Heliyon 9 (2023) e15639

Contents lists available at ScienceDirect

Heliyon
journal homepage: www.cell.com/heliyon

Research article

Tolerance, taxonomic and phylogenetic studies of some bacterial

isolates involved in bioremediation of crude oil polluted soil in the
southern region of Nigeria
Emmanuel Chukwuma Omenna a, Kingsley Omage b, c, *, Emmanuel Ezaka a,
Marshall Arebojie Azeke d
a
Institute of Agricultural Research and Training, Obafemi Awolowo University, Nigeria
b
Department of Biochemistry, College of Basic Medical Sciences, Igbinedion University Okada, Edo State, Nigeria
c
Division of Endocrinology, Diabetology and Nephrology, Department of Internal Medicine, University Hospital Tübingen, Germany
d
Department of Biochemistry, Ambrose Alli University, Edo State, Nigeria

A R T I C L E I N F O A B S T R A C T

Keywords: Indigenous bacteria play vital roles in the bioremediation of crude oil polluted soils. The effec­
Southern Nigeria tiveness of the bioremediation process depends on the tolerance, characteristics and biodiversity
Bacteria isolates of the bacteria isolates. Bacteria strains were isolated from crude-oil polluted sites in different
Phylogeny
locations in the southern region of Nigeria namely: Azikoro and Otukpoti (Bayelsa state); Ologbo
Taxonomy
Bioremediation
and Benin (Edo State) and non-polluted soil was collected from Ibadan (Oyo state). Tolerance
study was conducted for 96 h s. Isolation and characterization of the most effective isolate from
each location was done using cultural, physico-chemical and molecular methods. The tolerance
level of the isolates from the different oil-polluted soils and their comparative growth perfor­
mance on crude oil supplemented media decreases in the order: Azikoro - Ologbo - Otukpoti -
Benin. MATS analysis showed that cell surfaces of Azikoro, Ologbo and Otukpoti strains exhibited
58–63 % adhesion to n-hexadecane and are hydrophobic strains while Benin strain possess 38%
adhesion to n-hexadecane and are hydrophilic. The cell surfaces of isolates from Azikoro, Ologbo
and Otukpoti are highly Lewis-acidic while that from Benin is highly Lewis-basic. Isolates from
Benin-3, Ologbo-1, and Otukpoti-1 were shown to be gram positive while that from Azikoro was
gram negative. 16S rDNA fingerprinting confirmed the identities of the isolates as follows: Pae­
nalcaligenes suwonesis with accession numbers NR-133804.1 from Azikoro spillage site (93.77%);
Lactobacillus nagelii with accession number NR-158108.1 (91.30%) from Benin spillage site;
Lactobacillus fermentum with accession number NR-104927.1 (96.70%) from Ologbo and Otukpoti
spillage sites. Phylogenetic analysis putatively categorized the isolates from Otukpoti and Ologbo
in close association belonging to same homology while Benin isolate is a subgroup. The char­
acteristics and biodiversity of all the isolated bacteria from the regions possibly justifies their
involvement in the bioremediation of petroleum hydrocarbons.

* Corresponding author. Department of Biochemistry, College of Basic Medical Sciences, Igbinedion University Okada, Edo State, Nigeria.
E-mail addresses: omagekingsley@yahoo.com, omage.kingsley@iuokada.edu.ng (K. Omage).

https://doi.org/10.1016/j.heliyon.2023.e15639
Received 31 August 2022; Received in revised form 14 April 2023; Accepted 17 April 2023
Available online 20 April 2023
2405-8440/© 2023 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
E.C. Omenna et al. Heliyon 9 (2023) e15639

1. Introduction

Crude oil spills are dangerous occurrences which often pose great threats to the environment, human health, food production and
security. Crude oils and its refined products are mainly hydrocarbons, and majority of them are bio-degradable [1]. However,
accumulation of hydrocarbon contaminants in the environment constitutes a serious challenge to the ecosystem and human health.
The remediation of oil-polluted soils in the Southern region of Nigeria has always been a serious problem confronting the region which
requires urgent and effective solution [2]. The involvement of bacteria in bioremediation has generated much interest due to the
effectiveness, low cost and environmentally friendly nature of the process. However, the process of petroleum hydrocarbon degra­
dation by indigenous bacteria is usually slow due to low density of bacteria population and activity [3,4]. Nevertheless, the use of the
petroleum hydrocarbons as source of carbon and energy by the indigenous bacteria for their metabolic processes helps to increase their
survival and growth rate [5], which in turn makes the bioremediation process more effective and self-sustaining.
Micro-organisms survive in oil-contaminated habitats by metabolically degrading and utilizing the petroleum-hydrocarbons, which
are an excellent source of carbon and energy [6,7]. The composition of petroleum-hydrocarbons is a fundamental and influential factor
in the biodegradation process [8]. Microbial activities during the bioremediation of oil-polluted soils have been reported to be
significantly affected by temperature, oxygen, pH, and nutrients [9–11]. For instance, at low temperatures, the degradation rate of
petroleum-hydrocarbons is generally observed to be slow, and this is thought to be as a result of the reduced rate of enzyme activities
[12]. Besides, biodegradation of petroleum-hydrocarbons can take place on a wide range of temperatures, and degradation rate may
decrease with a decline temperature. Furthermore, Pawar [13] inferred that the soil pH of 7.5 was the optimum pH for bio-degradation
of all petroleum-hydrocarbons. The degradation of phenanthrene in liquid media by Burkholderia cocovenenas, isolated from
petroleum-hydrocarbon polluted-soil was favourable at pH values ranging from 6.5 to 7.0 [13]. The concentration of pollutants, which
poses a selective pressure on petroleum hydrocarbon degrading-microbes, also play an important role in the activities of microbes
during bioremediation [14]. However, when the condition is favourable to micro-organisms, biodegradation of petroleum hydro­
carbon will reach a maximum level, which is favourable for bioremediation. One key step in the microbial degradation of petroleum
hydrocarbons or bioremediation is the substrate oxidation by oxygenases in the catabolism of all aliphatic, cyclic- and
aromatic-compounds [15]. The petroleum hydrocarbon degradation activities of some microorganisms, like Trichoderma hypocrea,
Penicillium chrysogenum, Lasiodiplodia theobromae and Mucor racemosus have been reported to be useful in the bioremediation of crude
oil-polluted soils [16,17].
Amongst other micro-organisms, bacteria have been acclaimed to be the most active agent of bioremediation [18]. The variety of
bacteria involved in bioremediation differ in their physical classification, biodiversity and ability to tolerate the adverse environmental
conditions which often prevails within the ecosystem. These differences often result in adaptive characteristics within the bacteria
population. Thus, the type and characteristics of bacteria isolates may differ from one habitat or region to another. This is a common
phenomenon within the Niger Delta or Southern region of Nigeria. In an attempt to understand the differences in the ability of the
bacteria isolates to tolerate the environmental effects of crude oil pollution, their biodiversity and classification, we studied
oil-polluted and non-polluted soils from three states (Bayelsa, Edo and Oyo) within the Southern region of Nigeria. Here, we isolated,
screened and characterised the crude oil degrading bacteria. This is with a view to determining their tolerance, taxonomic and
phylogenetic characteristics.

