FOCUS ON PHARMACOGENETICS

TECHNOLOGY PLATFORMS
FOR PHARMACOGENOMIC
DIAGNOSTIC ASSAYS
Walter H. Koch
Abstract | Rapid advances in the understanding of genomic variation affecting drug responses,
and the development of multiplex assay technologies, are converging to form the basis for new
in vitro diagnostic assays. These molecular diagnostic assays are expected to guide the
therapeutic treatment of many diseases, by informing physicians about molecular subtypes of
disease that require differential treatment, which drug has the greatest probability of effectively
managing the disease, and which individual patients are at the highest risk of experiencing
adverse reactions to a given drug therapy. This article reviews some of the relative strengths and
limitations of the most widely used technologies and platforms for such assays.

SINGLE-NUCLEOTIDE
POLYMORPHISM
A substitution of one base
pair at a given position in
genomic DNA.
Roche Molecular Systems,
Pharmacogenetics
Department, 4300 Hacienda
Drive, Pleasanton,
California 94588, USA.
e-mail
walter_h.koch@roche.com
doi:10.1038/nrd1496
During the past thirty years, genetic variation in infec-
tious agents, as well as in humans, has been shown to
underlie many of the inter-individual differences in
drug response1,2. The earliest examples included
antibacterial and antiviral drug resistance, inherited
variation in several human cytochrome P450 drug-
metabolizing enzyme genes and various genes encoding
drug-conjugation enzymes, such as N-acetyltransferase
(NAT2), thiopurine methyltransferase (TPMT) and
glutathione transferase (GST)3–8.
Initial investigations of polymorphic human genes
indicated that a small number of common variants
accounted for the vast majority of differential enzyme
activity and drug responses observed. Recent research
has, however, revealed that drug-response variability, in
common with the genetics underlying complex diseases,
can involve many different genes and variants that alter
protein expression or function. Indeed, the number and
kinds of genetic variation affecting drug response
mirror those seen throughout the human genome, and
include every known type of variation, including SINGLE-
NUCLEOTIDE POLYMORPHISMS (SNPs), insertions and dele-
tions, gene conversion, complete gene deletion, and
gene duplication and amplification9 (see CYP2D6 allele
nomenclature website listed in the further information
section). In addition, changes in the expression of
individual genes or clusters of genes are increasingly
being viewed as biomarkers that could be predictive of
drug response10–12. This diversity of genetic and genomic
variation can be quite challenging for the development
of routine in vitro diagnostic assays. For example, certain
genotyping technologies and chemistries are broadly
applicable to the detection of several different forms of
variation, whereas others are substantially more limited
and often require complementary assays to be performed
to provide a complete genotype.
Polymerase chain reaction (PCR)-based assays,
coupled with various post-PCR detection methods,
have formed the cornerstone of most molecular diag-
nostic assays for nucleic-acid analytes, including those
developed for pharmacogenomics. With each new dis-
covery adding complexity to any given drug response
for which predictive biomarkers are desired, it has
become clear that, in the future, routine clinical diagnos-
tic assays will require convenient, automated, multiplex
detection formats for the simultaneous assessment of
many different molecular markers.
At the present time, assay formats can conveniently be
divided into low and high complexity on the basis of the
number of markers to be detected (see TABLE 1 for a
summary of common assay formats). In cases in which
relatively few SNPs within a single gene (or distributed

NATURE REVIEWS | DRUG DISCOVERY VOLUME 3 | SEPTEMBER 2004 | 7 4 9

REVIEWS

Table 1 | Technology platforms for pharmacogenomic diagnostic assays

Method Amplification Principle Detection Application(s) References
Low complexity
PCR-RFLP PCR Restriction site Gel-based SNP genotyping 29,30
AS-PCR PCR Allele-selective Gel-based, homo- SNP, other 13,31,32
amplification geneous fluorescence genotyping
TaqMan PCR PCR, RT-PCR FRET quenched Homogeneous Genotyping, 14,33,35
hydrolysis probes fluorescence mRNA
(including allele-specific) quantitation
Hybridization PCR, RT-PCR FRET reporting hybridization Homogeneous Genotyping, 36,37,38,39,40
probe PCR probes (differential melting fluorescence mRNA
FRET loss for genotyping) quantitation
Invader +/– PCR FRET quenched Fluorescence endpoint Genotyping, 15,44,45,46
Cleavase probes (including measurement mRNA
allele-specific) quantitation
High complexity
Linear arrays PCR Allele-specific immobilized Colorimetric detection Genotyping 20
oligonucleotide probes +/– densitometric strip
(nylon membranes) scanning
Microsphere PCR Coloured bead-immobilized Flow cytometry Genotyping, 16,22,48,51
arrays anti-Tag oligonucleotide fluorescence mRNA
and Tag-primer AS-PE quantitation
High-density PCR (DNA) Perfect-match/mismatch One- or two-colour Genotyping, 21,24,50,52,
oligonucleotide RT/IVT (RNA) signal detection fluorescence re-sequencing, 53,55,63,65,
arrays mRNA 66,70
quantitation
Electrophoretic PCR/RT-PCR Dideoxy-chain termination Slab gel or capillary Genotyping (w/SBE), 61,62,65
sequencing products, SBE fluorescence DNA sequencing
AS-PCR, allele-specific PCR; AS-PE, allele-specific primer extension; IVT, in vitro transcription; FRET, fluorescence resonance energy
transfer; PCR, ploymerase chain reaction; PCR-RFLP, PCR restriction fragment length polymorphism; RT-PCR, reverse transcription
PCR; SBE, single-base extension; SNP, single-nucleotide polymorphism.

CAPILLARY ELECTROPHORESIS
An adaptation of traditional
slab gel electrophoresis to a
capillary format.
MALDI-TOF MASS
SPECTROMETRY
A technique that enables mass
spectrometric analyses of
biomolecules including
proteins and nucleic acids.
across a few genes) must be identified, or the differential
gene expression of a few genes determined, homo-
geneous ‘real time’ PCR detection assays and various
other low-complexity assay formats can be used. These
include methods such as allele-specific PCR (AS-PCR),
TaqMan, hybridization probe-melting analysis, Invader
probes, single-base extension (SBE, or mini-sequence
analysis) and oligonucleotide ligation-PCR reactions
(OLA-PCR)13–17. This list is by no means exhaustive and,
in some cases, several different detection labels (for
example, fluorescent, chemiluminescent or electrochemi-
cal), as well as instrument platforms, have been used with
the same technical format. For example, SBE genotyping
reactions can be analysed by fluorescence detection
with CAPILLARY ELECTROPHORESIS, bead-coupled or micro-
array-based universal Tag arrays, matrix-assisted laser
desorption ionization time-of-flight (MALDI-TOF) mass
spectrometry, as well as a variety of other approaches18,19.
When marker complexity exceeds that which can be
conveniently performed by multiple reactions using the
aforementioned techniques, array formats of one form
or another provide significant advantages for multi-
plexing markers in a single assay format. These tech-
nologies, which are usually based on allele-specific
hybridization or SBE, allow highly parallel genotyping
assays to be designed. They include reverse line blots,
oligonucleotide microarrays and bead-based tech-
nologies for simultaneous genotyping of multiple
monogenic or polygenic variants20–22. For example, a
decade ago immobilized oligonucleotide probe ‘linear
arrays’ were used to develop a method for typing poly-
morphisms at the human leukocyte antigen (HLA)-A
locus, a format that has also been used to develop geno-
typing assays for genes encoding other HLAs, the cystic
fibrosis transmembrane conductance regulator (CFTR)
protein, human immunodeficiency virus (HIV) drug
resistance and subtypes of human papilloma virus22.
Pharmacogenetic analysis of highly polymorphic genes,
such as the cytochrome P450 CYP2D6 gene, has also
been simplified by the use of immobilized oligo-
nucleotide array technologies, in this case microarrays23,24.
When coupled with multiplex PCR reactions, high-
density oligonucleotide microarrays are uniquely able to
simultaneously detect the presence of SNPs, insertions
and deletions, gene conversions, complete gene-deletion
and gene-duplication events in a single, allele-specific
hybridization reaction, as exemplified by the oligonu-
cleotide microarray-based genotyping of the CYP2D6
gene. So far, this is the only detection format that has
allowed simultaneous genotyping of such diverse forms
of genetic variation. It should be noted that CYP2D6 is
just one example of a monogenic assay that is predictive
of drug response; for other drugs, polygenic genotyping
— perhaps combining genotyping of drug transporters,
drug targets and drug-metabolizing enzymes — could
eventually become routine and require platforms capable
of performing assays of even higher complexity.
More recently, researchers have also turned their
attention to the global analysis of mRNA transcripts to
identify differentially expressed genes that have a role in

