Volume 21, Number 2 ISSN 1595-6938

June, 2021

NISEB JOURNAL

Journal of Society for Experimental

Biology of Nigeria

KLOBEX
 NISEB Journal
Journal of the Society for Experimental Biology of Nigeria
EDITOR-IN-CHIEF
Prof. C.C. Osubor. Dept of Biochemistry, Faculty of Life Sciences, University of Benin, Benin City

EDITOR
Dr. A.M. Petu Ibikunle. School of Science & Technology, National Open University of Nigeria, Lagos

ASSOCIATE EDITORS
Prof. E.C. Onyeneke, Department of Biochemistry, University of Benin, Benin City, Nigeria
Prof. (Mrs.) Joy Okpuzor, Department of Cell Biology & Genetics, University of Lagos, Lagos, Nigeria
Dr. S.M.C. Ezeukwu, Microbiology Division, Nigerian Institute of Medical Research, Yaba, Lagos, Nigeria
Prof. G.O. Anoliefo, Department of Plant Biology & Biotechnology, University of Benin, Benin City,
Nigeria

EDITORIAL ADVISORY BOARD

Y.A. Abayomi (Ilorin)
K.O. Adekoya (Lagos)
E.Y. Aderibigbe (Ado-Ekiti)
O. Adeyemi (Effurun)
T. Akpovughaye (Anyigba)
E.S. Omoregie (Benin)
A.H. Arzai (Kano)
F. Awoleye (Malete)
A.A. Bakare (Ibadan)
E.U. Edosomwan (Benin)
G.N. Elemo (Lagos)
K.I.T. Eniola (Ikeji-Arakeji)
J. Kayode (Ado-Ekiti)
O.T. Mustapha (Ilorin)
F.A. Oladele (Ilorin)
S.E. Omonigho (Benin)
C.O. Usifoh (Benin)
S.B. Olaleye (Ibadan)
G. Olaoye (Ilorin)
F.J. Olorunniji (Glasgow)
G.P. Oyeyiola (Ilorin)
A.I. Raji (South Africa)
M.T. Yakubu (Ilorin)
F.O. Ekhaise (Benin)

AIM AND SCOPE

The journal will publish original research papers in the fields of modern experimental biology. Reviews,
hypotheses and comments will also be considered for publication. The overriding criteria for publication
are originality, high scientific quality and interest to a multi-disciplinary readership.

SUBSCRIPTION INFORMATION
NISEB Journal is published quarterly by the Society for Experimental Biology of Nigeria. For libraries,
University Departments, Research Institutes and other multi-reader Institutions, the subscription rate for
Volume 21 (2021), No 2 issue is £50/$80/N20,000, including postage, packing and handling.
Specially reduced subscription rates: In order to maximize the dissemination of the scholarly articles
published in this journal, individuals are encouraged to take a personal subscription to the journal at a
specially reduced rate of N2,500 or equivalent per copy + N500 for ordinary postage or N6,000 for postage
by courier.

Subscription enquiries should be addressed to:

Society for Experimental Biology of Nigeria, c/o Department of Biochemistry, University of Benin, Benin
City.

© 2021 Society for Experimental Biology of Nigeria

All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted, in any
form or by any means, electronic, electrostatic, magnetic tape, mechanical, photocopying, recording or otherwise,
without the prior written permission of the publisher, Nigerian Society for Experimental Biology, Department of
Biochemistry, University of Ilorin, Ilorin, Nigeria.
It is a condition of publication that manuscripts submitted to this journal have not been published and will not be
simultaneously submitted or published elsewhere. Upon acceptance of the article, the author(s) will be requested to
transfer copyright for the article to the publisher. Such transfer will encourage the widest possible dissemination of
information.
 NISEB JOURNAL
Volume 21, Number 2 Contents June, 2021

Antibiotic Susceptibility Pattern of Airborne Bacterial Isolates in Public Schools in Benin 35

City, Nigeria
Ologbosere, O. A., Ukpebor, E. E and Ekhaise, F.O

Screening of Bacteria and Fungi Associated with some Agricultural Wastes for Cellulase 44
Production in Akure, Nigeria
Olukunle, O. F.

Incidence and Antibiotics Susceptibility of Airborne Bacterial Isolates in Three Hospital 53

Environments in Benin City, Nigeria
Idemudia, I.B*. and Ekhaise, F.O.

Melatonin Mitigates Sodium Fluoride-Induced Hormonal Imbalance, Oxidative Stress, 61

Seminal Fluid Alteration and Seminiferous Tubule Cytoarchitecture in Rats
Imam Abubakar Lekan, Okesina Akeem Ayodeji, Sulaimon Fatimo Ajoke, Ibiyeye Ruqayyah
Yetunde, Oyewopo Adeoye Oyetunji, Biliaminu Sikiru Abayomi, Abdulkareem Rukayat
Abiodun, Omoola Olasheu Oluwatosin and Salihu Moyosore Ajao
iv
 Ologbosere et al.

NISEB Journal Vol. 21, No. 2. June, 2021 1595-6938/2021

Printed in Nigeria (2021) Society for Experimental Biology of Nigeria
http://www.ojs.klobexjournals.com/index.php/nisebj

Antibiotic Susceptibility Pattern of Airborne Bacterial Isolates in Public

Schools in Benin City, Nigeria
Ologbosere, O. A.1*., Ukpebor, E. E2 and Ekhaise, F.O.1
1
Applied Environmental Bioscience and Public Health Research Group, Department of Microbiology, Faculty
of Life Sciences, University of Benin, Benin City
2
Department of Chemistry, Faculty of Physical Sciences, University of Benin, Benin City

Abstract
Air is the most important component in our environment needed to sustain life. Indoor air quality of schools is
critical in any given society for the wellbeing of living components. This study was aimed at investigating the
antibiotic susceptibility pattern of airborne bacterial isolates from classrooms (Primary 1, 3 and 5) in three
Public Primary School environments in Benin City. Indoor air samples were collected in triplicates using the
Settle Plate Method. The isolates were identified using molecular techniques methods and subjected to
antibiogram. The multiple antibiotic resistance and multiple drug resistance pattern, plasmid profiling and
curing were evaluated. Fourteen (14) airborne bacterial isolates were identified to include Bacillus
aryabhattai, Arthrobacter nicotianae, Pontibacter rhizospherae, Bacillus aereus, Exiguobacterium
profundum, Bacillus cereus, Pontibacter korlensis, Vagococcus fluvialis, Arthrobacter arilaitensis,
Exiguobacterium acetylicum, Alcaligenes faecalis, Bacillus stratosphericus, Bacillus subtilis and Bacillus
pumilus. Gram-positive bacteria were more prevalent, having a percentage frequency of 66.67 compared to
33.33 % observed of the Gram-negative isolates. Bacillus aerius and Arthrobacter arilaitensis were found to
be resistant to all antibiotics tested. All bacterial isolates were reported to possess high MAR index above the
permissible limit of 0.20, an indication that the bacteria are of public health consequence. It is evident that the
public school environments assessed are prone to outbreak of diseases arising from poor quality of air and
other compromised factors that would influence quality of the wellbeing of the occupants. It is therefore
recommended that adequate public health measures are required to mitigate the menace of poor air quality.
Keywords: Airborne bacteria, Antibiotics, Benin City, School, Season

Introduction
Air is an active system that consists of bioaerosols and particulate matter. These bioaerosols are dependent on
a number of factors such as: the number of occupants and their activities, outdoor air, structure of the building,
materials and furniture present in the building [1]. Microbial contamination is also affected by the resultant
aerosol generation and degree of ventilation. The safety of the indoor/outdoor environment should be a
question of importance to every individual [2].
Indoor air quality is a major determinant of human health and comfort as airborne bacteria contributes to
indoor air pollution [3]. Most people live indoors: in houses, offices, schools, colleges and hospitals where
they are exposed to a number of environmental conditions that affects their health status. Microbes are
ubiquitous in nature and are found in the indoor and outdoor environments and high levels of their presence
can result in adverse health effects particularly respiratory problems, sick building syndromes [4, 5, 6].
The quantity of microorganisms in a particular area depends upon the presence of water and other nutrient
sources in that particular environment, where they can develop extensively. The type of species and amount of
organisms present depends on the relative humidity, temperature, lighting and food available in that particular
environment [7]. Indoor air quality is a major factor that affects the health, wellbeing and productivity of
people and this is affected by the presence microbes such as bacteria, moulds and viruses [8,9]. People spend
about 80% - 90% of their time in indoor environments [10, 11] by breathing an average of 14 m3 of air per
day [12]. Millions of school-age children are affected by serious yet easily treatable and preventable illnesses,
which inhibit their ability to learn across the developing world. Particularly, school children are at risk due to
neglect of basic personal hygiene . The results in terms of morbidity and mortality are also more severe in
them compared to adults. The increased problem of communicable diseases among school children due to
poor hand washing practices and inadequate sanitary conditions remains a concern on the public health agenda
in developing countries. The air just like clean potable water is supposed to be human birthright but a
contaminated air with pathogenic microbes in the form of aerosolized droplets in the indoor environment is
injurious to health.
The resistance of bacteria to antibiotics is of serious threat to humans. Scientist discovered that bacteria mainly
commensals, serve as carriers and as reservoirs of genes responsible for antibiotic resistance and these genes
are similar to the resistance genes that are present in human pathogens [13,14,15,16]. Commensal bacteria
*Corresponding Author's E-mail: oluwabunmi.ologbosere@uniben.edu
35
 Ologbosere et al.

which serves as reservoir organisms, help to transfer genes responsible for resistance to pathogenic bacteria
and this poses a major threat in antibiotic resistance [14, 17, 18, 19]. Bacterial resistance to antimicrobials is a
genetic phenomenon caused by genes within the organisms that encode different biochemical mechanisms and
prevent the action of these drugs [20, 21]. Nowadays, both in developed and developing countries,
antimicrobial resistance is a concern and an epidemiological problem [22]. This study was aimed at
investigating the incidence and antibiotic susceptibility pattern of airborne bacterial isolates in three public
Primary Schools environments in Benin City, Nigeria.

Materials and Methods

Study Sites
The study was carried out in Benin City, Oredo Local Government Area. Benin City is located on longitude
600 20‘ 0‖ North, latitude 050 38‘ 0‖ East with a mass of 19,794 km2. It has a population of about 1, 147, 188
people.
Sample collection/procedure
Airborne bacterial samples were collected using the Passive Air Sampling Technique, the Settle Plate Method
using 90 mm diameter of Petri dishes. The sampling height was 1 m above the floor. Samples were collected
from Classrooms (Primaries 1, 3 and 5) in triplicates from three (3) selected Government owned Primary
Schools in Benin City. The three (3) Public Schools were identified as Schools A, B and C. The sampling was
carried out once daily and on a monthly basis across wet and dry seasons (May, 2018 - September, 2018 for
wet season and October, 2018 - March, 2019 for dry season).
Molecular Identification of Airborne Bacterial Isolates
Freshly grown airborne bacterial isolates were harvested and used for the determination of the DNA
composition. DNA was extracted according to the methods described by Chakravorty [23]. Briefly, 2 ml of 24
h. broth culture was transferred to Eppendorf tube and centrifuged at high speed (10,000 xg) for 5 min. The
supernatant was discarded after which 200 µl of sterile distilled water (SDW) was added to the pellets and
vortexed using a vortex mixer for 1 min before it was heated at 100 0C for 15 mins. Finally, it was thereafter
centrifuge at high speed for 2 min. The supernatant from the second spin was now regarded as the pure DNA
and from which, 10 µl of DNA was used for amplification of the gene by PCR. Successful amplification of the
genomic bacterial DNA was made possible using the 27F universal primer with the sequence 5'-
AGAGTTTGATCMTGGCTCAG and the 1540R primer with the sequence 5'-
TACGGYTACCTTGTTACGACT-3‘.
Polymerase chain reaction (PCR)
The cocktail, used for the preparation of PCR procedure consists of a colourless reaction containing mixtures
of 10 µl of 5xGoTaq, 1 µl of dNTPs mix (10 mM), 3 µl MgCl 2 (25mM), 1µl of 10pmol each 27F-5'-
AGAGTTTGATCMTGGCTCAG-3‘ and - 1540R, 5′- TACGGYTACCTTGTTACGACT-3′ primers as well
as 0.3 units of Taq DNA polymerase, which was made up to 42 µl containing 8 μl of DNA template (Taq
DNA polymerase was from Promega, USA) and SDW (sterile distilled water). PCR experiment was
performed using a PCR System, GeneAmp 9700 thermal cycler (USA by Applied Biosystem Inc.). The profile
for PCR used, consists of initial denaturation for 5 min at 94 0C; closely or briefly accompanied by a 30 cycle,
of 940C for 30 s, 500C for a minute and 720C for a minute and 30 seconds; and a final step of termination for
10 min at 720C. After the aforementioned processes, the product was kept in the refrigerator at 4 0C until ready
for use.
Amplified DNA Integrity
The purity of the 1.5Mb amplified DNA fragment was confirmed on agarose gel (1 %). 1 x TAE buffer was
used in the preparation of 1.5 % agarose gel whose mixture was boiled for 5 min in a microwave. It was
thereafter left to cool to about 450C (a molten state) before it was stained with 3 µl of ethidium bromide (0.5
g/ml), which transmits energy as a visible orange light after it has absorbed invisible UV light. Molten agarose
was poured into the casting tray slots after a comb was inserted into the slots. The gel was left to stand for 20
min to allow for solidification to form the wells. Into the gel tank, the 1 XTAE buffer was poured into the tank
of the gel to submerge it. A loading dye of 2 µl quantity (10 X blue gel) was added to 4 µl of each products of
PCR before they were loaded into the wells. The function of the loading dye was to give color and density to
the samples in order to make loading into the wells easy as well as monitoring the progress of the gel. For a
period of 45 min, at 120 V the gel was electrophoresed, then visualized by ultraviolet trans-illumination before
it was thereafter photographed. The amplified PCR product sizes were assessed by comparing their mobility
with that of the molecular weight ladder (100bp), these were evaluated together in the gel with the
experimental samples.
Purifying the Amplified DNA Product
Following integrity of the gel, purification of the amplified bacterial DNA fragments were carried out using
ethanol to remove the PCR reagents in the samples. Momentarily, 240 µl of 95% ethanol and 7.6 µl of 3M
sodium acetate were dispensed in a new sterile 1.5 µl Eppendorf tube to which was added to each 40 µl of the

36
 Ologbosere et al.

amplified PCR product, which was thoroughly mixed using a vortexer and stored for at least 30 min at -20 0C.
It was then centrifuge at 13,000 g for 10 min at 4 0C and the supernatant was briefly removed by inverting
tubes once on thrash. The pellets were thereafter washed via the addition of 150 µl of 70 % ethanol. This was
mixed again before another round of centrifugation at 7500 g and 4 0C for 15 min upon which the supernatants
were removed via the inversion of tubes on tissue paper and left to dry in fume cupboard/hood for about 10-15
min at room temperature. Briefly, 20 µl of SDW was added to resuspend the mixture and stored at -20 0C prior
to sequencing and 1.5 % agarose gel was used to check the integrity of the purified fragment, which was ran
for an hour on a voltage of 110 V. Confirmation of the integrity was carried out as previously described using
a nano-drop of model 2000 from thermo scientific.
Sequencing
Sequencing of the amplified bacterial DNA fragments was carried out using the Genetic Analyzer (Model
3130 x l) sequencer from the Applied Biosystems. The instructions on the manufacturer‘s manual (BigDye
terminator) was strictly followed.
Blasting of Amplified PCR Sequences
Following sequencing of the amplified bacteria DNA, blasting was carried out on the sequences using the
National Centre for Biotechnology Information (NCBI) blast website (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Bacterium with the highest homology chosen and the sequences were deposited in the GenBank
(https://submit.ncbi.nlm.nih.gov/subs/genbank/) to obtain ascension numbers for the isolated bacteria.
Standardization of Bacterial Culture
Standardized bacteria culture were prepared using the method delineated by Bauer et al. (1996) where 0.5 ml
of BaCl2 was added to 99.5 ml of 1% H2SO4. The corresponding turbidity (referred as 0.5 McFarland standard)
was used as control for the turbidity of bacterial suspension prepared via the addition of bacteria colony in a
sterile diluent. More bacterial cells were added to the diluent until the turbidity becomes identical to the 0.5
McFarland standard.
Antibiogram/Antibiotic Susceptibility Testing
The identified colonies of the bacterial isolates were used to determine the susceptibility and resistance of
bacterial isolates, which were subjected to standard antibacterial susceptibility testing (AST) to decipher their
resistance or susceptibility to conventional antibiotics used for treatment within the locality. The standard
antibiotic discs produced by Oxoid, UK, were used to execute the disc diffusion method employed in this
study. For this assay, a freshly grown bacterial culture from 18-24 h, were cultured on MHA. The inoculum
corresponding to 1.5 x 108 cells/ml McFarland standard were streaked using a sterile loop onto the MHA
plates before the introduction of antibiotic discs were added with extreme care to the plates with the aid of a
sterile forceps. The susceptibility results were recorded after incubation for a 24 h period at 37 0C. Following
the standard or rules of AST established in 2017 by CLSI [24], the inhibition zone around each disc (measured
using a meter rule in diameter) was assessed and interpreted based on 2017 CLSI standard as Resistant (R),
Intermediate resistant (I) and Sensitive (S). The antibiotic discs used in the study with their corresponding
codes and concentrations include ceftazidime (30 μg CAZ), amoxicillin/clavulanic acid (30μg AUG),
erythromycin (5μg ERY), ofloxacin (5μg OFL), GEN= gentamycin (10 μg GEN), cefuroxime (30μg CRX),
tetracycline (30μg TET), ceftriaxone (30μg CTR), cloxacillin (5μg CXC)
Determination of Multiple Antibiotic Resistance (MAR) Index of the airborne bacterial isolates
The MAR index is obviously a good tool that identifies the region where the isolates were obtained, whether it
is from a places of high or low risks areas where antibiotics are abused. This tool becomes necessary for health
risk assessment, an index of ≥ 0.2 and above is indicative of a ‗high-risk‘ contamination source. In this study
the MAR index was determined according to the methods of Chitanand [25]. This method employs the use of
percentage of antibiotic resistance being divided by sum of the percentage of total antibiotics used. For cases
where bacterial isolates appear singly, it is usually calculated as ( ) where a = Number of resistant antibiotics;
b = Total number of antibiotics used in the study. It is a general established rule that MAR index greater than
0.2 is indicative of the fact that the bacterium originates from areas where antibiotics have been abused (or
regularly used) or worse still from areas of high-risk source of contamination [26].
Plasmid isolation
Freshly grown cells on Tryptone Soy Broth for 24 h were transferred into 1000 µl Eppendoff tubes and labeled
appropriately. The broth was centrifuged at 14000g to obtain the pellets. To the pellets, 200 µl of buffer P1
was added, 200 µl of buffer P2 was added and mixed to obtain a clear purple and viscous cell. Then 400 µl of
buffer P3 was added and mixed to obtain a supernatant, which was transferred into a zymo-spin column in a
collection tube. The zymospin column collection tube was centrifuged for 30 secs and the flow-through in the
collection tube was discarded. A 200 µl of Endo-wash buffer was added to the column and centrifuged for 30
sec. A 400µl of plasmid wash buffer was added to the column and centrifuged for 1min and was transferred
into a clean 1.5 ml micro centrifuge tube and 30 µl of DNA elution buffer was added to the column and
centrifuged for 30secs to elute the plasmid DNA Agarose gel (0.8 %) was prepared and two drops of ethidium
bromide was added and allowed to gel and 10 µl of the samples mixed with loading dye was loaded into each

37
 Ologbosere et al.

well. The DNA ladder (10 µl) was loaded in the last well. The electrophoresis was allowed to run at 100v for
40min and the bands were visualized with UV trans-illuminator [27, 28].
Plasmid Curing
The bacterial isolates that were multi- drug resistant during antibiotic sensitivity test were subjected to plasmid
curing using 10 % of sodium dodecyl sulphate (SDS). The antibiotic resistant airborne isolates were grown on
tryptone soy broth containing 10 % SDS at 37 0C for 48 h and a loopful was streaked onto Mueller Hinton
agar (MHA) plates. The antibiotic disk was aseptically placed on the inoculated plates and incubated at 37 0C
for 24 h [29].