2. Materials and methods

2.1. Source of chemical reagents

The biosurfactant, di-rhamnolipid was purchased from Sigma Aldrich (Germany). Chemical-reagents used for the preparation of
mineral salt media (MSM) such as: KH2PO4, Na2HPO4, NaCl, KCl, as well as nutrient broth, potato dextrose agar (PDA), and nutrient
agar (NA) were purchased from SD Fine Chemicals Pvt Limited., SRL industries Limited., Merck and Hi Media Pvt. Limited. Pure di-
chloromethane (DCM) used for the extraction of petroleum-hydrocarbon was obtained from Merck (India). Other chemical-reagents
used in this study were of analytical grade.

2.2. Site description

Soil samples were collected from oil polluted and non-polluted sites in three states within the Southern region of Nigeria. The
samples were obtained from different locations within each state namely: Bayelsa State (Otukpoti and Azikoro) which lie within the
same latitude 04.84◦ N and longitude 06.27◦ E; Edo State (Ologbo - which lies within latitude 06.06◦ N and longitude 05.66◦ E and Benin
- which lies within latitude 06.35◦ N; and longitude of 05.63◦ E); non-polluted soil sample was collected from Moor Plantation, Ibadan,
Oyo State - which lies within latitude 7.39◦ N and longitude 3.5oE.

2.3. Soil sample collection

The crude-oil contaminated soil samples were collected from petroleum polluted sites (from 0 to 20 cm depth) at two locations each
from Bayelsa and Edo State. And non-polluted soil was collected from Oyo State, Nigeria. The soil samples were stored and conveyed to
the laboratory in ice-bags.

2
E.C. Omenna et al. Heliyon 9 (2023) e15639

2.4. Microbial isolation and screening from crude-oil contaminated soils

Mineral-salt-medium (MSM) was prepared by dissolving 0.27 g of KH2PO4, 1.4 g of Na2HPO4, 0.8 g of NaCl, and 0.2 g of KCl in 1 L of
deionized water, and then autoclaved at 121 ◦ C for 15 min [19]. The method described by Churchill et al. [20] was adopted for the
isolation of oil-degrading microorganisms using mineral salts medium (MSM). About 10 g of each sieved soil sample was added to 100
ml of the MSM and incubated in a shaker at 30 ◦ C and 140 revolutions per minute (rpm) for 48 h. Afterwards, 1 mL of the broth culture
was taken and transferred into 50 mL of freshly prepared MSM containing 2% crude oil, and was incubated under the same condition.
The isolation was on MSM containing 2% crude oil (PHC) as source of carbon and energy using spread plate method. The plates were
incubated at 30 ◦ C for 72 h. Morphologically distinct colonies were isolated and sub-cultured on nutrient agar and repeated until a pure
culture was obtained. The pure culture was stored in nutrient agar slant for further studies. The microbial-growth was monitored
through optical-density and the absorption was measured using a spectrophotometer at a wavelength of 620 nm [21]. The strains
which exhibited the heaviest growth density on MSM were subjected to characterizations following the procedure on the Bergey’s
manual for Systematic-Bacteriology [22,23].

2.5. Quantitative evaluation of petroleum hydrocarbon (PHC) biodegradation

About 2.0 ml each from the four PHC-degrading isolates were poured into a 500 mL round bottom flask containing 100 mL of sterile
defined MSM with 2% crude oil and then supplemented with 3% rhamnolipid and/or 3% kenaf core as shown in the design above. The
treatments with isolates were known as bio-augmentation and those without isolates were known as bio-stimulation (Table 2). All the
treatments were incubated for 90 days at 30 ◦ C and 200 rpm. The concentration of residual petroleum hydrocarbon and pH as well as
microbial count was monitored. The total petroleum hydrocarbon was determined in all treatments at the interval of 15, 30, 45, 60, 75,
and 90 days of incubation using modified spectrophotometric method [24]. About 5 mL of each sample was taken from all the
treatments and were mixed properly with an equivalent quantity of dichloromethane (Cl2CH2) at ratio 1:1 to extract hydrocarbons
from each treated sample. The extracted hydrocarbon from the samples were then determined using a Cecil Spectrophotometer (Model
CE1010, UK) at a wavelength of 600 nm. To determine the residual amounts of hydrocarbons in all the treatments, a standard curve
was also prepared using known amount of crude-oil [24]. The percentage of hydrocarbon degradation was determined by calculating
the difference between the initial and final concentration of crude-oil in each treatment using the formula (equation (1)) below:
Initial conc − Final conc
% PHC degradation = × 100 (1)
Initial conc

2.6. Tolerance studies

The crude-oil used in this study was obtained from the Depot of the Nigerian National Petroleum Co-operation (NNPC), Benin. To
study the tolerance range of the microbial isolates, different volumes of crude-oil (0, 2, 4, and 6%) were added to the mineral-salt-
medium (MSM) containing each isolate. The reaction mixture was kept in the incubator at 37 ◦ C for 96 h (i.e., 4 days). After the
incubation period, the tolerance range of the isolates in crude-oil concentrations were obtained based on their growth density
(turbidity). The microbial-growth rate was determined by their optical-density and the spectrophotometric-absorption at 620 nm using
Cecil Spectrophotometer (Model Cecil CE7500,7000 series) [21]. The strains/isolates with the heaviest growth density on MSM were
stored at 4 ◦ C for the in-vitro biodegradation study.

2.7. Gram staining of the different isolates

Gram staining was used to differentiate the bacteria in two large groups namely: gram positive and gram-negative organisms. It was
determined using heat-fixed liquid culture and the Difco staining kit, according to the manufacturer’s instructions. Smears were
prepared from each cultured isolate, air-dried and heated. The slides were placed on a staining rack with a pan underneath. Each slide
was flooded with crystal violet or methyl violet and was allowed to stay for 30–60 s, the slides were rinsed with tap water by draining.
Each smear was flooded with iodine solution and was allowed to stand for 1 min and then washed again with running water. The slides
were tilted and decolourized with 95% ethanol until the ethanol draining from the slides appeared colourless. The slides were washed
briefly with tap water, drained off with excess water before the smears were counter-stained with carbol-fuchsin for 20–30 s, washed
briefly with running water and then blot-dried. The slides were observed under oil –immersion objective lens microscope [25].

