Pearson Ib Chemistry Text Book Answers

lOMoARcPSD|20595249
Pearson IB Chemistry Text book answers
Chemistry HL (International Baccalaureate Diploma Programme)
Studocu is not sponsored or endorsed by any college or university

Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com)
lOMoARcPSD|20595249
Answers
Chapter 1
Exercises
1 (a) CuCO3 → CuO + CO2 6 X has diffused more quickly, so it must be a

(b) 2Mg + O2 → 2MgO lighter gas. Its particles have greater velocity
than the particles of Y at the same temperature.
(c) H2SO4 + 2NaOH → Na2SO4 + 2H2O
(Note though that they will both have the same
(d) N2 + 3H2 → 2NH3 value for average kinetic energy.)
(e) CH4 + 2O2 → CO2 + 2H2O
7 From the kinetic molecular theory we would
2 (a) 2K + 2H2O → 2KOH + H2 expect a solid to be more dense than its liquid,
(b) C2H5OH + 3O2 → 2CO2 + 3H2O and therefore that ice would sink in water.
(c) Cl2 + 2KI → 2KCl + I2 8 Bubbles will be present through the volume
(d) 4CrO3 → 2Cr2O3 + 3O2 of the liquid. A brown gas is visible above the
(e) Fe2O3 + 3C → 3CO + 2Fe brown liquid. As the two states are at the same
temperature, the particles have the same average
3 (a) 2C4H10 + 13O2 → 8CO2 + 10H2O kinetic energy and are moving at the same
(b) 4NH3 + 5O2 → 4NO + 6H2O speed. The inter-particle distances in the gas are
(c) 3Cu + 8HNO3 → 3Cu(NO3)2 + 2NO + 4H2O significantly larger than those in the liquid.
(d) 6H2O2 + 2N2H4 → 2N2 + 10H2O + O2 9 At certain conditions of low temperature and low
(e) 4C2H7N + 15O2 → 8CO2 + 14H2O + 2N2 humidity, snow changes directly to water vapour
by sublimation, without going through the liquid
4 (a) Sand and water: heterogeneous
phase.
(b) Smoke: heterogeneous
10 Steam will condense on the skin, releasing energy
(c) Sugar and water: homogeneous
as it forms liquid at the same temperature (E–D
(d) Salt and iron filings: heterogeneous on Figure 1.4). This is additional to the energy
(e) Ethanol and water: homogeneous released when both the boiling water and the
(f) Steel: homogeneous condensed steam cool on the surface of the skin.
5 (a) 2KNO3(s) → 2KNO2(s) + O2(g) 11 B

(b) CaCO3(s) + H2SO4(aq) → CaSO4(s) + CO2(g) 12 AW 01_EX_12
+ H2O(l)
(c) 2Li(s) + 2H2O(l) → 2LiOH(aq) + H2(g)
(d) Pb(NO3)2(aq) + 2NaCl(aq) → PbCl2(s) +
2NaNO3(aq)
(e) 2C3H6(g) + 9O2(g) → 6CO2(g) + 6H2O(l)
In the answers, exercises and text there is
inconsistency about whether the water formed
in combustion reactions is gas or liquid. At room
temperature it will ultimately finish up as a liquid,
as shown here.
Z08_CHE_SB_IBDIP_9755_ANS.indd 2 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

lOMoARcPSD|20595249
13 These calculations have used L = 6.02 × 1023 This is the same as the number of moles of
(a) 7.22 × 10 22
(b) 3.01 × 1024 carbon atoms used.
(c) 1.20 × 1023 Therefore the number of carbon atoms used =

moles of chalk × (6.02 × 1023 mol–1) =
14 0.53 mol H
6.02 × 1023 y
15 0.250 mol 100.09
16 (a) 262.87 g mol−1 (b) 176.14 g mol−1 36 (a) 2.50 mol (b) 5.63 mol
(c) 164.10 g mol−1 (d) 248.22 g mol−1 (c) 665.5 g
17 189.1 g 37 (a) 2C4H10 + 13O2 → 8CO2 + 10H2O
18 1.5 mol (b) 1.59 g
19 0.0074 mol Cl− 38 4.355 kg
20 1.83 × 1024 C atoms 39 (a) CaCO3 → CaO + CO2

(b) 92.8%
21 171 g (integer value because no calculator)
(c) CaCO3 is the only source of CO2; all the
22 10.0 g H2O CaCO3 undergoes complete decomposition;
23 2.0 mol N2 > 3.0 mol NH3 > 25.0 mol H2 > all CO2 released is captured; heating does
1.0 mol N2H4 not cause any change in the mass of the
other minerals present.
24 (a) CH (b) CH2O
40 (a) 85.2 g (b) 1.3 g H2
(c) C12H22O11 (d) C4H9
(e) C4H7 (f) CH2O 41 5.23 g C2H4Cl2
25 Na2S2O3 42 253.2 g theoretical CaSO3; 77.9%
26 CoSO4.7H2O 43 3.16 g ester
27 C17H25N 44 107 g of C6H6 needed
28 NH3 45 (a) 2.40 mol (b) 0.0110 mol

(c) 44 mol
29 6.94 Li
46 (a) 35.65 dm3 (b) 5.7 dm3
30 CdS
47 0.652 dm3
31 empirical formula CH; molecular formula C6H6
48 0.138 mol Br2 and 0.156 mol Cl2, so more
32 empirical formula H2PO3; molecular formula H4P2O6
molecules of Cl2
33 C10H16N5P3O13 for both empirical and molecular
49 0.113 dm3
formulas
50 0.28 dm3
34 C3H8O
51 90 kPa
35 Let y = mass of chalk in grams.
mass used 52 16 °C
moles of chalk used = ×
Mr(CaCO3)
53 3.0 dm3
yg
y
100.09 g mol–1 54 2.8 dm3

lOMoARcPSD|20595249
Answers
55 M = 133 g mol−1 so gas is Xe 73 52% NH3 by mass; assuming no side reactions

occur and gases behave as ideal gases
56 90.4 g mol−1
74 3.20 × 105 kg
57 Helium
75 0.225 mol dm−3 (or round to 0.23 mol dm−3)
58 311 dm3
YP
76 [Na2CO3] = mol dm−3
59 empirical formula and molecular formula = SO3 X
Y(Q − P)
60 At higher altitude the external pressure is less. [NaHCO3] = mol dm−3
X
As the air in the tyre expands on heating (due
77 100 mol O2; 3.2 kg
to friction with the road surface), the internal
pressure increases.
61 (a) Particles are in constant random motion and

collide with each other and with the walls of
Challenge yourself
the container in perfectly elastic collisions.
The kinetic energy of the particles increases 1 In cold climates, temperature may approach
with temperature. There are no inter-particle or go below the boiling point of butane so the
forces and the volume of the particles is butane stays liquid even when it is released
negligible relative to the volume of the gas. from the pressure it is under when stored in its
canister. This makes it ineffective as a fuel.
(b) At low temperature, the particles have lower
kinetic energy, which favours the formation 2 FeCl3.6H2O, CuSO4.5H2O, Co(NO3)2.6H2O
of inter-particle forces and reduces gas
3 N = 18%, P = 22%, K = 17%
PV
pressure. <1
nRT 4 Many reactions with ‘useless’ by-products could
have high stoichiometric yield under optimum
62 NH3 shows greater deviation than CH4 due to
conditions, but low atom economy, for example,
stronger intermolecular attractions, especially at
methanoic acid production:
low temperature.
2NaCOOH + H2SO4 → 2HCOOH + Na2SO4
63 B
For 100% conversion with stoichiometric
64 2.81 g
reactants, the yield = 100%.
65 4.93 g 2 × 46.03
atom economy = × 100% =
66 0.0100 mol (2 × 68.01) + 98.08
39%
67 0.400 mol dm−3
5 2NaN3(s) → 2Na(s) + 3N2(g)
3
68 3.1 cm 10Na(s) + 2KNO3(s) → K2O(s) + 5Na2O(s) + N2(g)
69 0.178 mol dm−3 K2O(s) + Na2O(s) + SiO2(s) → Na2K2SiO4 (alkaline
silicate glass)
70 0.0220 mol dm−3, 0.0802% HCl
6 As NaOH dissolves, the separated Na+ and OH−
−3 −3
71 0.106 mol dm Na2SO4 and 0.115 mol dm ions become hydrated, i.e. they are surrounded
Pb(NO3)2; assume no side reactions, all PbSO4 by H2O molecules. This involves breaking the
precipitates hydrogen bonds between the H2O molecules
72 1217 tonne in pure water and allows closer packing, which
reduces the volume.

lOMoARcPSD|20595249
Practice questions ( (
(b) (1.75)
35.45
143.32 ) )
= 0.433 g (Cl) and
1 D 2 D 3 B 4 C
(( )
0.433
0.535 )
(100) = 80.9% (Cl) [1]
Allow whole numbers for molar masses.

5 A 6 B 7 D 8 D
9 D 10 D 11 A 12 C
(c) ( 18.3
12.01 )
= 1.52 mol C and
13 D 14 C 15 D 16 A ( 0.77
1.01 )
= 0.76 mol H and
17 (a) temperature: 4
mass: 3
( 80.9
35.45 )
= 2.28 mol Cl
Allow whole numbers for atomic masses.

pressure: 3 [1]
Empirical formula = C2HCl3;
(b) 0.0650 kg = 65.0 g
Award [2] for correct empirical formula
65.0
n= = 1.00 (mol) [1] without working.
65.02
No penalty for using whole number atomic Mr = (24.02 + 1.01 + 106.35) = 131.38
masses. so molecular formula is C2HCl3 [3]
3 Award [3] for correct final answer without
(c) n(N2) = × 1.00 = 1.50 (mol)
2 working.
T = 25.00 + 273.15 = 298.15 K or 25.00 +
Allow whole numbers for atomic masses.
273 = 298 K
P = 1.08 × 1.01 × 105 Pa or 1.08 × 1.01 × 19 NH3/ammonia in excess, by 10 dm3 [1]
102 kPa or 1.09 × 105 Pa or 1.09 × 102 kPa
volume of N2 produced = 25.0 dm3 [2]
−1 −1
R = 8.31 J K mol (from IB Data booklet)
20 (a) n(HCl) = 0.200 mol dm−3 × 0.02720 dm3 =
Use PV = nRT (from IB Data booklet)
0.00544 or 5.44 × 10−3 (mol) [1]
nRT 1.50 × 8.31 × 298.15
V= = = (b) n(HCl) excess is 0.100 mol dm−3 × 0.02380
P 1.08 × 1.01 × 105
0.034.1 m3 = 34.1 dm3 [4] dm3 = 0.00238 or 2.38 × 10−3 mol [1]
Award [4] for correct final answer. Penalize not dividing by 1000 once only in (a)
Award [3] (max) for 0.0341 dm or 22.7 dm . 3 3 and (b).
Award [3] (max) for 34.4 dm3. (c) n(HCl) reacted = 0.00544 – 0.00238 =
0.00306 or 3.06 × 10−3 (mol) [1]
Award [2] (max) for 22.9 dm3.
(d) 2HCl(aq) + CaCO3(s) → CaCl2(aq) + H2O(l) +
CO2(g) or
2H+(aq) + CaCO3(s) → Ca2+(aq) + H2O(l) +
18 (a) ((
2 × 1.01
18.02 )
(0.089) = 1.0 × 10−2 g H and) CO2(g) [2]
((
12.01
44.01 )
(0.872) = 2.38 × 10−1 g C ) Award [1] for correct reactants and
products.
((
0.238
1.30 )
(100) = 18.3% C ) Award [1] if the equation is correctly
balanced.
(
1.0 × 10−2
1.30 )
(100) = 0.77% H [3] Award [1] (max) for the following equations:
Award [3] for correct final answer of 2HCl(aq) + CaCO3(s) → CaCl2(aq) +

18.3% C and 0.77% H without working. H2CO3(aq)
Allow whole numbers for molar masses. 2H+(aq) + CaCO(s) → Ca2+(aq) + HCO(aq)
5

lOMoARcPSD|20595249
Answers
Ignore state symbols. (g) only CaCO3 reacts with acid or impurities are
(e) n(CaCO3) = 1 n(HCl) 1
= × 0.00306 inert or non-basic or impurities do not react
2 2
with the acid or nothing else in the eggshell
= 0.00153 or 1.53 × 10−3 mol [2]
reacts with acid or no other carbonates. [1]
Award [2] for correct final answer.
Do not accept ‘all calcium carbonate reacts
(f) Mr(CaCO3) = 40.08 + 12.01 + 3 × 16.00 = with acid’.
100.09 or 100.1 g mol−1
21 NaCl 61.96%, CaCl2 38.04%
Accept 100.
m(CaCO3) = n × M = 0.00153 mol × 22 (a) 0.115 mol H2O
100.09 g mol−1 = 0.153 g (b) 0.0574 mol K2CO3
0.153 (c) K2CO3.2H2O
%CaCO3 = × 100 = 81.4% or
0.188
81.5% [3] (d) Heat to constant mass – when further
heating does not lead to further decrease in
Ignore state symbols.
mass.
Accept answers in the range 79.8% to
81.5%. 23 (a) NH3 is in excess
Award [3] for correct final answer. (b) HCl is limiting
(c) 1.64 g ammonium chloride forms
Chapter 2
Exercises
1 Examples are density (related to mass) or, for 4 electrons

neutrons
Species
protons
gases, rate of diffusion.

No. of
No. of
No. of
2 Tellurium has a greater proportion of heavier

isotopes (with more neutrons). 40
Ca2+ 20 20 18
40
3 (a) Ar 18 22 18
electrons
18
neutrons
Species
protons
39 +
(b) K 19 20 18
No. of
No. of
No. of
19
35
(c) 17
Cl– 17 18 18
(a) 7
Li 3 4 3 5 C
1
(b) H 1 0 1
electrons
neutrons
Species
protons
14
(c) C 6 8 6
No. of
No. of
No. of
19 −
(d) F 9 10 10
56 3+
(e) Fe 26 30 23
2
A 1H 1 1 1
11
B 5 B 5 6 5
16
C 8 O2− 8 8 10
19 −
D 9 F 9 10 10
6 B 7 B

lOMoARcPSD|20595249
8 Let x atoms be 20Ne atoms. The remaining 16 Sub-level 4s 4p 4d 4f

atoms are 22Ne.
No. of orbitals 1 3 5 7
number of 22Ne atoms = 100 – x
17 1s22s22p63s23p64s2
total mass = 20 × x + (100 – x) × 22 = 2200 – 2x
2200 – 2x 18 1s22s22px22py22pz23s23px13py13pz1, so three
average mass =
100 unpaired electrons
From the Periodic Table we see that the relative
atomic mass of neon = 20.18 19 C 20 C
2200 – 2x 21 (a) V is 1s22s22p63s23p63d34s2
20.18 =
100
(b) K is 1s22s22p63s23p64s1
2018 = 2200 – 2x
(c) Se is 1s22s22p63s23p63d104s24p4
2x = 2200 – 2018 = 182
(d) Sr is 1s22s22p63s23p63d104s24p65s2
x = 91; abundance 20Ne = 91%
22 D 23 B 24 B
9 probability of 35Cl = 34 probability of 37Cl = 14
probability of 35Cl–35Cl (M = 70) = 34 × 34 = 16
9
= 25 (a) O2− is 1s22s22p6
56.25% (b) Cl− is 1s22s22p63s23p6
probability of 35Cl–37Cl/37Cl–35Cl (M = 72) = 2 × 34 (c) Ti3+ 1s22s22p63s23p63d1
× 14 = 16
6
= 37.5% (d) Cu2+ is 1s22s22p63s23p63d9
37 37 1 1 1
probability of Cl– Cl (M = 74) = × = 4 4 16 =
6.25% 26 Ion 3d 4s
60
(a) Ti2+
56.25
relative abundance/%
50
(b) Fe2+
40 37.5
30 (c) Ni2+
20
(d) Zn2+
10 6.25
0 27 (a) Ne is 1s22s22p6
70 71 72 73 74 75
mass charge (b) Negatively charged ions would be F−, O2− or
N3−; positively charged ions would be Na+,
10 Let the abundance of 25Mg be x. Consider 100
Mg2+ or Al3+.
atoms.
(78.90 × 24) + (x × 25) + 28 (a) Cl is 1s22s22p63s23p5
(100 − 78.90 − x) × 26
24.31 = (b) Nb is 1s22s22p63s23p63d104s24p64d35s2
100
= 1893.6 + 25x + 2600 – 2051.4 – 26x (c) Ge is 1s22s22p63s23p63d104s24p2
= 2442.2 – x (d) Sb is 1s22s22p63s23p63d104s24p64d105s25p3
x = 11.20 29 (a) Si (b) Mn (c) Sr (d) Sc
25
Mg 11.20% and 26Mg 9.90%
30 11 31 20 32 [Kr]4d10
11 B 12 C 13 A 14 A
33 B 34 B
15 4s < 4p < 4d < 4f
35 (a) C has the electronic configuration 1s22s22p2.
The 4th electron is removed from a 2s
orbital, the 5th electron from the 1s

lOMoARcPSD|20595249
Answers
orbital. Electrons in 1s orbitals are closer was explained in 1905 by Albert Einstein. He
to the nucleus and experience a stronger realized that the pollen was being jostled by
electrostatic force of attraction. something even smaller; water molecules.
(b) The 2nd electron is removed from a 2p Einstein didn’t just base this theory on his
orbital, the 3rd electron from the 2s orbital. observations – he used complex mathematics
Electrons in 2s orbitals are closer to the to show that an atomic model could explain
nucleus and so experience a stronger Brownian motion.
electrostatic force of attraction. 2 Potash, soda, magnesia and barytes are
36 compounds of Group 1 and 2 elements. These
compounds were later broken down into their
component elements by electrolysis.
ionization energy
3 The Schrödinger model:

● does not have well-defined orbits for the
electrons
● does not treat the electron as a localized
particle but gives a probability wave
1 2 3 4 5 6 7
description
ionization number
● predicts the relative intensities of various
37 (a) The ionization energy rises from Na to Ar
spectral lines.
because the charge of the nucleus increases
but the number of inner ‘shielding’ electrons 4 (a) [Rn]7s25f146d7
remains the same. The increase in effective (b) The first g block element would be
nuclear charge makes it progressively more [Rn]7s25f146d107p6 8s28g1
difficult to remove an outer shell electron. Z = 86 + 2 + 14 + 10 + 6 +2 +1 = 121
(b) Mg has the electron configuration [Ne]3s2,
5 1s22s22p63s23p64s23d104p65s24d105p66s24f145d10
Al has the electron configuration [Ne]3s23p1.
6p65f4
The 3p electron, removed from Al, has more
energy and is further away from the nucleus 6 (a) There would be two types of p orbital and
than the 3s electron removed from Mg. two types of d orbitals.
(c) P has the configuration [Ne]3s23p1x3p1y3p1z, (b) Four groups in the p and d blocks.
S has the configuration [Ne]3s23p2x3p1y3p1z.
7 1290 kJ mol−1
The electron removed from S comes from a
doubly occupied 3p orbital, which is repelled 8 The convergence limit corresponds to the
by its partner and is easier to remove than transition n = 2 to n = ∞. To obtain the ionization
the electron removed from P which comes energy, we have to add the energy which
from a half-filled orbital. corresponds to the n = 2 to n = 1 transition. This
is the first line in the Lyman series.
I.E. = 1310 kJ mol−1
Challenge yourself
1 In 1827 Robert Brown dropped grains of

pollen into water and examined them under a
microscope. The pollen moved around erratically
in the water. This so-called ‘Brownian motion’
8

lOMoARcPSD|20595249
(b) 27 protons and 25 electrons [1]

Practice questions 2 2 6 2 6 7
(c) 1s 2s 2p 3s 3p 3d or [Ar] 3d 7
[1]
14 B
1 D 2 A 3 A 4 B
15 1s22s22p63s1 [1]
5 D 6 A 7 C 8 B
Do not accept [Ne]3s1
9 B 10 D
First electron easy/easiest to remove or 1
(54 × 5.95) + (56 × 91.88) + (57 × 2.17)
11 = 55.90 [2] electron in outermost/n = 3 energy level/furthest
100
from nucleus. [1]
Large increase between 1st and 2nd I.E. as
Answer must be to 2 d.p.
electron now removed from n = 2. [1]
12 (a) the electron configuration (of argon) or Next eight electrons slightly more difficult to
1s22s22p63s23p6 [1] remove or show (relatively) small increase as
(b) x = 1 and y = 5 [1] these electrons are in the same energy level/
second energy level/n = 2. [1]
(c) [1]
Large increase between 9th and 10th I.E. as
4s 3d electron now removed from n = 1 or last two
Accept all six arrows pointing down rather than electrons very hard/most difficult to remove or
up. innermost/lowest/closest to the nucleus/energy
level (OWTTE). [1]
13 (a) Cobalt has a greater proportion of heavier
Electron 11 also comes from 1s, so shows a
isotopes (OWTTE) or cobalt has a larger
small increase. [1]
number of neutrons. [1]
max [4]
Chapter 3
Exercises
1 Element Period Group 4 C 5 B 6 C

(a) helium 1 18 7 (a) Half the distance between the nuclei of
(b) chlorine 3 17 neighbouring atoms of the same element.
(c) barium 6 2 (b) (i) The noble gases do not form stable
(d) francium 7 1 ions and engage in ionic bonding so
the distance between neighbouring ions
2 (a) Periods are rows and groups are columns.
cannot be defined.
(b) 1s22s22p63s23p3
(ii) The atomic radii decrease from Na to
The valence energy level is the third principal
Cl. This is because the number of inner,
energy level, so the element is in period 3. It
shielding, electron is is constant (10)
has the 3p3 configuration, so it is in the third
but the nuclear charge increases from
group of the p block, which is Group 15.
+11 to +17. As we go from Na to Cl, the
3 Element 51 is antimony (Sb), which is in Group increasing effective nuclear charge pulls
15. Its valence electrons are 5s25p3, and so it the outer electrons closer.
has five valence electrons.
9

lOMoARcPSD|20595249
Answers
8 Si4+ has an electronic configuration of 1s22s22p6 32
(a) State under
conditions
where Si4– has an electronic configuration of
standard
1s22s22p63s23p6. Si4+ has two occupied energy
levels and Si4− has three and so Si4− is larger.
9 A 10 B 11 C 12 D
(b) Structure and bonding
13 (a) The electron in the outer electron energy MgO (s) giant structure ionic bonding;
level (level 4) is removed to form K+. The net strong attraction between
attractive force increases as the electrons in oppositely charged ions
the third energy level experience a greater SiO2 (s) giant structure covalent
effective nuclear charge. (quartz) bonding;
(b) P3− has electronic configuration of strong covalent bonds
1s22s22p63s23p6 whereas Si4+ has an throughout structure
electronic configuration of 1s22s22p2. P3– has P4O10 (s) molecular, covalent bonding;
one more principal energy level than Si4+ so weak van der Waals’ forces
between molecules;
its valence electrons will be further from the
P4O10 is larger molecule and
nucleus and it will have a larger ionic radius.
so has stronger London
(c) The ions have the same electron dispersion forces and a higher
configuration, 1s22s22p63s23p6: both have melting point than SO2
two complete shells; the extra protons in Na+ SO2 (g) molecular, covalent bonding;
attract the electrons more strongly. weak van der Waals’ forces
between molecules;
14 Phosphorus exists as molecules with four atoms:
SO2 is smaller molecule
P4. Sulfur exists as molecules with eight atoms:
and so has weaker London
S8. There are stronger London dispersion forces
dispersion forces and a higher
between the larger S8 molecules as there are melting point than P4O10
more electrons.
(c) Oxide pH of Equations
15 D 16 C 17 Cl− > Cl > Cl+
solution
18 B 19 C 20 D 21 B MgO alkaline MgO(s) +H2O(l) →
Mg(OH)2(aq)
22 Sodium floats on the surface; it melts into a
sphere; there is fizzing/effervescence/bubbles; SiO2 neutral – oxide
(quartz) is insoluble
sound is produced; solution gets hot; white
smoke is produced. P4O10 acidic P4O10(s) + 6H2O(l)
→ 4H3PO4(aq)
2Na(s) + 2H2O(l) → 2NaOH(aq) + H2(g) SO2 acidic SO2(l) + H2O(l) →
23 D H2SO3(aq)
(d) (i) Al2O3(s) + 6HCl(aq) → 2AlCl3(aq) + 3H2O(l)
24 The reactivities of the alkali metals increase but
those of the halogens decrease. (ii) Al2O3(s) + 2NaOH(aq) + 3H2O(l) →
2NaAl(OH)4(aq)
25 C 26 D 27 D 28 A
33 The oxides of Na and Mg are basic; the oxide of
29 A 30 B 31 D Al is amphoteric; the oxides of Si to Cl are acidic.
Ar forms no oxide.
Na2O + H2O → 2NaOH
SO3 + H2O → H2SO4
10

lOMoARcPSD|20595249
34 3d 4s 46 (a) Ni (b) V2O5

(c) Pt or Pd
Sc3+
47 (a) Homogeneous catalysts are in the
Ti3+
same state of matter as the reactants;
Ni2+ heterogeneous catalysts are in a different
state from the reactants.
Zn2+
(b) They provide a surface for the reactant
35 D 36 B 37 D molecules to come together with the correct
orientation.
38 (a) 1s22s22p63s23p63d104s2
(b) 1s22s22p63s23p63d10 (c) They can be easily removed by filtration from
the reaction mixture and re-used.
(c) The element does not form ions with partially
filled d orbitals. 48 D 49 D
39 Calcium has one oxidation state: +2 (typical of 50 Chromium has the electron configuration
Group 2). Chromium has common oxidation states [Ar]3d54s1; it has six unpaired electrons, which is
of +2, +3 and +6. Calcium(II) and chromium(VI) the maximum number for the series. Zn has the
have noble gas electron configurations, which [Ar]3d10 configuration with no unpaired electrons.
are typically stable. However, the extremely high
51 In a complex the d sub-level splits into two
charge density of chromium(VI) makes it unstable
energy levels due to the presence of the ligand’s
and other oxidation states are more common. The
lone pair of electrons. The energy difference
chromium(II) oxidation state has lost its outer 4s
between the two sets of d orbitals depends
electron and one 3d electron. Chromium(III) forms
on the oxidation state of the central metal, the
when the atom loses its 4s electron and two 3d
number of ligands and the identity of the ligand.
electrons.
Electron transitions between d orbitals result
40 C 41 C 42 D 43 C from the absorption of energy from the visible
region of the electromagnetic spectrum. The
44 (a) Zn
wavelength (colour) of light absorbed depends
(b) (i) Fe3O4: +2.67 on the size of the splitting between the two sets
(ii) MnO4−: +7 of d orbitals.
(iii) CrO42−: +6
As the two complexes both contain a cobat ion
(iv) [FeCN6]4−: +2 in the +2 oxidation state the difference in colour
45 (a) +2 is due to the identity of the ligands (H2O vs Cl–1)
and the coordination number (6 in [Co(H2O)6]2+
(b) The N atoms adopt a square planar
and 4 in [CoCl4]2–), which changes from H2O to
arrangement.
Cl–.
(c) The planar structure allows oxygen molecules
easy access to the iron ion, which can accept 52 (a) difference in nuclear charge of metal (ion)
a lone pair of electrons from an oxygen (b) difference in oxidation number
moledule and form a coordinate bond. This (c) difference in ligand
bond is not strong, so it the process is easily
reversible. This allows the complex to absorb 53 Fe2+ has configuration [Ar]3d6 and Zn2+ is
oxygen where oxygen is in high concentrations [Ar]3d10. Colour in transition metal complexes
(i.e. in the lungs) but release oxygen in tissues is due to the splitting of the d subshell into two
with low oxygen concentrations. sets of d orbitals with different energy levels;
11

lOMoARcPSD|20595249
Answers
the absorption of visible light results in electrons

being excited from the lower energy set to the Challenge yourself
higher energy set and the colour observed is
complementary to the colour (wavelength) of 1 Ytterbium, yttrium, terbium, erbium
light absorbed. Light can only be absorbed if
the d orbitals are partially filled and the higher 2 Two liquids, 11 gases
energy set has an empty or partially filled orbital 3 ‘Metalloid’ refers to the properties of certain
that can accept an electron from the lower elements in relation to the periodic table.
energy set. Fe2+ has partially filled d orbitals and ‘Semiconductor’ refers to the physical properties
so electronic transitions can occur from the of materials (including alloys, compounds). There
lower energy set to the higher energy set with is a partial overlap between the two sets.
the absorption of visible light and it appears
colour in solution. In Zn2+ all of the d orbitals are 4 1s22s22p63s23p64s23d104p65s24d105p64f76s2 or
fully occupied so an electronic transition cannot [Xe]4f76s2
occur from the lower energy set to the higher 5 The entropy change is positive as there are more
energy set so it is unable to absorb visible light particles on the right-hand side.
and Zn2+ is not coloured in solution.
6 The broad absorption spectrum of the complex
Fe2+ not in its highest oxidation state and so can ions should be contrasted with the sharp lines
be oxidized by removal of d electron; Zn2+ in its of atomic spectra (discussed in Chapter 2). Both
highest oxidation state and so can’t be oxidized phenomena are due to electronic transitions,
(and so can’t act as reducing agent). but the spectrum of a complex ion is affected
54 λmax= 525 nm. The colour absorbed is green; the by the surrounding ligands as the complex ion
colour transmitted is red. also has vibrational and rotational energy levels.
This allows the complex ion to absorb a wider
55 (a) [Ar] 3d6 range of frequencies due to the large number
of vibrational and rotational excited states also
(b) The splitting would be greater for [Fe(CN)6]4−. available. Because the absorption of complex
56 (a) [Fe(H2O)6]3+ is yellow and [Cr(H2O)6]3+ ions is measured in solution, interactions with the
is green; the colours they show are solvent further increase the number of energy
complementary to the colours of light they levels present in the complex ion and the number
absorb; colour is caused by transitions of associated frequencies it can absorb, resulting
between the two sets of d orbitals in the in the broad absorption bands observed.
complex; the different metals in the two The isolated gaseous ions do not have
complexes cause the d orbitals to split vibrational or rotational energy levels available to
differently as they have different nuclear them and will only absorb energy of the exact
charges and this results in different wavelength required to move an electron from a
wavelengths (colours) of light being lower energy to a higher energy atomic orbital,
absorbed. generating discrete line spectra.
(b) The oxidation state of the central ion is
different in the two complexes and this
affects the size of the d orbital splitting Practice questions
due to the different number of electrons
present in d orbitals. Fe2+ has the electron
1 C 2 A 3 B 4 B
configuration [Ar]3d6 and Fe3+ has the
electron configuration [Ar]3d5. 5 A 6 B 7 D 8 C
12

lOMoARcPSD|20595249
9 D 10 D 11 C 12 C 17 (a) Na: 11 p, 11/2.8.1 e− and Na+: 11 p, 10/2.8

e− OR Na+ has 2 shells/energy levels, Na has
13 (a) the amount of energy required to remove
3 / OWTTE [1]
one (mole of) electron(s) [1]
Na+ has greater net positive charge/same
from (one mole of) an atom(s) in the
number of protons pulling smaller number
gaseous state [1]
of electrons [1]
(b) greater positive charge on nucleus / greater
(b) Si4+: 10 e− in 2 (filled) energy levels / electron
number of protons / greater core charge [1]
arrangement 2.8 / OWTTE [1]
greater attraction by Mg nucleus for
P3−: 18 e− in 3 (filled) energy levels / electron
electrons (in the same shell) / smaller
arrangement 2.8.8, thus larger / OWTTE [1]
atomic radius [1]
OR Si4+ has 2 energy levels whereas P3−
14 Na2O(s) + H2O(l) → 2NaOH(aq) [1] has 3 / P3− has one more (filled) energy
SO3(l) + H2O(l) → H2SO4(aq) [1] level [1]
4+ − 3− − 4+
State symbols are not needed. Si has 10 e whereas P has 18 e / Si
Na2O is basic and SO3 is acidic [1] has fewer electrons / P3+ has more
electrons [1]
15 (a) solution becomes yellow/orange/brown/
darker [1] 18 (a) in the solid state ions are in fixed positions /
there are no moveable ions / OWTTE [1]
chlorine is more reactive than iodine (and
displaces it from solution) / OWTTE [1] Do not accept answer that refers to atoms
or molecules.
Allow correct equation Cl2(g) + 2KI(aq) →
2KCl(aq) + I2(s) for second mark or stating (b) 2O2− → O2 + 4e− / O2− → 12O2 + 2e− [1]
−
that iodine/I2 is formed. Accept e instead of e .
(b) no colour change / nothing happens as (c) (i) basic [1]
fluorine is more reactive than chlorine / Allow alkaline.
OWTTE [1]
(ii) Na2O + H2O → 2NaOH / Na2O +
16 (a) atomic number / Z [1] H2O → 2Na+ + 2OH− [1]
Accept nuclear charge / number of protons. Do not accept
(b) Across period 3: increasing number of 19 (a) first ionization energy: M(g) → M+(g) + e−/e
protons / atomic number / Z / nuclear OR the (minimum) energy (in kJ mol−1) to
charge [1] remove one electron from a gaseous atom
(atomic) radius/size decreases / same shell/ OR the energy required to remove one mole
energy level / similar shielding/screening of electrons from one mole of gaseous
(from inner electrons) [1] atoms [1]
No mark for shielding/screening or shielding/ periodicity: repeating pattern of (physical
screening increases. and chemical) properties [1]
Noble gases: do not form bonds (easily) / (b) 2.8.8 [1]
have a full/stable octet/shell/energy level / Two of: the outer energy level/shell is full;
cannot attract more electrons [1] the increased charge on the nucleus;
Do not accept ‘inert’ or ‘unreactive’ without great(est) attraction for electrons [2]
reference to limited ability/inability to form (c) 17 p in Cl nucleus attract the outer level
bonds or attract electrons. more than 11 p in Na nucleus / greater
nuclear charge attracts outer level more [1]
13

lOMoARcPSD|20595249
Answers
Allow converse for Na. Do not accept ‘has (c) +2 [1]

larger nucleus’. Only penalize once if roman numerals are used
2−
(d) S has one proton less/smaller nuclear or if written as 2+ or 3+.
charge so outer level held less strongly /
23 (a) [Fe(CN)6]4− +2 [1]
OWTTE [1]
−
(b) [FeCl4] +3 [1]
Allow converse for chloride. Do not accept
‘has larger nucleus’. Award [1 max] if answers given as 2+ and 3+,
2 and 3 or II and III.
(e) the radii of the metal atoms increase (from
Li → Cs) (so the forces of attraction are less 24 electron transitions between (split, partially
between them) / OWTTE [1] filled) d orbitals [1]
the forces of attraction between halogen absorption depends on energy difference
molecules are van der Waals forces [1] between the split d orbitals [1]
these forces increase with increasing mass/ water molecules replaced by ammonia
number of electrons [1] molecules [1]
20 (a) complex (ion) / the charge is delocalized ammonia (ligands) increase the splitting
over all that is contained in the brackets [1] between the d orbitals/larger energy
difference [1]
(b) colour is due to energy being absorbed
when electrons are promoted within the absorption moves to shorter wavelength/higher
split d orbitals OR the colour observed is frequency/towards blue end of spectrum [1]
the complementary colour to the energy [max 3]
absorbed / OWTTE [1] 25 (a)
Accept either answer for the first mark.
changing the ligand / coordination number /
geometry [1]
changes the amount the d orbitals are split/
energy difference between the d orbitals /
OWTTE [1]
21 NH3 is a Lewis base and Cu2+ is a Lewis acid [1] [1]
each NH3/ligand donates an electron pair (b) splitting increases/greater [1]