750 | SEPTEMBER 2004 | VOLUME 3 www.nature.com/reviews/drugdisc

 FOCUS ON PHARMACOGENETICS

a Denature hν Reporter fluorescence quenched human disease biology and drug response. The use of
microarray technology and sophisticated data-analysis
tools designed to evaluate all or most known human
R Q
genes allows the comparison of differential gene-
expression profiles between normal tissues and diseased
Primer Probe counterparts, and has revealed patterns or ‘signatures’
that readily differentiate the former from the latter25. For
example, gene-expression profiles can reveal specific
genes that are overexpressed in a particular cancer sample
due to genetic variation, altered transcriptional regulation
or epigenetic effects26. In some cases, the proteins that
Anneal hν Reporter fluorescence quenched are over- or underexpressed are drug targets or drug-
response modifiers, and therefore the gene-expression
signatures could serve as molecular markers for predict-
R Q
ing the probable response to particular drug therapies27.
The tremendous heterogeneity among cancers in particu-
lar makes high-density microarray platforms ideally
suited for discovering potential diagnostic and prognostic
markers, although in some cases the ultimate diagnostic
test will make use of quantitative homogeneous real-time
Extend hν Reporter fluorescence detected platforms for a smaller subset of informative markers.
Although beyond the scope of this review, it is worth
R noting that proteomic analysis technologies, including
two-dimensional gel analysis, MALDI-TOF mass spec-
trometry and protein arrays, are providing complemen-
Q tary information that might also result in new diagnostic
Taq tests that guide treatment decisions28.
The application of genetic, genomic and proteomic
technologies to the development of in vitro molecular
diagnostics provides many opportunities for improving
choice of therapy and the prediction of drug response.
b FC1 C430 (WT probe) FC2 430T (*2 MUT probe) The development of such in vitro diagnostics brings
14 14 with it numerous challenges, including those posed by
Normal fluorescence

Normal fluorescence

12 12
biological and technical complexity, as well as novel
10 10
8 8
regulatory issues associated with multi-analyte analyses.
6 6 These include complex instrumentation and assay for-
4 4 mats, and algorithms and software for the interpretation
2 2 of results. Given that the first examples of in vitro diag-
0 0 nostics designed to aid therapeutic decisions are making
0 10 20 30 40 50 60 0 10 20 30 40 50 60
Cycles Cycles their way towards regulatory approval and routine use
in the clinic, it is timely to review some of the relative
FC3 A1075 (WT probe) FC4 1075C (*3 MUT probe)
7 7
strengths and limitations of the most widely used tech-
Normal fluorescence

Normal fluorescence

6 6 nologies and platforms. This review will limit discussion

5 5
4 4
3 3
2 2
1 1
0 0
0 10 20 30 40 50 60 0 10
Cycles
Figure 1 | Genotype analysis approaches: TaqMan probes. a | TaqMan hydrolysis probe
principles. The 5′-nuclease activity of thermostable polymerases used in the polymerase chain
reaction (PCR) cleaves hydrolysis probes during the amplicon extension step, which separates
the detectable reporter fluorophore (R) from a quencher (Q). Fluorescence emitted when excited
by an external light source (hν) at each PCR cycle is proportional to the amount of product formed.
b | CYP2C9 genotyping. The data were generated with several DNA samples, in each case using
four hydrolysis probes in a single reaction. Each probe uses a different reporter dye with different
excitation/emission characteristics, and is complementary to one of the two variant alleles of
CYP2C9*2 or CYP2C9*3. The panels show fluorescence curves for either the common wild-type
complement probe (left) or the less common variant probe (right) of the CYP2C9*2 C430T SNP (top)
or the CYP2C9*3 A1075C SNP (bottom). Note that no detectable signal is generated when the
hydrolysis probe is mismatched (red curves). Heterozygous (pink or blue curves) and homozygous
samples (black curves) are shown for each case except the homozygous CYP2C9*3 allele.
primarily to genotyping and potential gene-expression-
based diagnostic opportunities. Furthermore, only
those assay formats and platforms that are commonly
used and currently automated, or that have near-
term automation potential, will be described, because
20 30 40 50 60 automation is a key driver for widespread adoption in
Cycles routine clinical diagnostic use.
Genotype analyses
The best-characterized examples of genetic variation
affecting individual responses to one or more classes of
drugs involve SNPs and other forms of variation in
genes encoding drug-metabolizing enzymes such as
TPMT, CYP2C9, CYP2C19 and CYP2D6. Of these, all
but CYP2D6 are amenable to low-complexity assay
formats, as the vast majority of so-called poor metabo-
lizers — that is, individuals who have inherited two
defective alleles — are defined by two or three common

NATURE REVIEWS | DRUG DISCOVERY VOLUME 3 | SEPTEMBER 2004 | 7 5 1

REVIEWS

a SNPs and alleles. Genotype analyses of common SNPs

within these genes have traditionally used PCR restriction
D R fragment length polymorphism (PCR-RFLP) analyses,
Donor dye Reporter dye particularly in situations in which naturally occurring
restriction sites exist29. When no restriction-enzyme
Excitation motif exists at the polymorphic site of interest, PCR
Emission primers have been used to introduce nucleotide
Excitation
Emission changes that create a restriction site for either of two
variants30. Although these methods are still used in
research settings, they are cumbersome and labour
intensive, and are not easily automated for routine
clinical diagnostic or high-throughput use. In addition,
they can produce misleading results due to incomplete
restriction digestion. Moreover, because this approach
requires opening reaction tubes post-PCR for the
treatment of amplicon(s) with restriction enzymes
(followed by electrophoretic analysis), the risk of PCR
b carry-over contamination necessitates the physical
hν No reporter fluorescence detected
separation of sample preparation, PCR set up and
post-PCR analysis to avoid false positives that result
D R
from PCR carry-over contamination. Modern tech-
niques for the discrimination of simple sequence varia-
tions all use allele-specific hybridization principles
and, in most cases, make additional use of unique
enzymatic discrimination capabilities, generally as
Primer Probe 1 Probe 2
part of closed-tube, homogeneous systems.

Allele-specific PCR. Allele-specific PCR (AS-PCR)

Reporter fluorescence detected
hν because of FRET
D R
No reporter fluorescence detected
hν
R cons in each reaction vessel is indicative of the
D intended amplification product, and not confounded
Taq
Figure 2 | Genotype analysis approaches: hybridization probes. a | Fluorescence
resonance energy transfer (FRET) principles. Excitation of a donor dye (D) by an external light
source (hν) leads to longer wavelength emission by a reporter dye (R) when the two are in
close proximity. b | Hybridization probe principles. Polymorphisms are detected with two
hybridization probes, one complementary to the wild-type allele and another adjacent probe,
when they hybridize to single-stranded polymerase chain reaction (PCR) products and FRET
occurs. Loss of fluorescence during a final PCR denaturation step results in a characteristic
melting-curve profile. Variants are distinguished from wild-type sequence because the
mismatch duplex between a wild-type complement probe and a variant sequence melts and
loses fluorescence at a lower temperature than the wild-type perfect duplex.
uses the differential amplification efficiency of two
homologous primers that differ only in their ultimate
3′-position; each primer is a perfect-match comple-
ment for the normal or variant allele13. The products
of each reaction can be detected via gel-based analysis
or, more typically, using fluorescent dye-based homo-
geneous real-time or kinetic PCR detection 31,32.
Homogeneous real-time detection represents a signif-
icant improvement over electrophoretic analysis in
terms of ease of use and automation. However, in gen-
eral, fluorescent dye-based AS-PCR requires at least
two PCR reactions per polymorphism queried.
Furthermore, AS-PCR relies on the optimization of
PCR amplification selectivity alone to ensure that the
fluorescent signal generated by dye binding to ampli-
by undesired side reactions, including primer dimers.
Because direct detection of polymorphisms is prefer-
able in a clinical diagnostic, and because genotyping
assays frequently, if not generally, must detect two or
more polymorphisms, various multiplex approaches
have been developed that meet this need, such as
those using TaqMan probes, hybridization probes and
Invader probes.
TaqMan probes. Increasingly, the methods of choice for
single and multiplex genotyping use homogeneous
amplification with direct probe-based variant detec-
tion. Although there are many possible variations of
this theme, the most commonly used method features
5′-nuclease hydrolysis probes, also known as TaqMan
probes14, 33 (FIG. 1a). Two differentially labelled fluorescent

752 | SEPTEMBER 2004 | VOLUME 3 www.nature.com/reviews/drugdisc

 FOCUS ON PHARMACOGENETICS

A probe A probe C probe

Invader oligo T T G

A C C
A target C target C target
Cleavage No cleavage Cleavage

b T G

c hν hν

R1 Q R2 Q

FRET FRET
T cassette 1 G cassette 2

Cleavage
hν hν
Reporter Reporter
R1 fluorescence R2 fluorescence
unquenched unquenched

Figure 3 | Genotype analysis approaches: Invader assay. Schematic representation of single-base discrimination and
detection with the Invader DNA assay. a | Hybridization between the Invader oligo and the probe to complementary target DNA
forms an invasive structure from the single-base overlap generated. No invasive structure is formed when a mismatch between
the probe and target DNA prevents formation of the single-base overlap. b | For biplex detection, the 5´ flaps cleaved in a primary
reaction serve as Invader oligos in a secondary fluorescence resonance energy transfer (FRET) reaction, in which specific
cleavage of multiple FRET cassettes results in the generation of fluorescence signal (c). The primary and secondary Invader
reactions occur simultaneously.