2.8. Genomic-DNA extraction from the isolates

The genomic-DNA was extracted from each isolate using the Quick-DNA Bacterial Miniprep kit (Zymo Research, CatalogueNo.
D6005) following the manufacturer’s instructions. Bacteria cells were harvested from 500 μL aliquot of bacteria broth culture using
micro-centrifuge at 10,000 g for 1min. Residual pellets were re-suspended in 300 μL of re-suspension buffer and 2 μL of lysozyme
solution. The mixture was homogenized by inverting it several times, and was incubated at 37 ◦ C for 1 h. Re-suspended cells were
recovered by centrifugation and lysed by adding 300 μL of lysis buffer, 2 μL of RNase A and 8 μL proteinase -K solution. The mixture
was incubated at 60 ◦ C for 10 min, thereafter it was allowed to cool at 20–25 ◦ C for 5 min. About 300 μL of binding buffer was
introduced to the mixture and vortexed briefly. The mixture was ice-cooled for 5 min and then centrifuged at 10,000 rpm for 5 min.

3
E.C. Omenna et al. Heliyon 9 (2023) e15639

The supernatant was transferred directly into a spin column and centrifuged at 10,000 rpm for 1min to trap the DNA. Trapped DNA still
present in the spin column was washed twice with washing buffer followed by elution of DNA. About 50 ml of elution buffer was
introduced to the tube and the DNA was eluted into sterile Eppendorf tube by centrifugation at 10,000 g for 2 min.

2.9. 16S rRNA polymerase chain reaction (PCR) amplification

The 16S rRNA gene, a single genetic locus, was used to assess the bacteria diversity in the samples for phylogenetic and taxonomic
studies. The 16S acts as a ‘barcode’ for differentiating the microbial-taxa and was used to classify bacteria taxonomically within the
heterogeneous community. PCR was used to amplify segments of the 16S gene from the selected isolates. Each PCR reaction mixture
consisted of 5 μl of master-mix (2xQia Quick-load, NEB), 1 μL (10 pmoL) each of the universal primers: I6S–27F- and 16S-1492R
(Table 1), 1 μL DNA template and 17 μL sterile nuclease free water, to make a total reaction of 25 μL. PCR amplification was con­
ducted in Applied Bio-system, 2720 Thermal cycler. The mixture was subjected to initial denaturation at 94 ◦ C for 3 min, followed by
35 cycles of 94 ◦ C for 45 s, 55 ◦ C for 60 s and 72 ◦ C for 60 s, and final extension at 72 ◦ C for 10 min. The PCR products were visualized
after electrophoresis on a 1 % agarose gel containing ethidium bromide in 0.5× Tris-borate buffer with pH 8.0 [26,27]. After elec­
trophoresis, the gels were observed or visualized under UV trans-illuminator, documented in Gel-doc XR (Bio Rad) and photographed.
The sizes of the amplicons were determined using 100–1200 bp DNA ladder plus. The extracted DNA was sequenced in forward and
reverse directions following the manufacturer’s instructions. The 16S rRNA gene sequence obtained from the isolates was compared
with the sequences available in the NCBI-database using BLASTn [28].

2.10. Phylogenetic analysis of the isolates

Searches for the EMBL/GenBank/DDBJ/PDB data-Libraries were performed using BLASTn [29]. Search for the algorithm was made
in order to establish the identity of the isolates. Sequences of the close relatives were retrieved and aligned with the new sequences.
Phylogenetic- and molecular-evolutionary analyses were conducted using MEGA software version-6 [27,28]. The phylogenetic-tree
was constructed by the maximum Parsimony method.

2.11. Physico-chemical properties of the isolates’ cell surface

The adhesive characteristics of each isolate to n-hexadecane, chloroform and ethyl-acetate were evaluated using microbial
adhesion to solvent (MATS) method with some modifications [30]. The cultured isolates were harvested in the stationary phase by
centrifugation at 5000 rpm for 10 min, washed three times and then re-suspended to an optical density of 0.4 at 400 nm (A0) in 0.1 M of
KNO3 (pH 6.2), after which 0.2 mL of solvent was added to 1.2 mL of the cell suspension. After pre-incubation for 10 min at 20–25 ◦ C,
the two-phase systems were mixed on a vortex for 2 min and then incubated for 15 min for phase separation. The aqueous-phase was
gently decanted and its optical density was measured at 400 nm (A1). The percentage microbial-adhesion to solvent was calculated
using the formula (equation (2)) below:
(1 − A1) x 100
(2)
A0
Three solvents used in this research study were: n-hexadecane (Sigma-Aldrich) - which is a polar solvent; chloroform (Sigma-
Aldrich) – which is a mono-polar and acidic-solvent; ethyl-acetate (Sigma Aldrich) – which is a mono-polar and basic-solvent. Isolate
adhesion to n-hexadecane reflects the cell-surface’s hydrophobicity or hydrophilicity. The MATS values obtained from the other two
solvents namely: chloroform and ethyl-acetate were regarded as electron-acceptor and electron-donor, confirming the acidic- and
basic-characteristics of the isolates’ cell surfaces [31].

2.12. Statistical analysis

Data obtained were subjected to analysis of variance (ANOVA). Comparison of Mean were made using a least significant difference
at the P < 0.05 probability level by the Statistical Analysis System (SAS) program (SAS Institute, Cary, N.C.).

Table 1
16S Primer sequences.
Name of Primer Target Sequence (5′ –3′ )

16S–27F 16S rDNA sequence AGAGTTTGATCCTGGCTCAG

16S-1492R 16S rDNA sequence CGGTTACCTTGTTACGACTT

4
E.C. Omenna et al. Heliyon 9 (2023) e15639

Table 2
The physico-chemical properties of the isolates’ cell surfaces.
Isolate % Adhesion to n-hexadecane %Adhesion to chloroform (acidic) % Adhesion ethyl acetate (basic)

Azikoro1 63.1a 85.4a 34.3c

Benin3 38.7d 21.3c 65.0a
Ologbo1 58.64bc 82.1b 38.7b
Otukpoti1 58.63bc 82.1b 38.7b

Mean values with the different superscript along a column are significantly different (P < 0.05).

3. Results

3.1. The tolerance level and comparative growth performance of the isolates on the crude oil supplemented media decrease in the order:
Azikoro isolate > Ologbo isolate > Otukpoti isolate > Benin isolate

As indicated in Fig. 1, the three isolates from each location were inoculated in MSM supplemented with crude oil at 0-, 2-, 4-, and 6-

Fig. 1. (A) - Growth profile of Azikoro (AZ) isolates in media supplemented with different volumes of crude oil. (B) - Growth profile of Benin
isolates in media supplemented with different volumes of crude-oil. (C) - Growth profile of Ologbo isolates in media supplemented with different
volumes of crude-oil: (D) - Growth profile of Otukpoti isolates in media supplemented with different volumes of crude-oil. (E) - Comparative Growth
profile of the efficient isolates on different crude oil concentrations: There was no growth of Ibadan isolate on crude -oil contaminated MSM.

