BIOENGINEERED

2022, VOL. 13, NO. 1, 206–216

https://doi.org/10.1080/21655979.2021.2012906

RESEARCH PAPER

C1q/tumor necrosis factor related protein 6 (CTRP6) regulates the phenotypes of

high glucose-induced gestational trophoblast cells via peroxisome proliferator-
activated receptor gamma (PPARγ) signaling
Jin Zhang and Wen-Pei Bai
Department of Obstetrics and Gynaecology, Beijing Shijitan Hospital, Capital Medical University, Beijing, P.R. China

ABSTRACT ARTICLE HISTORY

Multiple studies have confirmed that adipokines are compactly relevant to insulin resistance and Received 26 October 2021
participate in the pathogenesis of gestational diabetes mellitus (GDM). This paper aimed to study Revised 26 November 2021
the effects of C1q/tumor necrosis factor related protein (CTRP)6 on the phenotypes of trophoblast Accepted 27 November
2021
cells, covering cell proliferation, invasion and migration, and initially explore the mechanism. High
glucose was used to induce trophoblast cells to establish an in vitro model. The expression levels KEYWORDS
of CTRP6 were firstly determined, and then the effects of CTRP6 knockdown on cell viability, CTRP6; gestational
apoptosis, migration and invasion were assessed using CCK8, TUNEL, wound healing, Transwell trophoblast cells; PPARγ;
assays. Moreover, the role of peroxisome proliferator-activated receptor gamma (PPARγ), probable gestational diabetes
target of CTRP6, was evaluated through co-transfection with PPARγ overexpression vector. The mellitus; high glucose
results of the present study revealed that CTRP6 and PPARγ were both upregulated in high
glucose-induced cells. And CTRP6 knockdown could significantly elevate the abilities of cell
viability, migration and invasion, and avoid cell apoptosis. In addition, PPARγ overexpression
was found to restrain the protective effects of CTRP6 knockdown on the above aspects, indicating
CTRP6 played a role in trophoblast cells via inhibiting PPARγ expression. In conclusion, CTRP6
regulated the viability, migration and invasion of high glucose-induced gestational trophoblast
cells through PPARγ signaling.

Introduction
Gestational diabetes mellitus (GDM) refers to nor­
mal glucose metabolism before pregnancy and
abnormal glucose tolerance first discovered during
pregnancy, which is one of the most familiar com­
plications of pregnancy [1]. It is manifested as
metabolic and endocrine disorders, including sig­
nificant changes in the body fluid environment,
such as alterations in the levels of adipokines and
inflammatory cytokines [2]. As the alterations in
the childbearing age, dietary patterns and lifestyles
of contemporary women, the morbidity of GDM is
increasing gradually [3]. After childbirth, the glu­
cose tolerance of most pregnant women with
GDM returned to normal, whereas a few would
develop type 2 diabetes [4]. Moreover, several stu­
dies have identified that, compared with healthy
pregnant women, the offspring of pregnant
women with GDM are at a relatively higher risk
of long-term complications such as obesity and
diabetes [5]. It is generally believed that the patho­
genesis of GDM is complex, which may be the
result of multiple factors such as inflammatory
factors, insulin resistance (IR), pancreatic β-cell
function defects, genetics and environment [6].
Recently, considerable studies have indicated that
some adipokines, such as leptin, adiponectin and
visfatin, are compactly relevant to IR and partici­
pate in the pathogenesis of GDM [2,7,8].
C1q/tumor necrosis factor related protein is
a newly discovered highly conserved adiponectin
family consisting of 15 members (CTRP1-
CTRP15) [9]. Therein, CTRP6 is widely expressed
in a variety of tissues and organs, including adi­
pose tissue, heart, brain and placenta [10]. It plays
different roles in different physiological or patho­
logical processes, and has been proven to be
involved in inflammation, diabetes, and cardiovas­
cular disease [11]. In addition, a previous study

