
of PRL remains elevated. Thus, the relationship between the concentra-
tion of PRL and its receptors seems to be independent of the hormone
level in the serum, but is dependent on the different signaling pathways
that become activated inside the cells.
Attachment of PRL to its receptor at the prostate activates the Stat5 sig-
naling pathway [6,7], which seems to be an important mechanism since
its blockage produces disorganization of the epithelium [8,9]. Further-
more, PRL triggers transitory activation of the Stat3 pathway that lasts
for some minutes, a response that is clearly observed during the execution
of sexual behavior [10]. Additionally, PRL triggers the Mapk signaling
pathway in the prostate epithelium which seems to be associated with
the induction of cell proliferation [7]. In a recent study, we found that
Stat3 is the main pathway that showed a significant sustained increase
in long-term sexually active males [5]. Thus, it seems that this increase un-
derlies the synthesis of prostatic semen [6], and the stimulation of sperm
motility [11,12]. However, as in other cases, the increase in the Stat3 path-
way was not sustained but dropped suddenly to precopulatory levels in
the long-term. Hence, although constant execution of sexual behavior in
males produces a sustained elevation of PRL levels, there is a controlled
level of the signaling pathways activated in the epithelial cells of the
gland. This process could be employed to maintain a healthy gland.
Therefore, in this work we investigated the mechanisms invoked during
the well-known effects of hyperprolactinemia (HyperPRL).
Subjects with HyperPRL experience alterations in several reproduc-
tive parameters such as penile erection [13] or decreased tendency to
reach ejaculation [14]. This situation also produces a significant modifi-
cation of prostate histology, as observed in the epithelial structure and
alveolar area [1], which could reach a level of hyperplasia in the long-
term [5]. Furthermore, it has been reported that HyperPRL produces
an increase in the expression of PRL-R, and that activation of the Stat3
signaling pathway is highly correlated with the evolution of prostate pa-
thologies [8,15]. However, all of these data pertain to males without
sexual experience or males engaged in a single bout of sexual behavior.
In nature, however, a male rat is involved in periodic sexual behavior
during adulthood, with several consecutive ejaculations that have a spe-
cific impact on PRL, PRL-R, and cell signaling pathways in the prostate.
Thus, we hypothesize that the physiology of constant sexual activity in-
cludes fine control of the hormone mechanisms that are progressively
disrupted when PRL levels increase above normal values. In this work,
we set out to investigate the manner by which this complex situation
responds to HyperPRL in long-term sexually active male rats.
2. Materials and methods
2.1. Subjects and sexual behavior
Wistar male rats between 300 and 350 g/bw were used and
underwent 4 sessions of sexual behavior tests every other day. The
171
training was carried out during the last third of the dark phase of
the light-dark cycle, an optimum phase for expression of the sexual
behavior in this species.
Ovariectomized females were also used, and their sexual receptivity
was induced with steroids dissolved in sesame oil. To this end, subcuta-
neous injections of estradiol benzoate (10 μg) and then progesterone
(2 mg) were administered 48 and 4 h, respectively, before tests. Males
were placed in the training arena 5 min prior to testing for adaptation
and then receptive females were introduced. From this moment, sexual
behavior was recorded until ejaculation was achieved. Following com-
pletion of 4 training sessions, males whose first ejaculation latency
was b 10 min were selected. These were then allowed to reach just
one ejaculation for another 15 days of sexual behavior every other day
following induction of hyperprolactinemia (see below). At the end of
the period and prior to sacrifice, rats were then placed into one of four
groups of a copulatory series, where rats were and allowed to achieve
between one and four consecutive ejaculations. Following each ejacula-
tion, a blood sample was collected from the heart of randomly selected
males, and the ventral prostate was removed, placed in physiological
saline, frozen in liquid nitrogen, and then stored at −70 °C until use.
2.2. Induction of hyperprolactinemia
Two procedures were used to induce HyperPRL. 1) A daily IP admin-
istration of 100 g of ovine PRL (Sigma Chemicals, cat. L-6520), and 2) a
transplant of the adenohypophysis (ADH) to the renal capsule. Both
procedures were employed in an effort to determine whether any dif-
ferences exist between acute and sustained elevation of PRL. The AHD
transplant procedure was performed as reported elsewhere [16–19].
Immediately following decapitation of a female donor, the ADH was ex-
tracted, placed in a culture plate with saline solution, and then carefully
placed under the renal capsule of the surgically exposed kidney of the
experimental subject. Animals were kept in recovery and under obser-
vation for a week prior to commencement of the experiments. In the
sham group, the kidney was exposed but no ADH was transplanted.
2.3. Quantification of prolactin
The blood concentration of PRL was determined using the ALCO kit
(cat. 12-MKVRP1), as established by Beach and col. 1985. The standard
curve range was from 5 to 80 ng/ml. Briefly, 25 μl of each sample and
standard curve solutions was loaded and to each was immediately
added 50 μl of rat PRL sample buffer. The plate was incubated with
constant agitation for two hours at room temperature. The plate con-
tents were decanted, washed four times, and 200 μl of tetramethyl
benzidine-coupled secondary antibody was added to each well. The
plate was then incubated for 30 min in the dark at room temperature,
and the reaction was stopped by the addition of 50 μl of hydrochloric
acid to each well. The plate was then read using an ELISA reader at
450 nm. Absorbances were analyzed using linear regression and the
data obtained are reported in ng/ml.