(to Cu2+) [1] NH3 has greater electron/charge density /
NH3 replace H2O ligands around Cu2+ ion/ NH3 higher in spectrochemical series /
around central ion [1] NH3 stronger base [1]
forming coordinate (covalent)/dative covalent Allow converse argument for H2O. Do not award
bond [1] second mark for stating that NH3 is a stronger
[max 3] ligand or has a smaller size. If ‘decreases’ is
given for the first part of the answer then no
22 (a) +2 [1]
mark can be scored in the second part.
(b) +3 [1]
14

lOMoARcPSD|20595249
Chapter 4
Exercises
δ δ δ δ δ
1 lead nitrate, Pb(NO3)2 12 (a) H Br (b) O C O
δ δ
barium hydroxide, Ba(OH)2 (c) Cl F (d) O O
δ δ δ
potassium hydrogencarbonate, KHCO3 (e) H N H
magnesium carbonate, MgCO3
δ
copper sulfate, CuSO4 H
calcium phosphate, Ca3(PO4)2 13 (a) C 2.6 H 2.2 difference = 0.4
ammonium chloride, NH4Cl C 2.6 Cl 3.2 difference = 0.6, more polar
2 (a) KBr (b) ZnO (b) Si 1.9 Li 1.0 difference = 0.9
(c) Na2SO4 (d) CuBr2 Si 1.9 Cl 3.2 difference = 1.3, more polar
(e) Cr2(SO4)3 (f) AlH3 (c) N 3.0 Cl 3.2 difference = 0.2
N 3.0 Mg 1.3 difference = 1.7, more polar
3 (a) tin(II) phosphate
(b) titanium(IV) sulfate F
(c) manganese(II) hydrogencarbonate 14 (a) H F (b) F C F
Cl
(d) barium sulfate
(e) mercury sulfide H H Cl
4 (a) Sn2+ (b) Ti4+ (c) H C C H (d) Cl P Cl
H H
(c) Mn2+ (d) Ba2+
H H
(e) Hg+
(e) H C C H (f) H C C H
5 A3B2
15 (a) 16 (b) 24
6 Mg 12: electron configuration [Ne]3s2 (c) 32 (d) 8
Br 35: electron configuration [Ar]3d104s24p5 (e) 20 (f) 26
The magnesium atom loses its two electrons +
H H
from the 3s orbital to form Mg2+. Two bromine
16 H+ O H H O H
atoms each gain one electron into their 4p sub- O
shell to form Br −. The ions attract each other by +
17 (a) O N O (b) N O
electrostatic forces and form a lattice with the

empirical formula MgBr2.
(c) O N O (d) O O O
7 B 8 D
2
9 Test the melting point: ionic solids have high O H H
melting points. (e) O S O (f) N N
O H H
Test the solubility: ionic compounds usually
dissolve in water but not in hexane.
18 (a) 105° bond angle, shape is bent
Test the conductivity: ionic compounds in
(b) 109.5° bond angle, shape is tetrahedral
aqueous solution are good conductors.
(c) 180° bond angle, shape is linear
10 D 11 C
15

lOMoARcPSD|20595249
Answers
(d) 107° bond angle, shape is trigonal pyramidal (c) London (dispersion) forces
(e) 120° bond angle, triangular planar (d) dipole–dipole, London (dispersion) forces
(f) 107° bond angle, trigonal pyramidal 30 (a) C2H6 (b) H2S
(g) 105° bond angle, shape is bent (c) Cl2 (d) HCl
19 (a) 120° bond angle, shape is trigonal planar 31 B
(b) 120° bond angle, shape is trigonal planar
32 (a) malleability, thermal conductivity, thermal
(c) 180° bond angle, shape is linear stability
(d) 120° bond angle, shape is bent (b) light, strong, forms alloys
(e) 105° bond angle, shape is bent (c) thermal conductivity, thermal stability, non-
(f) 107° bond angle, shape is trigonal pyramidal corrosive
20 (a) 4 (b) 3 or 4 (d) light, strong, non-corrosive
(c) 2 (d) 4 33 (i) anodizing: increasing the thickness of the
(e) 3 surface oxide layer helps resist corrosion
(ii) alloying: mixing Al with other metals such as
21 (a) polar (b) non-polar
Mg and Cu increases hardness and strength
(c) polar (d) non-polar
(e) non-polar (f) polar 34 (a) linear, 180°
(g) non-polar (h) non-polar (b) triangular pyramidal, 107°
(i) non-polar (c) bent, 105°
(d) tetrahedral, 109.5°
22 cis isomer has a net dipole moment
(e) octahedral, 90°
23 CH3OH < CO32− < CO2 < CO (f) seesaw, 117°
−
24 NO3 has three resonance structures, HNO3 has 35 (a) 6 (b) 6
two resonance structures; N–O bonds shorter in
(c) 6 (d) 5
HNO3
(e) 2 or 5
25 Similarities: strong, high melting points, insoluble
36 (a) 90° (b) 107°
in water, non-conductors of electricity, good
thermal conductors. (c) 90°
Differences: diamond is stronger and more lustrous; 37 (a) polar (b) polar
silicon can be doped to be an electrical conductor. (c) non-polar (d) polar
26 Graphite and graphene have delocalized (e) non-polar (f) non-polar
electrons that are mobile and so conduct 38 (a) polar (b) non-polar
electrical charge. In diamond all electrons are
(c) non-polar (d) non-polar
held in covalent bonds and are not mobile.
(e) non-polar (f) polar
27 A metal B giant molecular
39 In BF3 all the atoms have formal charge of 0.
C polar molecular D non-polar molecular
B: FC = 3 – 3 = 0
E ionic compound
each F: FC = 7 – (1 + 6) = 0
28 A
Zero formal charge represents the most stable,
29 (a) London (dispersion) forces preferred structure, so this is favoured despite
(b) H bonds, dipole–dipole, London (dispersion) violating the octet rule by having fewer than 8
forces electrons around Be.
16

lOMoARcPSD|20595249
40 (i) S: FC = 6 – 4 = +2 each O: FC = 6 – (1 + 6) angles of 109.5° give the puckered shape.

= –1 In C6H6 (benzene) the carbon atoms are all
2 sp2 hybridized, forming a planar triangular
O arrangement with bond angles of 120°.
O S O
O
(ii) S: FC = 6 – 6 = 0 each O: FC = 6 – (1 + 6)
Challenge yourself
= –1 each O: FC = 6 – (2 + 4) = 0
2 1 Aluminium oxide is less ionic than MgO due to a
O smaller difference in electronegativity. It has some
O S O partially covalent character, which means the
O comparison with more ionic oxides is not fully valid.
2 F2 has lower bond enthalpy than expected from
The structure with 12 electrons round the S atom
its atomic radius due to repulsion. The bond
has FC = 0 and so is the preferred structure.
length is so short that the lone pairs in the two
41 O–O bonds in O3 are weaker than in O2, due to atoms repel each other, weakening the bond.
lower bond order, therefore dissociation occurs
3 when bonded to F, e.g. in OF2
with lower energy light (longer wavelength).
4 Run each solution out from separate burettes,
42 O3 breakdown is catalyzed by NOx and CFCs in
and see whether the stream of liquid is deflected
the atmosphere, e.g.
in the presence of a charged rod. Only the polar
CCl2F2(g) → CClF2•(g) + Cl•(g)
solution will show deflection.
CFCs break down in upper atmosphere.
Test solubility with ionic and covalent solutes.
Cl•(g) + O3(g) → O2(g) + ClO•(g)
The polar solution will be a better solvent for
Chlorine radical reacts with ozone and another polar/ionic solutes; the non-polar solution for
radical is produced. covalent/non-polar solutes.
ClO•(g) + O•(g) → O2(g) + Cl•(g)
5 The high thermal conductivity of diamond is
Chlorine radical is regenerated and so acts as a because of its strong covalent bonds. When
catalyst for ozone destruction. heated the bonds becoming vibrationally excited,
43 Electrons in a sigma bond are most and as they are all connected heat energy could
concentrated in the bond axis, the region be readily transferred through the network from
between the nuclei. Electrons in a pi bond are one bond to the next. Silicon is similarly a good
concentrated in two regions, above and below thermal conductor – which is why computer
the plane of the bond axis. chips need to be cooled.
44 (b) H–F in HF (c) Cl–Cl in Cl2 6 Diamonds are kinetically stable with respect
(d) C–H in CH4 (e) C–H in C2H4 to graphite, as the conversion has a very high
(f) C–H in C2H2 (g) C–Cl in C2H3Cl activation energy (see Chapter 6). So the reaction
generally occurs too slowly to be observed.
45 (a) sp2 (b) sp3
7 It is difficult to know the number of valence
(c) sp2 (d) sp
electrons a transition metal has. Treating bonds
(e) sp2
from ligands as pure covalent molecules results
46 In C6H12 (cyclohexane) the carbon atoms are in transition metals in complex ions with large
sp3 hybridized, each forming a tetrahedral negative formal charges. The formal charge
arrangement with two neighbouring carbon model may not be useful for complex ions, as
atoms and two hydrogen atoms. The bond the values obtained do not make much sense.
17

lOMoARcPSD|20595249
Answers
8 In the polar winter small amounts of water vapour 5 B 6 A 7 B 8 D

freeze into ice crystals in the atmosphere, which
9 C 10 A 11 B 12 C
provide a reactive surface. Reactions on the crystals’
surfaces produce species such as Cl2• which later 13 D 14 B 15 A
dissociate into Cl•, which breaks down ozone.
16 Hydrogen bonding in butan-1-ol; stronger than
dipole–dipole attractions in butanal. [2]
Practice questions Accept converse argument. Do not penalize
‘dipole–dipole bonding’ instead of ‘dipole–
1 C 2 A 3 A 4 A dipole attractions’.
17 (a) PBr3 SF6

(i) Lewis structure: (i) Lewis structure:
Br P Br F
F F
Br S
F F
Allow x’s, dots or lines to represent F
electrons.
Allow x’s, dots or lines to represent
Penalize missing lone pairs on terminal
electrons.
atoms once only for the two Lewis
structures. Penalize missing lone pairs on terminal
atoms once only for the two Lewis
structures.
(ii) Shape: (ii) Shape:
trigonal/triangular pyramidal octahedral
Bond angle: Bond angle:
less than 109.5° 90°
Allow any angle less than 109.5° Ignore extra correct bond angles (e.g.
but greater than or equal to 100° 90° and 180° scores but not 90° and
(experimental value is 101°). 120°).
(iii) Polarity: (iii) Polarity:
polar non-polar
and and
Explanation: Explanation:
net dipole (moment) / polar PBr bonds no net dipole (moment) / polar SF
and molecule not symmetrical/ bond bonds but molecule symmetrical/ bond
dipoles do not cancel / asymmetric dipoles cancel / symmetric distribution of
distribution of electron cloud / electron cloud / OWTTE
P Br
Br / OWTTE
Br
[8]
18

lOMoARcPSD|20595249
Do not allow ECF in this question from (iv) in cis two carboxylic acid groups close
incorrect Lewis structure. together so on heating cyclic anhydride
Allow [1] max for stating that PBr is polar forms (with elimination of water) /
and SF is non-polar without giving a reason OWTTE [1]
or if explanations are incorrect. Allow converse argument for trans.
Allow polar bonds do not cancel for PBr3 (c) O of OH sp3 and O of C=O sp2 [1]
and polar bonds cancel for SF6.
Oxygens must be identified.
Do not allow asymmetric molecule as reason
for PBr3 or symmetric molecule for SF6 as 18 (a) Award [2 max] for three of the following
reason alone. features:
(b) (i) σ bond: Bonding

end-on/axial overlap with electron density Graphite and C60 fullerene: covalent bonds
between the two carbon atoms/nuclei / and van der Waals’/London/dispersion forces
end-on/axial overlap of orbitals so shared Diamond: covalent bonds (and van der
electrons are between atoms / OWTTE Waals’/London/dispersion forces)
π bond: Delocalized electrons

sideways/parallel overlap of p orbitals Graphite and C60 fullerene: delocalized
with electron density above and below electrons
internuclear axis/σ bond / sideways/ Diamond: no delocalized electrons
parallel overlap of p orbitals so shared Structure
electrons are above and below Diamond: network/giant structure /
internuclear axis/σ bond / OWTTE [2] macromolecular / three-dimensional
Marks can be scored from a suitable structure and Graphite: layered structure /
diagram. two-dimensional structure / planar
Award [1 max] for stating end-on/axial C60 fullerene: consists of molecules / spheres
overlap for σ and sideways/parallel made of atoms arranged in hexagons/
overlap for π only i.e. without mentioning pentagons
electron density OR stating electron
Bond angles
density between the two atoms/nuclei
Graphite: 120° and Diamond: 109°
for σ and above and below internuclear
C60 fullerene: bond angles between 109–120°
axis for π.
p Allow Graphite: sp2 and Diamond: sp3.
p Allow C60 fullerene: sp2 and sp3.
H C C H
s Number of atoms each carbon is bonded to
p
p Graphite and C60 fullerene: each C atom
attached to 3 others
(ii) 11 σ and 3 π [1]
Diamond: each C atom attached to 4
(iii) (strong) intermolecular hydrogen bonding
atoms / tetrahedral arrangement of C
in trans but (strong) intramolecular
(atoms) [6 max]
hydrogen bonding in cis so attraction
(b) (i) network/giant structure / macromolecular
between different molecules is less
(hence lower melting point) [1] each Si bonded covalently to 4 oxygen
atoms and each O atom bonded
Allow between molecules for
covalently to 2 Si atoms / single
intermolecular and within molecules for
covalent bonds [2]
intramolecular.
19

lOMoARcPSD|20595249
Answers
Award [1 max] for answers such as Ethanol contains a hydrogen atom bonded
network-covalent, giant-covalent or directly to an electronegative oxygen atom /
macromolecular-covalent. hydrogen bonding can occur between two
Both M1 and M2 can be scored by a ethanol molecules / intermolecular hydrogen
suitable diagram. bonding in ethanol; the forces of attraction
between molecules are stronger in ethanol
(ii) Silicon dioxide: strong/covalent bonds
than in methoxymethane / hydrogen bonding
in network/giant structure/macromolecule
stronger than van der Waals’/dipole-dipole
Carbon dioxide: weak/van der Waals’/ attractions. max [3]
dispersion/London forces between
Award [2] max if covalent bonds breaking during
molecules [2]
boiling is mentioned in the answer.
(c) triple (covalent) bond Penalize only once if no reference given to
one electron pair donated by oxygen to intermolecular nature of hydrogen bonding or
carbon atom / dative (covalent)/coordinate van der Waals.
(covalent) bond [2]
20 (a) (bond formed by) sideways overlap of p
Award [1 max] for representation of C≡O.
orbitals. [2]
Award [2] if CO shown with dative covalent 3 2
(b) C1 is sp and C2 is sp . [1]
bond.
21 Lewis structure Name of shape
(d) <Note: need the answer to part 18(d) of this
question> S
F F
S
bent/angular/V
SF2 F F
shaped
2 lone pairs on S
required for the
mark
F
(e) <Note: need the answer to part 18(e) of this F
question> S
F Seesaw/
SF4 F distorted
tetrahedral
1 lone pair on S
required for the
mark
F
F F octahedral
SF6 S Accept square
F F bipyrimidal
19 Methoxymethane is very weakly polar/weak van F
[6]
der Waals’/dipole–dipole forces exist between
Penalise missing lone pairs on fluorine atoms
methoxymethane molecules.
once in correct structures only.
Accept alternatives to van der Waals’ such as
London and dispersion forces
20

lOMoARcPSD|20595249
For Lewis structures candidates are not 2

expected to draw exact shapes of molecules. 23 (a) (i) F
Do not allow ECF for wrong Lewis structures. F F
Si
22 (a) (i) Cl P Cl / Cl P Cl F F
Cl F
Cl
trigonal pyramid octahedral/octahedron/square
in the range of 100–108° [3] bipyramidal
90° / 90° and 180° [3]
(ii) N H / +
N H
(ii) O N O
H H
linear
Must include minus sign for the mark. 180° [3]
bent/V-shaped Allow dots, crosses or lines in Lewis
in the range of 100–106° [3] structures.
(iii) F F / F F Penalize missing charge, missing
Xe Xe bracket once only in (i) and (ii).
F F F F
Lone pairs required for BOTH (i) and (ii).
square planar
90° [3] (b) NO2:
Penalize once only if electron pairs are N
missed off outer atoms O O
(b) (i) sigma bonds are formed by end on/axial Award [1] for correct representation of the
overlap of orbitals with electron density bent shape and [1] for showing the net
between the two atoms/nuclei dipole moment, or explaining it in words
pi bonds are formed by sideways (unsymmetrical distribution of charge).
overlap of parallel p orbitals with electron
CO2:
density above and below internuclear
axis/σ bond [2] O C O
Accept suitably annotated diagrams
Award [1] for correct representation of the
(ii) 8 sigma/σ linear shape and for showing the two equal
1 pi/π [2] but opposite dipoles or explaining it in words
(iii) 109°/109.5° (symmetrical distribution of charge). [3]
120° [2] For both species, allow either arrow or

(iv) sp hybridization arrow with bar for representation of dipole
moment.
1 sigma and 2 pi
Allow correct partial charges instead of the
sigma bond formed by overlap between
representation of the vector dipole moment.
the two sp hybrid orbitals (on each
of the two carbon atoms) / pi bonds Ignore incorrect bonds.
formed by overlap between remaining Lone pairs not needed.
p orbitals (on each of the two carbon
(c) Structure:
atoms) / diagram showing 2 sp hybrid
network/giant lattice / macromolecular /
orbitals and 2 p orbitals [3]
repeating tetrahedral units
21

lOMoARcPSD|20595249
Answers
Bonding:
(single) covalent (bonds) [2]
It is not necessary to identify which part (iv) <Note need answers to Qu23 part (d)
refers to structure and bonding specifically. part (iv)]
(d) (i) methanamide
O H
H C N [2]
24 (a) (i) from left N = +1, N = –1, all others = 0 [1]
H (ii) from left C = +1, 2nd N = –1 [1]
(ii) mixing/joining together/combining/
formal charges show same differences
merging of atomic orbitals to form
but structure (i) will be more important
molecular/new orbitals / orbitals of equal
because C has stable octet [1]
energy [1]
(b) (i) from left O = –1, Cl = +1, O = –1 [1]
(iii) <Note need answers to Qu23 part (d)
(ii) O = –1, Cl = 0, O = 0 [1]
part (iii)
structure (ii) is preferred due to less
difference in formal charge [1]
Chapter 5
Exercises
9395.4 J
1 B 2 B ∆Hc =
6.11 × 10–3 mol
3 A = –1.54 × 106 J mol−1
4 D 5 C = –1540 kJ mol−1
q 100 (b)
6 q = mc∆T, so ∆T = = = 7.25 °C C6H12O6(s) + 6O2(s)
mc 100 × 0.138
T = 25.0 + 7.25 = 32.3 °C
∆H = –1540 kJ mol –1
H
7 A 8 A 9 C
10 (a) ΔT = 36.50 – 25.85 = 10.65 °C (or K)

6CO2(g) + 6H2O(l)
q = mc∆T
q = m(H2O) × c(H2O) × ∆T(H2O) + m(Cu) ×
c(Cu) × ∆T(Cu) Extent of reaction
= (200.00 g × 4.18 J g−1 K−1 × 10.65 K) +

(120.00 g × 0.385 J g−1 K−1 × 10.65 K)
11 q = mc∆T
= 8900 J + 492 J
q = 150.00 g × 4.18 J g−1 K−1 × (31.5 – 25.0) K
q = 9392 J
= 4075.5 J = 4100 J (to 2 s.f.)
1.10 g
n(C6H12O6) = 0.0500 g
180.18 g mol−1 n(P) =
30.97 g mol−1
= 6.11 × 10−3 mol
= 1.61 × 10−3 mol
22

lOMoARcPSD|20595249
– 4100 J equation q = mc∆T, where q is the heat change,

ΔHc =
1.61 × 10−3 mol m is the mass of the substance(s) changing
= – 2525 × 103 J mol−1 temperature, c is the specific heat capacity of
= – 2500 kJ mol−1 the substance(s) changing temperature and ∆T
The precision of the answer is limited by the is the measured temperature change occurring
precision of measurement of the temperature in the substance(s).
difference. The value is lower than the literature 16 A
value owing to heat losses and incomplete
combustion. 17 ΔH⊖ = –394 kJ – (–283) kJ = –111 kJ
12 q = mc∆T 18 ΔH⊖ = –180.5 kJ + (+66.4) = –114.1 kJ
= 1000 g × 4.18 J g−1 K−1 × (70.0 – 20.0) K 19 ∆H⊖ = (2 × (–33.2 kJ mol–1)) + (+9.16 kJ mol–1) =
= 209 kJ, for 1 mole of 1 mol dm−3 solution –57.24 kJ mol−1
∆H = –209 kJ mol−1 20 B 21 C 22 D 23 D
13 ∆T = 32.3 – 24.5 = 7.8 K 24 (a) 3C(graphite) + 3H2(g) + 12O2(g) → CH3COCH3(l)

q = m(H2O) × c(H2O) × ∆T(H2O) ΔH⊖f = –248 kJ mol−1
= 100.00 g × 4.18 J g−1 K−1 × 7.8 K (b) Under standard conditions of 298 K (25 °C)
= 3300 J and 1.00 × 105 Pa. If the reaction involvves
50.00 solutions these have a concentration of 1.00
n(NaOH) = × 0.950 = 0.0475 mol mol dm–3.
1000
–3300 J
∆H = = 68.6 × 103 J mol−1 25 +330 kJ mol−1
0.0475 mol
= –69 kJ mol−1 26 –57.2 kJ mol−1
Assumptions: no heat loss, c(solution) = c(water), 27 D
m(solution) = m(H2O), density(H2O) = 1.00
28 2MgO(s) + C(s) → CO2(g) + 2Mg(s)
14 If the mass of the solution is taken as 105.04 g
∆H⊖reaction = (–394) – 2(–601) = +810 kJ mol−1
(mass of water + mass of NH2Cl dissolved), ∆H
= +16.5 kJ mol–1. Such a highly endothermic reaction is unlikely to
be feasible.
If the mass of the solution is instead assumed to
be 100.00 g (mass of water only), ∆H = +15.7 kJ 29 B 30 A 31 C
mol–1. 32 1 × C–C + 6 × C–H
q = mc∆T
33 B
= 100.00 g × 4.18 J g−1 K−1 × (21.79 – 25.55)
34 –125 kJ mol−1
= –1571 J for 5.35 g
q = 293.6 J per g 35 –486 kJ mol−1
n(NH4Cl) = 53.50 g mol−1 36 B 37 C

−1 −1
∆H = 293.6 J g × 53.50 g mol 38 C2H5OH(l) + 3O2(g) → 2CO2(g) + 3H2O(g)
= 15.7 kJ mol−1 H H
15 ∆H is change in enthalpy, the heat content of a
system. Enthalpy cannot be measured directly H C C O H (l) + 3 × O=O(g) →
but enthalpy changes can be calculated for
chemical reactions and physical processes H H
from measured temperature changes using the 2 × O=C=O(g) + 3 × H–O–H(g)
23

lOMoARcPSD|20595249
Answers
Bonds ∆H / kJ Bonds ∆H / kJ X = 2ΔH⊖i (K), 2 × the first ionization energy of

broken mol−1 formed mol−1 potassium
C–C +346 4 C=O 4 × (–804) Y = ΔH⊖e1(O) + ΔH⊖e2(O), the sum of the first
3 O=O 3 × (+498) 6 H–O 6 × (–463) and second electron affinities of oxygen
O–H +463 Z = ΔH⊖f (K2O(s)), the standard enthalpy of
C–O +358 formation of K2O(s)
5 C–H 5 × (+414) (c) ΔH⊖latt(K2O) = 361 + 2(89.2) + 2(419) + 12(498)
Total +4731 –5994 + (–141) + 753
= +2238 kJ mol−1
ΔH⊖ = +4731 – 5994 kJ mol−1 = –1263 kJ mol−1
The calculated value is less exothermic than 46 B
the enthalpy of combustion in Table 13. This is 47 They decrease down Group 17 as the ionic
because the bond enthalpy calculation assumes radius of the halide ion increases.
all species are in the gaseous state: water and
ethanol are liquids. 48 Consider first the effect of increased ionic charge
(Na+/Mg2+ and Cl−/O2−). The charge of both the
39 (a) Step II, as bonds are formed. positive and negative ions is doubled. This leads
(b) O2 has a double bond. O3 has resonance to a quadrupled increase in the lattice energy.
structures/delocalization with bonding This effect is further enhanced by the decrease
intermediate between double and single in ionic radius of the Mg2+ compared to Na+ due
bonds; the bond order is 1.5. The bonding to the increased nuclear charge of the metal
in O2 is stronger therefore reaction I needs and the decreased ionic radius of the oxide ion
more energy. because of a decrease in the number of energy
levels occupied.
40 L × Ephoton = 498 kJ = 498 000 J
498 000 49 C 50 A
Ephoton = J (= 8.272 × 10−19 J)
6.02 × 1023
λ = hc/Ephoton 51 Bonding in AgBr is stronger because Ag+ has
6.02 × 1023 smaller ionic radius and more covalent character,
= 6.63 × 10−34 × 3.00 × 108 ×
498 000 which makes bonding stronger than that based
= 2.41 × 10−7 m on the ionic model.
= 241 nm 52 They have similar ionic radii but the enthalpy
Any radiation in the UV region with a wavelength of hydration of the F− ion is significantly more
shorter than 241 nm breaks the O=O bond in exothermic. This suggests that there is an
oxygen. additional interaction to the electrostatic
attraction between the charged ion and the polar
41 The oxygen double bond is stronger than the
molecules. F− ions form hydrogen bonds with the
1.5 bond in ozone. Thus, less energy is required
water.
to dissociate O3 than O2. Longer wavelength
radiation of lower energy is needed to dissociate 53 (a) ΔH⊖sol(KCl) = ΔH⊖lattice(KCl) + ΔH⊖hyd(K+) +
O3. ΔH⊖hyd(Cl–)
42 A 43 C 44 D = +720 – 340 – 359 kJ mol−1

= +21 kJ mol−1
45 (a) K2O(s) → 2K+(g) + O2−(g)
<std> (b) ΔH⊖sol(KCl) = +17.22 kJ mol−1 (from data
(b) W = ΔHatom (O), the enthalpy of atomization
booklet)
of oxygen (which also corresponds to
21 − 17.22
1
2 E(O=O), the O=O bond enthalpy)
% accuracy = × 100% = 22%
17.22
24

lOMoARcPSD|20595249
The large inaccuracy is based on the 67 (a) ∆H is positive as heat is needed to break up
calculated value being found by the the carbonate ion.
difference between two large values. (b) ∆S is positive as there is an increase in the
54 B 55 C 56 A 57 D amount of gas produced.
(c) At low temperature: ∆G = ∆H and so is
58 (a) ∆S is negative. The number of moles of gas
positive.
decreases from reactants to products.
At high temperature: ∆G = –T∆S and so is
(b) ∆S is negative. Three moles of solid and
negative.
four moles of gas change into one mole of
The reaction is not spontaneous at low
solid and four moles of gas. There is a small
temperature but becomes spontaneous at
decrease in disorder.
high temperatures.
(c) ∆S is positive. A solid reactant is being
converted into an aqueous solution so there 68 D 69 C
is a large increase in disorder.
70 ∆Greaction = (–604 + –394) – (–1129) = 131 kJ mol−1
59 As ∆Greaction is very positive, the reaction is not
Gas
spontaneous under standard conditions. This
accounts for the stability of calcium carbonate in
the form of limestone, chalk and marble.
S
71 ΔH⊖reaction = 178 kJ mol−1

Liquid
ΔS⊖reaction = 160.8 J K−1 mol−1
Solid ΔG⊖reaction = +178 – (2000 × 160.8 × 10−3) kJ mol−1
T = –144 kJ mol−1
60 N2(g) + 3H2(g) → 2NH3(g) 72 B

⊖ −1 −1
191 3 × 131 2 × 193 S / J K mol
73 (a) 2C(graphite) + 3H2(g) + 12O2(g) → C2H5OH(l)
ΔS⊖reaction = 2 × 193 – (191 + (3 × 131)) (b) ΔS⊖reaction = +161 – (2 × 5.7) – (3 × 63.5) –
= –198 J K−1 mol−1 (12 × 102.5)
= –98 J K−1 mol−1
61 C(graphite) + 2H2(g) → CH4(g)
5.7 2 × 131 186 S⊖ / J K−1 mol−1 (c) ΔGreaction = –278 – (500 × –98 × 10−3)
ΔS⊖reaction = 186 – (5.7 + (2 × 131)) = –82 J K−1 mol−1 = –229 kJ mol−1
When adding figures, the figure with the smallest (d) The reaction is spontaneous as ∆G is
number of decimal places determines the negative.
precision. (e) At high temperature: ∆G = –T∆S and so
is positive. The reaction will stop being
62 C
spontaneous at higher temperature.
63 (a) H2O(s) → H2O(l)
74 C 75 D 76 B
ΔH⊖reaction = –286 – (–292) = +6 kJ mol−1
ΔH⊖reaction 77 When ∆G = –30 kJ mol−1
(b) T =
ΔS⊖reaction –30 kJ mol−1 = –123 – (T1 × –128 × 10−3) kJ mol−1
6000 93 = (T1 × 128 × 10−3)
= = 273 K
22.0
T1 = 727 K
64 A 65 D 66 B
When ∆G = +30 kJ mol−1
25

lOMoARcPSD|20595249
Answers
+30 kJ mol−1 = –123 – (T2 × – 128 × 10−3) kJ mol−1 between the layers. In diamond each carbon is
153 = (T2 × 128 × 10 ) −3 bonded to four other atoms by single covalent
bonds and the C=C bond order is 1. The total
T2 = 1195 K
bonding is slightly stronger in graphite (higher
78 When ∆G = –30 kJ mol−1 bond orders) and this makes it more stable.
–30 kJ mol−1 = –93 – (T1 × –198 × 10−3) kJ mol−1
6 It has two unpaired electrons in the 2p sub-level.
63 = (T1 × 198 × 10−3)
7 With positive ions, there is generally a loose
T1 = 318 K
electrostatic attraction with the partially
When ∆G = +30 kJ mol−1 negatively charged negative oxygen atoms of
+30 kJ mol−1 = –93 – (T2 × –198 × 10−3) kJ mol−1 the water molecules. Positive ions with higher
123 = (T2 × 198 × 10−3) charge densities, such as d block ions, may form
complex ions with formal covalent coordinate
T2 = 621 K
bonds with the water molecules. There is
increased covalent interaction between the Ag+
ions and the water molecules, which leads to
Challenge yourself more exothermic hydration enthalpies.
8 Sodium chloride is an ionic substance that