CONTACT Wen-pei Bai baiwp@bjsjth.cn Department of Obstetrics and Gynecology, Beijing Shijitan Hospital, Capital Medical University, 10 Tieyi
Road, Haidian District, Beijing 100038, P.R. China
© 2021 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted
use, distribution, and reproduction in any medium, provided the original work is properly cited.
 BIOENGINEERED 207

revealed that CTRP6 could inhibit the prolifera­
tion, invasion and migration of squamous cell
carcinoma cells [12]. And another study deemed
that CTRP6 could inhibit the proliferation of vas­
cular smooth muscle cells induced by platelet-
derived growth factor-bb [13]. Furthermore,
knockout of CTRP6 was found to inhibit obesity
in mice caused by high-fat diet [14], particularly,
obesity has been generally considered to be inse­
parable from diabetic pregnancy-eclampsia [15].
The adverse environment in the body of mother
with GDM affects the fetus through the placenta,
and the material exchange between mother and
fetus principally occurs in the placental tropho­
blast [16]. It happens that CTRP6 is expressed in
the gestational trophoblast cells according to the
human protein atlas (HPA) website (https://www.
proteinatlas.org/), which is dedicated to providing
information on the tissue and cell distribution of
all 24,000 human proteins [17] (Figure 1a).
Therefore, this study put forward the hypothesis
that CTRP6 may play a role in GDM. High glucose
was used to induce trophoblast cells to establish an
in vitro model. This paper explored the effects of
CTRP6 on the cell phenotypes, covering cell pro­
liferation, invasion and migration and initially
explored the mechanism.
Methods
Cell culture and grouping
Human chorionic trophoblast cells (HTR-8/SVneo
cells) were obtained from American Type Culture
Collection (ATCC) and can be used for the study
of placental function and trophoblast biology [18].

Figure 1. (a) Expression levels of CTRP6 in different types of cells from the analysis result of HPA website. (b) Cell viability in each
group was assessed using a CCK-8 assay. Expression levels of CTRP6 in each group of cells were determined using (c) Western
blotting and (d) RT-qPCR. Expression levels of PPARγ were determined using (e) Western blotting and (f) RT-qPCR. *p < 0.05,
**P < 0.01, ***P < 0.001.
208 J. ZHANG AND W.-P. BAI
The cells grew adherently, and the culture condi­
tion was RPMI 1640 medium (5.5 mM glucose;
Gibco, Thermo Fisher Scientific, China): FBS:
penicillin/streptomycin with 100:10:1, and the
incubator was adjusted to 37°C, 5% CO2 condi­
tion. The cells were randomly divided into
a control group and high glucose groups, each
containing the final concentration of D-glucose:
the control group (5.5 mM); the high glucose
group (10, 20, 30 mM) [19].
Cell transfection and grouping
Cells were seeded in a six-well plate at a density of
3 × 105, and transfection was performed [20] when cell
density reached 50%~60% next day. CTRP6 knock­
down was performed with the pLKO.1-short hairpin
(sh)RNA lentiviral vector (shRNA-CTRP6-1/2),
whereas non-targeted shRNA was as the negative
control (shRNA-NC; Vectorbuilder Biotechnology,
Guangzhou, China). Target sequences of shRNAs
were as follows: shRNA-CTRP6-1, 5ʹ-GATGTGT
GAGATCCCTATGGT-3ʹ; shRNA-CTRP6-2, 5ʹ-
GCACTTCTCAAACTTGGAAAT-3ʹ; shRNA-NC,
5ʹ-CAACAAGATGAAGAGCACCAA-3ʹ Peroxiso
me proliferator-activated receptor gamma (PPARγ)
overexpression (Ov) was performed with
a pcDNA3.1 vector (Ov-PPARγ), whereas the empty
vector was set as the negative control (Ov-NC;
Fenghui Biotechnology, Hunan, China). Cells were
transfected with 10 nM shRNAs and pcDNAs using
Lipofectamine® 2000 reagent (Invitrogen; Thermo
Fisher Scientific, China) at 37°C, according to the
manufacturer’s protocol. Following 4–6 h of transfec­
tion, the wells were washed twice with PBS, and then
filled with RPMI-1640 medium containing 10% FBS
to continue the culture for 48 h. Afterward, the cells
were divided into a control group, high glucose group
(30 mM), and transfection groups.
CCK-8 assay
The cells were seeded in a 96-well plate at a density
of 3 × 103 cells/well. Following the culture main­
tained for 72 h, 10 µl of CCK-8 reagent (Beyotime
Biotechnology, Shanghai, China) was added, and
cells were continued to be incubated at 37°C for
1 h in the dark. The absorbance of each well at
a wavelength of 450 nm was measured using
a microplate reader (Molecular devices, Shanghai,
China) [21].
Reverse transcription-quantitative PCR (RT-qPCR)
Total RNA was extracted from cells using TRIzol®
(Invitrogen; Thermo Fisher Scientific, China) on ice
for 15 min. The purity of the RNA was evaluated
using a NanoDropTM One Spectrophotometer
(Thermo Fisher Scientific, China). Following reverse
transcription of RNA into cDNA product with
PrimeScript RT reagent kit (Takara Biotechnology,
Dalian, China), SYBR Green Realtime PCR Master
Mix kit (TOYOBO, Shanghai, China) was used
according to the manufacturer’s protocol for qPCR.
The thermocycling condition was as follows: Initial
denaturation at 95°C for 10 min, 40 cycles of dena­
turation at 95°C for 2 sec and annealing at 60°C for
20 sec, and extension at 70°C for 10 sec. The normal­
ization method was adopted with GADPH as the
internal reference, and 2−ΔΔCq method [22] was
used to perform relative quantification. The primers
(5ʹ-3ʹ) used are as follows: CTRP6, forward:
CCATCCTGAAAGGTGACAAAGG, reverse: AG
TAATGCGTCTGGCACGAG; PPARγ, forward:
AATGGAAGACCACTCCCACT, reverse: GGTA
CTCTTGAAGTTTCAGGTC; GAPDH, forward:
GGAGCGAGATCCCTCCAAAAT, reverse: GGCT
GTTGTCATACTTCTCATGG.
Western blot analysis
Protein was extracted from cells on ice with pre­
cooled RIPA lysis buffer (contains protease inhi­
bitors; Beyotime Biotechnology) for 10 min, and
then quantified using a BCA assay kit (Abcam,
Shanghai, China). Protein samples (30 µg/lane)
were separated by 10% SDS-PAGE at 120 V and
transferred to PVDF membranes (Millipore,
Thermo Fisher Scientific) at 280 mV for 90 min.
The membranes were first blocked with 5%
skimmed milk for 2 h at room temperature.
Afterward, they were incubated with diluted pri­
mary antibodies against CTRP6 (ab36898; 1:500),
PPARγ (ab178860; 1:1,000), Bcl2 (ab32124;
1:1,000), Bax (ab32503; 1:1,000), Cleaved caspase3
(ab32042; 1:500) and GAPDH (ab181602;
1:10,000) at 4°C overnight followed by HRP-
conjugated goat anti-rabbit IgG secondary