5
E.C. Omenna et al. Heliyon 9 (2023) e15639

mL. Each line graph (Fig. 1A, Fig. B, Fig. 1C, or Fig. 1D) shows the growth density (turbidity) of three different isolates, after 96 h of
incubation, while each line on the graph indicates the turbidity for each (or one) isolate. The results showed that all the isolates
exhibited similar growth pattern upon inoculation on the crude oil supplemented media (Fig. 1A, Fig. B, Fig. 1C, Fig. D). The impact of
crude-oil concentration on the growth of the isolates was maximum at the media without crude oil (0 mL). There was slight decrease in
the growth performance of all the isolates at 2 mL concentration of crude oil, followed by a spike at 4 mL before a gradual decline in
growth at 6 ml crude oil concentration. The isolates with the highest growth rate or turbidity (colony) in each location was selected for
molecular characterization and in-vitro studies. The isolates with the best growth performance from each location was selected and
coded as follows: Azikoro-1 (AZ1), Benin-3 (BN3), Ologbo − 1(OL1), and Otukpoti-1 (OT1). The results in Fig. 1E show that,
comparatively, the Azikoro isolate appeared to be the most efficient organism with the highest turbidity at 2.80 followed by Ologbo
isolate (2.4) and Otukpoti (2.2) and least in Benin isolate (1.5). It is worthy of note that the isolates from Ibadan soil (Otukpoti) did not
show any growth on crude oil supplemented media. Therefore, Ibadan isolates were intolerant to petroleum hydrocarbons and were
not used for further studies.

3.2. The cell surface adhesive characteristics of the isolates from Azikoro, Ologbo and Otukpoti were shown to be highly Lewis-acidic while
that of the isolate from Benin was shown to be highly Lewis-basic

The isolates’ adhesive characteristics to n-hexadecane, chloroform and ethyl-acetate are as shown in Table 2. The isolates’ cell
surface characteristics were evaluated to determine their ability to interact and solubilize the crude-oil substrate in polluted soil or
water. The results show that Azikoro, Ologbo and Otukpoti isolates’ cell surfaces were highly Lewis-acidic, with the values ranging
from eighty-two to eighty-five percent adhesion to chloroform (>60%) and hydrophobic with more than fifty percent adhesion to n-
hexane (>50%), while Benin isolate’s cell surface was highly Lewis-basic with sixty-five percent adhesion to ethyl acetate (>50%) and
hydrophilic with less than fifty percent adhesion to n-hexane (<50%).

3.3. Isolates from Benin-3, Ologbo-1, and Otukpoti-1 were gram positive while that from Azikoro was gram negative

Gram staining was used to differentiate between the physical and chemical properties of the isolates (Fig. 2). The results of
decolourization of the isolates showed that Benin-3 (Fig. 2A), Ologbo-1 (Fig. 2B), and Otukpoti-1 (Fig. 2C) isolates changed from blue
to purple colour upon reaction to stain, which indicated gram positive. While Azikoro-1 (Fig. 2D) isolate changed on staining from pink
to red, indicating gram negative organism. The differential morphological features of the four isolates are as outlined in Table 3. The
results revealed that three isolates were gram positive while Azikoro isolate was the only gram-negative bacteria.

3.4. 16S ribosomal-RNA (16S rRNA) PCR of isolates shows amplicon size of 1.1k base pair

After the PCR, the amplified regions were interrogated through DNA sequencing and the amplicons with known based pair of

Fig. 2. Gram-stain images of the isolates from oil contaminated soils. A = Benin strain, B = Ologbo strain, C = Otukpoti strain, and D = Azikoro
strain. The full, non-adjusted images are provided in the supplementary material section (supplementary f. 2).

6
E.C. Omenna et al. Heliyon 9 (2023) e15639

Table 3
Summary of the morphological characteristics of the isolates.
Isolate Gram stain Shape Colour

Azikoro-1 – Flagellated Rod White

Benin-3 + Rod creamy white
Ologbo-1 + Cylindrical rod Creamy white
Otukpoti-1 + Cylindrical rod Creamy white

nucleotides were then sequenced to base-call the pattern of nucleic acids (DNA). The results showed that the DNA segments with the
expected sizes of ~1000 bp were amplified by using 16S-specific primers. The expected amplicons were produced at the same band
size. All the amplicons from the four different isolates have the same size of 1100 bp (1.1kbp). Fig. 3 shows that almost 1.1kbp of
nucleotides of targeted amplicons were amplified, eluted, and sequenced.

3.5. Comparative phylogenetic revealed the identities of the isolates

The sequence and phylogenetic analysis of the isolates revealed the similarities between them and standard or known bacteria
strain (Figs. 4–6). Ologbo-1 strain was identified to be Lactobacillus fermentum with accession number NR-104927.1 (96.7% similarity/
homology). Benin-3 strain was identified to be Lactobacillus nagelii with accession number –NR-158108.1 (91.3% similarity/homol­
ogy). Otukpoti-1 strain was identified to be Lactobacillus fermentum with accession number-NR-104927.1 (96.7% similarity/homol­
ogy). While Azikoro-1 strain was identified to be Paenalcaligenes suwonesis with accession number-NR-133804.1 (93.77% similarity/
homology).

3.6. Amino acid creation and translation

To get useful information about the protein or gene coding the region of the isolates, the amino acid sequence was created from the
consensus sequence using the sequence data obtained from forward primer (16S–27F) and the reverse complement of 16S-1492R. The
results (Figs. 7 and 8) of the sequence analysis with amino acids translation indicate that the nucleotide and deduced amino acid
sequences obtained from the bacterial isolates studied contained 500–530 nucleotides and 160 amino acids respectively. The isolates
shared 85–90% nucleotide and 75–80% similar amino acid sequences with other isolates except for Azikoro isolate. However, pro­
karyotic organisms like bacteria which are also known as single-celled organisms consist of 70S ribosomes out which are 20S small
subunits and 50S large subunits. Amino acids translation were done using Sorted Six-Frame Translation, Bioeditor.