TaqMan probes are designed as perfect matches to either
of two variants that differ by one or more nucleotides.
These dual-labelled probes are designed such that a
reporter fluorophore is quenched by an acceptor dye in
the native oligonucleotide probe configuration. During
each amplification cycle, the TaqMan probe hybridizes to
its complementary target region and, during the
primer extension step of each PCR cycle, is cleaved by
the 5′-nuclease action of thermostable DNA poly-
merases (for example, Thermus aquaticus), thereby
separating and releasing the quencher and fluorescent
reporter from one another. As a result, the reporter fluo-
rescent signal associated with each of two allele-specific
TaqMan probes can be measured quantitatively in real
time, and the fluorescent intensity increases with each
subsequent amplification cycle. The cycle at which
detectable signal crosses a preset threshold (designated
CT) is commonly used to report the presence of either of
two homozygous alleles, or the heterozygous state,
within the sample. The ability to genotype more than
one SNP within a single PCR reaction is limited less by
the ability to multiplex the amplification of several target
regions than by the number of different fluorescent
signals that can be detected within a single reaction. This
is governed by the overlap of emission spectra of fluo-
rescent dyes available for probe labelling, detection
hardware and cross-talk correction software. Various
instruments that are capable of detecting four to six dyes
simultaneously are now commercially available.
By way of example, the two common CYP2C9*2
and CYP2C9*3 alleles are caused by the C430T and
A1075C SNPs in exons 3 and 7, respectively; the inher-
itance of these alleles is associated with increased risk
of adverse reactions to the anticoagulant warfarin34.
Each leads to a significant reduction of enzyme activity,
and together these alleles account for the vast majority
of so-called CYP2C9 poor metabolizers, who are
deficient in this enzyme activity. The use of four fluo-
rescent dye colour combinations for TaqMan probes
uniquely complementary to the two CYP2C9 SNPs
allows simultaneous single-tube genotyping of these
two alleles (FIG. 1b). PCR reactions and TaqMan probes
can be readily designed such that similar amplification
and detection efficiencies are obtained, which facilitates
the establishment of CT cut-offs and the development
of detection algorithms that reliably ‘call’ each poly-
morphic site. A potential confounding factor in any
allele-specific detection probe approach, including

NATURE REVIEWS | DRUG DISCOVERY VOLUME 3 | SEPTEMBER 2004 | 7 5 3

REVIEWS
Box 1 | The CYP2D6 locus
Genotyping the CYP2D6 gene is challenging because the genomic locus contains two
or more highly homologous PSEUDOGENES, the gene is highly polymorphic and there is
significant variation in allele frequencies among people of different geographical
origins76–78. More than 80 polymorphisms within the coding and promoter regions of
this gene are known, including SNPs, In/Dels, repeats, and gene conversion events, as
well as complete gene deletion and duplication (see CYP2D6 allele nomenclature
website in further information). Particularly challenging are the CYP2D6*5 allele (see
figure, panel a), in which the entire gene is deleted (3–5% allelic frequency worldwide)
and gene duplications (see figure, panel b). At least six different CYP2D6 allelic
variants have been reported to exist as duplications, with from 2–12 tandem copies,
and gene duplication allele frequencies range from about 1 to about 30%, depending
on the population79,80. Direct detection of CYP2D6 gene deletion or duplication usually
requires a long PCR reaction, in each case generating a unique 3.5 kb product81,82.
Several common CYP2D6 alleles are comprised of combinations of 3 or more
polymorphisms, many of which are shared by as many as 20 different alleles. Select
common polymorphisms are shown in the figure, panel d. It is therefore important to
genotype relatively large numbers of polymorphisms across the entire CYP2D6 gene
and promoter sequence so that haplotype and genotype can be inferred. CYP2D6
genotypes can usually be unambiguously assigned on the basis of analysis of
approximately 20 polymorphic sites.
a probes that can be differentiated by their hybridization/
CYP2D8P CYP2D7P
3.5 kb amplicon
b wavelengths increases the potential number of sites
CYP2D7P CYP2D6 CYP2D6
3.5 kb amplicon
c CYP2D gene cluster
CYP2D8P CYP2D7P CYP2D6
d research use with this platform, including CYP2C9,
-1584G->C G31A C1023T G1659A G1846A C2850T G4042A
C100T C1039T G1661C 1863 9bp rpt A2953C G4180C
1707del
G1758A 2549Adel
G1758T 2613AGA del
TaqMan-based genotyping, is when additional poly-
morphisms exist within a few nucleotides of the SNP
being queried, and under the region spanned by the
probe. Although generally rare, such mutations can
interfere with TaqMan probe cleavage35. TaqMan
allele-specific genotyping is automatable, rapid, highly
reproducible and cost effective. Already long in use by
clinical reference laboratories in ‘home brew’ diagnos-
tic assays, the FDA has recently approved the COBAS
TaqMan instrument for automation of in vitro diag-
nostics using TaqMan technology (see Roche 510(k)
summary in further information).
Hybridization probes. Another robust homogenous
fluorescent genotyping approach makes use of post-PCR
PSEUDOGENE
DNA sequence similar to a
melting-curve profiles of allele-specific hybridization
homologue normal gene but that probes36. In this approach, two adjacent probes are
seems to have no function. designed for each polymorphic locus, one end-labelled
754 | SEPTEMBER 2004 | VOLUME 3
with donor dye, and the other end-labelled with an
acceptor dye, to take advantage of fluorescence reso-
nance energy transfer (FRET) principles (FIG. 2a). The
optimum hybridization temperature for these probes
ensures that the two probes bind adjacently during
the PCR primer annealing step. In this configuration
(FIG. 2b), a fluorescence signal can be generated during
and post-PCR. For the quantitation of markers, such
as during reverse-transcription PCR (RT-PCR), the
fluorescence signal can be measured at each anneal
cycle. By contrast, genotype discrimination is achieved
post-PCR by increasing the temperature such that the
two probes ‘melt’ off the target region with characteris-
tic denaturation profiles, which results in the loss of the
fluorescence signal. Mismatched probes melt at a lower
temperature than perfectly matched ones, which
enables the facile differentiation of two allelic variants.
Data are typically plotted as the first derivative of
the fluorescence versus temperature plots, with a
sharp optimum characteristic for the SNPs present.
This approach also allows the use of a single fluorescent
reporter dye with more than one pair of hybridization
denaturation temperature optima, thereby allowing
single-tube genotyping of two separate SNPs37. Using
multiple fluorophores with well-separated emission
that can be genotyped even further. At the time of
writing, the only FDA-approved genotyping assays,
which are designed to genotype the factor V Leiden
and the factor II (prothrombin) 20210A polymor-
phisms associated with venous thrombosis risk, make
use of the hybridization probe principle and FDA-
approved LightCycler instrumentation. Numerous
pharmacogenetic assays have been developed for
NAT1 and TPMT38–40. Similarly to TaqMan geno-
typing assays, hybridization probe PCR assays can
also give rise to atypical results when rare point muta-
tions are encountered within the region spanned by
these probes41,42.
Several new rapid-cycling thermocylers with homo-
geneous fluorescent detection capabilities, as well as
new ‘designer’ thermostable DNA polymerases with
increased enzymatic reaction rates, have decreased the
time required for PCR reactions and analyses. Using
these new tools, PCR reactions can often be completed
in 15–20 minutes. A portable, battery-powered thermo-
cycler instrument that can perform PCR has also been
developed for biological agent detection in field opera-
tions43. The commercial availability of such instruments
has led to speculation that point-of-care PCR-based
diagnostics are likely to be available soon. Although
these advances in PCR technology might provide the
basis for near-patient-care PCR-based testing at some
point in the future, the challenge of also providing
rapid, automated sample preparation of various samples
types, including blood, buccal cells and, in some cases,
tissue samples, remains the main barrier to the intro-
duction of point-of-care molecular diagnostic testing
in the near term.
www.nature.com/reviews/drugdisc
 FOCUS ON PHARMACOGENETICS

Invader assay. Another method for genotyping SNPs Invader assay is an isothermal reaction that amplifies a
makes use of the Invader oligos, overlapping cleavage target-specific signal, rather than a target. Although
probes and Cleavase, a structure-specific 5′-flap homogeneous Invader assays can in some instances be
endonuclease (FEN) enzyme44 (FIG. 3). Unlike PCR, the performed directly from genomic DNA, the method

Genomic DNA Genomic DNA

Polymerase chain reaction

Wild type G Mutant A

C T

• Denature
• Anneal allele-specific primers

G A

C T
Tag 1 Tag 2

Single-base chain extension

G A

C T

Fluorescent
label

Hybridize to bead

C T

Bead Bead
Anti-tag 1 Anti-tag 2

Flow cytometric analysis

Positive signal for anti-tag 1: homozygous wild type

Positive signal for anti-tag 2: homozygous mutant
Positive signals for anti-tag 1 and 2: heterozygous

Figure 4 | Bead-based multiplex genotyping using allele-specific primer extension. Allele-specific primers contain distinct
‘tag’ sequences that are complementary to ‘anti-tag’ oligonucleotides coupled to uniquely coloured beads. Tagged primers are
fluorescently labelled during extension, which leads to a signal associated specifically with a unique bead type. Flow cytometric
fluorescence signal averaging provides discrimination of alleles present.