Results
Fourteen (14) bacterial isolates from six (06) genera were identified to include: Bacillus aryabhattai,
Arthrobacter nicotianae, Pontibacter rhizospherae, Bacillus aereus, Exiguobacterium profundum, Bacillus
cereus, Pontibacter korlensis, Vagococcus fluvialis, Arthrobacter arilaitensis, Exiguobacterium acetylicum,
Alcaligenes faecalis, Bacillus stratosphericus, Bacillus subtilis and Bacillus pumilus. Seven isolates were
selected from each school making a total of 21 isolates. Table 1 shows the identified bacterial isolates and
their accession numbers. The isolates had percentage homology to the closest species within the range of
98.12% to 99.85 %.

Table 1: Molecular identification of the airborne bacterial isolates from the indoor air in the Public Primary
Schools
Sample code Molecular Identity Homology Closest Similarity Accession number
GI-A Bacillus aryabhattai 99.65 Bacillus aryabhattai MN120793
GI-B Arthrobacter nicotianae 98.96 Arthrobacter nicotianae MN120794
GI-C Pontibacter rhizosphera 99.66 Pontibacter rhizosphere MN120795
OGB-A Bacillus aereus 98.73 Bacillus aereus MN120796
OGB-B Exiguobacterium profundum 98.12 Exiguobacterium profundum MN120797
OGB-C Bacillus cereus 99.14 Bacillus cereus MN120798
EMO-A Pontibacter korlensis 99.06 Pontibacter korlensis MN120803
EMO-B Vagococcus fluvialis 99.29 Vagococcus fluvialis MN120804
EMO-C Bacillus cereus 99.65 Bacillus cereus MN120799
GI-D Arthrobacter arilaitensis 99.20 Arthrobacter arilaitensis MN120806
GI-E Exiguobacterium acetylicum 99.70 Exiguobacterium acetylicum MN120805
GI-G Alcaligenes faecalis 99.85 Alcaligenes faecalis MN120807
GI-F Alcaligenes faecalis 99.63 Alcaligenes faecalis MN120800
EMO-D Alcaligenes faecalis 99.63 Alcaligenes faecalis MN120801
EMO-E Alcaligenes faecalis 99.11 Alcaligenes faecalis MN120808
EMO-F Alcaligenes faecalis 98.40 Alcaligenes faecalis MN120809
EMO-G Bacillus stratosphericus 98.67 Bacillus stratosphericus MN120810
OGB-D Exiguobacterium acetylicum 99.04 Exiguobacterium acetylicum MN120811
OGB-E Bacillus cereus 99.00 Bacillus cereus MN120813
OGB-F Bacillus subtilis 99.75 Bacillus subtilis MN120812
OGB-G Bacillus pumilus 99.80 Bacillus pumilus MN120802

The prevalence of bacterial isolates from indoor air in selected Primary Schools is shown in Table 2.
Alcaligenes faecalis was reported as the most prevalent bacterial isolates in this study with a percentage
prevalence of 23.81. Bacillus cereus and Exiguobacterium profundum had prevalence of 14.29 % and 9.52 %
respectively. Other isolated bacterial species in the study had percentage prevalence of 4.76% each.
The prevalence of Gram negative and Gram-positive bacteria from indoor air in the selected Primary Schools
is shown in Table 4. The Gram-positive bacteria were more prevalent in Primary School A (57.14 %) and
Primary School B (100.00 %). Meanwhile, Gram-negative bacteria were found to be most prevalent in
Primary School C (57.14 %). In the entire study, it was observed that Gram-positive bacteria were more
prevalent, with a percentage frequency of 66.67 compared to 33.33 % reported for Gram-negative bacteria
isolates in the study.

38
 Ologbosere et al.

Table 2. Prevalence of airborne bacterial isolates from the indoor air in the Public Primary Schools
Isolates Number Percentage
Alcaligenes faecalis 5 23.81
Exiguobacterium profundum
2 9.52
Arthrobacter nicotianae
1 4.76
Bacillus aryabhattai
1 4.76
Pontibacter rhizosphere
1 4.76
Bacillus cereus 3 14.29
Bacillus subtilis
1 4.76
Bacillus pumilus
1 4.76
Pontibacter korlensis
1 4.76
Bacillus stratosphericus 1 4.76
Arthrobacter arilaitensis 1 4.76
Vagococcus fluvialis
1 4.76
Exiguobacterium acetylicum
1 4.76
Bacillus aerius 1 4.76

Table 3. Prevalence of Gram positive and Gram negative bacteria from the indoor air in the Public Primary
Schools
Primary schools Gram positive (%) Gram negative (%)

Primary School A 4 (57.14) 3 (42.86)

Primary School B 7 (100.00) 0 (0.00)
Primary School C 3 (42.86) 4 (57.14)
Total (%) 14 (66.67) 7 (33.33)

The results of the susceptibility (%) of bacterial isolates from indoor air in selected Primary Schools are shown
in Table 4. Bacillus aerius and Arthrobacter arilaitensis were found to be resistant to all antibiotics used in the
study. Pontibacter korlensis was observed to be susceptible to tetracycline and ofloxacin antibiotics. However,
most of the organisms were found to be resistant to the antibiotics used in the study except for a few such as E.
profundum which was found to be susceptible to gentamicin and ceftazidime.
The results of the multiple antibiotic resistance index of the bacterial isolates are shown in Figure 1. All
identified airborne bacterial isolates were reported to possess values higher than the permissible limit of 0.20.
A. faecalis, E. acetylicum B. aerius and A. arilaitensis were found to have a MAR index of 1.00. Table 5
shows the multiple antibiotics resistance index while Table 6 shows the multiple drug resistance.
The results of the antibacterial susceptibility of airborne bacterial isolates after curing are shown in Table 7.
Most of the isolates were susceptible to the antibiotics used in the study after curing. The percentage of
susceptibility increased after curing for most of the bacterial isolates. Alcaligenes faecalis, Bacillus cereus,
Bacillus aerius, Bacillus stratosphericus and Pontibacter korlensis amongst others had increased susceptibility
percentages after curing.

39
 Ologbosere et al.

Table 4: Antibacterial susceptibility (%) of bacterial isolates from the indoor air in the Public Primary Schools
before curing
Bacterial isolates (n) AUG CAZ CRX GEN CTR ERY OFL TET CXC
A. faecalis (5) 2(40) 2(40) 2(40) 4(80) 2(40) 0(0) 2(40) 2(40) 0(0)
E. acetylicum (2) 0(0) 0(0) 0(0) 1(50) 1(50) 1(50) 1(50) 0(0) 0(0)
A. nicotianae (1) 0(0) 0(0) 1(100) 1(100) 0(0) 0(0) 0(0) 0(0) 0(0)
B. aryabhattai (1) 0(0) 0(0) 0(0) 1(100) 0(0) 0(0) 1(100) 0(0) 1(100)
P. rhizosphera (1) 0(0) 0(0) 0(0) 1(100) 0(0) 1(100) 0(0) 0(0) 0(0)
B. cereus (3) 0(0) 0(0) 0(0) 1(33) 1(33) 1(33) 3(100) 2(67) 0(0)
B. subtilis (1) 0(0) 0(0) 0(0) 0(0) 1(100) 0(0) 0(0) 0(0) 0(0)
B. pumilus (1) 0(0) 1(100) 0(0) 0(0) 0(0) 1(100) 1(100) 0(0) 0(0)
P. korlensis (1) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 1(100) 1(100) 0(0)
B.stratosphericus (1) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 1(100) 0(0)
A. arilaitensis (1) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0)
V. fluvialis (1) 0(0) 0(0) 0(0) 1(100) 0(0) 0(0) 0(0) 0(0) 0(0)
E. profundum (1) 0(0) 1(100) 0(0) 1(100) 0(0) 0(0) 0(0) 0(0) 0(0)
B. aerius (1) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0)
Keys: (n)= number of isolates, CAZ = ceftazidime, AUG= augmentin, ERY= erythromycin, OFL= ofloxacin,
GEN= gentamicin, CRX = cefuroxime, TET = tetracycline,

RESISTANCE INDEX
1.2

0.8

0.6

0.4

0.2

Fig.1: Results of multiple antibiotic resistance index of airborne bacterial isolates

Table 5: RESULTS OF THE MULTIPLE ANTIBIOTICS RESISTANCE INDEX

Isolates RESISTANT ANTIBIOTICS RESISTANCE INDEX
A. faecalis AUG, CAZ, CRX, GEN, CTR, OFL, TET, ERY, CXC 1.00
E. acetylicum AUG, CAZ, CRX, GEN, CTR, OFL, TET, ERY, CXC 1.00
A. nicotianae AUG, CAZ, CTR, OFL, TET, ERY, CXC 0.78
B. aryabhattai AUG, CAZ, CRX,CTR, TET, ERY 0.66
P. rhizosphera AUG, CAZ, CRX, CTR, OFL, TET, CXC 0.78
B. cereus AUG, CAZ, CRX, GEN, CTR, TET, ERY, CXC 0.88
B. subtilis AUG, CAZ, CRX, GEN, OFL, TET, ERY, CXC 0.88
B. pumilus AUG, CRX, GEN, CTR, TET, CXC 0.66
P. korlensis AUG, CAZ, CRX, GEN, CTR, ERY, CXC 0.78
B. stratosphericus AUG, CAZ, CRX, GEN, CTR, OFL, ERY, CXC 0.88
A. arilaitensis AUG, CAZ, CRX, GEN, CTR, OFL, TET, ERY, CXC 1.00
V. fluvialis AUG, CAZ, CRX, CTR, OFL, TET, ERY, CXC 0.88
E. profundum AUG, CRX, CTR, OFL, TET, ERY, CXC 0.78
B. aerius AUG, CAZ, CRX, GEN, CTR, OFL, TET, ERY, CXC 1.00
Keys:CAZ = ceftazidime, AUG= augmentin, ERY= erythromycin, OFL= ofloxacin, GEN= gentamicin, CRX
= cefuroxime, TET = Tetracycline, CXC = Cloxacilllin

40
 Ologbosere et al.

Table 6: Multiple Drug Resistance Profile (MDR)

Isolates RESISTANT ANTIBIOTICS
A. faecalis A, B, C, D, E, F
E. acetylicum A, B, C, D, E, F
A. nicotianae A, B, D, E, F
B. aryabhattai A, B, D, E
P. rhizosphera A, B, D, F
B. cereus A, B, C, D, E
B. subtilis A, B, C, D, E, F
B. pumilus A, B, C, D
P. korlensis A, B, C, E
B. stratosphericus A, B, C, E, F
A. arilaitensis A, B, C, D, E, F
V. fluvialis A, B, D, E, F
E. profundum A, B, D, E, F
B. aerius A, B, C, D, E, F
Key:A - Penicillin ( AUG, CXC), B - Cephalosporins (CAZ, CTR, CRX),
C - Aminoglycocides (GEN), D - Tetracycline (TET), E - Macrolides (ERY)
F- Quinones (OFL)
CAZ = ceftazidime, AUG= augmentin, ERY= erythromycin, OFL= ofloxacin, GEN= gentamicin, CRX =
cefuroxime, TET = Tetracycline, CXC = Cloxacilllin, CTR = Ceftriaxone

Table 7: Antibacterial susceptibility (%) of bacterial isolates from the indoor air in the Public Primary Schools
after curing
Bacterial Isolates (n) AUG CAZ CRX GEN CTR ERY OFL TET CXC
A. faecalis (5) 5(100) 5(100) 4(80) 5(100) 4(80) 4(80) 5(100) 5(100) 4(80)
E. acetylicum (2) 2(100) 2(100) 2(100) 2(100) 2(100) 2(100) 2(100) 2(100) 2(100)
A. nicotianae (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
B. aryabhattai (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
P. rhizosphera (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
B. cereus (3) 2(67) 2(67) 2(67) 2(67) 2(67) 2(67) 3(100) 3(100) 3(100)
B. subtilis (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
B. pumilus (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
P. korlensis (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
B. stratosphericus (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
A. arilaitensis (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
V. fluvialis (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
E. profundum (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
B. aerius (1) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100) 1(100)
Key: CAZ = ceftazidime, AUG= augmentin, ERY= erythromycin, OFL= ofloxacin, GEN= gentamicin, CRX
= cefuroxime, TET = tetracycline,

Discussion
Microbial loads are significantly affected by the presence of human beings in the built environment [30, 31].
The question is how safe is the air in the surrounding environment where one spend much of his/her time?
Indoor environments are fundamental environmental factors which can affect our health negatively [32].
Indoor air quality is a major determinant of human health and comfort as airborne bacteria contributes to
indoor air pollution [3]. The airborne bacterial isolates isolated and identified include the following: Bacillus
aryabhattai, Arthrobacter nicotianae, Pontibacter rhizospherae, Bacillus aereus, Exiguobacterium
profundum, Bacillus cereus, Pontibacter korlensis, Vagococcus fluvialis, Arthrobacter arilaitensis,
Exiguobacterium acetylicum, Alcaligenes faecalis, Bacillus stratosphericus, Bacillus subtilis and Bacillus
pumilus. These isolates fall into three categories of bacteria which are Gram negative rods, Gram positive rods
and Gram positive cocci. Majority of these isolates have also been reported in literatures to be contaminants of
indoor air, howbeit in varying concentrations. Yassin and Almouqatea [33], reported similar bacterial isolates
such as Arthrobacter nicotianae, Vagococcus fluvialis and diphtheroids from indoor and outdoor environment

41
 Ologbosere et al.

in a study carried out in Kuwait. The findings in this study was also similar to the findings by Shahida et al.
[34], also isolated Gram negative rods, Gram positive rods and Gram positive cocci from indoor air in
different Nurseries and Day Care Centres.
Bacillus aerius and Arthrobacter arilaitensis were found to be resistant to all antibiotics used in the study.
Pontibacter korlensis was observed to be susceptible to tetracycline and ofloxacin antibiotics. The findings
about the antibiogram of the isolated bacteria were also in agreement with the report of Chapin et al. [35], who
evaluated the multi-drug resistant nature of airborne bacteria isolated from a concentrated swine feeding
operation. Chapin et al. [35], reported that there were ―high-level multidrug-resistant‖ isolates detected in the
air of swine feeding operation. More closely, was the results by Bragoszewska and Biedron [36] who reported
that multi-antibiotic resistant bacteria of human origin were isolated from indoor air in office buildings. In this
study, it was found that all bacterial isolates evaluated possessed high MAR index above the permissible limit
of 0.20. A. faecalis, E. acetylicum B. aerius and A. arilaitensis were reported to have multiple antibiotic
resistance (MAR) index of 1.00. This indicates that the isolated bacterial isolates are of public health
consequence. More so, it was observed that all isolates were found to possess between 1-3 plasmids.
Alcaligenes faecalis possesses 3 plasmids while Bacillus cereus had one.
Conclusion
The indoor air environment of classrooms is sacrosanct to the wellbeing of the pupils and as such care should
be taken to ensure that clean air be made available via proper ventilation measures in the public schools. More
so, the number of students being admitted into the Public School should be checked so as to prevent
overcrowding of the classrooms and possible spread of multi resistant and pathogenic bacteria amongst school
aged children.