1 N2(g): N2(g) + O2(g) → 2NO(g) ΔH⊖c = 90 kJ mol−1
contains alternating sodium and chlorine ions.
2 The specific heat capacities depend on the When salt is added to water, the partial charges
number of atoms in the unit mass. So c is on the water molecule are attracted to the Na+
approximately inversely proportional to the and Cl− ions. The water molecules work their
relative atomic mass. way into the crystal structure and between the
individual ions, surrounding them and slowly
3 The temperature of the Bunsen flame is 5748 °C
dissolving the salt – but as we have seen the
4 The difference in the values is largely to due to enthalpy change is very small. The aqueous
the assumption that H2O is gaseous in the bond solution is more disordered and so has a higher
enthalpy calculation. entropy, as discussed later in the chapter.
(1) CH4(g) + 2O2(g) → CO2(g) + 2H2O(l) 9 When Kc = 1, ΔG⊖reaction = 0
ΔH = –891 kJ mol−1
When Kc > 1, ΔG⊖reaction < 0
(2) CH4(g) + 2O2(g) → CO2(g) + 2H2O(g)
When Kc < 1, ΔG⊖reaction < 0
ΔH = –808 kJ mol−1
Possible function: ΔG⊖reaction = –A ln Kc where A is
(2)–(1) 2H2O(l) → 2H2O(g)
a constant with units kJ mol−1.
ΔH = 891 – 808 = +83 kJ mol−1
The precise relationship discussed in Chapter 7
H2O(l) → H2O(g) ΔH = +41.5 kJ mol−1
is ΔG⊖reaction = –RT ln Kc
There are (on average) two hydrogen bonds
between each molecule so a hydrogen bond is
approximately 20 kJ mol−1.
Practice questions
This assumes that all other molecular
interactions such as dipole–dipole and London
forces are negligible, which is an approximation. 1 D 2 D 3 A 4 C
5 Within the sheets of graphite the C=C bond 5 B 6 C 7 B 8 B

order 1.33 and the coordination number is 9 (a) amount of energy required to break bonds of
3, and there are weak intermolecular forces reactants
26

lOMoARcPSD|20595249
3 × 414 + 358 + 463 + 1.5 × 498 (kJ mol−1) density of water/solution = 1.0 / density of
= 2810 (kJ mol−1) [1] solution = density of water;
amount of energy released during bond heat capacity of cup is zero / no heat is
formation of products absorbed by the cup;
4 × 463 + 2 × 804 (kJ mol−1) = 3460 (kJ specific heat capacity of solution = specific
mol−1) [1] heat capacity of water;
−1
∆H = 2810 – 3460 = –650 (kJ mol ) [1] temperature uniform throughout solution;
Award [3] for correct final answer. Award [2] Award [1] each for any two. Accept
for (+)650. ‘energy’ instead of ‘heat’ [2]
(b) (i) m(methanol) = 80.557 – 80.034 = (b) (i) Tfinal = 73.0 (°C) [1]
0.523 (g) [1] Allow in the range 72 to 74 (°C).
0.523 g
n(methanol) = = ∆T = 48.2 (°C) [1]
32.05 g mol−1
0.0163 (mol) [1] Allow in the range 47 to 49 (°C). Award
[2] for correct final answer. Allow ECF if
Tfinal or Tinitial correct.
(ii) ∆T = 26.4 – 21.5 = 4.9 (K) [1]
(ii) temperature decreases at uniform
q = (mc∆T =) 20.000 × 4.18 × 4.9 (J) or
rate (when above room temperature) /
20.000 × 4.18 × 4.9 × 10−3 (kJ) [1]
OWTTE [1]
= 410 J or 0.41 kJ [1]
(iii) 10.1 (kJ) [1]
Allow in the range 9.9 to 10.2 (kJ).
410 (J)
(iii) ∆H⊖c = – or (c) Complete colour change shows all the
0.0163 (mol)
0.41 (kJ) copper has reacted, so n(Zn) = n(CuSO4)
– [1] 1.00 × 50.0
0.0163 (mol) = = 0.0500 (mol) [1]
1000
= –25153 J mol−1 or –25 kJ mol−1 [1]
(d) –201 kJ mol−1 [1]
Award [2] for correct final answer. Award
Allow in the range –197 to –206 (kJ mol−1).
[1] for (+)25 (kJ mol –1).
Value must be negative to award mark.
(c) (i) bond enthalpies are average values/
differ (slightly) from one compound to 11 (a) energy required = C=C + H–H
another (depending on the neighbouring = 614 + 436 = 1050
atoms) / methanol is liquid not gas in energy released = C–C + 2(C–H)
the reaction [1]
= 346 + 2(414) = 1174 [1]
(ii) not all heat produced transferred to
Allow full consideration of breaking all bonds
water / heat lost to surroundings/
and forming all the new bonds, which gives
environment / OWTTE / incomplete
values of 2706 and 2830.
combustion (of methanol) / water forms
energy required = C=C + H–H + 4(C–
as H2O(l) instead of H2O(g) [Do not allow
H)/612 + 436 + 4(413)
just ‘heat is lost’] [1]
and
10 (a) all heat is transferred to water/copper sulfate
energy released = C–C + 6(C–H)/347 +
solution / no heat loss;
6(413);
specific heat capacity of zinc is zero/
∆H = (1050 – 1174) or (2706 – 2830) =
negligible / no heat is absorbed by the zinc;
–124 kJ mol−1 [1]
27

lOMoARcPSD|20595249
Answers
(b) ∆H = –1411 + (–286) – (–1560) = (d) oxide has greater charge [1]
–137 kJ mol−1 [1] oxide has smaller radius [1]
(c) the actual values for the specific bonds Accept opposite arguments.
may be different to the average values / the
combustion values referred to the specific 22 (a) by definition ∆H⊖f of elements (in their
compounds / OWTTE [1] standard states) is zero / no reaction is
involved / OWTTE [1]
(d) (i) –124 kJ mol−1 [1]
(b) ∆H = –104 – (+20.4) [1]
(ii) average bond enthalpies do not apply
−1
to the liquid state / OWTTE; [1] = –124.4 kJ mol [1]
the enthalpy of vaporization/ Award [1] for +124.4 kJ mol−1, award [2]
condensation of cyclohexene and for correct final answer.
cyclohexane / OWTTE [2] (c) ∆S = 270 – (267 + 131) [1]
12 bonds broken: 4 × N–H, 1 × N–N, 1 × O=O = –128 J K mol−1 [1]

= +2220 (kJ mol−1) [1] Award [1] for +128 J K−1 mol−1, award [2] for
bonds formed: 1 × N≡N, 4 × O–H = –2797 correct final answer.
(kJ mol−1) [1] (–128 × 298)
(d) ∆G = ∆H – T∆S = –124.4 – [1]
1000
enthalpy change = 2797 + 2220 = = –86.3 kJ mol−1 [1]
–577 kJ mol−1 [1]
Units needed for the mark. Award [2] for
Award [3] for correct final answer. correct final answer. Allow ECF if only one
13 reaction II (requires a shorter wavelength) [1] error in first marking point.
O2 has double bond/bond order 2 and O3 (e) find the temperature for which ∆G = ∆H –
intermediate between double and single bonds/ T∆S = 0 / ∆H = T∆S [1]
bond order of 112 [1] T=
–124.4
= 972 K / 699 °C [1]
Do not accept stronger/weaker bonding without –128 / 1000
justification for the second marking point. Only penalize incorrect units for T and
inconsistent ΔS value once in parts (d) and
14 A 15 A 16 C 17 D (e).
18 B 19 B 20 B 23 (a) ∆H⊖reaction = Σ∆H⊖f (products) – Σ∆H⊖f (reactants)
21 (a) I is atomization/sublimation (of Mg) / = (1 × –84 + 2 × –242) – (2 × –201) [1]
∆H⊖atomization(Mg) / ∆H⊖sublimation(Mg) [1] = –166 (kJ or kJ mol ) −1
[1]
V is enthalpy change of formation of Award [1] for (+) 167.
(MgCl2) / ∆H⊖formation(MgCl2) [1]
(b) ∆S⊖reaction = ΣS⊖(products) – ΣS⊖(reactants)
(b) Energy value for II is +243 [1]
= (1 × 230 + 2 × 189) – (2 × 238 + 1 × 131) [1]
Energy value for III: is 738 + 1451 = 2189 [1] −1 −1 −1
= +1 (J K or J K mol ) [1]
Energy value for IV is 2 × (–349) [1] ⊖ ⊖ ⊖
(c) ∆G reaction = ∆H – T∆S
∆H⊖lat(MgCl2) = 642 + 148 + 243 + 2189 = –166 – 298 × 0.001 [1]
= (+)2252 kJ [1]
Award [1] for correct substitution of values.
(c) theoretical value assumes ionic model [1]
= –167 kJ or –167000 J [1]
experimental value greater due to
Units needed for mark in (c) only. Accept
(additional) covalent character [1]
–167 kJ mol–1 or –167000 J mol–1.
reaction is spontaneous [1]
28

lOMoARcPSD|20595249
Chapter 6
Exercises
1 Reaction gives off a gas: change in volume could 7 The reaction requiring the simultaneous collision
be measured. Reaction involves purple MnO4− of two particles is faster. The simultaneous
ions being reduced to colourless Mn2+ ions: collision of three particles is statistically less
colorimetry could be used. Reaction involves likely.
a change in the concentration of ions (23 on
8 B 9 B 10 B
the reactants side and 2 on the products side):
conductivity could be used. 11 The ashes must contain a catalyst that speeds
All these techniques enable continuous up the reaction between sugar and oxygen.
measurements to be made from which graphs (Deduced from the fact that all other factors that
could be plotted of the measured variable affect reaction rate can be ruled out.)
against time. 12 (a) 2CO(g) + 2NO(g) → 2CO2(g) + N2(g)
2 C (b) CO is a toxic gas: it combines with
haemoglobin in the blood and prevents
3 (a) (i) Measure the decrease in the mass of
it from carrying oxygen. NO is a primary
flask + contents.
air pollutant: it is oxidized in the air to
(ii) Measure the increase in pH of the form acidic oxides, leading to acid rain.
reaction mixture. It also reacts with other pollutants in the
(iii) Measure the increase in volume of gas atmosphere, forming smog.
collected. (c) The increased surface area of the catalyst
(b) The rate of the reaction decreases with in contact with exhaust gases will increase
time because the concentration of the acid catalyst efficiency.
decreases. (d) Catalytic activity involves the catalyst
4 0.200 interacting with the gases, and the reaction
0.180
occurring on its surface. As temperature
increases, the increased kinetic energy of
0.160
the gases increases the frequency with
0.140 which they bind to the catalyst.
[H2O2]
0.120 (e) Catalytic converters reduce pollution from

−0.040
0.100 cars but do not remove it completely. As in

48s (d), they are not effective when the engine
0.080
−0.022 first starts from cold, when an estimated 80%
0.060
60s of pollution occurs. Other pollutants in car
0.040
0 40 80 120 160 200 exhausts are not removed by the catalyst,
time/s e.g. ozone, sulfur oxides and particulates.
At 60 s, rate = 8.3 × 10−4 mol dm−3 s−1 Also the catalytic converter increases the
output of CO2, a serious pollutant because of
At 120 s, rate = 3.7 × 10−4 mol dm−3 s−1
its greenhouse gas properties.
5 D
13 Experiment 1: rate = k[H2][I2]
6 A Experiment 2: rate = k[H2O2]
29

lOMoARcPSD|20595249
Answers
Experiment 3: rate = k[S2O82−][I−] formal charges which have fractional values.

Experiment 4: rate = k[N2O5] The distribution of these formal charges in the
transition state may help to interpret its stability
14 1st order with respect to NO; 1st order with and how it will react in the next step of the
respect to O3; 2nd order overall. reaction mechanism.
15 Rate = k[CH3Cl]2
Rate = k [CH3Cl][OH−]
Rate = k [OH−]2
Practice questions
16 (a) mol−1 dm3 s−1 (b) s−1 1 A 2 B 3 C 4 C
(c) mol dm−3 s−1 (d) mol−2 dm6 s−1
5 A 6 A 7 B 8 C
(e) mol−1 dm3 s−1
9 C 10 D
17 From the units of k, it must be 1st order.
Rate = k[N2O5] 11 (a) catalyst; regenerated at end of reaction /
OWTTE [2]
18 k = 4.5 × 10−4/(2.0 × 10−3)2 = 1.1 × 102 mol−1
(b) (i) N2O2 [1]
dm3 min−1
(ii) ([H2] appears in rate expression so) step
19 C 2 rate-determining/rds/slow step [1]
20 NO: 2nd order; O2: 1st order Allow ‘since step 1 involves 2NO and
Rate = k[NO]2[O2] step 2 involves H2 and as all 3 molecules
are involved in rate expression, then two
21 Experiment 2: rate = 1.5 × 10−2 mol dm−3 s−1 steps must have approximately same
Experiment 3: rate = 1.5 × 10−2 mol dm−3 s−1 rate’ / OWTTE.
22 Rate = k[NO2][CO] (c) (k2 >> k1 so) step 1 rate-determining / rds /
slow step; two molecules of NO2 involved in
23 Yes, it fits the kinetic data and the overall step 1 consistent with rate expression / rate
stoichiometry. of overall reaction must equal rate of step 1
24 C which is rate = k1[NO2]2 / OWTTE [2]
(d) Ea = −R × m; measurement of gradient from
25 (a) 2AB2 → A2 + 2B2
two points on line
(b) Rate = k [AB2]2
Accept a gradient in range –2.14 × 104 K to
(c) mol−1 dm3 s−1 –2.27 × 104 K.
26 C 27 D 28 B correct answer for Ea;
29 134 kJ mol−1 correct units kJ mol−1 / J mol−1

corresponding to answer [4]
Allow kJ or J.
Challenge yourself A typical answer: Ea = 1.85 × 102 kJ mol−1.

Allow answers for Ea in range 1.75 × 102 kJ
1 Collecting a gas over warm water will cause its mol−1 to 1.91 × 102 kJ mol−1.
temperature and therefore its volume to increase. Award [4] for correct final answer with some
working shown.
2 If the partially made/broken bonds are treated as
Award [2 max] for correct final answer
containing only one electron, we can calculate
without any working shown.
30

lOMoARcPSD|20595249
12 (a) the concentration (of nitrogen(II) oxide) [1] (d) (i)

Award [0] if reference made to equilibrium.
Number of particles
(b) mol−2 dm6 s−1 / dm6 mol−2 s−1 [1] Ea (with catalyst)
−1 3 2 −1
Accept (mol dm ) s .
Ea (no catalyst)
13 (a) k increases with increase in T / k decreases
with decrease in T [1]
Energy
Do not allow answers giving just the
Arrhenius equation or involving ln k axes correctly labelled x = energy/
relationships. velocity/speed, y = number/% of
molecules/particles/probability
(b) gradient = −Ea/R;
graph showing correct curve for
−30000 (K) = −Ea/R
Maxwell-Boltzmann distribution
Allow value in range −28800 to −31300 (K).
If two curves are drawn, first and second
Ea = (30000 × 8.31=) 2.49 × 105 J mol−1/ marks can still be scored, but not third.
249 kJ mol−1 Curve(s) must begin at origin and not go
Allow value in range 240–260 kJ mol−1. up at high energy.
Allow [3] for correct final answer. two activation energies shown with Ecat
(c) 0.9 × 0.200 = 0.180 (mol dm ); −3 shown lower [3]
rate = (0.244 × (0.180)2 =) 7.91 × 10−3 mol Award the mark for the final point if
dm−3 s−1 shown on an enthalpy level diagram.
Award [2] for correct final answer. (ii) catalyst provides an alternative pathway
of lower energy / OWTTE [1]
Award [1 max] for either 9.76 × 10−3 mol
dm−3 s−1 or 9.76 × 10−5 mol dm−3 s−1. Accept catalyst lowers activation energy
(of reaction).
14 (a) to maintain a constant volume / OWTTE [1]
+
15 (a) XY + Z → X + YZ [1]
(b) (i) [H ] order 1, [CH3COCH3] order 1, [I2]
(b) transition
potential energy
order 0; state
2 transition
(rate = ) k[H+][CH3COCH3] [2] state
4
Award [2] for correct rate expression.
Allow expressions including [I2]0. 3
intermediate
(ii) neither were correct / Alex was right
about propanone and wrong about Ea 5
iodine / Hannah was right about Products
1 ∆H
propanone and hydrogen ions but Reactants
wrong about iodine / OWTTE [1]
extent of reaction
−3
(c) [CH3COCH3] = 0.100 mol dm and
Award [3] for all 5 correct, [2] for 4 correct,
[H+] = 0.100 mol dm−3
[1] for 3 correct.
4.96 × 10−6
k= = 4.96 × 10−4 mol−1 dm−3 (c) 1 X–Y + Z, W 2 X–Y–W
(0.100 × 0.100)
s−1
3 W–Y 4 W–Y–Z
Ignore calculation of [I2]. 5 W, Y–Z + X
No ECF here for incorrect units. Award [3] for all 5 correct, [2] for 4 correct,
[1] for 3 correct.
31

lOMoARcPSD|20595249
Answers
(d) 1st step is rate-determining step (highest (e) reaction is catalysed by W, which is not
energy of transition state); chemically changed at the end of the
rate equation = k[W][XY] [2] reaction [1]
(f) see graph in (b) above [2]
Chapter 7
Exercises
1 A 2 C 3 B (c) This is equivalent to an increase in pressure,

[NO2] 2 4
[NO2] [H2O] 6 so shifts to the left
4 (a) Kc = (b) Kc =
[NO]2[O2] [NH3]4[O2]7 (d) Shift to the right (e) Shift to the right
[CH3OH][Cl−]
(c) Kc = 15 (a) Amount of CO will decrease
[CH3Cl][OH−]
(b) Amount of CO will decrease
5 (a) N2O4(g) 2NO2(g)
(c) Amount of CO will increase
(b) CH4(g) + H2O(g) CO(g) + 3H2(g)
(d) No change in CO
6 (a) 3F2(g) + Cl2(g) 2ClF3(g)
16 C 17 B
[ClF3]2
Kc =
[F2]3[Cl2] 18 The Haber process is exothermic in the forward
(b) 2NO(g) N2(g) + O2(g) direction. Therefore, increasing temperature
[N2][O2] will decrease the value of Kc. This represents a
Kc =
[NO]2 decrease in the reaction yield.
(c) CH4(g) + H2O(g) CO(g) + 3H2(g)
19 (a) 2HI(g) H2(g) + I2(g)
[CO][H2]3
Kc = Initial: 1.0 0.0 0.0
[CH4][H2O]
Change: −0.22 +0.11 +0.11
7 (a) Mostly reactants (b) Mostly reactants
Equilibrium: 0.78 0.11 0.11
(c) Mostly products 2
[H2][I2] (0.11)
[HOCl]2 Kc = = = 2.0 × 10−2
[HI]2 (0.78)2
8 (a) > K; not at equilibrium; reaction
[H2O][Cl2O]
(b) At the higher temperature, the value of Kc is
proceeds to the left
higher, so the reaction must be endothermic.
(b) At equilibrium
[HOCl]2 20 N2(g) + O2(g) 2NO(g)
(c) > K; not at equilibrium; reaction
[H2O][Cl2O] Initial: 1.6 1.6 0.0
proceeds to the left Change: −x −x 2x
Equilibrium: 1.6 − x 1.6 − x 2x
9 (a) 7.73 × 104 (b) 3.60 × 10−3
As Kc is very small, 1.6 – x » 1.6
(c) 6.00 × 10−2
[NO]2 (2x)2
Kc = = = 1.7 × 10−3
10 B 11 D 12 C [N2][O2] (1.6)2
x = 0.03298, so 2x = 0.066
13 (a) Shift to the left (b) Shift to the right
[NO]eqm = 0.066 mol dm−3
(c) No shift in equilibrium
14 (a) Shift to the left (b) Shift to the right

32

lOMoARcPSD|20595249
21 (a) CO(g) + H2O(g) = H2(g) + CO2(g) 3 The concentration of a pure solid or pure liquid
is a constant, effectively its density, which is
Initial: 4.0 6.4 0.0 0.0
independent of its amount. These constant
Change: −3.2 −3.2 +3.2 +3.2
values therefore do not form part of the
Equilibrium: 0.8 3.2 3.2 3.2
equilibrium expression, but are included in the
[H2][CO2] (3.2)2 value of K.
Kc = = = 4.0
[CO][H2 O] (0.8)(3.2)
4 The value for Kc at 298 K for the reaction
(b) Put the values into the equilibrium N2(g) + O2(g) 2NO(g) is extremely low, so the
expression to determine Q: equilibrium mixture lies to the left with almost no
(3.0)2 production of NO. But at higher temperatures,
Q= = 0.56 such as in vehicle exhaust fumes, the reaction
(4.0)2
shifts to the right and a higher concentration
This is not equal to the value of Kc so the
of NO is produced. This gas is easily oxidized
reaction is not at equilibrium. As the value
in the air, producing the brown gas NO2 which
of this mixture is lower than Kc, the reaction
is responsible for the brownish haze: 2NO(g) +
will move to the right before equilibrium is
O2(g) → 2NO2(g).
established.
5 The atom economies of the Haber process
22 C
and the Contact process reactions described
23 (a) 0 (b) Negative are both 100% as there is only one product. In
(c) Positive other words, there is no waste. But this does not
mean that all reactants are converted to product,
24 (a) 79.8 kJ so the stoichiometric yield is less than 100%.
(b) Increasing temperature has increased the It is the goal of these industries to maximize
value of K so it must be an endothermic yield and efficiency by choosing the optimum
reaction. conditions, taking equilibrium and kinetic
considerations into account.
Challenge yourself
Practice questions
1 Earth receives energy from the Sun and
disperses energy, largely as heat. But exchange 1 C 2 D 3 D 4 A
of matter is minimal – the only exceptions to
5 D 6 C 7 D 8 A
Earth being a closed system are matter received
from space such as asteroids and space dust, 9 D
and matter lost to space such as spacecraft. 10 (a) (i) (K =) [SO3]2/[O2][SO2]2 [1]
2 The different values of Kc indicate different (ii) yield (of SO3) increases / equilibrium
stabilities of the hydrogen halides. The bonding moves to right / more SO3 formed;
in HCl is the strongest and in HI the weakest. 3 gaseous molecules → 2 gaseous
This is largely because of the size of the atoms. molecules / decrease in volume of
As I has a larger atomic radius than Cl, in HI the gaseous molecules / fewer gaseous
bonding pair is further from the nucleus than molecules on right hand side [2]
the bonding pair in HCl, and so experiences a
Do not allow ECF.
weaker pull. The HI bond breaks more easily and
so the dissociation reaction is favoured. (iii) yield (of SO3) decreases;
33

lOMoARcPSD|20595249
Answers
forward reaction is exothermic / reverse/ (c) value of Kc increases;

backwards reaction is endothermic / [SO2Cl2] increases;
equilibrium shifts to absorb (some of) the
decrease in temperature favours (forward)
heat [2]
reaction which is exothermic [3]
Do not accept exothermic reaction or Le
Do not allow ECF.
Châtelier’s principle.
(d) no effect on the value of Kc / depends only
Do not allow ECF.
on temperature;
(iv) rates of both forward and reverse
[SO2Cl2] decreases;
reactions increase equally; no effect on
increase in volume favours the reverse
position of equilibrium; no effect on value
reaction which has more gaseous moles [3]
of Kc [3]
Do not allow ECF.
(b) 2NO(g) + 2H2(g) → N2(g) + 2H2O(g)
(e) no effect;
NO(g) H2(g) N2(g) H2O(g)
catalyst increases the rate of forward
Initial/
0.100 0.051 0.000 0.100 and reverse reactions (equally) / catalyst
mol dm−3
decreases activation energies (equally) [2]
Change/
−0.038 −0.038 +0.019 +0.038 12 (a) exothermic
mol dm−3
Equilibrium/ Accept either of the following for the second
0.062 0.013 0.019 0.138
mol dm−3 mark.
[H2] at equilibrium = 0.013 (mol dm−3); increasing temperature favours endothermic/
[N2] at equilibrium = 0.019 (mol dm−3); reverse reaction; as yield decreases with
increasing temperature [2 max]
[H2O] at equilibrium = 0.138 (mol dm−3);
(b) yield increases / equilibrium moves to the
Kc = [N2][H2O]2/[NO]2[H2]2 = (0.019)(0.138)2/
right / more ammonia;
(0.062)2(0.013)2 = 5.6 × 102 [4]
increase in pressure favours the reaction
Award [4] for final correct answer.
which has fewer moles of gaseous
Accept any value also in range 557–560. products [2]
Do not penalize significant figures. [NH3]2
(c) (Kc =) [1]
[SO2Cl2] [N2][H2]3
11 (a) (Kc =) [1]
[Cl2][SO2] (d) [N2]: (at equilibrium = 1.00 − 0.031 =) 0.969
Ignore state symbols. (mol dm−3);
Square brackets [ ] required for the [H2]: (at equilibrium = 3.00 − 3(0.031) =) 2.91
equilibrium expression. (mol dm−3);
(0.062)2
(b) 7.84 × 10−3 mol of SO2 and 7.84 × 10−3 mol
of Cl2;
(Kc =
(0.969)(2.91)3 )= 1.6(1) × 10−4 [3]
Ignore units.
7.84 × 10−3 mol dm−3 of SO2, 7.84 × 10−3
mol dm−3 of Cl2 and 7.65 × 10−4 mol dm−3 of Award [1] for Kc = 1.4 × 10−4
SO2Cl2; (e) no effect [1]
12.5 [3] 13 (a) reactants and products in same phase/state;
Award [1] for 10.34. rate of forward reaction = rate of reverse
Award [3] for the correct final answer. reaction;
34

lOMoARcPSD|20595249
Answers
concentrations of reactants and products (f) no effect (on the value of the equilibrium
remain constant / macroscopic properties constant)
remain constant [2 max] as it speeds up forward and reverse
Do not accept concentrations are equal. reaction / concentrations of reactants
[HI]2 and products do not change / position of
(b) (Kc =) [1] equilibrium does not change / no change in
[H2][I2]
(c) no change to position of equilibrium [1] yield [2]
(d) the reaction is exothermic / heat is given 14 (a) ∆G° = 0

out / ∆H is negative [1] (b) ΔG = −70 kJ mol−1
(e) amount of H2 remaining at equilibrium The reaction has a very high value for K, so
1.80 will go essentially to completion – from the
= 1.60 − = 0.70 mol
2 equilibrium yield, this reaction is likely to give
amount of I2 remaining at equilibrium a high production of methanol. However,
1.80 kinetic data are not available, so the rate
= 1.0 − = 0.10 mol
2 cannot be deduced.
(1.80 / 4.0)2 1.802
Kc = / 15 (a) [H2(g)] = 4.0 mol dm−3
(0.70 / 4.00) × (0.10 / 4.00) 0.70 × 0.10
(1.80)2 [I2(g)] = 1.0 mol dm−3
Kc = = 46.3 [4]
0.70 × 0.10 [HI] = 4.0 mol dm−3
Award [4] for correct final answer. (b) (i) HI originally placed = 2.0 mol dm−3
(ii) I2 at equilibrium = 0.218 mol dm−3; HI at
equilibrium = 1.56 mol dm−3
Chapter 8
Exercises
1 (a) HSO3− (b) CH3NH3+ 4 HPO42−(aq) + H2O(l) PO43−(aq) + H3O+(aq) (acid

(c) C2H5COOH (d) HNO3 behaviour)
(e) HF (f) H2SO4 HPO42−(aq) + H2O(l) H2PO4−(aq) + OH−(aq)
(base behaviour)
2 (a) H2PO4− (b) CH3COO−
5 (a) H2SO4(aq) + CuO(s) → CuSO4(aq) + H2O(l)
(c) HSO3− (d) SO42−
(b) HNO3(aq) + NaHCO3(s) → NaNO3(aq) +
(e) O2− (f) Br−
H2O(l) + CO2(g)
3 (a) CH3COOH (acid)/CH3COO− (base) (c) H3PO4(aq) + 3KOH(aq) → K3PO4(aq) +
NH3 (base)/NH4+ (acid) 3H2O(l)
(b) CO32− (base)/HCO3− (acid) (d) 6CH3COOH(aq) + 2Al(s) →
+
H3O (acid)/H2O (base) 2Al(CH3COO)3(aq) + 3H2(g)
(c) NH4+ (acid)/NH3 (base) 6 B
−
NO (base)/HNO2 (acid)
2 7 B
35

lOMoARcPSD|20595249
Answers
8 (a) nitric acid + sodium carbonate / sodium [OH−] = 5.9 × 10−8 mol dm−3
hydrogencarbonate / sodium hydroxide acidic
2HNO3(aq) + Na2CO3(aq) → 2NaNO3(aq) +
24 (a) 0.40 (b) 10.57
H2O(l) + CO2(g)
(c) 10.00
(b) hydrochloric acid + ammonia solution
HCl(aq) + NH4OH(aq) → NH4Cl(aq) + H2O(l) 25 B
(c) copper(II) oxide + sulfuric acid [C2H5NH3+][OH−]

26 (a) Kb =
[C2H5NH2]
H2SO4(aq) + CuO(s) → CuSO4(aq) + H2O(l)
[H2SO4][OH−]
(d) methanoic acid + potassium hydroxide (b) Kb =
[HSO4−]
HCOOH(aq) + KOH(aq) → KCOOH(aq) + [HCO3−][OH−]
(c) Kb =
H2O(l) [CO32−]
9 pH increases by 1 unit 27 HNO2 < H3PO4 < H2SO3
10 pH = 4.72 28 Strong acids and bases are fully dissociated,

so it is not useful to think of them in terms of an
11 [H+] = 1.0 × 10−9 mol dm−3, [OH−] = 1.0 × 10−5
equilibrium mixture. The pH of their solutions can
mol dm−3
be derived directly from their concentration.
12 (a) [OH−] = 2.9 × 10−6; basic
29 B
(b) [H+] = 1.0 × 10−12; basic
30 Kb = 5.6 × 10−4
(c) [H+] = 1.0 × 10−4; acidic
(d) [OH−] = 1.2 × 10−10; acidic 31 [H+] = 1.0 × 10−4 mol dm−3; [OH−] = 1.0 × 10−10
mol dm−3
13 pH = 2.0
32 pH = 3.22; [H+] = 6.0 × 10−4 mol dm−3
14 (a) pH = 6.9 (b) pH = 2
33 A
(c) pH = 4.8
34 HF is the stronger acid.
15 pH = 13.17
35 pKb CN− = 4.79; pKb F− = 10.83
16 B 17 A
CN− is the stronger base.
18 (a) H2CO3 (b) HCOOH
36 (a) pKb CH3COO− = 9.24
19 (a) Lewis acid Zn2+; Lewis base NH3
(b) Methanoic acid is a stronger acid than
(b) Lewis acid BeCl2; Lewis base Cl− ethanoic acid from its lower pKa. Therefore,
(c) Lewis acid Mg2+; Lewis base H2O its conjugate base is weaker.
20 D, CH4 because it does not possess a lone pair. 37 B 38 B
21 C, there is no exchange of H+. 39 (i) Because it has a higher concentration of the

acid and its conjugate base.
22 [H+] = [OH−] = 1.55 × 10−7
pH = pOH = 6.81 40 (a) equal to 7 (b) less than 7
pH + pOH = pKw = 13.62 (c) less than 7 (d) greater than 7
neutral 41 B; salt of strong base and weak acid
23 pOH = 7.23 42 (a) less than 7 (b) greater than 7

+ −7 −3
[H ] = 1.7 × 10 mol dm (c) equal to 7
36

lOMoARcPSD|20595249
Answers
43 D (III only) (c) Particulates act as catalysts in the

production of secondary pollutants.
44
(d) SO2(g): CaO(s) + SO2(g) → CaSO3(g)
(e) NO: formed from the combination of
buffer region
nitrogen and oxygen at the high temperature
of internal combustion engines.
pH
50 (a) Dry acid deposition typically occurs close to

<7 equivalence point the source of emission.
Wet acid deposition is dispersed over a
much larger area and distance from the
emission source.
25 cm3
volume of HCl added (b) The acid is formed in the air from sulfur
dioxide (SO2) and nitrogen oxide (NO) which
45 Initial pH of acid ⇒ Ka of acid ⇒ pKa of acid. are emitted by thermal power stations,
At half equivalence, pH = pKa, so this can be industry and motor vehicles. A major source
read directly off the curve. is the burning of fossil fuels, particularly in
coal-fired power stations. Pollutants are
46 D
carried by prevailing winds and converted
47 (a) Strong acid–strong base and strong acid– (oxidized) into sulfuric acid (H2SO4) and nitric
weak base acid (HNO3). These are then dissolved in
(b) pKa = 4.6 (midway in endpoint range) cloud droplets (rain, snow, mist, hail) and
this precipitation may fall to the ground as
(c) yellow at all pHs below 3.8
dilute forms of sulfuric acid and nitric acid.
48 (a) Contains dissolved carbon dioxide which The dissolved acids consist of sulfate ions,
reacts with water to form carbonic acid: nitrate ions and hydrogen ions.
CO2(g) + H2O(l) H2CO3(aq)
51 The hydroxyl free radical •OH.
(b) Sulfuric acid:
It is formed by the reaction between water and
S(s) + O2(g) → SO2(g)/2SO2(g) + O2(g) → either ozone or atomic oxygen:
2SO3(g)
H2O + O• → 2•OH
H2O(l) + SO3(g) → H2SO4(aq)
O2 + O• → O3; O3 + H2O → 2•OH + O2
(c) Nitric acid:
reduced by use of catalytic converters,
recirculation of exhaust gases
(d) CaCO3(s) + H2SO4(aq) → CaSO4(aq) + H2O(l) Challenge yourself
+ CO2(g)
(e) Effects on materials, plant life and human 1 Increasing the length of the carbon chain
health (see text for details). increases the donation/push of electrons
towards the carbonyl C atom, known as a
(f) Use alternative energy source to fossil fuels
positive inductive effect. This causes less
or use coal with a low sulfur content.
electron withdrawal from the O–H bond, so
49 (a) SO2 and NO weakening acid strength. The basic strength of
(b) SO2 and particulates amines depends largely on the availability of the
37

lOMoARcPSD|20595249
Answers
lone pair electrons on nitrogen. C2H5 pushes acids). Decomposition of plant material to peat
electrons towards N more than CH3 does, so it is and then coal conserves this sulfur. Additional
a stronger base. sources are the depositional environment such
as sea water, where sulfates are reduced by
(This will make more sense after studying
bacteria to form H2S, which can react further to
inductive effects in Chapter 10.)
form organic sulfur structures.
2 (a) pH increases on dilution of a strong acid as
7 Combustion of nitrogen involves the highly
[H+] decreases.
endothermic step (+942 kJ mol−1) of breaking
(b) pH increases on dilution of a weak acid the triple N≡N bond, as well as the O=O bond
as [H+] decreases, but the change is less (+498 kJ mol−1). The exothermic step of forming
than for a strong acid, as acid dissociation the triple N≡O bond releases less energy –
increases with dilution. approximately 630 kJ mol−1. Therefore enthalpy
(c) pH of a buffer stays the same with dilution, change (bonds broken minus bonds formed) is
as Ka or Kb and [acid]/[salt] ratio stay endothermic. So the stability and strength of the
constant. nitrogen triple bond creates an unusual situation
where the products of combustion are less
3 [acid] = initial concentration of acid; [HA] =
stable than the reactants.
equilibrium concentration of acid. These will be
equal only for weak acids, in which the extent of 8 HNO2: N = +3, nitric(III) acid
dissociation is so low that the acid is considered HNO3: N = +5, nitric(V) acid
to be undissociated at equilibrium.
H2SO3: S = + 4, sulfuric(IV) acid
[salt] = initial concentration of salt solution; [A−] H2SO4: S = +6, sulfuric(VI) acid
= concentration of anion/conjugate base at
equilibrium. These will be equal for fully soluble
salts in which the formula unit contains a single
anion.
Practice questions
4 Titration needs to add acid from burette to 1 D 2 B 3 C 4 C
base (see exam hint on page 400). The pH
at half equivalence when half the base has 5 B 6 C 7 C 8 B
been neutralized and half remains unreacted 9 C 10 D 11 A 12 A
is recorded. At this point, pOH = pKb. (pOH is
13 C
usually calculated from the measured pH by
assuming the temperature is 298 K, so pH + 14 (a) (Kw =)[H+(aq)][OH−(aq)] [1]
pOH = 14.) Do not penalize if (aq) not stated.
5 Indicators usually contain structures with H3O+ may be given instead of H+.
delocalized electrons, either benzene rings and/ Do not mark award if square brackets are
or multiple bonds. Conjugation of the electrons omitted or are incorrect.
influences the absorption of light in the visible (b) (i) (pKb =(14.00 − 7.52 =) 6.48 and) Kb =
region, giving rise to specific colours. The gain or (10−6.48) = 3.3 × 10−7 [1]
loss of H+ changes the delocalization within the Do not award mark if answer just left as
structure, which causes changes in absorption 10−6.48.
maxima and so different colours. Colour is [HOCl][OH−] x2
discussed in Topic 13, Chapter 3. (ii) Kb = = = 3.3 × 10−7
[OCl−] 0.705
[OH−] = 4.8 × 10−4 (mol dm−3)
6 Sulfur is present in proteins in living cells (a
component of two out of the twenty amino Award [2] for correct value of [OH−].
38

lOMoARcPSD|20595249
Answers
OCl− only partially hydrolysed / pKa = 4.7 [2]

x negligible (compared to [OCl−]) / Accept in range 4.2 to 5.2. M2 can only
OWTEE [3] be scored if M1 correct (i.e. no marks for
Accept [HOCl] = [OH−]. just Data Booklet value of 4.76).
Kw 1.00 × 10−14 (v) 14
(iii) [H3O+]/[H+] = − = =
−11
[OH ] 4.8 × 10−4 13
2.1 × 10 12
pH = (−log10[H3O+]/−log10[H+] = 11
−log10(2.1 × 10−11) =)10.68 [2] 10
9
Award [2] for correct final answer. 8
7
15 (a) (i) Acid: proton/H+ donor and Base:
pH
6
proton/H+ acceptor 5
4
Do not accept OH− for base.
3
Weak base: (base/electrolyte) partially 2
dissociated/ionized (in solution/ 1
0
water) and Strong base: (base/
electrolyte assumed to be almost) 0 10 20 30 40 50
Volume / cm3
completely/100% dissociated/ionized (in
solution/water) / OWTTE Starting pH: 1
NH3 / CH3CH2NH2 [3] Equivalence point: pH = 7 and 25 cm3
Allow either name or formula or other Final pH reached: 12–13
suitable example. correct curve shape [4]
(ii) sulfurous acid/H2SO3 Do not award M4 if turn in curve is seen
corrodes marble/limestone buildings/ at low volumes (suggesting weak acid–
statues / leaching in soils / harms/kills strong base titration).
plants Award [4] if values corresponding to
OR M1, M2 and M3 are labelled on graph
nitrous acid/HNO2 (e.g. using X) and correct shape of curve
shown.
corrodes marble/limestone buildings/
statues / leaching in soils / harms/kills (b) (i) HIn is a weak acid / weak base
plants HIn H+ + In−
OR colour 1 colour 2
carbonic acid/H2CO3 required.
corrodes marble/limestone buildings/ Award [2] for M2 alone.