antibody (ab6721; 1:10,000; all Abcam) at room
temperature for 1 h. The chemiluminescence reac­
tion was performed using an ECL kit (Yeasen
BioTechnology, Shanghai, China), and densitome­
try was analyzed using the ImageJ software (v1.8;
National Institutes of Health) [23].
TUNEL assay
Cells were seeded into a 24-well plate at a density
of 2 × 105 cells/well and cultured until they
reached ~80% confluence. The operation was con­
ducted using the TUNEL kit (Beyotime
Biotechnology) according to the manufacturer’s
instructions. Following the cover glass was sealed,
the results were observed under a fluorescence
microscope (magnification, x200; Olympus
Corporation, Japan) [24].
Wound healing assay
Cells were seeded into a 6-well plate at a density of
5 × 105 cells/well until reaching ~80% confluence.
A gentle scrape on the well surface was performed
with a 200-µl pipette tip. The wells were washed
with PBS to remove free cells. Following culture in
serum-free RPMI-1640 medium at 37°C for 24 h,
images of the wound area were captured at 0/24 h
under an inverted microscope (magnification,
x100; Nikon Corporation, Japan) [25].
Transwell assay
The Matrigel (BD Biosciences) was taken out from
−20°C and melted on ice, and quickly diluted with
serum-free RPMI-1640 medium at a ratio of 1:4.
50 μl of the diluted Matrigel was added to the
upper chamber of the Transwell (Corning, Merck
KGaA, Germany) for dry at 37°C for 10 h. The
cells were resuspended in serum-free RPMI-1640,
and the cell density was adjusted to 4 × 104 cells/
ml. 100 µl cell suspension was added into the upper
chamber, and 500 µl RPMI-1640 containing 20%
FBS was added into lower chamber. Following incu­
bation at 37°C for 24 h, the non-invaded cells in the
upper chamber were gently wiped away with a wet
cotton swab. The cells on the submembrane surface
were fixed with 4% paraformaldehyde for 20 min
and stained with 0.1% crystal violet for 10 min at
BIOENGINEERED 209
room temperature. The results were observed under
an inverted microscope (magnification, x100; Nikon
Corporation) [26].
Statistical analysis
Each cellular experiment was repeated indepen­
dently at least three times. Data were presented
as the mean ± SD and processed using GraphPad
Prism 8.0 (GraphPad Software, San Diego, USA).
Data were in accordance with the normal distribu­
tion by Shapiro-Wilk test [27], and comparisons
were conducted using one-way ANOVA [28] fol­
lowed by Tukey’s post hoc test [29]. P < 0.05 was
considered to indicate a statistically significant
difference.
Results
In the present study, CTRP6 and PPARγ were
found to be upregulated in high glucose-induced
cells. And CTRP6 knockdown could significantly
elevate the abilities of cell viability, migration and
invasion, and avoid cell apoptosis. In addition,
PPARγ overexpression was found to restrain the
protective effects of CTRP6 knockdown on the
above aspects, indicating CTRP6 played a role in
trophoblast cells via inhibiting PPARγ signaling.
Expression levels of CTRP6 and PPARγ in high
glucose induced-trophoblast cells
CTRP6 was found to be expressed in gestation
trophoblast from the analysis result of HPA web­
site (Figure 1a). Human chorionic trophoblast cells
(HTR-8/SVneo cells) were firstly divided into the
control group and high glucose groups (10, 20,
30 mM). Cell viability in each group was assessed
using a CCK-8 assay. Following induction with
glucose, cell viability was found to be decreased
in a concentration-dependent manner (Figure 1b).
Next, the expression levels of CTRP6 in each
group of cells were determined using RT-qPCR
and Western blotting. The results revealed that
CTRP6 expression level was upregulated accom­
panied with the increased concentration of glucose
(Figure 1c-d). In addition, the expression levels of
PPARγ were also upregulated depending on the
elevated concentration of glucose (Figure 1e-f).
210 J. ZHANG AND W.-P. BAI