References
[1] Dowes J, Thorne P, Pearce N, Heederick D: Bioaerosol health effects and exposure assessement: Progress
and Prospects. Annals of Occupational Hygiene 47(3):187-200. 2003.
[2] Ekhaise, FO, Isitor, EE, Idehen, O, Emoghene, OA: Airborne microflora in the atmosphere of a hospital
environment of University of Benin Teaching Hospital (UBTH), Benin City. World Journal of
Agricultural Science 6(2):166-170. 2010.
[3] Tambekar DH, Gulhane PB, Bhokare DD: Studies on environmental monitoring of microbial air flora in
the hospitals. Journal of Medical Science 7(1): 67- 71. 2007.
[4] Sheik GB, Rheam AI, Shehri ZS, Otaibi OB: Assessment of bacteria and fungi in air from college of
applied medical sciences at AD-Dawadmi, Saudi Arabia. International Research Journal of
Biological Sciences 4(9): 48-52. 2015.
[5] Hsu SI, Ito K, Kendall M, Lippmann M: Factors affecting personal exposure to thoracic and fine particles
and their components. Journal of Exposure Science and Environmental Epidemiology 22(5): 439-
447. 2012.
[6] Fabian MP, Miller SL, Reponen T, Hernandez MT: Ambient bioaerosol indices for indoor air quality
assessments of flood reclamation. Journal of Aerosol Science 36: 763-766. 2005.
[7] Slawomira M, Dumała D, Dudzinska MR: Microbiological Indoor Air Quality in Polish Schools. Annual
Environmental Protection 15: 231-244. 2013.
[8] World Health Organization (WHO): Guidelines for indoor air quality: Dampness and Mould. Copenhagen,
Denmark 248pp. 2009.
[9] Wamedo SA, Ede PN, Chuku A: Interaction between building design and indoor airborne microbial load in
Nigeria. Asian Journal of Biological Sciences 5:183-191. 2012.
[10] Awad, AH, Farag, SA. An indoor bio-contaminants air quality. International Journal of Environmental
Health Research 9: 313-319.1999.
[11] Ekhaise, FO. Microbes, Man and the Environment: The Constant Interactions. 197 th Inaugural Lecture
Series of University of Benin, Thursday 26 th April, 2018. University of Benin Press, Ekehuan
Campus, University of Benin, Benin City. 107pp. 2018.
[12] Brochu, P, Ducré-Robitaille, JF, Brodeur, J. Physiological daily inhalation rates for free-living individuals
aged 1 month to 96 years, using data from doubly labeled water measurements: a proposal for air
quality criteria, standard calculations and health risk assessment. Human Ecology and Risk
Assessment 12: 675-701. 2006.
[13] Perreten V, Schwarz F, Cresta L, Boeglin M, Dasen G, Teuber M: Antibiotic resistance spread in food.
Nature 389:801–802. 1997.
[14] Igbinosa EO, Obi LC, Tom M, Okoh AI: Detection of potential risk of wastewater effluents for
transmission of antibiotic resistance from Vibrio species as a reservoir in a Peri-urban community in
South Africa. International Journal of Environmental Health Research 3:1–13. 2011.
[15] Igbinosa EO, Obuekwe IS: Evaluation of antibiotic resistant gene in abattoir environment: A concern to
public health. Journal of Applied Sciences and Environmental Management 18 (2):165-171. 2014.

42
 Ologbosere et al.

[16] Igbinosa, EO, Oviasogie, FE. Multiple antibiotics resistant among environmental isolates of
Stenotrophomonas maltophilia. Journal of Applied Sciences and Environmental Management
18(2):255-261. 2014.
[17] Miller RV, Levy SB: Horizontal gene transfer in relation to environmental release of genetically
engineered microorganisms. In pp. 405– 416. Gene transfer in the environment. Eds Levy, S.B.,
Miller, R.V. McGraw-Hill Publishing Company, New York. 1989.
[18] Mathur S, Singh R: Antibiotic resistance in food lactic acid bacteria—a review International Journal of
Food Microbiology 105: 281– 295. 2005.
[19] Lee JC, Kang HY Oh JY et al.: Antimicrobial resistance and integrons found in commensal Escherichia
coli Isolates from Healthy Humans. Journal of Bacteriology and Virology 36(3):133 – 139. 2006.
[20] Aminov RI: Minireview - The role of antibiotics and antibiotic resistance. Environmental Microbiology
11(12):2970–2988. 2009.
[21] Gonzalez-Candelas F, Comas I, Martinez JL, Galan JC, Baquero F: The Evolution of Antibiotic
Resistance. Genetics and Evolution of Infectious Diseases 1: 305-337. 2011.
[22] Chandran A, Hatha AA, Varghese S, Sheeja KM: Prevalence of multiple drug resistant Escherichia coli
Serotypes in a tropical estuary, India. Microbes and Environments 23(2): 153–158. 2008.
[23] Chakravorty S, Helb D, Burday M, Connell N, Alland D: A detailed analysis of 16S ribosomal RNA gene
segments for the diagnosis of pathogenic bacteria. Journal of Microbiological Methods 69 (2): 330-
339. 2007.
[24] Clinical and Laboratory Standard Institute (CLSI): Performance standards for antimicrobial susceptibility
testing; Fifteenth Informational Supplement. Clinical and Laboratory Standard Institute 25(1): 100
– 115. 2017.
[25] Chitanand MP, Kadam TA, Gyananath G, Totewad ND, Balhal DK: Multiple antibiotic resistance
indexing of coliforms to identify high risk contamination sites in aquatic environment. Indian
Journal of Microbiology 50: 216-220. 2010.
[26] Krumpernam PH: Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources
of fecal contamination of foods. Applied Environmental Microbiology 46:165-170. 1983.
[27] Crosa JH, Tolmasky ME, Actis LA, Falkow S: Plasmids In: Gerhardt, P., Murray, R.G.E., Wood, W.A
and Kreig, N.R. (editors). Methods for General and Molecular Bacteriology. American Society for
Microbiology, Washington, D.C. pp 365-386. 1994
[28] Daniel EO, Olisaka FN, Umunna OA, Daodu AA, Odeh HO: Plasmid borne resistance among bacteria
isolated from African salads (Abacha). Journals of Advances in Food Science and Technology
3(3):129-133. 2016.
29] Al-Arfaj AA, Abderahim KAA, Yakout SM, Abd-Alrahman SH: (Rapid mini-prep isolation of high
quality small and large plasmids from phytopathogenic Gram negative bacteria. African Journal of
Microbiological Research 7 (15):1415-1420. 2013.
[30] Loftness V, Hakkinen B, Adan O, Nevalainen A: Elements that contribute to healthy building design.
Environmental Health Perspectives 115(6): 965-970. 2007.
[31] Hospodsky D, Qian J, Nazaroff WW, Yamamoto N, Bibby K, Rismani-Yazdi H.. Human occupancy as a
source of indoor airborne bacteria. PLoS One 7:e34867. 2012
[32] Hayleeyesus FS, Manaye AM: Microbiological Quality of Indoor Air in University Libraries. Asian
Pacific Journal of Tropical Biomedicine 4(1): S312-S317. 2014
[33] Yassin MF, Almouqatea S: Assessment of airborne bacteria and fungi in an indoor and outdoor
environment. International Journal of Environmental Science and Technology 7:535-544. 2010.
[34] Shahidah N, Hasnah S, Shuhaili S, Syamzany A, Mohd-Shukri MA: Indoor airborne bacteria and fungi at
different background area in Nurseries and Daycare centres environments. Journal CleanWAS
1(1):35-38. 2017.
[35]Chapin A, Rule A, Gibson K, Buckley T, Schwab K: Airborne multidrug- resistant bacteria isolated from
a concentrated swine feeding operation. Environmental Health Perspectives 113(2):137-142. 2004.
[36] Bragoszewska E, Biedron, I: Indoor air quality and potential health risk impacts of exposure to antibiotics
resistant bacteria in office rooms in Southern Poland. International Journal of Environmental
Research and Public Health 15: 1-17. 2018.

43
 Olukunle, O. F.
NISEB Journal Vol. 21, No. 2. June, 2021 1595-6938/2021
Printed in Nigeria (2021) Society for Experimental Biology of Nigeria
http://www.ojs.klobexjournals.com/index.php/nisebj

Screening of Bacteria and Fungi Associated with some Agricultural Wastes

for Cellulase Production in Akure, Nigeria

Olukunle, O. F.
Department of Biotechnology, Federal University of Technology, P. M. B. 704, Akure, Ondo State, Nigeria

Abstract
In order to properly utilize large amount of agricultural wastes (agrowastes) generated in the environment, a study
was carried out to isolate and identify microorganisms associated with some agricultural wastes in Akure South
Local Government Area of Ondo State, Nigeria. In this study, microorganisms associated with corn cobs and the
peels of cassava, banana and orange were isolated using standard microbiological methods. The bacterial isolates
were identified by morphological and biochemical characterization using the taxonomic scheme of Bergey’s Manual
of Determinative Bacteriology while the fungal isolates were identified based on their microscopic and macroscopic
features. These microorganisms were further screened for their cellulolytic ability using qualitative screening
method. The bacterial load of the agricultural wastes ranged from 4.07 x 10 6 ± 0.24 Cfu/g to 5.90 x 106 ± 0.38 Cfu/g
while the fungal load ranged from 0.53 x 10 6 ± 0.03 Sfu/g to 0.60 x 106 ± 0.06 Sfu/g. There was significant difference
(p ≤ 0.05) in the total viable bacterial and fungal loads of the agrowastes used in this study. Fifteen bacterial and
thirteen fungal isolates were identified with Bacillus subtilis and Rhizopus oryzae being the most predominant
bacterium and fungus having 75% and 50% occurrence respectively. Aspergillus niger and Bacillus larvae had the
best cellulase producing potential. The former and the latter showed the largest zones of cellulase hydrolysis of
50.00 ± 2.3 mm and 36.00 ± 1.2 mm among the bacteria and fungi respectively. These microorganisms could be
harnessed for the conversion of agrowastes into various economic resources such as the production of bioenergy.
Keywords: Agricultural wastes, Microbial loads, Cellulolytic and cellulase production

Introduction
Agricultural wastes, otherwise, known as agrowastes are by-products of agricultural activities. Examples include:
animal waste (manures) and crop residues (residual stalks, shells, stover, fibre, straw, leaves, roots, husks, cobs, etc).
Agricultural wastes are biological materials (biomass) which can be used as feedstocks in industrial processes to
manufacture products through microbial conversion or transformation (1). Biological agents such as microorganisms
and enzymes are used to transform these feedstocks into desirable and valuable products. For instance, the use of
microorganisms to convert agrowastes into methane through fermentation process (2). Agrowastes are important
for their wide availability, renewability, virtually free and good resource. Hence, they can be reutilized as raw
materials for animal feed, composting, bioenergy, etc (3). Various agricultural wastes, for instance, potato, millet
and wheat bran starch are widely used for the production of enzymes (4). However, agrowastes, especially, fruits
and vegetable wastes, constitute a major source of environmental pollution (5), particularly in urban areas where
human population is high and there are no adequate disposal methods on ground (3; 6). The improper disposal of
agrowastes has become a major pollution issue round the globe (7).
Microorganisms play vital role in the decomposition of complex molecules in agrowastes as well as in their
recycling. The agrowastes are suitable substrates for microorganisms, thereby, utilizing them as carbon and nitrogen
sources for their metabolism (8). In nature, microorganisms are known to produce an array of useful enzymes, which
have been exploited commercially over the years for industrial purposes (9). One of these enzymes is cellulase
which is a complex multienzyme system that acts collectively to hydrolyze cellulose from agricultural wastes,
producing simple glucose units (10). Cellulases are synthesized by a large diversity of microorganisms (aerobic,
anaerobic, mesophilic or thermophilic fungi and bacteria) when grown on cellulosic materials (11). Microbial
enzymes have some advantages over plant and animal enzymes because they are easily cultured in large quantities in
a short time. Despite the ubiquitous and abundance of microorganisms in the environment, just a few percentages of
them have the ability to degrade cellulose contained in the agrowastes probably due to its presence in recalcitrant
cell walls of the agrowastes (12). Celluloses are synthesized by cellulolytic fungi such as Chaetomium, Funsarium,
Myrothecium, Penicillium, Aspergillus and Trichoderma species and cellulolytic bacteria such as Bacillus (12).
Agricultural wastes have become an alternative raw material for bioenergy production. Many environmental
problems such as greenhouse gases, pollution of soil, land and air originating from fossil fuels can be solved. The
cost of cellulase imported to the country is very high cost and there is need to encourage the production of this
*Corresponding Author's E-mail: ofolukunle@gmail.com
44
 Olukunle, O. F.
enzyme locally. The agricultural wastes which constitute nuisance to the environment can be utilized to serve as
substrates, thereby reducing the cost of importation and dependence on other countries. In the same vein,
environmental pollution arising from these agricultural wastes can be reduced. In the light of the foregoing, this
study aimed at isolating and identifying microorganisms which are associated with some agrowastes collected from
Akure South Local Government Area of Ondo State with the view to screening them for cellulolytic activity.

Materials and Methods

Collection of samples
One thousand grams each of fresh corn cobs, peels of orange, cassava and banana. were collected aseptically into
sterile cellophane bags and transported to the laboratory of the Department of Microbiology, Federal University of
Technology, Akure from farm and Oba Market in Akure South Local Government, Ondo State, Nigeria. Akure lies
about 70°15 North of the equator and 50°15 East Meridian.
Sterilization of glassware and culture media preparation
All glasswares were washed thoroughly, air dried and sterilized in hot oven at 180 oC for 2 h. Nutrient agar (NA) and
potato dextrose agar (PDA) were prepared according to manufacturer’s specifications while the composition of
mineral salt medium (MSM) in gram per litre was MgSO4 (0.2), K2HPO4 (0.9), KCl (0.2), NH4NO3 (1.0), FeSO4.
7H2O (0.002), ZnSO4 (0.002), agar (15g) and 1% (w/v) carboxymethyl cellulose (CMC). All the media were
autoclaved at 121oC for 15 min and allowed to cool to about 45oC before use.
Lignocellulosic treatment
The lignocellulosic substrates (corn cobs, peels of banana, orange and cassava) were washed in clean water and
oven-dried at 70°C with DHG Heating Drying Oven (Jianqyin Linqlinq Machinery Co., Limited, China) for 2 h,
then milled, sieved with mesh size 40 mm and stored at 4oC in air tight transparent plastic containers to keep it
moisture free (13).
Isolation and enumeration of microorganisms from the agricultural wastes
Six-fold serial dilutions were carried out on each of the treated lignocellulosic samples and pour plated with molten
NA and PDA. Nutrient agar and potato dextrose agar plates were incubated at 37 oC for 24 hours and 28oC for 3 to 5
days for bacteria and fungi respectively in triplicate before examination for microbial growths. Colony count was
carried out on plates (in triplicates) by using colony counter and expressed as colony forming unit for bacteria and
spore forming unit for fungi respectively (14).
Purification and Identification of microbial isolates
Bacterial isolates were purified by streaking on fresh sterile NA before subculturing. Fungal isolates were also
subcultured to get pure isolates. The pure isolates were stored temporarily on slants and kept at 4oC for further use.
Morphological characterization of bacteria
Pure bacterial isolates were Gram and spore stained for Gram reaction and spore formation. Hanging drop method
was used for motility test (14).
Biochemical characterization
The biochemical tests performed on the bacterial isolates were Coagulase, Catalase, Urease, Citrate, Oxidase,
Voges-Proskaeur, Methyl Red, Indole production, Sugar fermentation and Starch hydrolysis. The methods described
by Fawole and Oso (14) were used for all the tests with the exception of Citrate and Indole production, which were
conducted using the methods of Cheesbrough (15). The bacterial identification was based on Bergey’s Manual of
Determinative Bacteriology (16).
Screening of microorganisms for cellulase production
A 24 h old bacterial and 72 h old fungal pure cultures were inoculated aseptically into nutrient broth and potato
dextrose broth, incubated at 37oC for 48 h and 28oC for 48-72 h respectively. Qualitative (plate) screening was done
using mineral salt medium (MSM) supplemented with 1% CMC as carbon source to check for the hydrolysis of the
CMC by the microorganisms. Wells, each of 5 mm (diameter) were made with a sterile cork-borer at the middle of
the freshly prepared agar in different plates and 0.2 mL each of the broth was introduced carefully into the well. The
plates were incubated at 37°C for 48 h and 28oC for 48-72 h for bacteria and fungi respectively, after which they
were observed for clear zone by flooding the plate with 1% (w/v) Lugol’s iodine. The colonies showing clear zones
on the dark background were considered as cellulase-producing bacteria and fungi. The clear zone was measured
using a meter rule. (17).
Statistical analysis: The means ± standard errors (SE) of data were calculated. Significance of difference between
different treatment groups was tested with one-way analysis of variance (ANOVA) using SPSS (Statistical Package
for Social Science) version 20 software. For all tests, the significance was determined at the level of P ≤ 0.05.

Results
Microbial load of agricultural wastes

45
 Olukunle, O. F.
Microbial load of the agricultural wastes are shown in figure 1. It was observed that bacterial loads were higher than
fungal loads in all the agrowastes. There was significant difference (p ≤ 0.05) in the bacterial and fungal loads of the
banana peels, orange peels, cassava peels and corn cobs. The bacterial load of the agricultural wastes ranged from
4.07 x 106 ± 0.24 Cfu/g to 5.90 x 106 ± 0.38 Cfu/g while the fungal load ranged from 0.53 x 10 6 ± 0.03 Sfu/g to 0.60
x 106 ± 0.06 Sfu/g. Bacterial load (5.90 x 106 ± 0.38 Cfu/g) of banana peels was the highest while corn cobs recorded
the lowest fungal load (0.53 x 106 ± 0.03 Sfu/g).
Identities of bacterial isolates from agricultural wastes
Tables 1 and 2 show the morphological and biochemical characteristics of the bacterial isolates and the cultural and
microscopic features of the fungal isolates from the agricultural wastes. Morphological, biochemical and cultural
characteristics of bacterial isolates from the agricultural substrates revealed fifteen (15) bacteria: two (2) species of
Pseudomonas, Serratia and Erwinia, one (1) specie of Proteus and Citrobacter and five (5) species of Bacillus.
They possessed varying abilities to ferment glucose, galactose, sucrose, maltose and lactose (Table 1). The cultural
and microscopic features of the fungal isolates obtained from the tested agricultural wastes revealed thirteen (13)
fungi: four (4) species of Aspergillus, three (3) species of Rhizopus, two (2) species of Fusarium and one (1) species
each of Penicillium, Mucor, Saccharomyces and Varicosporium (Table 2).