NATURE REVIEWS | DRUG DISCOVERY VOLUME 3 | SEPTEMBER 2004 | 7 5 5

REVIEWS
DNA Hybridize mRNA
cDNA synthesis
Polymerase
chain reaction
cDNA
Amplicon(s) In vitro transcription
Scan
Labelled cRNA
Fragmentation
End labelling
Fragmentation
Figure 5 | Oligonucleotide microarray-based genetic variation detection or gene-
expression analysis. Either DNA or mRNA is amplified several thousand fold using polymerase
chain reaction (PCR), or an in vitro transcription (IVT) approach, respectively. Amplification targets
— either DNA in the case of PCR, or cRNA in the case of IVT — are typically fragmented before
hybridization to reduce secondary-structure formation and self-annealing. Targets can be labelled
during amplification or following fragmentation using either a fluorescent reporter or biotin; in the
latter case, a fluorescent dye-coupled streptavidin is used to stain array-hybridized targets before
a laser scan of the microarray surface. Fluorescence intensity images are then analysed, and
signals are associated with each individual probe feature. Sequence variation or relative gene
expression is determined using algorithms unique for each type of application.
generally requires a PCR step before analysis when
genotyping members of a highly homologous gene
family, or when pseudogenes exist, to avoid undesired
cross-hybridization. For polymorphism detection, a so-
called Invader oligonucleotide probe overlaps by one
base an allele-specific detection probe when hybridized
to the target region in tandem (FIG. 3). This configura-
tion, created only when a perfect match exists, creates a
structure that is a substrate for the Cleavase enzyme.
The non-hybridizing ‘5′-flap’ is released by cleavage and
hybridizes to a FRET cassette in a secondary reaction,
thereby creating another Cleavase substrate. Cleavage of
this secondary substrate separates the quencher from
the fluorophore, and generates a fluorescent signal that
can be read with standard fluorescent plate readers. To
address the limitation imposed by the requirement of
two independent reactions per SNP — one for each
allele-specific probe — a ‘biplex’ format assay has been
designed that uses two unique primary detection probes
and FRET cassettes, each of which is labelled with a dif-
ferent fluorescent dye, thereby enabling detection of
both allelic variants within a single reaction45.
Application to CYP2D6 genotyping
To illustrate some of the challenges faced in develop-
ing diagnostic genotyping assays using either low- or
high-complexity platform formats, it is useful to con-
sider the example of the CYP2D6 gene, which encodes
debrisoquine 4-hydroxylase (see BOX 1 for a descrip-
tion of the CYP2D6 locus). The CYP2D6 enzyme,
756 | SEPTEMBER 2004 | VOLUME 3
expressed primarily in the liver, metabolizes ~20–25%
of all drugs, including many therapeutics used in the
treatment of psychiatric and cardiovascular diseases.
Genotyping of CYP2D6 to include only the most com-
mon, clinically relevant alleles from all geographical
regions would require many individual reactions with
homogeneous amplification systems, because of the
large number of polymorphisms that must be detected.
Several research tests based on TaqMan technology have
been developed to detect the most common Caucasian
CYP2D6 defective alleles; however, these methods have
typically limited their focus to three or four SNPs.
A more comprehensive method for genotyping 11
polymorphisms within the CYP2D6 gene has been
developed using Invader technology46. This application
requires a PCR reaction to isolate the CYP2D6 gene to
prevent Invader oligo and probe binding to highly
homologous flanking CYP2D7P and CYP2D8P pseudo-
genes; this requirement precludes the direct use of
genomic DNA. The method has also been used to deter-
mine CYP2D6 copy number by comparison of a
CYP2D6-specific signal with that of a reference gene,
which indicates the presence of a CYP2D6 gene deletion
or duplication. The Invader assay does not, however,
allow the routine determination of which CYP2D6 allele
is duplicated. This knowledge is crucial for the correct
prediction of enzyme phenotype, because the six differ-
ent alleles of CYP2D6 known to exist as gene duplications
encode null, intermediate and normal activity proteins
(see CYP2D6 allele nomenclature in further informa-
tion). For CYP2D6 genotyping, each polymorphism
queried by the Invader biplex reaction requires the use
of an aliquot of PCR amplicon. As these reactions are
typically performed in 96- or 384-well plates to facili-
tate automation, great care must be exercised to avoid
PCR carry-over contamination during routine clinical
diagnostic use45.
Multiplex platforms for high marker complexity
The genotyping of pharmacogenetic loci such as
CYP2D6 (BOX 1) can best be carried out by assay formats
that can detect dozens of polymorphisms in a single
multiplex analysis. Various multiplex approaches have
been developed since the advent of PCR, including
allele-specific oligonucleotide (ASO) dot blots or linear
arrays20,47, bead-based ‘Tag arrays’48 and high-density
oligonucleotide microarrays of various types21,49,50. Of
these, bead- and microarray-based approaches are the
most easily automated and will therefore be the focus of
further discussion.
Bead-based multiplex genotyping. An example of the
application of bead-based genotyping assay formats is a
recently commercialized research-use assay genotyping
12 CYP2D6 polymorphisms (see link to TM Bioscience
Products page in further information). This assay uses
polystyrene microspheres to which oligonucleotide
‘anti-tag’ sequences are attached (FIG. 4). Each uniquely
tagged microsphere contains a spectrally distinct dye
combination such that the beads can be readily
detected and distinguished from one another using
www.nature.com/reviews/drugdisc
 FOCUS ON PHARMACOGENETICS

