2022

Vaccinology
LAB MANUAL
SAIF UL EMAN
Contents
Lab Protocols...............................................................................................................................................2
Planning to work:.....................................................................................................................................3
Safety Procedures:...................................................................................................................................3
Emergency Procedures:...........................................................................................................................4
Good housekeeping and personal hygiene:.............................................................................................4
pH Meter.....................................................................................................................................................4
What is a pH meter?................................................................................................................................5
Working Principle of a pH meter?............................................................................................................5
pH Meter Operation Procedure:..............................................................................................................5
pH Meter Calibration:..............................................................................................................................6
PCR (Polymerase Chain Reaction).......................................................................................8
What is PCR?...........................................................................................................................................8
Working Principle of PCR?.......................................................................................................................8
Components of a PCR?............................................................................................................................9
 DNA Template.............................................................................................................................9
 Taq Polymerase...........................................................................................................................9
 Oligonucleotide Primers.............................................................................................................9
 Deoxyribonucleotide triphosphate (dNTPs)...............................................................................9
 Magnesium and potassium.........................................................................................................9
Steps in PCR?.........................................................................................................................................10
Denaturation.....................................................................................................................................10
Annealing..........................................................................................................................................10
Elongation.........................................................................................................................................10
Recipe for Master mix: (for a group of 8 People).............................................................................11
Procedure:.........................................................................................................................................12
Primer Designing.......................................................................................................................................13
Steps:.....................................................................................................................................................13
RNA Extraction..........................................................................................................................................16
 Materials:..............................................................................................................................................16
Chemicals or reagents:..........................................................................................................................16
Procedure:.............................................................................................................................................16
Quantification using nanodrop:.............................................................................................................18
Reading from Nanodrop:.......................................................................................................................19
cDNA synthesis:.........................................................................................................................................20
Reagents:...............................................................................................................................................20
Procedure:.............................................................................................................................................20
Lab Protocols
Planning to work:
 Before performing any experiment keep in view the
hazards related to the experiment, the possible thing that
may go wrong and how to deal with them.
 Take all the precautionary measures and equipment that
can help minimize the risk.
 Always keep in mind about the effects and characteristics
of different chemicals in lab e.g., toxicity, flammability,
corrosivity, reactivity etc.
 All protective equipment e.g., safety googles, lab coat,
mask and gloves must be worn.
 Remember the emergency contact numbers in case of any
emergency.
 Keep an eye on equipment if they are cracked or damaged.
 Avoid using damaged or repaired electrical equipment.
Also check that the wiring is proper i.e., insulation is not
damaged.

Safety Procedures:
 Avoid too much lose dressing.
 When pouring hazardous chemicals, use safety googles as
well as face shield.
 Chemically resistant lab coats are recommended.
  Avoid wearing T-Shirts and shorts. If you have long hair,
then they must be tied in a proper way so it may not get in
contact with chemicals or flame of burner.
 Avoid too much makeup or creams.
 Volatile chemicals must be processed in fume hoods.
 Always perform experiments under the supervision of a
lab instructor.
 Avoid moth sucking to fill pipette.
 Glass, needles, other sharp objects, and other chemicals
must be disposed of in their desired bins.

Emergency Procedures:
 Know nearest emergency eyewash or shower.
 Know basic first aid in case of different injuries.
 Know exit doors of the lab.

Good housekeeping and personal hygiene:

 Avoid direct contact with any chemical.
 Never smell or taste laboratory chemicals
 Wash hands thoroughly with soap after experiment.
 Do not eat or drink in laboratory.
 Wipe benches and shelves properly with cleaners.
 Do not pick up sharp equipment by hand.
 Leave desired chemicals at their right place. e.g., irritants
and acids should not be kept on eye level.
 Turn off burner after experiment.
 Remove lab equipment before leaving the lab.
pH Meter
What is a pH meter?
It is an instrument that measures exact potential of “Hydrogen
Ions” in a suspension in order to determine its acidity or
alkalinity expressed in the form of pH.

Working Principle of a pH meter?