statues / acidification of lakes [2] in base equilibrium moves to right / in
Do not allow oxides (e.g. CO2 etc.). acid equilibrium moves to left [3]
Do not accept just corrodes or damages. (ii) phenolphthalein
(iii) Volume of KOH: 20 (cm3) indicator colour change occurs in range

of pH at the equivalence point /
Allow any value between 20 and 21 (cm3).
OWTTE [2]
pH at the equivalence point: 8.0–10.0 [2]
M2 can be scored independently even if
(iv) At half-equivalence point, [CH3COOH] = indicator is incorrect.
[CH3COO−] so pH = pKa;
39

lOMoARcPSD|20595249
Answers
16 (a) strong acid completely dissociated/ionized No mark for more acidic.

and weak acid partially dissociated/ionized inverse relationship between pH and
HNO3(aq) → H+(aq) + NO3−(aq) 1
[H+]/pH = −log[H+]/pH = log10 + [2]
HCN(aq) H+(aq) + CN−(aq) [3] [H ]
+ +
Accept [H3O ] in place of [H ].
Insist on both arrows as shown.
(b) (i) Acid: H2PO4−
State symbols not needed.
(Conjugate) base: HPO42−
Accept H2O and H3O+.
[H+][CN−] No mark for NaH2PO4 or Na2HPO4.
(b) Ka = H2PO4−(aq)
[HCN] H+(aq) + HPO42−(aq) [3]
Allow H3O+ instead of H+. Accept reverse equation or reaction with
Ka = 10 −9.21 −10
= 6.17 × 10 water.
(c) [H ] = √Ka[HCN] / √(6.17 × 10−10 × 0.108
+ Ignore state symbols, but equilibrium
= 8.16 × 10−6 sign is required.
Allow in the range 8.13 × 10−6 to 8.16 × 10−6. Accept OH− (ions) react with H+ (ions) to
form H2O.
pH = 5.09
(ii) strong base/OH− replaced by weak
OR
base (HPO42−, and effect minimized) /
pH = 12(pKa − log[HCN])/12(9.21 − log0.108) strong base reacts with acid of buffer /
= 5.09 equilibrium in (i) shifts in forward direction
[H ] = 10−5.09 = 8.16 × 10−6
+
OH−(aq) + H2PO4−(aq) → H2O(l) +
Allow in the range 8.13 × 10−6 to 8.16 × 10−6. HPO42−(aq) [2]
If expression for [H+] missing but both answer Ignore state symbols, accept equilibrium
correct, award [3], if one answer correct, sign. Accept OH– added reacts with H+
award [2]. to form H2O.
assume [H+] << 0.108/negligible (iii) strong acid/H+ replaced by weak
dissociation [4] acid (H2PO4−, and effect minimized) /
strong acid reacts with base of buffer /
17 (a) (i) (Ka) = [H+][OH−]/(Kw) = [H3O+][OH−] [1]
equilibrium in (i) shifts in reverse direction
Do not award mark if [ ] omitted or other
H+(aq) + HPO42− (aq) → H2PO4−(aq) [2]
brackets are used. +
Accept reaction with H3O .
(ii) [H+] increases, [OH−] decreases but
Ignore state symbols.
still some present (Kw constant) /
[OH−] cannot go to zero as equilibrium (c) (i) NH3 weak(er) base/partial dissociation
K [OH−] < 0.1(0)/pOH > 1 (thus pH < 13 /
present / [OH−] = w+ , thus [OH−] cannot
[H ] pH + pOH = 14) [2]
be zero / OWTTE [1]
(ii) around pH = 5
(iii) (changing T disturbs equilibrium)
Accept a value between 4 and 6.
endothermic reaction / forward reaction
favoured / equilibrium shifts to the right strong acid–weak base titration, (thus
acidic) / at equivalence point, NH4+
to use up (some of the) heat supplied
present is acidic / NH4+ NH3 + H+ [2]
Kw increases (as both [H+] and [OH−]
(iii) NH3(aq) + H2O(l) NH4+(aq) + OH−(aq)
increases) [3]
Ignore state symbols, but equilibrium
(iv) (as [H+] increases) pH decreases /
sign required.
pH < 7
40

lOMoARcPSD|20595249
Answers
[NH4+][OH−] Ignore units.

Kb = [2]
[NH3] Award [3] for correct final answer.
(iv) [NH3] = [NH4+] [1] (vi) optimum/most effective/highest buffer
(v) pOH = 14.00 − 9.25 = 4.75 capacity/50%–50% buffer/equally
pKb (= pOH) = 4.75 effective as an acidic buffer and a basic
buffer / OWTTE [1]
Kb = 1.78 × 10−5 [3]
Chapter 9
Exercises
1 (a) NH4+ = N −3, H +1 3 (a) Ca(s) + 2H+(aq) → Ca2+(aq) + H2(g)

(b) CuCl2 = Cu +2, Cl −1 0 +1 +2 0
(c) H2O = H +1, O −2 oxidation: Ca(s) → Ca2+(aq) + 2e−
(d) SO2 = S +4, O −2 reduction: 2H+(aq) + 2e− → H2(g)

(e) Fe2O3 = Fe +3, O −2 (b) 2Fe2+(aq) + Cl2(aq) → 2Fe3+(aq) + 2Cl−(aq)
+2 0 +3 −1
(f) NO3− = N +5, O −2
oxidation: 2Fe2+(aq) → 2Fe3+(aq) +2e−
(g) MnO2 = Mn +4, O −2
reduction: Cl2(g) + 2e− → 2Cl−(aq)
(h) PO43− = P +5, O −2
(c) Sn2+(aq) + 2Fe3+(aq) → Sn4+(aq) + 2Fe2+(aq)
(i) K2Cr2O7 = K +1, Cr +6, O −2
+2 +3 +4 +2
(j) MnO4− = Mn +7, O −2
oxidation: Sn2+(aq) → Sn4+(aq) + 2e−
2 (a) reduction reduction: 2Fe3+(aq) + 2e− → 2Fe2+(aq)
Sn2(aq) 2Fe3(aq) → Sn4(aq) 2Fe2(aq) (d) Cl2(aq) + 2Br−(aq) → 2Cl−(aq) + Br2(aq)
12 13 14 12
0 −1 −1 0
oxidation
oxidation: 2Br−(aq) → Br2(aq) + 2e−
(b) reduction
reduction: Cl2(aq) + 2e− → 2Cl−(aq)
Cl2(aq) 2NaBr(aq) → Br2(aq) 2NaCl(aq)
0 1121 0 1121
4 (a) Zn(s) + SO42−(aq) + 4H+(aq) → Zn2+(aq) +
oxidation SO2(g) + 2H2O(l)
(c) reduction
(b) 2I−(aq) + HSO4−(aq) + 3H+(aq) → I2(aq) +
2FeCl2(aq) Cl2(aq) → 2FeCl3(aq) SO2(g) + 2H2O(l)
1221 0 1321
(c) NO3−(aq) + 4Zn(s) + 10H+(aq) → NH4+(aq) +
oxidation
4Zn2+(aq) + 3H2O(l)
(d) reduction
(d) I2(aq) + 5OCl−(aq) + H2O(l) → 2IO3−(aq) +
2H2O(l) 2F2(aq) → 4HF(aq) O2(g)
1122 0 1121 0 5Cl−(aq) + 2H+(aq)
oxidation (e) 2MnO4−(aq) + 5H2SO3(aq) → 2Mn2+(aq) +
3H2O(l) + 5SO42−(aq) + 4H+(aq)
(e)
reduction
5 B 6 D
I2(aq) SO32(aq) H2O(l) → 2I(aq) SO42(aq) 2H(aq)
0 1422 1122 21 1622 11
oxidation
41

lOMoARcPSD|20595249
Answers
7 (a) chromium(III) oxide (b) copper(I) chloride (b) Fe / Fe2+ Mg / Mg2+

(c) nitric(V) acid (d) nitric(III) acid cathode anode
(e) lead(IV) oxide Fe2+(aq) + 2e− → Fe(s)
Mg(s) → Mg2+(aq) + 2e−
8 (a) reducing agent = H2(g); oxidizing agent = Cl2(g)
(c) Mg / Mg2+ Cu / Cu2+
(b) reducing agent = Al(s); oxidizing agent =
anode cathode
PbCl2(s)
Mg(s) → Mg2+(aq) + 2e−
(c) reducing agent = KI(aq); oxidizing agent =
Cl2(aq) Cu2+(aq) + 2e− → Cu(s)
(d) reducing agent = CH4(g); oxidizing agent = 14 (a) oxidation reduction

Mg(s) → Mg2 (aq) 2e Zn2 (aq) 2e → Zn(s)
O2(g) V
e flow
anions
9 (a) CuCl2(aq) + Ag(s) magnesium zinc
electrode salt bridge electrode
No reaction, Cu is a more reactive metal cations
solution of
than Ag. magnesium solution of
nitrate zinc nitrate
(b) 3Fe(NO3)2(aq) + 2Al(s) → 2Al(NO3)3(aq) + Anode Cathode
3Fe(s)
(b) Mg(s) | Mg2+(aq) || Zn2+(aq) | Zn(s)
Al is a more reactive metal than Fe, so is
able to reduce Fe2+. 15 The iron spatula would slowly dissolve as it
(c) 2NaI(aq) + Br2(aq) → 2NaBr(aq) + I2(aq) is oxidized to Fe2+ ions. Copper metal would
precipitate as Cu2+ ions are reduced. The blue
Br is a more reactive non-metal than I, so is
colour of the solution would fade as Cu2+ ions
able to oxidize I−.
are removed.
(d) KCl(aq) + I2(aq)
16 E ⊖cell = E ⊖half-cell where reduction occurs E ⊖half-cell where oxidation occurs
No reaction, Cl is a more reactive non-metal
= E ⊖Cd2+ − E ⊖Cr3+ = –0.40 − (–0.75) = +0.35 V
than I.
17 BrO3− will be reduced (higher E ⊖ value); I− will be
10 (a) W > X > Y > Z
oxidized.
(b) (i) no reaction
Cell reaction:
(ii) no reaction
BrO3−(aq) + 6H+ + 6I− → Br−(aq) + 3H2O(l) + 3I2(s)
11 (a) Solution changes from purple to colourless E ⊖cell = E ⊖BrO3– − E ⊖I2 = +1.44 − (+0.54) = +0.90 V
(b) C2O (aq) → 2CO2(g) + 2e
4
2− −
18 Strongest oxidizing agent Cu2+; strongest
(c) MnO4−(aq) + 8H+(aq) + 5e− → Mn2+(aq) + 4H2O(l)
reducing agent Mg.
(d) 2MnO4−(aq) + 16H+(aq) + 5C2O42−(aq) →
2Mn2+(aq) + 8H2O(l) + 10CO2(g) 19 (a) No reaction
(e) 6.16 × 10−3 (f) 6.16 × 10−3 (b) Reaction occurs
(g) 24.7% BrO3−(aq) + 6H+(aq) + 3Cd(s) → Br−(aq) +

3H2O(l) + 3Cd2+(aq)
12 (a) 0.117%
E ⊖cell = E ⊖BrO3 − E ⊖Cd2+ = +1.44 − (−0.40) = 1.84 V
(b) Solution changes from orange to green
(c) No reaction
13 (a) Zn / Zn2+ Fe / Fe2+
20 −270 kJ
anode cathode
Zn(s) → Zn2+(aq) + 2e− 21 (a) At anode: 2Br−(l) → Br2(l) + 2e−
Fe2+(aq) + 2e− → Fe(s) At cathode: 2K+(l) + 2e− → 2K(l)
42

lOMoARcPSD|20595249
Answers
(b) At anode: 2F−(l) → F2(g) + 2e− (b) Reaction at the cathode would be the
At cathode: Mg (l) + 2e → Mg(l)
2+ − same with copper deposited on the copper
electrode.
(c) At anode: S2−(l) → S(l) + 2e−
Cathode: Cu2+(aq) + 2e– → Cu(s)
At cathode: Zn2+(l) + 2e− → Zn(l)
Reaction at the anode would be different:
22 (a) e−
Cu(s) → Cu2+(aq) + 2e–
anode + − cathode The copper electrode disintegrates as it
oxidation reduction is oxidized, releasing Cu2+ ions into the
inert electrodes solution. The blue colour of the solution
would not change as Cu2+ ions are produced
Cl− Mg2+ Mg Cl2(l)
and discharged at an equal rate.
(b) Anode: 2Cl−(aq) → Cl2(g) + 2e− 26 During electrolysis of NaCl(aq) at the cathode
Cathode: Mg2+(aq) + 2e− → Mg(s) H2O is reduced (rather than Na+, which is
Overall: Mg2+(aq) + 2Cl−(aq) → Mg(s) + Cl2(g) reduced in molten Na(l) and H2(g) is discharged:
23 D 2H2O(l) + 2e− → H2(g) + 20k–(aq)
24 Ions present: K+(aq), F−(aq) 27 AlCl3(l) → Al3+(l) + 3Cl−(l)

At anode: F−(aq) and H2O(l); H2O(l) will be oxidized. 2Cl−(l) → Cl2(g) + 2e− Al3+(l) + 3e− → Al(l)
1 mole 2 moles 3 moles 1 mole
Reaction occurring is 2H2O(l) → 4H+(aq) + O2(g) of Cl2 of electrons of electrons of Al
+ 4e– H+(aq) and O2(g) will be discharged at the
So the same quantity of electricity will produce
anode.
Cl2 : Al 3 : 2
At cathode: K+(aq) and H2O(l); H2O(l) will be reduced.
Therefore, yield of Al = 0.2 mol × 2/3 = 0.13 mol Al
Reaction occurring is 2H2O(l) + 2c– → H2(g) +
Mass Al = 0.13 × M(Al) = 3.5 g
2OH–(aq) OH–(aq) and H2(g) will be discharged at
the cathode. 28 C
Products will be O2(g) and H2(g)
29 The mass of the silver anode will decrease as Ag
This is because H2O has a higher E ⊖ than K+ so is oxidized to Ag+ ions that are released into the
is preferentially reduced at the cathode; H2O has solution. The mass of the cathode (spoon) will
a higher E ⊖ than F− so is preferentially oxidized at increase as a layer of Ag is deposited. Impurities
the anode (assuming the concentration of F− is may be visible collecting as a sludge at the
not high enough to cause it to be discharged). bottom of the electrolyte as they fall from the
25 (a) At the anode, bubbles of gas emitted; at the decomposing anode.
cathode, pinky brown layer of copper metal
deposited. The blue colour of the solution
fades. Challenge yourself
Anode: 2Cl−(aq) → Cl2(g) + 2e−
or 1 H2O2 : H = +1, O= −1
2H2O(l) → 4H+(aq) + O2(g) + 4e− Oxygen is halfway between 0 (element) and −2
depending on the concentration of the (usual oxidation state in compounds), so can
solution. be oxidized (to 0) or reduced (to −2). It will more
Cathode: Cu2+(aq) + 2e− → Cu(s) easily be reduced from −1 to −2 as it is a very
Blue colour fades as the concentration of electronegative element, and so acts mainly as
Cu2+ ions in solution decreases. an oxidizing agent.
43

lOMoARcPSD|20595249
Answers
2 Cl2(aq) + 2NaOH(aq) → NaCl(aq) + NaClO(aq) + above hydrogen in the ECS / Fe is a

H2O(l) better reducing agent than H2 / Fe is
Cl changes from 0 to −1 (reduction) oxidized more readily than H2 [3]
Cl changes from 0 to +1 (oxidation) (ii) −0.28 V [1]
Both changes occur simultaneously. (iii) Co2+ / cobalt(II) ion [1]
(iv) 2Al + 3Fe2+ → 3Fe + 2Al3+ [2]
3 Iodine solution contains the triiodide ion, I3−, in which
the central atom has five electron domains with Award [1] for correct reactants and
two bonding and three non-bonding pairs in the products and [1] for correctly balanced;
equatorial plane. This gives a linear ion with a low ignore states. Do not accept .
charge density, which is able to slip into the coils of (v) To complete the electrical circuit / OWTTE;
the hydrophobic interior of the amylose helix. by allowing the movement of ions [2]
4 Solubility of gases decreases with increasing (b) (i) +2 [1]
temperature as evaporation is higher. So the (ii) +3 [1]
discharge of hot water will lower the dissolved (iii) +2 [1]
O2 content.
Only penalize once if roman numerals
− −19
5 Charge per e = 1.602189 × 10 C are used or if written as 2+ or 3+.
Electrons per mole = 6.02 × 10 mol−1 23
(c) (i)
Therefore, charge per mole = 1.602189 × electron
10−19 C × 6.02 × 1023 mol−1 = 96451.78 C mol−1 flow
6 ∆G = −RT ln Kc and ∆G = −nFEcell

RT ln Kc
Therefore Ecell =
nF
Expressing in terms of log10 and combining all
constants at 298 K:
0.0592
Ecell = log10 Kc
n
NaCl (aq)
battery / source of electricity connected

Practice questions to two electrodes in the solution with
positive and negative electrodes
1 B 2 B 3 D 4 C correctly labelled;
electrons / current flowing from the cell
5 C 6 C 7 A 8 A
to the negative electrode;
9 B 10 A 11 C labelled solution of sodium chloride [3]
12 (a) (i) The voltage obtained when the half-cell If the connecting wires to electrodes are
is connected to the standard hydrogen immersed in the solution [1 max].
electrode; (ii) Na+, H+/H3O+, Cl−, OH− [2 max]
Under standard conditions of 298K and All four correct [2], any 3 correct [1].
1 mol dm−3 solutions;
(iii) hydrogen at (–)/cathode and oxygen at
Electrons flow (in the external circuit) (+)/anode
from the half-cell to the hydrogen
2H+ + 2e− → H2 / 2H2O + 2e− → H2 +
electrode / the metal in the half-cell is
2OH−
44

lOMoARcPSD|20595249
Answers
4OH− → O2 + 2H2O + 4e− / 2H2O → (c) Reduction occurs at the cathode / negative
O2 + 4H+ + 4e− [3] electrode and oxidation occurs at the
Accept e instead of e–; if electrodes anode / positive electrode
omitted or wrong way round [2 max]. Cathode / negative electrode: Na+ + e− → Na
(iv) ratio of H2 : O2 is 2 : 1 [1] Anode / positive electrode: 2Cl → Cl2 + 2e−/
(d) (i) (–)/(cathode) 2H+ + 2e− → H2 / Cl− → 12Cl2 + e−
2H2O + 2e− → H2 + 2OH− Award [1 max] if the two electrodes are not
(+)/(anode) 2Cl− → Cl2 + 2e− [2] labelled/labelled incorrectly for the two half-
equations.
Accept e instead of e–; if electrodes
omitted or wrong way round [1 max]. Overall cell reaction: Na+(l) + Cl−(l) →
Na (l) + 12Cl2(g) [5]
(ii) (–)/(cathode) Na+ + e− → Na
Award [1] for correct equation and [1] for
(+)/(anode) 2Br− → Br2 + 2e− [2]
correct state symbols.
Accept e instead of e–; if electrodes
Allow NaCl(l) instead of Na+(l) and Cl–(l).
omitted or wrong way round [1 max].
(d) Al does not corrode / rust; Al is less dense /
13 (a) Electrolytic cell converts electrical energy to better conductor / more malleable [1]
chemical energy and voltaic cell converts Accept Al is lighter (metal compared to Fe).
chemical energy to electrical energy /
Accept converse argument.
electrolytic cell uses electricity to carry out
a (redox) chemical reaction and voltaic cell (e) Cathode / negative electrode
uses a (redox) chemical reaction to produce Object to be plated
electricity / electrolytic cell requires a power Allow a specific example here, e.g. spoon.
supply and voltaic cell does not. Accept inert metal / graphite.
Electrolytic cell involves a non-spontaneous Do not accept silver halides or their formulae.
(redox) reaction and voltaic cell involves a
Anode / positive electrode
spontaneous (redox) reaction.
Silver / Ag
In an electrolytic cell, cathode is negative
Electrolyte: [Ag(CN)2]− [3]
and anode is positive and vice versa for
a voltaic cell / electrolytic cell, anode is Allow silver nitrate / AgNO3 / silver cyanide /
positive and voltaic cell, anode is negative / any other suitable silver salt/solution.
electrolytic cell, cathode is negative and Do not accept AgCl.
voltaic cell cathode is positive.
14 (a) 2Al(s) + 3Ni2+(aq) → 2Al3+(aq) + 3Ni(s) [2]
Voltaic cell has two separate solutions and Correct reactants and products, award [1].
electrolytic cell has one solution / voltaic cell
Balancing award [1].
has salt bridge and electrolytic cell has no
salt bridge. Ignore state symbols and equilibrium sign.
Electrolytic cell, oxidation occurs at the (b) (+) 1.40 (V) [1]
positive electrode/anode and voltaic cell, (c) aluminium anode / negative electrode
oxidation occurs at the negative electrode/ nickel cathode / positive electrode
anode and vice versa. [2 max] electron movement from Al to Ni
(b) (solid) ions in a lattice / ions cannot move correct movement of cations and anions
(molten) ions mobile / ions free to move [2] through salt bridge [4]
If electron movement shown correctly but
not labelled, award the mark.
45

lOMoARcPSD|20595249
Answers
voltmeter (ii) nitric acid / HNO3 / NO3− / nitrate [1]

−
e e−
V (b) (i) 0.100 × 0.0285
cations salt bridge anions
2.85 × 10−3 (mol) [2]
Al anode Ni cathode
(ii) 2.85 × 10−3 (mol) [1]
−3
(iii) (63.55 × 2.85 × 10 ) = 0.181 g [1]
Allow 63.5.
15 (a) (i) Copper: 0 to +2 / increases by
2 / +2 / 2+ (iv) (0.181
0.456 )
× 100 = 39.7% [1]
Allow zero/nought for 0.
Nitrogen: +5 to +4 / decreases by
(v) (44.2 − 39.7
44.2 )
× 100 = 10 / 10.2% [1]
1 / −1 / 1− [2] Allow 11.3%, i.e. percentage obtained in

Penalize missing + sign or incorrect (iv) is used to divide instead of 44.2%.
notation such as 2+, 2+ or II, once only.
Chapter 10
Exercises
1 (a) carboxylic acid; butanoic acid Cl Cl Cl

(b) halogenoalkane; 1,1-dichloropropane Cl C C C H 1,1,1,2,3-pentachloropropane
(c) ketone; butanone
Cl H H
(d) ester; methyl ethanoate
Cl H Cl
(e) ether; methoxyethane
Cl C C C Cl 1,1,1,3,3-pentachloropropane
(f) ester; ethyl pentanoate
Cl H H
2 (a) CH3(CH2)4COOH
(b) CH3CH2CH2CHO Cl Cl Cl
(c) CH2CH(CH2)2CH3 Cl C C C H 1,1,2,2,3-pentachloropropane
(d) CH2BrCH(CH3)C2H5 H Cl H
or CH2BrCH(CH3)CH2CH3 Cl Cl Cl
(e) HCOOCH2CH3
Cl C C C Cl 1,1,2,3,3-pentachloropropane
(f) CH3OCH2CH2CH3
H H H
(g) CH3C≡CCH3
6 B
3 A 4 D
7 Benzene is a cyclic molecule with a planar
Cl Cl H
framework of single bonds between the six
5 Cl C C C H 1,1,1,2,2-pentachloropropane carbon atoms and six hydrogen atoms. The
Cl Cl H carbon atoms are also bonded to each other
by a delocalized cloud of electrons which forms
a symmetrical region of electron density above
46

lOMoARcPSD|20595249
Answers
and below the plane of the ring. This is a very (b) C2H5COOH(aq) + C4H9OH(aq) →
stable arrangement, so benzene has much lower C2H5COOC4H9(aq) + H2O(l)
energy than would be expected.
14 (a) butanone; orange → green
8 (a) Similar molar mass will mean molecules have (b) methanal; orange → green
approximately equal London (dispersion)
(c) no reaction; no colour change
forces and so differences in boiling point can
be attributed to differences in dipole–dipole 15 Nucleophilic substitution involves an electron-
or hydrogen bonding. rich species (e.g. OH−) attacking an electron-
(b) Solubility in hexane will increase with deficient carbon atom (e.g. in chloroethane),
increasing chain length as the non-polar part leading to substitution of the halogen functional
of the molecule makes a larger contribution group by the nucleophile.
to its structure. C2H5Cl + OH− → C2H5OH + Cl−
9 (a) C5H14(l) + 6O2(g) → 5CO(g) + 7H2O(l) 16 Benzene has a very stable structure as a result
(b) 2C4H10(g) + 13O2(g) → 8CO2(g) + 10H2O(l) of its symmetrical ring of delocalized electrons.
Addition reactions would involve breaking
(c) C3H4(g) + O2(g) → 3C(s) + 2H2O(l)
this ring and therefore decreasing its stability.
10 Bromine + ethane Substitution reactions in which one or more
initiation hydrogen atoms of the ring are replaced by other
UV light atoms or groups preserves the aromatic ring
Br2 2Br• bromine radicals
structure and therefore its stability.
propagation
Br• + C2H6 → C2H5• + HBr 17 (a) CH3CH2CH2CH2Br primary
C2H5• + Br2 → C2H5Br + Br• CH3CH2CHBrCH3 secondary
C2H5Br + Br• → C2H4Br• + HBr C(CH3)3Br tertiary
C2H4Br• + Br2 → C2H4Br2 + Br· (b) The tertiary halogenoalkane reacts by an SN1
mechanism.
termination
S = substitution; N = nucleophilic;
Br• + Br• → Br2
1 = unimolecular
C2H5• + Br• → C2H5Br
(c) RBr → R+ + Br−
C2H + C2H → C4H10
5
•
5
•
18 C
Overall, these reactions show how a mixture of
products is formed. 19 (a) The carbon–halogen bond breaks more
easily in the iodo- and bromo- derivatives
11 (a) CH3CH2CH2CH3 butane
than in the chloro- derivatives, so these
(b) CH3CH2CH(OH)CH3 butan-2-ol compounds more readily undergo
(c) CH3CH2CHBrCH3 2-bromobutane substitution reactions.
12 (a) No observable change. (b) The substitution reaction of OH for Cl occurs
in both these compounds, displacing Cl−
(b) Burns with very smoky flame.
and forming the white precipitate of AgCl,
(c) The bromine water changes from brown to
which darkens on exposure to air. The
colourless.
tertiary halogenoalkane C(CH3)3Cl isomer
13 (a) C2H5OH(l) + 3O2 → 2CO2(g) + 3H2O(l) reacts more quickly than the primary isomer
2C3H7OH(l) + 9O2(g) → 6CO2(g) + 8H2O(l) CH3CH2CH2CH2Cl because it undergoes an
SN1 mechanism, which is faster.
47

lOMoARcPSD|20595249
Answers
20 Alkenes have a double bond which is an electron- H H H

dense region and so is susceptible to attack
I1
by electrophiles which are themselves electron H C C C H
deficient. They undergo addition reactions
H
because they are unsaturated; one of the bonds
in the double bond breaks and incoming groups H H H
can add to the two carbon atoms.
Cl2
When bromine approaches but-2-ene, it is H C C C H
1
polarized by the electron density in the double I H
bond. Electrons in the bromine–bromine bond
are repelled away from the double bond, leading H H H
to the heterolytic fission of the bromine molecule.
The Br+ product now attaches itself to one of H C C C H
the carbon atoms as the carbon–carbon bond
I Cl H
breaks. This produces an unstable carbocation
which then rapidly reacts with the Br − ion. The 23 Concentrated H2SO4 and concentrated HNO3.
product is 2,3-dibromobutane.
The stronger acid H2SO4 protonates the HNO3,
H H H H leading to production of the nitronium ion NO2+.
Br1 This is a strong electrophile which reacts with the
H C C C C H
π electrons of the benzene ring, substituting for
Brδ1
H H.
Brδ2
H H H H 24 (a) Use LiAlH4 in dry ether and heat. The acid is
reduced first to the aldehyde and then to the
Br2
H C C C C H alcohol.
1
[+H]
H Br H CH3CH2COOH C2H5CH2OH
H H H H (b) Nitrobenzene is heated under reflux with tin
and concentrated HCl, and the product is
H C C C C H reacted with NaOH.
[+H]
H Br Br H C6H5NO2 C6H5NH2
(c) Ethanal is heated with NaBH4(aq).
21 But-1-ene + HBr → 2-bromobutane
[+H]
Application of Markovnikov’s rule enables us CH3CHO CH3CH2OH
to predict that the electrophile H+ will add 25 Start with ethanol. Take one portion and oxidize
to the terminal carbon-forming a secondary it using acidified potassium(VI) dichromate
carbocation, as this is stabilized by the positive solution and heat under reflux to allow the
inductive effect of the alkyl groups. Br− will then reaction to go to completion.
add to carbon 2, forming 2-bromobutane. [+O]
C2H5OH CH3COOH
δ+ δ−
22 ICl is polarized: I Cl owing to the greater
The product is ethanoic acid.
electronegativity of Cl than I. So when it
React the ethanoic acid product with another
undergoes heterolytic fission it will form I+ and
portion of the ethanol by warming it in the
Cl−. By application of Markovnikov’s rule, the
presence of some concentrated H2SO4. The
I+ will attach to the terminal carbon, while Cl−
esterification reaction yields ethyl ethanoate.
will add to carbon 2. The product is therefore
1-iodo-2-chloropropane. CH3COOH + C2H5OH → CH3COOC2H5
48

lOMoARcPSD|20595249
Answers
26 React the 1-chlorobutane with NaOH in warm

aqueous solution to convert it into butan-1-ol. Challenge yourself
C4H9Cl + NaOH → C4H9OH + NaCl
Oxidize the butan-1-ol using acidified 1 All four C atoms in the molecule are sp3
potassium(VI) dichromate solution and heat hybridized because they form four single bonds
under reflux to allow the reaction to go to which are tetrahedrally arranged. The nitrogen
completion. atom is also sp3 hybridized, as its four electron
[+O] domains are also tetrahedrally arranged. Note
C4H9OH C3H7COOH that here the hybridization also includes the lone
27 C pair on the nitrogen atom.
28 3-methylhexane: CH3CH2CH(CH3)CH2CH2CH3 2 Complete combustion:

2C2H6 + 7O2 → 4CO2 + 6H2O
H
C: −3 → +4
C Incomplete combustion:
C2H5 C3H7
CH3 2C2H6 + 5O2 → 4CO + 6H2O
C: −3 → +2
29 (a) H H H H H
3 Heterolytic describes breaking of the bond,
H C C C C C H producing two different products. The products
are ions, and the reaction mechanism involves
H H H
attraction of the electron density of the C=C
Z-pent-2-ene double bond to the positive ion.
H H H H 4 The repeating unit in polystyrene is

