فطريات بشكل عام

Republic of Iraq
Ministry of Higher Education and

Scientific Research
University of Baghdad
College of Science for women
Department of Biology
Prevalence of Candidalysin ECE1Gene

Among Candida albicans Isolated From
Respiratory Tract and Oral Cavity In
Iraqi patients
A Thesis
Submitted to the Council of College of Science for Women

University of Baghdad in Partial Fulfillment of the
Requirements for the Degree of Master
In Biology/Microbiology
By
Sukayna Rasheed Majeed
Supervised by
Asst. Prof. Dr. Safaa Al-Deen Ahmed Al-Qaysi
2023 A.D. 1444 A.H.

‫س َّما أ ُ ْخف َِي لَ ُهم من قُ َّر ِة أَ ْع ُي ٍن َج َزاء ِب َما َكا ُنوا‬
‫َفال َت ْعلَ ُم َن ْف ٌ‬
‫َي ْع َملُون‬
‫سىره السجذة ‪ -‬اَِت ‪71‬‬

Supervisor’s Certification
I certify that this thesis entitled (Prevalence of Candidalysin ECE1

Gene Among Candida albicans Isolated From Iraqi Patients Infected
With Respiratory Tract and Oral Cavity) was carried out by (Sukayna
Rasheed Majeed) under my supervision at the College of Science for
women, University of Baghdad as a partial fulfillment of the requirements
for the degree of Master in Biology/Microbiology
Signature
Asst. Prof. Dr. Safaa Al-Deen Ahmed Al-Qaysi
/ /2023
In view of the available recommendation, I forward this thesis to debate by

the examining committee.
Signature
Assist. Prof. Dr. Mushtak Faraj Karomi
Head of the department
Chairman of higher studies committee
/ /2023
Committees Certification
We, the members of the examining committee, certify that we have read this thesis
and have examined the student in its contents and that, according to our opinion, is
accepted as a thesis for the degree of Master in Biology/Microbiology.
Signature: Signature:
Name: Dr. Mohsen Hashem Risan Name: Dr. Thamer Abd Al_Shaheed Muhsen
Title: Professor Title: Professor
Date: Date: / / 2023 Date: / / 2023
Chairman Member
Signature: Signature:
Name: Teeba Hashim Mohammad Name: Dr. Safaa Al-Deen Ahmed Al-Qaysi
Title: Lecturer Title: Assistant Professor
Date: / / 2023 Date: / / 2023
Member Member (supervisor)
Approved by the Council of the C ollege of Science for women / University of

Baghdad
Signature:
Name and title: professor. Dr. Samira Naji Kadhim,
Dean of the college of Science for Women
Date: / / 2023
To the Almighty ALLAH for the guidance, Strength, Power,
Protection, Skills, and for his giving us a healthy life.
To the high-ranking one who honored me with his name... my dear

father
To the light of my eyes, the sociable my soul, and the joy of my life
My mother, then my mother, then my mother, for her love, prayer,
caring, sacrifices for educating and preparing me for future and
whose prayers accompanied me and for continues provide their
moral, spiritual, emotional, and financial support
To a precious soul that gone to its lord to whom I miss him with all my
heart To Dora, who enlightened my path with pride and honor, to my
brother, the heroic martyr Haider Rasheed
To my dear wonderful brothers
To everyone who supported me and had a role from near or far in

completing this thesis
To the pioneers of science and its students .
Sokayna
Acknowledgments
First and foremost, praises and thanks to ALLAH, the almighty, for his
showers of blessings throughout my research work to complete the research
successfully to be useful for the service of our dear country, Iraq
I would like to express my deep and sincere gratitude and thanks to my

honorable supervisor, Asst. Prof. Dr. Safaa Al-Deen Ahmed Al-Qaysi, He
has taught me the methodology to carry out the research and to present the
research works as clearly as possible, it was a great honor for me to work
under his guidance
I would also like to extend my thanks to the Dean of the College, Prof. Dr.
Samira Naji Kadhim, and to all the staff of biology Department.
I extend my thanks to Prof. Dr. Mohsen Hashem Risan for all the helping
during my study.
As well as my sincere thanks and appreciation to Dr. Ahmed Abdul Jabbar

Suleiman and Dr. Magda Hadi Mahdi for providing me valuable scientific
advice.
I wish to express my special gratitude and love to my family for their guide
them and endless support.
I would like to express my sincere gratitude to my friends, Noorulhuda

Ojaimi, Sally Khodair
Finally, thanks and appreciation to everyone who contributed to the support

of this research ... and those who prayed for me with a sincere invitation,
may God reward them all on my behalf with the best reward of the
benefactors
Abstract I
Abstract
The main goal of this study was to isolate and identify Candida
albicans and investigate the prevalence of some virulence factors which include
biofilm formation, proteinase, coagulase, hemolysin production and
Candidalysin gene ECE1 distribution among C. albicans isolates depending on
several tests. The current study included 280 samples (swabs) were collected
during a period of 3 months from May to Augest 2022 of different ages and
genders of non-duplicated Iraqi patients who infected and suspected of
respiratory diseases and candidiasis from Baghdad hospitals (Medical City
Hospitals, Al-Yarmouk Teaching Hospital and AL-Imamein AL- Kadhimaein
Medical Educational City). The collected swabs were cultured on SDA medium
supplemented with chloramphenicol as antibacterial at a concentration 50 mg/l,
the plates of SDA were incubated at 37 °C for 24h
The culture results showed from 102 positave samples out of 280. 59
(57.84%) was female while 43 (42.16%) was male includes 58(56.86%) oral
cavity and 44 (43.14%) respiratory tract, while 178 of them were negative
Candida isolates were identified using conventional methods by morphological
and microscopic examination, grown on HiCrome Candida medium, germ tube
production, chlamydospore formation and confirmed using VITEK-2 system,
Morphological appearances colonies of C. albicans on SDA was white to
cream-colored smooth, glabrous, yeast-like, under microscopic examination,
the shape of Candida yeast cells was spherical to oval, with the presence of
budding, and much larger than bacterial cells. The results of the examinations
were shown in this study all C. albicans isolates were production of germ tube
and chlamydospores Will The other species did not produce any of them.
Abstract II
Out of 102 Candida isolates, C. albicans 70 (68.63 %) was the most frequent
isolate, followed by 11 (10.78%) C. trobicalis, and 6 (5.88%) C. kyfer and 6
(5.88 %) C. kruzei, and 5 (4.9%) C. Parapsilosis, and 4(3.9%) C. glabrata
respectively, Susceptibility of Candida isolates to antifungal drugs was
examined by disk diffusion method, performed as recommended by (CLSI)
M44-A document. The isolates showed a high level of susceptibility to
Amphotericin-B (93.14%), Clotrimazole (90.20%), Nystatin (85.92%) while
Candida isolates had a resistance of 42.86% to each of voriconazole and
ketoconazole. and that resulte of biofilm formation by using micro-titer plate
method was 48.57% from C. albicans isolates were strong producer for biofilm,
and 40% were moderately biofilm producer, while 4.29% non-producer of
biofilm and these results was matching with tube adherence methode results. C.
albicans isolates showed varied proteolytic activity, 42.86% was strong activity
and 4.86% of isolate have weak protolytic activity and the percentage of strong
hemolytic activity among C. albicans isolates was 28.57% while 51.43%
moderate in production, C. albicans isolates showed varied phospholipase
activity, 64.29% was strong activity and 7.14% of isolate have weak activity.
The percentage of positive coagulase production among C. albicans isolates
was 84.29% while 15.71% was negative in production and while, Prevalence of
Candidalysin gene ECE1 among 70 isolates of C. albicans was investigated
using polymerase chain reaction (PCR) technique, Molecular detection of
ECE1 gene among the 70 of C. albicans isolates collected revealed that there
were 15 (60%) isolates collected from oral cavity of males were positive for
ECE1 gene and 6(37.5%) from respiratory tract respectively, while 10(40%) of
isolates collected from oral cavity of females was positive of targeted gene in
oral cavity. Also, 10(62.5%) from respiratory tracts of females was harbouring
this gene.
List of Contents IV
List of Contents
No Subject Pag
e
Abstract I
List of Contents IV
List of Figures VIII
List of Tables X
List of Abbreviation XI
Chapter one: Introduction
1.1 Introduction 1
1.2 Aims of Study 4
Chapter two: literature review
2 Literature Review 5
2.1 Fungal Pathogen 5
2.2 Yeasts 5
2.3 Classification of Candida 7
2.4 Candida 8
2.5 Pathogenesis of Candida 13
2.6 Epidemiology of Candida 13
2.7 Candida spp 14
2.7.1 C. albicans 14
2.7.2 C. krusei 16
2.7.3 C. kyfer 17
2.7.4 C. parapsilosis 17
2.7.5 C. tropicalis 18
2.7.6 C. glabrata 18
2.8 Virulence Factors of C. albicans 20
2.8.1 Proteases 21
2.8.2 Phospholipases 21
2.8.3 Di-morphisms (Morphogenesis) 22
2.8.4 Hemolysin 22
List of Contents V
2.8.5 Biofilm Formation of C. albicans 23

2.8.6 Coagulase 25
2.9 Candidalysin 26
2.10 Anti-fungal Agents. 29
2.11 Future Challenges 32
Chapter three: Methodology
3 Materials and Methods 34
3.1 Materials 34
3.1.1 Apparatus Were Used in This Research 34
3.1.2 Equipment‘s Were Used in This Research 35
3.1.3 Solutions Used in This Present Study 36
3.1.4 Kits Used in This Present Study 36
3.1.5 Antifungal Drugs 37
3.1.6 Culture Media 37
3.1.7 Stains Used in The Current Study 38
3.1.8 Chemical and Biological Were Used 38
3.2 Method‘s 39
3.2.1 Preparation of Culture Media 39
3.2.1.1 Sabouraud Dextrose Agar (SDA) 39

3.2.1.2 HiCrome Agar Medium for Candida 39
3.2.1.3 Proteinase Activity Agar 40
3.2.1.4 Sabouraud Dextrose Broth (SDB) 40
3.2.1.5 Hemolysin Activity Agar 40
3.2.1.6 Corn Meal Agar (CMA) and Tween 80 41
3.2.1.7 Mueller-Hinton Agar 41
3.2.1.8 Phospholipase Activity Agar 41
3.2.1.9 Yeast Peptone Dextrose Broth (YPD) 42
3.2.1.10 Tryptic Soy Broth (TSB) 42
3.2.2 Preparation of Stains and Solutions 42
3.2.2.1 Crystal Violate 42
3.2.2.2 Lacto-phenol Cotton Blue 42
List of Contents VI
3.2.2.3 Ethidium Bromide 43

3.2.2.4 TBE Buffer 43
3.2.2.5 Potassium Hydroxide (KOH 10%) 43
3.2.2.6 Phosphate buffer saline (PBS) 43
3.2.2.7 McFarland Standards 44
3.2.3 Sterilization Methods 44
3.2.4. Preservation of Isolates 44
3.2.5 Sample Collection 45
3.2.6 Preparation of Candida spp Suspension 45
3.2.7 Identification of Candida spp 46
3.2.7.1 Morphological and Cultural Characteristics 46
3.2.7.2 Microscopic Examination 46
3.2.7.3 Culturing on HiCrome (Candida medium) 46
3.2.7.4 Identification of Candida spp. Isolates Using VITEK-2 47
System
3.2.7.5 Germ Tube Formation 48
3.2.7.6 Chlamydospores Formation 48
3.2.8 Antifungal Susceptibility Testing of Candida spp Isolates 49
3.2.9 Study of Some Virulence Factors In Candida spp 50
3.2.9.1 Assessment of Biofilm Formation by Clinical C. albicans 50
Isolates
3.2.9.2 Hemolysin Production 52
3.2.9.3 Proteinase Production 52
3.2.9.4 Determination of Phospholipase Activity 53
3.2.9.5 Coagulase 54
3.2.10 Molecular Study and Detection of ECE1 Gene Among C. 54
albicans Isolate
3.2.10.1 DNA Extraction 54
3.2.10.2 Measurement Concentration and Purity of Candida DNA 56
3.2.10.4 Preparation of The Agarose Gel 57
3.2.10.3 Agarose gel Electrophoresis of DNA 57
List of Contents VII
3.2.10.5 The Casting of The Agarose Gel 58

3.2.10.6 Preparation of Sample 58
3.2.10.7 The Primers 58
3.2.10.8 Polymerase Chain Reaction (PCR) 59
3.2.10.9 PCR Optimization 60
3.2.10.10 Agarose Gel Electrophoresis of PCR Products 60
3.2.11 Sequencing and Alignment of Sequence 61
3.2.12 Deposition of Sequences to GenBank 61
3.2.13 Statistical Analysis 61
Chapter four : Results and Discussion
4 Results and Discussion 62
4.1 Isolation and Identification of yeast 62
4.2 Antifungal Susceptibility Testing 71
4.3 Detection of Some Virulence Factors Among C. albicans 76
Isolates
4.3.1 Biofilm Formation Assessment 76
4.3.2 Hemolysin Activity 79
4.3.3 Proteinase Activity 81
3.3.4 Phospholipase 83
4.3.5 Coagulase Production 84
4.4 Molecular Study 86
Chapter Five: Conclusions and Recommendations
5.1 Conclusions 91
5.2 Recommendations 92
Refrence 94
Appendixes
List of Figures
2-1 C. albicans (Candidiasis,Online site.,2022) 16

2-2 Virulence factors of C. albicans 20
List of Contents VIII
2-3 Biofilm formation 24

2-4 Factors associated aith occurrence of biofilm 24
2-5 Precancerous and malignant new-formations in oral cavity 28
by C. albicans hypothetically
4-1 The percentage of positive and negative culture of 62
collected swabs samples from patients on SDA medium.
4-2 Colonies of C. albicans gown on SDA medium at 37 °C 66
after 24 h incubation.
4-3 Microscopic features of C. albicans cells stained with A- 67
Lacto phenol cotton blue B- crystal violate dyes,
examined under light microscope (40X).
4-4 Differentiation of Candida isolates according to colony 68
color grown on HiChrom Candida agar medium for 24h at
37°C.
4-5 C. albicans isolate produced A-germ tube when grown on 70
human serum after 3 h incubation at 37 °C. (40 X) B-
Chlamydospore formation on corn meal broth
supplemented with 10% tween 80 after 24-48 h incubation
at 37 °C.
4-6 Antifungal susceptibility test using disk diffusion method 74
against C. albicans isolate,
4-7 The ability of C. albicans to formation biofilm by using 76
test tube method.
4-8 Hemolytic activity of C. albicans isolate on blood agar 79
medium. Ring shaped formation around C. albicans
colony was reported that indicated hemolysin positive
List of Contents IX
production
4-9 The proteolytic activity of isolates of 70 C. albicans on 82
BSA agar medium at 37 for 24 hrs.
4-10 Tube coagulase test of C. albicans 85
4-11 Electrophoresis of the PCR product of the ECE1 gene of 87
C. albicans isolates using a 2% agarose gel for 60 minutes
under a voltage of 70 volts and photographed under
ultraviolet light after staining it with ethidium bromide.
List of Table
(2.1) Candida species commonly isolated in clinical settings an 9
ecology
(3-1) Apparatus used in the present study 34
(3-2) General Equipment‘s utilized in this study 35
(3-3) Solution used through the study 36
(3-4) Kits used in this study 36
(3-5) Antifungal agents employed in this work 37
(3-6) Culture media used during this current study 37
(3-7) Stains used in the current study 38

(3-8) Chemicals and biological materials used. 38
(3-9) Zone interpretation for fungi in millimeter. 50

(3-10) Classification of biofilm formation according to biofilm 52
density
(3-11) DNA extraction Kit component 55
List of Contents X
(3-12) PCR Primers used in this study for amplification of ECE1 59

gene
(3-13) Reaction components for amplification of ECE1 gene in 59

conventional PCR
(3-14) The optimum conditions of PCR technique used in the 60

detection of ECE1 gene among C. albicans isolates
(4-1) Distribution of clinical Candida spp isolated from 64

different specimens according to gender.
(4-2) Methods used in the idwntification of Candida spp 65
(4-3) Color and morphology of Candida spp on chrome
Candida agar.
(4-4) Antifungal susceptibility of Candida spp isolated from the 74
oral cavity and respiratory tract of patients
(4-7) The biofilm capacity of 70 C. albicans isolated from oral 78
cavity and respiratory tract.
(4-8) Distribution of hemolytic activity of C. albicans isolates 80
on blood agar medium.
(4-9) The Proteinase activity of 70 isolate of C. albicans. 82
(4-10) The Phospholipase activity of 70 isolate of C. albicans. 83
(4-11) Coagulase activities of 70 C. albicans isolated from oral 85
cavity and repertory tract
(4-12) Distribution of the candidalysin ECE1 gene among C. 88
albicans isolates according to source of isolation and
gender.
List of Contents XI
List of Abbreviations
°C Centigrade
AIDS Acquired Immune Disease Syndrome
AMB Amphotericin B
bp Base pair
BSA Bovine Serum Albumin
C. albicans Candida albicans
C. glabrata Candida glabrata
C. keyfer Candida keyfer
C. krusei Candida krusei
C. parapsilosis Candida parapsilosis
C. tropicalis Candida tropicalis
CLO Clotrimazole
CLSI Clinical and laboratory Standards Institute
CMA Corn Meal Agar
Co2 Carbon Dioxide
CV Crystal Violet
D.W Distilled Water
Da Dalton
DNA Deoxyribonucleic Acid
dNTPs Deoxyribonucleotide Triphosphates
ECO Econazole
EDTA Ethylene Diamine Tetra Acetic Acid
ELISA Enzyme-linked Immunosorbent assay
GT Germ Tube
H Hour(s)
HIV Human Immunodeficiency Virus
HRP Horseradish Peroxidase
Hz Hemolysin Activity
ICU Intensive Care Unit
ITZ Itraconazole
KH2PO4 Potassium Dihydrogen Phosphate
List of Contents XII
KOH Potassium Hydroxide

KTO ketoconazole
MFC Minimal Fungicidal Concentration
mg/dl Milligram / Decilitre
MgSO4 Magnesium Sulfate
MIC Minimal Inhibitory Concentration
Min Minute
mmol/l Millimoles/ Litter
NCBI National Center for Biotechnology Information
ng Nanogram
ng/µL Nanogram / Microlitter
No Number
NYS Nystatin
OD Optical Density
PBS Phosphate Buffer Saline
PCR Polymerase Chain Reaction
Prz Proteinase Activity
RNA Ribonucleic Acid
Rpm Revolution per minute
rpm Round per minute
Saps Aspartic Proteinase
SDA Sabouraud Dextrose Agar
SDB Sabouraud Dextrose Broth
SP Spectrophotometric
spss Statistical Package for Social Science
TBE Tris-boric-EDTA-Buffer
TCA Trichloroacetic Acid
USA United States of America
UV Ultra Violet
v Visually
μg Microgram
μL Micolitter
μm Micrometer
Chapter One
Introduction
Chapter One: Introduction 1
1.1. Introduction
Fungi are make up approximately 7% of all eukaryotic organisms

which found on earth (Mora et al., 2011). Fungal infections are a major
cause of morbidity and mortality in the global population with species of
Candida, Cryptococcus, Pneumocystis, and Aspergillus and contributing to
an estimated 2 million life-threatening infections reported each year (Brown
et al., 2012). It is critical to understand the molecular mechanisms that
support fungal pathogenesis and host immunity better and use this
understanding to creation of new diagnostics, vaccines, and
immunotherapies (Naglik et al., 2019).
Yeasts are eukaryotic microorganisms classified in the kingdom of

fungi, with about 1,500 species (Hibbett et al., 2018). The phylogenetic
diversity of yeasts is shown by their placement in the divisions Ascomycota,
Basidiomycota, and Deuteromycota. The Candida spp. belong to
Ascomycota division, class Ascomycetes (Hibbett et al., 2018).
C. albicans are one of the most dangerous fungi to human health
This yeast despite being a normal component of the commensal flora can
infect the skin, mouth, vagina, and gut in both healthy and
immunosuppressed people furthermore, C. albicans responsible for invasive
candidiasis, an infection of the blood, heart, and other organs in hospitalized
patients, Even in otherwise healthy patients, invasive candidiasis has high
mortality rates about 50% (Russell et al., 2021).
Hyphae constitute an important stage in the illness progress
because is the more invasive morphology of most yeast, which is necessary
for diffusion into the bloodstream during systemic infections. In addition,
the hypha formation is usually accompanied by the development of various
additional virulence factors, such as adhesions, invasions, metal acquisition

factors, hydrolytic and detoxifying enzymes, all of them are playing a role
in the pathogenesis of C. albicans (Chen et al.,2020: Mogaveroet et al.,
2021).
That dimorphic fungal phases are formed due to
immunodeficiency, stress, and other external factors, the morphological
change of Candida spp. make the yeast overgrow and more virulent in their
hosts. The host recognition biomolecules (adhesions), phospholipases,
secreted aspartyl proteases, and hemolysins that are connected to the active
invasion of host tissue are among the fungus's virulence factors. Thus, C.
albicans can produce a variety of diseases, such as vulvovaginitis and
oropharyngeal candidiasis, as well as hematogenously disseminated
systemic candidiasis (Vanková et al., 2020).
The first cytolytic peptide toxin discovered in a human fungal
infection is called candidalysin. In the many cases, C. albicans secretes a
substance called candidalysin, which works on triggering host
immunological reactions and promoting infection generated by selective
proteolysis of the hypha-associated protein ECE1p by Kexin proteases at
conserved lysine-arginine recognition sites, following secretion,
candidalysin disrupts epithelial cells plasma membranes causes cellular
stress that leads to necrotic cell death and promotes fungal translocation
across intestinal epithelial cells (Richardson et al., 2022).
Due to their immunocompromised state and the side effects of
chemotherapy, cancer patients are at significant risk for fungal infection,
especially by species of Candida, Patients with cancer are more at risk for
developing oral candidiasis when they are receiving chemotherapy, this
infection typically comes with several symptoms such as burning, pain, taste
changes, decreased saliva secretion, and difficulty swallowing, but it can

also remain unrecognized infection (Aldossaryet al., 2016). Candidalysin is
a virulence factor of the C. albicans genus encoded by the ECE1 gene where
it is secreted in people whose immunity is weak or who have immune
suppression, which leads to C. albicans being a dangerous pathogen causing
many diseases such as cancer and dermatitis in addition to its infiltration to
the body organs and the possibility of it even reaching the brain (Mora et al.,
2011).
In Iraqi patients, the C. albicans is widespread among people particularly
children and young as well as adults who suffering from different disease
such as immune disease. For this reasons, the main aims of the current study
are the detection of some virulence factors among C. albicans isolates
isolated from Iraqi patients and study the prevalence of Candidalysin gene
ECE1, as well as investigation antifungal activity of some antifungal drugs
against the tested isolates.
The molecular biology part of the current thesis included the study
of the ECE1 gene in Candida fungus in terms of diagnosing the gene using
conventional PCR and sending some samples that carry this gene for the
purpose of determining the genetic sequence using the Sanger sequence
technique. According to national center for biotechnology information, the
ECE1 gene in C. albicans is located on the fourth chromosome and encodes
a protein with exon number 1, Gene ID number was 3646814 ( Naglik et
al.,2019).
1.2. Aims of the Current Study:
1- Determining some the virulent factors among the isolated C. albicans

such as, Haemolysin, Protease, Biofilm Formation, Phospholipase and
Coagulase, Antifungal suscebtiblity.
2- Molecular detection of candidalysin ECE1 gene among the tested
isolates.
Chapter Two
Literatures Review
Chapter Two: Literature Review 5
2. Literatures Review
2.1. Fungal Pathogens
Humans are affected by a pathogenic fungus, although superficial

fungal infections are usually harmless, invasive infections are far more
difficult to cure and have a devastating influence on human health,
accounting for a high mortality rate, Despite the fact that human fungal
illnesses have been overlooked, recent research estimates that they kill more
than 1.6 million people each year (Bongomin et al., 2017).The effect of
fungi on human health is a growing problem. Every year, 4.9 million people
worldwide are affected by invasive or persistent fungal diseases (Janbon et
al., 2019).
The ecology of the pathogenic fungi and the type of people
afflicted has a significant impact on the epidemiology of fungal diseases. As
a consequence, the incidence of fungal diseases for opportunistic fungal
infections can vary depending on the underlying related disorders. Although
antifungal medications are available, fungal infections are usually difficult to
treat and the death rate is still very high (Scorzoni et al., 2017). The first is
that there is now no effective vaccination, and the arsenal of antifungal
compounds is small and unavailable in most countries. Actually, there are
just a few kinds of antifungal compounds that are used to treat fungal
infections, and there are worries about their toxicity, the host immune
system's deterioration, and the people they affect drug resistance is another
new problem (Janbon et al., 2019).
2.2. Yeasts
Yeasts are eukaryotic microorganisms classified in the kingdom

fungus, and about 1500 species of yeast have been identified thus far
(Kurtzman and Fell, 2006). A few species reproduce by binary fission, but
the majority of reproduce asexually through budding, Although most molds
have pseudohyphae, or fake hyphae, which are a string of connected budding
cells, some species with yeast forms can develop into multicellular
organisms (Kurtzman and Fell, 2006). Most yeast is between 3 and 4 mm in
diameter, however, some can be over 40 mm in diameter, depending on the
species (Walker et al., 2002).
The phylogenetic diversity of yeasts is shown by their placement
in the divisions Ascomycota, Basidiomycota, and Deuteromycota. The
division Ascomycota commonly known as ascomycetes comprises the
Saccharomyces, Pichia, Endomycopsis, Nematospora, and Candida.
Members of the division Basidiomycota are known as the basidiomycetes,
and the yeast belonging to this division are Cryptococcus neoformans and
Malassezia. The Deuteromycota also known as fungi imperfect comprises a
group of fungi of which Rhodotorula, Torulopsis, and Trichosporon have
belonged (Kurtzman and Piskur, 2006).
Yeasts are a portion of the commensal fungi flora of the healthy
population. However, due to the large and rapid increase in the incidence of
opportunistic fungal infections, the focus has been on treatment and, above
all, prevention of these complications, Several species of fungi are
considered to be implicated in nosocomial infections, such as Aspergillus
spp., Zygomyces spp., Fusarium spp., Scedosporium spp., Cryptococcus
spp., Trichosporon spp., Geotrichum spp., and Rhodotorula spp., C.
albicans continues to be the most prevalent, counting to 50-90% of the

isolates from fungal infections (Vázquez-González et al., 2013: Ferreira et
al.,2013).
2.3. Classification of Candida
Candidiasis is an infection caused by a yeast species of the genus

Candida, which belongs to the (Hajjeh et al., 2004).
Kingdom: Fungi
Phylum: Ascomycota
Subphylum: Saccharomycotina
Class: Saccharomycetes
Order: Saccharomycetales
Family: Saccharomycetacae
Genus: Candida
About 20 species are known to cause infections in humans (Moris et al.,

2008). Includes the species C. albicans, C. glabrata, C. parapsilosis, C.
tropicalis, C. guilliermondii, C. lusitaniae, and C. krusei, C. dubliniensis, C.
pelliculosa, C. kefyr, C. norvegensis, C. haemulonii, and Saccharomyces
cerevisiae (Aittakorpi et al., 2012).
2.4. Candida
The word "Candida" is derived from the Latin word "'candid,"

which means "white." Candida spores are a pathogenic, polymorphic fungus
that becomes invasive when the host's normal balance of flora is disturbed
(Abood, 2014). Infections in humans have been linked to about 14 different
species of Candida, with C. albicans being the most common yeast isolate
(Meurman, et al., 2007). C. tropicalis, C. glabrata, C. krusei, and C.
parapsilosis are also emerging as significant etiologic agents of Candida
infection, however C. albicans is the species that is most usually isolated (
Nieminen et al., 2014). Candida is opportunistic eukaryotic cosmopolitan
yeast belonging to the Ascomycota phylum, the Hemiascomycetes class, the
Saccharomycetales order, and the Candidaceae family, these are non-
pigmented, non-encapsulated, aerobic or facultative anaerobic and single-
cell thallus organisms which reproduce asexually by budding spores
(Lagane., 2007). They vary in size (3 to 15 μm) and are distinguished from
other yeasts by the polysaccharide composition of their cell wall and their
ability to present different morphologies, depending on the environmental
conditions (pH, temperature, etc.), they can take a more elongated and
cylindrical shape called pseudomycelium or mycelium, pseudomycelium
development is due to a lack of detachment of the bud from the mother cell.
That of the germ tube and true mycelium, on the other hand, is species-
dependent and observed only for C. albicans and C. dubliniensis. Candida is
heterotrophic microorganisms that only develop in the presence of organic
matter and they are endogenous or exogenous commensal germs that express
their pathogenic power in the presence of promoting factors, They are
responsible for more than 80% of yeast infections in humans (Tamo., 2020).
Table (2-1) Candida species commonly isolated in clinical settings

ecology (El-Kirat et al., 2010)
Most frequent
Ecology
species
Commensal yeast from the digest and respiratory
C. albicans
tract mucosa, more than 75% of yeasts isolated
C. glabrata Digestive mucosa and urogenital
C. parapsilosis Skin
Soil, water, digestive tract, urogenital and
C. tropicalis
respiratory tract
C. krusei Food (Dairy, Beer)
Less common species Ecology
C. dubliniensis Birds, digestive tract
C. guilliermondii Skin
C. lusitaniae Environment, digestive tract
C. kyfer Food, digestive tract, respiratory tract
C. lipolytica Animals and plants
C. ciferrii Onychomycosis
C. inconspicua Digestive tract, hospital environment
C. rugosa Water, Food (dairy products)
C. famata Skin
C. africana Vagina
Disseminated Candidiasis, It can also be called invasive or

systemic candidiasis. It is a serious infection that can infect blood, eyes,
brain, and liver and can cause disseminated disease, patients who are
immuno-compromised are susceptible to these infections (Hazen, 1995).
Diagnosis of C. albicans, the diagnosis of candidiasis depends on

several factors including the location of infection and the symptoms thus
taking clinical samples, direct examination, culture, and identification of the
germs in the sample, serodiagnostic can also be performed (Tamo., 2020).
Morphological Identification, the identification of the germ that

caused the infection often starts with a macroscopic examination of the
microbial colonies after the clinical sample from the patient has been
cultured, the shape, size, and color of the colonies are evaluated in
accordance with the manufacturer's recommendations and the type of culture
medium employed. For instance, C. albicans colonies are uniformly green
on chromogenic media like the Hicrome Candida agar medium (Pincus et
al., 2007).
Molecular identification In order to overcome the limitations of

phenotypic identification approaches, molecular biological techniques have
been created. This is because some species of Candida present may not be
easily recognized by morphological and biochemical characteristics. Several
strategies have been put out for molecular identification to distinguish
Candida spp using both DNA-based and non-DNA-based methodologies
(Cirak et al., 2003).
Multi-locus enzyme electrophoresis, which analyzes the

polymorphism of fungal enzymatic proteins and describes them, is one of
the non-DNA-based techniques (Sudhan et al., 2016). Techniques like PCR,

Nucleic Acid Sequence Based Amplification, DNA-microarrays,
Fluorescent in situ hybridization, and MLP typing are among the DNA-
based technologies (Delavy., 2019).
Chlamydospores, chlamydospore formation is a diagnostic
adjective for identifying C. albicans. It takes 48–72 h to make them using
conventional techniques in rice meal agar. Using liquid media, such as
cornmeal broth and dairy supplements, this time can be cut short. Infection
with Candida may be made more likely by the presence of Candida in the
mouth and epithelial alterations, which, when combined with other
cofactors, may also cause epithelial dysplasia and malignant transformation.
In general, multiple aims, such as fungus growth, germ tube testing, and
chlamydospore utilizing different techniques, are used to detect Candida in
the oral cavity, Sabouraud Dextrose Agar is the major isolation medium for
Candida that is most frequently utilized (SDA) (Gupta et al., 2019).
Chlamydospores, a cell type known as a chlamydospore is formed

by the pathogenic yeast C. dubliniensis under specific growth conditions;
this cell type differs from hyphal or yeast cell types in that it contains an
additional internal layer in its cell wall (Bemena et al., 2021). As opposed to
ascospores, which contain the haploid products of meiosis, chlamydospores
are huge circular cells that are the consequence of mitotic divisions.
Chlamydospores aren't known to play a part in the Candida life cycle.
Chlamydospores are frequently induced by nutrient restriction or low
oxygen levels, and C. dubliniensis appears to undergo chlamydosporulation
more quickly than C. albicans (Bottcher et al., 2016). The chlamydospore
wall, which has an interior layer not present in budding or hyphal C.
dubliniensis cells, is more extensive than the walls of those cell types,
according to ultrastructural investigations. This layer's structure and makeup
have not been adequately described. The structure of the chlamydospore
wall in C. dubliniensis was examined in previous study proved that chitosan
makes up the distinctive interior layer of the chlamydospore wall.
Additionally, genes encoding orthologs of Saccharomyces
cerevisiae proteins essential for the synthesis of the chitosan layer in
ascospores are likewise important for the assembly of the chlamydospore
wall (Bemena et al., 2021).
Germ tube, the germ tube test is frequently regarded as the most
accurate technique for identifying Candida with a sensitivity of up to 98%,
the germ tube test is the most practical, quick, and simple method for
differentiating C. albicans and C. dubliniensis from other species (Moya-
Salazar and Rojas, 2018).However, this test is one of three screening assays
used to distinguish C. albicans from other species. This test is carried out
using a variety of media, with human serum (fresh, inactivated, or frozen)
being the most suitable and practical for filamentation (Moya-Salazar and
Rojas, 2018). These media include water agar with 1% milk, BHI,
commercial media (broth SST, TSA-BAP, BHI, YEPD free-serum, among
others), and others. The germ tube test has undergone some variations in
recent years, most of which are low-cost, low-benefit tests that are mostly
used in middle- and low-income countries for screening purposes (Moya-
Salazar and Rojas, 2018). The germ tube is crucial for the development of
pathogenicity during the invasion of the host tissues and possesses unique
phagocytosis resistance according to Faidal and others, the development of
the germ tube is correlated with an increase in the yeast's ability to adhere to
and infiltrate the host's tissues Candida is the yeast that causes this.
Therefore, one of the primary causes of candidiasis is its capacity to produce
a germ tube without the assistance of other types (Abu Elteen, 2000).
2.5. Pathogenesis of Candida
Medical Aspects As an opportunistic human pathogen Candida

spp. causes fungal infection in different parts of the body known as
candidiasis. Candidaemia is the most severe known infection caused by
Candida spp (Koundal and Cojandaraj., 2020). The major clinical forms of
infections are cutaneous Candidiasis, It is a skin and nail infection caused by
Candida. Infants' inguinal folds, skin folds, and nail folds are the most
frequently observed locations. The pathogen can thrive in the warm, moist
parts of the skin (Pelletier et al., 2005).
Mucosal Candidiasis, People who have impaired immune systems, poor oral
hygiene, hyposalivation, dentures, or smoke are more likely to develop
mucosal membrane candidiasis. Mouth candidiasis is oral thrush. Compared
to oral candidiasis, esophageal candidiasis is less frequent. The female
genital tract is infected with vulvovaginal candidiasis (Hazen, 1995).
2.6. Epidemiology of Candida spp.
The World Health Organization (WHO) today unveiled the first-

ever list of fungal "priority pathogens," listing 19 fungi that have become
serious dangers to public health due to their capacity to produce invasive,
life-threatening illnesses and their increasing resistance to antifungal
medications. C. auris, multidrug-resistant yeast that was first found in Japan
in 2009 and has subsequently spread throughout the world, is one of the
fungi in the critical priority category As many as 53% of patients die from
invasive infections brought on by C. auris, which is easily transmissible in

medical facilities and sometimes resistant to all forms of antifungal therapy
(WHO, 2022). Another Candida spp given critical priority is C. albicans,
which is common in the mouth, throat, gut, vagina, and skin but can cause
severe disease when it invades other tissue (WHO, 2022).
More than a billion people worldwide are impacted by fungal
diseases every year, leading to more than 1.6 million fatalities 75 to 88% of
these infections are caused by candidiasis, and their occurrence is rising
along with mortality rates despite advances in treatment (Bongomin et al.,
2017). The clinical range of candidiasis includes localized conditions
including cutaneous, nail, intestinal, and genital candidiasis as well as
systemic conditions like candidemia. They are caused on by Candida-related
yeasts only about 20 of the more than 200 Candida spp that have been
identified are linked to human infections. The majority of these germs are
commensal and grow on the skin, within the body, in the mouth, throat,
intestines, and vagina without creating any issues (Sullivan et al., 2017).
2.7. Candida spp
2.7.1. C. albicans
Along with morphogenesis, C. albicans also has to be able to

acquire nutrients like lipids, respond to DNA damage appropriately,
maintain metal ion homeostasis, and perform functional DNA damage
response while the creation and development of C. albicans disseminated
infections (and generally other infections) still depend on hyphal
morphogenesis, its significance in commensalism is less clear. In fact, it has
been demonstrated that mutants with hyphal development deficiencies have
higher fitness in the gastrointestinal system, indicating that hyphal
morphogenesis is disadvantageous for commensalism (Janbon et al., 2019;

Bhalla et al., 2022). C. albicans from a commensal pathogen to an
opportunistic one is a widespread fungus that lives in human mucosa as well
as certain environmental reservoirs (Opulente et al., 2019). According to Ali
et al. (2012), human colonization of the mouth, vagina, and gut normally
begins in infancy, mostly during breastfeeding or vaginal delivery.
Colonization resistance in mice, which do not natively harbor C.
albicans, depends on the existence of healthy endogenous microbiota and
antimicrobial peptides (AMP), such as CRAMP, a peptide similar to the
human AMP cathelicidin LL-37. Recent research has demonstrated that
intestine IgA-mediated immune selection against C. albicans filaments
reduces unfavorable fungal effectors while enhancing the commensal yeast's
competitive fitness (Ost et al., 2021).
Inside the gut, C. albicans suppresses certain prominent genera of
gut bacteria and local inflammation; it contributes to the development of
healthy microbiota (Rao et al., 2021). According to Bacher et al., (2019), the
presence of C. albicans in the gut is linked to an increase in splenic IgG-
producing B cells and systemic antifungal IgG that confers protection
against candidemia.
Most people who carry C. albicans are asymptomatic, and the
disease usually develops when the host's homeostasis or endogenous
microbiota are disturbed. Recent research has demonstrated that using β-
lactam antibiotics increases the production of bacterial peptidoglycan
components, such as tracheacytotoxin, which triggers the growth of invasive
hyphal fungi in the gut (Tan et al., 2021). Antibiotic-induced perturbations,
immune system abnormalities, alterations in the microbiome, and/or changes
in mucocutaneous barrier integrity in the setting of expression of a variety of
virulence determinants allow C. albicans to transform into an opportunistic

pathogen (McCarty et al., 2016; Zhai et al., 2020).
Figure (2-1) C. albicans (Candidiasis, Online site., 2022).
2.7.2. C. krusei
The group of etiological agents that cause candidiasis includes C.

krusei, and although it is not isolated as frequently as other Candida species,
the infections brought on by this yeast are particularly important in the
clinical environment because of its intrinsic resistance to fluconazole drug
(Samaranayake., 1994; Gomez-Gaviria et al., 2020).
2.7.3. C. kyfer
A developing pathogen, C. kyfer, is especially dangerous for

immunocompromised and hemophiliac patients. Kluyveromyces marxianus,
the fungus' sexual form, is of biotechnological interest because of its
resistance to heat, capacity to make bioethanol, and capacity to produce
enzymes (Seth-Smith et al., 2020). Systemic candidiasis and deep infections
have both been linked to the uncommon cause of candidiasis which rarely
caused by C. kyferr. The case reports Nurdin et al., (2021) described the first
instance of cutaneous candidiasis brought on by C. kefyr. A rare, developing
species of Candida called C. kyferr can cause candidemia, particularly in
those with hematologic malignancies. It resides in the digestive tract and is
related to consuming dairy products that contain this species (Reda et al.,
2022).
2.7.4. C. parapsilosis
A new non-albicans Candida species called C. parapsilosis

primarily affects immunocompromised patients and low-birth-weight
neonates. The prevalence of infections caused by C. parapsilosis in non-
albicans species is rising globally, and C. parapsilosis in hospitals in Asian,
European, and South American nations, C. parapsilosis is currently the
second or third most frequent yeast species linked to invasive candidiasis
(Singh et al., 2019). Although C. parapsilosis is frequently linked to
infections in low birth weight newborns, invasive infections in hospitalized
immunocompromised individuals, receiving parenteral nourishment, or
using intravascular devices for an extended period of time and despite its
clinical importance, it is still unclear how pathogenic C. parapsilosis , what
are variables contribute to its virulence, and how it interacts with the host
(Giri and Kindo., 2012; Asadzadeh et al., 2022).
2.7.5. C. tropicalis
C. tropicalis is widespread in the environment, human skin,
vagina, mouth, and digestive tract, which would become pathogenic rapidly
after an alteration of the host immune system, causing the localized and even
systemic infection (Zhai et al., 2021).
2.7.6. C. glabrata
C. glabrata is yeast of increasing medical relevance, particularly

in critically ill patients. C. aglabrata is asexual, haploid yeast of the clade
Nakaseomyces. It was initially named Cryptococcus glabrata, It then
changed to Torulopsisglabrata in 1894, but the Candida genus was described
in 1913 (Kounatidis et al., 2018; Kumar et al., 2019). C. glabrata is a
successful pathogen epithelial surface (mouth, gastrointestinal tract, vagina,
skin, and present in stool) as healthy microbial flora with no age specificity
(Ahmed et al., 2015). C. glabrata is commonly found in the environment,
particularly on flowers, leaves, surfaces, water, and soil. It is considered the
second most frequently isolated cause of candidiasis after C. albicans. It
accounts for approximately 15–25% of invasive clinical cases (McCarty et
al., 2016). In fact, C. glabrata is the second most common species found in
the United States and North-western Europe (Pappas et al., 2018), was
shown as a cause of BSI in intensive care units in the United States between
1989 and 1999 in a survey that reported. An increased incidence of C.
glabrata infection among Candida species as a cause of BSI in U.S. ICUs
between 1989 and 1999 in a survey showed that C. glabrata ranked second
to C. albicans accounting for 20% to 24% of all Candida BSIs (Pfaller et al.,
2007). Invasive candidiasis due to C. glabrata causes substantial morbidity

and mortality of approximately 40–60%, perhaps due to the inherent low
susceptibility of C. glabrata to the most commonly used azoles
(Timmermans et al., 2018).
The usual route of C. glabrata to reach the bloodstream is through

the breach of natural barriers, such as the use of catheters, trauma, or surgery
(Galocha et al., 2019). However, disease susceptibility increases due to
certain conditions such as AIDS and tuberculosis (TB), immunosuppressive
use and cancer drugs, prolonged antibiotic therapy, and prolonged
hospitalization (Perez-Torrado et al., 2017). An increased frequency of C.
glabrata isolation has also been observed to be associated with older age, as
reported by Zhang et al., (2015). Accordingly, C. glabrata was isolated
more from patients in the age group >70 years than the other age groups
(58.2% vs. 41.8%) out of 193 samples collected. A switch from normal flora
to the pathogenic state may occur, leading to disease setting in, ranging from
superficial (mucosal and skin) to systemic with an alarming mortality rate
(Kaur et al., 2005).
2.8. Virulence Factors of Candida albicans.
Virulence factor of C. albicans are divided into several types including

candidalysin, biofilm, hydrolytic enzymes etc... As showin in the Figure (2-
2).
Figure (2-2) Virulence Factors of C. albicans (da Silva Dantas et al.,

2016).
2.8.1. Proteases
Extracellular hydrolytic enzymes are crucial in the development of

candidal overgrowth because they promote tissue penetration, adhesion, and
consequently invasion of the host. Phospholipases and secretory proteinases
are two of Candida's most significant hydrolytic enzymes (Tsang et al.,
2007). Many secreted proteases have been reported as virulence factors in
fungal infection or allergy, but little is known about intracellular proteases of
fungi (Ito et al., 2010). Secreted proteinases are responsible for adhesion,
tissue damage, and invasion of host immune responses and their proteolytic
activity has been associated with tissue invasion (Naglik et al., 2003; Hube
and Naglik, 2005). Measuring the activity of the proteinase, Bovine serum
albumin (BSA) degradation was used to assess the extracellular proteinase
activity of Candida isolates. Proteinase activity (Prz) was calculated as the
colony to the diameter of the proteolytic unstained zone (Sachin et al.,
2012).
2.8.2. Phospholipases
The secretion of extracellular phospholipases is considered a

key attribute that aids invasion of the host mucosal epithelia. The
phospholipases, in general, catalyze the hydrolysis of phospholipids, which
are major components of all cell membranes (Ibrahim et al., 1995; Monod
and Zepelin., 2002). Phospholipases catalyze hydrolysis of one or more ester
bonds in glycerophospholipids. They carry out a number of significant
functions, such as membrane stability or destabilization and the release of
lipid second messengers (De Maria, .2007). Determination of phospholipase
activity The Candida phospholipase activity was detected by measuring the
size of precipitation zone after the growth on egg yolk agar. Phospholipase
activity of the isolate was considered positive when a precipitation zone was
visible around the colony on the plate (Sachin et al., 2012).
2.8.3. Di-morphisms (Morphogenesis)
The morphological transformations are a distinguishing trait of

polymorphic yeasts, such as several Candida spp that are significant human
infections. Temperature, pH value fluctuations, oxygen levels, and nutrition
availability are among the triggers that can typically cause these changes in
cell structure, The yeast-to-hypha transition, a crucial virulence factor in
particular for C. albicans, so is the main subject of current research on the
morphology of Candida (Mayer et al., 2013; Böttcher et al., 2016).
2.8.4. Hemolysin
Another potential virulence component that may contribute to the

pathophysiology of candida is hemolysin. In particular, hyphal invasion in
disseminated candidiasis is facilitated by hemolysin secretion followed by
the iron acquisition (Luo et al., 2001; Tsang et al., 2007). Haemolysin is
another putative virulence factor thought to contribute to candidal
pathogenesis. In particular, the secretion of haemolysin, followed by iron
acquisition, facilitates hyphal invasion in disseminated candidiasis (Tsang et
al., 2007).
Determination of haemolysin activity was evaluated with a blood
plate assay so hyphal invasion in disseminated candidiasis is made easier by
the secretion of haemolysin followed by the iron acquisition (Sachin et al.,
2012). The existence of hemolytic exoenzymes is crucial because it enables
yeasts to absorb iron ions from hemoglobin additionally; there is a
positive link between this metal and the development and spread of diseases
(Martins et al., 2014).
2.8.5. Biofilm Formation Among C. albicans
Formation of biofilm is a property of C. albicans pathogenesis and

most infections caused by C. albicans are associated with the formation of a
biofilm on the surface of the host or on abiotic surfaces (implants), which
leads to high morbidity and mortality (Tsui et al., 2016). Because C.
albicans can transition from yeast to hyphae morphologically, its biofilm is a
complex structure of diverse morphological forms (Pryia et al., 2020). The
biofilm progresses through several consecutive phases (Talapko and Skrlec.,
2020). C. albicans individual cells attach to the substrate in the initial stage,
forming the biofilm's basic layer. The next stage is cell proliferation and
filamentation, during which the cells grow into protruding elongated
structures that eventually develop into filamentous hyphal forms. The
development of hyphae is a sign that the biofilm is beginning to form.
Following the establishment of an extracellular polysaccharide matrix, the
maturation phase begins. The third stage entails the dispersion of non-
adherent cells, which may lead to the emergence of new biofilms as the
shown in Figure (2- 3) and the potential for tissue diffusion (Cavalheiro et
al., 2018; McCall et al., 2019).
Figure (2-3) Biofilm formation (Talapko et al., 2021)
Figure (2-4) Factors associated with occurance of biofilm (Atriwal et al.,

2021).
2.8.6 Coagulase
Plasma coagulase is an enzyme that attaches to plasma fibrinogen

and sets off a series of events that cause plasma to clot, the hydrolytic
enzyme activity found on the surface of microbial pathogens are capable of
harming host cells in vivo, the first discovery of coagulase production by
Candida spp. was made by Rodrigues et al., (2003). Who used the coagulase
tube test using rabbit plasma to find significant coagulase activity in C.
albicans (88.5%) and C. tropicalis (82.6%) but lower activities in other
species. Also this test routinely used to detect the presence of S. aureus. The
coagulase tube test is the most frequently used method for staphylococci
because of its greater accuracy and its ability to detect both bound and free
coagulase (Fairbrother., 1940; Rossney et al., 1990). Coagulase production
test following the inoculation of each strain into a glass tube with 500 ml of
EDTA-rabbit plasma and incubation for 4 h at 35°C, the existence of a clot
that could not be suspended by moderate shaking was used to determine the
amount of coagulase production after 24 hours, the tube was reincubated and
reexamined if no clot had formed (Isenberg., 1998).
2.9. Candidalysin
Candidalysin is synthesized by targeted proteolytic processing of

the hypha-associated protein ECE1 by kexin proteases at conserved lysine-
arginine recognition sites, and it is essential for C. albicans mucosal
infections following secretion, candidalysin disrupts the plasma membrane
of the gastrointestinal epithelial cells, causes cellular stress that leads to
necrotic cell death, and promotes fungal translocation across the cells
(Richardson et al., 2022).The transcription of ECE1 is highly correlated with
hypha development (Martin et al., 2013). While hypha production and
maintenance are essential for invasion, candidalysin is the primary virulence
factor responsible for causing epithelial damage (Moyes et al., 2016).
This peptide toxin, which is a product of the larger extent of cell
elongation ECE1 polyprotein, is only released by C. albicans hyphae and
causes harm to several epithelial cell types, including oral, vaginal, and
intestinal cells, as a result of pore-induced damage (Moyes et al., 2016;
Allert et al., 2018).
The most prevalent fungus which infects the oral cavity is
Candida spp, which is known as candidiasis or Candidosis and is mainly
caused by C. albicans in the Oral Cavity It was once believed that between
35% and 80% of people carry oral Candida, according to recent studies
employing molecular identification techniques, all persons have Candida
spp. as part of their normal flora in oral (Lewis and Williams., 2017; Peters
et al., 2017). C. albicans is the most prevalent species in infected and
healthy mouths, and it is thought to be present in more than 80% of oral
fungal isolates C. glabrata, C. dubliniensis, C. kyfer, C. parapsilosis, C.
krusei, and C. tropicalis are other forms of the so-called non-albicans
Candida species that are found in the mouth (Aslani et al., 2018; Sav et al.,
2020; Rafiq et al., 2020). Pre-cancerous and cancerous oral lesions are
among the most common forms of cancer, mainly in developed countries
with a male prevalence mostly around the fifth and sixth decades of life (Di
Cosola et al., 2021).
Oral bacteria and C. albicans interact in a variety of ways. In

addition to boosting the invasion of oral squamous cell carcinoma, as shown
by an increase in adherence to extracellular matrix proteins, a naeslundii and
S mutans also appear to promote oral carcinogenesis by upregulating the
expression of pro-inflammatory cytokines. Oral cancer appears to be mostly
caused by viral, bacterial, and yeast infections. The most common
mycobiome (fungal microbiome) to be isolated from the oral cavity is
Candida spp. It is followed by Cladosporium, Aureobasidium,
Saccharomycetales, Aspergillus, Fusarium, and Cryptococcus, when
associated with dysplasia, Candida spp. may represent a subsequent
infection of an earlier altered epithelium. Oral yeast carriage has also been
found to correlate with the presence of oral epithelial dysplasia (OED),
which supports the function of microbial infection in oral carcinogenesis
(Arzmi et al., 2019). The development of biofilm and hyphae is frequently
linked to C. albicans pathogenic condition. Candidaemia and invasive
candidiasis are both highly correlated with colonization of C. albicans along
the gastrointestinal system. Candidalysin encourages epithelial damage and
tissue invasion, which activates the MAPK and PI3K epithelial signaling
(Arzmi et al., 2019).
Figure (2-5) Precancerous and malignant neoformations in oral cavity

by C. albicans hypothetically (Di Cosola et al., 2021).
Pathways In addition to hypha production, the two routes stimulate GM-CSF

and NLRP3, which are essential for epithelium injury. Extreme epithelial
dysplasia has been linked to a long-term inflammatory infiltrate that
progresses to malignancy. All of these molecular biomarkers are connected
to oral carcinoma and higher risk of oral squamous cell carcinoma, and
Candidalysin stimulates numerous important immune response pathways
linked to cell growth, proliferation, survival, angiogenesis, differentiation,
and motility (Engku et al., 2020).
2.10. Anti-Fungal Agents
Current antifungal agents have several limitations, including that

only a small number of classes of antifungals are available, certain of which
have severe toxicity and high cost. Moreover, the emergence of drug
resistance is a new limitation to successful patient outcomes (Li et al., 2018).
Therefore, the development of antifungals with novel targets is an essential
strategy for the efficient management of C. albicans infections. It is widely
recognized that ion homeostasis is crucial for all living cells; biofilm
production is related to a high level of antifungal resistance and easily
occurs in host tissues, prostheses, and indwelling medical devices (Silva et
al., 2017). Fungal-selective targets are insufficient due to the fact that most
eukaryotes share similar metabolic pathways and essential cellular
machinery with humans (Zhang et al., 2012). There are currently five classes
of antifungal agents used in the treatment of systemic mycoses: polyenes
(amphotericin B), azoles (fluconazole, itraconazole, posaconazole,
voriconazole, and isavuconazole), echinocandins (caspofungin, micafungin
and anidulafungin), allylamines (terbinafine), and antimetabolites
(flucytosine) (McCarthy et al., 2017; Van Daele et al., 2019).
Polyenes achieve fungicidal activity by binding ergosterol in the
cell membrane, resulting in increased permeability and the leakage of
intracellular components, which subsequently leads to cell death (McCarthy
et al., 2017; Van Daele et al., 2019). Amphotericin B is the most clinically
relevant polyene for invasive fungal infections, and maintains a broad
spectrum of fungicidal activity, covering yeasts, moulds, and dimorphic
fungi. Its use in practice is limited by a lack of an oral formulation, infusion
reactions, and significant dose-limiting toxicities such as nephrotoxicity. The
development of several lipid-based formulations and co-administration with

normal saline has improved patient tolerability but has not completely
eliminated toxicities. Despite these drawbacks, amphotericin B sees
consistent clinical use as empiric coverage of invasive fungal infections until
a more tolerable therapy or formulation can be identified (Daele et al., 2019;
Perfect., 2017).
Similar to polyenes, azoles target ergosterol to achieve fungicidal
activity (Perfect., 2017; Daele et al., 2019). They specifically inhibit
ergosterol synthesis by inhibiting the lanosterol 14α-demethylase enzyme
Potent inhibit ergosterol synthesis by inhibiting the lanosterol 14α-
demethylase enzyme. Potent fungicidal activity and a broad spectrum of
coverage as a class have made azoles first-line therapy for fungicidal activity
and a broad spectrum of coverage as a class have made azoles first-line
therapy the treatment and/or prophylaxis of many invasive fungal infections.
Many azoles are conveniently for the treatment and/or prophylaxis of many
invasive fungal infections. Many azoles are available as intravenous and oral
formulations, though erratic absorption (oral suspension formulations)
conveniently available as intravenous and oral formulations (Balfour and
Faulds., 1992).
In addition to ergosterol, another potent antifungal target is 1, 3-β-
d-glucan, an important component of fungal cell walls. Echinocandins
inhibit 1, 3-β-d-glucan synthesis to weaken fungal cell walls and trigger cell
lysis. Echinocandin coverage is primarily limited to yeasts and moulds and
they have little activity against endemic mycoses, and they remain one of the
preferred treatment options for invasive candidiasis, including candidemia.
Echinocandins are notably well-tolerated with limited adverse effects or
drug interactions. Use is instead limited by a lack of oral formulations, with
all current echinocandins only available as once-daily intravenous infusions

(Balfour and Faulds., 1992).
Allylamines such as terbinafine interfere with ergosterol synthesis
by the inhibition of squalene epoxidase. Commonly utilized as a topical
agent, terbinafine is only used in the treatment of dermatophytes and moulds
in the salvage setting, given the efficacy and more favorable adverse effect
profile of other antifungal agents (Balfour and Faulds., 1992).
The final agent of clinical significance, flucytosine, is a
pyrimidine analogue that selectively interferes with fungal nucleic acid
synthesis to achieve activity (Perfect., 2017). It is available as an oral
formulation and its major adverse effects are essentially limited to bone
marrow suppression. However, the use as monotherapy is rare due to the
rapid development of resistance, and it is primarily utilized as a component
of combination therapy for the management of cryptococcal meningitis,
urinary candidiasis, or chromoblastomycosis (Perfect., 2017).
Accounting for spectra, toxicities, and formulations, the existing
antifungal options still leave gaps in management and significant
opportunities for the development of new agents. Some development has
been focused on adding new agents within the existing classes (rezafungin)
in addition to improving formulations of previously approved agents
(SUBA-itraconazole, Amphotericin B cochleate). Novel classes of
antifungals are also being actively developed. Ibrexafungerp and the
tetrazoles act on similar fungal biosynthesis pathways previously targeted by
existing classes (1,3-β-d-glucan and ergosterol synthesis), while many other
agents in development (olorofim, MGCD290, Fosmanogepix, VL-2397, T-
2307) look to establish entirely novel targets of antifungal activity (Su et al .,
2022).
The increasing incidence of severe refractory Candida infections

and the appearance of antifungal resistance have prompted the development
of new ways to address fungal infections, such as combination therapy.
Combination therapy is an empirical strategy for treating refractory Candida
infections. Caspofungin has been recommended to treat candidaemia
Caspofungin in combination therapy has some applications, while the
efficacy of combination therapy in the treatment of refractory Candida
infections needs more study, such as randomized controlled trials (Su et al .,
2022).
2.11. Future Challenges
Hence, the identification of new families of safer antifungal drugs

and the development of vaccines associated with new tools to perform early
diagnostics represent the main goals of the field early diagnosis is still
difficult as many of these pathogenic fungi are naturally commensal to the
human body and some others are very common in the environment (WHO.,
2022). The ideal diagnostic tool should not only detect the pathogenic
microorganism but also the stage at which the commensal or the
environmental fungus is switching to become pathogenic and invasive. The
identification of new families of antifungal drugs is also limited by the fact
that these pathogens are eukaryotes (Arastehfar et al., 2020).
Most molecules that can inhibit fungal growth are also highly
toxic to humans we still need to improve our knowledge of the biology of
these fungi during the infection and identify the key factors implicated in
their virulence. The implementation of new or recently improved
technologies in sequencing, metabolomics, or microscopy should help us to
get better insights into the cell biology, biochemistry, and genetics of
pathogenic fungi (Mayer et al., 2013). Together with the progress in the
understanding of the immune response during fungal infections, and the
potential of innate immune system boosting in protecting adaptive-immune
deprived patients, this knowledge will be translated into the identification of
better diagnostic tools and specific drug targets. In that sense, the usage of
fungus-specific CD4 T cells as specific sensors for the diagnostic of fungal
infections is very promising. The other main challenge is societal. Fungal
diseases are mostly neglected and their impact on human health is not
widely appreciated this under-appreciation results in a limited amount of
resources specifically dedicated by funding agencies to this field, thus
limiting its development (Janbon et al., 2019).
Thus there is need to obtain a better knowledge of their
epidemiology and their impact on human health in developed countries but
also in the poorest ones. In that sense, the type of survey done by the
National Center of Mycosis and Antifungal of the Institut Pasteur is
instrumental. New fungal pathogens like C. aureus and Mucor sp. Have
been recently identified as emerging and will represent a challenge for
physicians and researchers in the coming years. Fungal research initiated by
Louis Pasteur in the middle of the 19th century has known fantastic
development in recent years but still needs to be further developed to better
fight these deadly pathogens (Mariottini et al,. 2016).
Chapter Three
Methodology
Chapter Three: Methodology 34
3. Materials and Methods
3.1. The Material
3.1.1. Apparatus were used in this research as in table (3-1).
Table (3-1) Apparatus used in the present study

Equipment and apparatus Company Origin
Autoclave Fisher Japan
Biological Hood CLASS II-A2 Turkey

Centrifuge Hettich Germany
Centrifuge for Eppendorf tube Hettich Germany
Deep Freezer Concord USA
Electrophoresis Gel MAXICELLEC360M USA
ELISA Reader Human Germany
Flame Burner Rashmi Scientific India
Incubator Nave Turkey
Micropipettes Humpippette Germany
Microwave Oven Shownic Thailand
pH-meter Concord Korea
Refrigerator Philips Holland
Sensitive balance Jessy Korea
Thermo-cycler G-STROM USA
UV.VIZ Trans-illuminator ORANGE India
Vitek 2 Compact Bio-Merieux France
Vortex Memmert Germany
Water bath G.F.L Germany
Water Distillatory G.F.L Germany
3.1.2. Equipment’s Were Used in This Research.
Table (3-2) General equipment’s utilized in this study.
Equipment Company Origin

CO2 incubator Cypress Diagnostics
Cylinder Jiassco India
Different size Micropipettes Top dragon Europe
Disposable petri dishes Sterellin England
DNA Tube Promega USA
Flask Chemical-Lab China
Forceps Lab – service Spain
Burner Himedia India
Glass microscope slide with cover it Superstar China
Latex gloves Greatglove Malaysia
Loop Lab – service Spain
Micro pipette, Multi-channel pipette Estmed China
Parafilm Estmed China
Racks for Eppendorf tubes Meheco China
Racks For Test Tube Meheco China
Screw cap bottles Pyrex England
Spin centrifuge Benchmark USA
Syringe Meheco China
Test tube Pyrex England
Tips-Pipette 1ml ,and,200µl, 10µl Promega USA
Transport Cotton Swab with media Lab – service Spain
Wooden applicator stick Meheco China
3.1.3. Solutions Used In This Present Study
Table (3-3) Solution used during the study
Solution Company Origin
Alcohol BDH England

Glycerol Oxoid England
Ladder TransGen Biotech China
McFarland Standards Biomerièux France
Normal Saline Pioneer Iraq
Nuclease Free Water TransGen Biotech China
Phosphate Buffered saline (PBS) Capricorn Germany
TBE Buffer 10X SCBT USA
Tween-80 Fluka Germany
3.1.4. Kits This Present Study
Table (3-4) Kits used in this study
Kit name Company Origin

DNA Extraction Kit TransGen Biotech China
VITEK 2 System Biomereux USA
3.1.5. Antifungal Drugs.
Antifungal disk that used in this work against Candida spp. are listed in
table (3-5).
Table (3-5) Antifungal agents employed in this work

Antifungal Potency Company Origin
Amphotercin-B 20 µg Liofelchem Italy
Clotrimazole 50 µg Liofelchem Italy
Fluconazole 25 µg Liofelchem Italy
Itraconazole 10 mcg HI-Media India
Ketoconazole 10 mcg HI-Media India
Miconazole 10 µg Liofilchem Italy
Nystatine 100 IU Liofilchem Italy
Voriconazole 1 µg Liofilchem Italy
3.1.6. Culture Media.
Table (3-6) Culture media used during this current study

Culture Media Company Origin
Corn meal agar Bangalore India
Egg yolk agar HI-media India
HiCrom Candida agar HI-media India
Mueller-Hinton II Agar Oxiod England
Yeast Peptone Dextrose Broth HI-media India
Tryptic Soy Broth Difco USA
Sabouraud dextrose agar
Direvo German
Sabouraud dextrose broth
3.1.7. Stains Used in The Current Study.
Table (3-7) Stains used in the current study
Stain Company Origin

Bromophenol blue TransGen Biotech China
Crystal violet BDH England
Ethidium bromide solution (10mg\ml) TransGen Biotech China
Lacto-phenol Cotton Blue Stain, Solution CDH India
Methylene blue BDH England
Amido black HI-media India
3.1.8. Chemical and Biological Were Used.

Table (3-8) Chemicals and biological materials used.
Chemicals Company Origin
Agarose powder Promega USA
Trichlroacetic acid (TCA) BDH England
Glucose BDH England
Potassium hydroxide )KOH( BDH England
Master Mix TransGen Biotech China
Magnesium sulfate MgSO4 BDH England
Monopotassium phosphate KH2PO4 BDH England
Dextrose BDH England
Acetic acid BDH England
Sodium chloride (NaCl) BDH England
Calcium chloride (CaCl2) HI-media India
3.2 Method’s
3.2.1. Preparation of Culture Media
All of the culture media used in this study were prepared

according to the manufacturer's directions. Other culture media were made
in the lab in accordance with scientific guidelines. Except for the maintained
medium, all of these were sterilized in an autoclave at 121°C for 15 min and
15 psi.
3.2.1.1. Sabouraud Dextrose Agar (SDA)
Culture medium was ready by dissolving 62 g in 1 L of D.W. and

adjusted the pH to 5.6, autoclaved at 121 °C, for 15 min and 15 psi. Then,
the antibacterial chloramphenicol was added to medium at a concentration of
0.05 g/L to prevent the growth of bacterial contaminants, and then the
medium was distributed in sterile Petri dishes or sterile glass bottles.
Incubated at 37 °C for 24 h, and then stored at 4 °C until use, where yeasts
are grown, identified, and preserved before being used again (Lyon et al.,
2008).
3.2.1.2. Chrome Agar Medium for Candida spp.
This medium was used to differentiate between Candida spp.

according to the color formed on the petri-dishes after the culturing of
yeasts. Chrome agar was ready in accordance with the manufacturer's
instructions, by dissolving 42.72 g of powdered medium in 1 L of D.W. and
adjusted the pH to 5.6, heat to boiling and letting it cool to 45–50°C, mixing
it thoroughly, and then pouring the medium into Petri dishes to keep it until
use (Manns et al., 1994).
3.2.1.3. Proteinase Activity Agar
This medium was prepared according to (Staib et al., 1966) with few
modifications, using a medium composed of (Dextrose 2%, KH 2PO4 0.1%,
MgSO4 0.05% and supplemented with agar 2%), Autoclaved at 115 °C for
15 min, mixed well after cooling to 50°C and supplemented with 1% Bovine
serum albumin (BSA) solution and dispensed into a sterile petri dish, after
mixed thoroughly.
3.2.1.4. Sabouraud Dextrose Broth (SDB)
This medium was ready by dissolving 30 g in 1 L of D.W. heat and string it

until it is boiling. Sterilize using autoclaving for 15 min at 121°C at 15 psi.
Cool to 45 to 50 °C Mix thoroughly and distributed in sterile tubes.
3.2.1.5. Hemolysin Activity Agar
This medium was used to determine the activity of C. albicans isolates to

lysis of blood, and ready according to (Manns et al., 1994). with some
modification, by dissolving 62 g of SDA in 1 liter of D.W., then the medium
was supplemented with 3% glucose, pH was adjusted to 5.6 0.2, all the
components were autoclaved at 121 °C and for 15 min and 15 psi, left to
cool at the room temperature to 56 °C. After that, enriched human
concentrated blood was added at the percentage 7%. The investigated yeast
colonies were streaked in the center of petri-dishes and incubated in CO2
(5%) incubator for 48 h.
3.2.1.6. Corn Meal Agar (CMA) and Tween 80

This medium was ready according to the manufacturing
instructions by dissolving 17 g of the medium in 1 liter of D.W., with the
addition of 15 ml of Tween 80 this achieved according to dalmaus
techniques (Horvath et al., 2003).
3.2.1.7. Mueller-Hinton Agar
The medium was used to determine the susceptibility assay of Candida spp.
against some antifungal drugs. MHA was ready by Suspend 38 grams in 1
liter of D.W., and supplemented with glucose (2%) and methylene blue (0.5
µg/ml), and then heated with frequent agitation until the medium boils well,
and autoclaved at 121 °C for 15 min (Giri et al., 2014).
3.2.1.8. Phospholipase Activity Agar
The egg yolk medium contained 10% sterile egg yolk, 11.7 g of sodium
chloride, 0.11 g of calcium chloride, and 13.0 g SDA (the are all placed in
184 ml distilled water) (Tsang et al,. 2007; Mohandas et al., 2011). All of
the substances were combined and sterilized, with the exception of the egg
yolk, which was then centrifuged at 500 g for 10 min at room temperature.
Twenty ml of the supernatant were then added to the sterilized medium that
had already been prepared. Inoculating 10 μl aliquots of yeast of the yeast
suspension (about 108 yeast cell/ml) were deposited onto the surface of egg
yolk agar medium after than left to dry at room temperature and incubated at
37 °C for 48 h (Tsang et al,. 2007).
3.2.1.9. Yeast Peptone Dextrose Broth (YPD)
Prepared according to the manufacturer's directions by suspend 50.5 g in 1

liter of of D.W. heat and string it until it is boiling, Sterilize using
autoclaving for 15 min at 121°C at 15 psi. Cool to 45 to 50 °C Mix
thoroughly and distributed in sterile tubes.
3.2.1.10. Tryptic Soy Broth (TSB)
Prepared according to the manufacturer's directions by suspend 30.0 g of

powder in 1 liter of of D.W. warm slightly to completely dissolve, Sterilize
using autoclaving for 15 min at 121°C at 15 psi. Cool to 45 to 50 °C Mix
thoroughly and distributed in sterile tubes (Chandra et al., 2001).
3.2.2. Preparation of Stains and Solutions
3.2.2.1. Crystal Violet
The dye was taken from the stock of instruments and applied to the task of
staining yeasts in order to examine their microscopic characteristics (Zhao et
al., 2018).
3.2.2.2. Lacto-phenol Cotton Blue
This stain was created according to the manufacturer's

instructions, which were written on the containers: Cotton blue (Aniline
Blue) 0.05g, and glycerol 40 ml, and Phenol 2 grams and Lactic acid 20 ml
(McGregor et al., 1992).
3.2.2.3. Ethidium Bromide
The preparation of a stock solution according to the

manufacturer's instructions was mixing 10ml of distilled water with 0.05g of
ethidium bromide powder in a sterile, dark bottle. The solution was vortexed
to ensure that all of the powder was dissolved.
3.2.2.4. TBE Buffer
The buffer was created by adding 10 ml from the stock solution

to 90 ml of distilled water to create 100 ml of (1X) TBE buffer, which was
created from 10 X TBE buffer (as the stock solution) TransGen Biotech\
China.
3.2.2.5. Potassium Hydroxide (KOH 10%)
To make this solution, dissolve 10 g of KOH powder in 90 milliliters of

distilled water next, add 10 ml of glycerol solution to avoid the solution
from crystallizing and keep the sample from drying out. Finally, keep the
solution at room temperature and use it to examine samples directly (Roberts
et al., 1990).
3.2.2.6. Phosphate buffer saline (PBS)
It consists of (NaCl 8.5 g, KCl 0.2 g, KH2PO4 0.2 g, Na2HPO4 1.15 g) all
the constituents dissolved in 500 ml of D.W and the volume was completed
to 1 litter and the pH was adjusted to 7.2. Sterilize using autoclaving for 15
min at 121°C at 15 psi (Marks et al., 1975).
3.2.2.7. McFarland Standaerds
Macfarland's standard solution was prepared according to the method

described by the British Society for Antinimicrobial Chemotherapy (BSAC)
2013, by adding 0.5 ml of barium chloride BaCl2 to 9.5 ml of sulfuric acid
H2SO4 and mixed well to obtain a turbidity of 106×1.5 CFU/ml (CFU/ml).
3.2.3 Sterilization Methods
In this study all the glasses are sterilized, equipment‘s and culture media
accordance to (Quinn et al., 2001) as follow:
1. Moist heat sterilization (autoclave): The culture media were autoclaved at

121 °C for 15 min, under 15 psi to ensure their sterilization.
2. Dry heat sterilization (oven): this technique was used to sterilize forceps
and all glasses used during this study; a temperature of (160-180) was
maintained for two hours.
3. Direct burning (Heating): The sterilization of the inoculating loop and

forceps point involved holding them over a gas burner flame until they
turned red.
3.2.4. Preservation of Isolates
Preservation of isolates was performed in two steps:
1. Short time preservation: (Vandepitte et al., 2003)
The isolates were cultured on screw-capped tubes with 5 ml of SDA as

slants, then covered tightly in parafilm and kept at 4 for three months.
2. Long-term preservation: (Karch et al., 1995)
It was carried out by adding pure colonies to SDA broth that contained 15%
glycerol and storing it at -20°C for 12 to 18 months after 48 h at 30°C.
3.2.5. Samples Collection
All the Candida spp. isolates were collected from clinical

samples including Iraqi patients who suspected of respiratory diseases and
candidiasis , during the period from May 2022 to August 2022, from some
Baghdad hospitals (Medical City Hospitals, Al-Yarmouk Teaching Hospital,
and AL-Imamein AL- Kadhimaein Medical Educational City) , In this study
280 samples (swabs) were collected from different ages and genders of non-
duplicated patients suffering from respiratory diseases and oral candidiasis
(respiratory tract and oral cavity). The collected swabs were cultured on
Sabouraud Dextrose Agar (SDA), supplemented with chloramphenicol at
concentration 50 mg/L as antibacterial. The petridish of SDA were
incubated at 37 °C for 24-48 h. The grow colonies were differentiated and
transferred to Chrome Candida medium for identification according to color
of colonies.
3.2.6. Preparation of Candida spp Suspension
The SDA medium was inoculated with Candida spp. isolates

and incubated at 37 °C for 24-48 h. Then, a colony of the inoculation grown
on the medium was transferred using a loop to a screw cup secured and
containing 5 mL of sterile physiological saline solution (0.9%), mixed well
and then set the number of cells is approximately cells/ml of determining
the suspension's turbidity using a turbidity and contrasting it with the
reference McFarland‘s standard solution (Benke et al., 1980).
3.2.7. Identification of Candida spp
3.2.7.1 Morphological and Cultural Characteristics
For preliminary identification, the collected colonies of Candida

spp. were cultured on SDA medium at 37 °C for 24 to 48 h., the
morphological features of the yeasts colonies were studied and recorded,
which include colony type, shape, scent, diameter, color and height, this was
achieved according to (Ellis et al., 2007).
3.2.7.2. Microscopic Examination
A single colony was transferred to glass slide using sterilized loop

and mixed with a drop of KOH solution. After drying, the prepared sample
was spread out fixated on a flaming fire and stained with gram stain
according to instructions of manufacturing, and investigated under a light
microscope at 40X to detect yeast shape, yeast budding form and their
arrangement (McGregor et al., 1992).
3.2.7.3. Culturing on HiCrome (Candida Medium)
Colonies of isolated Candida spp were cultured on SDA

transferred to HiCrome Candida agar, this medium considered as a selective
and differential medium facilitates the quick isolation and speculative
identification of Candida spp. The chromogenic substrate found in HiCrome
medium reacts with the enzymes produced by Candida spp. this resulting in
produce colonies in various colors. The culture of yeasts on medium was
incubated at 37 °C for 48 h., during this time, the colors of yeasts colonies
changes were observed. This medium was prepared and autoclaved in
accordance with the directions of the HiCrome agar Company (Horvath et

al., 2016).
3.2.7.4. Identification of Candida spp. Isolates Using VITEK-2 System
For more conformation and identification of Candida spp. isolates,

The all collected isolates were subject to identification in AL-Imamein AL-
Kadhimaein Medical City Educational Lab. Division / Baghdad - Al-
Kadhimiya using the Vitek2 compact device equipped by the French
company BioMerieux, Marcy, which is an automated system approved in the
diagnosis of yeasts and bacteria, which is mainly based on a set of
biochemical reactions, and it gives results minutes within hours (Kaur et al.,
2016 ). The Identification of the isolates was confirmed by VITEK2 as
follow:
Procedure:
A smear from the edge of a colony established on an SDA medium was

taken to introduce samples into the VITEK® 2, where it was incubated for
less than 48 hrs At 37°C.
1. A test tube made of clear plastic was filled with 3 ml of sterile normal
saline (12 mm x 75 mm).
2. To generate a suspension of a homogeneous organism at a density

corresponding to McFarland No. 1.80 to 2.20 using VITEK ® 2
DENSICHEKTM Plus titration, a sufficient number of morphologically
similar colonies were transferred using a pure wand to the saline tube made
in step 1.
3. The cassette was loaded with the suspension tube and YST card.
The stuck was transferred to the cassette once the tape was placed into the
device's first opening, and the procedure took 7 minutes to finish. To
distinguish the organism at 37°C, it was removed and put in the second
entrance.
3.2.7.5. Germ Tube (GT) Formation
In this experiment the capability of C. albicans to form the germ

tube in the fresh human serum was performed, All the obtained clinical yeast
isolates sub-cultured on SDA agar and transferred thoroughly with a sterile
wooden stick, then, the transferred colonies inoculated in the test tube
contained 5 ml of human serum and incubated at 37 °C for 2-3 h, for reading
the results of this test, a small drops of the serum were withdrawn by Pasteur
pipette and putted on a clean glasses slide, the tested drops covered with a
coverslip, and examined using light microscope at a magnification of 40X
for the existence of germ tubes formed by C. albicans isolates. The result
was considered negative when germ tube were not seen arising from the C.
albicans cells. While the result considered positive when the tested yeast
cells formed germ tube and seen under light microscope (McGinnis., 1980).
3.2.7.6. Chlamydospores Formation
To determine the ability of clinical C. albicans isolates to form

chlamydospores, this performed using corn meal tween 80 agar, A small
colonies from C. albicans isolates was picked up using a sterile loop and
was suspended in a tubes supplemented with cornmeal broth and Tween 80,
a sterile inoculating loop was used to make two distinct streaks that were
about 3.5 cm long and 1.2 cm apart. In order to dilute the yeast inoculum
without digging into the agar, the sterilized inoculating loop was first
streaked back and forth across the two original streak lines after cooling.
Sterilized with flame, a 22 mm square cover glass was then put over the
streaks after cooling. All inoculating plats were cultured for one to two days
at 25° C. They were then examined under a light microscope to identify the
thick-walled chlamydospores (McGinnis., 1980).
3.2.8. Antifungal Susceptibility Testing of Candida spp Isolates
The antifungal susceptibility tests for all clinical Candida

isolates (102) were performed using disk diffusion method in accordance
with CLSI standards, the antifungal susceptibility tests were achieved for
eight antifungal drugs were listed in the Table (3-9).
The procedure includes a suspension of Candida isolates were made by

selecting (5–6) colonies from an overnight culture on a SDA plates. It was
suspended in 5 ml of sterile normal saline; the turbidity was adjusted to 0.5
McFarland standards. A sterile cotton swab was moistened in inoculum
suspension, and streaked on Mueller-Hinton agar medium(MH-GMB), it
was prepared and autoclaved according to manufacture instructions and
supplied by 2% dextrose and 0.5 g/mL methylene blue. All plates were left
for 30 mints at room temperature, antifungal disks placed on the surface of
(MH-GMB) medium. The plates were incubated at 37°C for 24 h. The
inhibition zone formed around the antifungal disks was measured in
inhibition were calculated in (mm), and interpreted as described by CLSI,
(Sensitive S, resistant R, susceptible dose dependent (SDD) (Giri et al.,
2014).
Table (3-9) Zone interpretation for fungi in millimeter.

Antifungal used Abbreviation Potency Sensitive Intermediate Resistance
Micaconazole MCL 10 ( 12-19
Clotrimazole CC 50 ) 12-19
Fluconazole Flu 25 ( ) 12-18
Ketoconazole KT 10 ( ) 21-27
Voriconazole VRC 1 ( ) 15-18
Itraconazole IT 10 ( ) 22-14
Nyststine NC 100 ( ) 10-14 NO
Amphotercine-B AP 20 ( ) 10-14
Employing a ruler for all antifungal disks, Interpretation of all antifungal

sensitivity (Sensitive S, resistant R, susceptible dose dependent (SDD) (Giri
et al., 2014).
3.2.9. Study of Some Virulence Factors for in Candida spp
3.2.9.1 Assessment of Biofilm Formation by Clinical C. albicans Isolates
A- Determination of Biofilm Formation by Using Tube Adherence

Method
Biofilm formation was determined for 70 isolates of C. albicans

by using tube adherence method proposed by Christensen et al (1985) Once
the TSB medium was sterilized and supplemented with glucose (final
concentration of 8%), a loopful of the yeast from the SDA plate was injected
into the tube. after that incubated at 37°C for 24 h. The tube contents were
aspirated out and washed three time with phosphate buffer saline (PBS) and
pH was adjusted to (7.2). The walls of the tubes were stained with 1%
crystal violet for 3 h. The stain was removed from the tubes then inverted
and left to dry and fixed with 200µl 95% methanol.
B-Determination of Biofilm Formation by Using Micro-titer Plate

Method
To assess the ability of all C. albicans isolates for biofilm

development, the yeast isolates were grown on SDA at 37 °C for 24-48 h,
before being suspended in yeast extract peptone dextrose medium (YPD)
and adjusted the pH at 7.2, culture of the yeast was adjusted to a 0.5
McFarland standard (1.5 x106 cells/mL) as a yeasts suspension, In this
experiment Crystal violet staining was used accordance to (Jin et al., 2003).
Briefly, 200 μL of yeast suspension were seeded into well each of the sterile
96-well microtiter polyester plate. Then, sealing the plates and incubated for
24 h at 37°C, Thereafter, the wells containing medium and yeast planktonic
cells were washed using 200 µl of PBS for three time. Then, 110 μL of a
crystal violet 0.4% solution was added to each well plate. After 45 min at
room temperature incubation in the dark, it was washed thoroughly several
times with water. Crystal violet was used to uniformly label adherent cells,
which often develop biofilm on all side wells. The biofilms produced by C.
albicans isolates were fixed with 200 µl of 95% methanol, were used to
solubilize crystal violet stained biofilm. Of that, 100 µl were transferred to a
fresh plate that had already been read, following the measurement of the
optical density (OD) at 595 nm, the results were read as follows:
Based on the established OD cut-off values (ODc) and biofilm density,

biofilm production was divided into four categories, Table (3-10).
Table (3-10) Classification of biofilm formation according to biofilm

density (Davarzani et al., 2021).
Optical Density Values (OD) Interpretation of biofilm production
OD ODc No biofilm production

ODc OD ODc Weak biofilm production
2 ODc OD 4 ODc Moderate biofilm production
4 ODc OD Strong biofilm production
3.2.9.2. Hemolysin Production
To evaluate the ability of clinical C. albicans isolates to lysis the

erythrocytes, all C. albicans were cultured and incubated at optimal
conditions according to (Manns et al., 1994). A loopfull of pure colony of C.
albicans isolates was inoculated into SDA supplemented with antibiotic
Chloramphenicol, and incubated at 37C for 24-48 h, This culture was used
to a just the suspension of 10 6 cells/mL in sterile Phosphate buffer solution
(PBS), the blood agar enriched medium was prepared by adding 7% fresh
human blood to 100 ml of SDA supplemented with chloramphenicol and
glucose 3%. The pH adjusted at a final concentration 5.2 ±0.2. Then, a
loopfull of culture suspension was seeded on the SDA medium. The Petri-
dishes were incubated for 24-48 h at 37 °C in a 5% CO2 environment.
3.2.9.3. Proteinase Production
Extracellular proteinase activity of clinical C. albicans isolates

collected during this study was analyzed according to (Staib et al., 1966).
With few modifications, using a medium composed of (Dextrose 2%,
KH2PO4 0.1%, MgSO4 0.05% and supplemented with agar 2%), Autoclaved
at 121 °C for 15 min and 15 psi, mixed well after cooling to 50°C and
supplemented with 1% Bovine serum albumin (BSA) solution. Yeast
suspension of 1×108 cells/ mL was prepared, and 10 μl of yeast suspension
was inoculated onto the surface of prepared medium. The Petri dishes were
incubated for 24-48 h at 37 °C. After that, the Petri dishes were fixed with
20% Trichloroacetic acid (TCA) and stained with 1.25% amidoblack, and
use Acetic acid (15%) for decolorization. The proteinase activity was seen
as opaqueness of the petri dishes agar, corresponding to a zone of proteolysis
around the yeast colony which not stained with amidoblack.
3.2.9.4. Determination of Phospholipase Activity.

By evaluating the extent of the zone of precipitation after the
growth on egg yolk agar, the C. albicans phospholipase activity was
discovered (Samaranayake et al,. 1984).The egg yolk medium contained
10% sterile egg yolk, 11.7 g of sodium chloride, 0.11 g of calcium chloride,
and 13.0 g SDA (the are all placed in 184 ml distilled water) (Tsang et al,.
2007; Mohandas et al., 2011). All of the substances were combined and
sterilized, with the exception of the egg yolk, which was then centrifuged at
500 g for 10 min at room temperature. Twenty ml of the supernatant were
then added to the sterilized medium that had already been prepared.
Inoculating 10 μl aliquots of yeast of the yeast suspension (about 10 8 yeast
cell/ml) were deposited onto the surface of egg yolk agar medium after than
left to dry at room temperature (Tsang et al,. 2007). and incubated at 37 °C
for 48 h.
3.2.9.5. Coagulase
Candida isolates were grown on Sabouraud dextrose agar

supplemented with 1% chloramphenicol after cultures were checked for
purity. Next, the plate was kept at 37°C for 24-48 h, and the yeast growth
colonies were carefully transferred into a glass tube with 5 ml of EDTA-
rabbit plasma and incubated there for 4-6 h at 35°C. The tube was re-
incubated for 24 h in the absence of a clot, then re-examined (Rodrigues et
al., 2003). For the coagulase test's positive and negative controls, the type
strains of Staphylococcus aureus and Staphylococcus epidermidis were
employed. The presence of a clot served to measure coagulase production.
3.2.10. Molecular Study and Detection of ECE1 Gene among C. albicans

Isolates
3.2.10.1. DNA Extraction
For detection of the existence of ECE1 gene among C. albicans

isolates, the whole genomic DNA of C. albicans isolates were extracted and
purified using yeast genomic DNA extraction kit (TransGen, Biotech/China)
and the steps of extraction were done based on the manufacturer‘s
instruction. Firstly, colonies of C. albicans were grown on SDA as a pure
culture for 18-24 h at 37°C before being processed for DNA extraction and
PCR analysis.
Table (3-11) DNA extraction kit component
No. Component The quantity

1 Lysis Buffer(LB2) 6 ml
2 Binding Buffer(BB2) 28 ml
3 Clean Buffer(CB2) 15 ml
4 Wash Buffer(WB2) 12 ml
5 Elution Buffer(EB) 25 ml
6 Proteinase K 20mg/ml 1 ml
7 Spin Column 50
8 RNase A20mg/ml 1 ml
9 Collection Tube 50
DNA extraction process
1- A single colony of C. albicans isolates was cultured overnight on YPD

broth medium at 28 °C with shaking at 150 rpm for 24 h.
2- The yeast cells were harvested by centrifuging at 12000 for 1 min.
3- Five hundred µl of sorbitol buffer and lyticase were added, and the
mixture was incubated at 37 °C for 1 h.
4- After that the mixture was centrifuged at 5000 rpm for 10 min.
5- A volume of 100 µl of LB2 and 20 µl of proteinase K were added, and
mixed by the vortex and incubated at 55 °C for 45 min.
6- The components were centrifuged for 5 min at 12000 rpm, and the
supernatant was transferred to a sterile 1.5 ml microcentrifuge tube.
7- A volume of 20 µl of RNase was added and incubated for 2 min at room

temperature to obtain RNA-free Total genomic DNA.
8- A volume of 500 µl of binding buffer was added to the Eppendorf tube.
9- Then, the components were vortexed for 5 sec, and incubated at room
temperature for 10 min, centrifuged briefly and the solution was
transferred to the spin column.
10- The solution was centrifuged at 12000 for 1 min, discard the flow
through.
11- A volume of 500 µl of CB2 was added and then centrifuged for 1 min.
12- A volume of 500 µl of WB2 was added and then centrifuged for 1
min, Discard the flow.
13- The previous step was repeated once.
14- The tube was centrifuged with opened lids for 2 min to remove the
residual ethanol.
15- The spin column was transferred to a new micro-centrifuge tube, and
a volume of 100 µl of EB was added, The EB was preheated to obtain an
appropriate amount of DNA.
3.2.10.2. Measurement Concentration and Purity of Candida DNA
The DNA Purity and concentration of isolate was measured by a

nanodrop UV spectrophotometer by which the optical density of DNA (1.5
μl) was measured at 2 wavelengths (260 and 280 nm), in most samples,
DNA preparation gave A260/A280 ratio between 1.8 and 2.0, which is
considered to be suitable for analysis. And measurement of DNA
Concentration for most of the samples was in the range of (50-90) ղg/ml.
3.2.10.3. Preparation of the Agarose Gel
Agarose gel was prepared using a w/v percentage solution, in this

experiment; agarose gel was prepared in two concentrations, 1% and 2% as
follows:
a) In two separate flasks, one gram and two grams of agarose powder were
added.
b) One hundred ml (1X) TBE buffer was added, which had been prepared
from (10 X) TBE buffer (as the stock solution), the buffer have been
prepared by adding 10 ml from the stock to 90 ml of distilled water.
c) They were combined in a flask, with the flask being heat resistant.
d) The microwave was used for (1-3) min, and the flask was preferably
swirled every (30-45) sec, during the heating process while waiting for it to
boil. The gel was left in room temperature until it has cooled to reach 50°C.
* Ethidium bromide dye was added in a volume of (2-3) µl per 100 ml of gel
with the usual precautions taken because the dye is neurotoxic. The gel was
then placed into a tray that had already been fitted with a comb (Sambrook
et al., 1989 and Ream et al., 2019).
3.2.10.4. Agarose gel Electrophoresis of DNA
The agarose gel electrophoresis technique was used to separate

DNA fragments extracted from C. albicans isolates, and also the visualize
results of the PCR products in the presence of the ladder to determine the
band size of the PCR product on the agarose gel.
3.2.10.5. The Casting of the Agarose Gel
The agarose solution was placed and platform assembly

into the gel box and gently poured to avoid air bubbles from
developing and allowed to cool for 30 min, where the comb was
placed and left at room temperature until hardened. The inserted
comb was gently removed, and the gel plate was attached to its stand
in the Electrophoresis horizontal unit represented by the tank utilized
in the electrophoresis and the tank filled with TBE buffer (1X) until
the gel surface reached 2-3 mm.
3.2.10.6. Preparation of sample
A volume of 3µl of the processor loading buffer (TransGen

Biotech / China) was mixed with (7l) of the presumed DNA to be
electrophoresis, following which the 10µl of loading mixture was applied to
the gel's holes. A voltage of 70 volts has been applied, allow 90 min for the
tincture to reach the other side of the gel. The gel was imaged after being
evaluated by a UV source with a trans-illuminator.
3.2.10.7. The Primers
The primers listed in the Table (3-12), were used for PCR
amplification of ECE1 gene, in this study; these primers were purchased
lyophilized from (Alpha DNA, USA). The powder of primers was dissolved
in nuclease-free water. To achieve a final concentration of 100 pmol/μL in
nuclease-free water as a standby solution to prepare a 10 pmol/μL
concentration as work primer suspension, the stock solution of primers was
kept in refrigerator at -20 C.
Table (3-12) PCR Primers used in this study for amplification of ECE1
gene
Gene Sequence Tm Reference

F-AGCTGTTGACACAGCCATGA 60.7 Designed by this
ECE1
R-TCTGAAACAATTTGAGCAGCA 56.3 study
3.2.10.8. Polymerase Chain Reaction (PCR)
Molecular detection of the ECE1 gene presence among the

isolated C. albicans isolates was achieved by PCR techniques in according
to (White et al., 2006). The components and concentrations of PCR reaction
were listed in the table (3-13) as mentioned in the manufacturer‘s
instruction.
Table (3-13) Reaction components for amplification of ECE1 gene in

conventional PCR.
NO. Components Volume µl

1. Taq PCR PreMix 12.5
2. Forward Primer 1
3. Reverse Primer 1
4. DNA 4
5. Nuclease Free Water 6.5
Final volume 25
3.2.10.9. PCR Optimization
Accidentally, there was no specific combination of conditions

that was optimum for all PCR. As a result, each PCR is likely to require
unique optimization for the template/primer pairings used. Inadequate
optimization frequently leads to complications such as no obvious PCR
product or low-efficiency amplification of the chosen template; the presence
of nonspecific bands or smeary background; the formation of "primer-
dimers" that compete for amplification with the chosen template/primer set,
or mutations caused by errors in nucleotide integration (Grunewald., 2003).
The PCR reaction was adjusted after many annealing attempts. Table (3.14)
shows the optimal temperature that generated the best results for PCR
reactions.
Table (3-14) The optimum conditions of PCR technique used in the
detection of ECE1 gene among C. albicans isolates
Phase of Reaction Tm (ᵒC) Time Number of Cycles
Denaturation-1 94 5 min 1
Denaturation -2 94 30 sec
Annealing 58 40 sec 35
Extension-1 72 45 sec
Extension -2 72 5 min 1
3.2.10.10. Agarose Gel Electrophoresis of PCR Products
To transfer PCR products onto the gel, prepare a 2% agarose gel

by dissolving (2g) in (100ml) of TBE buffer and heating it in the microwave.
Allow cooling to a temperature of about 50-60 °C. Then, pour 4µl ethidium
bromide dye into a flask containing gel. Fill the specified basin with the gel
and a comb with small holes. It is allowed to firm before being loaded with a
quantity (5µl) straight without the addition of a loading dye and finally
relayed at a voltage of 70 for roughly 60 or 90 minutes.
3.2.11. Sequencing and Alignment of Sequence
Following staining with Ethidium Bromide Stain, the PCR
products were separated on a (2%) agarose gel electrophoresis and examined
under ultraviolet light (302 nm). The current study's PCR products and
primers were sent to the South Korean business Macrogen
(dna.macrogen.com) for sequencing analysis to look for mutations. A
homology search was performed using the Basic Local Alignment Search
Tool (BLAST) tool, which is available online at
(http://www.ncbi.nlm.nih.gov) (NCBI), the Bioedit program.
3.2.12. Deposition of Sequences to GenBank
All the analyzed sequences were submitted to the NCBI bank.
3.2.13. Statistical Analysis
The data obtained during this study were analyzed using the
following software, Microsoft excel, IBM SPSS V26, and Minitab v.18. The
results reported in this study were expressed as N (%). Z-test was used to
compare two proportions. One-way analysis of variance was used for
biofilm analysis. The chi-square test of association and chi square goodness
of fit was used for categorical data. P≤ l 0.05, and 0.01 were considered
significantly and highly significantly different (Daniel and Cross., 2013).
Chapter Four
Results and Discussion
Chapter Four: Results And Discussion 62
4. Results and Discussion
4.1. Isolation and Identification of Yeast
During the present study, A total of 280 clinical samples

(swabs) were collected from of different ages and genders of non-duplicated
Iraqi patients who infected and suspected of respiratory diseases and
candidiasis., the sources of collection which include oral cavity and
respiratory tract, these clinical swabs were collected during the period from
May to Augast in 2022 from some hospitals in Bagdad city (Medical City
Hospitals, Al-Yarmouk Teaching Hospital and AL-Imamein AL-
Kadhimaein Medical City Educational), the swabs were cultured on SDA
meidum at optimum conditions and the results 102 (36.43%) were positive
sample to grow Candida spp., while 178 (63.57%) were negative foe culture
as shown in the Figure (4-1).
Prevalence of Candida spp.
Positive
36%
Negative
64%
Figure (4-1) The percentage of positive and negative culture of collected

swabs samples from patients on SDA medium.
In the current study, less than half (36.43%) of the visited patients
to targeted hospitals were positive grow of Candida spp. Previous reports
and studies reported that nearly 10% of the common species inhibits the oral
cavity behave as opportunistic yeast pathogens, and causing infections and
diseases like oral candidiasis (Sardi et al., 2013; Pinto- Almazán et al.,
2022). The opportunistic infections of oral cavity are the common frequently
among the compromised patients such as AIDS and HIV (Patel et al., 2006).
Candida spp. colonization the oral cavity in varied levels according to the
age, in new born patients ranged between 42-45%, in good healthy children
about 50-64%, in healthy adults ranged between 30-45%, in wearers of
denture 55-65%, in peoples infected with oral microbes 65-85%, while in
individuals who immunocompromised like those infected with HIV and/or
undergoing to treatment by chemotherapy include patients with acute
leukaemia, it is ranged between 90-95% (Akpan and Morgan., 2002; Patil et
al., 2015).
Distribution of Candida Isolates According Gender
Candida spp. isolates were collected from clinical sources (oral

cavity and respiratory tract), distributed according to patient‘s gender,
isolates of C. albicans and C. tropicalis were mainly isolated from patients
for each sex and no significances differences appeared between the isolates
according to gender only in C. krusei . The frequency of collected Candida
spp. isolates based on gender is illustrated in Table (4-1).
Table (4-1) Distribution of clinical Candida spp isolated from different

specimens according to gender.
Male Female Total

Types of Candida spp
N (%) N (%) N (%)
C. albicans 30 (42.9) 40 (57.1) 70 (68.6)
C. tropicalis 7 (63.6) 4 (36.4) 11 (10.8)
C. kruzei 1(16.7) 5 (83.3) 6 (5.9)
C. kyfer 2(33.3) 4 (66.7) 6 (5.9)
C. parapsilosis 2(40.0) 3 (60.0) 5 (4.9)
C. glabrata 1 (25.0) 3 (75.0) 4 (3.9)
Total 43(42.16) 59 (57.84) 102 (100)
Data presented as N (%), ¥: Z-test was used to test two proportions. N.S: Not significant
(P>0.05)*, ** Significant and highly significant (P ≤ 0.05) and (P ≤ 0.01) respectively
Identification of Candida spp.
All isolates of yeasts obtained during this study were subjected to

identification using some phenotypic characters (Morphological
Characteristics of colonies on SDA medium, Chlamydospore, Germ tube
production, color of colonies on Chrome Candida agar), the result of
identification was confirmed by using automated method VITEK-2 system.
The number of Candida isolates, according to species is listed in Table (4-2)
Table (4-2) Methods used in the identification of Candida spp.
Species Identification method Number

Candida Germ tube Chlamydospores and
Vitek 2
isolate Chrome agar percentage
Positive Negative Positive Negative system
N (%)
C. albicans 70 0 70 0 green 70 70
C. tropicalis 0 11 0 11 blue 11 11
C. krusei 0 6 0 6 pink 6 6
0 Cream with
C. kyfer 0 6 6 6 6
center pale pink
C.parapsilosis 0 5 0 5 White to cream 5 5
C. glabrata 0 4 0 4 Light pink 4 4
Six species of Candida were identified during this study is shown

in the Table (4-2) The results of the current study our finding indicated that
C. albicans was the most frequent isolates 70 (68.63%) of positive sample,
while non albicans Candida species were isolated 31.37% and among which
C. tropicalis was the most common with a percentage (10.78%) of other
species, while C. glabrata 4(3.90%) was the lowest frequent of isolated
Candida collected during the isolation and the results of the current study
are concomitant with the studies of Ayeni et al. (1999), Kauffman et al.
(2000), Sobel et al. (2000), Passos et al. (2005).
The Morphological features of Candida spp. growing on SDA

medium, show the morphology of yeast colonies isolated, which are white to
creamy, curved, smooth to wrinkled, soft and round, and also features by
yeast odor (Marsh and Martin., 2009). So, morphological appearances
colonies of C. albicans on SDA white to cream-colored smooth, glabrous,
yeast-like these characteristics are consistent with what the researcher said
(Ellis et al., 2007). as shown in Figure (4- 2)
Figure (4- 2) Colonies of C. albicans grown on SDA medium at 37 °C

after 24 h incubation.
The microscopic examination of Candida spp. was examined under light

microscope after staining with Lacto phenol cotton and crystal violate, the
results of examination showed that the oval shape with budding Referred to
cells of Candida yeast, the features of yeast cells with budding (Zhao et al.,
2018). Is shown in Figure (4-3).
Figure (4-3) Microscopic features of C. albicans cells stained with A-

Lacto phenol cotton blue B- crystal violate dyes, examined under light
microscope (40X).
Chrome Candida agar medium was used in the differentiation and

identification of collected isolates, Candida species identified according to
the colonies color on chrome Candida agar as shown in Figure (4.4).
Chromogenic agar medium used for identification of Candida as an
alternative technique in resource limited setting due to ease of use and their
lower costs, this allows a fast presumptive differentiation and identification
of the common clinical species of Candida (Perry., 2017). The different
resulted colors may be depending on the reaction between enzyme type
released from the yeast and this chromogenic mix, the reactions produced
during incubation were revealed by spontaneous color changes in the
organism (Mulet Bayona et al., 2022). Distinctive and special diagnoses for
each Candida type based on the basic substance of those enzymes on the
medium (Tintelnot et al., 2000). This test is accurate and high in diagnosing
the different species of Candida, this due to contains a substrate which is
called the chromogenic mixture, where the enzymes of each type of Candida
yeast to interact with its substrate in this medium Such as type C. albicans
produces specific an enzyme (BN-Acetylgalactosaminidase) that work on its
substrate in the medium (Jabra-Rizk et al., 2001).
Figure (4-4) Differentiation of Candida isolates according to colony color

grown on Chrome Candida agar medium for 24h at 37°C.
The grow colonies were differentiated and transferred to HiCrome Candida

medium for identification according to color of colonies as shown in Table
(4-3) (Gravina et al., 2007).
Table (4-3) Color and morphology of Candida spp on chrome Candida

agar.
Species Hi chrome candida agar color and morphology
C. albicans Light green-smooth-brilliant
C. tropicalis Blue-dark blue with dark halo in agar-smooth-brilliant
C. kruzei Purple fuzzy-smooth and brilliant
C. kyfer Cream with center pale pink to purple –brilliant
C. parapsilosis White to cream-smooth and brilliant
C. glabrata Light pink to Cream- smooth- brilliant
VITEK 2 Compact System
The VITEK 2 compact system is a stable kit to identification

Candida species clinically. In this study and by use VITEK 2 System six
isolates of Candida species included C. albicans 70 (68.63%), C. tropicalis
11 (10.78%), C. krusei 6 (5.88%), C. kefyr 6 (5.88%), and C. parapsilosis 5
(4.90%), C. glabrata 4(3.90) was idintyfide. The most frequently isolated
Candida spp from clinical manifestations are C. albicans (predominant
worldwide) next C .tropicalis, while the less frequently isolated were C.
glabrata from clinical manifestation as also described in some other studies
(Moretti et al.,2000; Mancianti et al., 2002). The Vitek more sensitive and
specific for diagnosis C. albicanis more than others methods (culture and
germ tube test), Vitek very important test to diagnosis C. albicanis and it
have sensitivity and specificity to differentiation for Candida spp.
Identification by use Germ tube and chlamedospore
Most Candida spp. are easily identified using classical methods

such as microscopic and cultural features, and identification according to
individual species can be differentiated using some biochemical tests and
physiological characteristics (Patel., 2022). Previous studies and reports
indicated that the identification of C. albicans strains and some strains of C.
dubliniensis and C. tropical is generally done by production of germ tube
under unfavorable condition (Quinn et al., 2011). On the other hand, C.
albicans when growing under certain non-optimal conditions, can undergone
to produce of chlamydospores, these spores are round with thick cell walls
as shown in the Figure (4-5) (Chaffin et al., 1998).
Figure (4-5) C. albicans isolate produced A-germ tube when grown on

human serum after 3 h incubation at 37 °C. (40X). B-Chlamydospore
formation on corn meal agar supplemented with 10% tween 80 after 2-5
days incubation at 37 °C.
4.2. Antifungal Susceptibility Testing
Antifungal susceptibility pattern of all clinical Candida isolates

obtained from oral cavity and respiratory tract samples to eight antifungal
drugs was evaluated in vitro using the disk diffusion method was according
to CLSI guidelines. The results are expressed as resistant (R), Susceptible
does-dependent (SDD) and sensitive (S), according to the values of
inhibition zone diameter and summarized in Table (4-4). Among the used
antifungals drugs, amphotericin-B was highly active towards more Candida
isolates, the number and the percentage of susceptible isolates were 94.14%,
while the susceptibility values of another antifungal drugs against Candida
isolates recorded as 93.14, 90.2, 85.29, 70.59, 51.96, 49, 47,1% for
amphotericin-B, clotirmazole, nystatin, fluconazole, voriconazole,
miconazole, itraconazole and ketoconazole respectively. For C. albicans
isolates showed the highest antifungal resistant for Voriconazole (40.19%)
and the lowest resistant were recorded against the antifungal drug
amphotericin-B (2.94%). On the other hand, the non-C. albicans isolates
also showed high susceptibility towards amphotericin-B, clotrimazole and
itraconazole and the percentages of sensitivity were.
Table (4-4) Antifungal susceptibility of Candida spp isolated from the oral cavity and respiratory tract of
patients.
Species (No)
C. albicans C. tropicalis C. kruzei C. kayfer C. parapsilosis C. glabrata Total
No (70) No (11) No (6) No (6) No (5) No (4) (102)
Antifungal
S (%) 50(71.43) 7(63.64) 4(66.67) 5 (83.33) 3(60) 3(75) 72(70.59)
Fluconazole SDD (%) 5(7.14) 1(9.09) 0(0) 0 (0) 0(0) 0(0) 6(5.88)
R (%) 15(21.43) 3(27.27) 2(33.33) 1(16.67) 2(40) 1(25) 24(23.53)
S (%) 65(92.86) 9(83.33) 4(66.67) 6(100) 4(80) 4(100) 92(90.20)
Clotrimazole SDD (%) 0(0) 1(9.09) 0(0) 0(0) 0(0) 0(0) 1(0.98)
R (%) 5(7.14) 1(9.09) 2(33.33) 0(0) 1(20) 0(0) 9(8.82)
S (%) 30(42.86) 6(54.55) 3(50) 2(33.33) 4(80) 3(75) 48(47.06)
Ketoconazole SDD (%) 10(14.29) 1(9.09) 1(16.67) 1(16.67) 0(0) 1(25) 14(13.73)
R (%) 32(45.71) 4(33.33) 2(33.33) 3(50) 1(20) 0(0) 40(39.22)
S (%) 35(50) 6(54.55) 3(50) 3(50) 2(40) 4(100) 53(51.96)
Voriconazole SDD (%) 5(7.14) 1(9.09) 0(0) 2(33.33) 0(0) 0(0) 8(7.84)
R (%) 30(42.86) 4(33.33) 3(50) 1(16.67) 3(60) 0(0) 41(40.19)
S (%) 30(42.86) 8(72.73) 4(66.67) 2(33.33) 2(40) 4(100) 50(49.02)
Micaconazole SDD (%) 20(28.57) 2(18.18) 0(0) 2(33.33) 1(20) 0(0) 25(24.51)
R (%) 20(28.57) 1(9.09) 2(33.33) 2(33.33) 2(40) 0(0) 27(26.47)
S (%) 65(92.86) 8(72.73) 4(66.67) 4(66.67) 3(60) 3(75) 87(85.29)
Nystatin SDD (%) 3(4.29) 2(18.18) 1(16.67) 2(33.33) 1(20) 0(0) 9(8.82)
R (%) 2(2.86) 1(9.09) 1(16.67) 0(0) 1(20) 1(25) 6(5.88)
S (%) 68(97.14) 9(83.33) 5(83.33) 5(83.33) 4(80) 4(100) 95(93.14)
Amphotericin-B SDD (%) 2(2.86) 1(9.09) 0(0) 1(16.67) 0(0) 0(0) 4(3.92)
R (%) 0(0) 1(9.09) 1(16.67) 0(0) 1(20) 0(0) 3(2.94)
S (%) 30(42.86) 8(72.73) 2(33.33) 2(33.33) 2(40) 4(100) 48(47.06)
Itraconazole
SDD (%) 15(21.43) 1 (16.67) 2(33.33) 3(50) 1(20) 0(0) 22(21.57)
R (%) 25(35.71) 2 (18.18) 2(33.33) 1(16.67) 2(40) 0(0) 32(31.37)
Chi square test P-value 0.001** 0.006** 0.121N.S 0.015* 0.369 N.S 0.007**
Figure (4-6) Antifungal susceptibility test using disk diffusion method