Working principle of pH meter is based on potentiometric
analysis of Hydrogen ions. The relation between electric voltage
and concentration of these ions is used to determine pH of
suspension.
pH Meter Operation Procedure:
1. I pressed the ON switch on the pH meter to turn it on.
When it was turned on, the MEAS annunciator and ATC
indicator appeared on the LCD.
2. The electrodes were then washed with distilled water.
3. I maintained the sample's temperature at 25 degrees
Celsius.
4. After that, I immerse the electrodes in the sample and
stirred it to create a homogeneous sample. I made sure
the electrode's tip was completely immersed in the
sample.
5. I waited until the reading becomes stable.
 6. The READY indicator turned on once the reading was
stabilized. After that, I pressed the HOLD key and then the
ENTER key to save the reading.
7. I took note of the pH and temperature values.
8. Lastly, I rinsed the electrodes with distilled water before
storing them inside the buffer.

pH Meter Calibration:
1. First, I ensured that the proper monitoring mode was
selected on the pH meter.
2. Then, I washed the electrode with distilled water without
wiping it, as this would produce an electrostatic charge on
the electrodes.
3. Before use, all standards and samples were brought to 25
degrees Celsius.
4. I dipped the electrodes in the standard buffer or
calibration solution (pH 7/pH 10) and ascertained that the
electrode endpoints were completely immersed in the
buffer. I stirred the electrodes in the buffer to make a
homogeneous sample.
5. By pressing the CAL/MEAS key, I entered pH calibration
mode. The CAL sign was present.
6. The primary display showed the measured measurement,
while the secondary screen displayed the pH standard
buffer solution reading.
7. I waited until the pH levels were stabilized.
8. After the reading had been stabilized, I confirmed it by
hitting the HOLD/ENTER key.
9. The pH meter was now calibrated to the current buffer
solution.
10. Finally, I rinsed the electrodes with distilled water
before immersing them in the buffer.
PCR
(Polymerase Chain Reaction)
What is PCR?
It is a technique used in molecular biology to create multiple
copies of DNA or its segments. It can produce from millions to
billions of copies of DNA based on the requirement.

Working Principle of PCR?

The PCR technique relies on the replication of DNA by enzymes.
PCR uses primer-mediated enzymes to amplify a small section
of DNA. DNA Polymerase creates new DNA strands that are
complementary to the template DNA. Only the pre-existing 3'-
OH group can be added by the DNA polymerase. So, a primer is
necessary. As a result, additional nucleotides are now added to
the DNA polymerase's 3' prime end.

Components of a PCR?
PCR components include the following:
 DNA Template- The DNA from the sample which is of
our interest. It acts as a guide for newly forming DNA
copies
 Taq Polymerase- is used to polymerize DNA. It is
thermostable and does not denature when heated to
extremely elevated temperatures.
 Oligonucleotide Primers- are single-stranded DNA
segments that are complementary to the 3' terminals of
sense and anti-sense strands.
 Deoxyribonucleotide triphosphate (dNTPs)- are the
building blocks for DNA synthesis and provide energy for
polymerization. These are single base units.
 Magnesium and potassium- in the buffer system create
optimal conditions for DNA denaturation and renaturation.
 It also affects integrity, polymerase activity, and stability.