—CH(C6H5)–CH2—
H C C C C C H
5 The cyanide ion, CN−, and ammonia, NH3, are
H H H H nucleophiles that react with halogenoalkanes in
E-pent-2-ene substitution reactions. They act as ligands with
transition metal ions, forming complexes such as
(b) H Cl Cl H
[Cu(NH3)4(H2O)2]2+ and [Cu(CN)4]3−. They act as
H C C C C H Lewis bases by donating a lone pair of electrons.
For example:
H H
NH3 + BCl3 → NH3BCl3
Z-2,3-dichlorobut-2-ene
6 The order of the reaction with respect to each
H Cl H reactant can be deduced from experiments
H C C C C H in which the concentration of each reactant
in turn is changed, and the initial rate of the
H Cl H reaction then measured. If, for example, the
concentration of halogenoalkane is doubled
E-2,3-dichlorobut-2-ene while the concentration of OH− remains
constant, and the rate is found to have doubled,
then it indicates that the reaction is first order
with respect to halogenoalkane. Examples of this
type of experiment and the interpretation of the
results are given in Chapter 6.
49

lOMoARcPSD|20595249
Answers
7 With bromine water, the water can also take than the trans isomer, and its density is less.
part in the second part of the reaction because cis-Butenedioic acid is a stronger acid because
of its lone pairs. The carbocation is attacked when H+ is lost, the cis anion is more stable than
by water in competition with Br−, and the major the trans form.
product is 2-bromoethanol, CH2BrCH2OH. The
bromine water is decolorized from brown. The
relative concentration of bromoethanol and
Practice questions
1,2-dibromoethane depends on the strength of
the bromine water used.
1 C 2 C 3 D 4 A
8 The –NH2 group in phenylamine is electron
5 A 6 A 7 B 8 C
donating due to conjugation of the lone pair of
electrons on N with the ring electrons. As a result, 9 B 10 B 11 A 12 C
the electron density of the ring is increased,
13 A 14 D
making it more susceptible to electrophilic attack.
In contrast, the –NO2 group in nitrobenzene is 15 (a) A: 1-bromobutane
electron withdrawing due to the electronegativity B: 2-bromobutane
of the nitrogen and oxygen atoms.
C: 2-bromo-2-methylpropane
d2 d2
O O D: 1-bromo-2-methylpropane [4]
N
Penalize incorrect punctuation, e.g.
commas for hyphens, only once.
Accept 2-bromomethylpropane and
1-bromomethylpropane for C and D
Also, the electrons in its double bond conjugate respectively.
with the π electrons in the ring, causing the (b) (i) C / 2-bromo-2-methylpropane;
electron density of the ring to be decreased, unimolecular nucleophilic substitution [2]
making it less susceptible to electrophilic attack.
(ii) RBr → R+ + Br− [1]
9 In both square planar and octahedral Allow use of 2-bromo-2-methylpropane
compounds, geometric isomers can arise due to instead of RBr.
groups having the possibility of being in adjacent
(iii) A / 1-bromobutane / D / 1-bromo-2-
(cis) or in across (trans) positions. In tetrahedral
methylpropane
compounds, all positions are adjacent to each
other, so these isomers are not possible. •• H H −
OH−
HO C Br
10 H H C
CH3CH2CH2 Br
CH3CH2CH2 H
H
C C
O C H C O
H •• H
OH−
O O C + Br −
C
H HO H (CH3)2CH
H
Br
CH2CH2CH3
cis-butenedioic acid
melting point 139 °C
H − H
The cis isomer, maleic acid, has a lower melting
HO C Br C + Br −
point as it forms fewer intermolecular bonds. HO H
(CH3)2CH H CH(CH3)2
The cis isomer is much more soluble in water
50

lOMoARcPSD|20595249
Answers
curly arrow going from lone pair/negative No mark for change to clear, or for decolorized
charge on O in OH– to C with no reference to original colour.
Do not allow curly arrow originating on H (b) Chloroethene:
in OH−. H H
curly arrow showing Br leaving
C C
Accept curly arrow either going from
bond between C and Br to Br in H Cl
1-bromobutane or in the transition state.
No mark if the lone pairs are missing on Cl.
representation of transition state Accept lines, dots or crosses for e– pairs.
showing negative charge, square
Poly(chloroethene):
brackets and partial bonds [4]
Do not penalize if HO and Br are not at [ CH2 CHCl ] n
[2]
180° to each other. n and square brackets are not required.
Do not award fourth mark if OH–C bond Continuation bonds must be shown.
is represented. (c) (hydration of ethene for the manufacture of)
–
(c) (b) (i) no change as [OH ] does not appear ethanol / C2H4 + H2O → C2H5OH; (synthesis
in the rate equation / in the rate determining of) CH3COOH / ethanoic / acetic acid;
step (synthesis of) ethylene glycol / 1,2-ethanediol
(b) (iii) rate doubles as the rate is proportional / ethane-1,2-diol; (synthesis of) drugs /
to [OH–] / OH– appears in the rate- pesticides; (hydrogenation of unsaturated
determining / slow step / first order with oils in the manufacture of) margarine [2 max]
respect to OH– [2] Accept other commercial applications.
Award [1] if correctly predicts no rate change 17 (a) A: H H H
for SN1 and doubling of rate for SN2 without
H C C C Cl
suitable explanation.
(d) rate of 1-bromobutane is faster; C–Br bond H H
is weaker / breaks more easily than C–Cl H C H
bond [2]
H
(e) 2-bromobutane / B; (plane-) polarized light
shone through; enantiomers rotate plane of H H H
B:
plane-polarized light to left or right / opposite
directions (by same amount) H C C C OH
Accept ‘turn’ instead of ‘rotate’ but not H H
‘bend’/‘reflect’. H C H
Physical properties identical (apart from
H
effect on plane-polarized light); chemical
properties are identical (except with other
C: H H
chiral compounds) [5] O
Do not accept ‘similar’ in place of ‘identical’. H C C C H
C
16 (a) Colour change from yellow / orange / rust H H
H H
colour / red / brown to colourless [1]
51

lOMoARcPSD|20595249
Answers
D: H of A and D. M2 (for B) and M5 (for E) may

also be scored for substitution product if
H C H primary chloroalkane used. Penalize missing
H
hydrogens once only in Q7.
H C C Cl (b) CH3CH2COOH + CH3OH →
CH3CH2COOCH3 + H2O
H
H C H [1] for reactants and [1] for products.
(concentrated) sulfuric acid / H2SO4
H
Do not accept just H+ or acid.
E: H methyl propanoate [4]
H C H 18 (a) (the solution changes) from orange to

H green [1]
(b) +6 [1]
H C C OH
Do not accept 6, 6+ or the use of Roman
H numerals unless they have already been
H C H penalized in 2(a).
H (c) Cr2O72– + 14H+ + 6e– → 2Cr3+ + 7H2O [1]

(d) CH3CH2OH → CH3CHO + 2H + 2e + –
Accept condensed formulas. [5]
Cr2O72– + 3CH3CH2OH + 8H+ → 2Cr3+ +
Award [1 max] if A and D are other way
3CH3CHO + 7H2O [3]
round (and nothing else correct). Award
[2 max] if A and D are other way round For second equation award [1] for correct
but one substitution product B or E is reactants and products and [1] for correct
correct based on initial choice of A and D. balancing.
Award [3 max] if A and D are other way (e) H+ is a reactant / OWTTE [1]
round but both substitution products B (f) ethanoic acid / CH3COOH / acid [1]
and E are correct based on initial choice
Accept acetic acid.
Chapter 11
Exercises
1 The smallest division is 1 so the uncertainty is ±0.5. (d) 3 × 10 or 3.0 × 10 °C (unspecified)
2 The missing diamond has a mass of between 4 (a) 4 (b) unspecified

9.87 and 9.97 g. (c) 3 (d) 4
The found diamond has a mass between 9.9
5 A 6 A 7 D 8 A
and 10.3 g.
As the ranges overlap, it could be the missing 9 A 10 D 11 C
diamond. 12 The average value = 49.0 s
−2 2 3
3 (a) 4 × 10 g (b) 2.22 × 10 cm The uncertainty in the measurements is given
as ±0.1 s but the results show that there is
(c) 3.0 × 10−2 g
52

lOMoARcPSD|20595249
Answers
additional uncertainty, suggesting that the value 26 B 27 C 28 C

could be anywhere between 48.8 and 49.2 s. So
29 A (the spectrum on the left) corresponds to
the value could be quoted as 49.0 s ± 0.2 s.
CH3CH2CHO
13 D 14 D 15 B 16 B B (the spectrum on the right) corresponds to
17 C 18 A 19 C CH3COCH3
Similarities
20 Number of moles = concentration ×
Both have a molecular ion corresponding to 58.
volume/1000
Differences
= 1.00 × 10.0/1000 = 0.0100 mol
A has peaks corresponding to 29 (CH3CH2+) and
% uncertainty in concentration = (0.05/1.00) ×
28 (loss of CH3CH2).
100 = 5%
B has a peak corresponding to 43 (loss of CH3).
% uncertainty in volume = (0.1/10.0) × 100 = 1%
% uncertainty in number of moles = 5% + 1% = 30 (a) Mass / charge Fragment
6%
15 CH3+
Absolute uncertainty in number of moles =
29 C2H5+
(6/100) × 0.0100 = 0.0006
Number of moles = 0.0100 ± 0.0006 mol 43 C3H7+ (loss of CH3)
21 (a) ∆T = 43.2 − 21.2°C = 22.0°C 58 C4H10+
absolute uncertainty = (±)0.2°C (b) CH3CH2CH2CH3

(b) % uncertainty = 0.2/22.0 × 100% ≈ 1%
31 Molecule Corresponding saturated IHD
(c) ∆H = −4.18 × 22.0/0.500 = −184 kJ mol−1 non-cyclic molecule
(d) 1% C6H6 C6H14 4
(e) absolute uncertainty = 1/100 × 184 = CH3COCH3 C3H8O 2
(±) 2 kJ mol−1 C7H6O2 C7H16O 5
(f) experimental value for ∆H = −184 (±) 2 kJ C2H3Cl C2H5Cl 1
mol−1 C4H9N C4H9NH2 1
The literature value is outside this range. C6H12O6 C6H14O6 1
The random errors involved in reading 32 B 33 D 34 B

the thermometer do not account for this
35 (a) Empirical formula CH2O. Molecular formula
difference.
C2H4O2.
There are systematic errors. The
assumptions on which the calculation is (b) IHD = 1
based are not strictly valid. Some of the heat (c) O
of reaction passes into the surroundings and
the other uncertainties in the measurements CH3 C OH
cannot be ignored. It should also be noted 36
that the standard value for ΔH refers to
standard conditions of 298 K and 100 kPa.
symmetric stretch asymmetric stretch symmetric bend
22 B 23 A 24 B IR active IR active IR active
25 Concentration of chromium (from graph for 37 B

absorbance of 0.215) = 3.34 µg dm−3
53

lOMoARcPSD|20595249
Answers
38 The polarity (of bond or molecule) changes as 49 X-ray crystallography.

the bonds are bent or stretched.
50 Monochromatic means all the X-rays have the
39 Hex-1-ene shows an absorption in the range same wavelength.
1610–1680 cm−1 due to the presence of the The angle of diffraction depends on the
C=C bond. wavelength. If the X-rays have different
40 C–H bond wavelengths, different diffraction angles/pattern
would be obtained. It would be impossible to
41 CH3OCH3 match the angles with the wavelengths.
42 C 43 A 51 Hydrogen atoms have a low electron density.
44 (a) 2 (b) 1 52 The atoms must have a regular arrangement if
(c) 1 (d) 2 an ordered diffraction pattern is to be produced.
45 The H atoms are in three different environments. 53 (a) C6H5CH3

There are three peaks in the 1H NMR spectrum.
(b) Hydrogen atoms do not appear because of
46 (a) CH3COCH2CH3 their low electron density
(b) Type of Chemical No. of H Splitting (c) The saturated non-cyclic compound is C7H16
hydrogen atom shift / ppm atoms pattern
IHD = 12(16 − 8) = 4 (the IHD of a benzene
CH3CO 2.2–2.7 3 1 ring = 4)
COCH2CH3 2.2–2.7 2 4
CH2CH3 0.9–1.0 3 3
Challenge yourself
47
of peaks
Splitting
No. of H
Number
pattern
atoms
Chemical
Compound 1 Y1ave = Y2ave = 3
shift / ppm
(−2×(−2)) + (−1×(−1)) + 0 + (1 × 1) + (2 × 2)
R=
CH3CHO 2 2.2–2.7 3 2 (−2)2 + (−1)2 + 02 + 12 + 22
=1
9.4–10.0 1 4
2 Y1ave = Y2ave = 3
CH3COCH3 1 2.1 6 1
(−2 × 2) + (−1 × 1) + 0 + (1×(−1)) + (2×(−2))
R=
48 (a) Possible structures: CH3CH2COOH, (−2)2 + (−1)2 + 02 + 12 + 22
= −1
CH3COOCH3, HCOOCH2CH3.
(b) The peak at 8.0 ppm corresponds to 3 Y1ave = Y2ave = 3
R–COOH. There is no splitting as there are (−2×(−2)) + (−1 × 2) + 0 + (1 × 1) + (2 × (−1))
R=
no hydrogen atoms bonded to neighbouring 22 + 12 + 02 + 12 + 22
carbon atoms. 4−2+1−2
= = 0.10
The peak at 1.3 ppm corresponds to a CH3 10
group. The peak is split into a triplet because 4 Saturated hydrocarbons have the general
there is a neighbouring CH2 group. formula CnH2n+2
The peak at 4.3 ppm corresponds to the For CnHp:
R–CH2–COO group. The peak is split into a H atoms needed = 2n + 2 − p
quartet as there is a neighbouring CH3 group.
H2 molecules needed = IHD = 12(2n + 2 − p)
Molecular structure: CH3CH2COOH
For CnHpOq:
54

lOMoARcPSD|20595249
Answers
Oxygen forms two covalent bonds. Comparing only this compound would give a peak in the
ethane, C2H6: C–H, to ethanol, C2H5OH: C–O–H, 9.4–10 ppm region / OWTTE [2 max]
we see that the presence of O has no impact on (b) 2.5 ppm peak
the IHD:
CH3–CO–CH3 also has hydrogen atoms on
IHD = 12(2n + 2 − p) a carbon next to the >C=O group [2]
For CnHpOqNr: (c) (i) 1700–1750 cm−1 (>C=O) [1]
Nitrogen forms three covalent bonds. Comparing (ii) 1610–1680 cm−1 (>C=C<) /
C–H to C–N–H, we see that the presence of 3200–3600 cm−1 (–O–H) [1]
one N increases the IHD by 1:
(d) C3H6O+ and m/z = 58
IHD = 12(2n + 2 − p + r)
C2H5+ and m/z = 29
For CnHpOqNrXs:
CHO+ and m/z = 29
A halogen, X, forms one bond, like hydrogen, so
CH3+ and m/z = 15 [2 max]
can be treated in the same way:
Penalize missing + sign once only.
IHD = 12(2n + 2 − p + r − s)
6 (a) (stretches/vibrations in) HBr involve change
5 E = hf
in bond dipole / (stretches/vibrations in) Br2
E = 6.63 × 10−34 J s × 3.0 × 1014 s−1 = 1.989 ×
do not involve change in bond dipole [1]
10−19 J
(b) (i) I: O–H
The energy of one mole of photons = 6.02 ×
II: C–H
1023 mol−1 × 1.989 × 10−19 J
III: C=O [3]
= 120 kJ mol−1
Award [2] for C–H for I and O–H for II.
6 1/λ = 2100 cm−1 = 210 000 m−1
(ii) m/z 102: molecular ion peak /
λ = 1/210 000 m = 4.76 × 10−6 m (CH3)3CCOOH+ / C5H10O+ / M+
f = 3.00 × 108 × 210 000 = 6.30 × 1013 s−1 m/z 57: (CH3)3C+ / (M–COOH)+ / C4H9+
m/z 45: COOH+ [3]
7 This is the Bragg equation. This is covered in
more detail in Chapter 12. Penalize missing + once only.
(iii) (H of) COOH group [1]
(iv) nine hydrogens in the same
Practice questions environment / (CH3)3C– (group) [1]
CH3 O
1 B 2 C 3 C 4 A (v) (CH3)3CCOOH / (CH3)3CCO2H / H3C C C C OH [1]

CH3
5 (a) Compound:
(vi) no peak at 11.5 ppm in spectrum of
CH3–CH2–CHO isomer / different chemical shift values
Explanation: [1 max] four peaks (instead of two) / different
only this compound would give 3 peaks / number of peaks;
OWTTE Three of these peaks can be split in actual
only this compound has H atoms in 3 spectrum, so allow for this in answers if
different chemical environments / OWTTE exactly four peaks is not stated.
only this compound has protons in ratio different integration trace / different
3:2:1 in each environment / OWTTE areas under the peaks / integration trace
55

lOMoARcPSD|20595249
Answers
would have a 3:2:2:3 peak area presence of peak between 1700 and 1750
ratio [2 max] cm−1 / peak for C=O
Do not award mark if incorrect peak area absence of peak between 1610 and 1680
ratios are given for the structure drawn cm−1 / peak for C=C [2 max]
in (v). (b) H H
O
7 change in bond length / bond stretching / H C C C
asymmetric stretch
H
H H
change in bond angle / bending (of molecule)
Accept CH3CH2CHO.
Allow [1 max] for only stating vibrations.
3:2:1
induces molecular polarity / dipole moment /
OWTTE [3] Ignore order.
ECF if structure is incorrect only if its NMR
8 (a) C3H8O+ [1]
spectrum contains three peaks. [2]
Accept more detailed formula such as
CH3CH2CH2OH+. 11 (a) (i) (2-)methylpropan-2-ol
(b) CH3O+ / CH2OH+ [1] the (H atoms in the three) –CH3 groups
are responsible for the peak at 1.3 ppm
For (a) and (b), if charge is missing penalize
once only. the –OH hydrogen atom is responsible
for the peak at 2.0 ppm
(c) (A) CH3CH2CH2OH
Accept explanations with suitable
Accept more detailed formula.
diagram. [3]
(B) CH3CH(OH)CH3 [2]
(ii) (2-)methylpropan-1-ol
Accept more detailed formula.
the first peak (at 0.9 ppm) is due to
Hydrogen(s) missing, penalize once only.
the (H atoms in the) two –CH3 groups
Award [1] if both structures correct but the (bonded to the second carbon atom) /
wrong way round. (CH3)2CHCH2OH
9 (a) A: O–H the peak at 3.4 ppm is due to the
B: C=O (H atoms in the) –CH2– group /
(CH3)2CHCH2OH
C: C–O
Accept explanations with suitable
Award [2] for three correct, [1] for two
diagram. [3]
correct. [2]
(b) (i) butan-1-ol and butan-2-ol
(b) m/z = 74: C2H5COOH+ / C3H6O2+
74: M+ / C4H10O+ / CH3CH2CH2CH2OH+
m/z = 45: COOH+
and CH3CH2CH(OH)CH3+
m/z = 29: C2H5+
59: C3H7O+ / (M – CH3)+ /
Penalize missing + charge once only. CH2CH2CH2OH+ and CH2CH(OH)CH3+ /
Do not award mark for m/z = 29: CHO+. [3] CH3CH2CH(OH)+
(c) –COOH [1] 45: C2H5O+ / (M – C2H5)+ / CH2CH2OH+
(d) CH3CH2COOH / CH3CH2CO2H and CH(OH)CH3+
More detailed structural formula may be given. [1] Accept explained answers instead of
formulas. [4]
10 (a) absence of peak between 3200 and 3600
cm−1 / above 3000 cm−1 / peak for OH
56

lOMoARcPSD|20595249
Answers
(ii) butan-1-ol Do not accept answers with reference to

13
+
CH2OH / (M – C3H7) + C/14C isotopes and peak at m/z = 61.
Penalize missing + signs once only in Do not accept C2H3O2+ / C3H7O+ does
parts (b)(i) and (ii). [2] not exist. [1]
(c) they all contain O–H (b) (i) A: C=O and B: C–O
they all contain C–H No mark if two bonds are given for
A or B.
they all contain C–O
Ignore names if incorrect. [1]
Award [1 max] for same functional groups/
bonds. [2 max] (ii) ester
Do not accept COO. [1]
12 D could be CH3CH2COOCH3 or
(c) (i) H O H H [1]
CH3COOCH2CH3
this is because there are 3 peaks / 3:2:3 ratio H C C O C C H /
explanation of splitting into a singlet, a triplet and H H H
a quartet
CH2CO2CH2CH3
methyl propanoate / CH3CH2COOCH3 is correct
isomer because of higher chemical shift value of
(ii) [3]
peak area
Chemical
singlet (3.6 instead of 2.0–2.5) [4]
Splitting
Relative
pattern
shift /
Peak
ppm
13 (a) (i) 88
Do not award mark if units are given.
First 2.0 3 Singlet
C4H8O2+ [2]
Second 4.1 2 Quartet
(ii) CH3CH2+ /C2H5+ / CHO+
Only penalize once for missing charge in Third 0.9–1.0 1 Triplet
(a)(i) and (ii). [1] (iii) (quartet means) neighbouring C:
(iii) C2H3O2 produced has no charge / has 3 H atoms [2]
fragment produced after loss of C2H5
from molecular ion has no charge
Accept fragment(s) too unstable,
fragment breaks up etc.
57

lOMoARcPSD|20595249
Answers
Chapter 12
Exercises
1 A
2 Substance χaverage Δχ % ionic character Bonding

Cl2O 3.3 0.2 6 (Polar) covalent
PbCl2 2.5 1.4 44 Polar covalent
Al2O3 2.5 1.8 56 Ionic
HBr 2.6 0.8 25 Polar covalent
NaBr 1.95 2.1 66 Ionic
3 Substance χaverage Δχ % ionic character Bonding

van Arkel-Ketelaar Triangle % % Polar covalent
of Bonding covalent ionic
8 92
3.0 electronegativity
difference
2.5 ∆ = |a − b| ionic
25 75
2.0
CuO
∆ eneg
1.5 50 50
CuO 2.65 1.5 47 polar
1.0 covalent 75 25
0.5
metallic covalent
0.0 100 0
0.79 1.0 1.5 2.0 2.5 3.0 3.5 4.0
average electronegativity ∑ = (a + b)
2
4 Metal atoms can slide across each other with the to aluminium atoms: Al3++ 3e− → Al
metallic bonding not breaking as the delocalized (d) Aluminium is more reactive than hydrogen.
electrons can move to accommodate the Hydrogen gas would be produced as the
changes in the lattice. hydrogen from the water is reduced in
preference to the aluminium.
The ionic and covalent bonds are directional
and more rigid in ceramics. They resist changes (e) Aluminium oxide is only 56% ionic based
in the atomic arrangement but will break if the on electronegativity values. The ions are not
applied forces are too strong. completely free in the molten compound.
5 Concrete can contain iron or carbon fibres. If (f) Oxygen is produced at the anode from the
these are connected into a network within the oxide ions:
concrete the material will conduct electricity 2O2− → O2 + 4e−
along the network. The oxygen reacts with the carbon to
produce carbon dioxide:
6 (a) Bauxite
C + O2 → CO2
(b) Aluminium is more reactive than carbon.
(c) Aluminium ions are attracted towards the 7 At the cathode

negative electrode where they are reduced Cu2+ + 2e− → Cu
1 mol 2 mol 1 mol
58

lOMoARcPSD|20595249
Answers
n(Cu)/n(e−) = 1/2 2Fe2O3(s) + 2CH4(g) + O2 → 4Fe(l) + 2CO2(g) +

n(Cu) = (1/2)n(e ) − 4H2O(l) Balanced
0.100 F = 0.100 mol of e− 10 (a) TiO2 + 2C + 2Cl2 → TiCl4 + 2CO
n(Cu) = 0.0500 mol
(b) TiCl4 + 2Mg → Ti + 2MgCl2
m(Cu) = 0.0500 mol × 63.55 g mol−1
= 3.18 g 11 The alloy is stronger than the pure metal.
Adding atoms of different size disrupts the
At the anode
regular metal lattice so that it is difficult for one
2Cl− → Cl2 + 2e−
2 mol 1 mol 2 mol layer to slide over another. Alloying can make
n(Cl2)/n(e−) = 1/2 the metal harder, stronger and more resistant to
n(Cl2) = (1/2)n(e−) corrosion.
0.100 F = 0.100 mol of e− 12 All of the electron spins are paired in diamagnetic
n(Cl2) = 0.0500 mol elements.
V(Cl2) = 0.0500 mol × 22.4 dm3 mol−1 Atoms are paramagnetic if they have unpaired
= 1.1 dm3 electrons. So, to determine whether the
8 n(e−) = 0.0965 A × 1000 s/96 500 C mol−1 = elements are paramagnetic or diamagnetic, we
96.5/96 500 = 0.00100 mol need to consider the electron configuration for
each element.
n(Ti) = 0.011975/47.9 = 0.000250 mol
No. of
n(e−)/n(Ti) = 4 Electron Magnetic
Element unpaired
config. behaviour
Ti is in the +4 state. Formula: TiCl4 electrons
Na [Ne]3s1 1 Para
9 Fe2O3(s) + CH4(g) + O2 → 2Fe(l) + CO2(g) + H2O(l)
2
Unbalanced Mg [Ne]3s 0 Dia
2 1
Al [Ne]3s 3p 1 Para
Balance the elements only present in a
Si [Ne]3s23p2 2 Para
combined state first.
P [Ne]3s23p3 3 Para
Balance the C and H: 2 4
S [Ne]3s 3p 2 Para
Fe2O3(s) + CH4(g) + O2 → Fe(l) + CO2(g) + 2H2O(l) 2 5
Cl [Ne]3s 3p 1 Para
Unbalanced 2 6
Ar [Ne]3s 3p 0 Dia
Balance the Fe and O:
Phosphorus has the most unpaired electrons
Fe2O3(s) + CH4(g) + 12O2 → 2Fe(l) + CO2(g) + and so is the most paramagnetic.
2H2O(l) Balanced
13 Atom K Sc V Mn Ga As
1 1 2 3 2 5 2
Electron [Ar]4s [Ar]3d 4s [Ar]3d 4s [Ar]3d 4s [Ar]3d 4s 4p [Ar]3d104s24p3
10 2 1
configuration
No. of 1 1 3 5 1 3
unpaired
electrons
K, Sc, Ga < V, As < V
59

lOMoARcPSD|20595249
Answers
14 (a) Positive argon ions and (free) electrons. An activated complex corresponds to a
(b) Argon, as it is present in the plasma. maximum in the energy and a reaction
intermediate corresponds to a local
(c) ICP-MS
minimum in energy. Reaction intermediates
(d) ICP-AES , ICP-MS is less effective with non-
can in theory be isolated.
metals as they have higher ionization energies
(b) Heterogeneous catalysts are in a different
and so form positive ions less readily.
phase from the reactants; they can be easily
15 (a) Different calibrations are produced for each removed by filtration.
electron transition so three transitions are (c) They have a large surface area per unit
analysed. mass for reactants to be adsorbed and their
(b) It produced 3.00 × 107 counts in one surface structure can be modified to improve
minute = 0.0500 × 107 c s−1 = 5.00 × effectiveness.
105 c s−1 = 500 kc s−1 (d) Toxicity of the nanoparticles is dependent
[Hg] = 1.95 µg dm−3 on their size, so need to regulate for type of
(c) 798 kc s−1 material and size of particles.
(d) Series 2, as it has the steepest gradient;
20 (a) Liquid Liquid crystal
small differences in concentration can be
detected with large differences in count rate. Molecular disordered disordered
arrangement
16 0.37% by mass Molecular disordered ordered
orientation
17 Transition metals are effective heterogeneous
catalysts as they form weak bonds to small (b) The phase transitions of thermotropic liquid
reactant molecules which allow them to come crystals depend on temperature.
together with the correct orientation. The phase transitions of lyotropic liquid
The ability of transition metals to show variable crystals depend on both temperature and
oxidation states allows them to be particularly concentration.
effective homogeneous catalysts. (c) The molecules/ions group together to form a
18 (a) Lower temperatures needed so reduced spherical arrangement; the hydrophilic heads
energy costs. are exposed to water, shielding the non-polar
tails.
Catalysts act selectively, increasing the yield
of the desired product. They are not used up 21 Thermotropic liquid crystal materials are pure
and so can be reused over long periods of substances that show liquid crystal behaviour
time. over a temperature range between the solid and
(b) Sulfur impurities block the active sites of the liquid states. Example: biphenyl nitriles.
catalyst; the impurities are adsorbed on the Lyotropic liquid crystals are solutions that show
catalyst surface more strongly than reactant the liquid crystal state at certain concentrations.
molecules. Examples: soap and water, Kevlar® in solution.
19 (a) An activated complex is an unstable 22 (a) Low reactivity of C–H bond due to high
combination of reactant molecules that bond energy and low polarity.
can go on to form products or fall apart to (b) Increases polarity. Molecule can change
form reactants. A reaction intermediate is orientation when an electric field is applied.
a species that is produced and consumed
during a reaction but does not occur in the 23 (a) C24H23N
overall equation.
60

lOMoARcPSD|20595249
Answers
(b) The addition of a benzene ring makes the 126.15

Atom economy = × 100% = 35.0%
molecule more rigid and rod-shaped. 360.42
(b)
24 (a) A
CH2
(b) There are strong C–C covalent bonds
within the chains and relatively strong NH
intermolecular forces between the large
polymer chains. N N
( )
25 (a) H CH3 HN N NH
CH2 CH2
C C
H H n (c) There are relatively weak intermolecular

forces between the chains in polyethene.
(b) These forces are broken when the solid
H CH3 H CH3 H CH3 H CH3 H CH3
melts but are reformed when the liquid is
isotactic polypropene cooled. The crosslinks between the chains
(c) Isotactic polypropene has a regular structure in the thermosetting resin are made from
with the methyl groups pointing in the same strong covalent bonds. When heated to high
direction and so is crystalline and tough. temperature the resin does not melt but burns.
(d) Mr = (3 × 12.01) + (6 × 1.01) = 42.09 (d) There is extensive cross-linking in

thermosetting plastics which means they
n = 2.1 × 106/42.09 = 50 000
cannot be reshaped and do not melt when
(e) The chains in a polymer are not all the same heated.
length.
Elastomers have very limited cross-links
26 (a) The pure form, which has strong diplole– which knot some chains together and
dipole interactions between the chains, is prevent molecules slipping across each
hard and brittle. The addition of plasticizers other without restricting the freedom of the
allows the chains to slip across each other molecules to coil and uncoil.
and makes the plastic more flexible.
28 (a) Polystyrene can act as a good shock
(b) The non-expanded form of polystyrene is absorber. Its low density will reduce
a colourless, transparent, brittle plastic. transport costs and make it easier to handle.
The expanded form is opaque with a lower
(b) A volatile hydrocarbon is added during
density. It is a better insulator and shock
the polymerization process. The volatile
absorber.
hydrocarbon turns into a gas, forming
The expanded form is produced by bubbles that force the surrounding polymer
heating polystyrene beads with a volatile to expand and take the shape of the mould.
hydrocarbon such as pentane. The pentane
evaporates and causes bubbles to form in 29 (a) No. of diameters = 10 × 10−6 m/1 × 10−9 m
the plastic. = 10−5/10−9 = 104 = 10 000
(b) Strong covalent C–C bonds must be broken.
27 (a) Relative molar mass of reactant =
(6 × 12.01) + (24 × 1.01) + (12 × 14.01) + (c) Range of tube lengths with different structures
( 6 × 16.00) = 360.42 lead to a less regular structure in the solid,
which reduces strength. As properties
Relative molar mass of desired product =
are sensitive to tube length, it is difficult to
(3 × 12.01) + (6 × 1.01) + (6 × 14.01) = 126.15
produce tubes with required properties.
61

lOMoARcPSD|20595249
Answers
(d) Large surface area for reactants to be (d) Natural polymers (e.g. starch, cellulose or
adsorbed; the shape and size of the tubes protein) can be added. Bacteria can break
make them shape-selective catalysts, only down the natural polymers and so the bag is
reactants of the appropriate geometry are broken down into smaller pieces.
able to interact effectively with the active sites.
33 Method Advantages Disadvantages
(e) Quantum effects predominate and the
electrons behave like waves; the length of landfill efficient not popular with
method to locals; needs to
the tube affects the behaviour of electrons;
deal with large be maintained and
the tubes are conductors or semiconductors volumes monitored after
depending on the length. use
30 (a) The size of the nanoparticles is similar to the incineration reduces can cause
volume; energy pollutants such as
wavelength of harmful UV radiation. UV is
source greenhouse gases
scattered and not absorbed. and dioxins
(b) Toxicity of the nanoparticles is dependent
34 Advantages: saves natural resources; saves
on their size, so need to regulate for type of
energy; reduces pollution
material and size of particles.
Disadvantages: materials need to be sorted
31 (a) Approx. 25 atoms high
35 (a) 1–5
Each C atom has a diameter of 2 × 75 ×
10−12 m and each O atom has a diameter of (b) 1–4
2 × 64 × 10−12 m 36 Both molecules have C–H bonds so they have
Approximate length = 25 × 2 × 70 × 10−12 m strong absorptions between 2850 and 3090
= 3.5 × 10−9 m cm−1.
(b) Scanning tunnelling microscope (STM) or The monomer has a C=C bond not found in
atomic force microscope (AFM). the polymer so it will have a weak absorption at
1620–1680 cm−1.
32 (a) Plastics are easily moulded; they are non-
biodegradable; they have low density. 37 (a) A
(b) Method Advantages Disadvantages (b) A: The resistance is zero at very low
temperature due to the formation of Cooper
landfill simple plastics are not
method to biodegradable; electron pairs. The crystal structure is
deal with limited sites distorted at low vibrational energies by the
large volumes presence of electrons, and pairs are more
incineration reduces CO2 is a difficult to impede than single electrons.
volume; greenhouse
B: The resistance decreases as the reduced
plastics are gas; CO is
concentrated poisonous; HCl vibrational energies of the ions in the lattice
energy produced from offer reduced resistance to the passage of
source combustion of single electrons.
PVC causes
acid rain 38 The electrons are given energy as they are
recycling conserves plastics need to accelerated by the power source.
natural be sorted They collide with the ions in the lattice and pass
resources
on some of their kinetic energy.
(c) Bacteria do not have the enzymes needed The average vibrational energy and thus
to break the C–C bonds present. temperature of the ions increases.
62

lOMoARcPSD|20595249
Answers
39 Type 1 superconductors are metals or alloys. Density = (4 × 196.97/6.02 × 1023)/(407 ×

They only exhibit superconductivity at very low 10−12)3 g m−3
temperatures (<20 K). = 19.4 × 103 kg m−3
They lose their superconductivity suddenly as 43 nλ = 2d sin θ
the temperature or magnetic field strength is
With n = 1 (θ = 17.9°)
increased.
d = λ/2 sin θ
Type 2 superconductors are ceramic metal
compounds. d = 150 × 10−12 m/(2 × sin(17.9°)) = 244 ×
10−12 m
Some can exhibit superconductivity at higher
temperatures (<100 K). Assuming the atoms are touching
They lose their superconductivity gradually as R = d/2 = 122 × 10−12 m

the temperature or magnetic field strength is 44 –(–NH–(CH2)6–NH–CO–(CH2)8–CO–)n–
increased.
45 O
40 Location Number
Contribution
Total
of atoms of atoms atoms HO C
C OH
Corner 8 8 × (1/8) 1 H CH3
There is one atom.
46 (a) [O CH2 CH2 CH2 O CO CH2 CH2 CO ]
n
+ H2O
41 (a) The diagonal of the cube = 4rM
(b) [ HN CH2 (CH2)4 CH2 NH CO CH2 CH2 CO ] + HCl
The length of a unit cell = 4rM / •√3 = (4 × O O
n
220 / •√3) × 10−12 m (c) [O CH2 CH2 CH2 O C NH (CH2)3 NH C O ]

n
−12
= 508 × 10 m
47 (a) The primary amine and carboxylic acid
(b) The volume of a cube = (508 × 10−12)3 m3 groups.
No. of atoms = 2 (b) H2O
Mass of individual atom = 39.10/6.02 ×
1023 g
Mass of unit cell = 2 × 39.10/6.02 × 1023 g
(c)
CO [ NH CONH CONH CO ] n
NH2
(d) The polymer formed has straight chains.