CTRP6 knockdown improves the viability, inva­
sion and migration of high glucose induced-
trophoblast cells
In order to explore the role of CTRP6 in high
glucose induced-trophoblast cells, its expression
was knocked down by transfection with shRNAs.
The expression levels of CTRP6 in the control and
the transfected cells were determined using RT-
qPCR and Western blotting. According to the
results, the expression level was lower in the
shRNA-CTRP6-1 group compared with the
shRNA-CTRP6-2 group (Figure 2a-b), hence,
these cells transfected with shRNA-CTRP6-1were
used for the subsequent assays. Afterward, cells
were divided into four groups: ) the control; )
high glucose (30 mM); ) high glucose (30 mM) +
shRNA-NC; ) high glucose (30 mM) + shRNA-
CTRP6. Cell viabilities of these groups of cells
were determined using the CCK8 assay, and the
results demonstrated that CTRP6 knockdown
could upregulate the viability of high glucose
induced-cells (Figure 2c). Meanwhile, cell apopto­
sis was determined using TUNEL assay and
Western blotting. The fluorescence intensity was
enhanced in the high glucose group compared
with the control group, and that was downregu­
lated in the CTRP6 knockdown group to a certain
extent (Figure 2d-e). In addition, the Western blot

Figure 2. Expression levels of CTRP6 in the control and the transfected cells were determined using (a) Western blotting and (b) RT-
qPCR. (c) Cell viability was determined using a CCK8 assay. Cell apoptosis was determined using (d–e) TUNEL assay and (f) Western
blotting, magnification, x200. *p < 0.05, **P < 0.01, ***P < 0.001.