Table 1: Morphological and biochemical characteristics of isolates from agricultural wastes

Test 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Cell shape Rd Rd Rd Rd Rd Rd Rd Rd Rd Rd Rd Rd Rd Rd Rd
Gram stain - - - - - - - - - - + + + + +
Spore stain - - ND ND - - - - - - + + + + +
Catalase + + + + + + + + + + + +
Citrate + + + + + + + + + + + - - +
utilization
Urease + - + + + + - - - - - + - - -
VP - - + + - + + - + - + + + + +
MR - - - - + - + + + - - + -
Oxidase + + - - - - - - - - ND ND ND ND ND
Indole - - + - + - - + - - - - - - -
Fermentation
Lactose - + + + - - + + + + - + - - +
Sucrose - ND - + + + + - + + + + + + +
Glucose + - + + + + + + + + + + + + +
Mannitol - - - - - + + + + + - - + - -
Galactose + + - - + + + + + + - - + - -
Fructose - + ND ND - ND ND ND ND ND + + + + +
Maltose - - + + - + + + + + + + + + +
H 2S - + - - + - - + + - - - - - -
Nitrate + + + + + + + + + + + + + + +
reduction
Starch - - - ND ND + + ND + + + - + + +
hydrolysis
65% NaCl ND ND ND ND ND ND ND ND ND ND + ND ND ND ND

Probable P. P. K. K. P. S. S. C. E. E. B. B. B. B. B.
organisms ae flu oxy pne vul mar liq div chr cac sub lar len cer thu

Legend:
P. ae = Pseudomonas aeruginosa
P. flu = Pseudomonas fluorescens
K. oxy = Klebsiella oxytoca
K. pne = Klebsiella pneumoniae
P. vul = Proteus vulgaris
B. sub = Bacillus. subtilis
B. len = B. lentus
S. mar = Serratia marcescens + = Positive
S. liq = Serratia. liquifacens - = Negative
C. div = C. diversus VP = Voges Prokauer
E. chr = E. chrysanthemi MR = Methyl Red
E. cac = E. cacticida ND = Not determined
B. lar = B. larvae
B. cer = B. cereus

46
 Olukunle, O. F.
B. thu = B. thurigiensis

Table 2: Cultural and microscopic features of fungal isolates obtained from the tested agricultural wastes
S/N Cultural and Microscopy description Fungal identities
1. Dark pigment sporangium. Non-septate, thin sporangiophore with Rhizopus stolonifer
sporangium in an umbrella-like form.
2. The culture appeared cream in colour. Hyphae were hyaline and Fusarium sulmorum
septate. Conidiophores were rather short and usually non-septate
when compared to other Fusarium species. The conidiophores had a
somewhat inflated appearance. Conidiophores were produced singly
as they extend from the aerial mycelium.
3. Yellowish green hyphae with branching structures that were slightly Penicillium notatum
elongated and end in clusters of flask-shapes known as phialides,
called conidiospores
4. Stipes were smooth, brown and pigmented, vesicles were globose, Aspergillus
phialide biseriate, conidia were globose, conidial head were dark penicilloides
green and radiate
5 Aseptate hyphae with large diameters, sporangiophores were erect, Mucor mucedo
branched bearing a globose. Appeared grey in colour.
6. Colonies show typical blue-green surface pigmentation. Conidial Aspergillus fumigatus
heads were typically columnar, uniseriate with the phialides limited to
the upper two thirds of the vesicle and curving to be roughly parallel
to each other.
7. Black and powdery colonies. Conidiophores terminate in vesicles, Aspergillus niger
smooth walled, colourless with brownish shades.
8. Creamy, raised, smooth and circular colonies, tiny and shiny. Large, Saccharomyces
globose to ellipsoidal budding yeast like cell or blastoconidia. Hypha cerevisiae
was absent.
9. Conidiophore stipes were hyaline and coarsely roughened, often more Aspergillus flavus
noticeable near the vesicle, conidia were globose to sub globose, pale
green and conspicuously echinulate
10. White cottony at first becoming brownish grey to blackish-grey, Rhizopus oryzae
sporangiophores were non-septate, Sporangia were globose with a
flattened base, greyish black, powdery in appearance.
11. White to pink in colour that turns reddish brown as the culture ages, Fusarium poae
develop clusters of short branched and unbranched mono phialide,
microcornidia were sickle shaped and septate. Chlamydospores were
absent.
12. No distinction between conidia and conidiophores. Conidiophores Varicosporium
were simple, sparingly branched near the apex, bearing apical conidia. elodeae
Each lateral septate were branched, pinkish and fluffy in appearance.
13. Aseptate hyphae with large diameter, thick and cotton wool-like, pin Rhizopus nigricans
head-like visible sporangia. Growth was usually rapid with stolon
development and aerial mycelia usually fill the entire plate. Appeared
back in colour.

Frequency distribution of bacterial and fungal isolates in the agricultural wastes

The distribution of bacterial and fungal isolates in each agricultural wastes are presented in Figures 2 and 3. The
results revealed that Bacillus subtilis was the most dominant bacterium in the agricultural wastes, while Rhizopus
oryzae was the most predominant fungus isolated from the agricultural wastes, Banana peels recorded the highest
number of fungal isolates.

47
 Olukunle, O. F.

Figure 1: Microbial loads of agricultural wastes

Legend:
P = Pseudomonas
K = Klebsiella
B = Bacillus

Figure 2: Occurrence of bacterial isolates in the agricultural wastes

48
 Olukunle, O. F.

Figure 3: Occurrence of fungal isolates in the agricultural wastes

Screening of bacterial and fungal isolates for cellulase production

The result of the screening of microorganisms for cellulolytic ability (Table 3) showed that Bacillus larvae had the
highest cellulose hydrolytic ability with largest zone of 36.00 mm while Proteus vulgaris and Klebsiella
pneumoniae recorded no hydrolytic activity. Screening of the fungal isolates revealed that Aspergillus niger had the
highest cellulose hydrolytic potential with clearance zone of 50.00 mm while the least clearance zone of 14.00 mm
was reported for Mucor mucedo.

Table 3: Test microbial isolates screened for cellulase production

Bacillus. larvae 36.00 + R. stolonifer 34.00 +

Bacillus subtilis 18.00 + Fusarium sulmorum 22.00 +
Bacillus lentus 12.00 + Penicillum notatum 28.00 +
Bacillus cereus 20.00 + Aspergillus 39.00 +
penicilloides
Proteus vulgaris 0 - Mucor mucedo 14.00 +
Klebsiella 0 - Aspergillus fumigatus 40.00 +
pneumoniae
E. chrysantheni 10.00 + Aspergillus niger 50.00 +
E. cacticida 09.00 + Saccharomyces 20.00 +
cerevisiae
C. diversus 17.00 + Aspergillus flavus 26.00 +
S.liquifacens 0 - R. oryzae 18.00 +
S. marcescens 0 - F. poae 19.00 +
Bacillus thuringiensis 0 - V. elodea 25.00 +
Klebsiella oxytoca 0 - Rhizopus nigricans 36.00 +
Pseudomonas 0 -
fluorescens
Pseudomonas 0 -
aeruginosa

49
 Olukunle, O. F.
Discussion
The microbial load obtained in this study showed that agricultural wastes harbour bacteria and fungi but the former
were more than the latter. The presence of these bacteria could be attributed to contamination of the agricultural
wastes by humans during handling, the domestic dumping sites as suggested by Oviasogie and Oviasogie (18) or
could have originated from the soil surrounding the crops (19). High microbial loads in the agricultural peels could
also be attributed to high moisture content and nutrients in these agrowastes (20). These findings are also in
agreement with the reports of Janet and Kelechi (21) and Ebe et al. (22) who isolated microorganisms from maize
cob, wood shave and dump sites.
Organisms identified include: Pseudomonas aeruginosa, Pseudomonas fluorescens, Klebsiella oxytoca, Klebsiella
pneumonia, Proteus vulgaris, Serratia marcescens, Serratia liquifacen, Citrobacter diversus, Erwinia cacticida,
Erwinia chrysantheni, Bacillus subtilis, Bacillus cereus, Bacillus larvae, Bacillus lentus and Bacillus thuringiensis
while the fungal isolates include: Rhizopus stolonifer, Fusarium sulmorum, Penicillium notatum, Aspergillus
penicilloides, Mucor mucedo, Aspergillus fumigatus, Aspergillus niger, Saccharomyces cerevisiae, Aspergillus
flavus, Rhizopus oryzae, Fusarium poae, Varicosporium elodea and Rhizopus nigricans. These microorgansisms
identified in this study, were probably found on the agrowastes because they derive their nutrients and other growth
requirements from them. However, the presence of Pseudomonas aeruginosa was highly uncommon and could have
been as a result of contamination by air or soils (23). This findings conforms with the findings of Adewara and
Ogunbawo (24) and Akinyele et al. (25) who reported names of similar microorganisms isolated from their test
substrates.
The distribution of bacterial and fungal isolates in each agricultural wastes revealed that Bacillus subtilis and
Rhizopus oryzae were the most predominant organisms. This is probably due to the simple nutritional requirements
of these organisms that are readily available in these agrowastes, particularly in the banana and orange peels. In
addition, microbes degrade wastes to generate energy and nutrients for growth; hence a usual consequence of
biodegradation of a compound is an increase in the number of the microorganisms degrading the wastes. This is in
accordance with the previous work done by Adeyemo, (26); and Adewara and Ogunbawo (24).
These microbes release enzymes that help to degrade or breakdown these compounds in the agricultural waste
materials. Microbes produce enzymes like cellulase among others to help in substrate degradation. Secretion of
enzymes by microorganisms have been reported by Chuckwu et al., (20). Most of the isolates with hydrolytic
ability in this study have been reported as cellulase producers but with variable capabilities (27). Qualitative
screening investigations have recorded values closer to what was obtained in this study. Guatam et al. (17) revealed
that 20% of the microorganisms considered in their study were able to show clear zones of inhibition around their
colonies. Their quantitative screening showed Bacillus larvae to exhibit the highest cellulolytic activity. Bacillus
spp. are known to produce cellulase and are the most widely used bacterial framework for cellulase enzyme
production. The wider the clear zone, the greater the zone of inhibition and hence the greater the cellulolytic
activity of the microbial isolates (El-Sersy et al., 28; Guatam et al., 17). The screened isolates were also reported
by Adeyemo et al. (26) and Ezekiel et al. (29) in the screening of bacterial isolates from waste dump sites. The best
fungal specie in this study was found to be Aspergillus niger because it showed the highest cellulolytic ability.
Aspergillus niger is known to have more cellulolytic potential than Bacillus larvae in agreement with work of
Singh et al. (30). These findings corroborate other findings from Guatam et al. (17) and Kumar and Thippe (31).
Conclusion
These agricultural wastes of (peels of banana, orange and cassava peels and corn cobs) used in this study are good
sources for cellulolytic microorganisms which can be exploited for industrial processes, particularly in the
production of cellulase. Further work could be done to produce cellulase from these microorganisms and they could
be harnessed for the conversion of agrowastes into various economic resources such as in the production of biofuels
and biogas. In addition, these microorganisms could be molecularly characterized and the sequence data deposited in
NCBI database for bioinformatics study and reference.
Acknowledgements
The author is grateful to the Federal University of Technology and the Department of Microbiology for providing
the laboratory space and some materials to conduct this study.

References
1. Lee SY, Sankaran R, Chew KW, Tan CH, et al., Waste to bioenergy: a review on the recent conversion
technologies. BMC Energy 1: 4 – 26. 2019.

2. Sadh PK, Duhan S, Duhan JS. Agro-industrial wastes and their utilization using solid state fermentation:
a review. Bioresources and Bioprocessing 5:1 DOI.org/10.1186/s40643-017-0187-z, 2018.

50
 Olukunle, O. F.
3. Sabiiti EN: Utilizing agricultural waste to enhance food security and conserve the environment. Afr J
Food Agr Nutr & Dev. 11(6): 1-9. 2004.

4. Sajjad M, Choudhry S: Effect of starch containing organic substrates on alpha amylase production in
Bacillus strains. Afri J Microbio Res. 6: 7285-7291. 2012.

5. Garg N, Ashfaque M: Mango peel as substrate for production of extracellular polygalacturonase from
Aspergillus fumigatus. Ind J Horticul. 67: 140-143. 2010.

6. Sabiiti EN, Bareeba F, Sporndly E, Tenywa JS, Ledin S, Ottabong E: et al. Urban market garbage: A
hidden resource for sustainable urban/peri-urban agriculture and the environment in Uganda. The Uganda
J. 50: 102-109. 2004.

7. Tumuhairwe JB, Tenywa JS, Otabbong E, Ledin S: Comparison of four low-technology composting
methods for market crop wastes. Waste Management, 29: 2274–2281. 2009.

8. Siddiqui A, Salahuddin T, Riaz A, Zohra RR, Naheed S: Production of amylase from Bacillus sp. AY3
using fruit peels as Substrate. Fuuast J. Biol. 4(2): 213-215. 2014.

9. Demain AL, Adrio JL: Contributions of microorganisms to industrial biology, Mol. Biotech. 38(1): 41 –
55. 2008.

10. Smith EJ: An industrial application of cellulases, Journal of Biotechnology and Bioengineering. Press
syndicate of the University of Cambridge, Third Edition. pp 68-83. 1996.

11. Kuhad RC, Gupta R, Singh A: Microbial Cellulases and their Industrial Applications. Enzyme Res. DOI:
10.4061/2011/280696. 2011.

12. Wilson DB: Microbial diversity of cellulose hydrolysis, Curr Opin Microbiol. 14(3): 259 – 263. 2011.

13. Hafiz MNT, Muhammad A, Ishtiaq A, Shahbaz H: Media optimization for hyperproduction of
carboxymethyl cellulase using proximally analysed agro-industrial residues with Trichoderma harzianum
under SSF. IJAVMS. 4(2): 47-55. 2010.

14. Fawole MO, Oso BA: Laboratory Manual of Microbiology, Spectrum Books Limited. 2: 112-121. 2012.

15. Cheesbrough M: District Laboratory Practice in Tropical Countries. 2nd Edition, Cambridge University
Press, Cambridge, UK. 50: 165-176. 2006.

16. Bergey. D. H. and Holt, J. G. (1994). Bergey's Manual of Determinative Bacteriology. 9th edition.
Williams and Wacket, Baltimore, Washington DC.

17. Gautam SP, Bundela PS, Pandey AK, Jamaluddin AMK, Sarsaiya S. Cellulase production by
Pseudomonas sp. isolated from municipal solid waste compost, Int J Acad Res. 2(6): 330–333. 2010.

18. Oviasogie FE, Oviasogie PO: Physicochemical properties and fungal dynamics of soils obtained from
public, reclaimed and residential wastes dumpsites, Nig J Agr Food & Env. 10(3): 57-63. 2014.

19. D'Mello JPF: Scottish Agricultural College (SAC), West Mains Road, Edinburgh EH9 3JG, United
Kingdom. www.fao.org/docrep/article/agrippa/556_en.htm. Retrieved on 22nd April 2020.

20. Chukwu EC, Onuegbu BA, Osakwe JA: Some environmental effects on the seed rot of Irvingia
gabonesis var gabonesis. Niger Delta Biology. 4(2): 72-74. 2004.

21. Janet OW, Kelechi H: Microorganisms associated with dumpsites in Port Harcourt Metropolis, Nig J
Ecol & Nat Env 8(2): 9-12. 2015.

51
 Olukunle, O. F.
22. Ebe TE, Mgbemena IC, Njoku T, Roseline FO, Emmanuel E, Anyanwu J. et al.: Bacteria associated with
domestic solid waste dump in Egbu, Owerri North Local Government Area in Imo State, Nigeria. J Env
Earth Sci. 5(12): 2224-3216. 2015.

23. Singh AK, Sanat R, Yashab K, Harison M, Jyotsna KP, Jane CB et al: Bio-ethanol production from
banana peel by simultaneous saccharification and fermentation process using cocultures Aspergillus
niger and Saccharomyces cerevisiae. Int J Curr Microbiol. Appl Sci. 3(5): 84-96. 2014.

24. Adewara AO, Ogunbanwo ST: Effects of processing variables on the production of Burukutu, a Nigerian
fermented beverage. Nat. & Sci. Journal. 11(1): 16-28. 2013.

25. Akinyele BJ: Optimization of cellulase production by Aspergillus flavusNSPR017 cultured on pretreated
agro wastes. Nig. J Microbiol. 25: 2291-2301. 2014.

26. Adeyemo IA, Adetoyi OE, Oni MO, Ayodele MJ, Olayemi AB: Studies on degradation of waste papers
using microflora/microbial consortia isolated from refuse dumpsites in Ilorin metropolis, Int. J. Biotech.
& Food Sci. 1(1):13-22. 2013.

27. Moharram AM, Abdel-Hafez SII, Abdel-Star MA: Cellulolytic activity of fungi isolated from different
substrates from the New Valley Governorate, Egypt. Pure Science Engineering, 1: 101–114. 1995.

28. El-Sersy NA, Abd-Elnaby H, Abou-Elela GM, Ibrahim HAH, Toukhy NM: Optimization, economization
and characterization of cellulase produced by marine Streptomyces ruber. Afr J Biotech. 9: 6355-6364.
2010.