4. Discussion

4.1. Tolerance of the isolates

This study evaluates the isolates’ response, tolerance and metabolic capacity to use the petroleum-hydrocarbons by growing on the
MSM-media contaminated with different volumes of crude-oil. The isolates from the oil contaminated soil samples displayed similar
growth pattern at different rates, but exhibited higher growth (higher turbidity) at the media without crude oil. The isolates showed
decreased growth at 2 % crude oil concentration and subsequently a spike in growth at 4 % crude oil concentration and a decline in
growth at 6 % crude oil. The increase in growth in the media with 4 % concentration of crude oil indicates that optimum growth of
bacterial in crude-oil contaminated soils depends on the concentration of the crude oil. This is partly in agreement with previous report

Fig. 3. Agarose gel images showing the band size of the four amplicons: L- 100bp DNA molecular marker (New England Biolabs, Massa­
chusetts, USA). The isolate-PCR products were visualized after electrophoresis on a 1 % agarose gel containing ethidium bromide in 0.5× Tris-borate
buffer. The full, non-adjusted images are provided in the supplementary material section (supplementary f. 3).

7
E.C. Omenna et al. Heliyon 9 (2023) e15639

Fig. 4. A phylogenetic tree showing the relationship between Azikoro-1 isolate (Paenalcaligenes suwonesis) and other Alcaligenes in NCBI-
database. Bootstrap percentages (based on 1000 replications) > 70% appeared at the branch-points. The number at branch points indicated the
corresponding branches that were recovered in both the maximum parsimony and maximum-likelihood trees. The bar 0.002 indicates substitution
per nucleotide.

Fig. 5. A phylogenetic tree showing the relationship between Otukpoti-1 isolate and other Lactobacilli fermentum in NCBI database:
Bootstrap percentages (based on 1000 replications) > 60% appeared at branch-points. The number at branch points indicated the corresponding
branches that were recovered in both the maximum parsimony and maximum-likelihood trees. The bar 0.1 indicates substitution per nucleo­
tide position.

which stated that microbial growth often starts at the beginning of the exponential phase and peaks at the end of exponential phase
[32]. It is worthy of note that the beginning and end of the exponential phase correspond with different concentrations of crude oil in
the polluted soils. However, isolates from the soil obtained from Ibadan did not show any form of growth in the MSM-media

8
E.C. Omenna et al. Heliyon 9 (2023) e15639

Fig. 6. A phylogenetic-tree showing the relationship between Benin-3 isolate and other Lactobacilli nagelii in NCBI-database: Bootstrap
percentages (based on 1000 replications) > 50% appeared at the branch-points. The number at branch-points indicated the corresponding branches
that were recovered in both the maximum parsimony and maximum-likelihood trees. The bar 0.05 indicates substitution per nucleotide.

supplemented with crude oil, irrespective of the concentration of the crude oil. Comparative evaluation of the efficient isolates showed
that AZ1 exhibited the highest oil-tolerance rate at 6% crude oil concentration followed by OL1 and OT1 while BN3 was the least.
Although, Ali and co-researchers [33] reported that the hydro-carbonoclastic bacteria, Dietzia papillomatosis, tolerated up to 20% crude
oil and was said to be the most tolerant bacteria in the consortia. Also, Lian and co-researchers [34] suggested that during crude oil
pollution, the proportion of the petroleum-degrading micro-organisms in the soil increases dramatically due to their acclimatization
and stabilization to petroleum-induced stress. But our findings show that the growth of the isolates decreased with increased con­
centration of crude-oil. And comparatively, the isolate from Azikoro soil sample exhibited the highest growth density.
Hydro-carbonoclastic bacteria have been described as those bacteria that are capable of utilizing petroleum-hydrocarbons as their
energy and carbon sources [33]. They possess mono and dioxygenases which catalyze the splitting of oxygen molecules into atoms and
then introduce the atoms into aliphatic- and aromatic-hydrocarbons [35]. The attack on the hydrocarbon produces alkanols from
alkanes which are subsequently oxidized to alkanals and finally to their corresponding fatty acids. The fatty acids are then degraded by
β-oxidation to Acetyl-CoA units. Through TCA cycle, this intermediate becomes mineralized to CO2 and H2O for ATP production and
keto acid of the cycle which produces amino acids for the synthesis of bacterial cell materials. This supports the growth of the bacteria
[35,36]. The bacterial under study (AZ1, OL1 and OT1) which exhibited optima growth in the presence of the crude oil most likely
utilized the metabolic process as described above. This is because the concentration of crude oil has been reported to be vital in the
biodegradation process while the rates of microbial uptakes and biodegradation of water-soluble compounds are usually proportional
to the concentration of the compound but same cannot be said of compounds with low aqueous solubility and those that can exert
membrane toxicity at high concentration [37]. Although, there are speculations that high concentrations of highly soluble or volatile
organic compounds may be detrimental to microbial forms due to their toxicity, but Tarabily and Khalid [38] reported that biodeg­
radation activities in oil sludge often occurred between crude oil concentrations of 1.25% and 6.0% and were best at 5%, which agrees
with our findings. In this light, Tarabily and Khalid [38] stated that oil loading greater than 5.0% leads to a decline in microbial
numbers due to toxicity. They further emphasized in their reports that there was complete cessation of degradation activity when the
concentration exceeded 50%.

4.2. Physico-chemical characteristics of the Niger Delta bacteria’s cell surfaces

The hydrophobicity of cells is an important factor that could influence the physical contact between micro-organisms and hy­
drocarbons. In addition, increasing the cell membrane hydrophobicity could help micro-organism to directly make contact with big oil
droplets [10,11]. Our findings show that the isolates with low adhesion to n-hexadecane (<50%) were hydrophilic strain while those
with high adhesion from above >50% were hydrophobic strain. The hydrophilic nature of the bacteria cell-surfaces may be due to the
presence of polysaccharides while the presence of (lipo) teichoic acid may be responsible for their hydrophobic nature. The hydro­
phobicity of the strains which decreased in the order AZ1 - OL1 - OT1, may directly affects the integrity of the cell-surface of the
bacteria. It was also observed that lactobacilli showed great diversity in cell-structures and compositions. Thus, they were able to

9
E.C. Omenna et al. Heliyon 9 (2023) e15639

Fig. 7. Sequence alignment of the primers with Forward and reverse compliment.