2.4. Western blot
Tissue samples from the ventral prostate (100 mg) were homoge-
nized in 200 μl of Lysis buffer containing SoluLyse M (cat. L-30012,
Genlantis Inc.) and protease inhibitor cocktail tablets (cat. No.
11836153001, ROCHE), and then constantly agitated at 4 °C for 1 h.
Samples were centrifuged at 13000 rpm for 30 min at 4 °C and the
supernatants (total extract) were recovered. Aliquots were obtained
and frozen at − 70 °C. Protein concentration was determined by the
Bradford method. One hundred micrograms of protein from each
sample was subjected to 7.5% SDS-PAGE under reducing conditions at
200 V (Mini-Protean III, Bio-Rad) and then transferred onto a
nitrocellulose membrane at 100 V for 1.30 h.
172 L.I. Pascual-Mathey et al. / Physiology & Behavior 157 (2016) 170–177

The nitrocellulose membrane 0.45 μm (162–0115, Bio-Rad) was 3. Results

blocked with TBS containing Tween-20 (0.1%) and milk (5%) for 1 h.
The membrane was washed 3 times with a solution comprising 3.1. Sexual behavior parameters
TBS-Tween-20 (0.1%) for 5 min each, and then incubated overnight
at 4 °C with the first antibody against pStat3 (H-190, 1:250), pStat5 Copulatory parameters showed that males in the study displayed
a/b (H-134, 1:250), and Mapk (sc-252, 1:500) from Santa Cruz appropriate ejaculatory parameters, and that neither of the procedures
Biotechnology. The membrane was washed 3 times and then to induce HyperPRL affected the execution of sexual behavior. The
incubated with secondary antibody (Goat anti-mouse 1/1000, quantification of behavioral parameters is presented in Table 1. As an
Santa Cruz Biotechnology) for 1 h at room temperature. Protein bands overall representation of sexual behavior, we analyzed the hit rate
were revealed using the HRP kit (170-6465, Bio-Rad) and densitometric value since two of the most important behavioral parameters during
analysis of the bands was performed using the Kodak image station mating are the frequency of mounts (FM) and frequency of intromis-
440-CF with Kodak 1D 3.6 software. Βeta-actin (44 kDa) was used as sions (FI), that are computed with the ratio FI/(FM + FI) that reflects
loading control. the potency of mating in male rats; values obtained show that males
displayed levels of copulation that fell in the average range of sexually
expert subjects (Fig. 1).
2.5. RT-PCR
3.2. Level of PRL in serum
Tissue from the ventral prostate (100 mg) was homogenized in a
Politron in 1 ml of Trizol and incubated for 5 min at room temperature.
After long-term execution of sexual behavior, consecutive ejacula-
To this was added 200 μl of chloroform with continuous shaking and
tions after 15 days produced a constant elevation of PRL in serum, as
sample was incubated again for 3 min. The mixture was centrifuged
shown elsewhere [5]. However, although no change was observed in
at 8000 rpm for 15 min at 8 °C and the aqueous phase separated.
the execution of sexual behavior, successive ejaculations was accompa-
Total RNA (RNAt) was precipitated using 1:1 (v/v) isopropanol, homog-
nied by a change in PRL serum profile levels. Subjects with daily admin-
enized, incubated for 10 min at room temperature, and then centrifuged
istration of PRL showed a significant increase of the hormone in the first
at 12000 rpm for 10 min at 8 °C. The resulting pellet was washed with
ejaculation, while in subsequent ejaculations the level returned to basal
300 μl of 75% ethanol, and centrifuged at 7500 rpm for 5 min at 8 °C.
values. Subjects with the ADH transplant showed a significant constant
The ethanol was decanted and the pellet was dried outdoors and then
elevation of serum PRL during the four consecutive ejaculations (Fig. 2).
dissolved in 50 μl of sterile water. One microliter of this solution was
added to 999 μl of sterile water (1:1000 dilution) to quantify RNAt.
3.3. PRL receptor mRNA
Absorbances were recorded 260 and 280 nm using a spectrophotometer
(Genova MK3).
In long-term sexually active males that displayed consecutive
Total cDNA (cDNAt) was obtained by thermocycling (3 min at 70 °C)
ejaculations after 15 days, the ventral prostate showed a different
a mixture comprising 3 μl (3 mg) of RNAt, 1 μl of Oligo (dt), 1 μl of
mRNA expression profile for the long and short isoforms of the PRL
DNTPs, and 6 μl of sterile water. To this was added 9 μl of a cocktail
receptor that was dependent on the HyperPRL procedure (Fig. 3).
containing 5 μl of Buffer 5× (50 mM Tris-HCl pH 8.3, and 40 mM KCl),
Messenger RNA expression of the long isoform increased after daily ad-
2 μl of DTT, 1 μl of RNAse inhibitor, and 1 μl of MMLV. The final volume
ministration of PRL, with a significant increase in the fourth ejaculation,
was 20 μl. The mixture was incubated at 37 °C for 60 min and then at
but was significantly reduced in every ejaculation in ADH transplanted
94 °C for 3 min. Amplification of cDNAt was accomplished with 2 μl of
subjects. Expression of the short isoform increased significantly with
oligonucleotide. For both long and short PRL-R the sense sequence
both HyperPRL procedures.