29. Ezekiel CN, Odebode AC, Omenka RO, Adesioye FA: Growth response and comparative cellulase
induction in soil fungi grown on different cellulose media. acta SATECH 2(3): 52–59. 2010.

30. Singh AK, Sanat R, Yashab K, Harison M, Jyotsna KP, Jane CB et al: Bio-ethanol production from
banana peel by simultaneous saccharification and fermentation process using cocultures Aspergillus
niger and Saccharomyces cerevisiae. Int J Curr Microbiol. Appl Sci. 3(5): 84-96. 2014.

31. Kumar NJ, Thippes B: Isolation and screening of potential cellulolytic fungi from Areca nut husk waste,
Int J Curr Sci. 8: 125-132. 2013.

52
 Idemudia and Ekhaise

NISEB Journal Vol. 21, No. 2. June, 2021 1595-6938/2021

Printed in Nigeria (2021) Society for Experimental Biology of Nigeria
http://www.ojs.klobexjournals.com/index.php/nisebj
Incidence and Antibiotics Susceptibility of Airborne Bacterial Isolates in
Three Hospital Environments in Benin City, Nigeria
Idemudia, I.B*. and Ekhaise, F.O.
1
Applied Environmental Bioscience and Public Health Research Group, Department of Microbiology, Faculty
of Life Sciences, University of Benin, Benin City

Abstract
Air quality of an environment is not easy to control because microbial spores are always present in the air
hence exposing humans to infection and contamination. The aim of this study was to evaluate the prevalence
and antibiotics susceptibility of airborne bacterial isolates in three different hospitals. Settled Plate Methods
were used to collect air samples, biochemical and molecular techniques were used to identify the bacterial
isolates. Antibiotic sensitivity patterns were determined and plasmid DNA was extracted, the isolates that
harboured plasmids were subjected to plasmid curing. The seasonal variation of the airborne bacterial
isolates across the three Hospitals sampled ranged from 8.38 ± 2.31 × 10 2 - 50.46 ± 12.98 × 102 cfu/m3 in the
dry season and 9.43±2.44 × 102 - 33.66 ± 11.75 × 102 cfu/m3 in the wet season. The identified airborne
bacterial isolates were Staphylococcus aureus, Staphylococccus epidermidis, Staphylococccus heamolyticus
Bacillus cereus, Bacillus thuringiensis, Bacillus subtilis, Comamonas testosteroni, Providencia vermicola,
Providencia rettgeri and Alcaligenes faecalis. The bacterial isolates recorded high multiple antibiotic
resistances index values greater than 0.2. Bacillus cereus, Bacillus thuringiensis, Comamonas testosteroni,
Providencia vermicola and Staphylococccus epidermidis harboured plasmid between sizes 21 and 23kb.
Upon curing, Bacillus cereus and Bacillus thuringiensis were found to be sensitive to majority of the
antibiotics they were previously resistant to, an indication that, their resistance were harboured in the
plasmid. Due to the severity of the effects of nosocomial infections and multiresistant bacterial strains, it is
recommended that more emphasis be made on this field of research.
Keywords: Airborne bacteria, Antibiotics, Benin, Hospital environments

Introduction
The introduction of harmful particulates, biological or chemical molecules into the atmosphere is termed air
pollution and it is a major problem having adverse effect on the health and general wellbeing of man [1, 2, 3,
4, 5, 6]. Hospitals are places where sick or injured people go for medical examinations and treatments.
Infected and non-infected people are found in the hospital environment thus there is always an array of
infectious microbes dominating the indoor air of hospitals leading to proliferation of virulent and antimicrobial
resistant pathogens.
Antibiotic-resistant microorganisms pose a significant threat to humans. Bacteria, primarily commensals, have
been revealed to operate as carriers and repositories of genes that cause antibiotic resistance, according to
researchers and these genes are similar to the resistance genes that are present in human pathogens [7, 8, 9,
10]. Commensal bacteria which now serve as reservoir organisms, help to transfer genes responsible for
resistance to pathogenic bacteria and this poses a major threat in antibiotic resistance [8, 11, 12,13].
Antimicrobial resistance in bacteria is a genetic condition that is induced by genes in the organism that encode
various biochemical pathways that prevent these medications from working [14, 15]. Antimicrobial resistance
is a public health concern in both developed and poor countries [16].
Bacteremia infections as a result of drug-resistant bacteria has a greater fatality rate than infections that are
caused by drug-susceptible bacteria, while it's unclear if the higher mortality rate is due to a higher virulence,
reduced antibiotic efficiency, or both [17]. The aim of this study was to look at the prevalence and antibiotic
susceptibility of airborne bacterial isolates in three different hospital settings in Benin City, Nigeria.

Materials and Methods

Study locations and Sites
Three hospitals located in Ekehuan Road, Airport Road and Sapele Road Benin City were used for this study.
The first two (Hospitals 1 and 2) are private hospitals while the third (Hospital 3) is a Government - owned
hospital. Ethical clearance were received from the managements of the hospitals before commencement of
sampling.
The sampling sites were as follows; Hospital Gate, Accident and Emergency unit, Treatment room, Male
ward, Maternity ward, Female ward, Microbiology Laboratory, Children ward and the Theatre.
Sample Collections

*Corresponding Author's E-mail: iyore.idemudia@uniben.edu

53
 Idemudia and Ekhaise

The Air samples were collected using freshly prepared Tryptone Soya agar plates which were exposed in
triplicates and placed 1 m above ground level for 10 mins and incubated at 370C for 24h. They were collected
monthly for 12 months between October, 2015 and September, 2016 [2, 18].
Enumeration and Biochemical Identification
The mean values from the triplicates plates were enumerated and converted to cfu/m 3 using the formula below.
Cultural, morphological and biochemical characteristic features were used to identify the bacterial isolates [19,
20].
cfu/m3 = a × 10000
p× t × 0.2 - - - - - Equation 1
where: a: Number of colonies counted in Petri dish; p: Surface area of the Petri dish ( );
t: Exposure time (10min)
Extraction of airborne bacterial DNA
The Zymo bacteria Miniprep kit (Zymo Research, Fermentas, USA) was used to extract genomic DNA from
the bacterial isolates. The protocol was followed exactly as it was given in the instructions. A NanoDrop
Spectrophotometer was used to measure the concentration and purity of DNA (ND-1000, Thermo Fisher
Scientific, US) [21].
PCR Amplification and Conditions
Amplification was carried out by Polymerase Chain Reaction (PCR) utilizing a universal primer set of
16SrRNA (27FAGAGTTTGATCCTGGCTCAG and 1492R – GGTTACCTTGTTACGACTT) using a
Thermal Cycler (Model FTC41H2D, UK). The protocol as described in the instructions were adopted.
Fragments were observed on 1.5% agarose gel electrophoresis [22].
PCR Product Sequencing
The PCR products were purified and sequenced with version 3.1 ABI Big Dye 3730XL genetic analyzer. The
results were obtained as nucleotides in FASTA format and were read using Bio edit Sequence viewer 7.2.1
[23].
Sequence Identification
Identification of sequences was done using the GenBank’s Basic Local Alignment Search Tool (BLAST)
algorithm on National Centre for Biotechnology and Information (NCBI) website
(http://blast.ncbi.nlm.nih.gov). Using Bio edit software, sequences with high similarity were downloaded from
NCBI and subjected to multiple sequence alignment [23, 24].
Antibiotic Sensitivity Patterns of the Bacterial Isolates
The isolates' antibiotic sensitivity testing were performed using the Disk Diffusion technique. Thirteen
antibiotic disc (Oxoid) belonging to 8 classes were used, they include; Penicillin [(Cloxacillin (5μg),
Amoxycillin (25μg), Augmentin (30μg)], Cephalosporin [Cefuroxime (30μg), Ceftriaxone (30μg), Ceftazidime
(30μg)], Aminoglycosides [Gentamycin (10μg)], Macrolides [Erythromycin (5mμg)], Quinones [Ofloxacin
(5μg), Nalidixic acid (30μg)], Sulfonamides [Cotrimoxazole (25μg)], Tetracycline (25μg) and Nitrofurantoin
(200μg). The inoculum were streaked on Muller Hinton Agar after which the impregnated disk was placed
aseptically on the inoculated plates and incubated at a temperature of 37 0C for 24 h. thereafter , measurement
of the zone around each disk (in mm) was carried out and interpreted. Multiple drug resistance (MDR) isolates
were identified as isolates that were resistant to at least three different groups of antibiotics, while for each
isolate, the multiple antibiotic resistance (MAR) index was computed by dividing the number of antibiotics to
which the isolate was resistant by the total number of antibiotics tested [25, 26].
MAR index = a
B- - - - - - Equation 2
where a is the number of antibiotics the isolate is resistant to.
b is the total number of antibiotics used
Plasmid Isolation and Curing
Plasmids were isolated and the bands visualized with UV transilluminator [27. 28. 29]. Plasmid curing was
performed on all isolates found to have plasmids using a sub-inhibitory dose of 10% sodium dodecyl sulphate
(SDS). Antibiotic-resistant isolates were cultured for 48 hours on tryptone soya broth containing 10% SDS at
37°C. Thereafter the broth was stirred to homogenize the contents before being streaked onto Mueller Hinton
agar (MHA) plates. The impregnated disks were aseptically placed on the inoculation plates which were then
incubated at 37°C for 24 hours before the colonies were screened for antibiotic resistance using the disk
diffusion method. To determine the cured marker, anti-bioGrams of isolates were compared before and after
curing. The absence of resistance following plasmid curing suggests that resistance was plasmid-mediated [29,
30, 31].
Data Analysis
The data were presented as mean + SEM (standard error) using the one way Analysis of Variance (ANOVA)
SPSS version 16. Significance at P values < 0.05 were considered [4, 32].

54
 Idemudia and Ekhaise

Results
Table 1 shows the effect of seasonal variation on airborne bacterial population in Hospital 1. The values
ranged from 12.83 + 3.84 ×102 to 19.73 + 5.44 ×102 cfu/m3 in the dry season and 9.43 + 2.88 ×102 to 20.82 +
4.33 ×102 cfu/m3 in the wet season. No significant difference (p>0.05) was recorded in the values obtained
from the dry and wet season. Table 2 shows the effect of seasonal variation on airborne bacterial population in
Hospital 2. The values ranged from 8.38 + 2.31 ×102 to 26.24 + 6.47 ×102 cfu/m3 in the dry season and 9.43 +
2.44 ×102 to 33.66 + 11.75 ×102 cfu/m3 obtained in the wet season. Significant difference (p<0.05) was
recorded in the values obtained from the Accident and Emergency Ward and the Children’s ward. The effect
of the seasonal variation on airborne bacterial population in Hospital 3 is presented in table 3. The values
ranged from 16.45 + 3.88 ×102 to 50.46 + 12.98 ×102 cfu/m3 in the dry season and 13.27 + 2.26 ×102 to 29.73 +
13.27 ×102 cfu/m3 in the wet season. Significant difference (p<0.05) was recorded in the values obtained from
the Laboratory, Accident and Emergency Ward and Theater.
The identified airborne bacterial isolates belonged to the genus Staphylococcus, Bacillus, Comamonas,
Providencia and Alcaligenes which were molecularly identified (Table 4) as Staphylococcus aureus,
Staphylococcus heamolyticus, Staphylococcus epidermidis, Comamonas testosteroni, Providencia vermicola,
Providencia rettgeri, Alcaligenes faecalis Bacillus cereus, Bacillus thuringiensis and Bacillus subtilis.
The zone of inhibition and antibiotic susceptibility pattern of the bacterial isolates before and after plasmid
curing are shown in Table 5.

Table 1: Effects of Seasonal Variation on Airborne Bacterial Population in Hospital 1 (cfu/m3)

Parameter Dry season Wet season P-value Significance Level
Accident and emergency ward 19.12±6.03 15.41±5.57 0.44 P>0.05
Laboratory 15.46±4.39 14.14±3.58 0.69 P>0.05
Maternity ward 13.23±3.34 16.50±4.53 0.32 P>0.05
Treatment room 12.83±3.84 15.46±6.65 0.56 P>0.05
Theatre 13.61±4.19 9.43±2.88 0.16 P>0.05
Male ward 15.19±4.43 12.31±2.64 0.34 P>0.05
Children ward 15.32±3.27 17.55±5.19 0.53 P>0.05
Female ward 15.06±4.54 12.97±2.25 0.48 P>0.05
Hospital gate 19.73±5.44 20.82±4.33 0.79 P>0.05
Key:
P>0.05 - No significant difference
Dry season: Oct., 2015- March., 2016. Wet season: April, 2016- Sept., 2016

TABLE 2: Effects of Seasonal Variation on Airborne Bacterial Population in Hospital 2 (cfu/m3)

Parameter Dry season Wet season P-value Significance Level
Accident and emergency
ward 17.54±3.61 33.66±11.75 0.03 P<0.05*

Laboratory 19.64±5.72 14.67±3.63 0.21 P>0.05

Maternity ward 14.14±2.84 13.36±3.79 0.78 P>0.05

Treatment room 15.40±3.35 16.37±3.52 0.73 P>0.05

Theatre 8.73±1.55 11.83±4.53 0.27 P>0.05

Male ward 9.95±1.93 9.43±2.44 0.77 P>0.05

Children ward 8.38±2.31 13.09±3.35 0.04 P<0.05*

Female ward 10.74±2.09 11.39±3.08 0.76 P>0.05

Hospital gate 26.24±6.47 19.78±3.68 0.14 P>0.05

Key:
P<0.05 - There is significant difference
P>0.05 - No significant difference
Dry season: Oct., 2015- March., 2016
Wet season: April 2016- Sept 2016

55
 Idemudia and Ekhaise

Table 3: Effects of Seasonal Variation on Airborne Bacterial Population in Hospital 3 (cfu/m3)

Parameter Dry season Wet season P-value Significance Level
Accident and emergency ward 50.46±12.98 22.44±11.26 0.01 P<0.05*
Laboratory 29.60±8.02 17.77±6.45 0.04 P<0.05*
Maternity ward 18.59±5.49 17.15±3.79 0.71 P>0.05
Treatment room 17.68±4.66 17.90±3.98 0.95 P>0.05
Theatre 19.78±4.66 13.27±2.26 0.04 P<0.05*
Male ward 22.30±6.84 19.65±8.30 0.67 P>0.05
Children ward 16.45±3.88 26.54±15.83 0.29 P>0.05
Female ward 22.39±4.63 17.81±4.02 0.20 P>0.05
Hospital gate 45.18±12.81 29.73±6.64 0.07 P>0.05
Key:
P<0.05 - Significant difference
P>0.05 - No significant difference

Dry season: Oct., 2015- March., 2016

Wet season: April 2016- Sept 2016

Table 4: Gene Bank bacteria identification using 16S rRNA partial sequencing
Isolates Closest Phylum Class Family Nucleotid Similari Accession
strains in e ty % no.
Gene Bank sequence
database (base pair)

Bacillus Bacillus Firmicutes Bacilli Bacillaceae 900 99 CP012483.1

cereus cereus
Bacillus Bacillus Firmicutes Bacilli Bacillaceae 905 82 KU899993.1
subtilis substilis
Bacillus Bacillus Firmicutes Bacilli Bacillaceae 902 78 KX822720.1
thuringiensis thuringiensis
Staphylococcu Staphylococc Firmicutes Cocci Staphylococcacea 895 98 NR_036904.
s epidermidis us e 1
epidermidis
Staphylococcu Staphylococc Firmicutes Cocci Staphylococcacea 896 97 NR_118997.
s aureus us aureus e 1
Staphylococcu Staphylococc Firmicutes Cocci Staphylococcacea 895 99 NR_036955.
s heamolyticus us e 1
heamolyticus
Alcaligenes Alcaligenes Proteobacteri (β) Beta Alcaligenaceae 886 78 LC213619.1
faecalis faecalis a proteobacter
ia
Providencia Providencia Proteobacteri Gamma Enterobacteriacea 891 90 KU870748.1
rettgeri rettgeri a Proteobacter e
ia
Providencia Providencia Proteobacteri (γ) Gamma Enterobacteriacea 890 91 KX098543.1
vermicola vermicola a Proteobacter e
ia
Comamonas Comamonas Proteobacteri (β) Beta comamonadaceae 895 76 KF77200.1
testosterone testosterone a Proteobacter
ia

Augumentin, Ceftazidime, Cefuroxime, Ceftraxone, Cloxacillin and Amoxicillin resistance was found in all
11 bacteria isolated. Plasmids were discovered in Staphylococcus epidermidis, Bacillus cereus, Comamonas
testosteroni, Providencia vermicola, and Bacillus thuringiensis, all of which were sensitive to Augumentin,
Gentamicin, Nitrofurantoin and Nalidixic acid. Bacillus cereus and Bacillus thuringiensis were shown to be
sensitive to the majority of the isolates that they were previously resistant to after plasmid curing. Table 6
represents the results of the multiple antibiotics resistances index, with all the isolates having index greater
than 0.2. Table 7 shows the multiple drug resistance profile (MDR) of the bacterial isolates. Bacillus
thuringiensis, Bacillus subtilis and Comamonas testosterone were resistant to more than three (3) groups of
antibiotics which makes them multi drug resistant bacterial isolates.