modify their cell-surfaces in response to the environmental changes. In all predictions, species and strains show variations in the
cell-surface hydrophobicity as a result of the different expressions from certain surface-components such as adhesins, polysaccharides
and proteins [31]. However, isolates from Azikoro possibly utilized the outer membrane lipopolysaccharide (LPS) in the dissolution of
hydrocarbons, due to their gram-negative nature. The increase in cell hydrophobicity has been stated to facilitate the attachment of cell
to hydrocarbon droplet [35]. This increase can be induced by the bio-surfactant combined with slightly soluble-substrate [39]. The
observation from this study is, however, at variance with the report from the study carried out by Hua and Wang [39] which stated that
the hydrophobicity of bacteria cell-membrane can cause a decrease uptake of the availability of hydrocarbons by bacteria cells, thus
increasing the difficulty in biodegradation. This implies that most substrates that promote microbial-growth need to undergo cellular
attachment and then become accessible to the catabolic-machinery. Although, Hua and Wang [39] reported that micro-organisms can
grow in fatty-acids and not in water-phase, it is often combined with petroleum-hydrocarbons to form agglomeration when in close
contact with the microbial cells. The results from this present study also supported the suggestion that the cell hydrophobicity and the
nature of substrates were important-factors in microbial adhesion to surfaces.
Also, the isolate’s affinity for chloroform (acidic-solvent and electron-acceptor) varied significantly. Their affinity for chloroform
which decreased in the order BN3 - AZ1 - OL1 - OT1, demonstrated Lewis-acid capacity of their cells and this was related to the
carboxylic and hydrogen sulphite groups in the microbial-surfaces. This observation was in agreement with the data reported by Anna
et al. [31], which highlighted that among other strains assessed, Lactobacillus fermentum-Na had least affinity with chloroform while

10
E.C. Omenna et al. Heliyon 9 (2023) e15639

Fig. 8. Amino acid translation from consensus sequence data (This helps to determine the protein encoded in the region).

Lactobacillus plantarum (88.8%) and Lactobacillus fermentum 3-2 was 93.8%. However, on adhesion to ethyl-acetate (a basic-solvent and
electron-donor), all the isolates showed low adhesion to the basic solvent (>40%), except for BN3 isolate which has the highest
adhesion (65%) to ethyl-acetate. Furthermore, the results from this study are in agreement with the report by Hua and Wang [39]
which highlighted that the important factors affecting bio-degradation of crude-oil pollutants were their in-accessibilities to
micro-organism and the contact of the cells with the hydrophobic-compounds. Hua and Wang [39] stated that gram-positive and
gram-negative bacteria have three different pathways by which hydrocarbons are taken up. These are; uptake of
petroleum-hydrocarbons dissolved in the aqueous-phase, contact of the cell with sub-micron oil-droplets, and direct contact of the cell
with the large oil-drops. Accordingly, the physical interaction between bacteria cell and hydrocarbons is possible by the trans-­
membrane transport of petroleum-hydrocarbons. Microbial cells have resources to access the soluble, emulsified
petroleum-hydrocarbons, and large oil-droplets, and they also transport these substrates across the membrane and form inclusions of
the hydrocarbons before they can be metabolised [10,11].

4.3. Molecular characterisation of efficient petroleum-hydrocarbon degraders

The strain identification based on the 16S rDNA gene sequence analysis was used to confirm the organism and it indicated that the
bands of all the DNA samples from the isolates were sharp and there was no contamination or degradation of the genomic DNA. On
alignment of the obtained 16S rDNA sequence data, comparison with the data-based-sequences deposited in the NCBI Gene Bank and
phylogenetic analysis, the identified bacteria isolates are as follows: AZ1 were Paenalcaligenes suwonesis with accession number MK-

11
E.C. Omenna et al. Heliyon 9 (2023) e15639

5037212.1 (98% similarity), OT1 and OL1 were Lactobacillus fermentum with accession number NR-104927.1 (96.7% similarity), while
BN3 were Lactobacillus nagelii with accession numbers NR-158108.1 (91.3% similarity). The phylogenetic analysis revealed that most
of the isolates had the same phylogeny and putatively categorized the isolates from OT1 and OL1 in close association as belonging to
same homology while BN3 isolate is a subgroup. For instance, OL1 and OT1 were the same lactobacillus fermentum while BN3 was
Lactobacillus nagelii. Lactobacillus is a genus of gram-positive, facultative anaerobic or micro-aerophilic, rod-shaped, non-spore-
forming bacteria. They are major parts of the lactic-acid bacteria groups which convert sugars to lactic-acids. However, the AZ1
strain, Paenalcaligenes suwonesis was the only gram-negative bacteria. Paenalcaligenes suwonesis is a non-spore forming and aerobic
flagellated rod. The genus Paenalcaligenes was proposed as part of the Alcaligenaceae family and a class of betaproteobacteria [40].
Paenalcaligenes suwonesis was a novel bacteria species first discovered in the Suwon region of the Republic of Korea [40]. The
phylogenetic relationship of the four bacterial strains from different locations in the Niger Delta region of Nigeria showed that there
was evolutionary relationship with other strains from elsewhere in India and China. The analysis also revealed that there was a major
cluster or close lineage between AZ1 strain and those bacteria found in India as shown in the tree diagram.
BLASTn analysis showed that the sequence retrieved from the analyzed AZ1 strain has similarity with the DNA-sequence data from
Paenalcaligenes suwonesis isolated from a variety of soils, chicken manure, spent mushroom compost and underground water. Also, the
sequence from OT1 and OL1 strains share similarity with the DNA-sequence data from Lactobacilli fermentum isolated from a variety of
fermented traditional foods, fermented cereal foods, gruel ogi, milk koko, African soft cheese, garri, oil bean seed and soy daddawa,
while the sequence from BN3 strain aligned with the data from Lactobacilli nagelii isolated from a variety of water, fruit, coconut shake,
vegetables, and sugarcane. However, the Alcaligenes’ phylogenetic tree revealed that the DNA sequence obtained from AZ1 strain-
MK5037212.1 in this study was closely-related to MF-769402- P. suwonesis previously found in the soil in India, while OT1 and
OL1 strain-NR-104927.1 obtained from this study was closely related to JN944733- Lactobacillus fermentum previously found in
Nigerian fermented cereal foods and that of BN3 strain-NR-158108.1 was closely related to MG976652- Lactobacillus nagelii previously
found in coconut shake.
Comparative sequence analysis revealed that the highest homology of the three Lactobacilli belong to the same sub-clade. This
suggests possible monophyletic origin of each isolate from Otukpoti, Ologbo and Benin City while AZ1 strain (from Azikoro) appeared
to be a different bacterium with the highest oil-degrading potential. Further bioinformatics on the database revealed that the sequences
amplified from OT1, OL1 and BN3 strains could be clustered into a single and well-supported clade.