result revealed that the expression levels of Bax
and cleaved caspase 3 were downregulated,
whereas Bcl2 expression was upregulated arisen
from CTRP6 knockdown (figure 2f). These indi­
cated that CTRP6 knockdown could protect the
aliveness of trophoblast cells from the injury
caused by high glucose.
Moreover, the abilities of cell migration and inva­
sion were assessed using wound healing and Transwell
assays. The result of wound healing assay displayed
that high glucose caused the inhibited cell migration
and CTRP6 knockdown promoted it (Figure 3a).
Coincidentally, CTRP6 knockdown likewise recov­
ered the inhibiting effect of high glucose on cell inva­
sion from the result of Transwell assay (Figure 3b). To
sum up, CTRP6 knockdown improved cell survival,
invasion and migration of trophoblast cells which
were subjected to high glucose.
CTRP6 knockdown inhibits PPARγ expression and
improves the viability, invasion and migration of high
glucose induced-trophoblast cells by inhibiting PPARγ
The expression levels of PPARγ in the four
groups of cells mentioned above were determined
using Western blotting. Its expression was upre­
gulated in high glucose group and downregulated
in the CTRP6 knockdown group, indicating insuf­
ficient CTRP6 expression may also cause a decline
in the expression of PPARγ (Figure 4a).
Figure 3. The ability of cell migration and invasion was assessed using (a) wound healing and (b) Transwell assay, magnification,
x100. ***P < 0.001.
BIOENGINEERED 211
Subsequently, PPARγ overexpression was estab­
lished by transfection, and the efficacy was verified
using RT-qPCR and Western blotting. The results
of these two assays both revealed that PPARγ was
highly expressed in the transfected cells
(Figure 4b-c). Following cells were divided into
five groups: ) the control; ) high glucose
(30 mM); ) high glucose (30 mM) + shRNA-
CTRP6; ) high glucose (30 mM) + shRNA-
CTRP6 + Ov-NC; ) high glucose (30 mM) +
shRNA-CTRP6 + Ov-PPARγ, cell viability was
determined in these five groups using the CCK8
assay. The result indicated that PPARγ overexpres­
sion downregulated high glucose-induced cell via­
bility, breaking the effect of CTRP6 knockdown on
the viability (Figure 4d). Furthermore, cell apop­
tosis was determined similarly as aforementioned.
Focusing on the results of the fifth group, PPARγ
overexpression significantly promoted cell apopto­
sis, which is equivalent to reversing the impact of
CTRP6 knockout on cell survival (Figure 4e-g).
Finally, cell migration and invasion was also
assessed using wound healing and Transwell
assay. The results suggested that PPARγ over­
expression could not only suppress cell migra­
tion but also inhibit the invasion (Figure 5a-d).
These results indicated that CTRP6 knockdown
improved the invasion and migration of high
212 J. ZHANG AND W.-P. BAI

Figure 4. (a) Expression levels of PPARγ in four groups of cells were determined using Western blotting. The efficacy of PPARγ overexpression
was verified using (b) RT-qPCR and (c) Western blotting. (d) Cell viability was determined in five groups using a CCK8 assay. Cell apoptosis was
determined using (e-f) TUNEL assay and (g) Western blotting, magnification, x200. *p < 0.05, **P < 0.01, ***P < 0.001.

glucose induced-trophoblast cells by inhibiting
PPARγ expression.
Discussion
GDM is a familiar perinatal comorbidity that influ­
ences maternal transformation, placenta formation
and fetal development. It is also one of the predictors
of long-term type 2 diabetes in pregnant women and
their offspring [5]. Those with severe GDM or poor
control of blood glucose may ultimately suffer from
some adverse pregnancy outcomes, such as hyper­
tension of pregnancy, premature delivery, stillbirth,
fetal development and giant babies [30]. Therefore,