–2 –1 0 +1 +2 manufacture does allow the production of relatively

AA MMA MMA M* MMA MMA
PMA PMA PMA PMA PMA
PMB PMB PMB PMB PMB
MMB MMB M* MMB MMB
BB MMA MMA M* MMA MMA
PMA PMA PMA PMA PMA
PMB PMB PMB PMB PMB
MMB MMB M* MMB MMB
AB MMA MMA M* MMA MMA
PMA PMA PMA PMA PMA
PMB PMB PMB PMB PMB
MMB MMB M* MMB MMB
Figure 6 | High-density oligonucleotide microarray
probe-tiling approaches for genotyping. A general
strategy is shown in which a block of 20 probes using perfect
match (PM) and mismatch (MM) designs queries one strand
for a single-nucleotide polymorphism (SNP) underlying allele
A or B. Probe set columns to the left and right of the M*
mutant position also query neighbouring positions 5′ and 3′
of the variant position. Homozygous and heterozygous false-
colour fluorescence intensity examples are shown. Image
courtesy of Affymetrix, Inc.
laser counting in a Luminex xMAP flow instrument51.
Polymorphism detection is achieved using ‘tag’ comple-
ments that are covalently combined with an allele-
specific primer-extension detection format. Fluore-
scently labelled primer extension products are hybridized
via their tag sequences to a pool of unique beads, each of
which contains a different ‘anti-tag’ complement. Flow
detection of primer-extension-incorporated fluoro-
phore, which is associated with a specific coloured
microsphere, allows genotype determination for multi-
plexing up to 48 markers in a single tube with relatively
high sample throughput.
High-density microarrays for genotyping. High-density
oligonucleotide microarrays offer an alternative to the
bead-based format and have even greater multiplex
capability, being limited in principle only by the ability
to selectively amplify the genomic regions of interest in
one or more multiplex PCR reactions. For example,
with current manufacturing processes a ~2-cm glass
Affymetrix microarray can contain more than 1 million
unique oligonucleotide sequences, each spatially located
within an 11-µm-square position or ‘feature’ on the
array. Arrays of this type, coupled with clever amplifica-
tion schemes, are capable of genotyping tens and even
hundreds of thousands of SNPs across the human
genome. These tools are currently being used for large-
scale, genome-wide association studies to discover
genetic biomarkers of human disease52,53. Furthermore,
using whole-wafer arrays with tens of millions of
oligonucleotide probes tiled for entire chromosomal
regions, genome-wide SNP discovery of common
genetic variation is being carried out54. So far, no diag-
nostic genotyping applications exist that make use of
this degree of probe density, although very high
oligonucleotide-probe density is being used in several
gene-expression-based diagnostic applications that are
in development. Nevertheless, high-density-feature
smaller and lower-cost arrays, while maintaining a great
deal of oligonucleotide-probe redundancy to increase
polymorphism detection accuracy.
To genotype using high-density oligonucleotide
microarrays, the region(s) of interest is first amplified
by PCR, and then the target amplicons are fragmented by
DNase I, end-labelled with biotin and hybridized under
stringent conditions (FIG. 5). Hybridized amplicons are
stained using streptavidin–phycoerythrin conjugate,
and fluorescence associated with specific probe features
is detected using a laser-illuminated, confocal scanner.
Oligonucleotide-array-based assays often make use of
comparative fluorescence signals between sets of perfect-
match and mismatched oligonucleotides to detect
polymorphisms, while reducing the influence of cross-
hybridization (FIG. 6). Software and algorithm training
through the use of test samples of known genotype
identify the polymorphisms, alleles and genotype present
in the samples. This approach has been used to develop
the Roche AmpliChip CYP450 genotyping assay55. By
multiplexing long PCR reactions that amplify the
promoter and coding region of CYP2D6, exons 4 and 5
of CYP2C19, as well as a 3.5-kb CYP2D6 gene deletion
or CYP2D6 gene duplication-specific reactions, virtually
all known polymorphisms and alleles of CYP2D6, and
the two most frequent for CYP2C19, can be detected
simultaneously. The AmpliChip CYP450 has been
designed to detect more than 30 polymorphisms that
underlie the most common normal, reduced activity,
null and various duplicated alleles found in people of all
geographical origins (but does not detect most alleles
that so far been observed in only one family).
Among the advantages of a high-density microarray-
based multiplex platform is the ability to simultane-
ously detect a wide variety of types of genetic variation
using dozens or even hundreds of highly redundant
probes to ensure robustness. For example, the detection
of frameshift and repeat mutations by hybridization-
based assays using uniform conditions can be challeng-
ing. In this case, the use of multiple probe lengths and
designs in which the polymorphic site is varied
towards either the 3′ or 5′ end, as well as querying both
DNA strands, can dramatically improve routine detec-
tion through redundancy. A perceived drawback to
two-dimensional oligonucleotide microarrays is the
need to redesign their manufacture for each new varia-
tion that one wishes to detect. Although this could be
cumbersome and costly in a research setting, it pro-
vides little impediment for in vitro diagnostic assays,
because well-validated target genes are not expected to
change frequently.
Re-sequencing platforms. In some cases, variation
within a genetic determinant for drug response is so
large that it requires the complete re-sequencing of parts
of one or more genes. For example, more than 70 differ-
ent mutations in the genes encoding HIV reverse trans-
criptase and/or protease are associated with specific
antiviral drug resistance56. Similarly, numerous genes,
exemplified by the p53 tumour suppressor gene, are

NATURE REVIEWS | DRUG DISCOVERY VOLUME 3 | SEPTEMBER 2004 | 7 5 7

REVIEWS
Exon 7, codon 248
5′ T G G G C G G C AT G A A C C G G A G G C C C AT C 3′
G C C G TA C T T G G A C T C C G G G T
G C C G TA C T T G G C C T C C G G G T
G C C G TA C T T G G G C T C C G G G T
G C C G TA C T T G G T C T C C G G G T
G C C G TA C T T G G – C T C C G G G T
Single-base deletion Substitution position
CGG CA/GG
Base cell A/G:
Base cell G: mixture of mutant
wild type
and wild type
Figure 7 | Probe-tiling approach for re-sequencing p53.
Wild-type reference sequence is shown above one
complementary sense probe set. Each probe type, querying
all possible base substitutions, as well as a single-base
deletion, is contained in a probe cell. False-colour hybridization
intensity images are presented for a wild-type sample (left) and
mixed population tumour sample (right). Use of multiple
redundant probe sets to query both strands results in high
accuracy for sequence analysis. Adapted from REF. 83. Image
courtesy of Affymetrix, Inc.
known to acquire a wide variety of somatic mutations in
various cancers; such mutations are in many cases asso-
ciated with disease prognosis and/or drug response57,58.
Knowledge of the mutational status of p53 might be
either predictive of response, or necessary for the selec-
tion of therapy 59. For example, one class of drugs in
development that will require the presence of wild-type
p53 for efficacy are antagonists of the E3 ubiquitin ligase
MDM2 (REF. 60).
For both HIV drug-resistance genotyping and p53
mutation detection, re-sequencing by gel-based or
capillary electrophoresis, as well as high-density oligo-
nucleotide microarrays, have been successfully used61–64.
One way in which the two technology approaches differ is
that microarrays can re-sequence an entire gene, or even
much larger genomic regions, bi-directionally in a single
hybridization reaction (FIG. 7), whereas multiple elec-
trophoretic runs are required for bidirectional sequencing
of most genes65. In some instances, microarrays might
also be more sensitive for the detection of mutations
within mixed cell populations that frequently occur in
tumours, and could detect a mutant sequence that rep-
resents as little as 5% of the total mixed cell population.
A limitation of microarrays for re-sequencing, however, is
that they can only directly detect those mutations for
which specific oligonucleotide probe complements have
been made — a limitation not shared by conventional
gel-based or capillary electrophoretic sequencing
approaches. Two FDA-approved tests for HIV-resistance
758 | SEPTEMBER 2004 | VOLUME 3
genotyping that use dideoxy-sequence analysis — the
Abbott ViroSeq HIV-1 Genotyping System and the Bayer
TRUGENE HIV-1 Genotyping Kit — are currently avail-
able for specific drug combination selection in highly
active antiretroviral therapy (HAART).
A potential barrier limiting the widespread introduc-
tion of some of these multiplex platforms into clinical
diagnostic laboratories is their cost and high degree of
technical complexity. Therefore, the ability to use a single
instrument for multiple types of assays is particularly
appealing to clinical laboratories. Oligonucleotide
microarray platforms have the potential advantage of
being readily applicable to several pharmacogenomic
applications, including multiplex genotyping, re-
sequencing and differential gene expression. Although
gene-expression analysis in pharmacogenomics is cur-
rently being used primarily in drug research and devel-
opment, gene-expression profiling is beginning to reveal
useful predictive information for the likely drug
response and to guide the choice of therapy, especially
for chronic and potentially fatal diseases11,12.
Microarray-based analysis of differential gene expression.
Unlike DNA-sequence analysis and genotyping, the ana-
lyte(s) of interest in microarray-based gene-expression
analyses are mRNAs. mRNA is substantially more labile
than DNA, and requires greater care in handling to
avoid artefacts that result from RNase degradation. In
addition, mRNA is typically reverse transcribed to form
a cDNA before amplification by either PCR to generate
DNA copies, or, in the case of most microarray analyses,
in vitro transcription (IVT) linear-amplification pro-
cedures that produce cRNA copies (FIG. 5). These cRNAs
are typically labelled during the IVT reactions and are
often fragmented, especially when hybridized to
oligonucleotide arrays. Gene-expression arrays for
research have often used either spotted cDNAs or long
oligonucleotides as immobilized probes, as well as
oligonucleotide probe arrays manufactured by photo-
lithography techniques similar to those used in the
semiconductor industry; in this case, oligonucleotide
probes are synthesized directly on the microarray
surface50. Here, multiple spaced perfect-match–single-
base-mismatched probe pairs are used to query each
gene of interest (FIG. 8). A potential advantage of this
high-density oligonucleotide approach is the ability to
design probes that detect splice variants, as well as
specific chimeric transcripts that are generated when
particular translocations create fusion genes (for example,
BCR–ABL in chronic myelogenous leukaemia).
There are a wide variety of ways to perform data
analysis of the thousands of probe intensity data points,
and best practice guidelines for expression profiling in
clinical settings have recently been proposed66. A detailed
discussion of microarray data analysis methods is
beyond the scope of this review. Briefly, however, the
fluorescent intensity images must be converted to
numerical values that are often normalized and fil-
tered before further analysis. Various unsupervised
analysis methods (for example, hierarchical clustering
and self-organizing maps) are available for identifying
www.nature.com/reviews/drugdisc
 FOCUS ON PHARMACOGENETICS
5′ mRNA reference sequence 3′
Spaced DNA probe pairs
Reference sequence
... TGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCC
AATGGGTCAGAAGGACTCCTATGTGGGTG Perfect match oligo
AATGGGTCAGAACGACTCCTATGTGGGTG Mismatch oligo
Fluorescence intensity image Perfect match probe cells
Mismatch probe cells
Figure 8 | Affymetrix oligonucleotide microarray probe strategy for differential gene-
expression analysis. To mitigate bias effects that can arise from partially degraded mRNA, up
to 20 probes are selected, most of which are biased towards the 3´ end of the gene transcript.
Each perfect-match (PM) oligonucleotide probe is coupled to a single-base-mismatched (MM)
probe. Subtracting the average MM probe from average PM probe signal significantly reduces the
contribution of background and cross-hybridization, while increasing the quantitative accuracy
and reproducibility of the measurements. Adapted from REF. 50. Image courtesy of Affymetrix, Inc.
relationships by grouping genes that have similar expres-
sion patterns67. Similarly, several supervised analysis
methods (for example, support vector machines) have
been developed, in which a phenotype such as drug
response is used to direct the selection of genes that best
distinguishes a responder class from a non-responder
class of samples67.
Future directions: focus on oncology
With the fruits of nearly three decades of oncology
research providing new targeted therapies for specific
cancers, it will be increasingly important to ascertain the
presence of susceptible forms of these drug targets to
guide the selection of therapy. A recent example of this
need is provided by the drug trastuzumab (Herceptin;
Genentech/Roche), a monoclonal antibody designed to
target amplified and overexpressed ERBB2 (also known
as HER2) tyrosine kinase receptor found in ~25–30% of
all breast cancers. Indeed, FDA approval of trastuzumab
was predicated on the availability of a test to detect
ERBB2 overexpression. Both an immunohistochemistry
assay for the expressed protein (HercepTest; Dako) and
a nucleic-acid-based fluorescence in situ hybridization
(FISH) test (PathVysion; Abbott) have been approved as
in vitro diagnostics to guide trastuzumab treatment
decisions. Although these two tests are designed to work
with microscopic sections of formalin-fixed, paraffin-
embedded breast-cancer tissue specimens, determination
of ERBB2 status could, in principle, also be designed
using real-time PCR-based quantitation of either
ERBB2 DNA or RNA compared with a reference
gene, using extracted nucleic acids from fresh frozen
or formalin-fixed, paraffin-embedded tumour tissue.
Some of the new therapeutic agents designed to target
specific molecular defects within cancer cells show
dramatic effects in only a small percentage of patients
treated. One such example is the clinical response of
lung-cancer patients to the epidermal growth factor
receptor (EGFR) tyrosine kinase inhibitor gefitinib
NATURE REVIEWS | DRUG DISCOVERY
(Iressa; AstraZeneca), which has been shown to be asso-
ciated with mutations around the tyrosine kinase domain
targeted by the drug68,69. So far, relatively few mutations
within the ATP-binding pocket of the EGFR tyrosine
kinase domain have been identified and associated with
gefitinib response. If this number does not grow substan-
tially after further investigation, it is likely that a geno-
typing, rather than re-sequencing, approach will
ultimately be sufficient to identify most somatic muta-
tions in EGFR that affect gefitinib response.Although this
finding requires further investigation and prospective
validation, it might warrant the development of a multi-
plex EGFR mutation detection test, perhaps using a
multiplexed, homogeneous PCR detection platform, to
screen and identify patients most likely to respond.
Increasingly, analysis of differential gene expression
is being developed to provide molecular subtype infor-
mation for disease prognosis as well as treatment choice.
For example, microarray-based gene-expression analysis
of common acute adult and paediatric leukaemias can
identify molecular subtypes associated with particular
chromosomal translocations or deletions, many of
which require different treatment regimens70,71.
Furthermore, several pharmaceutical companies are
routinely performing gene-expression analysis of
tumour tissue during drug discovery and development
in the hope of identifying profiles that are predictive of
drug response.
The use of microarray technology to examine global
transcriptional changes that are induced by a particular
drug, or which correlate with response to a drug, offers an
alternative method of candidate-gene analysis and can
identify pathways, as well as individual genes, whose
differential expression underlies a drug response. Using
this approach with either tumour cell model systems or
tumour tissue, mediators and mechanisms of drug
response have been identified. For example, analysis of
5-fluorouracil-induced gene expression in breast-cancer
cell lines has identified genes associated with drug
resistance and response72. Similarly, gene-expression
patterns resulting from oligonucleotide microarray
analysis of mRNA derived from needle biopsies are
predictive of the therapeutic response to docetaxel
(Taxotere; Aventis) in breast-cancer patients73. Moreover,
gene-expression analysis of leukaemic cells from B-lineage
acute lymphoblastic leukaemia paediatric patients has
identified sets of differentially expressed genes that are
associated with sensitivity or resistance to prednisolone,
vincristine, asparaginase or daunorubicin — information
that might be used in the future to guide therapy choice12.
Genome-wide analysis using oligonucleotide micro-
arrays can be coupled with bioinformatic analyses to
cull a minimal set of differentially expressed genes with
high predictive value for diagnostic test development,
which in some cases can use a low-complexity assay
format. For example, gene-expression signatures from
breast tumours positive for the oestrogen receptor could
be reduced to a two-gene expression ratio that is predic-
tive of tamoxifen response in breast-cancer patients, a
finding that could lead to the development of a simple
RT-PCR-based test74.
VOLUME 3 | SEPTEMBER 2004 | 7 5 9
REVIEWS