Steps in PCR?
Following steps are involved during PCR:
Denaturation
When the reaction mixture is heated to 94°C for about 2
minutes, denaturation occurs. This results in single-stranded
DNA.
The single strands of DNA serve as a template for the formation
of new strands of DNA. To ensure the separation of the two
strands, the temperature should be maintained for a longer
duration.
Annealing
For around 20-40 seconds, the reaction temperature is now
reduced to 54-60°C. Primers attach to complementary
sequences on the template DNA, which then serve as the
beginning point for DNA synthesis.
Because the two split strands run in different directions, there
are two primers participating in the reaction: a forward primer
and a backward primer.
Elongation
The temperature is again raised to 72-80°C at this point. The
Taq polymerase enzyme adds nucleotides to the 3' end of the
primer at the rate of approximately ‘1000bp each minute’. This
causes the DNA to lengthen in the 5' to 3' direction.
As a result, a DNA molecule with two strands is formed.
These three stages are performed 20-40 times to produce a
considerable number of DNA sequences of interest in a short
amount of time.
Recipe for Master mix: (for a group of 8 People)
1. H2O = 16.5 μl × 8 = 132 μl
2. Buffer = 2 μl × 8 = 16 μl
3. MgCl2 = 2.5 μl × 8 = 20 μl
4. DNTP’s = 0.5 μl × 8 = 4 μl
5. Forward Primer = 1 μl × 8 = 8 μl
6. Reverser Primer = 1 μl × 8 = 8 μl
7. Taq =0.5 μl × 8 = 4 μl
Procedure:
1. 1 μl of DNA was added to master mix to make 25 μl of
suspension.
2. The profile was setup and PCR was then run.
Primer Designing
When performing a PCR reaction, oligonucleotide primers are
required. The essential characteristic of primers is that they
must match sequences on the template molecule. However,
primers do not have to totally correspond to the template
strand; however, the 3' end of the primer must completely
correspond to the template DNA strand in order for elongation
to occur. 
The 3' end of the primer is normally guanine or cytosine, and
the 5' end usually comprises spans of multiple nucleotides.
Furthermore, all 3' ends of the hybridized primers must point in
the same direction.

Steps:
PCR involves the following three steps:
1. First, the genetic material is denatured, converting the
double stranded DNA molecules to single strands.
2. The primers are then annealed to the complementary
regions of the single stranded molecules.
3. In the third step, they are extended by the action of the
DNA polymerase.
All these steps are temperature sensitive, and the common
choice of temperatures is 94oC, 60oC and 70oC, respectively.
Good primer design is essential for successful reactions. The
important design considerations described below are a key
to specific amplification with high yield.
Some of them are given below:
1. Primer Length: Primer length must be long enough for
adequate specificity and short enough for primers to bind
easily to the template at the annealing temperature. 18-22
bp is considered a sweet spot.
2. Primer Secondary Structures: The occurrence of primer
secondary structures caused by intermolecular or
intramolecular interactions might result in low or no
product yield.
3. Repeats: A repetition is a di-nucleotide that occurs
numerous times in a row and must be avoided since it can
cause mis-priming.
4. 3' End Stability: This is the highest G value of the five
bases measured from the 3' end. There will be Less false
priming if 3' end is unstable.
5. Primer Melting Temperature (Tm): The temperature at
which half of a DNA duplex dissociates to become single
stranded is termed as the primer melting temperature
(Tm). Primers with melting temperatures ranging from 52
to 58 degrees Celsius often offer the finest results.
6. Primer Annealing Temperature: The primer melting
temperature is a measure of the stability of the DNA-DNA
 hybrid. Inadequate primer-template hybridization will
result in low yield if the Ta is too high. Too little Ta may
result in non-specific products due to a considerable
number of base pair mismatches.
7. GC Content: GC content in primers must be 40% to 60%.

Manual Primer Design:

Organism Used:
Uncultured bacterium clone D48
FASTA:
>KU678387.1 Uncultured bacterium clone D48 PqqC (pqqC) gene,
partial cds
AACCGCTTCTTATTCCCGACCGCCCTCCCCAATAAAAGATGCGGCGATCATGT
CCAACTGTCCCGACCGG
GAAGTGCGCCGCGAGTGGATCCAGCGCATCATCGGACCCATGATGGCCCAA
AGAGTGACGAGGGCGGTAT
CGAGGCCTGGTTGCGCCTGGGCGAAGCGGTCGGACTCAACCGTGACGACGT
CATCTCTAGCAACCATATC
GCTCCAGGTGTGCGGTCCGCGGTGGATGCGTATATCAACTTCGCCCGCACGC
AGCCTTGGCAGGAAGCGG
TCGCCTCGTCGCTGACCGAG
Multiple Alignment:
KY062439.1
CAGGGCTGGGTCGCCAACCGCTTCTATTACCAGATCGCCATTCCGCTCAAGG
-ATGCGGC
KU678368.1 ---------------
AACCGCTTCTACTACCAGACCGCCATCCCGCTGAAGG-ATGCGGC
KU678387.1 ---------------
AACCGCTTCTTATTCCCGACCGCCCTCCCCAATAAAAGATGCGGC
**********: *:**.** ****.* ** .: **.. *******