Figure 5. The ability of cell migration and invasion was assessed using (a) wound healing and (b) Transwell assay, magnification,
x100. (c) Quantitative result of wound healing assay and (d) Transwell assay. *p < 0.05, ***P < 0.001.
reasonable control of the condition and blood glu­
cose can greatly reduce the impact on the health of
mothers and children. During pregnancy, the pla­
centa is a highly specific organ, it not only has the
functions of supplying nutrients to the fetus, exchan­
ging gas and removing metabolites, but also has
immune and endocrine functions [31]. The forma­
tion of placenta principally depends on the extra­
chorionic trophoblast to invade the membrane, and
trophoblast cells serve as the first barrier between the
mother and the fetus; its proliferation, differentia­
tion, invasion, and apoptosis are associated with the
normality of the placenta and the development of
fetus [32]. Moreover, based on the direct correlation
between trophoblast cells and the mother, the mater­
nal blood glucose alterations directly influence the
function of trophoblast cells. The trophoblast cells
are the first to be involved and undergo various
pathological changes to cope with the high glucose
stress environment [33,34].
BIOENGINEERED 213
Therefore, this study selected trophoblast cells
as a model to study the regulatory functions of
CTRP6. As aforementioned, the phenotype of
trophoblast cells is intimately relevant to fetal
development [32]. Therefore, following confirm­
ing that the expression level of CTRP6 was upre­
gulated in high glucose-induced cells, its effects
on cell proliferation, migration and invasion were
studied through silencing its expression. The
results demonstrated that CTRP6 knockdown
could maintain the viability of cells stimulated
by high glucose, inhibit their apoptosis, and alle­
viate the inhibitory effects of high glucose on cell
migration and invasion. Hence, these findings
indicate that inhibiting CTRP6 expression may
reduce the adverse effects on fetal development
under high glucose condition. A clinical report
revealed that compared with healthy individuals,
serum CTRP6 levels in obese individuals were
significantly upregulated. More importantly, the
214 J. ZHANG AND W.-P. BAI
receiver operating characteristic curve results sug­
gested that CTRP6 levels were associated with IR
[35]. In addition, a previous study found that
CTRP6 knockdown could suppress the inflamma­
tion, oxidative stress and extracellular matrix
accumulation in high glucose-induced glomerular
mesangial cells, which provides a basis for CTRP6
to be applied in the treatment of diabetic nephro­
pathy [36].
Furthermore, CTRP6 overexpression was reported
to activate the PPARγ signal to relieve hypertension
and vascular endothelial dysfunction in spontaneously
hypertensive rats [37]. And its knockdown was
deemed to inhibit fat production in 3T3-L1 adipocytes
through PPARγ signaling [38]. These indicated that
PPARγ might act as the downstream target of CTRP6.
Especially, a previous study revealed that PPARγ
expression was upregulated in GDM placental tissue
and trophoblast cells under high glucose environment
[39]. Herein, following the determination of upregu­
lated PPARγ expression level in high glucose-induced
trophoblast cells, the effects of PPARγ on cell pheno­
type were studied by urging it to overexpress. The
results in this study suggested that PPARγ overexpres­
sion reversed the influences of CTRP6 knockdown on
cell phenotype. In other words, PPARγ overexpres­
sion could suppress cell viability, migration and inva­
sion, and promote cell apoptosis, indicating CTRP6
play a role in altering the phenotype of high glucose-
induced trophoblast cells through regulating PPARγ
expression. This article proposes for the first time that
CTRP6 affects GDM through PPARγ signaling.
However, this study is limited to the cellular level,
clinical samples will be collected for in-depth research
in the future.
Conclusion
To sum up, the present study has found that
CTRP6 knockdown promotes the viability, inva­
sion and migration of high glucose induced-
trophoblast cells via inhibiting PPARγ expression.
The findings of the present study may promote
CTRP6 as a biomarker or therapeutic target for the
treatment of GDM.
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding
This study was supported by Beijing Haidian District health
development scientific research and cultivation plan
(HP2021-05-50602); Youth fund of Beijing Shijitan Hospital
Affiliated to Capital Medical University (2019-q20).
Availability of data and materials
The datasets used and/or analysed during the present study
are available from the corresponding author on reasonable
request.
Authors’ contributions
JZ and WB made contributions to content design and parti­
cipated in the experiments; JZ analyzed the data and draft the
manuscript; WB examined the data and critically revised the
manuscript for important intellectual content. Both of them
confirmed the authenticity of all the raw data and approved
the final manuscript.
References
[1] American College of Obstetricians and Gynecologists
Committee on Practice Bulletins. ACOG practice bul­
letin no. 190: gestational diabetes mellitus. Obstet
Gynecol. 2018 Feb;131(2):e49–e64.
[2] de Gennaro G, Palla G, Battini L, et al. The role of
adipokines in the pathogenesis of gestational diabetes
mellitus. Gynecol Endocrinol. 2019 Sep;35(9):737–751.
[3] Chiefari E, Arcidiacono B, Foti D, et al. Gestational
diabetes mellitus: an updated overview. J Endocrinol
Invest. 2017 Sep;40(9):899–909.
[4] Szmuilowicz ED, Josefson JL, Metzger BE. Gestational
diabetes mellitus. Endocrinol Metab Clin North Am.
2019 Sep;48(3):479–493.
[5] Johns EC, Denison FC, Norman JE, et al. Gestational
diabetes mellitus: mechanisms, treatment, and
complications. Trends Endocrinol Metab. 2018 Nov;29
(11):743–754.
[6] Plows JF, Stanley JL, Baker PN, et al. The pathophy­
siology of gestational diabetes mellitus. Int J Mol Sci.
2018 Oct 26;19(11):11.
[7] Pérez-Pérez A, Vilariño-García T, Guadix P, et al.
Leptin and nutrition in gestational diabetes.
Nutrients. 2020 Jul 2;12(7):1970.
[8] Radzicka S, Pietryga M, Iciek R, et al. The role of
visfatin in pathogenesis of gestational diabetes
(GDM). Ginekol Pol. 2018;89(9):518–521.
[9] Si Y, Fan W, Sun L. A review of the relationship
between CTRP family and coronary artery disease.
Curr Atheroscler Rep. 2020 May 28;22(6):22.
[10] Wong GW, Krawczyk SA, Kitidis-Mitrokostas C, et al.
Molecular, biochemical and functional characterizations