Conclusions the Pharmacogenetics Research Network, funded by the

Progress made in recent years suggests that pharma-
cogenomic biomarkers have the potential to provide
physicians with clinically useful, actionable informa-
tion that can improve patient care through increased
individualization of treatment, particularly in the
management of life-threatening disease. New examples
of genetic variation or differential gene expression
that are associated with disease state or therapy
response are being published at an ever-increasing
rate; this has been accelerated as a consequence of the
recently completed Human Genome project and by
new technologies.
Although these findings require replication and care-
ful validation to determine their clinical significance,
many are likely to lead to improvements in patient
stratification for therapy choice. The technologies for
assessing genetic and genomic variation are increasingly
making their way into diagnostic laboratories, and the
regulatory agencies that approve in vitro diagnostic
assays, as evidenced by the 2003 FDA Draft Guidance
for Industry Pharmacogenomic Data Submissions75 (see
link to document in further information). The rapid
translation of pharmacogenomics from the research
setting to the clinic will require efforts well beyond those
of diagnostic companies, and afford an opportunity for
partnerships between public programmes — such as
National Institutes of Health — academia, the regulated
industry and regulatory agencies, such as the FDA (see
the companion articles by Lesko and Woodcock, and
Weinshilboum and Wang, in this issue for further dis-
cussion of issues associated with the clinical translation
of pharmacogenomics).
Pharmacogenomics has been hailed as driving an
impending revolution in medicine; indeed, the tech-
nology platforms and assay formats needed to provide
patients and their physicians with better therapeutics
using pharmacogenomic information have matured to
the stage at which they can soon be utilized routinely.
However, several key factors will influence how and
when the widespread introduction of new diagnostic
tests using these principles and technologies will occur.
Regulatory agencies will need to apply new approaches
towards the review and approval of tests that use new
technologies, as well as drugs that work in concert with
companion diagnostics, often using complex multi-
analyte test formats. Physicians and payers will demand
clear guidance for, and definitive evidence of the benefit
provided by, the use of pharmacogenomic information in
a clinical setting. The need to focus attention on the edu-
cation of all healthcare professionals regarding how this
genomic information will be applied to improve medical
care of patients will therefore be of crucial importance.