KY062439.1
GATCATGTCCAACTGTCCCGACCGCGAGGTGCGGCGCGAGTGGATCCAGCG
CATCATCG-
KU678368.1
GATCATGTCCAACTGTCCGGACCGGGACGTGCGCCGCGAGTGGATCCAGCG
CATCATCG-
KU678387.1
GATCATGTCCAACTGTCCCGACCGGGAAGTGCGCCGCGAGTGGATCCAGCG
CATCATCGG
****************** ***** ** *****
*************************

KY062439.1 -
ACCACGACGGGCACAAGGGCGACGAAGGCGGGATCGAGGCGTGGCTGCG
GCTCGGGGAG
KU678368.1 -
ACCACGATGGCCATCGGGGTGACGAAGGCGGTATCGAGGCTTGGCTGCGAC
TGGGTGAG
KU678387.1
ACCCATGATGGCCCAAAGAGTGACGAGGGCGGTATCGAGGCCTGGTTGCGC
CTGGGCGAA
.*** ** ** *. ..*.* *****.***** ******** *** **** ** ** **.

KY062439.1
TCGGTCGGACTGCAGCGCGAGGACATCACCTCCCTCAAGCACGTGCTGCCG
GGCGTGCGG
KU678368.1
GCAGTCGGGCTCCAGCGCGCGGACGTGACTGCGCTCAAGCACGTCCTGCCC
GGTGTGTGT
KU678387.1
GCGGTCGGACTCAACCGTGACGACGTCATCTCTAGCAACCATATCGCTCCAG
GTGTGCGG
*.*****.** .* ** *. ***.* * * . *** ** .* ** ** *** *

KY062439.1
TTCGCGGTCGACGCCTACATCAACTTCGCCCGCACCCGGCCGTGGCAGGAAG
CGGTGACC
KU678368.1
TTCGCGGTCGACGCCTACATCAACTTCGCCCGCACCCGCCCCTGGCAAGAGG
CCGTCACC
KU678387.1
TCCGCGGTGGATGCGTATATCAACTTCGCCCGCACGCAGCCTTGGCAGGAA
GCGGTCGCC
 * ****** ** ** ** ***************** *. ** *****.**.**
** .**

KY062439.1
TCCTCGCTCACCGAGCTGTTCGCGCCCGAGATCCATCAGAAGCGGCTGGACA
CCTGGCCC
KU678368.1 TCATCGCTGACCGAG---------------------------------------------
KU678387.1 TCGTCGCTGACCGAG---------------------------------------------
** ***** ******

KY062439.1
GAGCACTATCCCTGGATCGACCGCGAGGGGTACTTCTACTTCCGCAAGCGGC
TCACCGAG
KU678368.1 ------------------------------------------------------------
KU678387.1 ------------------------------------------------------------

KY062439.1
GCCCGTCGCGACGTGCAGTTCGCGCTCGGATTCACGCTGGACAACTACGTGA
CCCGGGAG
KU678368.1 ------------------------------------------------------------
KU678387.1 ------------------------------------------------------------
KY062439.1
CAGCAGGAGCGCGCACTGGACATCCTGCAGTTCAAGCTCGACGTGCTGTGG
AGCATGCTC
KU678368.1 ------------------------------------------------------------
KU678387.1 ------------------------------------------------------------

KY062439.1 GATGCCATG
KU678368.1 ---------
KU678387.1 ---------

Forward Primer:
GATCATGTCCAACTGTC

Reverse Primer:
ATCAACTTCGCCCGCAC
RNA Extraction
Materials:
 Pipettes
 Eppendorf
 Tips

Chemicals or reagents:
 Chloroform
 Trizol
 Lysis Buffer
 PCR Water
 Isopropyl Alcohol (Chilled)
 PBS Buffer