comprised 20 pb (tgatgacctgcatctttcca), while the antisense sequence
for the short receptor comprised 20 pb (gtcaagttcccctgcattgt), giving a
3.4. Stat and Mapk signaling pathways
final product of 155 pb, and 21 nucleotides for the long receptor
(tagcttgcacacatcagcaac), giving a final product of 518 pb. The mixture
The ventral prostate of long-term sexually active males with induced
also contained 10 μl of cDNA and 36 μl of a cocktail comprising 1 μl of
HyperPRL did not show any modification in activation of the pStat5
dNTPs, 5 μl of Buffer 10 × without MgCl2, 1.5 μl of Mg ++ as MgCl2
signaling pathway in subjects with daily administration of PRL, but in
(50 mM), 0.5 μl of Taq polymerase, 28 μl of sterile water, and 2 drops of
ADH transplanted subjects was significantly increased in the second
mineral oil. Amplification was performed using the following steps:
and fourth consecutive ejaculation. A similar profile was found for the
1 cycle of denaturation (5 min at 94 °C), 35 annealing cycles (30 s at
pStat3 pathway that showed a significant increase in the third and
94 °C), then 1 cycle at 60 °C (40 s) and 1 at 72 °C (1 min), and 1 elongation
fourth ejaculation of ADH transplanted subjects. The Mapk signaling
cycle (10 min at 72 °C, then at 4 °C). The internal control consisted of am-
pathway did not show any modification in subjects with daily adminis-
plification of a 228 base pair sequence (nucleotides 471 and 698) of the
tration of PRL, but showed a significant increase in the second and third
gene for rat β-actin. The sense sequence used was aagtggtggtgtcgactctc
ejaculations of ADH transplanted subjects (Fig. 4).
(nucleotide 471) and the antisense sequence was agccatgtacgtagccatcc
(nucleotide 698). Products were separated at room temperature through
4. Discussion
a 1% agarose gel with 3 μl of ethidium bromide (10 mg/ml solution) for
30 min at 100 V. The resulting bands were analyzed in the Kodak image
The prostate is an accessory sexual gland that is dependent on
station 440-CF using Kodak 1D 3.6 software, where the density of bands
hormones for proper functionality. Testosterone and PRL are hormones
was measured. Chemicals were obtained from Invitrogen, Mexico.
that stimulate the gland, and their influence is correlated with the
sexual life of the subject [20]. In a previous study, we showed that
2.6. Statistical analysis subjects displaying long-term activity of sexual behavior possess a
constant elevation of serum PRL levels during mating [5]. Thus, a con-
The data for each test were compared with a one-way ANOVA for stant sexual life is accompanied by a sustained elevation of serum
independent groups followed by a post hoc application of the Testosterone and PRL. In this work we showed that the physiological
Newman-Keuls test to compare groups of experimental animals increase in serum PRL is under the threshold required to induce
against the corresponding control. Significant differences were behavioral alterations, since regardless of the procedure employed to
inferred when p b 0.05. induce HyperPRL, the parameters of sexual behavior remained in the
 L.I. Pascual-Mathey et al. / Physiology & Behavior 157 (2016) 170–177 173

Table 1
Copulatory parameters of control (Ctrl), ovine prolactin (oPRL), sham and pituitary-grafted (graft) male rats. Data are Mean ± SEM.

1 2 3 4 5

Tests

Number of mounts
Ctrl 6.7 ± 0.18 5.7 ± 0.20 6.4 ± 0.19 6.9 ± 0.18 6.5 ± 0.19
oPRL 7.5 ± 0.17 6.4 ± 0.19 4.3 ± 0.23 7.4 ± 0.17 8.1 ± 0.16
Sham 8.3 ± 0.52 3.8 ± 0.78 3.5 ± 0.80 5.5 ± 0.64 6.8 ± 0.58
Graft 14.0 ± 0.20 14.3 ± 0.20 11.4 ± 0.22 9.1 ± 0.25 11.1 ± 0.23
Number of intromissions
Ctrl 9.5 ± 0.08 8.2 ± 0.09 9.4 ± 0.08 8.8 ± 0.08 9.1 ± 0.08
oPRL 9.1 ± 0.08 8.9 ± 0.08 8.3 ± 0.09 8.7 ± 0.08 9.5 ± 0.08
Sham 11.1 ± 0.08 9.4 ± 0.09 8.6 ± 0.10 9.2 ± 0.05 10.4 ± 0.09
Graft 9.8 ± 0.18 7.8 ± 0.21 8.5 ± 0.20 8.0 ± 0.21 8.5 ± 0.20
Latency of mounts (sec)
Ctrl 4.6 ± 0.82 8.8 ± 1.11 6.7 ± 2.1 5.8 ± 1.12 6.5 ± 2.0
oPRL 6.6 ± 2.4 3.9 ± 1.7 7.3 ± 2.1 8.4 ± 2.7 7.1 ± 1.5
Sham 8.2 ± 2.3 5.8 ± 1.4 9.3 ± 2.2 7.2 ± 3.0 6.1 ± 1.3
Graft 5.4 ± 2.2 7.2 ± 2.7 6.9 ± 2.7 5.3 ± 1.8 5.7 ± 2.0
Latency of intromission (sec)
Ctrl 15.3 ± 3.1 18.3 ± 5.2 18.8 ± 3.3 18.4 ± 2.5 16.4 ± 2.7
oPRL 14.6 ± 2.4 14.7 ± 5.3 18.7 ± 2.6 15.9 ± 2.7 17.2 ± 3.1
Sham 15.0 ± 2.3 15.7 ± 4.3 17.7 ± 2.2 18.9 ± 2.9 16.9 ± 2.6
Graft 15.5 ± 2.5 16.9 ± 2.7 15.9 ± 2.7 17.9 ± 2.3 18.3 ± 3.4
Latency of ejaculation (sec)
Ctrl 296 ± 0.09 221 ± 0.10 235 ± 0.10 243 ± 0.10 188 ± 0.11
oPRL 263 ± 0.10 248 ± 0.10 208 ± 0.10 239 ± 0.10 235 ± 0.10
Sham 283 ± 0.30 237 ± 0.34 210 ± 0.36 182 ± 0.40 173 ± 0.36
Graft 447 ± 0.12 413 ± 0.13 301 ± 0.15 303 ± 0.15 324 ± 0.15

normal range. However, it was found that even though behavior was
not modified, this level of HyperPRL actually modified both expression
of PRL receptors and activation of signaling pathways in the prostate

Fig. 1. Hit rate following the first ejaculation of long-term copulating rats with induced
HyperPRL. Graphs show that neither daily administration of ovine PRL (oPRL) nor ADH Fig. 2. Serum levels of PRL following four consecutive ejaculations of males after 15 days of
transplant to the renal capsule (Adh) produced any alteration in the execution of the long-term sexual activity and with induced HyperPRL. Bars show the mean ± SEM. SE =
behavior. Bars show the mean ± SEM. SE = Sexually expert subject without treatment. Sexually expert subject showing the precopulatory level. * = p b 0.05; ** = p b 0.01.
174 L.I. Pascual-Mathey et al. / Physiology & Behavior 157 (2016) 170–177
Fig. 3. Levels of long (left panel) and short (right panel) PRL receptor mRNA at the ventral prostate following four consecutive ejaculations of males after 15 days of long-term sexual
activity. Bars show the mean ± SEM. SE = Sexually expert subject showing the precopulatory level. * = p b 0.05; ** = p b 0.01.
tissue, which follows our previous data showing that HyperPRL induces
prostate tissue changes observed in the alveolar area and epithelial
height [1]. Hence, cellular alterations precede the behavioral alterations
observed in subjects with a higher level of HyperPRL. It is known that
serum levels above 100 ng/ml reduce the potency of normal sexual
activity in males [21–23], and lower levels allow subjects to copulate
with a higher number of mounts, decreased number of intromissions,
and long ejaculation latencies [24,25]. Our lowest levels of HyperPRL
had no impact on displayed behavior, perhaps because these were
insufficient to affect the central nuclei underlying the behavior such as
in the medial preoptic area [6]. Thus, it is suggested that HyperPRL has
deleterious effects depending on its serum level, and even the lowest
level examined here was sufficient to produce significant modifications
in the prostate gland that may facilitate the development of a severe
pathology. Notwithstanding, it is important to notice that the correla-
tion between HyperPRL, prostate tissue, and behavioral modifications
does not suggest a direct influence, since it is known that neither the
complete removal of the prostate nor other accessory sexual glands
[26,27], nor the sympathetic denervation of the prostate [28], affect
the execution of sexual behavior.
The literature contains a variety of reports that detail the induction
of hyperPRL. Krüger et al. [25] in their work on humans produced an in-
crease in serum PRL using an i.v. injection of protirelin in a dose that
produced elevations similar to those observed during orgasms, and
only observed a modification in the ejaculation latency, while Doherty
et al. [23] used pituitary-grafted males, as we did here, and found inhi-
bition of reproductive parameters. However, even though we induced
hyperPRL using the same pituitary-grafted procedure, the absence of
any negative effect with regard to sexual behavior could be due to the
short period of stimulation we employed (15 days) compared to the
3–4 weeks employed by the aforementioned authors. Thus, as stated
by the same authors, PRL seems to be involved in one of the several neu-
roendocrine processes that regulate the expression of sexual behavior. It
is known that the impact of PRL at the central level could be due to the
presence of its receptors at several places, such as the choroid plexus
and other sites of the blood brain barrier [29–31]. The distribution of
PRL receptors allows the hormone to induce the release of dopamine
in the medial preoptic area to modulate the behavior, or to modify sero-
tonin levels from the paragigantocellular nucleus or periaqueductal
gray area to inhibit behavioral displays at the level of the spinal cord
[32]. Behavior could even be inhibited after alteration of penile erections
by the influence of the hormone on the wide dynamic neurons located
in the dorsal horn of the spinal cord [23,33]. Although here we did not
observe modifications of sexual behavior parameters, physiological
mechanisms such as emission or ejaculation may be altered, and
deserve further studies.
In males with constant execution of sexual behavior, the level of
mRNA for the long and short prostate receptor increased transiently
and in the long-term was reduced, although the level of serum PRL
remained high [5]. However, the induction of HyperPRL we performed
resulted in a different profile. Daily administration of PRL produced
elevated levels of mRNA in the long-term without reduction, while the
most dramatic difference was observed in the mRNA for the long recep-
tor in subjects with the ADH transplant, which showed a significant and
permanent reduction in level. Thus, it seems that HyperPRL results in
constant expression of the short PRL receptor and reduced expression
of the long PRL receptor at the prostate gland. These results are consis-
tent with those reported for kidney, lymphocytes and ovary [34–37].
Hence, it is suggested that modification in expression of receptor
mRNA could be a consequence of alterations in proteins regulating the
alternative splicing process, mainly the SR which is involved in produc-
ing the long receptor [36, 38–40]. Another possibility could involve the
cysteine residues located at positions 36/46 and 75/86 in the extracellu-
lar domain of the short receptor, which may act as a negative dominant
to the long isoform of the PRL receptor [39,41]. Alternatively, it could be
due to a receptor lacking subdomain S2 in the extracellular domain [42].
Therefore in the prostate, the maintenance of an equilibrium between
the two isoforms of the PRL receptor could be one process required to
maintain the morphology of the gland, as has been proposed for the
luteal body [39], and during a pathology the return to this equilibrium
could be necessary to cease progression of the pathology [42,43]. The
short isoform is quite important since it regulates a number of transcrip-
tion factors that promote the activation of genes required for prolifera-
tion as Pax5, Pax6, RUNX1, RFX1/2/3, Cdx2, and FOXO3 [36,40]. Hence,
 L.I. Pascual-Mathey et al. / Physiology & Behavior 157 (2016) 170–177
Fig. 4. Level of activation of the pStat3, pStat5 and Mapk signaling pathways in the ventral prostate of males after 15 days of long-term sexual activity. Bars show the mean ± SEM. SE =
Sexually expert subject showing the precopulatory level. * = p b 0.05.
the short isoform seems to be the key for triggering pathological
processes at the prostate [36,44–46].
Prolactin receptors at the prostate activate several cell signaling
pathways including Stat3, Stat5 a/b and Mapk. Here we showed that
these pathways displayed increased activity mainly in subjects with
the ADH transplant. Although other reports have claimed that PRL
effects are mediated only by the Stat5 a/b signaling pathway [7,47],
the activation we observed for every pathway could be due to the
constant sexual activity of our subjects, and propose that PRL could pos-
sess wider activity such as the stimulation of signaling pathways [5,10].
Hence, activation of Stat3 in some situations could inhibit the actions of
SOCS proteins, which negatively regulate the Jak/Stat pathway and con-
sequently trigger the commencement of prostate pathologies [48,49].
Alternatively, it could involve a crosstalk mechanism where Mapk phos-
phorylates Ser727 of Stat3 [50], which contributes to the pro-oncogenic
effects reported for the Stat3 pathway [15,51] and activation of
antiapoptotic proteins such as Bcl-2 and Mcl-1 [52]. All of these data
show the importance of PRL disregulation to induce morphological al-
terations of the prostate [1,48,50,53]. Even though the Mapk signaling
175
pathway was not activated by PRL in cultured organs [7], we observed
activation of this pathway in our subjects with HyperPRL. Again we
suggest that our model of long-term sexually active rats provided a dis-
tinctive physiological condition in these subjects. In subjects without
sexual activity, PRL induces an increase in prostate weight and epithelial
height [1], whereas in sexually active males the prostate weight remains
unchanged [54]. Thus, it is important to consider the cellular modifica-
tions produced by the constant execution of sexual behavior in an effort
to fully understand the role of each signaling pathway in terms of the
physiological and pathological conditions.
There are two important questions that emerge from our study.
Firstly, how do we account for the difference in results observed
between the two procedures employed to induce hyperPRL? Secondly,
what causes the observed changes in the prostate cells? The first ques-
tion could be addressed by examining the cell signaling level, since it
has been reported that PRL activates the Jak2 pathway, but under dis-
turbed conditions activates both Jak1 and Jak2 pathways which in
turn induce oncogenic effects on the prostate tissue [55]. Thus, this
causes the observed effect on the prostate, although there are other
176 L.I. Pascual-Mathey et al. / Physiology & Behavior 157 (2016) 170–177
mechanisms, such as one we recently described [56], where a combina-
tion of PRL with testosterone could produce histological abnormalities
in the prostate tissue as early as 4 weeks following commencement of
the treatment. Therefore, further studies are required in an effort to
delineate the entire neuroendocrine mechanisms that affect the
abnormal growth of the prostate gland.
5. Conclusions
Here we showed that induced HyperPRL in subjects with a constant
sexual life resulted in modified expression of the long and short PRL
receptor at the prostate tissue, in addition to modifications of the cell
signaling pathways. The present data, taken together with previous
data from our group, suggest that changes in the cell architecture
seem to be a consequence of modification of the short PRL receptor,
and constitutive activation of the signaling pathways commonly
activated by PRL. Thus, all of these changes may trigger pathological
processes as a result of destabilization of the cytoskeleton, as suggested
elsewhere [57].
Acknowledgments
The authors do not have any conflict of interests with the content of
the paper; this work was supported by grant of CONACyT 106531
(MEH), UV-CA-304, UV-CA-28, and PROMEP UV-PTC-716.
References
[1] M.E. Hernandez, A. Soto-Cid, F. Rojas, L.I. Pascual, G.E. Aranda-Abreu, R. Toledo, et al.,
Prostate response to prolactin in sexually active male rats, Reprod. Biol. Endocrinol.
4 (2006) 28.
[2] Y. Liu, R.B. Franklin, L.C. Costello, Prolactin and testosterone regulation of
mitochondrial zinc in prostate epithelial cells, Prostate 30 (1) (1997) 26–32.
[3] L.C. Costello, R.B. Franklin, Testosterone and prolactin regulation of metabolic genes
and citrate metabolism of prostate epithelial cells, Horm. Metab. Res. 34 (8) (2002)
417–424.
[4] K.M. Fedorka, W.E. Winterhalter, B. Ware, Perceived sperm competition intensity
influences seminal fluid protein production prior to courtship and mating, Evolution
65 (2) (2011) 584–590.
[5] F. Rojas-Durán, L.I. Pascual-Mathey, K. Serrano, G.E. Aranda-Abreu, J. Manzo, A.H.
Soto-Cid, et al., Correlation of prolactin levels and PRL-receptor expression with
Stat and Mapk cell signaling in the prostate of long-term sexually active rats,
Physiol. Behav. 138 (2015) 188–192.
[6] M.E. Hernandez, M.J. Wilson, The role of prolactin in the evolution of prostate
cancer, J. Urol. 02 (23) (2012) 188–197.
[7] T.J. Ahonen, P.L. Härkönen, R. Hallgeir, M.T. Nevalainen, PRL signal transduction in
the epithelial compartment of rat prostate maintained as long-term organ cultures
in vitro, Endocrinology 143 (1) (2002) 228–238.
[8] K.S. Siveen, S. Sikka, R. Surana, X. Dai, J. Zhang, A.P. Kumar, et al., Targeting the STAT3
signaling pathway in cancer: role of synthetic and natural inhibitors, Biochim.
Biophys. Acta 1845 (2) (2014) 136–154.
[9] M.T. Nevalainen, T.J. Ahonen, H. Yamashita, V. Chandrashekar, A. Bartke, P.M.
Grimley, et al., Epithelial defect in prostates of Stat5a-null mice, Lab. Investig. 80
(7) (2000) 993–1006.
[10] A. Soto-Cid, L.C.R. Hernández-Kelly, M.E. Hernández, J. Manzo, M.E. González-Mejia,
R.C. Zepeda, et al., Signal transducers and activators of transcription 1 and 3 in
prostate: effect of sexual activity, Life Sci. 79 (9) (2006) 919–924.
[11] W.P. Ventura, M. Freund, The role of semen and accessory gland secretions in sperm
transport in the rat, Acta Eur. Fertil. 3 (1) (1972) 87–103.
[12] B.L. Hart, Role of testosterone secretion and penile reflexes in sexual behavior and
sperm competition in male rats: a theoretical contribution, Physiol. Behav. 31 (6)
(1983) 823–827.
[13] P.C. Doherty, D.E. Wu, K.S. Matt, Hyperprolactinemia preferentially inhibits erectile
function in adrenalectomized male rats, Life Sci. 47 (2) (1990) 141–148.
[14] J. Rehman, G. Christ, M. Alyskewycz, E. Kerr, A. Melman, Experimental
hyperprolactinemia in a rat model: alteration in centrally mediated neuroerectile
mechanisms, Int. J. Impot. Res. 12 (1) (2000) 23–32.
[15] S. Yousuf, M. Duan, E.L. Moen, S. Cross-Knorr, K. Brilliant, B. Bonavida, et al., Raf
kinase inhibitor protein (RKIP) blocks signal transducer and activator of transcrip-
tion 3 (STAT3) activation in breast and prostate cancer, PLoS One 9 (3) (2014) 1–13.
[16] D.J. Bailey, J. Herbert, Impaired copulatory behaviour of male rats with
hyperprolactinaemia induced by domperidone or pituitary grafts, Neuroendocrinology
35 (3) (1982) 186–193.
[17] M.A. Blankenstein, J.B. Vries, A. Coert, H. Nievelstein, Effect of long-term
hyperprolactinemia on the prolactin receptor content of the rat ventral prostate,
Prostate 6 (1985) 277–283.
[18] A. Coert, H. Nievelstein, H.J. Kloosterboer, P. Loonen, J. Van Der Vies, Effects of
hyperprolactinemia on the accessory sexual organs of the male rat, Prostate 6
(1985) 269–276.
[19] C. Lee, D. Hopkins, J.M. Holland, Reduction in prostatic concentration of endogenous
dihydrotestosterone in rats by hyperprolactinemia, Prostate 6 (4) (1985) 361–367.
[20] M.E. Hernandez, A. Soto-Cid, G.E. Aranda-Abreu, R. Díaz, F. Rojas, L.I. Garcia, et al., A
study of the prostate, androgens and sexual activity of male rats, Reprod. Biol.
Endocrinol. 5 (2007) 1–9.
[21] A.G. Nasello, M.L.A. Vanzeler, E.H. Madureira, L.F. Felicio, Effects of acute and
long-term domperidone treatment on prolactin and gonadal hormone levels and
sexual behavior of male and female rats, Pharmacol. Biochem. Behav. 58 (4)
(1997) 1089–1094.
[22] M. Galdiero, R. Pivonello, L.F.S. Grasso, A. Cozzolino, A. Colao, Growth hormone,
prolactin, and sexuality, J. Endocrinol. Investig. 35 (8) (2012) 782–794.
[23] P.C. Doherty, M.J. Baum, R.B. Todd, Effects of chronic hyperprolactinemia on sexual
arousal and erectile function in male rats, Neuroendocrinology 42 (5) (1986)
368–375.
[24] F. Drago, C.O. Lissandrello, The “low-dose” concept and the paradoxical effects of
prolactin on grooming and sexual behavior, Eur. J. Pharmacol. 405 (1–3) (2000)
131–137.
[25] T.H.C. Krüger, P. Haake, J. Haverkamp, M. Krämer, M.S. Exton, B. Saller, et al., Effects
of acute prolactin manipulation on sexual drive and function in males, J. Endocrinol.
179 (3) (2003) 357–365.
[26] L.E. Tisell, K. Larsson, Unimpaired sexual behavior of male rats after complete
removal of the prostate and seminal vesicles, Investig. Urol. 16 (4) (1979) 274–275.
[27] P.H. Chow, K.W. Ng, S.F. Pang, Lack of effect of bilateral removal of accessory sex
glands on sexual behaviour in the male golden hamster (Mesocricetus auratus),
Physiol. Behav. 59 (2) (1996) 393–396.
[28] R. Diaz, L.I. Garcia, J. Locia, M. Silva, S. Rodriguez, C.A. Perez, et al., Histological
modifications of the rat prostate following transection of somatic and autonomic
nerves, An. Acad. Bras. Cienc. 82 (2) (2010) 397–404.
[29] Z.B. Redzic, J.E. Preston, J.A. Duncan, A. Chodobski, J. Szmydynger-Chodobska, The
choroid plexus-cerebrospinal fluid system: from development to aging, Curr. Top.
Dev. Biol. 71 (5) (2005) 1–52.
[30] H. Rosas-Hernandez, M. Ramirez, M.A. Ramirez-Lee, S.F. Ali, C. Gonzalez, Inhibition
of prolactin with bromocriptine for 28 days increases blood-brain barrier
permeability in the rat, Neuroscience 301 (2015) 61–70.
[31] H. Rosas-Hernandez, E. Cuevas, S.M. Lantz, W.R. Hamilton, M.A. Ramirez-Lee, S.F. Ali,
et al., Prolactin and blood-brain barrier permeability, Curr. Neurovasc. Res. 10 (4)
(2013) 278–286.
[32] J.J. Normandin, A.Z. Murphy, Nucleus paragigantocellularis afferents in male and
female rats: organization, gonadal steroid receptor expression, and activation
during sexual behavior, J. Comp. Neurol. 508 (5) (2008) 771–794.
[33] A. Montero, M.A. Fernandez, J.E. Cohen, M.R. Luraghi, L. Sen, Prolactin levels in the cere-
brospinal fluid of patients with HIV infection and AIDS, Neurol. Res. 20 (1) (1998) 2–4.
[34] M.I. Aleksandrova, N.S. Kushnareva, O.V. Smirnova, Prolactine receptor expression in
kidney tissue of female rats with cholestasis: the effect of hyperprolactinemia, Bull.
Exp. Biol. Med. 153 (4) (2012) 448–451.
[35] R. Shao, M. Nutu, B. Weijdegård, E. Egecioglu, J. Fernandez-Rodriguez, E. Tallet, et al.,
Differences in prolactin receptor (PRLR) in mouse and human fallopian tubes:
evidence for multiple regulatory mechanisms controlling PRLR isoform expression
in mice, Biol. Reprod. 79 (4) (2008) 748–757.
[36] J. Halperin, S.Y. Devi, S. Elizur, C. Stocco, A. Shehu, D. Rebourcet, et al., Prolactin
signaling through the short form of its receptor represses forkhead transcription
factor FOXO3 and its target gene galt causing a severe ovarian defect, Mol.
Endocrinol. 22 (2) (2008) 513–522.
[37] H. Maeda, S.I. Izumi, Y. Kato, L.Y. Cai, T. Kato, T. Suzuki, et al., Gene expression of
lymphocyte prolactin receptor was suppressed in lactating mothers, Tokai J. Exp.
Clin. Med. 35 (2) (2010) 62–65.
[38] N. Matter, M. Marx, S. Weg-Remers, H. Ponta, P. Herrlich, H. König, Heterogeneous
ribonucleoprotein A1 is part of an exon-specific splice-silencing complex controlled
by oncogenic signaling pathways, J. Biol. Chem. 275 (45) (2000) 35353–35360.
[39] J.M. Bowen, C.M. Telleria, R. Towns, P.L. Keyes, Downregulation of long-form
prolactin receptor mRNA during prolactin-induced luteal regression, Eur. J.