1. Weinshilboum, R. Inheritance and drug response. N. Engl. J.
Med. 348, 529–537 (2003).
2. Evans, W. E. & Relling, M. V. Moving towards individualized
medicine with pharmacogenomics. Nature 429, 464–468
(2004).
3. Ingelman–Sundberg, M., Oscarson, M. & McLellan, R. A.
Polymorphic human cytochrome P450 enzymes: an
opportunity for individualized drug treatment. Trends
Pharmacol. Sci. 20, 342–349 (1999).
4. Goldstein, J. A. Clinical relevance of genetic polymorphisms
in the human CYP2C subfamily. Br. J. Clin. Pharmacol. 52,
349–355 (2001).
5. Desta, Z., Zhao, X., Shin, J. G. & Flockhart, D. A. Clinical
significance of the cytochrome P450 2C19 genetic
polymorphism. Clin. Pharmacokinet. 41, 913–958 (2002).
6. Levy, G. N. & Weber W.W. in Interindividual Variability in
Human Drug Metabolism (ed. Pacifici, G. M. & Pelkonen, O.)
333–357 (Taylor and Francis, London and New York, 2001).
7. Weinshilboum, R. M., Otterness, D. M. & Szumlanski, C. L.
Methylation pharmacogenetics: catechol O-
methyltransferase, thiopurine methyltransferase, and
histamine N-methyltransferase. Annu. Rev. Pharmacol.
Toxicol. 39, 19–52 (1999).
8. Townsend, D. & Tew, K. Cancer drugs, genetic variation and
the glutathione-S–transferase gene family. Am. J.
Pharmacogenomics 3, 157–172 (2003).
9. Cascorbi, I. Pharmacogenetics of cytochrome p4502D6:
genetic background and clinical implication. Eur. J. Clin.
Invest. 33 (Suppl. 2), 17–22 (2003).
10. Dracopoli, N. C. Pharmacogenomic applications in clinical
drug development. Cancer Chemother. Pharmacol. 52
(Suppl 1), S57–S60 (2003).
11. Ross, J. S. et. al. Pharmacogenomics. Adv. Anat. Pathol.
11, 211–220 (2004).
12. Holleman, A. et. al. Gene-expression patterns in drug
resistant acute lymphoblastic leukemia cells and response
to treatment. N. Engl. J. Med. 351, 533–542 (2004).
13. Newton, C. R. et. al. Analysis of any point mutation in DNA.
The amplification refractory mutation system (ARMS).
Nucleic Acids Res. 17, 2503–2516 (1989).
14. Holland, P. M., Abramson, R. D., Watson, R. & Gelfand, D. H.
Detection of specific polymerase chain reaction product by
utilizing the 5’—-–3’ exonuclease activity of Thermus
aquaticus DNA polymerase. Proc. Natl Acad. Sci. USA 88,
7276–7280 (1991).
This paper describes the principles of the Taqman
homogeneous PCR detection format.
15. Lyamichev, V. et. al. Polymorphism identification and
quantitative detection of genomic DNA by invasive cleavage
of oligonucleotide probes. Nature Biotechnol. 17, 292–296
(1999).
16. Syvanen, A. C., Aalto-Setala, K., Harju, L., Kontula, K. &
Soderlund, H. A primer-guided nucleotide incorporation
assay in the genotyping of apolipoprotein E. Genomics 8,
684–692 (1990).
This study reports development of a primer extension
extension for genotyping.
17. Barany, F. Genetic disease detection and DNA amplification
using cloned thermostable ligase. Proc. Natl Acad. Sci. USA
1, 189–193 (1991).
18. Fan, J. B. et. al. Parallel genotyping of human SNPs using
generic high–density oligonucleotide tag arrays. Genome
Res. 10, 853–860 (2000).
19. Haff, L. A. & Smirnov, I. P. Single-nucleotide polymorphism
identification assays using a thermostable DNA polymerase
and delayed extraction MALDI–TOF mass spectrometry.
Genome Res. 7, 378–388 (1997).
20. Bugawan, T. L., Apple, R. & Erlich, H. A. A method for typing
polymorphism at the HLA-A locus using PCR amplification
and immobilized oligonucleotide probes. Tissue Antigens
44, 137–147 (1994).
21. Cronin, M. T. et al. Cystic fibrosis mutation detection by
hybridization to light-generated DNA probe arrays. Hum
Mutat. 7, 244–255 (1996).
This report is one of the first to describe the use
of high-density oligonucleotide microarrays
for multiplex genotyping large numbers of
polymorphisms.
22. Armstrong, B., Stewart, M. & Mazumder, A. Suspension
arrays for high throughput, multiplexed single nucleotide
polymorphism genotyping. Cytometry 40, 102–108
(2000).
This paper describes development of a bead-based
multiplex genotyping assay.
23. Murphy, G. M. Jr et al. CYP2D6 genotyping with
oligonucleotide microarrays and nortriptyline concentrations
in geriatric depression. Neuropsychopharmacology 25,
737–743 (2001).
24. Chou, W. H. et. al. Comparison of two CYP2D6 genotyping
methods and assessment of genotype–phenotype
relationships. Clin Chem. 49, 542–551 (2003).
25. Schena, M. et al. Parallel human genome analysis:
microarray-based expression monitoring of 1000 genes.
Proc. Natl Acad. Sci. USA 93, 10614–10619 (1996).
This is one of the first uses of microarrays to assess
differential gene expression of hundreds of human
genes in parallel.
26. DeRisi, J. et. al. Use of a cDNA microarray to analyse gene
expression patterns in human cancer. Nature Genet. 14,
457–460 (1996).
This was the first report of the use of microarrays to
examine differential gene expression in cancer.
27. Scherf, U. et. al. A gene expression database for the
molecular pharmacology of cancer. Nature Genet. 24,
236–244 (2000).
28. Liotta, L. & Petricoin, E. Molecular profiling of human cancer.
Nature Rev. Genet. 1, 48–56 (2000).
29. Goldstein, J. A. & Blaisdell, J. Genetic tests which identify
the principal defects in CYP2C19 responsible for the
polymorphism in mephenytoin metabolism. Methods
Enzymol. 272, 210–218 (1996).
30. Claassen, J. D., Pascoe, N., Schatzberg, A. F. &
Murphy, G. M. Jr. Rapid detection of the C-1496G
polymorphism in the CYP2D6*2 allele. Clin. Chem. 47,
2153–2155 (2001).
31. Higuchi, R., Dollinger, G., Walsh, P. S. & Griffith, R.
Simultaneous amplification and detection of specific DNA
sequences. Biotechnology NY 10, 413–417 (1992).
This paper was the first to describe a method for
homogeneous fluorescence-based detection of PCR
reaction products.
32. Schneeberger, C., Speiser, P., Kury, F. & Zeillinger, R.
Quantitative detection of reverse transcriptase–PCR
products by means of a novel and sensitive DNA stain.
PCR Methods Appl. 4, 234–238 (1995).
33. Livak, K. J. Allelic discrimination using fluorogenic probes
and the 5’ nuclease assay. Genet Anal. 14, 143–149 (1999).
34. Aithal, G. P., Day, C. P., Kesteven, P. J. & Daly, A. K.
Association of polymorphisms in the cytochrome P450
CYP2C9 with warfarin dose requirement and risk of
bleeding complications. Lancet 353, 717–719 (1999).
35. Teupser, D., Rupprecht, W., Lohse, P. & Thiery, J.
Fluorescence-based detection of the CETP TaqIB
polymorphism: false positives with the TaqMan-based
exonuclease assay attributable to a previously unknown
gene variant. Clin Chem. 47, 852–857 (2001).
36. Lay, M. J. & Wittwer, C. T. Real-time fluorescence
genotyping of factor V Leiden during rapid-cycle PCR.
Clin Chem. 43, 2262–2267 (1997).
This paper describes the use of hybridization probes
to genotype a common genetic variant.