56
 Idemudia and Ekhaise

Table 5: Antibiotics Susceptibility Patterns of Airborne Bacterial in Hospital Environments before and
after Plasmid Curing
ISOLATES OFL AUG CAZ CRX GEN CTR ERY CXC TET AMX COT NIT NAL
(before curing)
S. aureus S R R R S R S R S R S S S
B. substilis S R R R S R S R R R R S I
C. testosterone I R R R I R R R R R R I S
S. heamolyticus S R R R S R S R S S S S S
P. vermicola S R R R S R I R I R R S S
P. rettgeri S R R R S R S R I R R S I
S. epidermidis S R R R S R I R I R S S S
B. cereus S R R R S R I R I R R S S
A. faecalis S R R R S R I R S R S S S
B. thuringiensis S R R R S R R R R R R S S
ISOLATES OFL AUG CAZ CRX GEN CTR ERY CXC TET AMX COT NIT NAL
(after curing)
C. testosterone S R R R S R R R R R R S S
P. vermicola S R R R S R S R S R R S S
S. epidermidis S R R R S R S R S R S S S
B. cereus S S S S S S S S R S S S S
B. thuringiensis S S S S S S R S R S S S S
KEY; <14mm Resistance; 14-17mm Intermediate; >17mm Highly susceptible
OFL- Ofloxacin , AUG- Augumetin, CAZ- Ceftazidime, CRX- Cefuroxime, GEN- Gentamicin, CTR-
Ceftraxone, ERY- Erythromycin, CXC- Cloxacillin, TET- Tetracycline, AMX- Amoxicillin, COT-
Cotrimoxazole, NIT- Nitrofurantoin, NAL- Nalidixic acid

Table 6: Results of the Multiple Antibiotics Resistances Index

Isolates Resistant Phenotypes Resistance Index

S. aureus AUG, CAZ, CRX, CXC, TET, AMX 0.5
B. subtilis AUG, CAZ, CRX, CTR, CXC, TET, AMX, COT 0.6
C. testosteroni AUG, CAZ, CRX, CTR, ERY, CXC, TET, AMX, COT 0.7
S. heamolyticus AUG, CAZ, CRX, CTR, CXC 0.4
P. vermicola AUG, CAZ, CRX, CTR, CXC, AMX, COT 0.5
P. rettgeri AUG, CAZ, CRX, CTR, CXC, AMX, COT 0.5
S. epidermidis AUG, CAZ, CRX, CTR, CXC, AMX 0.5
B. cereus AUG, CAZ, CRX, CTR, CXC, AMX, COT 0.5
A. faecalis AUG, CAZ, CRX, CTR, CXC, AMX, COT 0.6
B. thuringiensis AUG, CAZ, CRX, CTR, ERY, CXC, TET, AMX, COT 0.7
Key; Amoxycillin (AMX), Cloxacillin (CXC), Augmentin (AUG), Ceftriaxone (CTR), Ceftazidime (CAZ),
Cefuroxime (CRX), Gentamycin (GEN), Tetraycline (TET), Erythromycin (ERY), Ofloxacin (OFL), Nalidixic
acid (NAL), Cotrimoxazole (COT), Nitrofurantoin (NIT)

Table 7: Multiple Drug Resistance Profile (MDR)

Isolates Resistant Groups
S. aureus A (CXC, AMX, AUG ); B (CAZ, CRX); D (TET)
B. subtilis A (AUG, CXC, AMX); B (CAZ, CRX, CTR); D (TET); G (COT)
C. testosteroni A (AUG, AMX, CXC); B (CAZ,CRX,CTR); D (TET); E (ERY); G (COT)
S. heamolyticus A (AUG, CXC,); B (CAZ, CRX, CTR)
P. vermicola A (AUG, CXC, AMX); B (CAZ, CRX, CTR) G(COT)
P. rettgeri A (AUG, CXC, AMX); B (CAZ, CRX, CTR) G(COT)
S. epidermidis A (AUG, CXC, AMX); B (CAZ, CRX, CTR)
B. cereus A (AUG, CXC, AMX); B (CAZ, CRX, CTR); G (COT)
A. faecalis A (AUG, CXC, AMX); B (CAZ, CRX, CTR); G(COT)
B. thuringiensis A (AUG, CXC, AMX; B (CAZ, CRX, CTR); D (TET); E (ERY); G (COT)

Key; A- Penicillin [(Amoxycillin (AMX), Cloxacillin (CXC), Augmentin (AUG)]. B- Cephalosporin

[Ceftriaxone (CTR), Ceftazidime (CAZ), Cefuroxime (CRX)]. C- Aminoglycosides [Gentamycin (GEN)]. D-
Tetracycline (TET). E- Macrolides [Erythromycin (ERY)]. F- Quinones [Ofloxacin (OFL), Nalidixic acid
(NAL)]. G- Sulfonamides [Cotrimoxazole (COT)]. H- Nitrofurantoin (NIT).

57
 Idemudia and Ekhaise

Discussion
Microbial presence in the air is known to be a major attribute for infections and diseases. The microbiological
air quality is an indicator of a given environment's sanitary status, it's critical to investigate the quality of the
air we breathe. The number and variety of airborne microorganisms have a considerable impact on
environmental cleanliness, particularly in the health sector [33]. Ekhaise et al. [3] also isolated Staphylococcus
epidermidis, Staphylococcus aureus and Bacillus sp., with Staphylococcus aureus being the most frequently
isolated. Staphylococcus sp. and Micrococcus sp. were found in significant numbers in office buildings,
according to Rintala et al. [34]. Skin infections, pneumonia, osteomyelitis and endocarditis are all caused by
these bacteria, which are typical members of the natural flora of the human skin, mouth cavity and outer ear.
Similar to the findings of this study, Verde et al. [35] found Gram-positive cocci to be the most prevalent or
common phenotype (88 %) among all bacteria isolated from the hospital environment's indoor air. The genus
Staphylococcus is the most common bacteria in the indoor air environment, followed by Micrococcus
according to Pastuszka et al. [36], which combined represented 58-78 % of total bacteria concentration.
Bacillus sp. have been implicated in meningitis, septicemia, bacteremia and wounds. Alcaligenes sp. causes
pneumonia, urinary tract infection and peritonitis. Gram-positive cocci, such as Staphylococcus, are common
flora in practically every area of the human body, hence they are routinely separated in any setting where
people come into contact. In the investigation by Gouse et al. [37], members of the Staphylococcal and spore-
forming Bacillus species predominated the air microflora.
All of the bacteria isolated in this study were shown to be multiresistant to more than two antibiotic classes.
Previously, it was assumed that the struggle against antibacterial resistance had been won with the discovery
of new antibiotics in the 1940s and 1960s, however most bacteria quickly develop resistance to new antibiotics
following their use and introduction. Nonetheless, the multiple antibiotic resistance index value can be used to
estimate the public health hazard posed by any infection [38]. If they have a MAR value of less than or equal
to 0.2, the majority of harmless or less virulent and resistant species or strains pose no hazard to public health.
When the MAR index is above 0.2, there is reason to be concerned regarding patient and hospital staff public
health. The MAR index represents the pathogen's prominence as a public health issue and, more importantly,
its source (whether or not antibiotics have been used) [16, 39]. In this research, none of the isolated pathogens
were within the safe range of 0.2 hence they are of public health importance, it implies that the isolates
originated from high risk source of contamination [40]. It was observed in this present study that most of the
pathogens possessed plasmids which confer their antibacterial resistance nature. Although some of the
bacterial isolates retained their resistance after curing, it does not change the fact that the patients admitted to
these hospitals are liable to come down with nosocomial infections due to highly resistant bacterial strains.
Conclusion
it was evidenced from this research that the Hospital 3 (Government owned) had a higher microbial load than
the Hospitals 1 and 2 (privately owned) with the Hospital gate having higher load than the other sampling
areas, this could be justified because the hospital gate is an outdoor environment and the first point through
which every staff and patient coming into the hospital must pass through. Comamonas testosterone was
identified molecularly and this was previously classified as Pseudomonas spp. using biochemical
identification. Antimicrobial resistance is a growing global problem, so periodic monitoring of resistance
pattern of bacterial isolates among patients is beneficial to the patients as well as the hospital. All of the
isolates had an antibiotic resistance index of greater than 0.2, indicating that they all came from high-risk
sources of contamination where antibiotics are extensively used.
Conflict Of Interest
The authors declare that there is no conflict of interest with respect to this article

References
[1] Jaffal AA, Banet IM, EL-Mogeth AA, Nsanze H, Benar A, Ameen AS: Residential indoor airborne
microbial populations in the United Arab Emirates. Environmental International 23 (4):529-533.
1997.
[2] Ekhaise FO, Ighosewe OU, Ajakpovi OD: Hospital indoor airborne microflora in private and government
owned hospitals in Benin City, Nigeria. World Journal of Medical Sciences 3(1):19-23. 2008.
[3] Ekhaise FO, Isitor EE, Idehen O, Emoghene AO: Airborne microflora in the atmosphere of an hospital
environment of University of Benin Teaching Hospital (UBTH), Benin City, Nigeria. World Journal
of Agricultural Science 6(2):166-170. 2010.
[4] Idemudia IB, Ekhaise IB: Bacteriological enumeration and air quality of three major Hospitals in Benin
City, Nigeria. Journal of Science and Technology Research 1(2):77-86. 2019.
[5] Manisalidis J, Stavropoulou E, Stavropoulos A, Bezirtzoglou E: Environmental and Health Impacts of Air
Pollution: A Review. Frontiers in Public Health 8(14):1-14. 2020.
[6] Siebielec S, Woźniak M, Gałązka A, Siebielec G: Microorganisms as indoor and outdoor air biological
pollution. Postępy Mikrobiologii – Advancements of Microbiology 59(2):115–127. 2020.

58
 Idemudia and Ekhaise

[7] Perreten V, Schwarz F, Cresta L, Boeglin M, Dasen G, Teuber M: Antibiotic resistance spread in food.
Nature 389:801–802. 1997.
[8] Igbinosa EO, Obi LC, Tom M, Okoh AI: Detection of potential risk of wastewater effluents for
transmission of antibiotic resistance from Vibrio species as a reservoir in a peri-urban community in
South Africa. International Journal of Environmental Health Research 3:1–13. 2011.
[9] Igbinosa E, Obuekwe IS: Evaluation of antibiotic resistant gene in abattoir environment: A concern to
public health. Journal of Applied Sciences and Environmental Management 18 (2):165-171. 2014.
[10] Igbinosa EO, Oviasogie FE: Multiple antibiotics resistant among environmental isolates of
Stenotrophomonas maltophilia. Journal of Applied Sciences and Environmental Management
18(2):255-261. 2014.
[11] Mathur S, Singh R: Antibiotic resistance in food lactic acid bacteria—a review International Journal of
Food Microbiology 105: 281– 295. 2005.
[12] Lee JC, Kang HY, Oh JY, Jeong JH, Kim J, Seol SY, Cho DT, Lee YC: Antimicrobial resistance and
integrons found in commensal Escherichia coli Isolates from Healthy Humans. Journal of
Bacteriology and Virology 36(3):133 – 139. 2006.
[13] Wu B, Chunhua Q, Wang L, et al.: Detection of microbial aerosols in hospital wards and molecular
identification and dissemination of drug resistance of Escherichia coli. Environment International
137:1-10. 2020.
[14] Aminov RI: Minireview - The role of antibiotics and antibiotic resistance. Environmental Microbiology
11(12):2970–2988. 2009.
[15] Gonzalez-Candelas F, Comas I, Martinez JL, Galan JC, Baquero F: The Evolution of Antibiotic
Resistance. Genetics and Evolution of Infectious Diseases 1: 305-337. 2011.
[16] Chandran A, Hatha AA, Varghese S, Sheeja KM: Prevalence of multiple drug resistant Escherichia coli
Serotypes in a tropical estuary, India. Microbes and Environments 23(2): 153–158. 2008.
[17] Atata RF, Ibrahim YKE, Giwa A, Akanbi AA: Antibiotics resistance profile of bacterial isolates from
surgical site and hospital environment in a University Teaching Hospital in Nigeria Journal of
Medicine and Medical Sciences 4(4):181-187. 2013.
[18] Augustowska M, Dutkiewicz J: Variability of airborne microflora in a hospital ward within a period of
one year. Annals of Agriculture and Environmental Medicine 13:99-106. 2006.
[19] Buchanan RE, Gibbons NE: Bergey’s manual of determinative bacteriology, 8 th Edition. Willams and
Wilkins, Baltimore. 1268pp. 1974.
[20] Cheesbrough M: Distinct Laboratory Practice in Tropical Countries. Part 2. (2 nd Ed). Cambridge
University Press, New York, United States. 442pp. 2006.
[21] Shibu Y, Pfannkoch CA, Tenney A, et al.: A metagenomic framework for the study of airborne microbial
communities. PLoSOne 8:12-18. 2013.
[22] Mohini J, Deshpande JD: Polymerase Chain Reaction: methods, principles and application. International
Journal of Biomedical Research 2(1): 81-97. 2011.
[23] Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and
PSI-BLAST: A new generation of protein database search proGrams. Nucleic Acids Research
25:3389–3402. 2007.
[24] Hall TA: BioEdit: A user-friendly biological sequence alignment editor and analysis proGram for
Windows 95/98/NT”. Nucleic Acids Symposium Series 41: 95-98. 1999.
[25] Clinical and Laboratory Standard Institute (CLSI): Performance standards for antimicrobial susceptibility
testing; Fifteenth Informational Supplement. Clinical and Laboratory Standard Institute 25(1): 100 –
115. 2005.
[26] Azu NC, Onyeagba RA: Antimicrobial properties of extracts of Allium cepa (Onions) and Zingiber
officinale (Ginger) on Escherichia coli, Salmonella typhi and Bacillus subtilis. International Journal
of Tropical Medicine 3:1-4. 2007.
[27] Crosa JH, Tolmasky ME, Actis LA, Falkow S: Plasmids, pp 365-386. In: Gerhardt, P., Murray, R.G.E.,
Wood, W.A. and Kreig N.R. (editors). Methods for General and Molecular Bacteriology. American
Society for Microbiology, Washington, D.C. 1994.
[28] Coral G, Karagoz S: Isolation and characterization of phenanthrene degrading bacteria from a petroleum
refinery soil. Annals of Microbiology 55:255-259. 2005.
[29] Al-Arfaj AA, Abderahim KAA, Yakout SM, Abd-Alrahman SH: Rapid mini-prep isolation of high
quality small and large plasmids from phytopathogenic Gram negative bacteria. African Journal of
Microbiological Research 7 (15):1415-1420. 2013.
[30] Fuji T, Takeo M, Maeda Y: Plasmid-encoded genes specifying aniline oxidation from
Acinetobacter sp. Strain YAA. Microbiology 143(1):93-99. 1997.

59
 Idemudia and Ekhaise

[31] Yah SC, Eghafona NO, Oranusi S, Abouo AM: Wide spread plasmid resistance genes among Proteus
species in diabetic wounds of patients in the Ahmadu Bello University Teaching Hospital (ABUTH)
Zaria. African Journal of Biotechnology 6(15):1757-1762. 2007.
[32] Isotalo J: Basics of Statistics. Finland: University of Tampere. 82pp. 2011.
[33] Pasquarella C, Pitzurra O, Savino A: The index of microbial air contamination. Journal of Hospital
Infection 46:241 -256. 2000.
[34] Rintala H, Pitkaranta M, Toivola M, Paulin L, Nevalainen A: Diversity and seasonal dynamics of
bacterial community in indoor environment. BioMedCentral Microbiology 8(56):1471-1490. 2008.
[35] Verde SC, Almeida SM, Matos J, et al.: Microbiological assessment of indoor air quality at different
hospital sites. Research in Microbiology 1:1-7. 2015.
[37] Gouse BS, Ali Ismali AAR, Zafer SA, Omar BM: Assessment of Bacteria and Fungi in air from College
of Applied Medical Sciences (Male) at AD-Dawadmi, Saudi Arabia. International Research Journal
of Biological Sciences 4(9): 48-53. 2015.
[38] Yujie B, Caixia F, Min H, Lei L, Ming HW, Chunmiao Z: Human health risk assessment of antibiotic
resistance associated with antibiotic residues in the environment: A review. Environmental Research
169: 483–493. 2019.
[39] Singh NS, Singhal N, Kumar M, Virdi JS: High Prevalence of Drug Resistance and Class 1 Integrons in
Escherichia coli Isolated From River Yamuna, India: A Serious Public Health Risk. Frontiers in
Microbiology 12:1-12. 2021.
[40] Pastuszka JS, Marchwinska-Wyrwal E, Wlazlo A: Bacterial aerosol in Silesian hospital: preliminary
results. Polish Journal of Environmental Studies 14 (6): 883-890. 2005.

60
 Imam Abubakar Lekan et al.

NISEB Journal Vol. 21, No. 2. June, 2021 1595-6938/2021

Printed in Nigeria (2021) Society for Experimental Biology of Nigeria
http://www.ojs.klobexjournals.com/index.php/nisebj

Melatonin Mitigates Sodium Fluoride-Induced Hormonal Imbalance,

Oxidative Stress, Seminal Fluid Alteration and Seminiferous Tubule
Cytoarchitecture in Rats
1
Imam Abubakar Lekan, 2*Okesina Akeem Ayodeji, 1Sulaimon Fatimo Ajoke, 3Ibiyeye Ruqayyah Yetunde, 1Oyewopo
Adeoye Oyetunji, 4Biliaminu Sikiru Abayomi, 1Abdulkareem Rukayat Abiodun, 5Omoola Olasheu Oluwatosin and
1
Salihu Moyosore Ajao
1
Department of Anatomy, Faculty of Basic Medical Sciences, College of Health Sciences, University of Ilorin,
2
Department of Clinical Medicine and Community Health, School of Health Sciences, College of Medicine and
Health Sciences, University of Rwanda.
3
Department of Public Health Sciences, Faculty of Pure and Applied Sciences Kwara State University, Malete
Kwara State, Nigeria.
4
Department of Chemical Pathology, Faculty of Basic Medical Sciences, College of Health Sciences, Ilorin, Nigeria
5
Department of Human Anatomy, Faculty of Biomedical Sciences, Kampala International University, Western
Campus, Uganda.