Endocrinol. 143 (2) (2000) 285–292.
[40] Y.S. Devi, A. Shehu, J. Halperin, C. Stocco, J. Le, A.M. Seibold, et al., Prolactin signaling
through the short isoform of the mouse prolactin receptor regulates DNA binding of
specific transcription factors, often with opposite effects in different reproductive
issues, Reprod. Biol. Endocrinol. 7 (2009) 87.
[41] E. Saunier, F. Dif, P.A. Kelly, M. Edery, Targeted expression of the dominant-negative
prolactin receptor in the mammary gland of transgenic mice results in impaired
lactation, Endocrinology 144 (6) (2003) 2669–2675.
[42] D. Tan, S. Tan, J. Zhang, P. Tang, J. Huang, W. Zhou, et al., Histone trimethylation of
the p53 Gene by expression of a constitutively active prolactin receptor in prostate
cancer cells, Chin. J. Physiol. 56 (5) (2013) 282–290.
[43] V.C. Amaral, G.A.R. Maciel, K.C. Carvalho, R.R. Marcondes, J.M. Soares, E.C. Baracat,
Metoclopramide-induced hyperprolactinemia effects on the pituitary and uterine
prolactin receptor expression, Gen. Comp. Endocrinol. 189 (2013) 105–110.
[44] H.N. Jabbour, P.A. Kelly, Prolactin receptor subtypes: a possible mode of tissue
specific regulation of prolactin function, Rev. Reprod. 2 (1) (1997) 14–18.
[45] K.B. Reddy, S.M. Nabha, N. Atanaskova, Role of MAP kinase in tumor progression and
invasion, Cancer Metastasis Rev. 22 (4) (2003) 395–403.
[46] Y.L. Xie, S.A. Hassan, A.M. Qazi, C.H. Tsai-Morris, M.L. Dufau, Intramolecular disulfide
bonds of the prolactin receptor short form are required for its inhibitory action on
the function of the long form of the receptor, Mol. Cell. Biol. 29 (10) (2009)
2546–2555.
 L.I. Pascual-Mathey et al. / Physiology & Behavior 157 (2016) 170–177
[47] A. Dagvadorj, R.A. Kirken, B. Leiby, J. Karras, M.T. Nevalainen, Transcription factor
signal transducer and activator of transcription 5 promotes growth of human
prostate cancer cells in vivo, Clin. Cancer Res. 14 (5) (2008) 1317–1324.
[48] R. Buettner, L.B. Mora, R. Jove, Activated STAT signaling in human tumors provides
novel molecular targets for therapeutic intervention activated STAT signaling in
human tumors provides novel molecular targets for therapeutic intervention 1,
Clin. Cancer Res. 8 (4) (2002) 945–954.
[49] C.V. Clevenger, Roles and regulation of stat family transcription factors in human
breast cancer, Am. J. Pathol. 165 (5) (2004) 1449–1460.
[50] B.P. Ceresa, C.M. Horvath, J.E. Pessin, Signal transducer and activator of transcription-3
serine phosphorylation by insulin is mediated by a Ras/Raf/MEK-dependent pathway,
Endocrinology 138 (10) (1997) 4131–4137.
[51] A. Saha, J. Blando, E. Silver, L. Beltran, J. Sessler, J. DiGiovanni, 6-Shogaol from dried
ginger inhibits growth of prostate cancer cells both in vitro and in vivo through
inhibition of STAT3 and NF-κB signaling, Cancer Prev. Res. 7 (6) (2014) 627–638.
[52] C.L. Chen, F.C. Hsieh, J.C. Lieblein, J. Brown, C. Chan, J.A. Wallace, et al., Stat3
activation in human endometrial and cervical cancers, Br. J. Cancer 96 (4) (2007)
591–599.
177
[53] M. Kieslinger, I. Woldman, R. Moriggl, J. Hofmann, J.C. Marine, J.N. Ihle, et al.,
Antiapoptotic activity of Stat5 required during terminal stages of myeloid differen-
tiation, Genes Dev. 14 (2) (2000) 232–244.
[54] J.S. Park, J.K. Kwon, H.R. Kim, H.J. Kim, B.S. Kim, J.Y. Jung, Farnesol induces apoptosis
of DU145 prostate cancer cells through the PI3K/Akt and MAPK pathways, Int. J. Mol.
Med. 33 (5) (2014) 1169–1176.
[55] S. Druillennec, C. Dorard, A. Eychène, Alternative splicing in oncogenic kinases: from
physiological functions to cancer, J. Nucleic Acids 2012 (2012) 1–14.
[56] D. Herrera-Covarrubias, G.A. Coria-Avila, P. Chavarría Xicoténcatl, C. Fernández-
Pomares, J. Manzo, G.E. Aranda-Abreu, M.E. Hernandez, Long-term administration of
prolactin or testosterone induced similar precancerous prostate lesions in rats, Exp.
Oncol. 37 (1) (2015) 13–18.
[57] P.P. Provenzano, D.R. Inman, K.W. Eliceiri, P.J. Keely, Matrix density-induced
mechanoregulation of breast cell phenotype, signaling and gene expression through
a FAK-ERK linkage, Oncogene 28 (49) (2009) 4326–4343.