of C1q/TNF family members: adipose-tissue-selective
expression patterns, regulation by PPAR-gamma agonist,
cysteine-mediated oligomerizations, combinatorial asso­
ciations and metabolic functions. Biochem J. 2008 Dec
1;416(2):161–177.
[11] Sadeghi A, Fadaei R, Moradi N, et al. Circulating levels
of C1q/TNF-α-related protein 6 (CTRP6) in polycystic
ovary syndrome. IUBMB Life. 2020 Jul;72
(7):1449–1459.
[12] Hano K, Hatano K, Saigo C, et al. An adiponectin
paralog protein, CTRP6 decreased the proliferation
and invasion activity of oral squamous cell carci­
noma cells: possible interaction with laminin recep­
tor pathway. Mol Biol Rep. 2019 Oct;46
(5):4967–4973.
[13] Dong X, Hu H, Fang Z, et al. CTRP6 inhibits
PDGF-BB-induced vascular smooth muscle cell prolif­
eration and migration. Biomed Pharmacothe. 2018
Jul;103:844–850.
[14] Wu W, Zhang J, Zhao C, et al. Lentivirus-mediated
CTRP6 silencing ameliorates diet-induced obesity in
mice. Exp Cell Res. 2018 Jun 1;367(1):15–23.
[15] Yen IW, Lee CN, Lin MW, et al. Overweight and
obesity are associated with clustering of metabolic
risk factors in early pregnancy and the risk of GDM.
PloS One. 2019;14(12):e0225978.
[16] Knöfler M, Haider S, Saleh L, et al. Human placenta
and trophoblast development: key molecular mechan­
isms and model systems. Cell Mol Life Sci. 2019 Sep;76
(18):3479–3496.
[17] Thul PJ, Åkesson L, Wiking M, et al. A subcellular map
of the human proteome. Science (New York, NY). 2017
May 26;356(6340):6340.
[18] Msheik H, Azar J, El Sabeh M, et al. HTR-8/SVneo:
a model for epithelial to mesenchymal transition in the
human placenta. Placenta. 2020 Jan 15;90:90–97.
[19] Liu L, Zhang J, Liu Y. MicroRNA-1323 serves as
a biomarker in gestational diabetes mellitus and aggra­
vates high glucose-induced inhibition of trophoblast
cell viability by suppressing TP53INP1. Exp Ther
Med. 2021 Mar;21(3):230.
[20] Wang Q, Lu X, Li C, et al. Down-regulated long
non-coding RNA PVT1 contributes to gestational dia­
betes mellitus and preeclampsia via regulation of
human trophoblast cells. Biomed Pharmacothe. 2019
Dec;120:109501.
[21] Zhang L, Zhao F, Li C, et al. Hypomethylation of DNA
promoter upregulates ADAMTS7 and contributes to
HTR-8/SVneo and JEG-3 cells abnormalities in
pre-eclampsia. Placenta. 2020 Apr;93:26–33.
[22] Livak KJ, Schmittgen TD. Analysis of relative gene
expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method. Methods. 2001
Dec;25(4):402–408.
BIOENGINEERED 215
[23] Wang Y, Zhang L, Zhou X. Activation of Nrf2 signaling
protects hypoxia-induced HTR-8/SVneo cells against
ferroptosis. J Obstet Gynaecol Res. 2021 Nov;47
(11):3797–3806.
[24] Li J, Tong C, Xu P, et al. QSOX1 regulates trophoblas­
tic apoptosis in preeclampsia through hydrogen per­
oxide production. J Matern Fetal Neonatal Med. 2019
Nov;32(22):3708–3715.
[25] Zhang X, Li BY, Fu LJ, et al. Stomatin-like protein 2
(SLP2) regulates the proliferation and invasion of tro­