Density = (2 × 39.10/6.02 × 1023)/ Hydrogen bonds can form between the
(508 × 10−12)3 g m−3 closely packed chains.
= 9.91 × 105 g m−3 (e) The C, H, N and O atoms have a lower
= 991 kg m −3
relative atomic mass than Fe. The atoms
in Kevlar® are not close packed, unlike in a
42 (a) The diagonal a face = 4rM
metal.
The length of a unit cell = 4rM / •√2 = (4 ×
144 / •√2) × 10−12 m 48 (a) H CH3
= 407 × 10−12 m C C
−12 3 3
(b) The volume of a cube = (407 × 10 ) m
H H
No. of atoms = 4
(b) CH3 O
Mass of individual atom = 196.97/6.02 ×
1023 g HO CH C OH
Mass of unit cell = 4 × 196.97/6.02 ×1023 g
63

lOMoARcPSD|20595249
Answers
(c) H CH3 56 Fe2+ + H2O2 → Fe3+ + •OH + OH−

Fe2+ + •OH → Fe3+ + OH−
C C
2Fe2+ + H2O2 → 2Fe3+ + 2OH−
H CO2CH3
57 (a) O2−• + Fe3+ → O2 + Fe2+
49 Heavy metal ions interfere with the function of
H2O2 + Fe2+ → Fe3+ + OH− + OH•
key enzymes. They bind to the proteins instead
(b) The second step.
of essential ions such as Mg2+ or Ca2+ and so
interfere with key biochemical processes. (c) Oxidation number = −12
One electron is transferred to Fe3+, which is
50 (a) The ligand has two O atoms which can form
reduced to Fe2+.
dative coordinate bonds. It is a bidentate
ligand.
(b) Each ox forms two bonds. Coordination

number = 6. Oxidation state = +3
Challenge yourself
51 NiS(s) Ni2+(aq) + S2−(aq) 1 (a) The molecule is rigid and rod-shaped.
If the solubility is s: [Ni2+(aq)] = s; [S2−(aq)] = s (b) Thermotropic.
Ksp = [Ni2+(aq)] [S2−(aq)] = s2 = 2.0 × 10−26 2 (a) The observer can see nothing. The whole
area would appear dark as the polarizer and
s = √2.0 × 10−26
analyser are crossed.
= 1.4 × 10−13 mol dm−3 (b) The whole area would appear light as the
liquid crystal rotates the plane of polarization,
52 (a) Ksp = [Pb2+(aq)] [S2−(aq)]
so light is now transmitted by the analyser.
(b) Ksp = [Cu+(aq)]2 [S2−(aq)]
(c) In regions where there is no applied voltage
(c) Ksp = [Al3+(aq)] [PO43−(aq)]
the liquid crystal rotates the plane of
(d) Ksp = [Ni2+(aq)] [OH−(aq)]2 polarization so light is now transmitted by
53 (a) 1.3 × 10−5 mol dm−3 the analyser. In regions where there is voltage
applied the liquid crystal molecules align with
(b) [Ag+(aq)] [Cl−(aq)] = 1.6 × 10−10
the electric field and no longer rotate the
1.6 × 10−10
[Ag+(aq)] = plane of polarization. The observer would see
0.100
= 1.6 × 10−9 mol dm−3 a dark circle surrounded by light.
54 (a) s2 (b) 4s3 3 The halogen atoms have a larger mass and so
C–X bonds vibrate at a lower frequency.
(c) 4s3 (d) 108s5
(e) 27s4 4 ON(Ca) = +2
ON(O) = −2
55 (a) Ksp = [Pb2+] [S2−] = 1.30 × 10−28
ON(Ti) = 6 − 2 = +4
(b) [Pb2+] = [S2−]
5 ON(Ba) = +2
[Pb2+] = √1.30 × 10−28
ON(O) = −2
= 1.14 × 10−14 mol dm−3
ON(Y) = +3
(c) As the product of the concentrations is
constant, an increase in [S2−] will lead 3 × ON(Cu) = 14 – 4 – 3 = +7
to a decrease in [Pb2+] and Pb2+ will be ON = +7/3 = +213
precipitated out of solution. Two of the Cu ions are Cu2+ and one is Cu3+.
64

lOMoARcPSD|20595249
Answers
6 There are four atoms in the unit cell so the 12 [H2O] = n(H2O)/V(H2O)
volume occupied = 4 × volume of one atom Consider a 1 dm3 sample of H2O with a mass of
Assuming the atoms are spherical: 1.000 × 103 g
Volume = 4 × (4/3)πr3 n(H2O) = m(H2O)/M(H2O)
Edge of a unit cell = (4 / √‾2)r = 1.000 × 103/(16.00 + 2(1.01))
Volume of unit cell = ((4 / √‾2)r)3 = 55.49 mol dm−3
Volume occupied = [(16 / 3)πr3 / ((4 / √‾2)r)3] × 13 If the solubility is s: [Mm+(aq)] = ps; [Xn−(aq)] = qs
100%
Ksp = [Mm+(aq)]p [Xn−(aq)]q
= [(√‾2)3 ×π / 12] × 100%
= (ps)p(qs)q
= 74%
= ppqqsp+q
7 There are two atoms in the unit cell so the
volume occupied = 2 × volume of one atom
Assuming the atoms are spherical: Practice questions
3
Volume occupied = 2 × (4/3)πr
Edge of a unit cell = (4 / √‾3)r 1 (a) (i) melting point of the cryolite solution is
much lower than the melting point of
Volume of unit cell = ((4 / √‾3)r)3
alumina / Al2O3 / it lowers the melting
Volume occupied = [(8 / 3)πr3 / ((4 / √‾3)r)3] × 100% point of the mixture / cell operates at
= [(√‾3)3 ×π / 24] × 100% lower temperature [1]
= 68% Allow lowers melting point or lowers
melting point of aluminium oxide.
8 Element No. of Position Total number
atoms of atoms Do not allow lowers melting point of
aluminium.
Ca 1 Centre 1×1=1
(ii) Positive electrode:
O 12 Edges 12/4 = 3
2O2− → O2 + 4e− / O2− → 12O2 + 2e−
Ti 8 Corners 8 × 1/8 = 1 Negative electrode:
Formula: CaTiO3 Al3+ + 3e− → Al [2]
9 Polyesters have similar linkages to biopolymers Award [1] for correct equations but
and so can be broken down by bacteria. They wrong electrodes.
are broken down by hydrolysis. Allow e instead of e−.
10 Hg2+ binds to sulfur (b) use of fossil fuels (to provide energy)
Cysteine oxidation of the (graphite) positive electrode /

anode [2]
11 There are two particles on the left and seven
particles on the right. 2 (a) Al is more reactive than Fe / Al is higher
than Fe in the reactivity series / it is harder
There will be an increase in the number of ways
to reduce aluminium ores compared to iron
the energy can be distributed and an increase in
ores / Fe3+ is a better oxidizing agent than
entropy. This means ∆G (= ∆H − T∆S) is more
Al3+ / OWTTE [2]
likely to be negative and the reaction more likely
to be spontaneous. (b) (i) Fe3O4 + 4CO → 3Fe + 4CO2 [1]
(ii) Fe3O4 + 4H2 → 3Fe + 4H2O [1]
65

lOMoARcPSD|20595249
Answers
3 (a) homogeneous mixture of metals / a metal 6 (a) C–Cl bond / molecule is polar
and non-metal [1] stronger intermolecular / van der Waals /
(b) alloying element(s) disrupts regular / London / dispersion forces / dipole–dipole
repeating (metal) lattice attraction [2]
difficult for one layer to slide over another / (b) addition of plasticizers
atoms smaller than the metal cations can Allow misspelling within reason.
fit into the (holes of) metal lattice disrupting
gets between polymer chains / keeps
bonding
chains further apart and reduces attraction
can make metal harder / stronger / more (between the chains) [2]
corrosion resistant / brittle [2 max]
(c) H H H H H H
4 Mode of action of homogeneous catalysis:
C C C C C C
catalyst reacts in one step (of the mechanism)
and is regenerated at a later step /ability to H Cl H Cl H Cl
form a range of oxidation states (for transition Accept any structure with all the Cl atoms
metals) / reaction steps with catalyst have lower shown on the same side.
activation energies than for reaction without
Continuation bonds at end of structure not
catalyst / OWTTE
needed.
Example using chemical equation: Hydrogen atoms must be included. [1]
H+ (aq)
CH3COOH(aq) + C2H5OH(aq) 7 makes the polymer low density / good thermal
CH3COOC2H5(aq) + H2O(l) / other suitable example insulator / expanded / softer / better shock
Mode of action of heterogeneous catalysis: absorber
catalyst provides the reactive surface / presence packaging/insulation

of active sites / adsorb reactant molecule(s) (on Award [1 max] if thermal insulation given for
surface) both answers. [2]
Example using chemical equation: 8 (a) 1 nm to 100 nm [1]

V2O3(g) (b) physical techniques move atoms to a
2SO2(g) + O2(g) 2SO3(g) / N2(g) + 3H2(g)
Fe(s) Ni(s) specific position
2NH3(g) / C2H4(g) + H2(g) C2H6(g) /
chemical techniques involve chemical
other suitable example reactions to position atoms (in molecules)
Reversible sign not required for mark. Accept suitable examples for chemical
Catalyst and states must be specified to score techniques. [2]
mark. [4] (c) reference to effect on human health (e.g.
unknown, immune system may not cope,
5 (a) biphenyl nitriles / cyanobiphenyls [1]
unsatisfactory toxicity regulations)
(b) nitrile groups make molecule polar
reference to effect on employment (e.g.
intermolecular forces are strong enough to
increased/decreased job opportunities,
align in a common direction
adverse effect on traditional industries)
biphenyl groups make molecules more rigid/
reference to effect on quality of life (e.g.
rod-shaped
medical advances, faster computers, improved
(long) alkane chain ensures that molecules performance of electronic equipment)
cannot pack together closely (to maintain
liquid-crystal state) [4]
66

lOMoARcPSD|20595249
Answers
reference to public opinion (e.g. need to ends have half a buckyball (fullerene) /
improve information, encourage discussion, carbons in pentagons (and hexagons) [2]
seek approval) (b) covalent bonds are very strong [1]
reference to nanotechnology being (c) (i) large surface area
developed in wealthier nations hence
Do eactive surface’.
increasing the divide between different
high selectivity related to dimensions of
nations [2 max]
tube [2]
9 Advantage: (ii) unknown health effects
reduce volume / stable odour-free residue / Accept potemful as easily
source of energy i
Disadvantage: Accept difficulty of preparing nanotubes
expensive to build and operate / can form in required amounts. [1]
dioxins/toxic gases / requires energy / adds to
13 (a) (i) CN
greenhouse effect [2]
makes molecule polar, ensures common
10 (a) Landfill: orientation which can be changed by
can be used to deal with large volumes/ electric field
amounts / filled ground can be re-used / low (ii) C5H11
cost
prevents close packing of molecules
Do not accept ‘no air pollution’.
Incineration: (iii)
reduces volume / requires minimal space / molecules rigid and rod-shaped

source of energy Accept chemical stability for second or third
Do not accept ‘no land pollution’ mark not both. [3]
Apply list principle, i.e. award [0] when (b) liquid crystal between two glass plates which
oect aect adva have scratches at 90° to each other
give [2] molecules form a twisted arrangement
(b) limited supply of oxygen (prevents the between plates due to intermolecular
bacteria from acting) bonds
Do . [1] when polarizers are aligned with scratches,
light will pass through film and pixel will
11 (a) Positive electrode:
appear bright
graphite / carbon
applied voltage aligns polar molecules and
Negative electrode: pixel appears dark [4]
graphite / carbon (on a steel liner) [2]
14 (rod-shaped) molecules aligned in the same
(b) much less energy required to recycle than to direction
produce Al from ore / OWTTE
increasing temperature causes arrangement to
less production of CO2/greenhouse gases lose its directional order / molecules to become
(graphite used in the electrolysis is converted more randomly arranged until normal liquid state
into CO2) / the more that is recycled the less occurs [3]
there will be in landfill sites / OWTTE [2]
15 (a) (i) CH2CHCH3 [1]
12 (a) walls have rolled/single sheets of graphite /
carbons bonded in hexagons
67

lOMoARcPSD|20595249
Answers
(ii) H CH3 H CH3 H CH3 Do not accept boiling point.

softness / hardness / flexibility / strength /
C C C C C C
rigidity / density [2]
H H H H H H (c) atactic
harder / more rigid / higher melting point methyl groups arranged randomly /
/ stronger / denser OWTTE [2]
crystalline / chains closer together [3] 19 coke / carbon / C and limestone / calcium
(b) polystyrene beads contain pentane / volatile carbonate / CaCO3
hydrocarbon (coke)
heating causes pentane to evaporate to produce heat
white / opaque / lower density / better C + O2 → CO2
insulator / (better) shock absorber [4]
OR
Any two properties, [1] each.
to act as a reducing agent / to produce carbon
(c) carbon dioxide is a greenhouse gas / CO2 monoxide
causes global warming, climate change etc.
Fe2O3 + 3C → 2Fe + 3CO / 2Fe2O3 + 3C → 4Fe
produces toxic chlorine compounds / + 3CO2 / C + CO2 → 2CO
causes acid rain due to HCl [2]
(limestone)
16 HDPE: to remove impurities / silica
no / very few branches CaCO3 → CaO + CO2 and CaO + SiO2 →
chains pack closer together CaSiO3 / CaCO3 + SiO2 → CaSiO3 + CO2 [5]
stronger intermolecular forces 20 (metal)
Allow converse argument, e.g. LDPE has more does not rust / corrode
branches, so its chains are further apart and the
low density
intermolecular forces are weaker. [4]
thermal insulator / poor conductor of heat
17 (a) addition of plasticizers
electrical insulator / poor conductor of electricity
more flexible / flexibility [2]
Accept any answer above for [1].
(b) polymer disadvantages
(wood)
difficult to dispose of polymer properly
easily moulded
fills up landfill sites
non-biodegradable / does not rot
litter
low density
lack of biodegradability
Accept any answer above for [1].
use of natural resources
Do not accept reference to cost. [2]
Award [1] each for any two.
21 (a) lyotropic liquid crystal
PVC disadvantages
rigid rod-shaped molecules
burning produces toxic gases / HCl [3 max]
alignment of molecules depends on
18 (a) CH3 H [1] concentration of solution [3]
C C / CH3 − CH = CH2 (b) (Kevlar has) strong hydrogen bonds between
chains creating a very ordered / strong
H H
structure [2]
(b) melting point
68

lOMoARcPSD|20595249
Answers
(c) acid donates a proton to the O and N = 3.82 × 10−2 g

atoms, breaking the hydrogen bonds [2] Award [4] for correct final answer. [4]
22 Ksp = [Ag+][Cl−]/1.8 × 10−10 = 8.0 × 10−3 × [Cl−] (b) add excess hydroxide ions / increase the pH
[Cl−] = 2.3 × 10−8 mol dm−3 more Ni(OH)2 will precipitate due to common
2+ − 2 −5
Ksp = [Pb ][Cl ] / 1.7 × 10 = 1.9 × 10 × [Cl ] −2 − 2 ion effect / OWTTE [2]
[Cl−] = 3.0 × 10−2 mol dm−3 24 (a) The diagonal of a face = 4rM and the length
AgCl will precipitate first (because it is less of a unit cell = 4rM/√‾2
soluble) [5] = 4 × 174/√‾2 × 10−12 m = 492 × 10−12 m
23 (a) Ksp = [Ni2+] × [OH−]2 (b) The volume of a cube = (492 × 10−12)3 m3
[OH−] = 2[Ni2+], hence Ksp = 4[Ni2+]3 No. of unit cells = 1 × 10−6/(492 × 10−12)3
6.50 × 10−18 = 8.4 × 1021 [4]
[Ni2+] = ( 4 )
= 1.18 × 10−6 mol dm−3
25 The length of a unit cell = 4rM/√‾2
Mass of Ni2+ in 1 dm3 = 58.71 × 1.18 × 10−6
= 6.90 × 10−5 g = 4 × 130/√‾2 × 10−12 m
Award [4] for correct final answer. = 368 × 10−12 m
Accept The volume of a cube = (368 × 10−12)3 m3
Ksp = [Ni2+] × [OH−]2 No. of atoms = 4
pH = pOH = 7 → [OH ] = 10 mol dm
− −7 −3
Mass of individual atom = 195.08/6.02 × 1023 g
2+
[Ni ] Mass of unit cell = 4 × 195.08/6.02 × 1023 g
6.50 × 10−18
= = 6.50 × 10−4 mol dm−3 Density = (4 × 195.08/6.02 × 1023)/
(10−7)2
(368 × 10−12)3 g m−3
Mass of Ni2+ in 1 dm3 = 6.50 × 10−4 × 58.71
= 26.00 × 103 kg m−3 [5]
Chapter 13
Exercises
1 C18H32O16 + 2H2O → 3C6H12O6 5 Aerobic respiration yields a great deal more

energy than anaerobic respiration, as in the
2 Monomers must each have two functional
presence of oxygen the oxidation of glucose
groups. A molecule of water is given off for each
to CO2 and H2O is complete. In anaerobic
bond that forms between the monomers.
respiration, oxidation is incomplete, and much of
3 (a) anabolic (b) catabolic the energy remains in the end products such as
(c) catabolic (d) anabolic ethanol.
4 Sunlight, photosynthetic pigments to absorb 6 (a) Tyr–Val–His; Tyr–His–Val; His–Tyr–Val;

light energy, water and carbon dioxide. His–Val–Tyr; Val–His–Tyr; Val–Tyr–His
Carbon dioxide is reduced by the hydrogen There are a six different tripeptides possible
from water, forming carbohydrate. The oxidation from three amino acids: 3 × 2 × 1
state of carbon decreases from +4 in CO2 to 0 in (b) There are 24 different peptides that can be
C6H12O6. Oxygen is oxidized from −2 in H2O to 0 synthesized from four amino acids: 4 × 3 ×
in O2. 2 × 1
69

lOMoARcPSD|20595249
Answers
7 (a) leucine (b) threonine 11 (a) and (b)

(c) glutamic acid (d) lysine
8 Fibrous proteins are usually elongated molecules no
rate of reaction
inhibitor
with a well-defined secondary structure. They
are structural materials and insoluble in water. competitive
Globular proteins have a well-defined tertiary inhibitor
structure and are compact spherical molecules,
soluble in water. They are functional as enzymes,
[substrate]
carriers, hormones and receptors.
(c) (i) no effect on Vmax
9 Hydrogen bonds in the secondary structure are
between groups that are part of the peptide (ii) Km increases
bonds of amino acids four residues apart in 12 Similarities: both increase rate of reaction by
a polypeptide chain. Hydrogen bonds in the providing pathway of lower Ea; both have no
tertiary structure are between groups such as effect on Kc or yield.
–OH in the side chains of amino acids.
Differences: enzymes are proteins, inorganic
10 (a) Enzymes are biological catalysts; they are catalysts have a varied structure; enzymes show
made of proteins; they are very specific in saturation kinetics, inorganic catalysts usually
their action; they are affected by changes do not; enzymes are regulated by inhibitors,
in temperature and pH; during the reaction inorganic catalysts are usually not; enzymes
they form an enzyme–substrate complex in are sensitive to pH and temperature, inorganic
which the reaction occurs. catalysts usually work well at a wide range of
temperature and pressure.
(b)
13 (a) Hands are likely to carry free amino acids
rate of reaction
that could be deposited on the paper and

interfere with the chromatogram.
(b) Isoleucine has an isoelectric point = 6.0
Therefore, at pH < 6.0 it will be positively
optimum
charged and so attracted to the cathode; at
temperature pH > 6.0 it will be negatively charged and so
The shape shows increasing rate with attracted to the anode.
increasing temperature as a result of the (c) Glutamic acid has an isoelectric point = 3.2
increase in average kinetic energy leading to
Histidine has an isoelectric point = 7.6
more successful collisions between enzyme
Therefore, pH between 3.2 and 7.6 would
and substrate. This continues to a maximum
achieve separation, e.g. pH 5.0.
point (close to 40 °C in humans), known as
the optimum. At temperatures higher than Glutamic acid will be negatively charged and
this, the rate of the reaction falls dramatically attracted to the anode.
as the enzyme is denatured. This means that Histidine will be positively charged and
it loses its specific tertiary structure and can attracted to the cathode.
no longer bind the substrate at the active
14 75 cm3 of 0.05 mol dm−3 NaOH
site.
15 A series of dilutions (< 5) is prepared of a protein
standard solution. These are treated with a
reagent (such as Biuret solution) which generates
70

lOMoARcPSD|20595249
Answers
colour according to the protein content. (b) Water-soluble: vitamin C; fat-soluble vitamin
Absorbance of each solution is measured under A / vitamin D.
carefully controlled conditions of temperature, Vitamin C has many –OH and polar groups
wavelength and volume of reagent added. The able to form hydrogen bonds with water.
calibration curve is plotted of absorbance versus Vitamins A and D are predominantly non-
protein concentration. The same conditions are polar/have hydrophobic groups and so
applied to the experimental solution, whose cannot form hydrogen bonds with water.
protein concentration can then be read from the
calibration curve. 22 Fortification of certain staple foods such as rice
and flour with micronutrients; supply of nutritional
10.16
16 10.16 g I2 = moles I2 supplements particularly in places where certain
254
= 0.04 moles I2 deficiencies are known (e.g. iodine); possible
changes and improvements in nutrient content
Therefore, 0.02 moles fat react with 0.04 moles I2
through genetic modification.
so there are two double bonds in the fat.
23 (a) Polynucleotides form by the condensation
17 (a) Melting point above 25°C: lauric, myristic,
reactions between nucleotides. Phosphate
palmitic and stearic acids are solids at room
groups react with ribose sugar molecules
temperature.
at C3 and C5 forming phosphodiester
(b) Melting point increases as London
links between the sugar molecules. The
dispersion forces increase with size of the
backbone of the polynucleotide strand
R group, due to an increase in number of
is an alternating sequence of sugar and
electrons.
phosphate groups.
(c) An increase in the number of the C=C
(b) The double helix of the DNA molecule is
double bonds adds kinks to the structure
stabilized by hydrogen bonds between the
which reduces the ability of the molecules to
complementary pairs of bases. Guanine and
pack together. The intermolecular forces are
cytosine pairs are held together by three
weaker and the melting points decrease.
hydrogen bonds, and adenine and thymine
18 Fats and oils; hydrolytic and oxidative rancidity. pairs by two hydrogen bonds. The molecule
is also stabilized by hydrophobic interactions
19 (a) CH2O
between the stacked bases in the interior of
(b) Monosaccharides are water soluble as they the helix.
are small molecules with many free –OH
groups which can form hydrogen bonds. 24 (a) TTAGCGTATATTAAGCGATCG
Polysaccharides are insoluble as they are (b) UUAGCGUAUAUUAAGCGAUCG
much larger molecules. (c) There are seven base triplets so seven
amino acids can be inserted.
20 CH2OH CH2OH
OH O H O H 25 Benefits Concerns
H H Improved flavour, Uncertainties about
OH H O
OH H
texture and nutritional the outcomes
H H OH
value
H OH H OH
Longer shelf-life Links to increased
Lactose allergies (for people
C12H22O11. Glycosidic bond. involved in their
processing)
21 (a) Carbon–carbon double bonds and hydroxyl
groups.
71

lOMoARcPSD|20595249
Answers
curve of myoglobin is hyperbolic, representing

Benefits Concerns
saturation kinetics with no cooperative binding,
Increased crop yields Pollen from GM as myoglobin contains a single heme group and
in plants and feed crops may escape to no quaternary structure.
efficiency in animals contaminate ‘normal’
crops 31 The carbon–carbon double bonds that remain
in partially hydrogenated fats are changed
26 When a substance is oxidized, electrons are from cis to trans configurations. Trans fats are
transferred and the oxidation number of the associated with a number of negative health
substance is increased. This happens to Fe effects, including cardiovascular disease.
in cytochromes when they act as electron Complete hydrogenation results in fats that have
carriers. Oxygenation does not involve transfer no carbon–carbon double bonds.
of electrons and there is no change in oxidation
32 Cellulose is a polymer of β-glucose. It has
number; it involves the bonding of a molecule of
–OH groups sticking out on both sides of its
oxygen as a ligand. This happens in hemoglobin
chains, so hydrogen bonds between them
when it forms oxyhemoglobin.
form microfibrils, which give it rigidity. It is used
Colour Colour of for support. Starch is a polymer of α-glucose,
27 pH λmax
absorbed pigment forming compact and spiral molecules.
1 550 Green Red 33 Light activates the conversion of 11-cis-
7 350 None visible Colourless retinal to the all-trans isomer, which causes its
dissociation from opsin and the triggering of a
28 (a) The carotenoids are coloured due to the nervous impulse.
presence of an extended π system of
electrons in their molecules. They are not 34 Ionic bonds, hydrogen bonds, van der Waals
water soluble as the molecules contain a forces, hydrophobic interactions.
non-polar hydrocarbon chain. They are 35 Biomagnification refers to the increasing
soluble in non-polar fats and oils. concentration of a xenobiotic substance
(b) The colour is due to the presence of at different levels in a food web. It is often
anthocyanins. These are water soluble as associated with toxic effects for organisms that
the molecules contain polar hydroxyl groups feed at a high trophic level, as their cells contain
which form hydrogen bonds with water. the highest concentrations.
The colour changes in the presence of 36 Break down oil spills, help break down some
acid as the degree of conjugation of the π plastics, in biological detergents that improve
system is reduced when anthocyanins are energy efficiency, in Green Chemistry involving
protonated. This changes the wavelength of less toxic chemical pathways and solvents.
the light absorbed.
29 A: 0.17; B: 0.50; C: 0.67

Polar molecules interact fairly strongly with the Challenge yourself
polar Si–O bonds of the stationary phase and so
have smaller Rf values. 1 The entropy of the environment increases.
30 Oxygen dissociation curve of hemoglobin is Energy is returned as less useful forms such
sigmoidal, representing cooperative binding as heat and other forms which quickly become
between the four heme groups within the randomized. Order is created at the expense
quaternary structure. Oxygen dissociation of the environment, which becomes more
disordered.
72

lOMoARcPSD|20595249
Answers
2 In C6H12O6 the oxidation state of C = 0 Leu–His–Arg [3 max]

In CO2 the oxidation state of C = +4 Award [3] for all six correct, [2] for five or
four, [1] for three.
3 Threonine and isoleucine have two chiral carbon
atoms. (d) (i) Hydrogen bonding [1]
(ii) van der Waals forces / hydrophobic
4 Proline is a secondary amine; all other amino
interactions / dispersion forces
acids are primary amines. In peptides, proline
does not have any hydrogens bonded to N, so Ionic bonding / (formation of) salt
cannot be a hydrogen bond donor, but can be bridges / electrostatic attractions
a hydrogen bond acceptor. The presence of Covalent bonding / (formation of)
proline leads to a bend or kink in the polypeptide disulfide bridges [2 max]
chain. Award [1] each for any two.
5 (a) first order Do not accept sulfur bridges or
hydrogen bonding.
(b) mixed order
(c) zero order 2 (a) (i) CH2OH CH2OH [3]
H O H H O H
6 succinate = butanedioate
H H
fumarate = trans-butenedioate OH H OH H
HO O OH
malonate = propanedioate
H OH H OH
7 Oxidation state of carbon will be higher in a (ii) C12H22O11 + H2O → 2C6H12O6 [2]
carbohydrate than in a lipid.
(iii) catabolism [1]
8 Threonine and isoleucine have four Accept hydrolysis.
stereoisomers, as they each have two chiral C
(b) (i) CH2OH [1]
atoms.
H O OH
9 β-Glucose is more stable because there is less
H
steric hindrance in the trans position. OH H
OH H
H OH
Practice questions Accept structures given as repeating unit
with open bonds at the –OH groups at
1 (a) condensation positions 1 and 4.
water / H2O [2] (ii) starch forms a compact spiral structure /
(b) H2N CH CO NH CH COOH [2] granular / amorphous
CH2 SH CH2 OH cellulose forms microfibrils / cables /

rigid structure
H2N CH CO NH CH COOH
cellulose can form hydrogen bonds
CH2 OH CH2 SH between chains due to β-glycosidic links
(c) Arg–His–Leu (and starch cannot) [3]
Arg–Leu–His 3 (a) rate of reaction increases with temperature
His–Arg–Leu from approximately 0 to 35°C
His–Leu–Arg increasing kinetic energy of enzyme and
Leu–Arg–His substrate increases the probability of a
73

lOMoARcPSD|20595249
Answers
successful collision forming an enzyme– 5 (a) Hemoglobin has a compact structure and a
substrate complex specific three-dimensional conformation. Its
catalytic action / alternative pathway of lower shape is determined by both its tertiary and
activation energy occurs due to binding of quaternary structures. [3]
substrate to enzyme (b) [4]
% saturation of hemoglobin
100
at 40°C tertiary structure / conformation of 80
enzyme starts to break down / denature and
60
less enzyme–substrate complex forms
40
above 40°C enzyme is denatured / unable to
20
bind to substrate [5]
0
(b) optimum temperature / maximum rate of 0 2 4 6 8 10 12 14
reaction at temperature lower than 40°C partial pressure of oxygen/kPa
graph rises more quickly at low (c) Binding of O2 to the first subunit causes a
temperatures [2] conformational shift, which facilitates the
binding of O2 to the subsequent subunits. [2]
4 (a) (i) linoleic acid C17H31COOH so has two
% saturation of hemoglobin
C=C bonds (d) 100
low pCO2
2 moles I2 react with 1 mole linoleic acid 80 pH 7.6
2 × 254 g react with 280 g 60 high pCO2
pH 7.4
508 × 100 40
100 g linoleic acid reacts with
280 20
= 181 g I2 [3] 0
0 2 4 6 8 10 12 14
(ii) X has fewer C=C double bonds / is less partial pressure of oxygen/kPa
unsaturated / more saturated [1]
Actively respiring cells release CO2 / lower
(iii) X has higher melting point as molecules
pH. This shifts the O2 dissociation curve to
pack more closely
the right, so that the blood is less saturated
unsaturation puts kinks in the with O2. Oxyhemoglobin dissociates more
hydrocarbon chains / less close packed readily at low pH. [3]
/ weaker intermolecular forces [2]
(e) In the presence of O2 from the air,
(b) Hydrolytic rancidity: fat breaks down by hemoglobin in the meat is converted to
hydrolysis at the ester links between glycerol oxyhemoglobin, which helps give meat a
and fatty acids, releasing the free acids. bright red colour. [2]
Favoured by high temperature and enzyme
(f) The oxygen dissociation curve for
lipase. [3]
myoglobin: (i) lies to the left of hemoglobin
Oxidative rancidity: unsaturated fat is oxidized
– it has a greater affinity for O2; (ii) is not a
at the carbon–carbon double bonds forming
sigmoidal shape but hyperbolic as there is
volatile aldehydes and ketones. Favoured by
no cooperative binding. [4]
light and enzymes or metal ions. [3]
(c) Lipids release more energy per unit 6 Benefit:
mass on oxidation than carbohydrates, enhanced taste/flavour/quality/nutrients/vitamin
as they are more reduced. Lipids are A / longer shelf life / greater yield / greater
insoluble and difficult to transport so their resistance to pesticides/disease
breakdown is more difficult and slower than
carbohydrates. [3]
74

lOMoARcPSD|20595249
Answers
Concern: 11 (a) substance foreign to organisms / not

increased allergies / changed composition of naturally found in the environment [2]
balanced diet / unknown health consequences (b) starch absorbs water and swells, causing
in food chain / risk of escape to wild population / plastic to break into small pieces which can
lack of knowledge of potential consequences to be broken down by bacteria [2]
ecosystem (c) PVC contains the C–Cl bond for which no
7 (a) deoxyribose sugar, phosphoric acid, enzyme exists in the environment [2]
nitrogenous base (purine/pyrimidine) [2] 12 (a) catalyse/speed up chemical reactions (in
(b) phosphate groups negatively charged / the body) / make reactions possible at body
anionic attracted to positive electrode temperature / lower activation energy. [1]
(c) (i) CGGATGAATCGAT (b) Vmax = 0.46 µmol min−1
(ii) GCCUACUUAGCUA [2] Km = [S] when v = 12 Vmax = 1.2 mmol dm−3 [2]
8 (a) pigments absorb visible light Accept 1.1–1.3 mmol dm−3.
and scatter/reflect/transmit the remaining Penalize once for wrong/no units.