Abstract
Sodium fluoride has been known to impair the reproductive system, hence, evaluate the protective and ameliorative
capacity of exogenous melatonin (MLT) on sodium fluoride-induced testicular toxicity. Forty-eight adults male
Wistar rats were randomly divided into six groups of eight animals each (6n = 8). Group I received; 0.2ml of
normal saline (NS) daily for 14 days, group II received 500ppm of sodium fluoride (NaF) per day for 14 days via
their drinking water, group III received 10mg/kg of melatonin (MLT) only for 14 days, group IV received sodium
fluoride and melatonin concurrently (MLT+NaF) for 14 days, group V received 500ppm of sodium fluoride followed
by 10mg/kg of melatonin daily (NaF-MLT) for 14 days, group VI received 10mg/kg of melatonin for 14 days
followed by 500ppm of sodium fluoride (MLT-NaF) for 14 days. After the treatments, hormonal assays, sperm
analyses, and histological investigations were carried out. Melatonin was able to regulate the hormonal profiles
and improved the caudal epididymal sperm quality and restored testicular morphology when administered with, and
after sodium fluoride but could not prevent the damage when administered before sodium fluoride.
Therefore, melatonin has therapeutic advantages and can be used to improve male infertility.
Keywords: Sodium Fluoride, Melatonin, Glutathione, Caudal Epididymis, Superoxide dismutase

Introduction
Infertility is an inability to conceive after one year of regular intercourse between males and females without the use
of contraception and it affects both males and females (1). Various environmental chemicals have been shown to
contribute to the development and manifestation of infertility by having a direct harmful effect on both male and
female gametes (2). Infertility affects about 48 million couples and approximately 180 million individuals
worldwide (3). Fluorine is a natural gas that is abundant in the environment as components of minerals in rocks and
soil; it combines with other elements like hydrogen, sodium to form fluoride compounds (4). Sodium fluoride is the
most common form of fluoride available and it appears as a colourless inorganic chemical compound. Excessive
exposure to fluoride has been found to cause adverse health conditions referred to as fluorosis which is a progressive
degenerative disorder that predominantly affects the skeletal system and teeth (5, 6). Chinoy and Sequeira (7),
showed that sodium fluoride treatment in mice induced alteration in the histology of reproductive organs, the
morphology of sperm, decrease in sperm motility, and caused biochemical changes to a reduction in estimated
glomerular filtration rate (EGFR). Androgen receptor (AR) expression has also been reported in fluoride-treated rats
(8, 9, 10) and interfere with G-proteins in Leydig cells, thereby affecting both level and function of testosterone
(11). Subsequently it has been reported that chronic fluoride toxicity resulted in regression of seminiferous tubule
and interrupt spermatogenesis in the rabbit (12). Fluoride treatment leads to oxidative stress as indicated by an
increased level of conjugated dienes in the testis, epididymis, and epididymal sperm (13)

61
*Corresponding Author's E-mail: akeemokesina@gmail.com
 Imam Abubakar Lekan et al.

Melatonin (n-acetyl-5-methoxytryptamine) is a known potent antioxidant and free radical scavenger of reactive
oxygen species ROS (14, 15), as well as reactive nitrogen species (RNS) (16). In mice, exogenous melatonin
preserves spermatogenesis that can be affected by oxidative damage caused by exposure to pesticides which
accelerate the production of free radicals and oxidative stress-reducing gonadal function (17). Melatonin prevents
germ cell degeneration and degradation of androgen receptors (AR) thereby helping to enhance fertility (18).
Therefore, the administration of melatonin can be a factor effective in preventing the action of testicular toxicants
(19).

Material and Methods

Chemicals
The tablet form of melatonin product of Good Neighbour Pharmacy, Broadway Industry, USA, ABC #:10148547
was obtained from a local Pharmaceutical Company in Ilorin. Kwara State Nigeria and Sodium fluoride salt, a
product of Guangdong Guanghua Chemical Factory Co. LTD, Shantou Guangdong 515000, China, was obtained
from Mich-Mikedeson Nigeria Limited, Taiwo in Ilorin. Kwara State, Nigeria.
Experimental Design
Forty-eight (48) adult male Wistar Rats weighing (120-200g) were used for this study. The animals were allowed
free access to feed and water. The animals were treated in accordance with the Guide for the Care and Use of
Laboratory Animals of the University of Ilorin. The ethical approval for the research was obtained from the
University of Ilorin Ethical Review Committee through the Ethical Review Committee of the Faculty of Basic
Medical Sciences with University Ethical Review Committee (UERC) approval number: UERC/ASN/2017/860.
Subsequently, the animals were divided into six (6) groups of eight animals each (6n=8). Group I received; 0.2ml of
normal saline (NS) daily for 14 days, group II received 500ppm of sodium fluoride (NaF) per day for 14 days via
their drinking water, group III received 10mg/kg of melatonin (MLT) only for 14 days, group IV received sodium
fluoride and melatonin concurrently (MLT+NaF) for 14 days, group V received 500ppm of sodium fluoride
followed by 10mg/kg of melatonin daily (NaF-MLT) for 14 days, group VI received 10mg/kg of melatonin for 14
days followed by 500ppm of sodium fluoride (MLT-NaF) for 14 days.
Serum Collection and Determination
At the end of the experiment, the animals were euthanized using ketamine hydrochloride (20 mg/kg,
intramuscularly). Blood was collected into a heparinized bottle and used for hormonal analysis. Testes were
harvested and fixed in Bouin’s fluid, unfixed testes were homogenized with 5% sucrose solution and then centrifuge
at 3000rpm for 10minutes. The supernatant was taken and used for the enzyme assays.
The serum level of follicle-stimulating hormone (FSH), luteinizing hormone (LH) and testosterone were determined
using Accu-bind ELISA Microwells from Monobind Inc. Lake Forest, CA 92630, the USA with product code: 425-
300, 625-300, and 3725-300 according to the manufacturer’s recommendation.
The SOD activity was determined using a superoxide dismutase assay kit, the product of the Cayman Chemicals,
1180 E. Ellsworth Rd. Ann Arbor, MI. The USA. Item No: 706002 following the producer’s instruction.
The glutathione (GSH) activity was evaluated using Glutathione Assay Kit (Colorimetric) Catalog Number KA0797
from abnova.
The Malondialdehyde (MDA) was evaluated according to the prescribed method of the Beckman and Koppenol
(20).
Seminal Fluid Analysis
Estimation of epididymal sperm characteristics
The epididymis of each testis was dissected and transferred into the Petri dish containing 1 ml of normal saline.
Epididymal sperm concentration: The sperms were counted according to the method of Robb et al., (21) by using a
Neubauer hemocytometer chamber.
Sperm motility: The percentage of the epididymal sperm motility was measured depending upon the graduation basis
that was suggested by Chemineau et al., (22)
Sperm abnormality and sperm viability: The percentage of abnormal spermatozoa and viability were counted using
the account of 200 sperms under a light microscope (100 X power) according to Evans and Maxwell (23).
Histological Analysis
Testes tissues were fixed in Bouin’s solution, dehydrated in ascending graded alcohol, cleared in xylene, and
embedded in paraffin. Then they were cut into 5µm sections using a microtome and stained with hematoxylin and
eosin (H&E) according to the method of Sheehan and Hrapchak (24). Images were viewed under a light microscope
and images were taken with amscope digital camera.
Statistical Analysis

62
 Imam Abubakar Lekan et al.

All quantitative data from this study were analyzed using analysis of variance ANOVA and Tukey post hoc test with
the GraphPad Prism version 5.0 and expressed as mean± standard error of the mean (±SEM).

Results
Reproductive Hormones
The result of this study showed a non-significant difference in serum level of LH across the experimental groups
MLT+NaF, NaF-MLT and MLT-NaF compared to the control groups NS, NaF and MLT at (P< 0.05). This study
also found a significant difference in serum level of FSH of NS when compared with MLT+NaF and NaF-MLT
groups but non-significant difference when compared with MLT-NaF group at (P< 0.05). This study also found a
significant difference in FSH level in NaF group compared to MLT+NaF, NaF-MLT and MLT-NaF groups at (P<
0.05). Significant difference was recorded in the testosterone level of the NS group when compared with other
experimental groups MLT+NaF, MLT-NaF, and NaF-MLT at (P < 0.05) shown in table 1. There was also a
significant different in the level of NaF group testosterone compared to NaF-MLT at (P< 0.05) (table 1).

Table 1: Serum level of follicle stimulating hormone (FSH), luteinizing hormone (LH) and testosterone (TT) in
male rat
Groups FSH (mlU/ml) LH (mlU/ml) TT (ng/ml)
NS (control) 2.96±0.03 3.75±0.16 4.90±0.26
NaF 3.17±0.18 4.00±0.18 2.39±0.09a
ab
MLT 2.38±0.11 0.28±0.01 2.97±0.25a
ab
MLT+NaF 2.10±0.03 3.75±0.20 3.03±0.25a
NaF-MLT 2.28±0.15ab 4.13±0.13 6.01±0.32abc
b
MLT-NaF 2.50±0.15 3.93±0.17 2.67±0.11a
NS (Normal saline), NaF (Sodium fluoride) only, MLT (Melatonin) only, MLT+NaF (Melatonin with Sodium
fluoride), NaF-MLT (Sodium fluoride followed by Melatonin), MLT-NaF (Melatonin followed by Sodium fluoride)
groups. a, b, c shows statistically significant difference from NS, NaF and MLT groups respectively at p<0.05.

Biochemical Parameters of Oxidative Stress Markers

Significance difference was recorded in SOD activities of NS group when compared with MLT+NaF, MLT-NaF
and NaF-MLT groups at (P< 0.05). Also, there was significant increase in SOD level of MLT+NaF compared to
NaF group at (P< 0.05). GSH activities of the NS group was significantly higher compared to those of the
MLT+NaF, MLT-NaF, and NaF-MLT groups at (p<0.05). NaF group recorded a significantly high GSH activity
compared to MLT-NaF (table 2). The concentration of the MDA of NS also showed a significant difference when
compared to MLT+NaF, MLT-NaF and NaF-MLT groups at p<0.05. The concentration of MDA in NaF group is
significantly high compared to MLT+NaF, MLT-NaF, and NaF-MLT.MLT also recorded a significant different in
MDA level compared to MLT+NaF, MLT-NaF and NaF-MLT groups at (p<0.05) (table 2).

Table 2: Superoxide Dismutase (SOD) Activities, Gutathione (GSH) activity and Malondialdehyde (MDA)
Concentrations in testis of adult male Wistar rat.
Groups SOD (U/L) GSH (mM) MDA (mM)
NS (control) 9.03±0.03 0.35±0.04 0.72±0.01
NaF 1.59±0.01a 0.22±0.01a 2.51±0.04a
MLT 2.17±0.01a 0.28±0.01 0.85±0.01ab
abc a
MLT+NaF 5.09±0.03 0.27±0.02 1.15±0.01abc
a a
NaF-MLT 1.73±0.08 0.27±0.04 0.56±0.02abc
ac abc
MLT-NaF 1.15±0.01 0.12±0.01 1.31±0.00abc
NS (Normal saline), NaF (Sodium fluoride) only, MLT (Melatonin) only, MLT+NaF (Melatonin with Sodium
fluoride), NaF-MLT (Sodium fluoride followed by Melatonin), MLT-NaF (Melatonin followed by Sodium fluoride)
groups. a, b, c shows statistically significant difference from NS, NaF and MLT groups respectively at p<0.05.

Epididymal Sperm Parameters

The result of this study found a significant different in the sperm viability (SV) in NS group compared to MLT-NaF
group only. The NaF also had a significant difference in SV compared to MLT-NaF group. The sperm concentration

63
 Imam Abubakar Lekan et al.

(SC) was significantly higher in NaF compared to treatment group MLT+NaF. The NaF group recorded a significant
difference in the level of Sperm motility (SM) compared to treatment groups MLT+NaF, MLT-NaF and NaF-MLT
at (p<0.05). There was a non-significant different in sperm mophorlogy (SMP) in NS group compared to treatment
groups MLT+NaF, MLT-NaF and NaF-MLT (table 3).

Table 3: Sperm count, Motility, Morphology and Viability of male Wistar rat.

Groups SV (%) SC(106/ML) SM (%) SMP (%)

#NS (control) 478.00±3.46 81.92± 0.83 85.54±2.9 90.06±1.15
NaF 455.00±7.51 73.37±0.80a 72.00±0.58a 77.85±1.71a

MLT 456.00±12.41 78.91±2.22b 82.71±2.54b 83.31±4.67

b
MLT+NaF 496.00±1.43 82.60±1.24 83.21±0.84b 81.62±2.42
NaF-MLT 477.00±6.06 78.01± 0.38 81.11±0.46b 82.85±0.73
MLT-NaF 303±46.29abc 78.67±0.23 81.54±0.06b 86.52±0.52
NS (Normal saline), NaF (Sodium fluoride) only, MLT (Melatonin) only, MLT+NaF (Melatonin with Sodium
fluoride), NaF-MLT (Sodium fluoride followed by Melatonin), MLT-NaF (Melatonin followed by Sodium fluoride)
groups. a, b, c shows statistically significant difference from NS, NaF and MLT groups respectively at p<0.05.

Histological Observation
Representative photomicrograph of testes showing normal histoarchitecture of the seminiferous tubule for the
control (NS), The NaF group shows deformed seminiferous tubule with mildly damaged germ cells GC, lengthen
lumen L and scanty Leydig cells LC and the MLT group shows fairly deformed tubule, with scanty but well-
organized GC, the MLT+NaF group shows normal histological presentation similar to that of the control, the NaF-
MLT group shows nearly normal structural histological appearance. MLT-NaF, shows a deformed seminiferous
membrane, vacuolated GC, disrupted LC and SC is shown in figure 1
.

Figure 1: Photomicrograph of Seminiferous tubule of rat. NS (Normal saline), NaF (Sodium fluoride) only, MLT
(Melatonin) only, MLT+NaF (Melatonin with Sodium fluoride), NaF-MLT (Sodium fluoride followed by Melatonin),
MLT-NaF (Melatonin followed by Sodium fluoride) groups. L=lumen, LC=leydig cell, GC=germ cell, SC=sertoli
cell, V=vacuolization. Scale bar 100µ (X10)

64
 Imam Abubakar Lekan et al.

Discussion
Proper hormonal circulation is essential for normal reproductive functions in both humans and animals. Male
reproductive hormonal pathways depend on the correct link between hypothalamic-pituitary-testicular axes whose
sequence ensures proper spermatogenesis and maintain fertility. Any alteration in this pathway will interfere with
normal fertility. The presence of LH in circulation stimulates the Leydig cells of the testes to synthesize and produce
testosterone and FSH stimulates Sertoli cells to produce androgen binding protein (25). From this study, NaF
greatly disrupted the hormonal sequence in the exposed rat thereby interrupting normal reproductive functioning.
Naf increased the concentration of the LH and FSH but reduced the concentration of the testosterone. The
mechanism by which NaF stimulates the production of gonadotropins is yet to be known. However, NaF might
interfere with the normal pineal gland functioning because it deposits in the pineal gland in large amounts (26). This
can inhibit the synthesis and production of melatonin by this gland. Physiologically melatonin possesses anti-
gonadotropin effects, the presence of which inhibits the production of FSH and LH. So, the inhibition of the
melatonin leads to an increased level of FSH and LH. Desensitization of the gonadotropin-releasing hormones
halted the stimulation of the pituitary gland to produce FSH and LH. However, the stimulation of the LH and FSH
by the NaF is not affected by the desensitization of the gonadotropin-releasing hormone and protein kinase C
activities (27). Despite the increase in FSH and LH, NaF decreased testosterone levels which may be attributed to
the adverse effects of NaF on the testes. Therefore it can be said that NaF causes oxidative stress on the testes, which
is evident on the injury observed in the Leydig cells. NaF also degrades androgen receptors and reduced the
expression of the LH receptor on the Leydig cell. Naf also reduces the expression and activities of the testicular
steroidogenesis enzymes. All these negative influences of the NaF on the testes could contribute to the reduced level
of testosterone. The findings of this study are strengthened by the suggestions of Han et al and Yao et al in their
respective works (28, 29). Melatonin regulates the body's hormonal system and controls the circadian rhythm.
Melatonin exposure decreases the level of reproductive hormones which can be associated with its regulatory role
and its anti-gonadotropins effect (30). However, co-administration of melatonin with sodium fluoride and melatonin
following exposure to sodium fluoride was able to normalize the hormonal sequence and enhance reproductive
functions. The ability of melatonin to enhance the reproductive hormones by elevating the testosterone level is a
result of its antioxidant property which helps to protect and ameliorate oxidative damage and arrest lipid
peroxidation. Melatonin enhances the expression of androgen receptors and encourages testosterone production (30).
Reactive oxygen species (ROS) produced by living organisms as a bye product of metabolism are useful to the body
at low concentrations but produce adverse effects at higher concentrations by affecting lipid, protein, and DNA of
the body cells. The ROS production is being constantly regulated by body antioxidant systems; excessive
availability of the ROS against the capacity of the antioxidant system results in oxidative stress (31).
Sodium fluoride markedly decreases the activities of the antioxidant system in the testes of the exposed rats.
Fluoride generates potent ROS (superoxide ion) and directly inhibits the activities of the antioxidant system as well
as reduced the expression of the antioxidant enzyme protein which will lead to reduced concentration and activities
of enzymes (32). The reduction in antioxidant activities due to NaF exposure leads to an increased free radical attack
on the membrane lipid resulting in peroxidation of the testicular membrane as observed in the increased MDA
concentration. Melatonin is a potent free radical scavenger because of its ability to remove excessive ROS from the
biological system (33); it also stimulates the antioxidant system and brings about an increase in the antioxidant
enzyme activities. Due to its ability to enhance the functions of the antioxidants, melatonin was able to protect
testicular tissue against the free radical assault and inhibit lipid peroxidation hence, reversing oxidative damage on
the Wistar rat testes. The finding of this present study is in agreement with the works of Reddy et al and Rao and his
colleague (34, 35). From this study, exposed rats to melatonin before sodium fluoride showed no preventive
advantage against oxidative stress induced by the sodium fluoride which may be as a result of the low melatonin
half-life in the body system (35).
Appropriate seminal fluid qualities are required for the proper functioning of the spermatozoa and are vital for
normal male fertility. Any abnormality to either function or structure of the sperm will hinder normal male
reproductive efficiency (36). From this study, it was found that sodium fluoride reduced the sperm concentration,
percentage motility, morphology, and viability as against the control. Spermatozoa membrane is rich in
polyunsaturated fatty acid which is a major target of a free radical attack on the cell membrane to cause peroxidation
on the membrane. This polyunsaturated fatty acid makes the spermatozoa more vulnerable to hazardous effects of
the NaF. The reduced sperm qualities observed may be as a result of the disruption of the hormonal pathways, where
NaF exposure brought about increased FSH and LH levels but decreased testosterone (37). Low testosterone levels
leads to cessation of spermatogenesis, which results in reduced sperm concentration and sperm qualities. Sperm
motility is an energy-required process and any negative alteration in energy production will hinder normal sperm
motility. NaF interferes with mitochondrial energy production by inhibiting glycolytic and Kreb's cycle enzymes