4.4. Growth of petroleum hydrocarbon degraders on different treatment media

In all the bio-augmented treatments, the growths of the isolates positively correlate with the hydrocarbon degradative capacities of
the bacteria and this was in the order: Paenalcaligenes suwonesis > Lactobacillus Fermentum > Lactobacillus nagelii. However, other
researchers discovered that there was 81.45% degradation for 1% (v/v) crude-oil with the consortium of Lactobacillus sp., Acidocella
sp., and Rhodococcus sp. within 7–25 days of incubation [41]. This present study observed that the bacteria growth was significantly
higher at the 90th day than other days. Our findings show that the decreasing trend of bacteria growth was: AZ1T6 > OL1T6 > OT1T6
> AZ1T2 > T4 > BN3T2 > BN3T6 > T3 > T5 > OT1T2 > OL1T2 > OL1T1 > OT1T1 > BN3T1 > T7. To a large extent, the data from this
present study strongly supported the previous reports which stated that the presence of micro-organisms together with the appropriate
metabolic-capacities was the major requirement in bio-remediation of oil spill. The micro-organisms which are inadvertently exposed
to petroleum-hydrocarbons spill become adapted and exhibited higher degradation than those micro-organisms without history of
petroleum-hydrocarbon contamination [42]. The results from this study showed that majority of the hydro-carbonoclastic isolates
were identified to be Alcaligenes and Bacillus species. This observation is in strong support of the report by Prakash et al. [43], which
indicated that the bacteria, Bacillus sp. and Micrococcus sp. have higher degradative ability, stronger cell envelope and can easily
proliferate both soil and water environment polluted with petroleum hydrocarbons (PHC). Moreover, Prakash et al. [43], stated that
the trait of bacterially-synthesized catabolic enzymes possessed by Bacillus sp. enabled them to grow and degrade the xenobiotic- or
recalcitrant-compounds. These catabolic enzymes make the bacteria strains well-equipped to survival in adverse environments [43].

5. Conclusion

Paenalcaligenes suwonesis from Azikoro, Bayelsa State; Lactobacillus fermentum from Otukpoti, Bayelsa State; Lactobacillus fermentum
from Ologbo, Edo State and Lactobacillus nagelii from Benin City, Edo State, Nigeria, were the efficient oil-degraders obtained from the
crude-oil polluted soils in the Niger Delta region of Nigeria. The bacteria isolates were hydrocarbonoclastic and are potential can­
didates for remediation of hydrocarbon pollution.

Author contribution statement

Emmanuel Chukwuma Omenna, Marshall Arebojie Azeke: Conceived and designed the experiments; Performed the experiments;
Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.
Kingsley Omage: Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.
Emmanuel Ezaka: Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or
data.

12
E.C. Omenna et al. Heliyon 9 (2023) e15639

Data availability statement

Data included in article/supplementary material/referenced in article.

Additional information

No additional information is available for this paper.

Funding

This research was self-funded by the authors.

Ethics approval

The ethical approval for this research was obtained from the Research Ethics Committee of the Department of Biochemistry,
Ambrose Alli University, Ekpoma Nigeria.

Acknowledgements

We acknowledge the Department of Biochemistry, Ambrose Alli University, Ekpoma for providing the necessary laboratory
facilities.

Appendix A. Supplementary data

Supplementary data related to this article can be found at https://doi.org/10.1016/j.heliyon.2023.e15639.

References

[1] R.C. Prince, Petroleum and other hydrocarbons biodegradation, in: Encyclopedia of Environ Microbiol, 2002, pp. 66–74.
[2] O.G. Erifeta, E.G. Eriyamremu, K. Omage, K.H. Njoya, Alterations in the bio-membrane of libyodrilus violaceus following exposure to crude oil and its fractions,
Int. J. Biochem. Res. Rev. 20 (2017) 1–11, https://doi.org/10.9734/IJBCRR/2017/37256.
[3] V.S. Cerqueira, M.C.R. Peralb, F.A.O. Camargo, F.M. Bento, Comparison of the bioremediation strategies for soil impacted with petrochemical oily sludge, Int.
Biodeterior. Biodegrad. 95 (2014) 338–345.
[4] R.M.M. Abed, S. Al-kharusi, M. Al-Hinai, Effects of biostimulation, temperature and salinity on the respiration activities and bacteria-community composition in
an oil polluted desert soil, Int. Biodeterior. Biodegrad. 98 (2015) 43–52.
[5] B.G. Sullivan, G.R. Gary, G.R. Krieger, The Clinical, Environmental Health, and the Toxic Exposure, second ed., Lippon Cott Williams and Wilkins, USA, 2001.
[6] H. Pathak, K. Bhatnagar, D.P. Jaroli, Physico-chemical properties of petroleum polluted soil collected from transport nagar (jaipur), J FALS 1 (2011) 84–89.
[7] M.C. Onojake, L.C. Osuji, The assessment of the physico-chemical properties of hydrocarbon Contaminated Soil, Arch. Appl. Sci. Res. 4 (2012) 48–58.
[8] A.B. Al-Hawash, L.A. Drag, A. Alhujaily, H.A. Abbood, X. Zhang, F. Ma, Principles of the microbial degradation of the petroleum-hydrocarbons in the
environment, Egyptian Journal of Aquatic Research 44 (2018) 71–76.
[9] X. Qin, J. Tang, D. Li, Q. Zhang, The effect of salinity on the bioremediation of petroleum-hydrocarbons in alkaline soil, Lett. Appl. Microbiol. 55 (2012)
210–217.
[10] R.R. Kalantary, A. Mohseni-Bandpi, A. Esrafili, S. Nasseri, F.R. Ashmagh, S. Jorfi, M. Ja’fari, The effectiveness of the biostimulation through nutrient addition on
the bioremediation of phenanthrene-contaminated soil, Iran. J. Environ. Health Sci. Eng. 12 (2014) 143.
[11] A. Ebadi, N.A. Khoshkholgh-sima, M. Olamaee, M. Hashemi, N.R. Ghorbani, Effective bioremediation of the petroleum-hydrocarbon polluted saline soil by
surfactant –producing Pseudomonas aeuroginosa Consortium, J. Adv. Res. 8 (2017) 627–633.
[12] S. Bisht, P. Pandey, B. Bhargava, S. Sharma, V. Kumar, K.D. Sharma, The bioremediation of polycyclic-aromatic-hydrocarbons (PAHs) using rhizosphere
Technology, Braz. J. Microbiol. 46 (2015) 7–21.
[13] R. Pawar, Effect of the soil pH on bioremediation of polycyclic-aromatic hydrocarbons (PAHS), J. Biorem. Biodegrad. 2 (2015) 5–10.
[14] G. Zafra, A.E. Absalón, D.V. Cortés-Espinosa, The morphological changes and growth of filamentous fungi in the presence of high concentrations of PAHs, Braz.
J. Microbiol. 46 (2015) 937–941.
[15] L. Meng, H. Li, M. Bao, P. Sun, The metabolic pathway for the new strain, Pseudomonas synxantha LSH-7’: from the chemo-taxis to the uptake of n-hexadecane,
Sci. Rep. 7 (2017), 39068.
[16] V. Balaji, P. Arulazhagan, P. Ebenezer, Enzymatic bioremediation of polycyclic-aromatic hydrocarbons by the fungal consortia enriched from petroleum
contaminated soil and oil seeds, J. Environ. Biol. 35 (2014) 521.
[17] S. Mineki, K. Suzuki, K. Iwata, D. Nakajima, S. Goto, The degradation of Polycyclic-aromatic hydrocarbons by fungi isolated from soil in Japan, Polycycl.
Aromat. Comp. 35 (2015) 120–128.
[18] R.M. Atlas, The petroleum biodegradation and oil spill bioremediation, Mar. Pollut. Bull. 31 (1995) 178–182.
[19] M. Wu, A.D. Warren, L. Wei, W. Xiaochang, Y. Qian, W. Tingting, The bioaugmentation and biostimulation of petroleum-hydrocarbon degradation and the
microbial community in petroleum-hydrocarbon contaminated soil, Elsevier International biodeterioration and biodegradation 107 (2016) 158–164.
[20] S.A. Churchill, R.A. Griffin, L.P. Jones, P.F. Churchill, Biodegradation rate, and enhancement of hydrocarbons by an oleophilic fertilizer and rhamnolipid
biosurfactant, J. Environ. Qual. 24 (1995) 19–28.
[21] W. Bhoosreddy, Manual of Diagnostic Microbiology, Himalaya Publishing House, Bombay, India, 1995.
[22] J.G. Holt, N.R. Krieg, P.H.A. Sneath, J.T. Stanley, S.T. William, The Bergey’s Manual on the Determination of Bacteria, 1994, pp. 53–56. Baltimore, MD, USA.
[23] P.F. Churchill, S.A. Churchill, Isolation-and characterization of Mycobacterium sp. capable of degrading three- and four-rings aromatic-and aliphatic-
hydrocarbons, Appl. Environ. Microbiol. 65 (1999) 549–552.
[24] P.J. Marquez-Rocha, V. Hernandez-Rodriguez, M.T. Lamela, Biodegradation of diesel oil in soil by a microbial consortium, Water Air Soil Pollut. 128 (2001)
313–320.

13
E.C. Omenna et al. Heliyon 9 (2023) e15639

[25] F.A. Al-Dhabaan, Morphological, biochemical and molecular identification of petroleum -hydrocarbon-degrading-bacteria isolated from oil polluted soil in
Dhabran, Saudi Arabia, Saudi J. Biol. Sci. 26 (2019) 1247–1252.
[26] J. Sambrook, D.W. Russell, The Molecular Cloning: a Laboratory Manual, Vol. 2, third ed., Cold Spring Harbor Laboratory Press, New York, 2001.
[27] A. Kindworth, E. Pruesse, T. Schweer, Evaluation of the general 16S ribosomal RNA-gene with PCR primers for Classical and the next-generation sequencing-
based-diversity studies, Nucleic Acids Res. 41 (2013) 1–7.
[28] K. Tamura, J. Dudley M. Nei S. Kumar, Mega 6: molecular evolutionary genetics analysis (MEGA) software version 6.0, Mol. Biol. Evol. 24 (2012) 1596–1599.
[29] S.F. Altschul, T.L. Maden, A.A. Schaffer, J. Zhang, W. Millr, D.J. Lipmann, Gapped BLAST and the new generation of protein database search programs, Nucleic
Acids Res. 25 (1997) 3389–3402.
[30] M.N. Bellon-Fontaine, J. Rault, C.J. Van-Oss, Microbial adhesion to solvents: a novel-method to determine the electron-donor/electron-acceptor or Lewis acid-
base properties of microbial cells, Science Direct Elsevier 7 (1996) 47–53.
[31] V.K. Anna, A.D. Anna, S.I. Denis, L.B. Nataliya, F.F. Rawil, A.Z. Yuri, S.B. Vladimir, R.Y. Dina, Assessment of resistance and bioremediation ability of
Lactobacillus Strains to lead and cadmium, Hindawi Int’l Journal of Microbiology 7 (2017) 1–7.
[32] D.C. Vuono, B. Lipp, C. Staub, E. Loney, Z.R. Harrold, J.J. Grzymski, A real-time multiplexed microbial growth intervalometer for capturing high-resolution
growth curves, Front. Microbiol. 10 (2019) 1135, https://doi.org/10.3389/fmicb.2019.01135.
[33] N. Ali, K.M. Dashti, H. Al-Awadhi, S. Radwan, Bioremediation of the soils saturated with spilled crude oil, Scientific Reports in Nature Research 10 (2020) 1–9.
[34] J. Lian, J. Wu, Y. Ha, X. Jia, Effect of cotton on several enzymatic activities of the petroleum contaminated soil, Environ. Protect. Eng. 39 (2013) 163–182.
[35] A. Ziolkowska, M. Wyszkowski, Toxicity of petroleum substances to micro-organisms and plants, Eco. Chem. Eng. S. 17 (2010) 73–82.
[36] J. Sikkema, J.A.M. De-Bont, B. Poolman, Mechanism of membrane toxicity of hydrocarbons, Microbiol. Rev. 59 (1995) 201–222.
[37] S.K. Panda, R.N. Kar, C.R. Panda, Isolation and Identification of the petroleum hydrocarbon degrading micro-organisms from oil contaminated environment, Int.
J. Environ. Sci. 3 (2013) 1314–1319.
[38] E.L. Tarabily, A. Khalid, The total microbial activity and the microbial composition of a Mangrove-sediment were reduced by oil pollution at the Arabian Gulf
KA El-Tarabily, Can. J. Microbiol. 48 (2002) 176–182.
[39] F. Hua, H.Q. Wang, The uptake and trans-membrane transport of the petroleum- hydrocarbon by micro-organisms, Biotechnol. Biotechnol. Equip. 28 (2014)
165–175.
[40] J.Y. Moon, J. Lim, J. Ahn, H. Weon, S. Kwon, S. Kim, Paenalcaligenes suwonesis sp. novel, from spent mushroom compost, Int. J. Syst. Evol. Microbiol. 64 (2014)
882–886.
[41] K. Sayed, L. Baloo, N.K. Sharma, Bioremediation of the total petroleum hydrocarbon by bioaugmentation and biostimulation in water floating with oil-spill
containment Booms as a Bioreactor-basin, Int. J. Environ. Res. Publ. Health 18 (2021) 2226–2253.
[42] A. Prakash, S. Bisht, J. Sing, P. Teotia, R. Kela, V. Kumar, The biodegradation potential of the petroleum hydrocarbons by bacteria and mixed bacteria consortia
from contaminated sites, Turk. J. Eng. Environ. Sci. 38 (2014) 41–50.
[43] A.D. Venosa, K. Lee, M.T. Suidan, S. Garcia-Blanco, S. Cobanli, M. Moteleb, J.R. Haines, G. Tremblay, M. Hazelwood, Bioremediation and biorestoration of the
crude oil contaminated freshwater wetland on the St Lawrence River, Ann. Finance 6 (2002) 1–5.

14