light [2] (c) rate increases due to more frequent
(b) (i) no effect as it lies outside the visible collisions
regions/is in the UV / OWTTE [2] rate of increase slows due to occupancy of
(ii) the colour will be the complementary active site on enzyme
colour to the colour absorbing at Vmax occurs when all active sites are
530 nm / it will be red as 530 nm is occupied/saturated [3]
blue-green / OWTTE [1] (d) a flatter line which begins at the origin and
(c) oxidation takes longer to reach Vmax [1]
temperature
13 (a) 3 H bonds shown correctly between
pH/acidity/basicity C and G [2]
presence of metal ions [2 max] 2 H bonds shown correctly between
9 Anthocyanins: water soluble due to their –OH C and G [1] [2 max]
groups, which allow formation of hydrogen NH2 O
bonds with H2O.
C C
Carotenoids: fat soluble due to long non-polar N
N CH HN C
hydrocarbon structure [4] CH
O C CH H2N C C
10 (a) Vitamin A: not soluble in water, non-polar N
N N H
molecule. H
cytosine guanine
Vitamin C: soluble in water due to several
–OH groups able to form hydrogen bonds (b) uracil (pairs with adenine)
with H2O. [2] 2 H bonds shown correctly between
U and A
(b) Vitamin A will be stored in fat deposits. [1] OR
(c) processed food / cooking destroys vitamins 2 H bonds shown correctly between
depletion of nutrients in soil and water cultures T and A [2]
lack of education / understanding about

balanced diet
poor distribution of global resources [3]
75

lOMoARcPSD|20595249
Answers
O NH2 14 (a) (specific) a particular enzyme can catalyse

only one reaction
C C
N enzyme binds to/reacts with substance /
HN CH N C
CH E+S → ES
O C CH HC C after reaction product leaves enzyme / EP →
N
N N H E+P
H
uracil adenine mention of active site [4]
(c) Sequence of three bases representing one OWTTE
amino acid [1]
(b) (i) Vmax reduced
(ii) Km unchanged [2]
Chapter 14
Exercises
1 (a) Solar heating, solar electricity, Moles of CH4 = 8.00 × 107/891 = 8.98 × 104
hydroelectricity, wind power, biomass. mol
(b) Fos sil fuels. Mass = 8.98 × 104 mol × 16.05 g mol−1
(c) Tidal is due to the presence of the = 1.44 × 106 g = 1.44 × 103 kg
moon, nuclear fission due to presence of
3 (a)
Formula
DHc / kJ
radioactive elements found in the earth. Specific
mol−1
M / g mol−1 energy / kJ
(d) Renewable sources are generally derived g−1
from recent solar energy.
H2 = 2 × 1.01 −286 = 286/2.02
useful output energy
2 (a) = = 2.02 = 142
total input energy
useful heat energy CH4 = 12.01 + −891 = 891/16.05
= 0.85
total input heat energy (4 × 1.01) = 55.5
Heat energy produced by combustion = = 16.05
4.00 × 107 kJ/0.85
(b) Assuming ideal behaviour: PV = nRT
= 4.71 × 107 kJ
PV = (m/M)RT
Moles of CH4 = 4.71 × 107/891 = 5.28 ×
ρ = m/V = PM/RT
104 mol
With everything in SI units, the units of
Mass = 5.28 × 104 mol × 16.05 g mol−1
density are kg m−3
= 8.48 × 105 g = 8.48 × 102 kg
With the molar mass in g mol−1, the units of
(b) Energy produced by combustion = 4.00 ×
density are g m−3
107 kJ/0.5
STP conditions: T = 273 K and P = 100 kPa
= 8.00 × 107 kJ
76

lOMoARcPSD|20595249
Answers
Formula Specific Density / g m−3 Energy / kJ cm−3

energy / kJ g−1
H2 = 286/2.02 = 1.00 × 105 × 2.02/8.13 × 273 = (286/2.02) × 1.00 × 105 × 2.02/
= 142 = 91.0 (8.13 × 273)
= 12 900
5
CH4 = 891/16.05 = 1.00 × 10 × 16.05/8.13 × 273 = (891/16.05) × 1.00 × 105 × 16.05/
= 55.5 = 723 (8.13 × 273)
= 40 100
Note: energy density of a gas is not determined by the molar mass.
3 (c) Hydrogen is the best fuel. (b) Increases the yield of the more useful lower
It is dangerous to store and burn. fractions used as fuels for cars.
Produces the more reactive alkenes, which
4 (a) Empirical formula: C135H96O9NS. (It typically
can be used as chemical feedstock, to make
also contains trace elements of silicon,
useful products such as plastics.
sodium, calcium, aluminium, nickel, copper,
zinc, arsenic, lead and mercury.) (c) Lower temperatures needed. Catalysts act
selectively, increasing the yield of the desired
(b) S + O2 → SO2 and 2SO2 + O2 → 2SO3 and
product.
H2O + SO2 → H2SO3 and H2O + SO3 →
H2SO4 8 (a) Octane is one of the main components of
2N + O2 → 2NO and 2NO + O2 → 2NO2 and petroleum: C8H18
2NO2 + H2O → HNO3 + HNO2 Any compound between pentane and
useful output energy decane would be acceptable as an answer.
5 (a) =
total input energy (b) They are isolated from crude oil by fractional
useful heat energy distillation.
= 0.38
total input heat energy The mixture of hydrocarbons is heated,
Heat energy produced by combustion =
causing them to vaporize.
5.00 × 105 kJ s−1/0.38
As the vapour travels up the fractionating
Mass = 5.00 × 105 kJ s−1/(0.38 × 33.0 kJ g−1)
column the hydrocarbons condense at
= 39 900 g s−1 = 39.9 kg s−1 different heights, resulting in their separation.
(b) We have the unbalanced equation: CH + The different compounds have different
(5/4)O2 → CO2 + 12H2O boiling points: the lowest boiling point
no. of moles of CO2 = no. of moles of CH compounds condense at the top and the
highest boiling point compounds condense
no. of moles of C H = 39 900/(12.01 + 1.01)
at the bottom.
= 3062 mol
mass of CO2 = 3062 × 44.01 = 135 000 g = As the relative molar mass increases, the
135 kg attractive London dispersion forces between
the molecules increase, leading to an
6 CH3 CH3 increase in the boiling point.
CH3 C CH2 CH CH3 (c) The components of gasoline have boiling

points above normal temperatures. They are
CH3 volatile liquids.
7 (a) C11H24 → C2H6 + 3C3H6 or C11H24 → C5H12 They can be easily vaporized in the car
+3C2H4 cylinder for reaction with oxygen.
77

lOMoARcPSD|20595249
Answers
Lower molar mass compounds are gases Coal liquefaction

which occupy too much volume, while Direct: 5C(s) + 6H2(g) → C5H12(l)
higher molar mass compounds do not
11H2(g) + 5CO(g) → C5H12(l) + 5H2O(l)
vaporize or burn easily.
(d) Higher fractions can be cracked into smaller 13 Carbon-containing fuels are non-renewable.
molecules; the larger molecules are heated They are needed as chemical feedstocks.
with a catalyst and broken into smaller Their combustion adds carbon dioxide to
molecules. the atmosphere, which contributes to global
Alkenes formed in the cracking process warming.
can undergo alkylation reactions with lower
14 (a) CO(g) + 12O2(g) → CO2(g): ∆Hc0 =
molecular mass alkanes to further increase
−283 kJ mol−1
the yield of gasoline.
H2(g) + 12O2(g) → H2O(g): ∆Hc0 =
(e) Cracking: C16H34 → C6H12 + C10H22
−286 kJ mol−1
C6H10 + C10H24
CO(g) + H2(g) + O2(g) → CO2(g) + H2O(g):
Alkylation: (CH3)3CH + CH3CH=CHCH2CH3 ∆Hc0 = −283 + (−286) kJ mol−1 =
→ CH3CH–CHCH2CH3 −569 kJ mol−1
| |
(b) CH4(g) + 2O2(g) → CO2(g) +2H2O(g):
9 The general pattern is: ∆Hc0 = −891 kJ mol−1
straight-chain alkanes < cycloalkanes < alkenes (c) One mole of synthesis gas has the same
< aromatics volume as two moles of methane. One mole
pentane < cyclopentane < pentene < benzene of synthesis gas produces 569 kJ and two
moles of methane produce 2 × 891 kJ.
10 The general pattern is that the octane number
of straight-chain alkanes decreases with an 15 (a) Methane is the major component of natural
increase in chain length. Alcohols have very high gas. It has the formula CH4.
octane numbers. CH4(g) + 2O2(g) → CO2(g) + 2H2O(g)
heptane < hexane < pentane < ethanol (b) Natural gas is the cleanest of the fossil fuels
11 (a) High specific energy / energy density. to burn as it has a high H : C ratio.
As a liquid it is convenient to handle and The combustion of natural gas produces

deliver. minimal amounts of carbon monoxide,
hydrocarbons and particulates. It does
Easy to vaporize, which to assists
contribute to global warming but does not
combustion.
contribute to acid rain, unlike coal and oil.
(b) It is formed by the partial decomposition of
(c) Natural gas is the fossil fuel in the shortest
marine plants millions of years ago.
supply and it is unevenly distributed around
(c) Compounds are separated by fractional the world.
distillation.
Oil is expected to last a little longer and coal,
Increase of petrol fraction by cracking. which is distributed more evenly around the
Further refining: reforming, alkylation, world, longer still.
isomerization to increase octane number. (d) Supplies of methane can be increased as a
12 Coal gasification result of the cracking of larger hydrocarbons
from oil or by coal gasification.
C(s) + H2O(g) → CO(g) + H2(g)
CO(g) + 3H2(g) → CH4 + H2O
78

lOMoARcPSD|20595249
Answers
Cracking 18 (c) They produce less carbon dioxide / have a

C4H10 → CH4 (g) + C3H6(g) smaller carbon footprint.
Coal gasification 19 (a) Predicted mass of deuterium nucleus = 2

C(s) + H2O(g) → CO(g) + H2(g) (1.008 665 + 1.007 265) amu
CO(g) + 3H2(g) → CH4 + H2O = 2.01593 amu
16 (a) wide availability ∆m = 2.01593 − 2.01355 amu = 0.00238

amu = 0.00238 × 1.66 × 10−27 kg
relatively cheap compared to other sources
∆E = 0.00238 × 1.66 × 10−27 × (3.00 × 108)2 J
ease of transportation
∆E = 0.00238 × 1.66 × 10−27 × (3.00 × 108)2
power stations can be built close to the
× 6.02 × 1023 J mol−1
source
= 2.14 × 1011 J mol−1
high energy density
= 2.14 × 108 kJ mol−1
can be used with existing technology
concern over nuclear (b) Binding
nucleons
Nuclide
Binding
No. of
energy / kJ
limited productivity of other sources energy / kJ
mol−1 per
mol−1
not possible to generate sufficient electrical nucleon
energy without it 4
He 4 2.73 × 109 2.73 × 109/4
2
many transport systems rely on fossil fuels = 6.825 × 10
8
(b) Oil used to power internal combustion 2

1
H 2 2.14 × 108 2.14 × 108/2
engines
= 1.07 × 108
17 It is more efficient
It produces more thermal energy per unit of mass
/ has a higher specific energy / energy density
It produces less CO2 per unit of output energy
18 (a) Moles
Mass needed
0 –1 needed to
Fuel ∆H / kJ mol Molar mass / g mol–1 to produce
c produce
10 000 kJ
10 000 kJ
Methylbenzene −3910 10 000/3910 (12.01 × 7) + (8 × 1.01) 2.56 × 92.15

= 2.56 = 92.15 = 236
Ethanol −1367 10 000/1367 (12.01 × 2) + (6 × 1.01) + 16.00 7.31 × 46.08
= 7.31 = 46.08 = 337
(b) Fuel
Moles of CO2 Mass of CO2
produced / mol produced / g
Methylbenzene 7 × 236 7 × 236 × 44.01

= 72 700
Ethanol 2 × 337 2 × 337 × 44.01
= 29 700
79

lOMoARcPSD|20595249
Answers
(c) We have the following energy changes as 22 (a) Energy produced from 1 g = 6.72 × 10−6 ×
the nuclei of the two elements are formed: (3.00 × 108)2 J g−1
2p + 2n → 2 21H: ∆E = 2 × 2.14 × 108 kJ mol−1 = 6.05 × 1011 J
4
2p + 2n → He: ∆E = 2.73 × 109 kJ mol−1
2 = 6.05 × 108 kJ
Using Hess’ law we have for the following: (b) Mass of coal needed = 6.05 × 108 kJ/
2 21H → 2p + 2n: ∆E = −2 × 2.14 × 108 kJ 30 kJ g−1 = 20 × 106 g
mol−1 = 20 × 103 kg
4
2p + 2n → He: ∆E = 2.73 × 109 kJ mol−1
2
23 (a) E = Δmc2
Adding the equations:
Δm = 0.018884 amu
2 21H → 42He: ∆E = (−2 × 2.14 × 108) + (2.73 = 0.018884 g mol−1
× 109) kJ mol−1
E = 0.018884 × 10−3 kg × (3.00 × 108)2
∆E = 2.30 × 109 kJ mol−1
= 1.70 × 1012 J mol−1
(d) 42He is more stable than 21H
= 1.70 × 109 kJ mol−1
20 (a) 10n (b) mass of coal which produces this energy =
17
(b) O
8 6.04 × 108 kJ/30 kJ g−1 = 2.02 × 107 g
21 (a) ΔE = hc/λ = 2.02 × 104 kg
= 6.63 × 10−34 × 3.00 × 108/λ J = 20.2 ×103 kg

= 6.02 × 1023 × 6.63 × 10−34 × 3.00 × 24 (a) W: atomic number = 90, mass number =
108/λ J mol−1 233 − 4 = 229: 229
90Th
= 6.02 × 1020 × 6.63 × 10−34 × 3.00 × X: atomic number = 0, mass number = 236
108/λ kJ mol−1 − 233 = 3: 310n
= 0.00012/λ kJ mol−1 Y: atomic number = 93, mass number =
λ/m −1
ΔE / kJ mol 239: 239
93Np
Z: atomic number = 34, mass number = 92:

656 × 10−9 0.00012/656 × 10−9 92
34Se
= 183
(b) Process II (fission) is used to produce
486 × 10−9 0.00012/486 × 10−9
electricity in nuclear power plants. (Process
= 247
IV is also a fission reaction and is another
434 × 10−9 0.00012/434 × 10−9 potential reaction.)
= 276 This process can be initiated as required by
(b) By inspection we can see that transitions controlling the input of neutrons, whereas
from n = 2 fall into this range the other processes are natural ones and
occur randomly.
ΔE / kJ mol−1 Transition
Process II is self-sustaining if the critical
183 n=2→n=3
mass is available. It produces more neutrons
247 n=2→n=4 than are needed initially and so a chain
276 n = 2 → n =5 reaction occurs which can lead to the fission
(c) At higher energy, energy levels become of more nuclei.
closer together; the energy differences (c) The mass of the products is less than
between higher energy levels and the lower the mass of the reactants. The difference
level (n = 2) become closer together and the is converted to energy according to the
difference in wavelength decreases. equation ΔE = Δmc2.
80

lOMoARcPSD|20595249
Answers
25 Less than 1% of uranium is the fissionable As the ratio is close to one, the molecules
isotope: 235
92U have very similar physical properties and so
There is less than the critical mass present. are hard to separate.
There is insufficient 235
92U to sustain the chain 28 (a) Fuel enrichment means that the amount of
reaction. 235
U in the fuel is increased, which means
26 (a) UO2 is a giant ionic; UF6 is molecular more than the critical mass of 235U is
covalent. available for fission so the reaction can be
sustained.
The +4 oxidation state forms ionic
compounds but the +6 state forms covalent (b) Enriched fuel can be used in the
compounds as the U6+ ion would be too manufacture of nuclear weapons.
polarizing. 29 (a) mass which is converted to energy = 1/1000
(b) Both compounds would have similar × 1.0 kg
radioactivity as its depends on the nucleus = 1.0 × 10−3 kg
of the atoms and not on the electron
ΔE = Δmc2
arrangements.
= 1.0 × 10−3 kg × (3.00 × 108 m s−1)2
(c) For fission reactors, the fuel (typically
based on uranium) is usually based on the = 9.0 × 1013 J
metal oxide; oxides are used rather than = 9.0 × 1010 kJ
the metals themselves because the oxide (b) mass of coal which produces this energy =
melting point is much higher than that of the 9.0 × 1010 kJ/30 kJ g−1 = 3.00 × 109 g
metal and because it cannot burn, being
already in the oxidized state. 30 Δm = 5.2 × 10−3 amu
ΔE = Δmc2
27 (a) The elements all have non-polar molecular
= 5.2 × 10−3 × 1.661 × 10−27 × (3.00 × 108)2
covalent structures. The intermolecular
forces are due to the interaction between = 7.77 × 10−13 J
an instantaneous dipole and induced dipole = 4.7 × 108 kJ mol−1
and so depend on the number of electrons.
31 (a) The first neutron is needed to initiate a chain
The boiling points increase as the number of
reaction and the reaction would not happen
electrons increase.
without it.
(b) UF6 has a lower boiling point than expected
(b) mass of reactants = 235.0439 + 1.0087 =
based on the trend in (a). Although it is a
236.0526 amu
non-polar molecule it does contain polar
bonds. The fluorine atoms all have a partial mass of products = 95.9342 + 137.9112 +
negative charge so repel the fluorine atoms (2 × 1.0087) = 235.8628 amu
in other molecules, which reduces the Δm = 0.1898 amu
intermolecular forces. ΔE = 0.1898 × 1.661 × 10−27 × (3.00 ×
(c) It is volatile and the fluorine atoms only have 108)2 J
one mass number so the mass difference = 0.1898 × 1.661 × 10−27 × (3.00 × 108)2 ×
is due to mass differences in the uranium 6.02 × 1023 J mol−1
atoms. = 1.71 × 1013 J mol−1
(d) The separation depends on the ratio of the = 1.71 × 1010 kJ mol−1
masses of the compounds containing the
228
two isotopes = 352/349. 32 (a) Th → 224
90
4
88Rn + 2He
(b) mass of products = 228.022800 amu

81

lOMoARcPSD|20595249
Answers
235
Δm = 0.005926 amu 35 U + 10n →………→ 90
92
144 1
38Sr + 54Xe + 2 0n
ΔE = Δmc2 36 high level: contains fission products

Δm = 0.005926 × 1.66 × 10−27 kg low level: clothing / fuel cans / other
−27
ΔE = 0.005926 × 1.66 × 10 × (3.0 × stored under water
108)2 J
buried underground
= 8.860 × 10−13 J
encased in steel/concrete
= 8.860 × 10−13 × 6.02 × 1023 J mol−1
vitrified / made into glass
= 5.33 × 1011 J mol−1 = 5.33 × 108 kJ mol−1
37 Use the information in the question to compile a
(d) mass of coal burned = 5.33 × 108 kJ
table:
mol−1/28 kJ g−1
= 1.9 × 107 g Time / years Activity / hr−1 g−1
= 1.9 × 104 kg 0 60.0
33 (a) Time / half-lives Fraction remaining 5730 30.0
0 1 5730 × 2 15.0
1 0.5 5730 × 3 7.5
2 0.25 5730 × 4 3.75
3 0.125
The shell is approximately 5730 × 4 years =
4 0.0625 22 920 years old.
5 0.03125 238
38 (a) Pu → 234
94
4
92U + 2He
6 0.015625
(b) One year is short compared to the half-life
7 0.0078125 and so the number of plutonium nuclei does
8 0.00390625 not change significantly.
9 0.001953125
(c) λ = ln 2/t½
= ln 2/(88 yr) = 0.007877 yr−1
10 0.000976563
ln([A]t)/([A]0) = −0.007877 yr−1 × 20 yr =
(b) 99.9%
−0.157533
34 First notice that 96.0 s = 96.0/19.2 = 5t½ ([A]t)/([A]0) = e−0.157 = 0.854
Use the information in the question to compile a = 85.4%
table:
39 (a) λ = ln 2/(28.4 yr) = 0.0244 yr−1
−1
Time / half-lives Time / s Activity / s A = A0e−0.0244 × 80
0 0 1200 = 5.1 × 1016 × e−0.0244 × 80
1 19.2 600
= 7.24 × 1015 s−1
2 38.4 300
(b) Initial activity is very high and still highly
3 57.6 150
radioactive after 80 years. This poses severe
4 76.8 75 health risks and problems of disposal.
5 96.0 37.5
40 Eneeded = 1216 kJ mol−1
The count rate would be 37 or 38 disintegrations = 1216 × 1000 J mol−1/(6.02 × 1023 mol−1)
per second.
82

lOMoARcPSD|20595249
Answers
E = hν 44 (a) Fossil fuels and biomass are derived from

−1
ν = 1216 × 1000 J mol /(6.02 × 10 mol × 23 −1 the sun through photosynthesis.
6.63 × 10−34 J s) Other sources: wind and hydroelectricity.
= 3.05 × 10 s 15 −1
(b) Advantage: renewable and has little
8 −1
λ = 3.00 × 10 m s /3.05 × 10 s 15 −1 environmental impact.
= 9.85 × 10−8 m Disadvantages: photosynthesis is not very

efficient so relatively little of the available
This is in the UV region of the electromagnetic
solar energy is trapped.
spectrum, as displayed in section 4 of the IB
data booklet. 45 (a) 6CO2 + 6H2O → C6H12O6 + 6O2
41 (a) CH2=CH–CH=CH2 is a conjugated system (b) Chlorophyll

with two double bonds separated by a single (c) Conjugated system of double and single
bond which extends along the full length of bonds
the molecule. (d) Process: fermentation
(b) The double bonds disappear as the Equation: C6H12O6 → 2C2H5OH + 2CO2
molecules undergo an addition reaction with
Conditions: acidity / absence of oxygen /
bromine.
below 40 °C
(c) Benzene absorbs radiation in the UV region.
Yeast provides enzyme
In nitrobenzene, conjugation between
the benzene ring and the nitro group 46 (a) Methane
allows radiation of longer wavelength to (b) Carbon monoxide and hydrogen
be absorbed. This radiation occurs in the (c) Particulates (soot), hydrocarbons, carbon
visible region of the spectrum and so the monoxide
compound is coloured. (d) Fossil fuels are running out. Biomass is a
42 (a) Increased conjugation (increased n) moves renewable source.
the absorption band λmax towards longer 47 (a) 1%
wavelength.
(b) Wavelength of radiation not absorbed by
(b) The first members of the series are chlorophyll
colourless as they absorb in the UV region,
Some radiation is reflected or heats the
but the later members (n > 2) are coloured
surface of the earth
as they absorb in the visible region.
Plants do not cover all the earth
(c) C6H5−(CH=CH)5−C6H5 absorbs in the
purple region and is probably yellow. (c) Photosynthesis: 6CO2 + 6H2O → C6H12O6 +
6O2
C6H5−(CH=CH)6−C6H5 absorbs in purple/
blue region and is probably orange. (d) Production of biogas
(d) Only λmax and not the full spectrum is given Production of ethanol / fermentation
so it not possible to give a precise answer. 48 Biodiesel is renewable.
43 The conjugated system includes eleven C=C Biodiesel is carbon neutral. Plants use the same
bonds and so absorbs in the visible region. amount of CO2 to make the oil that is released
The molecule absorbs blue light and so appears when the fuel is burned.
orange. Biodiesel is rapidly biodegradable and
completely non-toxic, meaning spillages
83

lOMoARcPSD|20595249
Answers
represent far less risk than petroleum diesel dioxide. More carbon dioxide is then
spillages. released, which amplifies the initial change.
Biodiesel has a higher flash point than petroleum (d) Increased carbon dioxide increases the
diesel, making it safer in the event of a crash. rate of photosynthesis, producing more
Blends of 20% biodiesel with 80% petroleum phytoplankton, which further reduce levels of
diesel can be used in unmodified diesel engines. carbon dioxide.
Biodiesel can be used in its pure form but 51 The removal of CO32−(aq) will cause the
engines may require certain modifications to equilibrium HCO3−(aq) H+(aq) + CO32−(aq) to
avoid maintenance and performance problems. shift to the right. The resulting decreased levels
Biodiesel can be made from recycled vegetable of HCO3−(aq) will cause H2CO3(aq) H+(aq) +
and animal oils or fats. HCO3−(aq) to shift to the right and so on until
CO2(g) CO2(aq) shifts to the right with the
49 (a) Distant from localized areas of pollution; data
absorption of CO2(g).
present an accurate measure of global levels
of CO2. 52 pH = 8.2: [H+] = 10−8.2
(b) % increase = (increase/initial value) × 100% pH = 8.1: [H+] = 10−8.1
= [(384 − 316)/316] × 100% = 21.5% % increase = (10−8.1 − 10−8.2)/10−8.2 × 100%
(c) Combustion of fossil fuels. = (100.1 − 1) × 100% = 26%
(d) The annual variation is due to CO2 uptake by 53 (a) respiration, volcanic eruption, complete
growing plants. The uptake is highest in the aerobic decomposition of organic matter,
northern hemisphere springtime. forest fires
(e) Photosynthesis: 6CO2 + 6H2O → C6H12O6 + (b) methane produced from anaerobic
6O2 decomposition
CO2 dissolves in water: CO2 + H2O (c) smoke particulates: block out sunlight
H2CO3(aq)
(d) high-energy short-wavelength radiation
(f) Decreased level of photosynthesis: less CO2 passes through the atmosphere;
taken in by plants.
lower energy / longer wavelength radiation
(g) CO2 absorbs infrared radiation, which leads from the earth’s surface is absorbed by
to increased vibrations and bending and vibrating bonds in CO2 molecules
stretching of the bonds.
(e) melting of polar ice caps; thermal expansion
50 (a) Carbon dioxide has polar C=O bonds and of oceans will lead to rise in sea levels,
the oxygen atoms have lone pairs. It can which can cause coastal flooding; crop
form hydrogen bonds with water molecules. yields reduced; changes in flora and fauna
(b) Relatively strong hydrogen bonds are distribution; drought; increased rainfall;
formed: ΔH is negative. The solubility desertification
decreases with increasing temperature, as 54 (a) incoming radiation from the sun is of short
the equilibrium shifts to the endothermic wavelength
(reverse) direction as the temperature
long-wavelength infrared radiation leaves
increases.
earth’s surface and some is absorbed by
(c) Increased temperatures due to increased gases in the atmosphere
atmospheric carbon dioxide concentrations
results in increased vibration of bonds in
could result in reduced solubility of carbon
molecules which then re-radiate heat back to
the earth
84

lOMoARcPSD|20595249
Answers
(b) Natural: (evaporation from) oceans −0.03 = −8.31 × 298/(2 × 9.65 × 104) × ln Q
Artificial: burning (any specified) fossil fuel 0.03 × 2 × 9.65 × 104/(8.31 × 298) = ln Q
(c) CO2 is more abundant but CH4 absorbs 2.34 = ln Q
the radiation more effectively / has a larger Q = e2.34 = 10.1
greenhouse factor
10.1 = [Zn2+(aq)]/0.100
55 (a) coal / diesel (fuel) / wood Zn2+(aq)] = 1.01 mol dm−3
(b) CH4 + O2 → C + 2H2O (b) The equilibrium needs to be shifted to the
56 (a) E = E0 − (RT/nF)ln Q right.
Cell reaction: Zn(s) + Ni2+(aq) Zn2+(aq) + [Zn2+(aq)] could be decreased or [Pb2+(aq)]

Ni(s); Q = [Zn2+(aq)]/[Ni2+(aq)] could be increased
E0 = −0.26 − (−0.76) = +0.50 V In detail:
Q = 0.100/0.00100 = 100 0.65 = 0.63 − (8.31 × 298/(2 × 9.65 × 104))

× ln Q
E = 0.50 − (8.31 × 298/(2 × 9.65 × 104)) ×
ln 100 V −0.02 = 8.31 × 298/(2 × 9.65 × 104) × ln Q
= 0.50 − 0.059 −0.02 × 2 × 9.65 × 104/(8.31 × 298) = ln Q
= 0.441 V −1.55873 = ln Q
(b) E = E0 − (RT/nF)ln Q Q = e−1.55873
Cell reaction: Mn(s) + Pb2+(aq) Mn2+(aq) + Q = 0.210 = [Zn2+(aq)]/0.100
Pb(s); Q = [Mn2+(aq)]/[Pb2+(aq)] Zn2+(aq)] = 0.021 mol dm−3
E0 = −0.13 − (−1.18) = 1.05 V (c) Increase the temperature. This would
Q = 0.100/0.00010 = 1.0 × 10 3 increase the size of the second negative
E = 1.05 − (8.31 × 298/(2 × 9.65 × 104)) × term in the Nernst equation.
ln(1.0 × 103) V 58 (a) The half reaction at the cathode is: Zn2+(aq)
= 1.05 − 0.088633 + 2e− Zn(s)
= 0.96 V The equilibrium will be to the right for high
0
(c) E = E − (RT/nF)ln Q [Zn2+(aq)]
Cell reaction: Zn(s) + Fe2+(aq) Zn2+(aq) + Solution B should be used at the cathode.
Fe(s); Q = [Zn2+(aq)]/[Fe2+(aq)] (b) E = E0 − (RT/nF)ln Q
0
E = −0.45 − (−0.76) = +0.31 V E = −(RT/nF)(ln 2)
Q = 1.50/0.100 = 15.0 = 0.0089 V
E = 0.31 − (8.31 × 298/(2 × 9.65 × 104)) ×
59 (a) CH3OH(l) + (3/2)O2(g) → CO2(g) + 2H2O(l)
ln 15.0 V −167 0 −394.4 2(−237.1)
= 0.31 − 0.035 = 0.28 V ∆Gf0 / kJ mol−1
∆Greaction = ∑∆Gf0 (products) − ∑∆Gf0 (reactants)

57 (a) E = E0 − (RT/nF)ln Q
= (−394.4 + 2(−237.1) − (−167) kJ mol−1
Cell reaction: Zn(s) + Pb2+(aq) Zn2+(aq) +
Pb(s); Q = [Zn2+(aq)]/[Pb2+(aq)] = −701.6 kJ mol−1
−∆Gsys −701.6
E0 = −0.13 − (−0.76) = +0.63 V (b) Efficiency = × 100% = ×
−∆Hsys −726
Q = [Zn2+(aq)]/0.100
100% = 97%
0.60 = 0.63 − (8.31 × 298/(2 × 9.65 × 104))
× ln Q
85

lOMoARcPSD|20595249
Answers
60 (a) Oxidation number increases from 0 to +2. 64 (a) Ionization energies decrease down a group
Pb(s) is oxidized. so the electrons are easier to remove in
(b) Pb(s) + SO42−(aq) → PbSO4(s) + 2e− germanium compared to diamond, resulting
in more free electrons.
(c) PbSO4 is insoluble: the Pb2+ ions do not
disperse into solution. (b) Boron has only three outer electrons so it
produces a positive hole in the lattice to give
(d) Advantage: delivers large amounts of energy
a p-type semiconductor.
over short periods.
Disadvantage: heavy mass; lead and sulfuric 65 Arsenic, as it has five outer electrons and a
acid could cause pollution. similar atomic radius.
61 (a) Bacteria oxidize the substrate: they live at 66 Si is doped with As to produce an n-type
the negative electrode or cathode. semiconductor and with Ga to produce a p-type
semiconductor. Light stimulates electron flow
(b) Sucrose is oxidized by the bacteria. 12 Cs
from the n-type to the p-type semiconductor
are oxidized from 0 to + 4 so 48 electrons
through an external circuit.
are released
24 Os are needed so 13 H2O are needed 67 Advantages Disadvantages
48 Hs are needed on both sides no pollution low power output
Check that the charges are balanced: zero no moving parts so no needs a large surface
on both sides maintenance area battery / storage
no need for refuelling as facilities needed in
C12H22O11(aq) + 13H2O(l) → 12CO2(g) + absence of light
sunlight is unlimited
48H+(aq) + 48e− high capital cost
produces less noise
(c) 48 electrons will reduce 12 O2 molecules conserves petroleum for easily damaged
48 Hs are needed on both sides: other uses
48H+(aq) + 12O2(g) + 48e− → 24H2O(l) 68 Conductivity increases as the gallium has one
(d) C12H22O11(aq) + 13H2O(l) → 12CO2(g) + less electron than silicon.
48H+(aq) + 48e− Electron holes are introduced, which make it a
+ −
48H (aq) + 12O2(g) + 48e → 24H2O(l) p-type conductor so electrons can move into
C12H22O11(aq) + 12O2(g) → 12CO2(g) + these holes. Arsenic has one more electron than
11H2O(l) silicon. An extra electron is introduced so it is a
n-type conductor. The extra electrons are free to
62 (a) H2 + 2OH− → 2H2O + 2e−
move.
O2 + 2H2O + 4e− → 4OH−
69 (a) Process Photovoltaic DSSC
(b) Less waste heat produced and more
chemical energy converted to useful energy. Light Silicon atom Electron excited
absorption is ionized to in conjugated
They use a renewable energy source which create hole and organic
is more efficient. electron (Si+ and molecule
e−) pair
63 Metals conduct electricity well, insulators do not;
semiconductors have intermediate conductivities. Charge Electron and Election is
separation hole move accepted by
The conductivity of metals decreases with in opposite semiconductor.
temperature; the conductivity of semiconductors directions due Positive ion
increases with temperature. Conductors have to electric loses its charge
field in p–n as the ion is
low ionization energies; insulators have high
semiconductor reduced by
ionization energies. electrolyte
86

lOMoARcPSD|20595249
Answers
(b) If the electron directly recombines with an This corresponds to 22 = Z2, where Z is the
ion the light energy is converted to useless atomic number of helium.
heat energy. This is a general result: the energy level is
proportional to the square of the atomic number.
7 The 1% difference in molecular mass between

Challenge yourself the molecules formed from the two isotopes
is due only to the difference in masses of the
1 680 kJ of heat is given out. Energy efficiency is uranium isotopes.
32%.
8 As many stages are involved (up to 4000), a
2 The decrease in entropy in your brain is large area of ground is needed.
accompanied by increases elsewhere in the
9 Other covalent fluorides with the non-metal in a
universe.
high oxidation state. An example is SF6.
3 Coal and oil are fossilized decayed plants or
10 C40H56
animals that contain amino acids. The amino
acid cysteine contains sulfur. Coal and oil with a The position of the double bond in the hexagon
higher percentage of sulfur are considered ‘dirty’ on the right is different in the two isomers.
because of the sulfur dioxide pollution that they 11 (a)
produce on combustion. Sulfur dioxide results in 2C16H23O11 + 19H2O + O2 → xH2 + yCO + zCO2
acid rain. −1/16 +2 +4 C
+1 +1 0 H
4 (a) Plotting a graph we see that the data follow −2 0 −2 −2 O
an approximate straight-line relationship:
(b) C is oxidized
100
O and H are reduced
80
(c) Balancing the H atoms:
60
octane number
octane number = −31.23n + 216.64