65
 Imam Abubakar Lekan et al.

(39), thereby reducing energy production which will, in turn, cause a reduction in sperm ability to move. Melatonin
elicited protective and ameliorative effects by reversing the sperm abnormalities induced by the NaF. The beneficial
effects of melatonin on sperm function and structure are due to its potent free radical scavenger which helps to arrest
free radical attack on the sperm membrane. The introduction of melatonin was able to normalize the hormonal
pathways by increasing testosterone levels which causes the process of spermatogenesis and eventually enhanced
the sperm qualities (40, 41).
The degeneration observed in the rats’ testis could be as a result of oxidative stress induced by sodium fluoride that
led to peroxidation of the testis membrane evidenced in this research from the high level of MDA as a result of NaF
exposure (42). The oxidative stress could be the reason for the disorganization observed in the germ cell and might
also lead to apoptotic signs in the sperm cells which could be deduced from vacuolation, germ cell loss, and
detachment (43). The multinucleated giant cells might be due to atrophy. The increased interstitial space with scanty
Leydig cells could be due to damage to the cells. The reduction in the cells of the interstitial space might also
contribute to low expression of LHR on the Leydig cells which will, in turn, lead to a reduction in testosterone
synthesis and production and hence induce impairment in the spermatogenesis process (44). Also, Sertoli cells were
disturbed which can as well be a contributing factor to impaired spermatogenesis owing to the disturbance that
might be induced on the FSHR in the Sertoli cells. Melatonin was able to correct the abnormalities which are due to
its effective antioxidant capacity that helps to reduce lipid peroxidation and restore seminiferous tubule integrity
(30). Melatonin could have also ameliorated the degenerative effect of NaF to prevent DNA damage and apoptosis.
Melatonin also helps in cell proliferation and cell differentiation. The ability to enhance cell proliferation and
differentiation could be a way by which melatonin improved spermatogenesis. Melatonin administered before
sodium fluoride could not prevent the degenerative changes observed in the testis which might be due to the short
half-life and bioavailability of the melatonin in the body.
Conclusion
Melatonin played a protective and ameliorative role as indicated in its ability to increase the activities of superoxide
dismutase and glutathione as well as reduce concentration of malondialdehyde thereby protecting against lipid
peroxidation of the testicular membrane. Melatonin also helps in moderating the hormonal imbalance due to sodium
fluoride exposure by increased testosterone production and enhanced spermatogenesis. Also, melatonin was able to
restore epididymal sperm count, increase sperm motility, morphology as well as sperm viability. Furthermore,
melatonin restored normal histoarchitecture of the testes showing more organized germ cell and improved
spermatogenesis. Therefore, this study concludes that melatonin has therapeutic advantages and can be used to
improve male infertility.
Acknowledgement
This work was done in the Histopathology and Chemical Pathology Laboratories, University of Ilorin, with the
assistance of the laboratory personnel. Also, we want to appreciate the entire laboratory staff in the Department of
Anatomy, University of Ilorin for their technical support during this experiment.
Conflict Of Interest
There is no conflict of interest

References
1. World Health Organization (WHO): International Classification of Diseases, 11th Revision (ICD-11)
Geneva. 2018.
2. Segal TR, Giudice LC: Before the beginning: Environmental exposures and reproductive and obstetrical
outcomes. Fertil. Steril. 112(4):613-62. 2019.
3. Ombelet W: Global access to infertility care in developing countries: a case of human rights, equity and
social justice. Facts Views Vis Obgyn. 3(4):257-266. 2011
4. Urbansky ET: Fate of fluorosilicate drinking water additives. Chem. Rev. 102, 2837–2854. 2002.
5. Susheela AK: Treatise on Fluorosis. Fluorosis Research and Rural Development Foundation (FR & RDF).
3rd edition. Delhi, India: 2006.
6. Shashi A, Singh JP, Thapar SP: Protein degradation in skeletal muscle of rabbit during experimental
fluorosis. Fluor. 25, 155-158.1992.
7. Chinoy NJ, Sequeira E: Effects of fluoride on the histoarchitecture of reproductive organs of the male
mouse. 3(4) Repro. Toxicol. 261-7.1989.
8. Zakrzewska H, Udala J, Blaszczyk B: In vitro influence of sodium fluoride on ram semen quality and
enzyme activities. 35(3) Fluor. 153-160. 2002.
9. Wan SX, Zhang JH, Wang JD: Fluoride-induced changes in the expression of epidermal growth factor and
its receptor in testicular tissues of young male rats. 25(2) Fluor. 71-76. 2006.

66
 Imam Abubakar Lekan et al.

10. Huang C, Yang HB, Niu RY, Sun ZL, Wang JD: Effects of sodium fluoride on androgen receptor
expression in male mice. Fluor. 41, 10-17. 2008.
11. Chabre M: Aluminofluoride and beryllofluoride complexes; a new phosphate analogs in enzymology.
Trends in Biochem. Sci. 15, 6-10.1990.
12. Susheela AK, Kumar A: A study of the effect of high concentrations of fluoride on the reproductive organs
of male rabbits, using light and scanning electron microscopy. J Reprod Infertil. 92(2) 353-60. 1991.
13. Kwiecinski GG, Petrie GI, DeLuca HE: Vitamin D is necessary for reproductive functions of the male rat. J
Nutr. 119(5), 741–744. 1989.
14. Reiter RJ, Tan DX, Mayo JC, Sainz RM, Leon J, Czarnocki Z: Melatonin as an antioxidant: biochemical
mechanisms and pathophysiological implications in humans. 50(4) Acta Biochim. Pol. 1129-46. 2003.
15. Ajoke S, Ayodeji O, Lekan I, Yetunde U, Abiodun I-A, Aminu I, Yetunde A, et al: (2020). Exogenous
Melatonin Ameliorates Pontine Histoarchitecture and Associated Oxidative Damage in Sodium Fluoride
induced Toxicity. Nig. J Neurosci, 17(2); 4-10.2020.
16. Chawla SL, Yadav R, Shah D, Rao MV: Protective action of melatonin against fluoride-induced
hepatotoxicity in adult female mice. Fluor. 41(1), 44-51. 2008.
17. Reiter RJ, Tan DX, Manchester LC, Paredes SD, Mayo JC, Sainz RM: Melatonin and reproduction
revisited. Biol. Reprod 81(3), 445-56. 2009.
18. Bustos-Obregón E, Poblete D, Catriao R, Fernandes FH: Protective role of melatonin in mouse
spermatogenesis induced by sodium arsenite. Int J Moy. 31(3), 849-856. 2013.
19. Patil L., R. Balaraman, Effect of melatonin on doxorubicin induced testicular damage in rats. Int. J. Pharm
Tech Res. 1(3), 879-4, 2009.
20. Beckman JS, Koppenol WH: Nitric oxide, Superoxide and Peroxynitrite: the good, the bad and the ugly.
Am. J. physiol. 271, 1424-1437.1996.
21. Robb G, Amann R, Killian G: Daily sperm production and epididymal reserves of pubertal and adult rats. J
Repro. Fertil. 54,103 - 107.1978.
22. Chemineau P, Cogine Y, Guerin Y, Orgeure P, Valtet JC: Training Manual on Artificial Insemination in
sheep and goats. FAO, Trop Anim Health Prod. 77- 83. 1991.
23. Evans G, Maxwell WMC: Salamon‟s Artificial Insemination of Sheep and Goats. Butterworths Aust. tax.
legis 33. 1987.
24. Sheehan DC, Hrapchak BB: Theory and Practice of Histotechnology, 2nd Edition; Battelle Memorial
Institute, Columbus, Ohio. 262-264. 1987.
25. Junqueira LC, Carneiro J: Basic Histology- Text and Atlas 11th Edition. The McGraw-Hill Companies.
2007.
26. Luke J: Fluoride deposition in the aged human pineal gland. 35(2) Caries Res. 125-8. 2001.
27. Steven BW, Brian EH, Michael PC: Stimulation of Luteinizing Hormone Release by Sodium Fluoride Is
Independent of Protein Kinase-C Activity and Unaffected by Desensitization to Gonadotropin- Releasing
Hormone. 126(5) Endocrinol. 2583-2591. 1990.
28. Han H, Sun Z, Luo G, Wanga C, Wei R, Wang J: Fluoride exposure changed the structure and the
expressions of reproductive related genes in the hypothalamus–pituitary–testicular axis of male mice. CHE
135, 297-303. 2015.
29. Yao F, Chang-Jiu H, Peng-Yun J, Zhi-Yong Z, Xiu-Zhi T, Feng W, Dun-Xian T et al: Guo-Shi, Effects of
Melatonin on the Proliferation and Apoptosis of Sheep Granulosa Cells under thermal Stress. Int. J. Mol.
Sci. 15, 21090-21104. 2014
30. Ciani E, Haug TM, Maugars G, Weltzien F-A, Falcón J, Fontaine R. Effects of Melatonin on Anterior
Pituitary Plasticity: A Comparison Between Mammals and Teleosts. Front Endocrinol.11:605111. doi:
10.3389/fendo.2020.605111. PMID: 33505357; PMCID: PMC7831660. 2021
31. Pizzino G, Irrera N, Cucinotta M, Pallio G, Mannino F, Arcoraci V et al: Oxidative stress: Harms and
Benefit for Human Health. Oxid. Med Cell Longev. 2017(3) 1-13. Doi: 10.1155/2017/8416763. 2017.
32. Adamek E., Pawłowska-Goral K., Bober K: In vitro and in vivo effects of fluoride ions on enzyme activity.
Ann. Acad. Med. Stetin. 51, 69–85. 2005.
33. Reiter RJ, Acuna-Castroviejo D, Tan DX, Burkhardt S: Free radical-mediated molecular damage.
Mechanisms for the protective actions of melatonin in the central nervous system. Ann N Y Acad Sci. 939,
200–215. 2001
34. Reddy KP, Sailaja G., Krishnaiah C: Protective effects of selenium on fluoride induced alterations in
certain enzymes in brain of mice. J. Environ. Biol. 30(5): 859-864. 2009.

67
 Imam Abubakar Lekan et al.

35. Rao MV, Bhatt RN: Melatonin protection against F-induced oxidative stress and testicular dysfunction in
rats. Fluor. 45(2), 116–124. 2012
36. Vasan SS: Semen analysis and sperm function tests: how much to test? IJU J Urol Soc India. 27(1):41-8.
2011.
37. Rehman S, Usman Z, Rehman S, Aldraihem M, Rehman N, Rehman I, et al: Endocrine disrupting
chemicals and impact on male reproductive health. Transl Androl Urol. 7(3);490-503.2018
38. Smith LB, Walker WH: The regulation of spermatogenesis by androgens. Semin Cell Dev Biol.30:2–13.
2014.
39. Ebadi M, Sharma SK: Peroxynitrite and mitochondrial dysfunction in the pathogenesis of Parkinson's
disease. Antioxid. Redox Signal. 5(3), 319-35. 2003.
40. Alwan NA, Alkalby MAJ, Al-Masoudi A E: Ameliorative Effect of Melatonin, Vitamin - C and their
Combination on Acrylamide Toxicity in Testis of Adult Male rats. Life Science Archives (Lsa). 2(4), 610 –
621. 2016.
41. Pushpalatha T, Srinivas M, Sreenivasula-Reddy P: Exposure to high fluoride concentration in drinking
water will affect spermatogenesis and steroidogenesis in male albino rats. 18(3) Biometals. 207-12. 2015.
42. Asadi N, Bahmani M, Kheradmand A, Rafieian-Kopaei M: The Impact of Oxidative Stress on Testicular
Function and Role of Antioxidants in Improving it: A review. J Clin Diagm Res. 11(5):IE01-5. 2017
43. Asadi A, Ghahremani R, Abdolmaleki A, Rajaei F: Role of sperm apoptosis and oxidative stress in male
infertility: A narrative review. Int J Reprod Biomed. 19(6):493-504. 2021
44. Hauptman D, Perić MH, Marić T, Bojanac AK, Sinčić N, Zimak Z, et al. Leydig Cells in Patients with
Non-Obstructive Azoospermia: Do They Really Proliferate? Life Basel Switz. 11(11).
doi:10.3390/life11111266. 2021

68
INSTRUCTIONS TO AUTHORS
1. NISEB JOURNAL will publish original research papers in the various fields of biological sciences,
biomedical sciences and life sciences which include agriculture, anatomy, biochemistry, botany (plant
biology), physiology, pharmacology, immunology, genetics, virology, haematology, microbiology,
parasitology, zoology and environmental biology.
2. Authors submitting a manuscript do so on the understanding that, if it is accepted for publication, copyright
in the article, including the right to reproduce the article in all forms of the media (print and electronic),
shall be assigned exclusively to the Publisher (Society for Experimental Biology of Nigeria). The Publisher
will not refuse any reasonable request by the author for permission to reproduce any of his or her
contributions to the journal.
3. Manuscripts are accepted for review and publication with the understanding that the same work has not
been, and will not be, published nor is presently submitted and being considered for publication elsewhere,
and that all persons listed as authors have given their approval for the submission of the paper.
4. The original typescript and two good photocopies should be sent to the Editor-in-Chief, PROFESSOR
CHRISTOPHER C. OSUBOR, Department of Biochemistry, University of Benin, Benin City, Nigeria. (E-
mail: ccosubor@uniben.edu).
5. In order to expedite action on the processing of manuscripts, we now encourage electronic submission of
manuscripts particularly by e-mail as attachments. Manuscripts submitted in this way should be sent to the
e-mail address of the Editor-in-Chief as shown in 4 above. If accepted for publication, they will be
published within two months of submission.
6. Manuscripts should be typewritten, with double spacing and wide margins following the conventional form.
The first page should contain the title of the manuscript, name(s) of all the authors and their address(es),
including telephone number and e-mail. Where there is more than one author, the corresponding author
should be indicated. An abstract (of not more than 200 words) should follow the authors' names and
addresses. This should adequately summarize the pertinent findings of the paper. The main body of the
paper may be divided into (a) Introduction, (b) Materials and Methods, (c) Result, (d) Discussion (e)
Acknowledgement and (f) References. "c" and "d" may be combined for conciseness and clarity. If the
research involves the use of human subjects, including collection of human blood or other human
specimens, an institutional ethical clearance document should be submitted with the manuscript.
Alternatively, a clear statement should be made, in the 'Materials and Methods' section, that informed
consent of the experimental subjects and/or appropriate ethical committee had been obtained.
7. All necessary illustrations should accompany the manuscript but should not be inserted within the text. The
illustrations should be numbered consecutively in the order in which they are referred to in the text. On the
back of each illustration, the author’s name and figure number should be written. The top of the illustration
should also be indicated if this is not clear. Legend to figures should be typed on a separate sheet, and
should give sufficient information to make the illustration comprehensible without reference to the text.
8. References must be listed in their order of appearance and be indicated in the text by numbers in soft
brackets. Full titles of papers cited should be included, and abbreviations of journals should conform to
those of ‘Index Medicus’. Do NOT use full stop after initials or abbreviations. The complete authors list as
well as inclusive page numbers should be given. However, if there are more than 7 authors, the first three
authors should be listed, followed by et al. Note the following examples:
(a) Cheung WY: Calmodulin plays a pivotal role in cellular regulation. Science 207: 19 - 27. 1980.
(b) Koch P-J, Walsh MJ, Schmelz M, Goldschmidt MD, Zimbelmann R, Franke WW: Identification of
desmoglein, a constitutive desmosomal glycoprotein, as a member of the cadherin family of cell adhesion
molecules. Eur. J. Cell Biol 53: 1 – 12. 1990.
(c) Tartakoff AM: The Secretory and Endocytic Paths. Mechanism and specificity of vesicular traffic in the cell
cytoplasm. John Wiley & Sons, New York, pp 7 - 39.
(d) Spandidos DA, Wilkie NM: Expression of exogenous DNA in mammalian cells. In: In vitro Transcription
and Translation – A Practical Approach. BD Hames and SJ Higgins (eds.) IRL Press, Oxford. pp. 1–48,
1984.
9. Upon publication the website from which the reprint can be downloaded will be sent to the corresponding
author. However, printed copies of reprints and/or copies of the journal may be purchased from the Editor-
in-Chief, Professor Christopher C. Osubor, Department of Biochemistry, University of Benin, Benin City,
Nigeria (E-mail: ccosubor@uniben.edu) or Publishers: Society for Experimental Biology of Nigeria,
Department of Biochemistry, University of Ilorin, P. M. B. 1515, Ilorin, Nigeria. 240003. (Email:
niseb@niseb.org).