Procedure:
1. 2ml Eppendorf tube was taken and 250microliters of freshly
taken blood was added to it.
2. To the Eppendorf-containing blood, 400 microliters of PBS
lysis buffer were added.
3. It was centrifuged for 5 minutes at 1500 rpm.
4. After removing the aqueous layer, the obtained pallet was
suspended in 400 L PBS lysis buffer and separated by
centrifugation at 1500 rpm for 5 minutes.
5. The supernatant was discarded after centrifugation, and the
pellet was washed with 400 L PBS and centrifuged at 1500
rpm for 5 minutes.
6. Supernatant was removed and 1ml of trizol reagent was
added to the pallet and the cells were homogenized by
pipetting the cells upward and downwards.
7. To ensure the separation of nucleoprotein complexes, the
homogenized cells were incubated on ice for around 5
minutes.
8. 200 microliters of chloroform were then added, and the
Eppendorf was violently agitated for 15 seconds before
incubating on ice for around 10 minutes.
9. This was centrifuged for about 20 minutes at 4 degrees
Celsius at 12,000 g.
10. Separation process (Centrifugation) divided the mixture
into three phases, and the aqueous layer was separated and
transferred to another Eppendorf tube.
11. To the Eppendorf holding the aqueous phase, 500
microliters of refrigerated isopropyl alcohol were added.
12. This was thoroughly mixed and kept on ice for 15 minutes
before being centrifuged at 12000g for twenty minutes at
4°C.
13. After discarding the supernatant, the pallet was rinsed
with 1.0 ml of 75% refrigerated ethanol and centrifuged at
7500g for 5 mins at 4 ° C. at 7500g.
14. After removing the supernatant, the RNA pallet was dried
at room temperature.
15. To resuspend the RNA pellet, twenty microliters of PCR
water was added.

Quantification using nanodrop:

 Nanodrop was used to quantify the RNA extracted from
the blood specimen.
 Nanodrop readings were blanked using 1microlitre PCR
water
 A microliter of the extracted RNA suspended in PCR water
was quantified using nanodrop.
260/280 Ratio Concentration (ng/μL)
1 1.64 328.15
Reading from Nanodrop:
cDNA synthesis:
Reagents:
 H2O (6.4 μl)
 Buffer (4 μl)
 dNTPs (2 μl)
 DTT (1 μl)
 Rnase inhibitor (1 μl)
 mRNA (4.6 μl)
 oligo dT primers (1 μl)
 Reverse transcriptase (1 μl)

Procedure:
1. Thawed pre-frozen components on ice by turning and
tapping the Eppendorf.
2. All materials were then short spun for 30 seconds at 700
rpm.
3. To minimize contamination, all components were introduced
to a single Eppendorf tube using a pipette on the working
bench.
4. In Eppendorf, the total volume was 20 microliters.
5. When mixing the components, it was ensured that all
reagents were introduced in descending order of
concentration, i.e., water was added first, followed by the
mRNA sample, and so on.
6. The tube was placed in PCR for cDNA synthesis while the
conditions were kept constant.
Gel Electrophoresis:
Reagents or Chemicals:
 Ladder
 TAE Buffer
 Loading Dye
 Ethidium Bromide
 Agarose

Procedure:
1. 100 ml of 1X TAE Buffer was microwaved with 2g of agarose
for 2- 3 minutes, or until the solution became clear.
2. I waited till the emission of vapors from the solution ceased
and gently adding 6 microliters Ethidium Bromide.
3. The tips were disposed of, and the pipette was thoroughly
cleaned with ethanol.
4. Solution which was formed was then carefully poured into
the tray with the combs already attached.
5. I waited 20-25 minutes for the gel to solidify.
6. After solidification, the combs were carefully withdrawn from
the gel, and the gel was taken from the casting tray.
7. The solidified gel was put in a chamber loaded with TAE
buffer.
8. 3 microliters the first well was stocked using a ladder.
9. 5 microliter DNA was taken and 3microliter die was mixed
with it.
10. The DNA and dye were loaded into wells carefully.
11. Leads were connected correctly, and the power supply was
turned on.
12. Now the DNA bands were visualized under UV
Transilluminator after about 40 minutes.

Picture: