Postharvest Biology and Technology 200 (2023) 112315

Contents lists available at ScienceDirect

Postharvest Biology and Technology

journal homepage: www.elsevier.com/locate/postharvbio

Bacillus cereus B8W8 an effective bacterial antagonist against major

postharvest fungal pathogens of fruit
Mohammed Khadiri a, b, Hassan Boubaker b, Latifa Askarne b, Said Ezrari a, c, Nabil Radouane a,
Abdelaaziz Farhaoui a, d, Hajar El Hamss a, Abdessalem Tahiri a, Essaid Ait Barka e,
Rachid Lahlali a, *
a
Phytopathology Unit, Department of Plant Protection, Ecole Nationale d’Agriculture de Meknès, Km10, Rte Haj Kaddour, BP S/40, Meknès 50001, Morocco
b
Laboratoire de Biotechnologies Microbiennes et Protection des Végétaux, Faculté des Sciences, Université Ibn Zhor, BP 8106, 8000 Agadir, Morocco
c
Microbiology Unit, Laboratory of Bioresources, Biotechnology, Ethnopharmacology and Health, Faculty of Medicine and Pharmacy Oujda, University Mohammed
Premier, Oujda, Morocco
d
Department of Biology, Laboratory of Biotechnology and Valorization of bio-Resources (BioVaR), Moulay Ismail University Faculty of Sciences, BP 11201, Meknes,
Morocco
e
Unité de Recherche Résistance Induite et Bio-Protection des Plantes-EA 4707-USC INRAE1488, Université de Reims Champagne-Ardenne, 51100 Reims, France

A R T I C L E I N F O A B S T R A C T

Keywords: The antifungal activity of Bacillus cereus (B8W8) was investigated against major post-harvest fungal pathogens
Botrytis cinerea affecting citrus and apples fruits namely Penicillium digitatum, Penicillium italicum, Geotrichum citri-aurantii,
Penicillium spp. Penicillium expansum, Botrytis cinerea, Monilinia laxa and Monilinia fructigena. The in vitro dual culture of B8W8
Monilinia spp.
and fungal pathogens showed high inhibition rates of the mycelial growth of Monilinia laxa and Penicillium
Geotrichum citri-aurantii
digitatum (71.4% and 72.5% respectively). Subsequently, the volatile compounds (VOCs) have a high antago­
Biocontrol
Biochemical traits nistic effect against Monilinia laxa (86.4%) and Monilinia fructigena (73.4%). In addition, the bacterial-free cell
Fruit quality parameters filtrate of B8W8 had a significantly important effect on the inhibition of spore’s germination and mycelial growth
of Penicillium expansum, Botrytis cinerea, Penicillium italicum and Geotrichum citri-aurantii. The in vivo bioassays
revealed a significant impact of B8W8 on fruit decays either by reducing the disease severity of causative agents
or by completely preventing their occurrence, particularly brown rot of apple caused by M. laxa and green mold
of citrus caused by P. digitatum (DS = 0%). However, the severity of sour rot of citrus caused by G. citri-aurantii
was only reduced by 50%. The semi-commercial trials showed a high potential of B. cereus B8W8 to reduce the
incidence of gray mold of apple and green mold of citrus to very low values during at storage. In addition, the
biological treatment with B8W8 was shown generally more effective than imazalil, the chemical treatment
reference. Furthermore, the rapid colonization of fruit wounds by B8W8 could promote its antagonistic ability.
Moreover, biochemical tests showed the ability of B8W8 to produce protease, amylase, and hydrocyanic acid
(HCN). Interestingly, the molecular analysis demonstrated the ability of this bacterium to produce the fengycin.
The secretion of this lipopeptide and lytic enzymes is more likely the major mechanism of action involved in the
biocontrol activity of this bacterium. Results indicated that quality parameters of fruit, when challenged post-
harvest pathogens and treated with B8W8, were mostly very close to those of the untreated control, suggest­
ing that B8W8 did not affect the fruit quality. Accordingly, it was concluded that B. cereus strain B8W8 could be
an effective biological agent to control the main fungal pathogens of apples and citrus fruits during post-harvest
period.

1. Introduction fruits in Morocco was 778.866 tons and 1.786.947 tons respectively
during 2020 (FAOSTAT, 2022). However, these crops face major prob­
Apple and citrus are two of the most extensively grown fruit crops in lems such as post-harvest diseases that affect the fruit quality and cause
Morocco and worldwide. The annual production of apples and citrus economic losses (Rharmitt et al., 2016). Monilina fructigena and M. laxa

* Corresponding author.
E-mail address: rlahlali@enameknes.ac.ma (R. Lahlali).

https://doi.org/10.1016/j.postharvbio.2023.112315
Received 5 November 2022; Received in revised form 16 February 2023; Accepted 27 February 2023
Available online 1 March 2023
0925-5214/© 2023 Elsevier B.V. All rights reserved.
M. Khadiri et al.
are the two main pathogens that cause the brown rot disease on apples
(Lahlali et al., 2020). Moreover, Botrytis cinerea and Penicillium expansum
are two fungal pathogens that cause gray and blue molds respectively in
apple fruit, leading to important economic losses during post-harvest
storage. In the case of citrus fruit, the major common and serious dis­
eases affecting fruit during storage are blue (Penicillium italicum) and
green (Penicillium digitatum) molds (Palou et al., 2002; Zhang et al.,
2004; Talibi et al., 2014). In addition, the sour rot caused by Geotrichum
citri-aurantii, although less frequent compared to the above-mentioned
citrus diseases, is a potentially devastating post-harvest disease (Eckert
and Brown, 1986; Karim et al., 2016). Infection by these pathogenic
fungi occurs throughout the growing season in pre- and post-harvest,
and commonly occurs with mechanical fruit wounds (Talibi et al.,
2014; Wenneker, 2020; Głos et al., 2022).
The fungicides are the main method for controlling post-harvest
fungal pathogens of pome and citrus fruits (Calvo et al., 2007). How­
ever, the frequent use of synthetic substances has led to the emergence of
new fungal strains resistant to divers fungicides, which makes the
management of post-harvest fruit diseases much more challenging
(Boubaker et al., 2009). Moreover, due to strict regulation, carcinoge­
nicity, long degradation periods, and severe and high residual toxicity,
the use of chemical treatments in packinghouse stations are increasingly
limited to reducing fruit fungicide residues and decreasing their toxi­
cological and environmental risks, as well as to protect consumers
(Tripathi and Dubey, 2004; Palou et al., 2008). Furthermore, the severe
requirements of sustainable agriculture, which include integrated crop
management and biological production, have required the development
of alternative strategies for the control of post-harvest fruit decays
(Adaskaveg and Förster, 2009; Droby et al., 2016; Spadaro and Droby,
2016).
Nowadays, biological control agents (BCAs) and mainly bacteria, are
among the most reliable strategies for managing fungal diseases (Droby
et al., 2016). In this regard, several species of the genus Bacillus are
widely used as biocontrol agents of fungal pathogens on the fruit and
have shown remarkable antagonistic activity against a variety of fungal
pathogens. Several studies evidenced the ability of these bacteria to
suppress post-harvest fungal infections caused by Penicillium spp. on
citrus fruit (Chen et al., 2018). For instance, the high efficacy of the
bacterial antagonist Bacillus amyloliquefaciens to reduce brown rot dis­
ease on apple fruit (M. fructigena and M. laxa) was recently proved
(Lahlali et al., 2020). Also, López-González et al. (2021) demonstrated
that ten Bacillus strains inhibited P. expansum’s mycelial growth and
decreased the severity of blue mold disease on apple. Gordillo et al.
(2015) underlined that some bacteria from the Bacillus genus produced
antifungal metabolites causing the plasma membrane disturbance of
Geotrichum citri-aurantii conidia. In addition, lipopeptides secreted by
the bacterium B. subtilis lowered significantly the disease severity of gray
mold (Toure et al., 2004). Furthermore, the bacterium Bacillus cereus
have shown to impede spore germination and mycelial growth of
P. digitatum (Mohammadi et al., 2017).
In Morocco and other countries, the control of fungal diseases of
apples and citrus is primarily based on the use of fungicides, which has
resulted in the appearance of resistant fungal strains and the risk of
residual toxicity. Therefore, it is vital to explore for alternative strategies
to manage these pathogens. Hence, this study aims to: i) assess the
effectiveness of a new screened bacterium Bacillus cereus against spores’
germination and mycelial growth of several post-harvest fungal patho­
gens (B. cinerea, P. expansum, M. fructigena and M. laxa) of apples, and
(G. citri-aurantii, P. italicum and P. digitatum) of citrus fruit; ii) evaluate
the ability of this bacterium to produce volatile organic compounds
(VOCs) and lytic enzymes; iii) confirm its efficacy through in vivo tests on
apples and citrus fruit; and iv) its impact on the quality parameters of
fruit.
2
Postharvest Biology and Technology 200 (2023) 112315
2. Material and methods
2.1. Fungal pathogen preparation
The post-harvest fungal pathogens used in the current study were
P. expansum (Aby4), B. cinerea (PR1), M. laxa (SPSV), M. fructigena
(VPBG), G. citri-aurantii (GK), P. italicum (IN) and P. digitatum (DN).
These fungal species were isolated and selected from other isolates based
on a pathogenicity test. They were stored at the phytopathology Unit of
the National School of Agriculture (ENA) in Meknes-Morocco. For cul­
tures preparation, one-week-old colony of each fungus was used to
inoculate the agar plates. Afterwards, the Petri plates were incubated
using an IN 30 cultivator instrument at 25 ◦ C for 7 d in darkness
(Memmert GmbH Co., Koln, Germany).
Spore suspensions were prepared by adding 10 mL of sterile distilled
water (SDW) supplemented with 0.05% (v/v) Tween 20–10-D-old fungal
colonies of each pathogen. The suspension was then filtered with
Whatman paper (No. 1) to separate spores from the mycelium and agar
debris, then the final concentrations were adjusted to 1 × 104 spores mL-
1
using a hematocytometer (Lyousfi et al., 2021).
2.2. Bacterial antagonist
The bacterial strain B8W8 was previously isolated from the natural
soil of the ENA-Meknes, Morocco, and identified as Bacillus cereus ac­
cording to the phylogenetic tree analysis (Fig. 1). Before each experi­
ment, the bacterial antagonist was maintained 24 h on Luria Bertani (LB)
medium at 25 ◦ C. The bacterial suspension was prepared by filling Petri
dishes with 10 mL of SDW and gently scraping off the bacterial colonies
with a sterile glass cell spreader Rod. The obtained suspension was
recovered in a Falcon tube (15 mL), homogenized by vortex, then
adjusted to 1 × 108 CFU/mL concentration (~2 OD at λ = 620 nm) using
a Spectronic 20 spectrophotometer (Zhou et al., 2019).
2.3. Hypersensitivity and growth temperature bioassay test
The pathogenicity of the bacterium Bacillus cereus B8W8 was eval­
uated using a hypersensitivity test on tobacco leaves (Nicotiana taba­
cum). An aliquot (100 μL) of the bacterial strain B8W8 (1 × 108 CFU/
mL) was injected at the level of the midrib of the lower part of the leaf.
Sterilized distilled water (EDS) was used as a negative control. Inocu­
lated plants were incubated in a growth chamber at 28 ◦ C and observed
after 24–48 h. A positive hypersensitivity reaction results in leaf dryness
and brown necrosis (Mohammadi et al., 2017). For the growth tem­
perature bioassay test, 100 μL of a bacterial suspension of B8W8 (1 ×
108 CFU/mL) was spread on Petri dishes containing an LB medium,
Fig. 1. Phylogenetic tree generated in MEGA X software using a Kimura two-
parameter model based on maximum-likelihood analysis of nucleotide se­
quences of the 16 S rRNA gene of the bacterial strain B8W8.
M. Khadiri et al.
these dishes were incubated for 24 h at different temperatures (28 ◦ C,
37 ◦ C and 40 ◦ C). The experiment was repeated twice over time, with
three replicates for each temperature.
2.4. Biochemical traits of bacterial strain B8W8
2.4.1. Amylase activity
Nutrient agar (NA) medium supplemented with 1% soluble starch
was used to assess the potential of B. cereus strain B8W8 to produce
amylase. A 10 μL aliquot of 2-D-old bacterial cultures were added in
triplicate to the center of the NA medium. After 3 d of incubation at
28 ◦ C, 3 mL of the iodine solution “Lugol” was spread over the agar
surface to visualize the starch hydrolysis. Halo formation around col­
onies is due to starch hydrolysis indicating the presence of amylase
enzyme, whereas its absence is considered as negative for amylase ac­
tivity (Dinesh et al., 2015). The following formula was used to calculate
the amylolytic index: Amylolytic index = Transparent halo diameter/­
colony diameter (Mubarik, 2010).
2.4.2. Protease activity
A skim milk-based medium was used to determine the ability of this
strain to produce proteolytic enzymes. Thus, one spot (5 μL) of the
above-mentioned bacterial suspension was placed in the center of each
Petri dishes in three replicates and set aside to dry, then incubated for 3
d at 28 ◦ C. The presence of proteolytic enzymes is translated by the
formation of the halo around the colonies while its absence indicates the
opposite (Prashar et al., 2013). The proteolytic index was determined as
previously described by Mubarik, 2010.
2.4.3. Cellulase activity
The ability of B. cereus B8W8 to produce cellulase was evaluated
using carboxymethylcellulose (CMC) agar. An aliquot of 10 μL of 24 h-
old bacterial culture was placed in the center of the Petri dishes in
triplicate, dried and incubated for 4 d at 28 ◦ C. Cellulase activity was
detected by pouring 0.1% Congo red (dye) onto the agar surface. After
15 min, the Petri plate was rinsed three times with NaCl (1 M) solution.
After 10 min, a clear zone forms around the colonies indicating positive
cellulose activity (Syed-Ab-Rahman et al., 2018). The cellulolytic index
was assessed as previously reported by Mubarik, 2010,
2.4.4. Production of hydrocyanic acid (HCN)
The ability of B. cereus strain B8W8 to produce hydrogen cyanide
(HCN) was qualitatively determined according to Trivedi et al. (2008).
The surface of LPGA medium that had been glycine-added (4.4 g/L) was
covered with an aliquot of 100 μL of the bacterial suspension. Then, a
sterile Whatman disc No. 1 was impregnated with a picrate solution
(2.5% picric acid + 12.5% anhydrous sodium carbonate (Na2CO3)) and
placed on the Petri dish lid, while control plates were only amended
with SDW. All plates were sealed with parafilm and incubated upside
down for 4 d at 28 ◦ C. The production of volatile hydrogen cyanide is
confirmed when the color of Whatman paper turns from yellow to or­
ange (Lahlali et al., 2020).
2.5. Detection of lipopeptides biosynthesis genes by PCR
Polymerase chain reaction (PCR) method was used to detect the
presence of the lipopeptides’ biosynthesis genes (bacillomycin, fengy­
cin, iturin, and surfactin) in the DNA extracted from the bacterial strain
B8W8. This method has been described as quick, easy, and effective
compared to other conventional identification methods (Hsieh et al.,
2004). In order to amplify those genes the specific primers used were
(Table 7): iturin (ITUP1F/ITUP2R), bacillomycin (BACC1F/BACC1R),
surfactin (P17/P18) and fengycin (FEND1F/FEND1R) (Hsieh et al.,
2004; Ramarathnam et al., 2007; Dimkić et al., 2013). Each PCR
amplification used a total of 25 μL of PCR mixture, which included 5 μL
of PCR buffer (5 ×), 1 μL of each primer (10 μM), 0.25 μL of Taq DNA
3
Postharvest Biology and Technology 200 (2023) 112315
polymerase (5 U/μL) (Bioline, London, UK), 2.5 μL of genomic DNA, and
15.25 μL of SDW. The PCR reaction tubes were deposited in a thermo­
cycler that had already been configured for DNA amplification of each
gene. PCR products were then visualized by electrophoresis on a 1.5%
agarose gel mixed with Cyber Safe (Invitrogen, CA, USA) in
Tris-Borate-EDTA buffer (TBE) (0.5 ×), and visualized by using a UV
illuminator and a digital recorded (Ezrari et al., 2021). Table 1.
2.6. In vitro effect of bacterial B8W8 on mycelial growth
To evaluate the ability of the bacterium B8W8 to inhibit the mycelial
growth of post-harvest fruit fungal pathogens, a dual culture bioassay on
PDA medium was performed. A twenty-four-hour-old bacterial culture
was streaked down the Petri dish’s perimeter in four equidistant streaks;
3–4 cm length (Lahlali et al., 2007). A 5 mm-mycelial plug cutting from
the growth margin of 7 D-old culture of each pathogenic fungus was
deposited in the center of a Petri dish containing PDA medium within
the bacterial band and incubated at 28 ◦ C. Petri dishes inoculated only
with mycelial plugs were used as negative controls. After 7 d of incu­
bation, the antagonistic activity was evaluated by calculating the inhi­
bition rate (IR) of mycelial growth as follows: IR = (C-T) / C × 100; with
C representing the average diameter of fungal colonies in the control
plate and T corresponding to the average diameter of fungal colonies in
biological treatment (Ezrari et al., 2021). The experiment was done
twice over time with three replicates for each combination of pathogen
and treatment.
To assess the antagonistic effect of the bacterium on the hyphal
structure of each pathogenic fungus, microscopic observations were
performed after one-week of dual culture bioassay. Relative to controls,
a mycelial plugs were removed from the zone of inhibition and exam­
ined by light microscopy to assess the hyphal damages triggered by the
bacterium (Lyousfi et al., 2021).
2.7. Effect of bacterial-free cell filtrates on spore germination and
mycelial growth
The bacterial strain was first subcultured on NA medium for 48 h at
25 ◦ C. Bacterial colonies were then transferred to nutrient broth con­
taining beef extract (10 g), peptone (10 g), NaCl (10 g), glucose (20 g)
and 1000 mL of SDW and kept con a rotary shaker (130 r/min) for 3 d at
30 ◦ C. The bacterial supernatant was collected after centrifuging the
bacterial suspension for 25 min at 5500 G force and filtered through a
0.22 m Millipore filter (Li et al., 2015). The resulting filtrates were then
kept at − 20 ◦ C until use. To assess the antifungal efficacy of bacterial
metabolites, Petri dishes containing PDA supplemented with 10% bac­
terial cell-free filtrate were inoculated with 5 mm mycelial plugs and
placed at 28 ◦ C. Plates inoculated with each fungal pathogen were
served as controls. After 7 d of incubation, mycelial growth diameter
was measured, and inhibition rates were calculated as previously
described. This experiment was repeated twice over time with three
replicates.
To evaluate the impact of bacterial cell-free filtrate on spore germi­
nation, an aliquot of the cell-free filtrate was combined with a conidial
suspension (1 ×104 spores mL-1) of each pathogenic fungus (1 v:1 v).
After 24 h of incubation periods, spore germination inhibition was
recorded under a light microscope using a micrometer. From each
replicate, 100 spores were evaluated. A spore was considered as
germinated if the germ tube length was equal or superior to the length of
the spore (Boubaker et al., 2016). Results are presented as inhibition rate
of spore germination and were calculated as previously described
(Boubaker et al., 2016) using the following formula: GI (%) = (Gc-Gt/
Gc) x 100; where Gc and Gt represent the average number of spores
germinated in controls and treatments, respectively. This experiment
was performed twice with three replicates.
M. Khadiri et al.
Table 1
Specific primers used for detection of lipopeptide genes.
Lipopeptides Primer code Primer Sequence
Iturin ITUP1F/ ITUP2R AGCTTAGGGAACAATTGT CATCGGGGCTTC/
TCAGATAGGCCGCCATATCG
GAATGATTCG
Fengycin FEND1F/ FEND1R TTTGGCAGCAGGAGAAGTT/ GCTGTCCGTTCTGCTTTTTC
Surfactin P17/ P18 ATGAAGATTTACGGAATTTA/ TTATAAAAGCTCTTCGTACG
Bacillomycin BACC1F/ BACC1R GAAGGACACGGCAGAGAGTC/ CGCTGATGACTGTTCATGCT
2.8. Effect of volatile compounds (VOCs) on mycelial growth
This bioassay was used to assess the antifungal activity of Bacillus
strain B8W8, producing VOCs that inhibit the fungal growth without
direct contact. The bacterial antagonist was inoculated in Luria-Bertani
(LB) medium in three parallel stripes at 28 ◦ C for 24 h, then each Petri
dish’s lid was swapped out for the bottom of another plate containing
PDA medium inoculated with a 5 mm mycelial plug of the fungal
pathogen (Héctor Calvo et al., 2020). The two bottoms were sealed
together with the parafilm to prevent loss of volatiles. The control
consisted of LB bacteria-free plates applying the same procedure
described by Lahlali et al. (2007). The experiment was done twice with
three replicates for each treatment Inhibition rates were calculated as
above after 7 d of incubation at 25 ◦ C.
2.9. In vivo bioassay
2.9.1. Fruits preparation
The citrus (Citrus sinensis cv. Navel) and apple (Malus domestica cv.
Golden delicious) fruits used in this study were harvested at maturity
stage and did not receive any post-harvest treatments. Healthy fruits
without any visible injuries rot and blemishes were selected and stored
at 4 ◦ C until their further use. Prior to each trial, fruits were surface-
disinfected by soaking in sodium hypochlorite solution (1%) for
5 min, rinsed twice with SDW, and then air-dried for one hour under a
laminar flow hood (Lyousfi et al., 2021). Disinfected fruits were
wounded at two equidistant sites in the equatorial region using a sterile
stainless steel rod; each wound had 3 mm in diameter and 4 mm in
depth (Lahlali et al., 2020).
2.9.2. In vivo biocontrol assay
To assess the efficacy in vivo of the Bacillus strain B8W8, each wound
was treated with 50 μL of bacterial suspension (1 ×108 CFU mL-1) and
inoculated with 50 μL of a conidial suspension (1 ×104 spores mL-1) of
each pathogenic fungus after 24 h of incubation periods (Mohammadi
et al., 2017). For the positive control, fruits were inoculated only with 50
μL of a conidial suspension of each pathogenic fungus while they were
inoculated with 50 μL of SDW in the negative control. To compare the
effectiveness of chemical treatment with B. cereus B8W8, fruits were
treated with 50 μL of the fungicide imazalil at a concentration of 1-μg
mL-1.
Afterwards, fruits were placed in disinfected plastic boxes with
sterile wet paper towels to maintain a high humidity, and then incubated
for 7 d at 25 ◦ C in a growth chamber (Rodríguez-Chávez et al., 2019).
This trials was conducted twice with five fruits (10 wounds) per treat­
ment. The lesion diameters were assessed 7 d post-inoculation using a
digital caliper and the disease severity was recorded as follows (Askarne
et al., 2012): Disease severity = (mean lesion diameter in mm of treat­
ment/mean lesion diameter of control) × 100.
2.10. Semi-commercial bioassay of B. cereus B8W8
For semi-commercial trials of the B8W8 bacterium, two fungal
pathogens affecting post-harvest apples and citrus (B. cinerea and
P. digitatum) were selected for a large-scale semi-commercial trial
4
Postharvest Biology and Technology 200 (2023) 112315
Product References
Length
2 kb (Dimkić et al., 2013)
964 bp (Ramarathnam et al., 2007)
675 bp (Hsieh et al., 2004)
875 bp (Ramarathnam et al., 2007)
because the B8W8 bacterium has shown a high antifungal capacity
against these two pathogens in vitro; on mycelial growth and spore
germination and also in vivo on disease severity. Fruits were disinfected,
dried as previously described and injured (1 mm in diameter, 2 mm in
depth) at four equidistant points. Then, they were inoculated by
spraying the spore solution of the pathogen (1 ×104 spores/mL). After
one hour of incubation at room temperature, the fruits were immersed in
a bacterial suspension (1 ×108 CFU/mL) and an aqueous solution of
imazalil (200 mg/L) for 2 min. Fruits soaked in EDS served as a control.
Fruits were placed in sterile plastic bags (20 fruit/bag) with three rep­
licates and incubated at 5 ◦ C. The number of infected fruits was moni­
tored every 5 d until fruits in the control treatment were completely
infected (Lahlali et al., 2005; Calvo et al., 2017; Lahlali et al., 2020). The
experiment was repeated twice over time. The disease incidence (%) was
calculated according to the following formula:
Incidence = (number of infected fruits / total number of fruit) × 100.
2.11. Effect of Bacillus B8W8 strain on quality parameters
2.11.1. Weight loss
The weight of each fruit was recorded before (BT) and 7 d after
treatment (AT) and weight loss was calculated as: [100 × (BT weight –
AT weight)/BT weight] (Lyousfi et al., 2021).
2.11.2. Total soluble solids
The total soluble solids (TSS) content was evaluated by measuring
the refractive index of the fruit 7 d post-incubation using a Model PAL-1
digital refractometer (Atago, Tokyo Tech., Tokyo, Japan), and the result
was reported as % (El Guilli, et al., 2016).
2.11.3. Firmness
Firmness value was individually evaluated at four sites of the equa­
torial region on each fruit using the Agrosta®100 USB Digital Firmness
Instrument (Zhu et al., 2019). The measurements were made by a
10 mm tip sensor (Shore A standard = 8.06 N for 100%).
2.11.4. Titratable acidity
Titratable acidity (TA) was measured 7 d after incubation by titration
with 0.1 mM NaOH at pH 8.1 and two drops of 1% phenolphthalein as a
pH indicator on 10 mL of fruit juice diluted with 50 mL of SDW (Lyousfi
et al., 2021). The following formula was used to express the titratable
acidity in percentage of malic acid for apples and in percentage of citric
acid for citrus:
TA (%) = [(mL NaOH) (N NaOH) (meq.wt.acid)/mL sample] × 100 (
Zhang et al., 2009).
2.11.5. Maturity index
The maturity index (MI) was calculated as the ratio of TSS to TA
(Pobiega et al., 2021).
2.12. FTIR analysis
To know the impact of treatments on composition of peel fruit in
term of macromolecules changes, peel parts of apples and oranges fruits
(healthy, control and treated fruit) were dried at 45 ◦ C and grounded
M. Khadiri et al.
using a mortar. The resulting powder was placed on the ATR detector of
the FTIR Spectrometer (PerkinElmer Spectrum Two, U.S.). The ATR cell
was disinfected with ethanol and sterile distilled water before and after
each use. The average of the three reflectance spectra of each sample
was captured with a wavelength range between 4000 and 500 cm-1 and
a resolution of 4 cm-1. Spectra were baseline corrected, normalized
using "Spectrum version 10.6.1" software and plotted by "OriginPro
2021" software (Rodríguez-Chávez et al., 2019).
2.13. Population dynamics of bacterial strain B8W8 in fruit wounds
This parameter was carried out according to the protocol suggested
by (Hong et al., 2014) with slight modifications. Fruits were disinfected,
dried as previously described and injured (1 mm in diameter, 2 mm in
depth) at four equidistant points. 20 μL of the bacterial suspension of
strain B8W8 (1 ×108 CFU/mL) was individually inoculated into the
wounds and the inoculated fruits were incubated at 28 ◦ C in the light.
Growth of Bacillus cereus B8W8 at the wound was monitored for the
duration of the incubation. Tissue samples containing the entire wound
were removed, using a sterile knife, at different times (0, 24, 48, 72 and
96 h) after inoculation, weighed and placed in tubes containing a pro­
portional amount of buffered peptone water. Serial dilutions of each
sample were placed on LB. Bacteria colonies were counted to calculate
colony means (Log10 CFU) based on fresh weight. Three replicates of
five fruits were used for each incubation period. This experiment was
performed twice over time.
2.14. Effect of B. cereus B8W8 on the content of total polyphenols,
flavonoids and the yield of water-soluble polysaccharides of apple and
citrus fruits
Fruits were treated in the same way as in Section 2.9. After they were
cut into small pieces and put in an oven (memmert UF 160, B520.0283)
at 45 ◦ C for 5 days to dry them. Then the samples were ground and
sieved to obtain a fine powder (El Khetabi et al., 2020). The polyphenols
were extracted by decoction, by putting 0.1 g of the powder in 100 mL of
distilled water. The mixture was boiled for 30 min and then filtered
through Whatman N 1 filter paper (Mahmoudi et al., 2013).
The total polyphenol content of apples and oranges was measured
based on the following colorimetric method: 500 μL of Folin-Ciocalteau
reagent (10%) was mixed with 100 μL of aqueous extract (1 g/L), then
400 μL of aqueous sodium carbonate solution (7.5% w/v) were added.
Then, the mixture was incubated for 60 min at room temperature and
then the absorbance was measured using a Spectronic 20 spectropho­
tometer at 765 nm. A calibration curve (Y = 0.0057X+ 0.0992, R2 =
0.9932) was generated using a gallic acid standard in the range of
0–300 mg/L. The total phenolic compounds were expressed in gallic
acid equivalent to mg/1 g of dry extract. All measurements were made
in 3 repetitions and twice over time (VL et al., 1999; Waterhouse, 2002;
D’Abrosca et al., 2007; Tariq Bouhlali et al., 2015).
The total flavonoid content was measured by mixing two hundred
microliters of extract (1 g/L) with 1 mL of distilled water. Then, 100 μL
of aqueous solution of sodium nitrite (5% w/v) was added, followed by
100 μL of aqueous solution of aluminum chloride (10% w/v). The
mixture was incubated for 5 min at room temperature, and then 1 mL of
sodium hydroxide (1 M) was added to the mixture. Absorbance was
determined using a Spectronic 20 spectrophotometer at 510 nm. The
calibration was prepared using catechin in the range of 0–100 mg/L (Y
= 0.0084X - 0.0021, R2 = 0.9954). The results were expressed in mg of
catechin equivalent (CE)/1 g of dry extract according to the following
formula: CP, CF ¼ c£v£f/m.
With CP, CF: the content of total polyphenols or flavonoids in mg/g
of the dry extract, c: concentration of the sample determined from the
calibration curve in mg/L, v: volume of the extract in L, f: dilution factor
and m: dry weight of the extract in g. All measurements were made in
three repetitions and twice over time ( Kim et al., 2003; D’Abrosca et al.,
5
Postharvest Biology and Technology 200 (2023) 112315
2007; Souhilaa, 2013; Sir Elkhatim et al., 2018).
To determine the yield of water-soluble polysaccharides, the powder
of each sample was extracted three times with 85% ethanol (1:10, w/v)
under reflux at 80 ◦ C for 1 h to remove impurities and small lipophilic
molecules. It was then washed with the same ethanolic solution and
filtered. The extract was concentrated to 25% of the original volume by a
rotary evaporator under vacuum at 60 ◦C (BUCHI R-300 HL Labor­
technik AG 9230 Flawil/ Switzerland) and then centrifuged at 4000 G
force for 15 min using a centrifuge (ROTINA 420, REF 4701/Germany).
Ethanol was added slowly to the supernatant with stirring to obtain a
final concentration of 70% v/v. The resulting solution was stored
overnight at 4 C. The precipitate was obtained by centrifugation at
4000 G force for 15 min. The resulting precipitate was washed three
times with acetone and dried by a lyophilizer (Telstar 5097, LYOQUEST
– 55 PLUS/Spain). The yield of water-soluble polysaccharides was
expressed either as a weight ratio (%) relative to the initial weight of the
sample (Hwang et al., 1998; Dou et al., 2015; Mehellou et al., 2017; Peng
et al., 2019).
2.15. Statistical analysis
All in vitro and in vivo tests were repeated twice over time. Datasets
obtained were presented as average ± standard deviation. For each
experiment, analysis of variance (ANOVA) was applied using SPSS sta­
tistical software (version 20, IBM SPSS Statistics 20) and when the effect
was significant, the Duncan’s multiple range test was applied for means
separation at P ≤ 0.05.
3. Results
3.1. Hypersensitivity reaction and growth temperature bioassay
The results showed a negative hypersensitivity reaction of the bac­
terium Bacillus cereus B8W8 (Fig. S4). According to outcomes of the
growth temperature bioassay, the bacterial strain B8W8 had a high
ability to grow at 28 ◦ C but not at 37 ◦ C and 40 ◦ C.
3.2. Biochemical Traits of bacterial antagonist B8W8
B. cereus B8W8 was characterized by its ability to produce lytic en­
zymes such as amylase, protease, and cellulase, as well as its ability to
produce hydrogen cyanide. Protease and amylase production results
were found to be positive with indices of 1.06 and 1.39, respectively.
However, B.cereus B8W8 was unable to produce the cellulase (Table 2).
3.3. Detection of biosynthetic lipopeptide genes by PCR
The PCR was used to investigate the presence of the biocontrol genes
responsible for lipopeptides biosynthesis by B. cereus B8W8. The results
of the detection of the biosynthesis lipopeptides genes such as bacillo­
mycin, iturin, surfactin and fengycin are presented in Fig. S1. As results,
B. cereus had only the gene responsible for fengycin production, while it
Table 2
Capacity of Bacillus cereus (B8W8) to produce lytic enzymes such as amylase,
protease, cellulase as well as hydrocyanic acid (HCN), which are implicated in
the biocontrol mechanisms.
Bacterial Amylolytic Proteolytic Cellulosic HCN
antagonist index index index
Bacillus cereus 1.06 ± 0.06b 1.39 ± 0.07c 0a +
(B8W8)
All index were calculated as the diameter of the halo (mm) / diameter of a
colony (mm). Data represent mean ± standard deviation (SD). Values having the
different letter are significantly different according to the Duncan’s test
(P < 0.05). (+): Ability to produce the hydrocyanic acid.
M. Khadiri et al. Postharvest Biology and Technology 200 (2023) 112315

lacked the other genes. 3.5. In vitro effect on spore germination

The B. cereus B8W8 cell-free culture filtrate displayed different

3.4. In Vitro effect on mycelial growth
antagonistic effect on the spore germination of the different post-harvest
fungal pathogens. Thus, the filtrate had an inhibitory effect of 85.5%
3.4.1. Dual culture bioassay
against B. cinerea and 74% of P. italicum and P. expansum spores. In
Using a dual culture method, the statistical analysis showed that
addition, the inhibition percentage of spore germination of G. citri-aur­
B. cereus had an antagonistic potential on the mycelial growth of the
antii and P. digitatum was relatively high (65.4% and 57.9% respectively)
most studied pathogens (Fig. S2). Thus, the bacterium showed very high
compared to that of spore germination of the two Monilinia species,
inhibition rates of mycelial growth of P. digitatum and M. laxa (72.5%
specifically M. fructigena (Table 3).
and 71.4% respectively). Also, inhibition rates for P. expansum,
B. cinerea, and P. italicum ranged from 60% to 67%, while the lowest
3.6. In vivo effectiveness of B. cereus strain B8W8
inhibition rates were recorded for M. fructigena and G. citri-aurantii, with
31.3% and 40.9% respectively (Table 3).
The present findings from the in vivo trial showed that the B. cereus
B8W8 was effective in reducing the development of rot decays in apples
3.4.2. Effect of B. cereus strain B8W8 on the mycelial structure
and citrus fruits (Figs. 2, 3). Indeed, the severity of brown rot of apple,
The microscopic observations of the mycelium of the pathogenic
caused by M. laxa, and green mold of citrus, caused by P. digitatum, was
fungi in direct culture bioassays with B. cereus strain B8W8, showed
lowered to 0% compared to 100% in the control. In contrast, the
cytological alterations in the mycelial structure compared to the un­
fungicidal imazalil lowered the severity of brown rot of apples and green
treated control (Fig. S3). These substantial abnormalities were most
mold of citrus only to 11% and 46%, respectively (Fig. 4). In addition,
frequently associated with hyphal swelling, deformation, budding and
B. cereus B8W8 reduced the severity of blue mold on apples to 10% and
vacuolation of the mycelial structure (Fig. S3).
grey rot to 17%. However, chemical treatment had only lowered the
severity of diseases to 35% and 55% respectively. Furthermore, B. cereus
3.4.3. Effect of the bacterial cell-free filtrate
B8W8 reduced the disease severity of blue mold of citrus to 23%. Despite
The B. cereus cell-free filtrate had lowered the growth of seven post-
the relative effectiveness of this BCA against M. fructigena, the fungicide
harvest fungal pathogens of apples and citrus, with a very high inhibi­
imazalil was able to inhibit this fungus by 86%. In contrast, neither
tion rate against mycelial growth of B. cinerea approaching 80%. In
biological nor chemical treatments were effective against citrus sour rot
addition, the bacterium cell-free culture was able to reduce the diameter
caused by G. citri-aurantii (Fig. 4).
of the colony of P. expansum, P. italicum, G. citri-aurantii, and P. digitatum
by 68.6%, 68.1%, 63.6% and 51.9%, respectively. However, the myce­
3.7. Efficacy of Bacterial strain B8W8 under semi-commercial conditions
lial growth of the two Monilinia species was not affected by the bacte­
rium culture filtrate (Table 3).
Statistical analysis of the obtained results of the semi-commercial
trails showed substantial differences of disease incidence of gray mold
3.4.4. Effect of volatile organic compounds (VOCs)
and green mold between untreated controls, biological and chemical
The in vitro VOCs bioassay showed high antagonist activity of B8W8
treatments. Indeed, the biocontrol agent B. cereus B8W8 was able to
against M. laxa and M. fructigena with an inhibition rate of 86.4% and
reduce the incidence of gray mold to very low values during regardless
73.4%, respectively. The production of these volatile antifungal com­
of the incubation period (0–13.51%). In addition, it turned out that there
pounds inhibited the mycelial growth of P. digitatum by 66.9%. How­
was no difference between disease incidences obtained biological
ever, these VOCs showed low antifungal effect against P. expansum, P.
treatment (B8W8) and chemical treatment with imazalil (Fig. 5A). In
italicum, G. citriaurantii and B. cinerea (Table 3).
addition, B. cereus B8W8 was shown effective in suppressing the green
mold whatever disease the incubation period (0–8.51%). In contrast, the
Table 3 fungicidal imazalil did not displayed an important effect on green mold
In vitro effect of Bacillus cereus strain B8W8 cell-free culture filtrate on mycelial
disease; the incidence was 45% after 20 days of incubation (Fig. 5B).
growth and spore germination inhibition of M. fructigena, M. laxa, B. cinerea, P.
expansum, G. citri-aurantii, P. digitatum and P. italicum after 7 days of incubation
at 25 ◦ C.
3.8. Biocontrol effect on fruit quality parameters

Inhibition (%)
Statistical analysis showed a significant effect of the biological
Species Mycelial growth Spore treatment on the quality parameters of apples. Indeed, the bacterial
germination antagonist B8W8 was able to preserve the weight of the apples in
DC BF VOCs BF
M. laxa 71.40 30.28 86.46 46.35 ± 0.90b
M. laxa, M. fructigena, P. expansum and B. cinerea treatments when
± 0.75 f ± 2.37b ± 0.74 g compared with untreated control. In fact, the weight of apple fruit had
M. fructigena 31.30 6.08 73.45 27.72 ± 0.86a submitted a small loss using the biological treatment but much less than
± 2.24a ± 0.57a ± 1.82 f the weight loss in the case of chemical treatment or untreated control
B. cinerea 63.37 79.71 42.27 85.55 ± 0.68 f
except for M. fructigena where imazalil had reduced the weight loss of
± 0.37d ± 0.32 f ± 0.59a
P. expansum 66.94 68.65 56.74 74.79 ± 0.72e apples compared to the antagonistic bacterium. Likewise, the use of
± 1.60e ± 0.49e ± 0.14d B. cereus strain B8W8 against M. laxa maintained apple firmness.
G. citri- 40.97 63.66 48.47 65.47 ± 0.78d However, the firmness was slightly lower for apples inoculated with
aurantii ± 0.25b ± 1.12d ± 1.34b other fungal species and treated with B8W8 compared to the negative
P. digitatum 72.54 51.93 66.95 57.92 ± 0.72c
± 2.25 f ± 0.56c ± 0.87e
control but was significantly higher than untreated control.
P. italicum 60.83 68.13 51.37 73.53 ± 1.26e The percentage of total soluble solids was decreased by the apple
± 0.56c ± 1.30e ± 1.76c pathogens (untreated control). However, the biological treatment with
Data represent average inhibition rate (%) ± standard deviation (SD). Values B8W8 had relatively maintained this percentage close to that of negative
having the same letter, in the same column, are not significantly different ac­ control especially in the case of M. laxa. The ability of the B8W8 strain to
cording to the Duncan test (P < 0.05). antagonize M. laxa increased retention of apple acidity, with the same
DC: direct confrontation, BF: bacterial cell-free culture filtrate , VOCs: Volatile effect as the chemical treatment, bringing it closer to that of the negative
organic compounds control. Generally, the biological treatment had a positive impact on the

6
M. Khadiri et al. Postharvest Biology and Technology 200 (2023) 112315

Fig. 2. In vivo test of Bacillus cereus (B8W8) to control apple rots (Golden delicious) after 7 d of incubation at 25 ◦ C. A, B and C are respectively the untreated control,
treatment by imazalil (1 µg mL-1) and treatment by B8W8 against Monilinia laxa; D, E and F are respectively the untreated control, treatment by imazalil (1 µg mL-1)
and treatment by B8W8 against Penicilium expansum; G, H and I are respectively the untreated control, treatment by imazalil (1 µg mL-1) and treatment by B8W8
against Botrytis cinerea; J, K and L are respectively the untreated control, treatment by imazalil (1 µg mL-1) and treatment by B8W8 against Monilinia fructigena.

acidity of apples for all tested pathogenic fungi. Interestingly, untreated
apples inoculated by P. expansum had the highest acidity value. The
highest maturity index was obtained in apples treated with B8W8
against M. laxa compared to other treatments (Table 4).
The experiments conducted on citrus fruit revealed an important
effect of biocontrol treatment with the bacterium B. cereus strain B8W8
on the citrus fruit quality parameters. Indeed, the antagonistic ability of
this bacterium against P. digitatum reduced the weight loss of oranges
(Navel) to a very low percentage. Similarly, the treatment with B8W8
bacterium against G. citri-aurantii and P. italicum reduced the weight loss
of oranges compared to the untreated control. The B8W8 strain treat­
ment preserved the firmness of the P. digitatum-inoculated oranges. In
addition, the firmness was high in the case of the biological treatment
against P. italicum and G. citri-aurantii compared to imazalil or untreated
control. The percentage of TSSs was conserved in oranges fruit treated
infected with P. digitatum or P. italicum then inoculated with B8W8.
However, this parameter decreased when the bacterium B8W8 was used
against G. citri-aurantii as well as in both chemical treatment and un­
treated controls against all studied fungal species. The antifungal ac­
tivity of the B8W8 strain against P. digitatum maintained the acidity of
oranges compared to the negative control. This acidity was lower for
treatment with B8W8 against G. citri-aurantii and P. italicum compared to
chemical treatment and untreated control. The highest maturity index
and closest to that of the negative control was found in the case of
treatment with B. cereus strain B8W8 against P. digitatum in oranges
(Table 5).
3.9. Impact of biological treatment on functional groups of fruit
The spectra obtained by FTIR showed the appearance of a new peak
of 2850 cm-1 corresponding to the C─H bond for apples inoculated with
M. laxa and P. expansum and treated with imazalil and for the untreated
control (Fig. 6). A peak of 1735 cm-1 corresponding to the C═O bond
was observed for plant infected with M. fructigena then inoculated with
the bacterial antagonist and for the untreated control. For all the
negative controls of apples, three peaks were observed: 1058 cm-1
(C─O), 2925 cm-1 (C─H) and 3306 cm-1 (O─H). For the negative con­
trols of citrus (Navel), two peaks were obtained: 1645 cm-1 and
3316 cm-1 corresponding respectively to C─C and O─H bonds (Larkin,
2017; Socrates, 2004), with the absence of new peaks after having
inoculated the pathogen G. citri-aurantii (Fig. 6).
3.10. Population dynamics of B. cereus B8W8 in fruit wounds
The results obtained from the population dynamics of the bacterium
B. cereus B8W8 in wounded apple and citrus fruits showed a rapid in­
crease in its density after 24 h of incubation at 28 ◦ C. Then, the pop­
ulations of B8W8 continued to evolve slightly until 72 h of incubation
period. Interestingly, the population density of this bacterial antagonist
persisted between 72 h and 96 h of incubation times. Furthermore, our
results underline that the population density of B8W8 was relatively
higher in citrus than in apple (Fig. 7).
3.11. Effect of B. cereus B8W8 on the content of total polyphenols,
flavonoids and the yield of water-soluble polysaccharides of apple and
citrus fruits
The results of the tests of the effect of biological treatment by Bacillus
cereus B8W8 on the content of total polyphenols, flavonoids and on the
yield of water-soluble polysaccharides of apple and citrus fruits showed
a highly significant difference between the treatments carried out and
the untreated controls. Indeed, apples treated with Bacillus cereus B8W8

7
M. Khadiri et al. Postharvest Biology and Technology 200 (2023) 112315

Fig. 3. In vivo test of Bacillus cereus (B8W8) against citrus rots (Navel) after 7 d of incubation at 25 ◦ C. A, B and C are respectively the untreated control, treatment by
imazalil (1 µg mL-1) and treatment by B8W8 against Penicilium digitatum; D, E and F are respectively the untreated control, treatment by imazalil (1 µg mL-1) and
treatment by B8W8 against Penicilium italicum; G, H and I are respectively the untreated control, treatment by imazalil (1 µg mL-1) and treatment by B8W8 against
Geotrichum citri-aurantii.

against blue mold, gray mold and brown rot caused by Monilinia laxa
had a higher content of total polyphenols and flavonoids compared to
those not treated against these fungal diseases at exception of brown rot
caused by Monilinia fructigena. In addition, the yield of water-soluble
polysaccharides from apples treated with B8W8 is very close to that of
the negative control and relatively low compared to untreated apples
(Table 6). Regarding citrus fruits, the concentration of total polyphenols
and flavonoids of fruits biologically treated with B8W8 against citrus
green mold and blue mold was significant. However, this content was
average for citrus undergoing biological treatment against sour rot, and
in the case of chemical treatment against the three fungal diseases
studied. Moreover, the content of these chemical compounds was rela­
tively low for the untreated controls. For the yield of water-soluble
polysaccharides extracted from citrus fruits, the weight ratio obtained
showed that this yield was approximately similar for the negative con­
trol and the biological and chemical treatments against fungal diseases
of citrus fruits except against sour rot, one of which slight increase was
observed. Similarly, an increase in this percentage was observed in the
case of the untreated controls (Table 7).
4. Discussion
Chemical treatment has been the primary strategy in the control of
post-harvest fruit diseases. However, biological control agents such as
bacteria against fungal pathogens causing fruit rots have emerged as one
of the most dependable and promising alternatives to synthetic fungi­
cides to create a sustainable lifestyle (Compant et al., 2005; Spadaro and
Droby, 2016). The use of antagonistic bacteria as a biological control
agent is an effective strategy that does not represent a risk to the envi­
ronment, humans and animals (Carmona-Hernandez et al., 2019). In this
context, the current study evaluated the antifungal potential of B. cereus
strain B8W8 against the apple and citrus rots. In vitro tests showed a high
antifungal capacity of B8W8 against fungal pathogens affecting apples
and citrus fruit. B. cereus strain B8W8 was able to inhibit M. laxa
mycelial growth by more than 71%, corroborating the study by Lahlali
et al., 2020. Moreover, this bacterium significantly affected the radial

8
M. Khadiri et al. Postharvest Biology and Technology 200 (2023) 112315

Table 4
Effect of Bacillus cereus strain B8W8 on the quality parameters of apple fruit 7
days post-incubation at 25 ◦ C.
Treatments Weight Firmness (N) TSSs TA (%) MI
loss (%) (%)

Negative 0.051 6.59 14.2 0.166 86.02

control ± 0.115a ± 0.17a ± 0.29a ± 0.016a ± 7.53a
M. laxa (B) 0.39 6.40 13.94 0.189 74.24
± 0.15a ± 0.19ab ± 0.18a ± 0.016ab ± 6.96b
M. laxa (F) 0.97 6.05 13.24 0.213 62.41
± 0.16b ± 0.21c ± 0.49b ± 0.016bc ± 4.84c
M. laxa (C) 2.64 4.13 10.02 0.389 25.81
± 0.37d ± 0.30 f ± 0.45d ± 0.018 g ± 1.15 h
M. 1.82 5.14 12.08 0.303 39.97
fructigena ± 0.21c ± 0.31e ± 0.31c ± 0.017e ± 2.01fg
(B)
Fig. 4. Disease severity obtained on apple and citrus fruit treated with the M. 1.00 5.64 12.98 0.236 55.32
biocontrol agent Bacillus cereus strain B8W8 and challenged postharvest fungal fructigena ± 0.17b ± 0.18d ± 0.25b ± 0.017c ± 4.94d
pathogens. Apples and citrus fruit were treated with strain B8W8 and fungicide (F)
imazalil at 1 µg mL-1, inoculated by fungal pathogens and held for 7 d at 25 ◦ C. M. 2.69 4.08 10 0.395 25.35
Treatments having the same letter are not significantly different according to fructigena ± 0.28d ± 0.26 f ± 0.23d ± 0.020 g ± 1.51 h
the Duncan test (p < 0.05). (C)
P. 0.94 6.16 13 0.272 48.10
expansum ± 0.20b ± 0.15bc ± 0.16b ± 0.026d ± 4.14e
(B)
P. 1.88 5.09 11.92 0.340 35.11
expansum ± 0.17c ± 0.32e ± 0.36c ± 0.021 f ± 2.20 g
(F)
P. 3.22 3.69 9.45 0.445 22.93
expansum ± 0.84e ± 0.07 g ± 0.35d ± 0.014 h ± 2.79 h
(C)
B. cinerea 1.04 5.58 13.02 0.295 44.48
(B) ± 0.36b ± 0.16d ± 0.24b ± 0.030de ± 3.88ef
B. cinerea 2.11 5.13 11.66 0.307 38.11
(F) ± 0.13c ± 0.30e ± 0.15c ± 0.019e ± 2.28 g
B. cinerea 2.84 3.90 9.94 0.371 27.06
(C) ± 0.33de ± 0.28fg ± 0.23d ± 0.045 g ± 2.97 h

Data represent mean ± standard deviation (SD). Values having the same letter,
in the same column, are not significantly different according to the Duncan test
(P < 0.05). TSSs: Total Soluble Solids; TA: Titratable Acidity; MI: Maturity
Index; N: Newton; B: Treatment by the bacterial suspension of Bacillus cereus
strain B8W8; F: Treatment by Imazalil Fungicide; C: Untreated Control (spore
suspension + SDW); the negative control was inoculated only by the sterile
distilled water (SDW).

Fig. 5. Incidence of gray mold in apples (A) and green mold in citrus fruit (B)
treated with the bacterial antagonist Bacillus cereus B8W8. Apples and citrus
fruit were inoculated with the fungal pathogens Botrytis cinerea and Penicillium
digitatum, respectively, treated with the B8W8 strain and the fungicide imazalil
at 200 mg/L and incubated at 5 ◦ C for 5, 10, 15 and 20 d. Treatments with the
same letter are not significantly different according to Duncan’s test (p < 0.05).
growth of B. cinerea and P. expansum, with inhibition rates of 63.3% and
66.9%, respectively. Similar results were found by Cozzolino et al.
(2020) with a bacterial antagonist of the genus Bacillus. However, the
strain B8W8 had only inhibited 31.3% of the growth of M. fuctigena,
compared to results reported by Lahlali et al., 2020 where the BCA
Bacillus sp. showed a significant inhibitory potential of the mycelium of
M. fructigena. According to Mohammadi et al. (2017), Bacillus cereus had
a potential to inhibit the growth of P. digitatum, which is compatible with
the current study (72.5% inhibition rate), confirming therefore results
reported by Hao et al. (2011). More recently, Tian et al. (2020) have
found a very high efficacy of Bacillus sp. in reducing the growth of
G. citri-aurantii. However, the B8W8 strain inhibited the
G. citri-aurantii’s growth by less than 50%. The volatile organic com­
pounds (VOCs) of B. cereus strain B8W8 had significantly different
antifungal capacity on the studied pathogens. The VOCs triggered a very
strong antagonistic effect against the brown rot caused by M. laxa and
M. fructigena with an inhibition rate of 73.4% and 86.4%, respectively.
The results presented are consistent with a study by Lahlali et al., 2020
showing a significant effect of VOCs from bacteria belonging to the
genus Bacillus on M. fructigena and M. laxa. Also, Calvo et al., (2020)
found that VOCs from bacteria belonging to the genus Bacillus have a
high efficacy against mycelial growth of B. cinerea but only a weak effect
against P. expansum. Nevertheless, our data showed that the VOCs of
B. cereus strain B8W8 have poor efficacy to inhibit the growth of
B. cinerea and P. expansum. In addition, these products have the capacity
to inhibit almost 50% of the radial growth of P. italicum and
G. citri-aurantii but they have an important antifungal effect against
P. digitatum (66.9%). These outcomes are consistent with those found by
Mohammadi et al., (2017) where the volatile metabolites of B. cereus
inhibited 70% of the mycelial growth of P. digitatum.
In the present study, a correlation was found between the antago­
nistic potential of the bacterium B8W8 against spore germination and
mycelial growth of the studied pathogens. These results showed a high
antifungal capacity of the bacterial cell-free filtrate of B8W8 against the
spore germination and the mycelial growth of P. expansum and

9
M. Khadiri et al. Postharvest Biology and Technology 200 (2023) 112315

Table 5 found the high antifungal activity of B. subtilis against M. fructicola and
Effect of Bacillus cereus strain B8W8 on the quality parameters of citrus fruit 7 M. laxa, and they suggested that antibiosis might be a key factor in its
days post-incubation at 25 ◦ C. antagonistic activity in response to the detection of lipopeptides in
Treatments Weight Firmness TSSs (%) TA (%) MI bacterial free-cell filtrates. The antifungal potential of the volatile
loss (%) (N) organic compounds of B8W8 may be due to the ability of this bacterium
Negative 0.067 7.11 13.26 0.256 52.07 to produce HCN. A previous study reported that the production of vol­
control ± 0.092a ± 0.11a ± 0.24a ± 0.022a ± 4.16a atile compounds like HCN by the bacterium Bacillus sp. was the main
P. digitatum 0.48 7.04 12.94 0.284 45.70 cause of inhibition of some fungal pathogens (Prashar et al., 2013).
(B) ± 0.21b ± 0.12a ± 0.27a ± 0.017a ± 3.55b
Blumer and Haas (2000) found that hydrogen cyanide (HCN) excreted
P. digitatum 2.01 5.03 8.86 0.573 15.47
(F) ± 0.26d ± 0.19d ± 0.48c ± 0.025c ± 9.98d by some antagonistic bacteria is a potent inhibitor of cytochrome c ox­
P. digitatum 3.06 4.37 7.34 0.732 10.04 idase; the terminal component of the respiratory chain of several or­
(C) ± 0.43e ± 0.26e ± 0.32e ± 0.045de ± 4.72e ganisms. The strain B8W8 had the ability to secrete protease and
P. italicum 1.19 6.03 11.38 0.490 23.29 amylase; these two lytic enzymes could play a key role in the biocontrol
(B) ± 0.15c ± 0.21b ± 0.35b ± 0.032b ± 1.62c
P. italicum 1.97 5.11 9.1 0.595 15.30
of fungal species. In accordance, Weller (2007) and Elshafie et al. (2012)
(F) ± 0.31d ± 0.24d ± 0.42c ± 0.022c ± 7.20d found that one of the most important mechanisms involved in the bio­
P. italicum 3.05 4.59 7.1 0.740 9.43 logical control of phytopathogenic fungi is the disruption of fungal cell
(C) ± 0.33e ± 0.13e ± 0.37de ± 0.041e ± 8.08e walls by using hydrolytic enzymes produced by bacterial strains. In this
G. citri- 2.05 5.66 8.84 0.564 15.69
context, several studies showed the very important role of protease
aurantii ± 0.08d ± 0.22c ± 0.28c ± 0.028c ± 8.86d
(B) production in the biocontrol of fungal diseases (Esmaeel et al., 2018;
G. citri- 2.20 4.88 8.12 0.575 14.17 Sethi and Mukherjee, 2018). In addition, Kim et al. (2016) suggested
aurantii ± 0.06d ± 0.30d ± 0.38d ± 0.039c ± 1.04d that the production of lytic enzymes such as amylase by the bacterium
(F) B. subtilis strain APEC170 may promote antifungal capacity against
G. citri- 3.00 4.47 8.04 0.694 11.59
several fungal pathogens that affect post-harvest apples. The inhibition
aurantii ± 0.09e ± 0.22e ± 0.31d ± 0.020d ± 4.33e
(C) rates of cell-free bacterial culture filtrate, volatile organic compounds,
and direct confrontation of B. cereus B8W8 strain against the pathogenic
Data represent mean ± standard deviation (SD). Values having the same letter in
fungi studied were different, which could be explained by the fact that
the same column are not significantly different according to the Duncan test
the B8W8 bacterium uses several modes of action to trigger its antago­
(P < 0.05). TSSs: Total Soluble Solids; TA: Titratable Acidity; MI: Maturity
Index; N: Newton; B: Treatment by a bacteria suspension of Bacillus cereus strain nistic activities and that the effectiveness of each mechanism differs
B8W8; F: Treatment by Imazalil Fungicide; C: Untreated Control (spore sus­ depending on the nature of the encountered pathogen. This finding is
pension + SDW); The negative control was inoculated only by the sterile distilled consistent with those reported in previous studies (Gotor-Vila et al.,
water (SDW). 2017; Aiello et al., 2019; Lahlali et al., 2020).
Furthermore, microscopic observations of the hyphal of the tested
B. cinerea, confirming the findings reported by Calvo et al., (2017). pathogens in dual culture with B. cereus strain B8W8 showed many al­
Previous studies showed a high antifungal activity of the bacterial terations in the mycelial structure such as hyphal swelling, vacuolation
filtrate of B. amyloliquefaciens to reduce the spore germination and the and deformation of the mycelium. These alterations may be due to
radial growth of M. fructigena and M. laxa (Lahlali et al., 2020; Lahlali substances secreted by the bacterium B. cereus strain B8W8. According
et al., 2020). In our work, a weak effect of the filtrate of B. cereus strain to this proposal, Li et al. (2015) showed that the production of hydro­
B8W8 was found on spore germination and mycelial growth of M. laxa lases and lipopeptides by antagonistic bacteria is likely involved in
and M. fructigena. In addition, several studies have confirmed the high inhibiting mycelial growth and hyphal damage of pathogenic fungi.
antagonistic potential of bacterial filtrates from B. amyloliquefaciens, In vivo test showed that B. cereus strain B8W8 had a significant
B. subtilis, and Bacillus sp. by inhibiting spore germination and mycelial antagonistic effect on the development of rots in apples and citrus more
growth of major post-harvest fungal pathogens of citrus than the chemical treatment in most cases. Indeed, the strain B8W8
(Yánez-Mendizábal et al., 2011; Gordillo et al., 2015; Mohammadi et al., completely inhibited brown rot in apples caused by M. laxa, as well as
2017). In the same perspective, current results showed the efficacy of the green mold in citrus fruit caused by P. digitatum. Current findings
B8W8 filtrate in controlling the mycelial growth of G. citri–aurantii, corroborated those of Mohammadi et al. (2017), who found that bac­
P. italicum and P. digitatum, with the inhibition percentage ranging be­ terial isolates might be used as alternative biocontrol agents to inhibit
tween 52% and 73%. P. digitatum-caused green mold in citrus fruit. Lahlali et al., (2020) also
In this study, B. cereus strain B8W8 showed significantly different reported that B. amyloliquefaciens and Pantoea agglomerans have a po­
antifungal potential in vitro against major post-harvest fungi affecting tential in the biocontrol of brown rot caused by M. laxa. Presented re­
apples and citrus fruit. It is important to note that B8W8 had a different sults showed that strain B8W8 reduced the severity of gray mold and
inhibitory capacity against the same fungal specie depending on the blue mold in apples caused by B. cinerea and P. expansum, respectively.
used biocontrol mechanism, namely, antibiosis by producing VOCs and These findings were in accordance with those reported by Cozzolino
antifungal metabolites (Toure et al., 2004; Dimkić et al., 2013; Run­ et al. (2020), underlining that Bacillus sp. might be utilized in the
gjindamai et al., 2013; Fan et al., 2017) or parasitism via the secretion of biocontrol of B. cinerea and P. expansum. In addition, the strain B8W8
lytic enzymes, which are the primary modes of action that have often reduced the blue mold in citrus fruit. Similarly, Calvo et al., (2017)
been adopted by antagonistic bacteria (Bonaterra et al., 2003; Kim et al., pointed out that B. amyloliquefaciens had an ability in biocontrol of blue
2016; Esmaeel et al. 2018; Jadhav et al., 2017). mold in citrus. According to Lahlali et al., 2020, B. amyloliquefaciens and
From the results of PCR analysis, the gene band involved in pro­ Pseudomonas sp. could protect apple against M. fructigena. However, the
ducing the fengycin lipopeptide was found around 1000 base pairs. In strain B8W8 did not have a significant effect in reducing brown rot of
this sense, primers used for the detection of genes responsible for the apple caused by M. fructigena. As well as, the strain B8W8 did not have
biosynthesis of fengycin by B. subtilis have 964 base pairs (Ramarathnam antifungal activity against sour rot of citrus caused by G. citri-aurantii. In
et al., 2007), which is in accordance with our results. Fan et al. (2017) contrast, Tian et al. (2021) have reported that Bacillus sp. might be an
have reported that the principal antifungal compound synthesized by antagonist with significant efficacy for the biocontrol of sour rot of cit­
B. subtilis was fengycin, which had a great importance in the biological rus. The results of semi-commercial bioassays have confirmed the very
control of fungal diseases of apples. Yánez-Mendizábal et al. (2012) high efficacy of this antagonist (B8W8) in the biocontrol of fungal dis­
eases affecting apples and citrus fruit during post-harvest storage.

10
M. Khadiri et al. Postharvest Biology and Technology 200 (2023) 112315

Fig. 6. Fourier Transform Infrared (FTIR) spectra of apple and citrus peel treated with Bacillus cereus strain B8W8. A: Monilinia laxa; B: Monilinia fructigena; C:
Penicillium expansum; D: Geotrichum citri-aurantii. a: negative control; b: treatment by B8W8; c: treatment by imazalil; d: untreated control. The numbers above the
curve represent the wavenumber (cm-1) of the remarkable peaks corresponding to chemical bonds.

Fig. 7. Population densities of Bacillus cereus (B8W8) as a function of incuba­
tion time of wounded fruit of apples and citrus fruit at 28 ◦ C. Each value is the
mean of three replicates and the vertical bars correspond to the stan­
dard deviation.
However, the chemical treatment with imazalil did not have enough
antifungal potential to control citrus green mold. Probably, P. digitatum
had developed some resistance to this active ingredient. In this context,
Erasmus et al. (2015) found a few strains of P. digitatum resistant to
imazalil. Regarding the evaluation of the population dynamics of the
biocontrol agent B. cereus B8W8 in fruit wounds, the results obtained
proved a rapid increase in the density of this bacterium after 24 h of
incubation, followed by a slight multiplication up to at 72 h and
persistence of B8W8 populations between 72 h and 96 h. This rapid
growth of the bacterium B. cereus B8W8 could be explained by the fact
that this bacterial antagonist had found the favorable and adequate
environment in the wounds of apple and citrus fruit. In this sense,
several studies have reported that the colonization of the fruit surface by
a microbial antagonist of the Bacillus genus is a key factor in the
biocontrol of post-harvest fungal diseases (Janisiewicz & Korsten, 2002;
Lastochkina et al., 2019; Chen et al., 2020). Additionally, Carmona-­
Hernandez et al. (2019) showed that antagonistic bacteria were adopted
as a biocontrol agent for post-harvest fungal diseases thanks to their high
inhibition capacity, their rapid colonization of fruit injuries and their
simple nutritional requirements.
According to the fruit quality parameters data, the antifungal ca­
pacity of B. cereus strain B8W8 had a significantly important effect on
the quality of apples and oranges for the majority of the studied fungal
species, by decreasing the values of weight loss at values very close to

11
M. Khadiri et al. Postharvest Biology and Technology 200 (2023) 112315

Table 6 antagonist is to be able to preserve fruit quality.

Effect of Bacillus cereus strain B8W8 on the content of total polyphenols, flavo­ Fourier transform infrared (FTIR) analysis showed the appearance of
noids and the yield of water-soluble polysaccharides of apple fruit. a new band at 2850 cm-1 attributed to C─H stretching vibration for
Treatments Total polyphenols Flavonoids Yield of water-soluble untreated apples inoculated with M. laxa. This band was absent in the
(mg GAE/g) (mg CE/g) polysaccharides (%) negative control and apples treated with B. cereus strain B8W8. Prob­
Negative 29.23 ± 0.66b 5.89 ± 0.34ab 1.463 ± 0.088a ably, the biological control agent B8W8 affected the functional groups of
control fruit. In addition, the appearance of peaks corresponding to the chemical
M. laxa (B) 31.68 ± 0.92a 6.25 ± 0.16a 1.475 ± 0.037ab bonds C─O, C─C, and O─H in the negative controls of apples and or­
M. laxa (F) 29.18 ± 0.52b 5.51 ± 0.43b 1.618 ± 0.064c
anges as well as the absence of these peaks for the other treated and
M. laxa (C) 20.50 ± 0.97e 3.36 ± 0.35d 1.856 ± 0.104d
M. fructigena 25.28 ± 1.15c 4.42 ± 0.32c 1.621 ± 0.059c untreated fruit might be due to the interaction between the bacterial
(B) antagonist and the pathogens. In this regard, previous studies have
M. fructigena 28.83 ± 0.93b 5.47 ± 0.39b 1.593 ± 0.017bc shown that most functional group changes were attributed to the
(F) complication of ions of bacterial and fungal components with the
M. fructigena 20.82 ± 1.19e 3.42 ± 0.58d 1.850 ± 0.080d
(C)
ionized O-H group of hydroxyl groups and O-H bands of carboxylic acids
P. expansum (B) 31.08 ± 0.93a 6.22 ± 0.31a 1.487 ± 0.020ab in the intermolecular and intramolecular hydrogen bond of polymeric
P. expansum (F) 29.12 ± 0.44b 5.50 ± 0.14b 1.585 ± 0.087abc compounds, such as carboxylic acids, alcohols and phenols (Wahab
P. expansum (C) 22.53 ± 0.94e 3,68 ± 0.19d 1.844 ± 0.086d et al., 2012).
B. cinerea (B) 31.30 ± 0.49a 6.29 ± 0.36a 1.465 ± 0.043a
Bioassays of the effect of the bacterium B8W8 on the total poly­
B. cinerea (F) 28.80 ± 1.05b 5.52 ± 0.16b 1.624 ± 0.055c
B. cinerea (C) 23.25 ± 0.35e 3.39 ± 0.48d 1.798 ± 0.051d phenol and flavonoid content of apple and citrus fruits revealed that the
biological treatment against the majority of the post-harvest diseases
Data represent mean ± standard deviation (SD). Values having the same letter,
studied contributed to an increase in the concentration of these phyto­
in the same column, are not significantly different according to the Duncan test
chemical compounds compared to untreated fruits, which could be
(P < 0.05). GAE: Gallic Acid Equivalent; CE: Catechin Equivalent; B: Treatment
explained by the fact that polyphenols and flavonoids are part of the
by the bacterial suspension of Bacillus cereus strain B8W8; F: Treatment by
Imazalil Fungicide; C: Untreated Control (spore suspension + SDW); the nega­ defense system of fruits, and the effectiveness of this bacterium B8W8 in
tive control was inoculated only by the sterile distilled water (SDW). the biocontrol of pathogens affecting apples and citrus fruit resulted in
stimulation and activation of these pathogen defense compounds. In the
same context, Zhu et al. (2019) showed that Yarrowia lipolytica increased
Table 7 the content of flavonoid compounds and total phenols, which activated
Effect of Bacillus cereus strain B8W8 on the content of total polyphenols, flavo­ the defense mechanisms of mandarins against blue mold and green mold
noids and the yield of water-soluble polysaccharides of citrus fruit. caused by P.italicum and P.digitatum respectively. Additionally, Deng
Treatments Total polyphenols Flavonoids Yield of water-soluble et al.(2015) confirmed that some phenolic compounds are components
(mg GAE/g) (mg CE/g) polysaccharides (%) of cell walls, and the interaction between phenolic compounds in cells
Negative control 41.36 ± 0.63b 8.06 ± 0.42b 1.024 ± 0.028a plays an important role in the development of resistance to infection by
P. digitatum (B) 43.77 ± 0.74a 9.19 ± 0.50a 1.029 ± 0.020a pathogens. Treatment with Bacillus cereus B8W8 bacteria against fungal
P. digitatum (F) 35.98 ± 0.70c 6.98 ± 0.22c 1.075 ± 0.009ab pathogens affecting apples and citrus fruits maintained the
P. digitatum (C) 26.39 ± 1.32e 4.20 ± 0.29d 1.202 ± 0.052c
water-soluble polysaccharide yield of treated fruits relatively similar to
P. italicum (B) 43.40 ± 0.71a 9.11 ± 0.06a 1.029 ± 0.015a
P. italicum (F) 36.75 ± 1.49c 7.03 ± 0.58c 1.068 ± 0.007ab that of negative controls. However, this yield was slightly high for un­
P. italicum (C) 25.81 ± 0.83e 4.66 ± 0.61d 1.185 ± 0.035c treated fruits against the inoculated pathogens. Probably, this slight
G. citri- aurantii 33.53 ± 1.20d 6.22 ± 0.96c 1.106 ± 0.033b elevation could be due to the chemical composition in water-soluble
(B) polysaccharides of pathogenic fungi. Previous studies have shown that
G. citri- aurantii 32.16 ± 1.73d 6.14 ± 0.66c 1.114 ± 0.041b
(F)
water-soluble polysaccharides are one of the main chemical compounds
G. citri- aurantii 26.38 ± 1.42e 4.53 ± 0.96d 1.188 ± 0.024c in fungi (Ahrazem et al., 2003; Giavasis, 2014; Snarr et al., 2017; Xiao
(C) et al., 2020). From these results obtained, the bacterial antagonist Ba­
Data represent mean ± standard deviation (SD). Values having the same letter, cillus cereus B8W8 had a positive impact on the content of total poly­
in the same column, are not significantly different according to the Duncan test phenols and flavonoids and also on the yield of water-soluble
(P < 0.05). GAE: Gallic Acid Equivalent; CE: Catechin Equivalent; B: Treatment polysaccharides of apple and citrus fruits.
by the bacterial suspension of Bacillus cereus strain B8W8; F: Treatment by It is crucial to point out that certain strains of the genus Bacillus,
Imazalil Fungicide; C: Untreated Control (spore suspension + SDW); the nega­ Pseudomonas and Pantoea had a certain pathogenicity in humans (Soutar
tive control was inoculated only by the sterile distilled water (SDW). and Stavrinides, 2018; Azam and Khan, 2019; Chelliah et al., 2019).
More precisely, certain strains of B. cereus are pathogenic for humans,
the negative control, preserving the firmness of the fruit, and main­ causing gastrointestinal infections (Kotiranta et al., 2000). Therefore, to
taining the percentages of titratable acidity (TA) and total soluble solids overcome this concern by regulatory authorities, no biocontrol agent
(TSSs) at percentages similar to the control not inoculated with the would be approved if it grows at human body-temperature (37 ◦ C) (Kerr
pathogens. In this context, several studies confirmed the positive impact and Bullard, 2020). In this study, we revealed that the bacterial B. cereus
of biocontrol agents (BCAs) in preservation of the fruit quality. Indeed, B8W8 did not grow at human body temperature. This result is in line
biological treatment by using B. amyloliquefaciens against sour rot and with finding of Batt, (2000), who found that B. cereus had an optimum
green and blue molds of citrus did not affect fruit quality parameters growth temperature between 28 ◦ C and 35 ◦ C and no growth was
(Hao et al., 2011; Hong et al., 2014). Moreover, biocontrol of blue and observed at 37 ◦ C. In addition, our results show that the bacterium Ba­
gray mold of apple by Rhodotorula glutinis preserved the fruit quality cillus cereus B8W8 had a negative hypersensitivity, and that this bacterial
(Zhang et al., 2009). Additionally, the biocontrol activity of biological strain had no impact on the fruit quality of apples and oranges. There­
treatments against M. fructigena showed minor changes in fruit quality fore, our bacterial strain B8W8 would not cause any clinical risk to
(Lyousfi et al., 2021). Furthermore, the antagonists Aureobasidium pul­ humans if applied post-harvest as a BCA on fruit.
lulans, Pseudozyma fusiformata and Metschnikowia sp. might be used as
biocontrol agents against brown rot of apples caused by M. laxa, pre­ 5. Conclusions
serving fruit quality parameters (Zhang et al., 2010). Interestingly,
Zhang et al. (2008) found that one of the characteristics of an excellent Our findings confirmed that B. cereus strain B8W8 was a potent

12
M. Khadiri et al.
effective BCA for the control of common post-harvest fungal pathogens
of apple and citrus fruit. Dual culture in vitro tests, VOCs and cell-free
bacterial culture filtrates showed a very significant inhibitory effect
against most studied pathogens. The in vivo biological tests and the semi-
commercial trials confirmed the results obtained in vitro. Indeed, the
biological treatment with the strain B8W8 had a high capacity to control
fungal diseases of apples and citrus fruit, while maintaining the quality
of the fruit. The rapid increase in the density of B8W8 populations could
play a very important role in biocontrol ability against these post-
harvest fungal diseases. The production of lytic enzymes and lip­
opeptides could be one of the main modes of action of this biocontrol
agent. Therefore, it was concluded that B. cereus strain B8W8 has
showed interesting biological activities against major post-harvest
fungal pathogens of fruit and might be used as a potential biological
control agent. However, before this bacterium can be marketed as a
biofungicide extensive research must be conducted with the aim to
develop an appropriate formulation for post-harvest conditions.
Funding
This work was financially supported by the Phytopathology Labo­
ratory of the Department of Plant Protection and Environment (ENA-
Meknes, Morocco).
CRediT authorship contribution statement
Mohammed Khadiri: Conceptualization, Data curation, Writing –
original draft, Methodology, Formal analysis.Hassan Boubaker:
Conceptualization, Validation, Synthesis of Results, Data curation, Su­
pervision, Writing – review & editing. Latifa Askarne: Writing – review
& editing. Said Ezrari: Writing – review & editing. Nabil Radouane:
Writing – review & editing. Abdelaaziz Farhaoui: Writing – review &
editing. Hajar El Hamss: Writing – review & editing. Abdessalem
Tahiri: Writing – review & editing. Essaid Ait Barka: Writing – review
& editing. Rachid Lahlali: Conceptualization, Validation, Synthesis of
Results, Data curation, Supervision, Writing – review & editing. All
authors have read and agreed to the published version of this
manuscript.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Data Availability
Data will be made available on request.
Acknowledgments
Authors are grateful to ENA-Meknes for providing this study with the
necessary facilities and funding. We are grateful to Dr. Lhoussain Ait
Haddoud for providing us the necessary equipment to evaluate fruit
quality and to Central Laboratory of ENAM for FTIR analysis.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the
online version at doi:10.1016/j.postharvbio.2023.112315.
References
Adaskaveg, J.E., Förster, H., 2009. New developments in postharvest fungicide
registrations for edible horticultural crops and use strategies in the United States. In
Postharvest pathology. Springer, pp. 107–117.
13
Postharvest Biology and Technology 200 (2023) 112315
Ahrazem, O., Prieto, A., San-Blas, G., Leal, J.A., Jiménez-Barbero, J., Bernabé, M., 2003.
Structural differences between the alkali-extracted water-soluble cell wall
polysaccharides from mycelial and yeast phases of the pathogenic dimorphic fungus
Paracoccidioides brasiliensis. Glycobiology 13 (11), 743–747. https://doi.org/
10.1093/glycob/cwg069.
Aiello, D., Restuccia, C., Stefani, E., Vitale, A., Cirvilleri, G., 2019. Postharvest biocontrol
ability of Pseudomonas synxantha against Monilinia fructicola and Monilinia fructigena
on stone fruit. Postharvest Biol. Technol. 149, 83–89.
Askarne, L., Talibi, I., Boubaker, H., Boudyach, E.H., Msanda, F., Saadi, B., Serghini, M.
A., Aoumar, A.A. Ben, 2012. In vitro and in vivo antifungal activity of several
Moroccan plants against Penicillium italicum, the causal agent of citrus blue mold.
Crop Prot. 40, 53–58. https://doi.org/10.1016/j.cropro.2012.04.023.
Azam, M.W., Khan, A.U., 2019. Updates on the pathogenicity status of Pseudomonas
aeruginosa. Drug Discov. Today 24 (1), 350–359.
Batt, C.A., 2000. Bacillus cereus. Encycl. Food Microbiol. 1, 119–124.
Blumer, C., Haas, D., 2000. Mechanism, regulation, and ecological role of bacterial
cyanide biosynthesis. Arch. Microbiol. 173 (3), 170–177. https://doi.org/10.1007/
s002039900127.
Bonaterra, A., Mari, M., Casalini, L., Montesinos, E., 2003. Biological control of Monilinia
laxa and Rhizopus stolonifer in postharvest of stone fruit by Pantoea agglomerans
EPS125 and putative mechanisms of antagonism. Int. J. Food Microbiol. 84 (1),
93–104.
Boubaker, H., Saadi, B., Boudyach, E.H., Benaoumar, A.A., 2009. Sensitivity of
Penicillium digitatum and P. italicum to imazalil and thiabendazole in Morocco. Plant
Pathol. J. 8 (4), 152–158.
Boubaker, H., Karim, H., Hamdaoui, A., El, Msanda, F., Leach, D., Bombarda, I.,
Vanloot, P., Abbad, A., Boudyach, E.H., Ben, A.A., 2016. Chemical characterization
and antifungal activities of four Thymus species essential oils against postharvest
fungal pathogens of citrus. Ind. Crops Prod. 86, 95–101. https://doi.org/10.1016/j.
indcrop.2016.03.036.
Calvo, H., Marco, P., Blanco, D., Oria, R., Venturini, M.E., 2017. Potential of a new strain
of Bacillus amyloliquefaciens BUZ-14 as a biocontrol agent of postharvest fruit
diseases. In. In: Food Microbiology, Vol. 63. Elsevier B.V. https://doi.org/10.1016/j.
fm.2016.11.004.
Calvo, H.éctor, Mendiara, I., Arias, E., Gracia, A.P., Blanco, D., Venturini, M.E., 2020.
Antifungal activity of the volatile organic compounds produced by Bacillus velezensis
strains against postharvest fungal pathogens. Postharvest Biol. Technol., 166 (April),
111208. https://doi.org/10.1016/j.postharvbio.2020.111208.
Calvo, J., Calvente, V., de Orellano, M.E., Benuzzi, D., Sanz de Tosetti, M.I., 2007.
Biological control of postharvest spoilage caused by Penicillium expansum and Botrytis
cinerea in apple by using the bacterium Rahnella aquatilis. Int. J. Food Microbiol. 113
(3), 251–257. https://doi.org/10.1016/j.ijfoodmicro.2006.07.003.
Carmona-Hernandez, S., Reyes-Pérez, J., Chiquito-Contreras, R., Rincon-Enriquez, G.,
Cerdan-Cabrera, C., Hernandez-Montiel, L., 2019. Biocontrol of Postharvest Fruit
Fungal Diseases by Bacterial Antagonists: A Review. Agronomy 9 (3), 121. https://
doi.org/10.3390/agronomy9030121.
Chelliah, R., Wei, S., Park, B.-J., Rubab, M., Dalirii, E.B.-M., Barathikannan, K., Jin, Y.-G.,
Oh, D.-H., 2019. Whole genome sequence of Bacillus thuringiensis ATCC 10792 and
improved discrimination of Bacillus thuringiensis from Bacillus cereus group based on
novel biomarkers. Microb. Pathog. 129, 284–297.
Chen, K., Tian, Z., Luo, Y., Cheng, Y., Long, C., 2018. Antagonistic activity and the
mechanism of Bacillus amyloliquefaciens DH-4 against citrus green mold.
Phytopathology® 108 (11), 1253–1262. https://doi.org/10.1094/PHYTO-01-17-
0032-R.
Chen, K., Tian, Z., He, H., Long, C. an, Jiang, F., 2020. Bacillus species as potential
biocontrol agents against citrus diseases. Biol. Control 151 (August), 104419.
https://doi.org/10.1016/j.biocontrol.2020.104419.
Compant, S., Duffy, B., Nowak, J., Clément, C., Barka, E.A., 2005. Use of plant growth-
promoting bacteria for biocontrol of plant diseases: principles, mechanisms of
action, and future prospects. Appl. Environ. Microbiol. 71 (9), 4951–4959. https://
doi.org/10.1128/AEM.71.9.4951-4959.2005.
Cozzolino, M.E., Distel, J.S., García, P.A., Mascotti, M.L., Ayub, M.J., Benazzi, L.M., Di
Masi, S.N., Silva, P.G., 2020. Control of postharvest fungal pathogens in pome fruits
by lipopeptides from a Bacillus sp. isolate SL-6. Sci. Hortic. 261, 108957 https://doi.
org/10.1016/j.scienta.2019.108957.
D’Abrosca, B., Pacifico, S., Cefarelli, G., Mastellone, C., Fiorentino, A., 2007.
“Limoncella” apple, an Italian apple cultivar: phenolic and flavonoid contents and
antioxidant activity. Food Chem. 104 (4), 1333–1337. https://doi.org/10.1016/j.
foodchem.2007.01.073.
Deng, Y., Zhao, Y., Padilla-Zakour, O., Yang, G., 2015. Polyphenols, antioxidant and
antimicrobial activities of leaf and bark extracts of Solidago canadensis L. Ind. Crops
Prod. 74, 803–809.
Dimkić, I., Živković, S., Berić, T., Ivanović, Ž., Gavrilović, V., Stanković, S., Fira, D.,
2013. Characterization and evaluation of two Bacillus strains, SS-12.6 and SS-13.1, as
potential agents for the control of phytopathogenic bacteria and fungi. Biol. Control
65 (3), 312–321. https://doi.org/10.1016/j.biocontrol.2013.03.012.
Dinesh, R., Anandaraj, M., Kumar, A., Bini, Y.K., Subila, K.P., Aravind, R., 2015.
Isolation, characterization, and evaluation of multi-trait plant growth promoting
rhizobacteria for their growth promoting and disease suppressing effects on ginger.
Microbiol. Res. 173, 34–43. https://doi.org/10.1016/j.micres.2015.01.014.
Dou, J., Meng, Y., Liu, L., Li, J., Ren, D., Guo, Y., 2015. Purification, characterization and
antioxidant activities of polysaccharides from thinned-young apple. Int. J. Biol.
Macromol. 72, 31–40. https://doi.org/10.1016/j.ijbiomac.2014.07.053.
Droby, S., Wisniewski, M., Teixidó, N., Spadaro, D., Jijakli, M.H., 2016. The science,
development, and commercialization of postharvest biocontrol products. Postharvest
Biol. Technol. 122, 22–29.
M. Khadiri et al.
Eckert, J.W., Brown, G.E., 1986. Postharvest citrus diseases and their control. Fresh
Citrus Fruits 315–360.
El Khetabi, A., Lahlali, R., Askarne, L., Ezrari, S., El Ghadaroui, L., Tahiri, A., Hrustić, J.,
Amiri, S., 2020. Efficacy assessment of pomegranate peel aqueous extract for brown
rot (Monilinia spp.) disease control. Physiol. Mol. Plant Pathol. 110 (November 2019)
https://doi.org/10.1016/j.pmpp.2020.101482.
Elshafie, H.S., Camele, I., Racioppi, R., Scrano, L., Iacobellis, N.S., Bufo, S.A., 2012. In
vitro antifungal activity of Burkholderia gladioli pv. agaricicola against some
phytopathogenic fungi. Int. J. Mol. Sci. 13 (12), 16291–16302.
Erasmus, A., Lennox, C.L., Korsten, L., Lesar, K., Fourie, P.H., 2015. Imazalil resistance in
Penicillium digitatum and P. italicum causing citrus postharvest green and blue mould:
impact and options. Postharvest Biol. Technol. 107, 66–76.
Esmaeel, Q., Miotto, L., Rondeau, M., Leclère, V., Clément, C., Jacquard, C., Sanchez, L.,
Barka, E.A., 2018. Paraburkholderia phytofirmans PsJN-plants interaction: from
perception to the induced mechanisms. Front. Microbiol. 9, 2093.
Ezrari, S., Mhidra, O., Radouane, N., Tahiri, A., Polizzi, G., Lazraq, A., Lahlali, R., 2021.
Potential role of rhizobacteria isolated from citrus rhizosphere for biological control
of citrus dry root rot. Plants 10 (5), 1–26. https://doi.org/10.3390/plants10050872.
Fan, H., Ru, J., Zhang, Y., Wang, Q., Li, Y., 2017. Fengycin produced by Bacillus subtilis
9407 plays a major role in the biocontrol of apple ring rot disease. Microbiol. Res.
199, 89–97. https://doi.org/10.1016/j.micres.2017.03.004.
Mubarik, 2010. Chitinolytic bacteria isolated from chili rhizosphere: chitinase
characterization and its application as biocontrol for whitefly (Bemisia tabaci Genn.).
Am. J. Agric. Biol. Sci. 5 (4), 430–435. https://doi.org/10.3844/
ajabssp.2010.430.435.
FAOSTAT. (2022). Appel and Citrus production statistic in Morocco. 〈http://www.fao.
org/faostat/fr/#home〉.
Giavasis, I., 2014. Bioactive fungal polysaccharides as potential functional ingredients in
food and nutraceuticals. Curr. Opin. Biotechnol. 26, 162–173.
Głos, H., Bryk, H., Michalecka, M., & Puławska, J. (2022). The Recent Occurrence of
Biotic Postharvest Diseases of Apples in Poland.
Gordillo, M.A., Navarro, A.R., Maldonado, M.C., 2015. Mode of action of metabolites
from Bacillus sp. strain IBA 33 on Geotrichum citri - aurantii arthroconidia. Can. J.
Microbiol. 61 (11), 876–880. https://doi.org/10.1139/cjm-2014-0788.
Gotor-Vila, A., Teixidó, N., Di Francesco, A., Usall, J., Ugolini, L., Torres, R., Mari, M.,
2017. Antifungal effect of volatile organic compounds produced by Bacillus
amyloliquefaciens CPA-8 against fruit pathogen decays of cherry. Food Microbiol. 64,
219–225.
Hao, W., Li, H., Hu, M., Yang, L., Rizwan-ul-haq, M., 2011. Postharvest Biology and
Technology Integrated control of citrus green and blue mold and sour rot by Bacillus
amyloliquefaciens in combination with tea saponin. Postharvest Biol. Technol. 59 (3),
316–323. https://doi.org/10.1016/j.postharvbio.2010.10.002.
Hong, P., Hao, W., Luo, J., Chen, S., Hu, M., Zhong, G., 2014. Combination of hot water,
Bacillus amyloliquefaciens HF-01 and sodium bicarbonate treatments to control
postharvest decay of mandarin fruit. Postharvest Biol. Technol. 88, 96–102. https://
doi.org/10.1016/j.postharvbio.2013.10.004.
Hsieh, F.-C., Li, M.-C., Lin, T.-C., Kao, S.-S., 2004. Rapid detection and characterization of
surfactin-producing Bacillus subtilis and closely related species based on PCR. Curr.
Microbiol. 49 (3), 186–191.
Hwang, J.K., Kim, C.J., Kim, C.T., 1998. Extrusion of apple pomace facilitates pectin
extraction. J. Food Sci. 63 (5), 841–844. https://doi.org/10.1111/j.1365-
2621.1998.tb17911.x.
Jadhav, H.P., Shaikh, S.S., Sayyed, R.Z., 2017. Role of hydrolytic enzymes of rhizoflora
in biocontrol of fungal phytopathogens: an overview. Rhizotrophs: Plant Growth
Promot. Bioremediation 183–203.
Janisiewicz, W.J., & Korsten, L. (2002). Biological control of postharvest diseases of fruits.
Karim, H., Boubaker, H., Askarne, L., Talibi, I., Msanda, F., Boudyach, E.H., Saadi, B., Ait
Ben Aoumar, A., 2016. Antifungal properties of organic extracts of eight Cistus L.
species against postharvest citrus sour rot. Lett. Appl. Microbiol. 62 (1), 16–22.
Kerr, A., Bullard, G., 2020. Biocontrol of crown gall by rhizobium rhizogenes: challenges
in biopesticide commercialisation. Agronomy 10 (8), 1–11. https://doi.org/
10.3390/agronomy10081126.
Kim, D.O., Jeong, S.W., Lee, C.Y., 2003. Antioxidant capacity of phenolic phytochemicals
from various cultivars of plums. Food Chem. 81 (3), 321–326. https://doi.org/
10.1016/S0308-8146(02)00423-5.
Kim, Y.S., Balaraju, K., Jeon, Y., 2016. Effects of rhizobacteria Paenibacillus polymyxa
APEC136 and Bacillus subtilis APEC170 on biocontrol of postharvest pathogens of
apple fruits. J. Zhejiang Univ. Sci. B 17 (12), 931–940.
Kotiranta, A., Lounatmaa, K., Haapasalo, M., 2000. Epidemiology and pathogenesis of
Bacillus cereus infections. Microbes Infect. 2 (2), 189–198.
Lahlali, R., Serrhini, M.N., Jijakli, M.H., 2005. Development of a biological control
method against postharvest diseases of citrus fruits. Commun. Agric. Appl. Biol. Sci.
70 (3), 47–58.
Lahlali, R., Bajii, M., Jijakli, M., 2007. Isolation and evaluation of bacteria and fungi as
biological control agents against Rhizoctonia solani. Commun. Agric. Appl. Biol. Sci.
72 (4), 973–982.
Lahlali, Rachid, Aksissou, W., Lyousfi, N., Ezrari, S., Blenzar, A., 2020a. Biocontrol
activity and putative mechanism of Bacillus amyloliquefaciens ( SF14 and SP10),
Alcaligenes faecalis ACBC1, and Pantoea agglomerans ACBP1 against brown rot disease
of fruit. Microb. Pathog. https://doi.org/10.1016/j.micpath.2019.103914.
Lahlali, Rachid, Mchachti, O., Radouane, N., Ezrari, S., Belabess, Z., Khayi, S.,
Mentag, R., Tahiri, A., Barka, E.A., 2020b. The potential of novel bacterial isolates
from natural soil for the control of brown rot disease (Monilinia fructigena) on apple
fruits. Agronomy 10 (11), 1814. https://doi.org/10.3390/agronomy10111814.
Larkin, P., 2017. Infrared and Raman spectroscopy: principles and spectral
interpretation. Elsevier.
14
Postharvest Biology and Technology 200 (2023) 112315
Lastochkina, O., Seifikalhor, M., Aliniaeifard, S., Baymiev, A., Pusenkova, L.,
Garipova, S., Kulabuhova, D., Maksimov, I., 2019. Bacillus spp.: Efficient biotic
strategy to control postharvest diseases of fruits and vegetables. Plants 8 (4), 1–24.
https://doi.org/10.3390/plants8040097.
Li, Z., Guo, B., Wan, K., Cong, M., Huang, H., Ge, Y., 2015. Effects of bacteria-free filtrate
from Bacillus megaterium strain L2 on the mycelium growth and spore germination of
Alternaria alternata. Biotechnol. Biotechnol. Equip. 29 (6), 1062–1068. https://doi.
org/10.1080/13102818.2015.1068135.
López-González, R.C., Juárez-Campusano, Y.S., Rodríguez-Chávez, J.L., Delgado-
Lamas, G., Medrano, S.M.A., Martínez-Peniche, R.Á., Pacheco-Aguilar, J.R., 2021.
Antagonistic activity of bacteria isolated from apple in different fruit development
stages against blue mold caused by penicillium expansum. Plant Pathol. J. 37 (1),
24–35. https://doi.org/10.5423/PPJ.OA.07.2020.0121.
Lyousfi, N., Lahlali, R., Letrib, C., Belabess, Z., Ouaabou, R., Ennahli, S., Blenzar, A.,
Barka, E.A., 2021. Improving the biocontrol potential of bacterial antagonists with
salicylic acid against brown rot disease and impact on nectarine fruits quality.
Agronomy 11 (2), 209. https://doi.org/10.3390/agronomy11020209.
Mahmoudi, S., Khali, M., Mahmoudi, N., 2013. Etude de l’extraction des composés
phénoliques de différentes parties de la fleur d’artichaut ( Cynara scolymus L.). Rev.
Nat. Technol. 5, 35–40.
Mehellou, Z., Boual, Z., Benagga, S., Daddi Addoun, N., Michaud, P., Didi Ould El
Hadj, M., 2017. Etude Des Polysaccharides Hydrosolubles Et Alcalisolubles Extraits
Des Dattes Demies Molles De La Variete Deglet Nour De Phoenix Dactylifera L.
Recoltee Au Sahara Septentrional Est Algerien. Polysaccharides de plantes de
milieux arides (Ouargla, Algeria, 21-22 Nov. POLYSAC 2017, 88–97.
Mohammadi, P., Tozlu, E., Kotan, R., Şenol Kotan, M., 2017. Potential of some bacteria
for biological control of postharvest citrus green mould caused by Penicillium
digitatum. Plant Prot. Sci. 53 (3), 134–143. https://doi.org/10.17221/55/2016-PPS.
Palou, Lluı.s,́ Usall, J., Muñoz, J.A., Smilanick, J.L., Viñas, I., 2002. Hot water, sodium
carbonate, and sodium bicarbonate for the control of postharvest green and blue
molds of clementine mandarins. Postharvest Biol. Technol. 24 (1), 93–96.
Palou, Lluís, Smilanick, J.L., Droby, S., 2008. Alternatives to conventional fungicides for
the control of citrus postharvest green and blue moulds. Stewart Postharvest Rev. 2
(2), 1–16.
Peng, B., Luo, Y., Hu, X., Song, L., Yang, J., Zhu, J., Wen, Y., Yu, R., 2019. Isolation,
structural characterization, and immunostimulatory activity of a new water-soluble
polysaccharide and its sulfated derivative from Citrus medica L. var. sarcodactylis.
Int. J. Biol. Macromol. 123, 500–511. https://doi.org/10.1016/j.
ijbiomac.2018.11.113.
Pobiega, K., Igielska, M., Włodarczyk, P., Gniewosz, M., 2021. The use of pullulan
coatings with propolis extract to extend the shelf life of blueberry ( Vaccinium
corymbosum) fruit. Int. J. Food Sci. Technol. 56 (2), 1013–1020. https://doi.org/
10.1111/ijfs.14753.
Prashar, P., Kapoor, N., Sachdeva, S., 2013. Isolation and characterization of Bacillus sp.
with In-vitro antagonistic activity against Fusarium oxysporum from rhizosphere of
tomato. J. Agric. Sci. Technol. 15 (SUPPL), 1501–1512.
Ramarathnam, R., Bo, S., Chen, Y., Fernando, W.G.D., Xuewen, G., De Kievit, T., 2007.
Molecular and biochemical detection of fengycin- and bacillomycin D-producing
Bacillus spp., antagonistic to fungal pathogens of canola and wheat. Can. J.
Microbiol. 53 (7), 901–911. https://doi.org/10.1139/W07-049.
Rharmitt, S., Hafidi, M., Hajjaj, H., Scordino, F., Giosa, D., Giuffrè, L., Barreca, D.,
Criseo, G., Romeo, O., 2016. Molecular characterization of patulin producing and
non-producing Penicillium species in apples from Morocco. Int. J. Food Microbiol.
217, 137–140. https://doi.org/10.1016/j.ijfoodmicro.2015.10.019.
Rodríguez-Chávez, J.L., Juárez-Campusano, Y.S., Delgado, G., Pacheco Aguilar, J.R.,
2019. Identification of lipopeptides from Bacillus strain Q11 with ability to inhibit
the germination of Penicillium expansum, the etiological agent of postharvest blue
mold disease. Postharvest Biol. Technol. 155, 72–79. https://doi.org/10.1016/j.
postharvbio.2019.05.011.
Rungjindamai, N., Xu, X.-M., Jeffries, P., 2013. Identification and characterisation of new
microbial antagonists for biocontrol of Monilinia laxa, the causal agent of brown rot
on stone fruit. Agronomy 3 (4), 685–703.
Sethi, S.K., Mukherjee, A.K., 2018. Screening of Biocontrol Potential of Indigenous
Bacillus spp. Isolated from Rice Rhizosphere against R. solani, S. oryzae, S. rolfsii and
Response towards Growth of Rice. J. Pure Appl. Microbiol. 12 (1), 41–53.
Sir Elkhatim, K.A., Elagib, R.A.A., Hassan, A.B., 2018. Content of phenolic compounds
and vitamin C and antioxidant activity in wasted parts of Sudanese citrus fruits. Food
Sci. Nutr. 6 (5), 1214–1219. https://doi.org/10.1002/fsn3.660.
Snarr, B.D., Qureshi, S.T., Sheppard, D.C., 2017. Immune recognition of fungal
polysaccharides. J. Fungi 3 (3), 47.
Socrates, G., 2004. Infrared and Raman characteristic group frequencies: tables and
charts. John Wiley & Sons.
Soutar, C.D., Stavrinides, J., 2018. The evolution of three siderophore biosynthetic
clusters in environmental and host-associating strains of Pantoea. Mol. Genet.
Genom. 293 (6), 1453–1467.
Spadaro, D., Droby, S., 2016. Development of biocontrol products for postharvest
diseases of fruit: the importance of elucidating the mechanisms of action of yeast
antagonists. Trends Food Sci. Technol. 47, 39–49.
Syed-Ab-Rahman, S.F., Carvalhais, L.C., Chua, E., Xiao, Y., Wass, T.J., Schenk, P.M.,
2018. Identification of Soil Bacterial Isolates Suppressing Different Phytophthora spp.
and Promoting Plant Growth. Front. Plant Sci. 9. https://doi.org/10.3389/
fpls.2018.01502.
Talibi, I., Boubaker, H., Boudyach, E.H., Ait Ben Aoumar, A., 2014. Alternative methods
for the control of postharvest citrus diseases. J. Appl. Microbiol. 117 (1), 1–17
https://doi.org/10.1111/jam.12495.
M. Khadiri et al.
Tian, Z., Chen, C., Chen, K., Liu, P., Fan, Q., Zhao, J., Long, C. an, 2020. Biocontrol and
the mechanisms of Bacillus sp. w176 against postharvest green mold in citrus.
Postharvest Biol. Technol. 159 (May 2019), 111022 https://doi.org/10.1016/j.
postharvbio.2019.111022.
Tian, Z., Li, Y., Yang, Q., Liu, P., Du, Y., Chen, C., Long, C. an, 2021. Antifungal activities
and the mechanisms of biocontrol agent WE-3 against postharvest sour rot in citrus.
Eur. J. Plant Pathol. https://doi.org/10.1007/s10658-021-02356-y.
Toure, Y., Ongena, M., Jacques, P., Guiro, A., Thonart, P., 2004. Role of lipopeptides
produced by Bacillus subtilis GA1 in the reduction of grey mould disease caused by
Botrytis cinerea on apple. J. Appl. Microbiol. 96 (5), 1151–1160. https://doi.org/
10.1111/j.1365-2672.2004.02252.x.
Tripathi, P., Dubey, N.K., 2004. Exploitation of natural products as an alternative
strategy to control postharvest fungal rotting of fruit and vegetables. Postharvest
Biol. Technol. 32 (3), 235–245. https://doi.org/10.1016/j.postharvbio.2003.11.005.
Trivedi, P., Pandey, A., Palni, L.M.S., 2008. In vitro evaluation of antagonistic properties
of Pseudomonas corrugata. Microbiol. Res. 163 (3), 329–336. https://doi.org/
10.1016/j.micres.2006.06.007.
VL, S., Orthofer, R., RM, L.-R., 1999. Analysis of total phenols and other oxidation
substrates and antioxidants by means of Folin-Ciocalteu reagent. Methods Enzym.
299, 152178.
Wahab, M.A., Boubakri, H., Jellali, S., Jedidi, N., 2012. Characterization of ammonium
retention processes onto Cactus leaves fibers using FTIR, EDX and SEM analysis.
J. Hazard. Mater. 241–242, 101–109. https://doi.org/10.1016/j.
jhazmat.2012.09.018.
Waterhouse, A.L., 2002. Determination of Total Phenolics. Curr. Protoc. Food Anal.
Chem. 6 (1). I1-I1. 〈https://currentprotocols.onlinelibrary.wiley.com/doi/
abs/10.1002/0471142913.fai0101s06〉.
Weller, D.M., 2007. Pseudomonas biocontrol agents of soilborne pathogens: looking back
over 30 years. Phytopathology 97 (2), 250–256.
Wenneker, M., 2020. Latent postharvest pathogens of pome fruit and their management:
from single measures to a systems intervention approach. Cbs 2016.
15
Postharvest Biology and Technology 200 (2023) 112315
Xiao, Z., Zhou, W., Zhang, Y., 2020. Fungal polysaccharides. Adv. Pharmacol. 87,
277–299.
Yánez-Mendizábal, V., Usall, J., Viñas, I., Casals, C., Marín, S., Solsona, C., Teixidó, N.,
2011. Potential of a new strain of Bacillus subtilis CPA-8 to control the major
postharvest diseases of fruit. Biocontrol. Sci. Technol. 21 (4), 409–426. https://doi.
org/10.1080/09583157.2010.541554.
Yánez-Mendizábal, V., Viñas, I., Usall, J., Torres, R., Solsona, C., Abadias, M., Teixidó, N.,
2012. Formulation development of the biocontrol agent Bacillus subtilis strain CPA-8
by spray-drying. J. Appl. Microbiol. 112 (5), 954–965.
Zhang, D., Spadaro, D., Garibaldi, A., Gullino, M.L., 2010. Selection and evaluation of
new antagonists for their efficacy against postharvest brown rot of peaches.
Postharvest Biol. Technol. 55 (3), 174–181. https://doi.org/10.1016/j.
postharvbio.2009.09.007.
Zhang, H., Wang, L., Dong, Y., Jiang, S., Zhang, H., Zheng, X., 2008. Control of
postharvest pear diseases using Rhodotorula glutinis and its effects on postharvest
quality parameters. Int. J. Food Microbiol. 126 (1–2), 167–171.
Zhang, H., Wang, L., Ma, L., Dong, Y., Jiang, S., Xu, B., Zheng, X., 2009. Biocontrol of
major postharvest pathogens on apple using Rhodotorula glutinis and its effects on
postharvest quality parameters. Biol. Control 48 (1), 79–83. https://doi.org/
10.1016/j.biocontrol.2008.09.004.
Zhang, H.-Y., Fu, C.-X., Zheng, X.-D., He, D., Shan, L.-J., Zhan, X., 2004. Effects of
Cryptococcus laurentii (Kufferath) Skinner in combination with sodium bicarbonate
on biocontrol of postharvest green mold decay of citrus fruit. Bot. Bull. Acad. Sin. 45.
Zhou, M., Li, P., Wu, S., Zhao, P., Gao, H., 2019. Bacillus subtilis CF-3 volatile organic
compounds inhibit Monilinia fructicola growth in peach fruit. Front. Microbiol. 10,
1–11. https://doi.org/10.3389/fmicb.2019.01804.
Zhu, H., Zhao, L., Zhang, X., Meshi, J., Li, J., Hu, W., 2019. Effi cacy of Yarrowia lipolytica
in the biocontrol of green mold and blue mold in Citrus reticulata and the
mechanisms involved. Biol. Control 139, 104096. https://doi.org/10.1016/j.
biocontrol.2019.104096.