phoblast cells by modulating mitochondrial functions.
Placenta. 2020 Oct;100:13–23.
[26] Fang YN, Huang ZL, Li H, et al. Highly expressed
miR-182-5p can promote preeclampsia progression by
degrading RND3 and inhibiting HTR-8/SVneo cell
invasion. Eur Rev Med Pharmacol Sci. 2018 Oct;22
(20):6583–6590.
[27] Vetter TR. Fundamentals of research data and vari­
ables: the devil is in the details. Anesth Analg. 2017
Oct;125(4):1375–1380.
[28] Wei P, Ru D, Li X, et al. Exposure to environmental
bisphenol A inhibits HTR-8/SVneo cell migration and
invasion. J Biomed Res. 2020 Jun 30;34(5):369–378.
[29] Hazra A, Gogtay N. Biostatistics series module 3: com­
paring groups: numerical variables. Indian J Dermatol.
2016 May-Jun;61(3):251–260.
[30] Pan JP, Liang SS, Huang MY, et al. Obstetric and neonatal
outcomes after frozen-thawed embryos transfer with
laser-assisted hatching: a retrospective cohort study. Arch
Gynecol Obstet. 2021 Aug 14. DOI:10.1007/s00404-021-
06153-0.
[31] Rolfo A, Nuzzo AM, De Amicis R, et al. Fetal-maternal
exposure to endocrine disruptors: correlation with diet
intake and pregnancy outcomes. Nutrients. 2020 Jun
11;12(6). DOI:10.3390/nu12061744.
[32] West RC, Ming H, Logsdon DM, et al. Dynamics of
trophoblast differentiation in peri-implantation-stage
human embryos. Proc Natl Acad Sci U S A. 2019
Nov 5;116(45):22635–22644.
[33] Lorenzon AR, Moreli JB, de Macedo Melo R, et al.
Stromal cell-derived factor (SDF) 2 and the endoplasmic
reticulum stress response of trophoblast cells in gesta­
tional diabetes mellitus and in vitro hyperglycaemic
condition. Curr Vasc Pharmacol. 2021;19(2):201–209.
[34] Blundell C, Tess ER, Schanzer AS, et al.
A microphysiological model of the human placental
barrier. Lab Chip. 2016 Aug 2;16(16):3065–3073.
[35] Liao X, Liu S, Tang X, et al. Circulating CTRP6 levels are
increased in overweight or obese Chinese individuals and
associated with insulin resistance parameters: a pilot study.
Exp Clin Endocrinol Diabetes. 2021 Jul;129(7):535–541.
[36] Xu E, Yin C, Yi X, et al. Knockdown of CTRP6 inhibits
high glucose-induced oxidative stress, inflammation and
extracellular matrix accumulation in mesangial cells
216 J. ZHANG AND W.-P. BAI
through regulating the Akt/NF-κB pathway. Clin Exp
Pharmacol Physiol. 2020 Jul;47(7):1203–1211.
[37] Chi L, Hu X, Zhang W, et al. Adipokine CTRP6
improves PPARγ activation to alleviate angiotensin
II-induced hypertension and vascular endothelial
dysfunction in spontaneously hypertensive rats.
Biochem Biophys Res Commun. 2017 Jan 22;482
(4):727–734.
[38] Wu WJ, Mo DL, Zhao CZ, et al. Knockdown of CTRP6
inhibits adipogenesis via lipogenic marker genes and Erk1/
2 signalling pathway. Cell Biol Int. 2015 May;39
(5):554–562.
[39] Suwaki N, Masuyama H, Masumoto A, et al. Expression
and potential role of peroxisome proliferator-activated
receptor gamma in the placenta of diabetic pregnancy.
Placenta. 2007 Apr;28(4):315–323.