760 | SEPTEMBER 2004 | VOLUME 3 www.nature.com/reviews/drugdisc


37. Bernard, P. S., Ajioka, R. S., Kushner, J. P. & Wittwer, C. T.
Homogeneous multiplex genotyping of hemochromatosis
mutations with fluorescent hybridization probes. Am. J.
Pathol. 153, 1055–1061 (1998).
38. Burian, M., Grosch, S., Tegeder, I. & Geisslinger, G.
Validation of a new fluorogenic real-time PCR assay for
detection of CYP2C9 allelic variants and CYP2C9 allelic
distribution in a German population. Br. J. Clin. Pharmacol.
54, 518–521 (2002).
39. Wikman, H. et al. Relevance of N-acetyltransferase 1 and 2
(NAT1, NAT2) genetic polymorphisms in non-small cell lung
cancer susceptibility. Pharmacogenetics 11, 157–168 (2001).
40. Wusk, B. et al. Thiopurine S-methyltransferase
polymorphisms: efficient screening method for patients
considering taking thiopurine drugs. Eur. J. Clin. Pharmacol.
60, 5–10 (2004).
41. Warshawsky, I. et al. Detection of a novel point mutation of
the prothrombin gene at position 20209. Diagn. Mol. Pathol.
11, 152–156 (2002).
42. Tag, C. G., Gressner, A. M. & Weiskirchen, R. An unusual
melting curve profile in LightCycler multiplex genotyping of
the hemochromatosis H63D/C282Y gene mutations.
Clin. Biochem. 34, 511–515 (2001).
43. Emanuel, P. A. et al. Detection of Francisella tularensis within
infected mouse tissues by using a hand-held PCR
thermocycler. J. Clin. Microbiol. 41, 689–693 (2003).
44. Kwiatkowski, R. W., Lyamichev, V., de Arruda, M. & Neri, B.
Clinical, genetic, and pharmacogenetic applications of the
Invader assay. Mol. Diagn. 4, 353–364 (1999).
45. de Arruda, M, et al. Invader technology for DNA and RNA
analysis: principles and applications. Expert Rev. Mol. Diagn.
2, 487–496 (2002).
46. Nevilie, M, et al. Characterization of cytochrome P450 2D6
alleles using the Invader system. Biotechniques. 34 (Suppl.),
40–43 (2002).
47. Saiki, R. K., Bugawan, T. L., Horn, G. T., Mullis, K. B. &
Erlich, H. A. Analysis of enzymatically amplified β-globin and
HLA-DQα DNA with allele-specific oligonucleotide probes.
Nature 324, 163–166 (1986).
This was the first use of PCR together with allele
specific probes to genotype a human gene variant.
48. Ye, F. et al. Fluorescent microsphere-based readout
technology for multiplexed human single nucleotide
polymorphism analysis and bacterial identification. Hum.
Mutat. 17, 305–316 (2001).
49. Gilles, P. N., Wu, D. J., Foster, C. B., Dillon, P. J. &
Chanock, S. J. Single nucleotide polymorphic discrimination
by an electronic dot blot assay on semiconductor
microchips. Nature Biotechnol. 17, 365–370 (1999).
50. Lipshutz, R. J., Fodor, S. P., Gingeras, T. R. & Lockhart, D. J.
High density synthetic oligonucleotide arrays. Nature Genet.
21 (Suppl. 1), 20–24 (1999).
51. Taylor, J. D. et al. Flow cytometric platform for high-
throughput single nucleotide polymorphism analysis.
Biotechniques 30, 661–666, 668–669 (2001).
52. Matsuzaki, H. et al. Parallel genotyping of over 10,000 SNPs
using a one-primer assay on a high-density oligonucleotide
array. Genome Res. 14, 414–425 (2004).
53. Kennedy, G. C. et al. Large-scale genotyping of complex
DNA. Nature Biotechnol. 21, 1233–1237 (2003).
54. Patil, N. et al. Blocks of limited haplotype diversity revealed
by high-resolution scanning of human chromosome 21.
Science 294, 1719–1723 (2001).
This paper describes the use of high-density
oligonucleotide micoarrays to genotype across an
entire chromosome.
NATURE REVIEWS | DRUG DISCOVERY
FOCUS ON PHARMACOGENETICS
55. Koch, W. H. in Clinical Pharmacogenomics (eds Wong, S. H.,
Linder, M. W. & Valdes, R.) (in the press).
56. Sebastian, J. & Faruki, H. Update on HIV resistance and
resistance testing. Med. Res. Rev. 24, 115–125 (2004).
57. Soussi, T. & Beroud, C. Assessing TP53 status in human
tumours to evaluate clinical outcome. Nature Rev. Cancer 1,
233–240 (2001).
58. Woods, Y. L. & Lane, D. P. Exploiting the p53 pathway for
cancer diagnosis and therapy. Hematol. J. 4, 233–247 (2003).
59. Petersen, S., Thames, H. D., Nieder, C., Petersen, C. &
Baumann, M. The results of colorectal cancer treatment by
p53 status: treatment-specific overview. Dis. Colon Rectum
44, 322–333 (2001).
60. Vassilev, L. T. et al. In vivo activation of the p53 pathway by
small-molecule antagonists of MDM2. Science 303,
844–848 (2004).
61. Yager, T. D. et al. High performance DNA sequencing, and
the detection of mutations and polymorphisms, on the
Clipper sequencer. Electrophoresis 20, 1280–1300 (1999).
62. Bharaj, B. S., Angelopoulou, K. & Diamandis, E. P. Rapid
sequencing of the p53 gene with a new automated DNA
sequencer. Clin. Chem. 44, 1397–1403 (1998).
63. Kozal, M. J. et al. Extensive polymorphisms observed in
HIV-1 clade B protease gene using high-density
oligonucleotide arrays. Nature Med. 2, 753–759 (1996).
64. Takahashi, Y. et al. Clinical application of oligonucleotide
probe array for full-length gene sequencing of TP53 in colon
cancer. Oncology 64, 54–60 (2003).
65. Wen, W. H. et al. Comparison of TP53 mutations identified
by oligonucleotide microarray and conventional DNA
sequence analysis. Cancer Res. 60, 2716–2722 (2000).
66. The Tumor Analysis Best Practices Working Group.
Expression Profiling — best practices for data generation
and interpretation in clinical trials. Nature Rev. Genet. 5,
229–237 (2004).
67. Parmigiani, G., Garrett, E., Irizarry, R. & Zeger, S. in The
Analysis of Gene Expression Data, (eds Parmigiani, G., Garrett,
E., Irizarry, R. & Zeger, S.) 1–45 (Springer, New York, 2003).
68. Lynch, T. J. et al. Activating mutations in the epidermal
growth factor receptor underlying responsiveness of non-
small-cell lung cancer to gefitinib. N. Engl J. Med. 350,
2129–2139 (2004).
69. Paez, J. G. et al. EGFR mutations in lung cancer: correlation
with clinical response to gefitinib therapy. Science 304,
1497–1500 (2004).
70. Ross, M. E. et al. Classification of pediatric acute
lymphoblastic leukemia by gene expression profiling. Blood
102, 2951–2959 (2003).
71. Haferlach, T. et al. Gene expression profiling as a tool for
the diagnosis of acute leukemias. Semin. Hematol. 40,
281–295 (2003).
72. Boyer, J., Maxwell, P. J., Longley, D. B. & Johnston, P. G.
5-Fluorouracil: identification of novel downstream mediators
of tumor response. Anticancer Res. 24, 417–423 (2004).
73. Chang, J. C. et al. Gene expression profiling for the
prediction of therapeutic response to docetaxel in patients
with breast cancer. Lancet 362, 362–369 (2003).
74. Ma, X. J. et al. A two-gene expression ratio predicts clinical
outcome in breast cancer patients treated with tamoxifen.
Cancer Cell 5, 607–616 (2004).
75. US Department of Health and Human Services Food and
Drug Administration, Center for Drug Evaluation and
Research, Center for Biologics Evaluation and Research &
Center for Devices and Radiological Health. ‘Draft’
Guidance for Industry: Pharmacogenomics Data
Submissions. (November, 2003).
76. Bradford, L. D. CYP2D6 allele frequency in European
Caucasians, Asians, Africans and their descendants.
Pharmacogenomics 3, 229–243 (2002).
77. Kimura, S., Umeno, M., Skoda, R. C., Meyer, U. A. &
Gonzalez, F. J. The human debrisoquine 4-hydroxylase
(CYP2D) locus: sequence and identification of the
polymorphic CYP2D6 gene, a related gene, and a
pseudogene. Am. J. Hum. Genet. 45, 889–904 (1989).
78. Heim, M. H. & Meyer, U. A. Evolution of a highly polymorphic
human cytochrome P450 gene cluster: CYP2D6. Genomics
14, 49–58 (1992).
79. Ingelman–Sundberg, M. Pharmacogenetics of cytochrome
P450 and its applications in drug therapy: the past,
present and future. Trends Pharmacol. Sci. 25, 193–200
(2004)
80. Sachse, C., Brockmoller, J., Bauer, S. & Roots, I.
Cytochrome P450 2D6 variants in a Caucasian population:
allele frequencies and phenotypic consequences. Am. J.
Hum. Genet. 60, 284–295 (1997).
81. Steen, V. M. et al. Detection of the poor metabolizer-
associated CYP2D6(D) gene deletion allele by long-PCR
technology. Pharmacogenetics 5, 215–223 (1995).
82. Lovlie, R., Daly, A. K., Molven, A., Idle, J. R. & Steen, V. M.
Ultrarapid metabolizers of debrisoquine:
characterization and PCR-based detection of alleles with
duplication of the CYP2D6 gene. FEBS Lett. 392, 30–34
(1996).
83. Ahrendt, S. A. et al. Rapid p53 sequence analysis in
primary lung cancer using an oligonucleotide probe
array. Proc. Natl Acad. Sci. USA 96, 7382–7387
(1999).
Acknowledgements
The author wishes to thank J. Flanagan for assistance in preparing
this manuscript, and G. Beer for providing CYP2C9 four-colour
genotyping results.
Competing financial interest
The author declares competing financial interests: see Web version
for details.
Online links
DATABASES
The following terms in this article are linked online to:
Entrez Gene: http://www.ncbi.nlm.nih.gov/LocusLink/
ABL | BCR | CFTR | CYP2C9 | CYP2C19 | CYP2D6 | EGFR |
ERBB2 | factor II | factor V | MDM2 | NAT2 | p53 | TPMT |
National Cancer Institute Cancer Topics:
http://www.cancer.gov/cancer_information/
Chronic myelogenous leukaemia
FURTHER INFORMATION
CYP2D6 allele nomenclature:
http://www.imm.ki.se/CYPalleles/cyp2d6.htm
Guidance for Industry: Pharmacogenomics Data Submissions:
www.fda.gov/cder/guidance/5900dft.pdf
Pharmacogenetics Research Network:
http://www.nigms.nih.gov/pharmacogenetics/
Roche 510(k) summary:
http://www.fda.gov/cdrh/pdf/k012966.pdf
TM Bioscience Product page:
http://www.tmbioscience.com/p450-2d6.php
Access to this interactive links box is free online.
VOLUME 3 | SEPTEMBER 2004 | 7 6 1