2C16H23O11 + 19H2O + O2 → 42H2 + yCO +
40 zCO2
20 x = 42
0
(d) Total change of oxidation number of H = −84
0 1 2 3 4 5 6 7 8
Total change of oxidation number of O = −2
−20 number of carbon atoms
Total increase in oxidation number of C =+86
This suggests an octane number of −33.
Balancing the change in oxidation numbers:
In practise the graph is a curve rather than 2y + 4z − 2 = +86
a straight line and octane has an octane
Balancing the C atoms: y + z = 32
number of −19.
Solving the equations: 2z = 88 − 64 = 22
(b) Assuming the same straight-line trend, for
an octane number of 100, n = 3.73. So z = 11 and y = 21
propane has an octane number above 100. 2C16H23O11 + 19H2O + O2 → 42H2 + 21CO +
11CO2
5 The isomers of octane have the essentially the
(e) 42H2 + 21CO → 21CH3OH
same number of C–C and C–H bonds.
2 molecules of wood produce 21 molecules
This suggests that they are not a key factor in a
of methanol
molecule’s octane number.
1 molecule produces 10.5 molecules
6 The ratio between the values is approximately 4
87

lOMoARcPSD|20595249
Answers
12 The solubility of carbon dioxide increases at high-level waste is vitrified / made into glass /
lower temperatures and higher pressures. buried underground / in granite / in deep mines
Increased levels of CO2(g) will lead to the / under water / in steel containers / in cooling
formation of the more soluble Ca(HCO3)2(aq). ponds / OWTTE
CaCO3(s) + H2O(l) + CO2(g) → Ca(HCO3)2(aq) low-level waste is stored under water / in

steel containers / in cooling ponds /filtered /
−∆Gsys −∆Hsys + T∆Ssys
13 Efficiency = × 100% = × discharged directly into sea / OWTTE
−∆Hsys −∆Hsys
T∆Ssys Accept cooling ponds/steel containers/under
100 = 1 + × 100 water/concrete containers only once. [3]
−∆Hsys
The entropy decrease is smaller for the reaction
3 Catalytic cracking:
which produces one mole of gaseous water,
which leads to a larger efficiency. used to produce moderate length alkanes for
fuels
lower temperature / lower energy consumption /
more control of product [2]
Practice questions
4 light nuclei for fusion and heavy nuclei for fission
1 (a) long wavelength / infrared / IR radiation from more massive nucleus produced in fusion as
Earth’s surface nuclei joined together and two lighter nuclei
(some of this radiation) is absorbed (by gas) produced in fission as nuclei split apart [2]
Do not accept ‘trapped’ or ‘blocked’. 5 6.25% remains
Do not award mark for ‘IR from sun’. 4 half-lives = 6400 years [2]
causes (increased) vibration in bonds
6 (a) energy transferred to surroundings / from
re-radiates heat back to the Earth system which is no longer available for use /
Accept ‘re-transmits’ cannot be used again [2]
23 5
Do not accept ‘reflects/bounces’ [2 max] (b) U undergoes a fission reaction due to
92
(b) melting of polar ice caps / glaciers melting neutron capture
thermal expansion of oceans / rise in sea reaction produces neutrons so chain

levels / coastal flooding reaction occurs
stated effect on agriculture (e.g. crop yields mass of products less than reactants
changed) corresponding energy released according to
changes in flora / plant / fauna / animal / E = mc2 [4]
insect distribution / biodiversity (c) the mass needed that allows fission to be
Accept specific example. sustained [1]
stated effect on climate (e.g. drought / 7 (a) wide availability

increased rainfall / desertification) produce energy at appropriate rate
Do not accept ‘climate change’ alone. ease of transportation
Do not allow ‘increased temperature / global current technology is based on fossil fuels
warming’ (given in question).
high energy density / specific energy [2 max]
Award [1] each for any three. [3 max]
(b) energy produced per unit mass / kg / stored
2 high-level waste has longer half-life / low-level per unit mass / kg [1]
waste has shorter half-life (c) uranium / hydrogen [1]
88

lOMoARcPSD|20595249
Answers
(d) Efficiency = 600 × 106/energyinput (d) 6CO2 + 6H2O → C6H12O6 + 6O2 [1]
6 −1
Energyinput = 600 × 10 /0.30 J s = 2000 × (e) (i) fermentation
106 J s−1 C6H12O6 → 2C2H5OH + 2CO2 [2]
6 3
Mass of fuel = 2000 × 10 /60 × 10 = 33.3 × (ii) C2H5OH(l) + 3O2(g) → 2CO2(g) + 3H2O(l)
103 g s−1 [3] −175 0 2(−394.4) 3(−237.1)
8 (a) coal about 90% and petroleum about 84% ∆G /kJ mol−1
f
0
and natural gas 75% [1] ΔG = 2(−394.4) + 3(−237.1) − (−175) =

(b) they have higher specific energy −1325.1 kJ mol−1
liquid or gaseous state make them more thermodynamic efficiency =

convenient to use / easier to transport −1325.1/−1367 = 97% [3]
produce less pollution / smaller carbon foot (f) bacteria live at the anode
print [2 max] they oxidize the biomass [2]
(c) hydrogen has a very high specific energy / 11 (a) the octane number indicates the resistance
energy density of a motor fuel to knock / premature ignition
it is clean burning producing only H2O when octane numbers are based on a scale on
it is burned [2] which 2,2,4-trimethylpentane (isooctane)
is 100 (minimal knock) and heptane is 0
9 (a)
Formula
Specific
M /g ∆Hc / kJ (maximum knock) [2]
energy /
mol−1 mol−1
kJ g−1 (b) octane number of straight-chain alkanes
decrease with an increase in chain length
C3H8 44.11 −2219 2219/44.11
= 50.31 straight chain alkanes < aromatics
C4H10 58.14 −2878 2878/58.14 alcohols have very high octane numbers:
= 49.50 [2] hexane (24.8) < pentane (61.7) < benzene
(105.8) < ethanol (108) [4]
(b) ρ = PM/RT
The octane numbers are given for reference
Formula Energy / kJ cm−3
and are not expected to be recalled.
C3H8 (2219/44.11) × 1.00 × 105 ×
23 5
44.11/(8.13 × 273) 12 (a) 92U → 23910Th + 42He
= 2219 × 1.00 × 105/ atomic number = 90 and element = Th
(8.13 × 273)
mass number = 231 [2]
=100 000
(b) To answer this question you need to know
C4H10 (2878/58.14) × 1.00 × 105 ×
that the half-life of 235 U is 704 million years.
58.14/(8.13 × 273) 92
= (2878 × 1.00 × 105)/ After one half-life the amount of 235

92
U will
(8.13 × 273) have decayed to 50% of its original amount.
= 130 000 [3] After two half-lives the amount of 235 U will
92
(c) propane as it the smallest molar mass [1] have decayed to 25% of its original amount,
i.e. 75% will have decayed.
10 (a) photosynthesis [1]
2 × 704 million years = 1408 million years
(b) chlorophyll
It will take 1408 million years for 75% of the
conjugated structure [2] 235
U to decay. [2]
92
(c) 6CO2 + 24H+ + 24e− → C6H12O6 + 6H2O [1]
89

lOMoARcPSD|20595249
Answers
13 (a) effects due to: increased carbon dioxide unburned hydrocarbons and carbon
levels, global warming monoxide
non-metal / sulfur / nitrogen oxides produce particulates cause global dimming [3 max]
acid rain
13 (b) Strategy Action
Increased energy efficiency • Use of insulation and more efficient appliances

and conservation • Reducing personal energy use by turning off lights and electronics
when not in use
• Reducing distance travelled in vehicles or using more efficient modes
of transport such as hybrid cars or public transport
Award [1 max] for action
Reduced dependence • Use alternative sources such as solar, wind, geothermal,

on carbon-based energy hydropower, wave, tidal or nuclear power
resources • Use reduced-carbon fuels such as natural gas. The potential use
of biomass depends on the processes by which it is converted to
energy
Award [1 max] for action
Capture and storage of • Carbon dioxide can be removed from the atmosphere and stored
carbon from fossil fuels or within plants and soil supporting the plants. Alternatively, carbon
from the atmosphere dioxide can be captured either before or after fossil fuel is burned
and then be stored (sequestered) within the earth
• Reduce deforestation and plant more trees
Award [1 max] for action [6]
(c) countries with cheaper gasoline on average:

15 (a)
Relative molecular
Standard enthalpy
Specific energy /
use more gasoline of combustion
ΔH / kJmol−1
Formula
kJ g−1
have less efficient vehicles
mass
Fuel
produce more CO2 and have higher carbon

footprint [3]
14 (a) octane C8H18

methane CH4 −891 16.05 55.5
any other compound with C5–C10 [2]
methanol CH3OH −726 32.05 22.7 [2]
(b) fractional distillation
mixture of hydrocarbons is heated causing (b) CH4: Ox (C) = −4; CH3OH: Ox (C) = −2 [1]
them to vaporize
(c) the more oxidized the C the lower the
different compounds have different boiling specific heat [1]
points; the lowest boiling point compounds
condense higher up the column (d)
Relative molecular
Standard enthalpy
Specific energy /
of combustion
ΔH / kJmol−1
as the size of the molecule increases the

Formula
kJ g−1
mass
Fuel
attractive van der Waals forces increase [4]

(c) larger molecules can be cracked into smaller
molecules when heated with a catalyst and
broken into smaller molecules
equation for cracking: C14H30 → C7H14 + methanol C6H12O6 −2803 180.18 15.6
C7H16 [2] oxidation number of C = 0

the result supports the hypothesis [3]
90

lOMoARcPSD|20595249
Answers
16 (a) they are too viscous devices / fuel cells require constant supply
as there are strong intermolecular forces of reactants and batteries have stored
between the triglyceride molecules [2] chemical energy / provide power until stored
(b) transesterification chemicals are used up / batteries can

be recharged and fuel cells do not need
reaction with methanol or ethanol with
recharging (have a continuous supply of
strong acid or base catalyst produces a
fuel) / fuel cells are more expensive than
methyl / ethyl ester [2]
rechargeable batteries / the reactions in a
17 (a) Cathode: rechargeable battery are reversible and in a
2H2O + O2 + 4e− → 4OH– fuel cell are not [2]
Anode: 19 Si has a lower ionization energy (than P or S)
2H2 + 4OH– → 4H2O + 4e−
so electrons can flow through the material more
If both equations given but at wrong easily
electrodes award [1]. [2]
(p-type) has small amount of / is doped with a
(b) Cathode: group 3 element / B / In / Ga
nickel hydroxide / Ni(OH)2
which produces electron holes / positive holes
Anode:
sun / photons cause release of electrons
cadmium hydroxide / Cd(OH)2
electrons move from n-type to p-type
Cell equation:
material [5 max]
Cd + 2H2O + 2NiO(OH) → Cd(OH)2 +
2Ni(OH)2 [3] 20 (a) 56
Fe [1]
18 (a) contains no lithium / metal / uses lithium salt (b) the energy released when nuclides form
in an organic solvent (as electrolyte) from separate nuclei into separate
nucleons [1]
involves movement of lithium ions (between
23 5 1 14 1 92 1
electrodes) [2] (c) 92 U+ n→0 56Ba + Kr +2 n
36 0
(b) Anode: two neutrons produced may cause two

LiC6 → Li+ + 6C + e− / Li+ ions dissociate further fissions
from anode (and migrate to cathode) producing four neutrons which may produce
Cathode: four further fissions [3]
Li+ + e− + MnO2 → LiMnO2 / Li+ + e− + CoO2 (d) one reaction: ∆E = 3.1 × l0−28 × [3 ×
→ LiCoO2 / Li+ + e− + FePO4 → LiFePO4 / Li+ 108]2/2.8 × l0−11 (J)
+ e− + NiO2 → LiNiO2 / Li+ ions are inserted = 2.8 × 10−11 × 6.02 × 1023 = 1.69 × 1013 (J
into metal oxide / phosphate (structure) mol−1)
Award [1] if electrodes are reversed. [2] = 1.69 × 1010 (kJ mol−1) [3]
(c) Similarity: (e) mass of 23 5
U in 1 g = 3.00 × 10−2 g
92
both convert chemical energy directly into
n = 3.00 × 10−2/235 = 0.000128 mol
electrical energy / both use spontaneous
specific energy = 1.69 × 1010 × 0.000128 =
redox reactions (to produce energy) / both
2.16 × 109 kJ g−1 [3]
are electrochemical cells / voltaic cells /
galvanic cells (f) enrichment process
Difference: converted to gaseous UF6
fuel cells are energy conversion devices and position in centrifuge / diffusion rate depends
rechargeable batteries are energy storage on the masses [3]
91

lOMoARcPSD|20595249
Answers
21 (a) nuclear fusion [1] excited electron injected into TiO2 semiconductor
(b) Δm = 0.00535 amu ionized dye reduced by electrode at anode
= 1.66 × 10−27 × 0.00535 kg = 8.88 × electrons pass through external circuit and
10–30 kg reduce electrolyte at cathode [8]
ΔE = Δmc2 = 8.88 × 10−30 × (3.00 × 108)2 J = 23 (a) 42% efficient so 2.00 × 104/0.42 kJ = 4.76 ×
7.99 × 10−13 J 104 kJ required every second
= 4.18 × 1011 J mol−1 = 4.18 × 108 kJ mol−1 4.76 × 107/2.8 × 10−11 = 1.70 × 1018 fissions
[4] each second = 6.12 × 1021 fissions each
(c) 32He hour
this is the source of the energy produced [2] moles needed = 6.12 × 1021/6.02 × 1023 =
1.02 × 10−2 so mass needed = 235 × 1.02 ×
(d) confining the hot plasma [1]
10−2
22 Photovoltaic cell: = 2.39 g [3]
an impurity such as arsenic and gallium added
(b) U-238 is present
to dope silicon layers to produce p–n junction
U-238 captures a neutron (to produce
electron emitted as photon ionizes Si atom
plutonium)
when p-type and n-type silicon are put together,
plutonium can be used as fuel for (fast
an electric field is produced which prevents
breeder) reactors [3]
recombination
(c) 0.693/(2.40 × 104 yr) = 2.89 × 10−5 yr−1 [1]
electrons need to pass through external circuit
(d) −ln(0.01)/2.89 × 10−5
Dye sensitised cell:
organic molecules with conjugated absorbs = 1.59 × 105 yr [2]
electrons
Chapter 15
Exercises
1 intramuscular / into muscles (b) Bioavailability, side-effects, possibility of

intravenous / into veins tolerance and addiction of the drug; age,
sex, diet and weight of patient.
subcutaneous / into fat
(c) Low therapeutic index means a low margin
The fastest will be intravenous as the drug can
of safety, so small changes in dosage may
be transported quickly all over the body in the
produce adverse side-effects.
bloodstream.
4 Method of administration of drug, solubility (in
2 Tolerance occurs when repeated doses of a
water and lipid) and functional group activity.
drug result in smaller physiological effects. It is
potentially dangerous because increasing doses 5 (a) 84.94%
of the drug are used in response and this might (b) melting point determination: melting point of
get close to or exceed the toxic level. asprin is 138–140°C
3 (a) Lethal doses can be determined for animals; 6 Increase its solubility in water by converting to
in humans the upper limit is the toxic dose. sodium salt.
92

lOMoARcPSD|20595249
Answers
7 (a) Mild analgesic blocks transmission of 14 (a) Mg(OH)2 + 2HCl → MgCl2 + 2H2O
impulses at site of injury, not in the brain; Al(OH)3 + 3HCl → AlCl3 + 3H2O
anticoagulant acts to prevent coagulation /
(b) Al(OH)3 reacts with H+ in a mole ratio of 1:3
thickening of the blood and so reduces risk
of coronary disease. Mg(OH)2 reacts with H+ in a mole ratio of 1:2
(b) Alcohol has synergistic effect with other So 0.1 mol Al(OH)3 will neutralize the greater
drugs; can cause stomach bleeding with amount.
aspirin. (c) KOH is a strong alkali so would be
dangerous for body cells; it is corrosive and
8 (a) R–C9H11N2O4S
would upset the stomach pH.
(b) At the R group. Modification prevents the
binding of the penicillinase enzyme and so 15 (a) pH changes from 5.12 to 5.11 (assuming no
maintains the action of the drug / prevents volume change on mixing).
resistant bacteria rendering it inactive. (b) No change in pH on dilution of buffer.
(c) Beta-lactam ring undergoes cleavage and 16 Viruses lack a cellular structure and so are
binds irreversibly to the transpeptidase difficult to target. Antibiotics specifically interfere
enzyme in bacteria. This inactivates the with bacterial cell walls or internal structures.
enzyme, which interrupts the synthesis of Viruses replicate inside host cells and so
bacterial cell walls. treatment may involve killing host cells.
9 Overuse of antibiotics in animal stocks / food 17 Subunits in hemagglutinin (H) and neuraminidase
chain; over-prescription; failure of patients to (N) can mutate and mix and match, so forming
complete treatment regimen. different strains. These change the specific
10 (a) The functional groups in common are ether nature of the glycoprotein–host interactions, and
linkage (–C–O–C–), tertiary amine linkage alter the body’s immune response. This is why it
(R–N(R′ – R″), alkene (–C=C–) and a is possible to suffer from flu several times during
benzene ring. a lifetime.
(b) main effect: pain relief 18 Tamiflu and Relenza do not prevent the flu virus
side-effect: constipation from entering cells, but act to stop it from being
released from the host cells. So if the infection is
11 Diamorphine has two ester groups in place of not stopped early, too many new viral particles
two –OH groups in morphine. The less polar may have already been released.
diamorphine is more soluble in lipids and so
crosses the blood–brain barrier more easily, and 19 Challenges: antiretroviral costs, distribution and
enters the brain where it blocks the perception of availability; patient compliance to regimen and
pain. multiple drug treatments; sociocultural issues.
Successes: new and more effective antivirals
12 In favour: strongest pain killer known; the only
that can be used in combination; better
effective analgesic against extreme pain.
screening of HIV-positive; controlling infection
Against: addictive drug; leads to dependence through drugs.
and serious side-effects.
20 (a) Bark of Pacific yew tree. Harvesting has
13 H2-receptor antagonists: block the binding of depleted the trees which grow slowly.
histamine, which prevents the reactions leading
(b) Taxol has 11 chiral carbon atoms, giving
to stomach acid secretion.
rise to a very large number of possible
Proton-pump inhibitors: directly prevent the stereoisomers. At many stages in its
release of acid into the stomach lumen.
93

lOMoARcPSD|20595249
Answers
synthesis, different enantiomers could components are the same as those between
be produced, which may have different the particles in the pure substances.
physiological properties, so these steps
(b) Boiling point of a mixture decreases with
need to be controlled by chiral auxiliaries.
increasing height in a fractionating column
21 A chiral auxiliary is itself an enantiomer which as the mixture becomes enriched in the
bonds to the reacting molecule to create the more volatile component.
stereochemical environment necessary to follow
28 (a) 2850–3090 cm−1 is characteristic of the
a certain pathway. The reaction then takes
C–H bond
place, forming the desired enantiomer and the
chiral auxiliary is then removed. 3200–3600 cm−1 is characteristic of the
O–H bond
Different enantiomers may have different
biological effects, some of which may be (b) The peak at 2850–3100 cm−1 is used to
harmful. An example are the genetic deformities characterize ethanol in the presence of water
caused by the (S)-enantiomer of the drug vapour.
thalidomide in the racemic mixture. (c) Propanone also contains C–H bonds,
90
which give the same characteristic band at
22 (a) Y → 9400Zr + −01β
39
2950 cm−1 as ethanol.
(b) 238 g
29 (a) molecular ion at m/z = 194
23 6.13 hours
(b) C–H in methyl groups: 2850–3090 cm−1
24 (a) Half-life is 6 hours – long enough for C=O: 1700–1750 cm−1 (two different peaks)
diagnosis but decays quickly.
(c) four peaks, relative areas 3:3:3:1
Radiation is gamma rays used for detection,
(d) amine, amide, alkene
and low-energy electrons which minimize
radiation dose. The isotope is chemically 30 Solvents cause problems of disposal. Organic
able to bond to various biomolecules. solvents can be incinerated, causing release
(b) Strong beta emitters that also emit gamma of pollutants, greenhouse gases and toxins.
radiation to enable imaging. Solvents can contaminate ground water and soil.
Some solvents can be hazardous to health of
25 (a) Targeted alpha therapy uses alpha emitters workers.
attached to carriers such as antibodies,
which specifically target certain cells. 31 Protective shoe-covers, clothing, gloves, paper
towels and contaminated implements. Interim
(b) Very high ionizing density and so a high storage in sealed containers for radioactivity to
probability of killing cells along their track. decay, before conventional disposal.
Short range and so minimize unwanted 32 The success of antibiotics in treating disease has
irradiation of normal tissue surrounding the led to their widespread use, and in some cases
targeted cancer cells. over-use. Exposure of bacteria to antibiotics
26 B – immiscible liquids increases the spread of resistant strains.
Antibiotic resistance renders some antibiotics
27 (a) An ideal solution contains fully miscible ineffective, especially with multiply resistant
components. Each component exerts strains, e.g. MRSA.
the same vapour pressure in the mixture,
according to its relative concentration, 33 Patient compliance refers to the importance
as it does when pure. The intermolecular of patients following medical instructions,
forces between the particles of the different in particular to completing the course of an
94

lOMoARcPSD|20595249
antibiotic treatment. This helps prevent the the eleven chiral O

spread of antibiotic-resistant bacteria. O carbon centres
O O OH
34 Green Chemistry principles seek to reduce
NH O
toxic emissions and waste substances in the
manufacture of drugs. This includes reduction
O
in the amount of solvent used, the adoption
of synthesis pathways with shorter routes, the OH O
H
OH O O
replacement of inorganic catalysts with enzymes
and the recycling of waste.
O O
6 K2CO3 dissolves readily in water, but not easily

Challenge yourself in ethanol as it is less polar. The presence of
the ions in water reduces the solubility of the
1 Two top C atoms in beta lactam ring: sp3 ethanol, so it forms a separate layer on top of
Lower C atom in beta lactam ring: sp2 the water. This process is used in biochemistry
to precipitate proteins from solution.
C in COOH group: sp2
All other C atoms: sp3
lower C atom in beta lactam ring (amide carbon):
sp2
Practice questions
2 Ethanoic anhydride is more susceptible to 1 (a) [1]
nucleophilic attack due to two electron-
withdrawing carbonyl groups:
d2
d1 O
R C d2
d1 O
R C d2 No mark if circle includes CO or just O.
O
Award [1] if it includes 7 C atoms but misses
This enables it to react more vigorously than out on attached H atoms
CH3COOH with the –OH groups in morphine.
(b) overprescription can lead to allergic reaction
3 Na2CO3 and NaHCO3 contain the conjugate may wipe-out harmless/helpful/beneficial
bases CO32− and HCO3− of weak acids. They are bacteria (in the alimentary canal)/destroyed
able to hydrolyse water and release OH− ions: bacteria may be replaced by more harmful
CO32−(aq) + H2O(l) → HCO3−(aq) + OH−(aq) bacteria
HCO3−(aq) + H2O(l) → H2CO3(aq) + OH−(aq) (may pass on genetic) resistance/immunity
4 Neuraminidase inhibitors compete with the [1] each for any two.
substrate sialic acid for binding to the enzyme modify R group/side chain to change
neuraminidase. They have a chemical structure penicillin effectiveness / form penicillin that
similar to the substrate and so bind in the same is more resistant to penicillinase
way at the active site of the enzyme. enzyme [3 max]
5 Red asterisks mark the position of chiral carbon 2 chiral auxiliaries are enantiomers/optically active
atoms.
95

lOMoARcPSD|20595249
Answers
auxiliary creates stereochemical condition (b) diamorphine has (2) ester/acetyl/COOCH3

necessary to follow a certain pathway / is used groups instead of hydroxyl/OH groups
to manufacture one enantiomer (so avoids need diamorphine is less polar/non-polar [2]
to separate a racemic mixture)
6 if concentration is too high it will have harmful
attaches/connects itself to non-chiral molecule /
side effects / determination of the lethal dose (to
makes it optically active
50% of the population / OWTTE
only desired/one enantiomer/molecule formed
if concentration is too low it has little or no
(and chiral auxiliary removed) [2 max]
beneficial effect / determination of the effective
3 (a) Al(OH)3 + 3HCl → AlCl3 + 3H2O / Mg(OH)2 + dose / dose which has a noticeable effect (on
2HCl → MgCl2 + 2H2O [1] 50% of the population) / OWTTE
Accept ionic equations. therapeutic window is the range between these
(b) less effect and (magnesium hydroxide) 2/0.2 doses / range over which a drug can be safely
mol OH− ions available as compared to administered / ratio of LD50:ED50
(aluminium hydroxide) 3/0.3 mol OH− ions for for minor ailments a large window is desirable,
neutralization / neutralizes 2H+/0.2 mol acid for serious conditions a smaller window may be
as compared to 3H+/0.3 mol acid [1] acceptable / OWTTE
Do not accept aluminium hydroxide can (therapeutic window) depends on the drug/age/
neutralize more acid. sex/weight
4 (a) viruses do not have cell/cellular structure a small therapeutic window means that an
overdose is a high risk / OWTTE [4 max]
viruses do not have nucleus
viruses do not have cell wall 7 (a) amine
viruses do not have cytoplasm [2] ether
Accept opposite statements for bacteria. alkene
(b) stops virus replication benzene ring [2 max]
Accept reproduction / multiplication. Do not allow arene.
becomes part of DNA of virus / alters virus Allow phenyl (ring or group) or benzene.
DNA / blocks polymerase which builds DNA Allow structural representation of functional
changes the cell membrane that inhibits the group instead of name (e.g. C=C instead of
entry of virus into the cells alkene).
prevents viruses from leaving the cell (after (b) phenol / alcohol / hydroxyl (group) [1]
reproducing) [2 max] Allow OH.
(c) HIV mutates (rapidly) (c) (di)esterification / condensation / (di)
Accept AIDS mutates acetylation [1]
HIV metabolism linked to that of host cell / 8 (a) penicillins interfere with the enzymes that
HIV uses host cell / drugs harm host cell as bacteria need to make cell walls / interfere
well as HIV / difficult to target HIV without with formation of bacterial cell walls /
damaging host cell OWTTE
HIV destroys helper cells of the immune the increased osmotic pressure causes the
system [2 max] bacterium to die / the bacterial cells absorb
too much water and burst / OWTTE [2]
5 (a) fast delivery / OWTTE [1]
96

lOMoARcPSD|20595249
(b) resistance to penicillinase enzyme / more (ii) (secondary) amine group / non-bonding
resistance to bacteria breaking it down / pair of electrons on (electronegative) N
effective against bacteria that are resistant atom [1]
(to penicillin G)
10 (a) C [1]
resistance to breakdown by stomach acid
(b) A / B/ A and B [1]
(so can be taken orally / OWTTE [2]
(c) A [1]
(c) amide group / –CONH– / peptide
ring is strained / 11 (a) intravenous / into veins
ring breaks easily so (the two fragments transported/pumped via blood (to various
similar to cysteine and valine) then bond(s) parts of the body) [2]
covalently to the enzyme that synthesizes (b) intramuscular/intermuscular/into muscles
the bacterium cell wall (so blocking its and subcutaneous/into fat [1]
action) [3] Allow [1] if all three methods are stated in
9 (a) H [2] (b)(i) and (ii) but not in correct place.
N
H2C CH2
(c) inhalation/breathing it in [1]
O HC CH2 12 (a) (i) Oxidation:

O
CH2 CH C2H5OH + H2O → CH3COOH + 4H+ +
H2C
4e−
O
Reduction:
Cr2O7−2 + 14H+ + 6e− → 2Cr3+ + 7H2O
Accept balanced equation with
F molecular formulas.
Award [1] for each correctly placed asterisk. If both equations are wrong, award [1]
(b) different enantiomers can cause different for C2H5OH → CH3COOH and Cr2O72−
(physiological) effects in the body → 2Cr3+.
thalidomide – one isomer prevented If correct equations are used but
morning sickness, the other caused fetal oxidation and reduction reversed, award
abnormalities / ibuprofen – one isomer is [1].
more effective than the other / DOPA – one (ii) orange to green [1]
isomer helps manage Parkinson disease, the −1
(b) peak at 2950 cm / absorption occurs due
other has no physiological effects [2]
to C–H bonds in ethanol
Accept other correct examples.
No mark for absorption due to just ethanol,
(c) chiral auxiliaries are themselves chiral or O–H bond in ethanol (water vapour in
attach to the non-chiral molecule (to enable breath also contributes).
the desired enantiomer to be formed) intensity / height to peak / absorption
after the desired enantiomer is formed the / amount of transmittance depends on
chiral auxiliary is removed/recycled [2 max] amount of ethanol / compare absorption
(d) (i) it turns the (relatively non-polar) molecule to standard / reference/control sample /
into an ionic/polar species sample containing no alcohol [2]
it increases its solubility in aqueous 13 (a) shorter half-life means the body is exposed
solutions / facilitates distribution around to radiation for a shorter time [1]
the body [2] (b) I → 13514Xe + −01β + 00γ
13 1
[1]
53
97

lOMoARcPSD|20595249
Answers
14 (a) boiling boiling [3] 15 obtained from needles of Pacific yew tree /
point point
BPt of
obtained from fungus / fermentation process
pure A
vapour composition
avoids production of waste / hazardous by-
products / (fermentation) avoids use of solvents /
liquid composition reagents / resources used renewable [2]
BPt of
pure B
0A 1.0 A
1.0 B mole fractions 0B
(b) as vapour rises up the column, it cools,

condenses and falls back down. It is re-
boiled by ascending vapour in a repeating
cycle until vapour exits the top of the
column [3]
98

lOMoARcPSD|20595249
Answers
99

Pearson Ib Chemistry Text Book Answers

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Pearson Ib Chemistry Text Book Answers

Uploaded by

Copyright:

Available Formats

lOMoARcPSD|20595249

Pearson IB Chemistry Text book answers

Chemistry HL (International Baccalaureate Diploma Programme)

Studocu is not sponsored or endorsed by any college or university

1 (a) CuCO3 → CuO + CO2 6 X has diffused more quickly, so it must be a

5 (a) 2KNO3(s) → 2KNO2(s) + O2(g) 11 B

Z08_CHE_SB_IBDIP_9755_ANS.indd 2 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

(c) 1.20 × 1023 Therefore the number of carbon atoms used =

17 189.1 g 37 (a) 2C4H10 + 13O2 → 8CO2 + 10H2O

18 1.5 mol (b) 1.59 g

19 0.0074 mol Cl− 38 4.355 kg

20 1.83 × 1024 C atoms 39 (a) CaCO3 → CaO + CO2

25 Na2S2O3 42 253.2 g theoretical CaSO3; 77.9%

26 CoSO4.7H2O 43 3.16 g ester

27 C17H25N 44 107 g of C6H6 needed

28 NH3 45 (a) 2.40 mol (b) 0.0110 mol

Z08_CHE_SB_IBDIP_9755_ANS.indd 3 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

55 M = 133 g mol−1 so gas is Xe 73 52% NH3 by mass; assuming no side reactions

61 (a) Particles are in constant random motion and

Z08_CHE_SB_IBDIP_9755_ANS.indd 4 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

Allow whole numbers for molar masses.

Allow whole numbers for atomic masses.

Award [3] for correct final answer of 2HCl(aq) + CaCO3(s) → CaCl2(aq) +

Z08_CHE_SB_IBDIP_9755_ANS.indd 5 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

1 Examples are density (related to mass) or, for 4 electrons

gases, rate of diffusion.

2 Tellurium has a greater proportion of heavier

Z08_CHE_SB_IBDIP_9755_ANS.indd 6 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

8 Let x atoms be 20Ne atoms. The remaining 16 Sub-level 4s 4p 4d 4f

Z08_CHE_SB_IBDIP_9755_ANS.indd 7 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

3 The Schrödinger model:

1 In 1827 Robert Brown dropped grains of

Z08_CHE_SB_IBDIP_9755_ANS.indd 8 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

(b) 27 protons and 25 electrons [1]

1 Element Period Group 4 C 5 B 6 C

Z08_CHE_SB_IBDIP_9755_ANS.indd 9 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

8 Si4+ has an electronic configuration of 1s22s22p6 32

(a) State under

Z08_CHE_SB_IBDIP_9755_ANS.indd 10 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

34 3d 4s 46 (a) Ni (b) V2O5

Z08_CHE_SB_IBDIP_9755_ANS.indd 11 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

the absorption of visible light results in electrons

Z08_CHE_SB_IBDIP_9755_ANS.indd 12 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

9 D 10 D 11 C 12 C 17 (a) Na: 11 p, 11/2.8.1 e− and Na+: 11 p, 10/2.8

Z08_CHE_SB_IBDIP_9755_ANS.indd 13 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

Allow converse for Na. Do not accept ‘has (c) +2 [1]

21 NH3 is a Lewis base and Cu2+ is a Lewis acid [1] [1]

each NH3/ligand donates an electron pair (b) splitting increases/greater [1]

Z08_CHE_SB_IBDIP_9755_ANS.indd 14 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

Z08_CHE_SB_IBDIP_9755_ANS.indd 15 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

Z08_CHE_SB_IBDIP_9755_ANS.indd 16 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

40 (i) S: FC = 6 – 4 = +2 each O: FC = 6 – (1 + 6) angles of 109.5° give the puckered shape.

Z08_CHE_SB_IBDIP_9755_ANS.indd 17 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

8 In the polar winter small amounts of water vapour 5 B 6 A 7 B 8 D

17 (a) PBr3 SF6

Z08_CHE_SB_IBDIP_9755_ANS.indd 18 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

(b) (i) σ bond: Bonding

π bond: Delocalized electrons

Z08_CHE_SB_IBDIP_9755_ANS.indd 19 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

Z08_CHE_SB_IBDIP_9755_ANS.indd 20 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

For Lewis structures candidates are not 2

120° [2] For both species, allow either arrow or

Z08_CHE_SB_IBDIP_9755_ANS.indd 21 Downloaded by mohammad abdurehman (mohammdabdurehman239@gmail.com) 05/09/2014 10:01

10 (a) ΔT = 36.50 – 25.85 = 10.65 °C (or K)

For Lewis structures candidates are not 2