against C. albicans isolate.
Results showed that the antifungal Amphotericin-B was the

highest susceptible in vitro to Candida isolates obtained from oral cavity and
respiratory tracts, Amphotericin-B has a high molecular weight, and is
almost completely insoluble in H2O. These traits resulting in low
permeability by human stomach and gastrointestinal (McEvoy., 2000; Liu .,
et al 2017). This antifungal has a broad spectrum of activity towards
Candida spp., and a few of another non-albicans Candida may be low
susceptible (Gallis., et al 1990). The current results revealed that the
collected clinical Candida spp. isolates showed high susceptibility (87%) to
nystatin, this funding in consistence with previous studies which reported
that the nystatin showed low resistant against all tested Candida spp. (Bilal
et al., 2022). Nystatin antifungal treatment of the infections by Candida
plays a significant role in its activity through the interaction with the
ergosterol found in cell membrane of yeasts and making it porous and led to
lysis the cell membrane, thus exerting its antifungal effect, this action is
considered as a mechanism to change the composition and main function of
cell membrane (Wang et al., 2016). Antifungal clotrimazole was susceptible
to Candida isolates in percentage 92% of the total tested isolates. It was

found to be the most useful antifungal drug against C. albicans and non-
albicans candida isolates.one of the most commonly antifungal drugs for
Candida spp infection is fluconazole, among Candida spp 70% were
susceptible to fluconazole. And this percentage accordance with 1qq
(Gandhi et al., 2015). The isolates of Candida spp. isolated during this
study showed varied levels of susceptibility against antifungal,
Fluconazole70%, voriconazole 51%, miconazole 49%, Itraconazole 47,
respectively, which was in accordance with other reports ( Magaldi., 2004 ;
Gandhi et al., 2015 ; Bhattacharjee., 2016).
groups of Azoles are five-membered heterocyclic component

with antifungal properties. They are classified in to 2 groups‘ imidazole and
triazole. Triazoles consist of 3 nitrogen in the azole ring and include
(fluconazole, itraconazole, voriconazole, isavuconazole, and posaconazole).
Fluconazole consider most common azole used during therapy and Second
common of triazoles that include voriconazole and posaconazole, and
isavuconazole are more potent against resistant fungi pathogen.
Imidazoles contain 2 nitrogen in the azole ring, include

(clotrimazole, econazole, ketoconazole, miconazole, and tioconazole) (Yasu
et al., 2018; Jenks et al., 2018). Azoles conseder most common antifungal
drug class which used for treating and preventing Candida spp infections.
Azoles target the enzyme 14α–demethylase (Erg11p), and very important
enzyme in ergosterol biosynthesis which Azoles bind to Erg11p, thereby
lowering the ergosterol levels of the cell (Veen et al., 2003).
4.3. Detection of Some Virulence Factors among C. albicans Isolates.
4.3.1. Biofilm Formation Assessment:
A- Tube Method
The biofilm formation was tested by using tube adherence methods; Biofilm
formation for 70 isolates of C. albicans was evaluated. The results showed
that most isolates 67(95.7%) were the ability to attach and build
multicellular structures at the surface of the test tube after 48 h incubation,
and staining by crystal violate while 3 isolates (4.29%) were haven‘t attach
and developed biofilm as showed in Figure (4-7). These results are identical
to those of the mico-titer plate method.
Figure (4-7) The ability of C. albicans to formation biofilm by using test

tube method.
The result consider as ―positive‖ by the presence of colored layers

in the inner wall of the tubes. A negative (0+), weak positive (1+), moderate
positive (2+), and strong positive (3+) rating was given for the test of
biofilm formation. Each isolate was tested at least three times and read
independently by two different observers.
B- Mico-titer Plate Method
The biofilm formation among C. albicans isolates was evaluated using a

quantitative crystal violet assay by 96 microtiter plates. In our funding,
among the clinical C. albicans isolates tested for the biofilm formation, 67
(95.7%) were have the ability to develop and produce biofilm in vitro in
broth medium at absorbance value more than 0.061. While there were 3
isolates (4.29%) were haven‘t to developed biofilm in broth medium and an
absorbance value was lower than 0.12 as showed in Table (4-7). According
to the values of biofilm production in the culture medium, we classified the
C. albicans isolates, strong producer 34 (48.57%), moderate producer 28
(40%), and weak 5 (7.14%), respectively. Whereas, among the 70 isolates,
there were three isolates (4.29%) did not developed biofilm as reported in
the Table (4-7) Based on the established OD cut-off values (ODc) and
biofilm density as shown in Table (3-10).
Table (4-7) The biofilm capacity of 70 C. albicans isolated from oral

cavity and respiratory tract.
C. albicans (N=70)
Strong Moderate weak No production

34 28 5 3
(48.57)% (40)% (7.14)% (4.29)%
As mentioned, Candida is the most common colonizer of the

human oral cavity and plays an essential role in wide oral infections and
diseases. However, some scientists reported that there is thought to be a
possible link between oral cavity and canalization of the pulmonary by
Candida, which may lead to respiratory infection. Studies and reports have
disrobed respiratory microbial pathogens colonizing the oral cavity, Also the
oral pathogens inhibits and colonizing the lungs (Vadiraj et al., 2013;
Przybylowska et al., 2015). Candida spp. is the commonly fungus
colonizing the oral cavity of humans, several studies indicated that the C.
albicans considered to be the strongest producer of biofilm among Candida
spp. isolated from different sources, through their ability do formation of
biofilms and morphology of the hyphae shift, displaying a biofilm
prevalence nearby (100%) and so becoming an important menace in
hospital-acquired infections (Boucherit et al., 2021; Cangui-Panchi et al.,
2022;). Recently, many reports and studies demonstrated that the majority of
diseases and acute clinical implications caused by Candida spp. to the ability
of biofilm formation on the attached surfaces (Lohse et al., 2018; Rodriguse
et al., 2020). Biofilm development by C. albicans is initiated to adhere on
both abiotic and biotic surfaces and it considered as significant contributing

factor to the beginning of the infection and pathogenicity. Candida varied in
the ability to biofilm formation depending on the species. Most studies
reported that the pathogenic effects are caused by C. albicans and to a lesser
extent by other species of Candida commonly associated with biofilm
production, that can produced both on plastic surfaces of clinical devices and
mucosal surfaces. The chemical structure of biofilm composed of matrix
materials enclosed small colonies of yeast, pseudo-hyphae and hyphae
ordered in a complex structure (Hasan et al., 2009; Nobile and Johnson.,
2015).
4.3.2. Hemolysin Activity
In our findings, all of the 70 isolates of C. albicans produced

hemolysin, Strong hemolytic activity observed in 20 isolates (28.57%),
whereas the higher number of isolates, 36 (51.43%) showed moderate
hemolysin activity and 14 isolates (20%), showed weak hemolysin activity
(Tsang et al., 2007). The Hemotlytic activity was determined by measuring
the ratio of the diameter of the yeast colony alone to the diameter of the
yeast colony plus the zone formed around this colony on blood agar
medium, the obtained results were calculated by dividing the colony dimeter
in (mm) by the diameter colony plus clear zone produced due to hemolytic
activity.
Table (4-8) Distribution of hemolytic activity of C. albicans isolates on

blood agar medium.
Enzymes No. of isolate 70

Secration by
Strong Moderate Weak Negative
C. albicans
< 0.5 0.5 – 0.69 0.7 – 0.99 1
Hemolysin 20 (28.57%) 36(51.43%) 14(20%) no
each colony's surrounding ring of greenish black was viewed as being

incomplete (alpha) and the ring of lysis was seen as completed (beta)
however, the absence of a greenish-black ring surrounding each colony was
taken to mean that there was no hemolysin activity (gamma) and the result
of hemolysin activity can calculate as following, the diameter of the
translucent zone of hemolysis divided on the diameter of the colony size.
Figure (4-8) Hemolytic activity of C. albicans isolate on blood agar

medium. Ring shaped formation around C. albicans colony was
reported that indicated hemolysin positive production.
Production of hemolysin is an essential virulence factor for C.

albicans and non-C. albicans to obtained iron from the lysis red blood cells
which permits growth in the host and support initiation the infection in blood
and mucosal tissue (Linares et al., 2007). In our funding, all of the collected
C. albicans isolates were positive of hemolysin and more than 80% showed
as strongly and moderately positive results, this result in consistence with
study was achieved by (Luo et al., 2001). Who reported that C. albicans and
other Candida isolates displayed alpha and beta hemolytic activities after
examining 70 Candida isolates on blood agar medium While (Nouraei et al.,
2020). Revealed that all of the C. albicans isolates collected from stock in
Iran exhibited strongly positive results of the production of hemolysin.
4.3.2. Proteinase Activity
Proteolytic activity was evaluated in 70 isolates of C. albicans

collected during this study; the proteinase activity (Prz) of all C. albicans
isolates was determined by the formation of proteolytic zone around the
colonies of yeasts growing on prepared medium after growing 48 h.
All tested isolates showed proteinase activity: 5 isolates

(7.14%) appeared weak activity, 33 isolates (47.14%) revealed moderate
activity, whereas 30 isolates (42.86%) showed strong activity of proteinase,
Table (4-9). The test was done on three different occasions for each C.
albicans isolate tested. The proteinase activity (Prz) of 70 C. albicans
isolates was tested by a halo zone formation around the inoculation area on
BSA medium. Less than one (Prz1) indicate proteinase activity, whereas a
Prz value of 1 indicates no activity (Tsang et al., 2007).
Table(4-9) The Proteinase activity of 70 isolate of C. albicans.

Secration by
C. albicans
< 0.5 0.5 – 0.69 0.7 – 0.99 1
Proteinase 30(42.86%) 33(47.14%) 5(7.14%) no
Figure (4-9) The proteolytic activity of 70 isolates of C. albicans on BSA

agar medium at 37 for 24 hrs.
Proteinase is hydrolytic enzyme that has been characterized as

playing an important role in the infections and pathogenicity of opportunistic
Candida spp. in human (Naglik et al., 2003; Schaller et al., 2005; Tay et al.,
2011). The proteolytic activity on BSA agar method has been demonstrated
in the current study and other reports and studies among clinical strains C.
albicans and non-C. albicans spp (Kumar et al., 2006; de Melo et al., 2019;
Ramos-Pardo et al., 2022 ). In previous study was achieved by
(Kantarcioglu and Yuce., 2002). revealed that the positive level of protease
activity among clinical Candida isolates collected from different clinical

sources was 78.9%. Also, the protease and phospholipase activities were
investigated in 122 isolates of Candida spp. collected from several sites of
anatomically distinct of healthy adults, the results of this study reported that
the C. albicans was positive to protease particularly these isolated from skin,
urogenital and oral cavity (Oksuz et al., 2007).
3.3.4. Phospholipase
Phospholipase production was seen in 63(90%) of 70 isolates, while 7(10%)

not show any activity to produce Phospholipase of C. albicans isolates as the
Table (4-10) where 45(64.29%) of the isolates were strong in production and
13(18.57%) isolates were medium in production, while 5(7.14%) isolates
were weak in production and 7(10%) isolates did not have any ability to
produce enzyme. When a precipitation zone could be seen surrounding the
yeast colony on the plate, phospholipase activity of 70 isolates of C.
albicans was regarded positive. The ratio of the diameter of the yeast colony
to the overall diameter of the colony plus the precipitation zone was used to
calculate the amount of phospholipase activity (Pz). Phospholipase activity
is indicated by (Pz) values less than one; while (Pz) values greater than one
indicate no activity.
Table (4-10) The Phospholipase activity of 70 isolate of C. albicans .

Secration by
C. albicans
< 0.5 0.5 – 0.69 0.7 – 0.99 1
Phospholipase 45(64.29%) 13(18.57%) 5(7.14%) 7(10%)
Extracellular phospholipase enzyme lyses host cells to facilitate adhesion

and penetration (Ghannoum and Abu-Elteen., 1990). Phospholipase enzyme
breaks down the phospholipids of the cell membrane and causing cell lysis
or host cell damage, it a major mechanism contributing to microbial
virulence (Ghannoum and Abu-Elteen., 1990; Salyers and Witt,. 1994).
According to several earlier investigations, 30 to 100% of Candida spp.
from various patient groups and locations indicated phospholipase activity
Also may depend on the site, as reported by a previous study the
Phospholipase activity was discovered in 55, 50, and 30%, respectively, of
the Candida spp. isolated from blood and wound infections and urine (Price
et al., 1982) or affected by growth conditions (Samaranayake et al., 2006).
For example, the presence of a high concentration of salivary glucose
combined with a reduced salivary secretion rate and enhances the growth of
yeasts and their adherence to epithelial oral cells (Darwazeh et al., 1990).
4.3.5. Coagulase Production
Candida coagulase production was examined by the classical

coagulase tube test; most of the C. albicans 59 (84.29%) isolates from oral
cavity and respirotary tract were able to induce clot formation from EDTA-
rabbit plasma after 24 h of incubation. And lower percentages of strains
tested11 (15.71%) were negative to produce coagulase as showing in the
Table (4-11).
Table (4-11) Coagulase activities of 70 C. albicans isolated from oral

cavity and repertory tract

Secration by C. albicans
Posative Negitive
Coagulase 59 (84.29%) 11 (15.71%)
Figure (4-10) Tube coagulase test for C. albicans isolate
Plasma coagulase is an enzyme that binds plasma fibrinogen,

activates a series of reactions that stimulate plasma to clot, and is also help
in identifying S. aureus. Different diagnostic kits like Pastorex Staph-Plus
and being increasingly used in clinical microbiology laboratories, recently
replacing the conventional coagulase lase test because they are more specific
and faster.Hydrolytic enzymes that are expressed on the surface of microbial
pathogens are able to cause host cell damage in the body of the organism,
but the pathogenic roles have not yet been elucidated. First reported of
Coagulase production from Candida species by (Rodrigues et al., 2003) who

detected high coagulase activity in C. albicans (88.5%) and this percentage
is consistent with our current study, where we found that 84% of C. albicans
isolates were producers of this enzyme also other studies (Yigit et al., 2008).
Who found that 68.9% and 64.7% of Candida isolates was produced
coagulase enzyme.
4.4. Molecular Study
In this study, to detect the prevalence of candidalysin ECE1 gene among

clinical C. albicans isolates, the specific primers of the tested gene were
designed according to the complete sequence deposited in gene bank. The
genomic DNA of all C. albicans isolates was extracted and subjected to the
PCR using designed primers, after electrophoresis the PCR product was
visualized. As predictable, the bands with molecular size 435 bp were
amplified from analyzed C. albicans isolates Figure (4-11) The results
revealed that there are15 (60%) isolates collected from oral cavity of males
were positive for ECE1 gene and 6(37.5%) from respiratory tract
respectively, while 10(40%) of isolates collected from oral cavity of females
was positive of targeted gene in oral cavity. Also, 10(62.5%) from
respiratory tracts of females was harbouring this gene as shown in the Table
(4-12). The obtained sequences of ECE1 gene for selected four isolates of C.
albicans were deposited in gene bank under accession numbers and the data
of alignment showed 100% percentage with the sequences of the same gene
of the others isolates of C. albicans.
Figure (4-11) Electrophoresis of the PCR product of the ECE1 gene of

C. albicans isolates using agarose gel at a concentration of 2% for 45
min under a voltage of 70 volts. After staining with ethidium bromide.
M. Gene ruler 1500 kb, Lane 1-9; PCR products of C. albicans isolates.
This is to detect the ECE1 gene, and after electrophoresis of the PCR
product, the results were positive for male from oral cavity in 15(60.0) and
6(37.5) in respiratory tract whereas negative result was 5(29.4) in oral cavity
and 4(33.3) in respiratory tract, while in female the result was as follows, 10
(40.0) of sample was positive in oral cavity and 10 (62.5) in respiratory tract,
while the negative result 12(70.7) in oral cavity and 8(66.7) in respiratory
tract as shown in Table (4-12) .
Table (4-12) Distribution of the candidalysin ECE1 gene among C.

albicans isolates according to source of isolation and gender.
Oral cavity Respiratory tract

Total P-value P-value
Gender Positive Negative positive Negative +ve vs+ve -ve vs -ve
N (%) N (%) N (%) N (%) N (%)
Male 15(60.0) 5(29.4) 6(37.5) 4(33.3) 30(42.9) 0.002** 0.638 N.S
Female 10(40.0) 12(70.6) 10(62.5) 8(66.7) 40(57.1) 1.00 N.S 0.197 N.S
P-value 0.149 N.S 0.008** 0.144 N.S 0.083 N.S
Data presented as N (%), ¥: Z-test was used to test two proportions. N.S: Not significant
(P>0.05). *, ** Significant and highly significant (P ≤ 0.05) and (P ≤ 0.01) respectively.
In 2016 Moyes et al. and Birse et al. in (1993) who discovered the new type
of fungal toxin called candidalysin, this cytolytic toxin is the first fungal
peptide toxin detected in a human fungal pathogen (Rogiers et al., 2019;
Russell et al., 2022) Candidalysin produced by strains of C. albicans and its
very important for infections during invasion of mucosa and other human
tissues ( Salvin., 1951). In previous studies and reports to elucidate the
activity of candidalysin in the lysis of red blood cells, the wild type of C.
albicans was incubated in parallel with another harbouring ECE1 gene
(mutant strain) on blood agar medium, the obtained data showed both the
mutant and wild strains have the ability to produce beta-hemolysis
(Mogavero et al., 2021; Richardson et al., 2022). This may referred to there
are another factors caused the hemolysis in RBCs and produce hemolytic
halo zone around the colonies of yeast strain, possibly produced aspartic
protease, that responsible to hemolysis in RBCs found in blood agar medium
(Pendark and Roberts., 2007). However, some studies revealed that the
strains of C. albicans have the ability to synthetic and secret candidalysin
and its direct precursor P3 considered are strong hemolytic peptides
(Mogavero et al., 2022). The strains of C. albicans harouring ECE1 gene

play an important role in the lysis of RBCs present in the medium of blood
agar is further supported by the data that revealed that ECE1 expression is
induced in the existence of hemoglobin(Richardson et al., 2018; Mogavero
et al., 2021). C. albicans has different virulence factors like the
morphological transition from unicellular yeast to hyphae and production of
lysis enzymes. The pathogenicity of C. albicans initiate when in contact with
the cells of host (Richardson et al., 2018; Macias-Paz et al., 2022). Several
researchers and scientists have demonstrated that candidalysin is produced
by C. albicans strains only when it grow in the hyphal form and causes
damage to cells of the host particularly the epithelial cells during mucosal
infection (Bain et al., 2014). Indeed, there are clear differences in the ECE1
gene expression levels were noticed and reported in C. albicans, some
strains of C. dubliniences and C. tropicalis when grown in the presence of
oral epithelial cells in vitro and independently of the hypha formation by the
strain of yeast (Willems et al., 2018; Richardson et al., 2022).
Chapter Five
Conclusions and Recommendations
Chapter Five: Conclusions And Recommendations 91
5. Conclusions And Recommendations

5.1 Conclusions
1- During this work, 102 Candida isolates were collected and identified
from clinical sources which include oral cavity and respiratory tract
infection of Iraqi patients.
2- It is found that 70 isolates were identified as C. albicans from the clinical

sources.
3- Amphotericin-B was the highest susceptible antifungal drug against

Candida species isolates in susceptibility percentage (93.14%)
4- The current results revealed that 48.57% from C. albicans isolates were
strong producer for biofilm, and 40% were moderately biofilm producer,
while 4.29% non-producer of biofilm.
5- C. albicans isolates showed varied proteolytic activity, 42.86% was

strong activity and 4.86% of isolate have weak protolytic activity
6- The percentage of strong hemolytic activity among C. albicans isolates

was 28.57% while 51.43% medreat in production
7- C. albicans isolates showed varied phospholipase activity, 64.29% was

strong activity and 7.14% of isolate have weak activity
8- The percentage of positive coagulase production among C. albicans

isolates was 84.29% while 15.71% was negative in production
9- Molecular detection of ECE1 gene among the 70 isolates of C. albicans

collected revealed that there were 28.57% harboring this gens, while the
other isolates were non- harboring.
Chapter Five: Conclusions And Recommendations 92
5.2 Recommendations
The study recommends the following:
1- Studying the gene expression of ECE1 using RT-PCR of harbouring

clinical C. albicans isolates.
2- Investigating the cytotoxicity effect of candidalysin against specific cell

lines such as TR 146.
3- Detecting the distribution of ECE1 gene among C. albicans collect from

other sources such as vagina and skin.
4- Studying the prevalence of ECE1 gene among other species of Candida

collect from different clinical sources.
References
References 94
Refrence
Abood, M.S. 2014. Immunological and molecular study of Candida spp causing
vulvovaginal candidiasis and the role of Lactic acid bacteria as probiotic in
vivo and in vitro. College of Science, University of Baghdad, Iraq.
Abu‐Elteen, K.H. 2000. Effects of date extract on adhesion of Candida species to

human buccal epithelial cells in vitro. Journal of oral pathology & medicine,
29(5), pp.200-205.
Ahmad, A., Husain, A., Khan, S. A., Mujeeb, M., and Bhandari, A. 2015.
Design, synthesis, molecular properties and antimicrobial activities of some
novel 2 (3H) pyrrolone derivatives. Journal of Saudi Chemical Society,
19(3), pp. 340-346.
Akpan, A. and Morgan, R. 2002. Oral candidiasis. Postgraduate medical journal,

78(922), pp.455-459.
Aldossary, M.A., Almansour, N.A. and Abdulraheem, B.S. 2016. Isolation and
identification of Candida species from the oral cavity of cancer patients
undergoing chemotherapy in Basrah, Iraq. Journal of Biology Agriculture
and Healthcare, 6(18), pp.22-30
Ali, G. Y., Algohary, E. H. S., Rashed, K. A., Almoghanum, M., and Khalifa, A.
A. 2012. Prevalence of Candida colonization in preterm newborns and
VLBW in neonatal intensive care unit: role of maternal colonization as a risk
factor in transmission of disease. The Journal of Maternal-Fetal & Neonatal
Medicine, 25(6), pp. 789-795.
Al-Jumaily, E.F., Mahdi, A.A.A.H. and Jumma, I.M. 2015. Study the purified
cell wall mannoproteins Candida albicans CA18 as immunomodulators on
vaccination of mice., pp.118-122.
Allert, S., Forster, T. M., Svensson, C. M., Richardson, J. P., Pawlik,

T.,Hebecker, B and Hube, B. 2018. Candida albicans-induced epithelial
damage mediates translocation through intestinal barriers. MBio, 9,
pp.e00915–e00918.
References 95
Arastehfar, A., Gabaldón, T., Garcia-Rubio, R., Jenks, J. D., Hoenigl, M.,
Salzer, H. J., and Perlin, D. S. 2020. Drug-resistant fungi: an emerging
challenge threatening our limited antifungal
armamentarium. Antibiotics, 9(12), p 877.
Arzmi, M. H., Dashper, S., and McCullough, M. 2019. Polymicrobial

interactions of Candida albicans and its role in oral carcinogenesis. Journal
of Oral Pathology & Medicine, 48(7), pp.546-551.
Asadzadeh, M., Al-Sweih, N., Ahmad, S., Khan, S., Alfouzan, W., and Joseph, L
. 2022. Fatal Lodderomyces elongisporus Fungemia in a Premature,
Extremely Low-Birth-Weight Neonate. Journal of Fungi, 8(9), p. 906.
Aslani, N., Janbabaei, G., Abastabar, M., Meis, J. F., Babaeian, M., Khodavaisy,
S., and Badali, H. 2018. Identification of uncommon oral yeasts from cancer
patients by MALDI-TOF mass spectrometry. BMC Infectious Diseases, 18,
pp.1-11.
Aittakorpi, A.; Kuusela, P.; Kähkölä, P.K.; Vaara, M.; Petrou, M.; Gant, V. and
Mäkia, M. 2012. Accurate and Rapid Identification of Candida spp.
Frequently Associated with Fungemia by Using PCR and the Microarray-
Based, J of Clin Microbiol., 50 (11). pp. 3635–3640.
Atriwal, T., Azeem, K., Husain, F. M., Hussain, A., Khan, M. N., Alajmi, M. F.,
and Abid, M. 2021. Mechanistic understanding of Candida albicans biofilm
formation and approaches for its inhibition. Frontiers in Microbiology, 12, p.
638609.
Ayeni, O., Riederer, K.M., Wilson, F.M. and Khatib, R. 1999. Clinicians'
reaction to positive urine culture for Candida organisms. Mycoses, 42(4),
pp.285-289.
Bacher, P., Hohnstein, T., Beerbaum, E., Röcker, M., Blango, M. G., Kaufmann,
S., and Scheffold, A. 2019. Human anti-fungal Th17 immunity and
pathology rely on cross-reactivity against Candida albicans. Cell, 176(6),
pp. 1340-1355.
References 96
Bain, J.M., Louw, J., Lewis, L.E., Okai, B., Walls, C.A., Ballou, E.R., Walker,
L.A., Reid, D., Munro, C.A., Brown, A.J. and Brown, G.D. 2014. Candida
albicans hypha formation and mannan masking of β-glucan inhibit
macrophage phagosome maturation. MBio, 5(6), pp.e01874-14.
Balfour, J.A. and Faulds, D. 1992. Terbinafine: a review of its pharmacodynamic

and pharmacokinetic properties, and therapeutic potential in superficial
mycoses. Drugs, 43, pp.259-284.
Bemena, L. D., Min, K., Konopka, J. B., and Neiman, A. M. 2021. A conserved
machinery underlies the synthesis of a chitosan layer in the Candida
chlamydospore cell wall. Msphere, 6(2), pp. e00080-21.
Beneke, F.S. and Rpgers, A.L. 1980. Medical mycology manual 4th edition
Burgess Pub. Co. Minn, pp.33-36.
Bhalla, K., Qu, X., Kretschmer, M., and Kronstad, J. W. 2022. The phosphate
language of fungi. Trends in Microbiology, 30(4), pp.338-349.
Bhattacharjee, S. 2016. DLS and zeta potential–what they are and what they are
not?. Journal of controlled release, 235, pp.337-351.
Bilal, H., Hou, B., Shafiq, M., Chen, X., Shahid, M.A. and Zeng, Y. 2022.
Antifungal susceptibility pattern of Candida isolated from cutaneous
candidiasis patients in eastern Guangdong region: A retrospective study of
the past 10 years. Frontiers in Microbiology, 13, p.981181.
Birse, C. E., Irwin, M. Y., Fonzi, W. a., and Sypherd, P. S. 1993. Cloning and
characterization of ECE1, a gene expressed in association with cell
elongation of the dimorphic pathogen Candida albicans. Infection and
Immunity, 61(9), pp. 3648–3655.
Bongomin, F., Gago, S., Oladele, R.O. and Denning, D.W. 2017. Global and
multi-national prevalence of fungal diseases—estimate precision. Journal of
fungi, 3(4), p.57.
Böttcher, B., Pöllath, C., Staib, P., Hube, B., and Brunke, S. 2016. Candida
species rewired hyphae developmental programs for chlamydospore
formation. Frontiers in microbiology, 7, p. 1697.
References 97
Boucherit-Otmani, Z., Boucherit, K. and Djediat, C. 2021. Interaction in a dual-

species bioﬁlm of Candida albicans and Candida glabrata co-isolated from
intravascular catheter. Microbial Pathogenesis, 152, p.104613.
Brown, G.D., Denning, D.W., Gow, N.A., Levitz, S.M., Netea, M.G. and White,
T.C. 2012. Hidden killers: human fungal infections. Science translational
medicine, 4(165), pp.165rv13-165rv13.
Cangui-Panchi, S.P., Ñacato-Toapanta, A.L., Enríquez-Martínez, L.J., Reyes, J.,

Garzon-Chavez, D. and Machado, A. 2022. Biofilm-forming
microorganisms causing hospital-acquired infections from intravenous
catheter: A systematic review. Current Research in Microbial Sciences,
p.100175.
Cavalheiro, M., and Teixeira, M. C. 2018. Candida biofilms: threats, challenges,

and promising strategies. Frontiers in medicine, 5, p. 28.
Chaffin, W.L., Lopez-Ribot, J.L., Casanova, M., Gozalbo, D. and Martinez, J.P.
1998. Cell wall and secreted proteins of Candida albicans: identification,
function, and expression. Microbiology and molecular biology reviews,
62(1), pp.130-180.
Chandra, J. ; Mukherjee, P. K. ;Leidich, S. D. ;Faddoul, F. F. ;Hoyer, L. L.

;Douglas, L. J. and Ghannoum, M. A. 2001. Antifungal resistance of
candidal biofilms formed on denture acrylic in vitro. J .Dent Res 80, pp.
903–908.
Chen, H., Zhou, X., Ren, B. and Cheng, L. 2020. The regulation of hyphae
growth in Candida albicans. Virulence, 11(1), pp.337-348
Christensen, G.D., Simpson, W.A., Younger, J.J., Baddour, L.M., Barrett, F.F.,
Melton, D.M. and Beachey, E.H. 1985. Adherence of coagulase-negative
staphylococci to plastic tissue culture plates: a quantitative model for the
adherence of staphylococci to medical devices. Journal of clinical
microbiology, 22(6), pp.996-1006.
References 98
Cirak, M. Y., Kalkanci, A., and Kustimur, S. 2003. Use of molecular methods in
identification of Candida species and evaluation of fluconazole resistance.
Memórias do Instituto Oswaldo Cruz, 98, pp.1027-1032.
Clinical and Laboratory Standards Institute. Performance standards for

antifungal susceptibility testing of yeasts, 1st ed. CLSI supplement M60
Clinical and Laboratory Standards Institute, Wayne, PA 2017.
da Silva Dantas, A., Lee, K.K., Raziunaite, I., Schaefer, K., Wagener, J., Yadav,
B. and Gow, N.A. 2016. Cell biology of Candida albicans–host interactions.
Current opinion in microbiology, 34, pp.111-118.
Daniel, W.W. and Cross, C. L. 2013. Biostatistics, A Foundation for analysis in

the health sciences., John wiely and sons. New York, Pp: 958
Darwazeh, A.M.G., MacFarlane, T.W., McCuish, A. and Lamey, P.J. 1991.

Mixed salivary glucose levels and candidal carriage in patients with diabetes
mellitus. Journal of oral pathology & medicine, 20(6), pp.280-283.
Davarzani, F., Saidi, N., Besharati, S., Saderi, H., Rasooli, I. and Owlia, P. 2021.
Evaluation of antibiotic resistance pattern, alginate and biofilm production in
clinical isolates of Pseudomonas aeruginosa. Iranian Journal of Public
Health, 50(2), p.341.
De Maria, L., Vind, J., Oxenbøll, K.M., Svendsen, A. and Patkar, S. 2007.
Phospholipases and their industrial applications. Applied microbiology and
biotechnology, 74, pp.290-300.
de Melo, A.V., Zuza-Alves, D.L., da Silva-Rocha, W.P., de Souza, L.F.C.,

Francisco, E.C., de Azevedo Melo, A.S. and Chaves, G.M. 2019. Virulence
factors of Candida spp. obtained from blood cultures of patients with
candidemia attended at tertiary hospitals in Northeast Brazil. Journal de
mycologie medicale, 29(2), pp.132-139.
Delavy, M., Dos Santos, A. R., Heiman, C. M., and Coste, A. T. 2019.
Investigating antifungal susceptibility in Candida species with MALDI-TOF
MS-based assays. Frontiers in cellular and infection microbiology, 9, p.19.
References 99
Di Cosola, M., Cazzolla, A. P., Charitos, I. A., Ballini, A., Inchingolo, F., and
Santacroce, L. 2021. Candida albicans and oral carcinogenesis. A brief
review. Journal of Fungi, 7(6), p. 476.
El Kirat, S. 2010. Développement d‘outils cellulaires et moléculaires pour

l‘étude des interactions Candida-phagocytes; Application à la caractérisation
du gène OLE2 codant une désaturase chez C. lusitaniae (Doctoral
dissertation, Bordeaux 2).
Ellis, D.H., Davis, S., Alexiou, H., Handke, R. and Bartley, R. 2007. Descriptions
of medical fungi (Vol. 2). Adelaide: University of Adelaide.
Engku Nasrullah Satiman, E. A. F., Ahmad, H., Ramzi, A. B., Abdul Wahab,
R., Kaderi, M. A., Wan Harun, W. H. A.,& Arzmi, M. H. 2020. The role of
Candida albicans candidalysin ECE1 gene in oral carcinogenesis. Journal of
Oral Pathology & Medicine, 49(9), pp.835-841.
Fairbrother, R.W. 1940. Coagulase Production as a Criterion for the

Classification of the Staphylococei. Journal of Pathology and Bacteriology,
50, pp.83-88.
Ferreira, A. V., Prado, C. G., Carvalho, R. R., Dias, K. S. T., and Dias, A. L. T.
2013. Candida albicans and non-C. albicans Candida species: comparison
of biofilm production and metabolic activity in biofilms, and putative
virulence properties of isolates from hospital environments and
infections. Mycopathologia, 175, pp. 265-272.
Gallis, H.A., Drew, R.H. and Pickard, W.W. 1990. Amphotericin B: 30 years of
clinical experience. Reviews of infectious diseases, 12(2), pp.308-329.
Galocha, M., Pais, P., Cavalheiro, M., Pereira, D., Viana, R., and Teixeira, M. C.
2019. Divergent Approaches to Virulence in C. albicans and C. glabrata:
Two Sides of the Same Coin. International journal of molecular sciences,
20(9), p. 2345.
Gandhi, T.N., Patel, M.G. and Jain, M.R., 2015. Antifungal susceptibility of
Candida against six antifungal drugs by disk diffusion method isolated from
References 100
vulvovaginal candidiasis. International Journal of Current Research and

Review, 7(11), p.20.
Ghannoum, M and Abu-Elteen, K.H. 1990. Pathogenicity determinants in

Candida,. A review. J Mycol Med, 33, pp. 265-82.
Giri, S. and Kindo, A.J. 2014. Evaluation of antifungal susceptibility testing in

Candida isolates by Candifast and disk-diffusion method. Indian Journal of
Pathology and Microbiology, 57(4), p.595.
Giri, S., and Kindo, A. J. 2012. A review of Candida species causing blood
stream infection. Indian journal of medical microbiology, 30(3), pp.270-278.
Gomez-Gaviria, M., and Mora-Montes, H. M. 2020. Current aspects in the

biology, pathogeny, and treatment of Candida krusei, a neglected fungal
pathogen. Infection and drug resistance, 13, p1673.
González Gravina, H., González de Morán, E., Zambrano, O., Lozano Chourio,
M., Rodríguez de Valero, S., Robertis, S. and Mesa, L. 2007. Oral
Candidiasis in children and adolescents with cancer: Identification of
Candida spp. Medicina Oral, Patología Oral y Cirugía Bucal (Internet),
12(6), pp.419-423.
Gravina, H.G., Morán, E.G. and Zambrano, O. 2007. Oral Candidiasis in

children and adolescents with cancer. Identification of Candida spp . Med
Oral Patol Oral Cir Bucal, 12(6), pp.419-23
Grunenwald, H. 2003. Optimization of polymerase chain reactions. PCR

protocols, pp.89-99.
Gupta, V., Abhisheik, K., Balasundari, S., Devendra, N. K., Shadab, K., and
Anupama, M. 2019. Identification of Candida albicans using different
culture media and its association in leukoplakia and oral squamous cell
carcinoma. Journal of oral and maxillofacial pathology: JOMFP, 23(1), p28.
Hasan, F., Xess, I., Wang, X., Jain, N. and Fries, B.C. 2009. Biofilm formation in
clinical Candida isolates and its association with virulence. Microbes and
infection, 11(8-9), pp.753-761.
References 101
Hajjeh, R.A.; Sofair, A.N.; Harrison, L.H.; Lyon, G.M.; Arthington- Skaggs,
B.A. and Mirza, S.A. 2004. Incidence of blood stream infections due to
Candida species and invitro susceptibilities of isolates collected from 1998
to 2000 in a population based active surveillance program, J. Clin.
Microbiol., 42. pp. 1519- 1527.
Hazen, K. C. 1995. New and emerging yeast pathogens. Clinical Microbiology

Reviews, 8(4), pp.462–478.
Hibbett, D.S., Blackwell, M., James, T.Y., Spatafora, J.W., Taylor, J.W. and
Vilgalys, R. 2018. Phylogenetic taxon definitions for fungi, dikarya,
ascomycota and basidiomycota. IMA fungus, 9, pp.291-298.
Horvath, L.L., Hospenthal, D.R., Murray, C.K. and Dooley, D.P. 2003. Direct
isolation of Candida spp. from blood cultures on the chromogenic medium
CHROMagar Candida. Journal of clinical microbiology, 41(6), pp.2629-
2632.
Hospenthal, D.R., Beckius, M.L., Floyd, K.L., Horvath, L.L. and Murray, C.K.
2006. Presumptive identification of Candida species other than C. albicans,
C. krusei, and C. tropicalis with the chromogenic medium CHROMagar
Candida. Annals of clinical microbiology and antimicrobials, 5(1), pp.1-5.
Hube, B. and Naglik, J. 2001. Candida albicans proteinases: resolving the

mystery of a gene family. Microbiology, 147(8), pp.1997-2005.
Ibrahim, A.S., Mirbod, F., Filler, S.G., Banno, Y., Cole, G.T., Kitajima, Y.,
Edwards Jr, J.E., Nozawa, Y. and Ghannoum, M.A. 1995. Evidence
implicating phospholipase as a virulence factor of Candida albicans.
Infection and immunity, 63(5), pp.1993-1998.
Isenberg, H.D. 1998. Essential procedures for clinical microbiology (pp. 216-
221). Washington, DC: ASM press.
Ito, M., Yamada, T., Makimura, K., Ishihara, Y., Satoh, K., Kikuchi, K., and
Abe, S., 2010. Intracellular serine protease from Candida glabrata species
detected and analyzed by zymography. Med Mycol, 1, pp. 29-35.
References 102
Jabra-Rizk, M.A., Brenner, T.M., Romagnoli, M., Baqui, A.A.M.A., Merz,

W.G., Falkler Jr, W.A. and Meiller, T.F. 2001. Evaluation of a reformulated
CHROMagar Candida. Journal of clinical microbiology, 39(5), pp.2015-
2016.
Janbon, G., Quintin, J., Lanternier, F., and d‘Enfert, C. 2019. Studying fungal
pathogens of humans and fungal infections: Fungal diversity and diversity of
approaches. Microbes and Infection, 21(5-6), pp.237-245.
Jenks, J.D., Salzer, H.J., Prattes, J., Krause, R., Buchheidt, D. and Hoenigl, M.
2018. Spotlight on isavuconazole in the treatment of invasive aspergillosis
and mucormycosis: design, development, and place in therapy. Drug design,
development and therapy, pp.1033-1044.
Jin, Y.Y.H.K., Yip, H.K., Samaranayake, Y.H., Yau, J.Y. and Samaranayake,
L.P. 2003. Biofilm-forming ability of Candida albicans is unlikely to
contribute to high levels of oral yeast carriage in cases of human
immunodeficiency virus infection. Journal of clinical microbiology, 41(7),
pp.2961-2967.
Kantarcioǧlu, A.S. and Yücel, A. 2002. Phospholipase and protease activities in

clinical Candida isolates with reference to the sources of strains:
Phospholipase‐and Protease‐Aktivitat bei klinischenCandida‐Isolaten mit
Bezug zur Herkunft der Stämme. Mycoses, 45(5‐6), pp.160-165.
Karch, H., Rüssmann, H., Schmidt, H., Schwarzkopf, A. and Heesemann,

J.1995. Long-term shedding and clonal turnover of enterohemorrhagic
Escherichia coli O157 in diarrheal diseases. Journal of Clinical
Microbiology, 33(6), pp.1602-1605.
Kauffman, C.A., Vazquez, J.A., Sobel, J.D., Gallis, H.A., McKinsey, D.S.,
Karchmer, A.W., Sugar, A.M., Sharkey, P.K., Wise, G.J., Mangi, R. and
Mosher, A. 2000. Prospective multicenter surveillance study of funguria in
hospitalized patients. Clinical Infectious Diseases, 30(1), pp.14-18.
Kaur, R., Dhakad, M.S., Goyal, R., Haque, A. and Mukhopadhyay, G. 2016.
Identification and antifungal susceptibility testing of Candida species: a
References 103
comparison of Vitek-2 system with conventional and molecular methods.

Journal of global infectious diseases, 8(4), p.139.
Kaur, R., Domergue, R., Zupancic, M. L., and Cormack, B. P., 2005. Yeast by
any other name: Candida glabrata and its interaction with the host. Current
opinion in microbiology, 8(4), pp.378-384.
Kounatidis, I., Ames, L., Mistry, R., Ho, H. L., Haynes, K., and Ligoxygakis, P.
2018. A host-pathogen interaction screen identifies ada2 as a mediator of
Candida glabrata defenses against reactive oxygen species. G3: Genes,
Genomes, Genetics, 8(5), pp. 1637-1647.
Koundal, S. and Cojandaraj, L. 2020 ‗Candida species – Morphology, medical

aspects and pathogenic spectrum‘, European Journal of Molecular and
Clinical Medicine, 7(7), pp. 4015–4021.
Kumar, C.G., Kumar, S.S.J. and Menon, T. 2006. Phospholipase and proteinase
activities of clinical isolates of Candida from immunocompromised patients.
Mycopathologia, 161(4), p.213.
Kumar, K., Askari, F., Sahu, M. S., and Kaur, R. 2019. Candida glabrata: a lot
more than meets the eye. Microorganisms, 7(2), pp .39.
Kurtzman, C.P. and Fell, J.W. 2006. Yeast systematics and phylogeny—
implications of molecular identification methods for studies in ecology.
Biodiversity and ecophysiology of yeasts, pp.11-30.
Kurtzman, C.P. and Piškur, J. 2005. Taxonomy and phylogenetic diversity

among the yeasts. In Comparative genomics: using fungi as models (pp. 29-
46). Berlin, Heidelberg: Springer Berlin Heidelberg.
Lagane, C. 2007. Rôle de l'IL-13 et des ligands de PPAR-gamma dans la réponse

anti-infectieuse des macrophages murins et des monocytes humains vis-à-vis
de Candida Albicans. Implication de PPAR-gamma (Doctoral dissertation,
Université de Toulouse, Université Toulouse III-Paul Sabatier).
Lewis, M. A. O., and Williams, D. W., 2017. Diagnosis and management of oral
candidasis. British dental journal, 223(9), pp.675-681.
References 104
Li, Y., Sun, L., Lu, C., Gong, Y., Li, M., and Sun, S. 2018. Promising antifungal
targets against Candida albicans based on ion homeostasis. Frontiers in
Cellular and Infection Microbiology, 8, p286.
Linares, C.E.B., Loreto, É.S.D., Silveira, C.P., Pozzatti, P., Scheid, L.A.,
Santurio, J.M. and Alves, S.H. 2007. Enzymatic and hemolytic activities of
Candida dubliniensis strains. Revista do Instituto de Medicina Tropical de
São Paulo, 49, pp.203-206.
Liu, M., Chen, M. and Yang, Z. 2017. Design of amphotericin B oral formulation
for antifungal therapy. Drug Delivery, 24(1), pp.1-9.
Lohse, M.B., Gulati, M., Johnson, A.D. and Nobile, C.J. 2018. Development and
regulation of single-and multi-species Candida albicans biofilms. Nature
Reviews Microbiology, 16(1), pp.19-31.
Luo G, Samaranayake LP and Yau JY. 2001. Candida species exhibit differential
in vitro hemolytic activities. J Clin Microbiol, 39(8), pp. 2971-2974.
Lyon, J.P., Moreira, L.M., Cardoso, M.A.G., Saade, J. and Resende, M.A. 2008.
Antifungal suscepitibility profile of Candida spp. oral isolates obtained from
denture wearers. Brazilian Journal of Microbiology, 39, pp.668-672.
Macias-Paz, I.U., Pérez-Hernández, S., Tavera-Tapia, A., Luna-Arias, J.P.,

Guerra-Cárdenas, J.E. and Reyna-Beltrán, E. 2022. Candida albicans the
main opportunistic pathogenic fungus in humans. Revista Argentina de
Microbiología.
Magaldi, S., Mata-Essayag, S., De Capriles, C.H., Pérez, C., Colella, M.T.,
Olaizola, C. and Ontiveros, Y. 2004. Well diffusion for antifungal
susceptibility testing. International journal of infectious diseases, 8(1),
pp.39-45.
Malcok, H.K., Aktas, E., Ayyildiz, A., Yigit, N. and Yazgi, H. 2009. Hemolytic
activities of the Candida species in liquid medium. The Eurasian Journal of
Medicine, 41(2), p.95.
Manns, J.M., Mosser, D.M. and Buckley, H.R. 1994. Production of a hemolytic
factor by Candida albicans. Infection and immunity, 62(11), pp.5154-5156.
References 105
Mariottini, G. L., and Grice, I. D. 2016. Antimicrobials from Cnidarians. A new

perspective for anti-infective therapy? Marine Drugs, 14(3), p.48.
Marsh , P. D. and Martin , M. 2009. Oral fungal infections. Oral. Microbiol.

Chrachill Livingstone, Edinburgh , U. K, pp. 166-179
Martin, R., Albrecht-Eckardt, D., Brunke, S., Hube, B., Hünniger, K. and Kurzai,
O. 2013. A core filamentation response network in Candida albicans is
restricted to eight genes. PloS one, 8(3), p.e58613.
Martins, N., Ferreira, I. C., Barros, L., Silva, S., and Henriques, M. 2014.
Candidiasis: predisposing factors, prevention, diagnosis and alternative
treatment. Mycopathologia, 177(5), pp. 223-240.
Mayer, F. L., Wilson, D., and Hube, B. 2013. Candida albicans pathogenicity
mechanisms. Virulence, 4(2), pp.119-128.
Marks, M. I., Marks, S., and Brazeau, M. 1975. Yeast colonization in

hospitalized and nonhospitalized children. The Journal of pediatrics, 87(4),
pp. 524-527.
Mc Ginnis, D. 1980. Laboratory Handbook of Medical Mycology.
McGregor, J. A., French, J. I. and Jone, W. 1992. Association of cervico vaginal

infection with increased vaginal fluid phosphates activity. Am. J. Obst Gyn.,
167, pp. 1588-1594
McCall, A. D., Pathirana, R. U., Prabhakar, A., Cullen, P. J., and Edgerton, M.
2019. Candida albicans biofilm development is governed by cooperative
attachment and adhesion maintenance proteins. NPJ biofilms and
microbiomes, 5(1), p.21.
McCarthy, M.W., Kontoyiannis, D.P., Cornely, O.A., Perfect, J.R. and Walsh,
T.J. 2017. Novel agents and drug targets to meet the challenges of resistant
fungi. The Journal of infectious diseases, 216(suppl_3), pp.S474-S483.
McCarty, T. P., and Pappas, P. G. 2016. Invasive candidiasis. Infectious Disease

Clinics, 30(1), pp. 103-124.
References 106
McEvoy, G.K. ed., 2000. AHFS drug information. 2000. American society of
health-system pharmacists
Meurman, J. H., Siikala, E., Richardson, M., and Rautemaa, R. 2007. Non-
Candida albicans Candida yeasts of the oral cavity. Communicating current
research and educational topics and trends in applied microbiology, 1(1),
p719-731.
Mogavero, S., Sauer, F.M., Brunke, S., Allert, S., Schulz, D., Wisgott, S.,
Jablonowski, N., Elshafee, O., Krüger, T., Kniemeyer, O. and Brakhage,
A.A. 2021. Candidalysin delivery to the invasion pocket is critical for host
epithelial damage induced by Candida albicans. Cellular Microbiology,
23(10), p.e13378.
Mohandas, V. and Ballal, M. 2011. Distribution of Candida species in different

clinical samples and their virulence: biofilm formation, proteinase and
phospholipase production: a study on hospitalized patients in southern India.
Journal of global infectious diseases, 3(1), p.4.
Monod, M. and Borg-von Zepelin, M. 2002. Secreted proteinases and other

virulence mechanisms of Candida albicans. Fungal Allergy and
Pathogenicity, 81, pp.114-128.
Moris, D.V.; Melhem, S.C.; Martins, M.A. and Mendes, R.P. (2008). Oral
Candida spp. Colonization in Human Immunodeficiency Virus – Infected
Individuals, J. Venom. Anim. Toxins incl. Trop. Dis., 14 (2), pp. 224-257.
Moya-Salazar, J., and Rojas, R. 2018. Comparative study for identification of

Candida albicans with germ tube test in human serum and plasma. Clinical
Microbiology and Infectious Diseases, 3(3), pp.1-4.
Moyes, D. L., Wilson, D., Richardson, J. P., Mogavero, S., Tang, S.

X.,Wernecke, J., Naglik, J. R. 2016. Candidalysin is a fungal peptide
toxin critical for mucosal infection. Nature, 532, pp.64–68.
Mulet Bayona, J.V., Salvador García, C., Tormo Palop, N., Valentín Martín, A.,
González Padrón, C., Colomina Rodríguez, J., Pemán, J. and Gimeno
References 107
Cardona, C. 2022. Novel chromogenic medium CHROMagarTM Candida

Plus for detection of Candida auris and other Candida species from
surveillance and environmental samples: A multicenter study. Journal of
Fungi, 8(3), p.281.
Nafisa, G., Hidana, R. and Virgianti, D.P. 2020. Influence of the Growth of
Candida albicans on Several Alternative Medium. In 2nd Bakti Tunas
Husada-Health Science International Conference (BTH-HSIC 2019) (pp. 5-
8). Atlantis Press.
Naglik, J.R., Challacombe, S.J. and Hube, B. 2003. Candida albicans secreted
aspartyl proteinases in virulence and pathogenesis. Microbiology and
molecular biology reviews, 67(3), pp.400-428.
Naglik, J.R., Gaffen, S.L. and Hube, B. 2019. Candidalysin: discovery and
function in Candida albicans infections. Current opinion in microbiology,
52, pp.100-109.
NCBI National Center for Biotechnology information

,https://www.ncbi.nlm.nih.gov.
Nieminen, M.T., Novak-Frazer, L., Rautemaa, V., Rajendran, R., Sorsa, T.,
Ramage, G., Bowyer, P. and Rautemaa, R. 2014. A novel antifungal is
active against Candida albicans biofilms and inhibits mutagenic
acetaldehyde production in vitro. Plos one, 9(5), p.e97864.
Nobile, C.J. and Johnson, A.D. 2015. Candida albicans biofilms and human
disease. Annual review of microbiology, 69, pp.71-92.
Nouraei, H., Pakshir, K., ZareShahrabadi, Z. and Zomorodian, K. 2020. High

detection of virulence factors by Candida species isolated from bloodstream
of patients with candidemia. Microbial Pathogenesis, 149, p.104574.
Nurdin, R. S. C., Vitayani, S., Amin, S., Kadir, D., Djamaluddin, W., and
Adriani, A. 2021. Cutaneous candidiasis caused by Candida kefyr. The Pan
African Medical Journal, 38.
Oksuz, S., Sahin, I., Yildirim, M., Gulcan, A., Yavuz, T., Kaya, D. and Koc,
A.N. 2007. Phospholipase and proteinase activities in different Candida
References 108
species isolated from anatomically distinct sites of healthy adults. Japanese

journal of infectious diseases, 60(5), p.280.
Opulente, D.A., Langdon, Q.K., Buh, K.V., Haase, M.A., Sylvester, K.,
Moriarty, R.V., Jarzyna, M., Considine, S.L., Schneider, R.M. and Hittinger,
C.T. 2019. Pathogenic budding yeasts isolated outside of clinical settings.
FEMS yeast research, 19(3), p.foz032.
Ost, K. S., O‘Meara, T. R., Stephens, W. Z., Chiaro, T., Zhou, H., Penman, J.,
and Round, J. L. 2021. Adaptive immunity induces mutualism between
commensal eukaryotes. Nature, 596(7870), pp. 114-118.
O'Toole G, Kaplan HB, Kolter R. Biofilm formation as microbial development.

2000. Annual Reviews in Microbiology, 54(1), pp. 49-79.
Pappas, P. G., Lionakis, M. S., Arendrup, M. C., Ostrosky-Zeichner, L., and

Kullberg, B. J. 2018. Invasive candidiasis. Nature Reviews Disease Primers,
4(1), pp. 1-20.
Passos, X.S., Sales, W.S., Maciel, P.J., Costa, C.R., Miranda, K.C., Lemos,
J.D.A., Batista, M.D.A. and Silva, M.D.R.R. 2005. Candida colonization in
intensive care unit patients' urine. Memórias do Instituto Oswaldo Cruz, 100,
pp.925-928.
Patel, M. 2022. Oral cavity and candida albicans: Colonisation to the

development of infection. Pathogens, 11(3), p.335.
Patil, S., Rao, R.S., Majumdar, B. and Anil, S. 2015. Clinical appearance of oral
Candida infection and therapeutic strategies. Frontiers in microbiology, 6,
p.1391.
Pelletier, R., Alarie, I., Lagacé, R., and Walsh, T. J. 2005. Emergence of
disseminated candidiasis caused by Candida krusei during treatment with
caspofungin: case report and review of literature. Medical Mycology, 43(6),
pp. 559–564.
Pendrak, M.L. and Roberts, D.D. 2007. Hemoglobin is an effective inducer of

hyphal differentiation in Candida albicans. Medical mycology, 45(1), pp.61-
71.
References 109
Pérez-Torrado, R., and Querol, A. 2017. Saccharomyces cerevisiae show low

levels of traversal across human endothelial barrier in vitro. F1000Research,
6(944), p. 944.
Perfect, J.R. 2017. The antifungal pipeline: a reality check. Nature reviews Drug
discovery, 16(9), pp.603-616.
Perry, J.D. 2017. A decade of development of chromogenic culture media for

clinical microbiology in an era of molecular diagnostics. Clinical
microbiology reviews, 30(2), pp.449-479.
Peters, B. A., Wu, J., Hayes, R. B., and Ahn, J. 2017. The oral fungal
mycobiome: characteristics and relation to periodontitis in a pilot
study. BMC microbiology, 17, pp.1-11.
Pfaller, M. A., and Diekema, D. 2007. Epidemiology of invasive candidiasis: a

persistent public health problem. Clinical microbiology reviews, 20(1), pp.
133-163.
Pincus, D. H., Orenga, S., & Chatellier, S. 2007. Yeast identification—past,

present, and future methods. Medical mycology, 45(2), pp. 97-121.
Pinto-Almazán, R., Frías-De-León, M.G., Fuentes-Venado, C.E., Arenas, R.,

González-Gutiérrez, L., Chávez-Gutiérrez, E., Torres-Paez, O.U. and
Martínez-Herrera, E. 2022. Frequency of Candida spp. in the Oral Cavity of
Asymptomatic Preschool Mexican Children and Its Association with
Nutritional Status. Children, 9(10), p.1510.
Price, M.F., Wilkinson, I.D. and Gentry, L.O. 1982. Plate method for detection of
phospholipase activity in Candida albicans. Sabouraudia: Journal of Medical
and Veterinary Mycology, 20(1), pp.7-14.
Priya, A., and Pandian, S. K. 2020. Piperine impedes biofilm formation and
hyphal morphogenesis of Candida albicans. Frontiers in microbiology, 11,
p. 756.
Przybyłowska, D., Rubinsztajn, R., Chazan, R., Swoboda-Kopeć, E., Kostrzewa-

Janicka, J. and Mierzwińska-Nastalska, E. 2015. The prevalence of oral
References 110
inflammation among denture wearing patients with chronic obstructive

pulmonary disease. Pulmonary Function, pp.87-91.
Quinn, P.J., Markey, B.K., Leonard, F.C., Hartigan, P., Fanning, S. and
Fitzpatrick, E. 2011. Veterinary microbiology and microbial disease. John
Wiley and Sons.
Quinn, P.K., Coffman, D.J., Bates, T.S., Miller, T.L., Johnson, J.E., Voss, K.,
Welton, E.J. and Neusüss, C. 2001. Dominant aerosol chemical components
and their contribution to extinction during the Aerosols99 cruise across the
Atlantic. Journal of Geophysical Research: Atmospheres, 106(D18),
pp.20783-20809.
Rafiq, N. B. 2022. Candidiasis. In StatPearls [Internet]. StatPearls Publishing.
Ramos‐Pardo, A., Castro‐Álvarez, R., Quindós, G., Eraso, E., Sevillano, E. and
Kaberdin, V.R. 2023. Assessing pH‐dependent activities of virulence factors
secreted by Candida albicans. MicrobiologyOpen, 12(1), p.e1342.
Rao, C., Coyte, K. Z., Bainter, W., Geha, R. S., Martin, C. R., and Rakoff-
Nahoum, S. 2021. Multi-kingdom ecological drivers of microbiota assembly
in preterm infants. Nature, 591(7851), pp. 633-638.
Ream, K., Sandhu, A., Valle, J., Weber, R., Kaizer, A., Wiktor, D.M., Borne,
R.T., Tumolo, A.Z., Kunkel, M., Zipse, M.M. and Schuller, J. 2019.
Ambulatory rhythm monitoring to detect late high-grade atrioventricular
block following transcatheter aortic valve replacement. Journal of the
American College of Cardiology, 73(20), pp.2538-2547.
Reda, N. M., Hassan, R. M., Salem, S. T., and Yousef, R. H. A. 2022. Prevalence
and species distribution of Candida bloodstream infection in children and
adults in two teaching university hospitals in Egypt: first report of Candida
kefyr. Infection, pp. 1-7.
Richardson, J.P., Brown, R., Kichik, N., Lee, S., Priest, E., Mogavero, S.,
Maufrais, C., Wickramasinghe, D.N., Tsavou, A., Kotowicz, N.K. and
References 111
Hepworth, O.W. 2022. Candidalysins are a new family of cytolytic fungal

peptide toxins. MBio, 13(1), pp.e03510-21.
Richardson, J.P., Brown, R., Kichik, N., Lee, S., Priest, E., Mogavero, S.,
Maufrais, C., Wickramasinghe, D.N., Tsavou, A., Kotowicz, N.K. and
Hepworth, O.W. 2022. Candidalysins are a new family of cytolytic fungal
peptide toxins. MBio, 13(1), pp.e03510-21.
Richardson, J.P., Mogavero, S., Moyes, D.L., Blagojevic, M., Krüger, T.,
Verma, A.H., Coleman, B.M., De La Cruz Diaz, J., Schulz, D., Ponde, N.O.
and Carrano, G. 2018. Processing of Candida albicans Ece1p is critical for
candidalysin maturation and fungal virulence. MBio, 9(1), pp.e02178-17.
Richardson, J.P., Willems, H.M., Moyes, D.L., Shoaie, S., Barker, K.S., Tan,
S.L., Palmer, G.E., Hube, B., Naglik, J.R. and Peters, B.M. 2018.
Candidalysin drives epithelial signaling, neutrophil recruitment, and
immunopathology at the vaginal mucosa. Infection and immunity, 86(2),
pp.e00645-17.
Roberts, G.D. 1990. Laboratory methods in basic mycology. Bailly and Scott‘s
Diagnostic Microbiology. 9th ed. St Louis: CV Mosby Company Ltd,
pp.715-24.jm
Rodrigues, A.G., Pina-Vaz, C., Costa-de-Oliveira, S. and Tavares, C. 2003.

Expression of plasma coagulase among pathogenic Candida species. Journal
of Clinical Microbiology, 41(12), pp.5792-5793.
Rodríguez-Cerdeira C. Martínez-Herrera E, Carnero-Gregorio M, López-

Barcenas A, Fabbrocini G, Fida M, El-Samahy M and González-Cespón JL.
2020. Pathogenesis and clinical relevance of Candida biofilms in
vulvovaginal candidiasis. Front Microbiol., 11 (544480): 1-23.
Rogiers O, Frising UC, Kucharikova S, Jabra-Rizk MA, van Loo G, Van Dijck P,
Wullaert A. 2019. Candidalysin crucially contributes to Nlrp3 inflamma-
some activation by Candida albicans hyphae. mBio 10:e02221-18.
References 112
Rossney, A.S., English, L.F. and Keane, C.T. 1990. Coagulase testing compared
with commercial kits for routinely identifying Staphylococcus aureus.
Journal of clinical pathology, 43(3), pp.246-252.
Roy, U. and Kornitzer, D. 2019. Heme-iron acquisition in fungi. Current opinion

in microbiology, 52, pp.77-83.
Russell, C.M., Schaefer, K.G., Dixson, A., Gray, A.L., Pyron, R.J., Alves, D.S.,
Moore, N., Conley, E.A., Schuck, R.J., White, T.A. and Do, T.D. 2022. The
Candida albicans virulence factor candidalysin polymerizes in solution to
form membrane pores and damage epithelial cells. Elife, 11, p.e75490.
Sachin, C.D., Ruchi, K. and Santosh, S. 2012. In vitro evaluation of proteinase,

phospholipase and haemolysin activities of Candida species isolated from
clinical specimens. International journal of Medicine and Biomedical
research, 1(2), pp.153-157
Salvin SB. 1951. Hemolysin from the yeast-like phases of some pathogenic
fungi. Proc Soc Exp Biol. Med., 76: 852–854.
Salyers,A. A.; Witt, D. D. 1994 . Bacterial pathogenesis: A molecular

approach,.Washington, DC: ASM Press, pp. 47-62.
Samaranayake, L.P., Raeside, J.M. and MacFarlane, T.W. 1984. Factors

affecting the phospholipase activity of Candida species in vitro.
Sabouraudia: Journal of Medical and Veterinary Mycology, 22(3), pp.201-
207.
Samaranayake, Y. H., and Samaranayake, L. P. 1994. Candida krusei: biology,

epidemiology, pathogenicity and clinical manifestations of an emerging
pathogen. Journal of medical microbiology, 41(5), pp. 295-310.
Samaranayake, Y.H., Dassanayake, R.S., Cheung, B.P.K., Jayatilake, J.A.M.S.,

Yeung, K.W.S., Yau, J.Y.Y. and Samaranayake, L.P. 2006. Differential
phospholipase gene expression by Candida albicans in artificial media and
cultured human oral epithelium. Apmis, 114(12), pp.857-866.
Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Gel electrophoresis of DNA.
In Sambrook, J., Fritsch, E.F. and Maniatis, T. (Eds.) Molecular Cloning: a
References 113
Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, USA, chapter 6.
Sardi JCO, Scorzoni L, Bernardi T, Fusco-Almeida, AM and Mendes Giannini,

MJS. 2013. Candida species: current epidemiology, pathogenicity, biofilm
formation, natural antifungal products and new therapeutic options. J med
microbial., 62(1): 10-24.
Sav, H.; Altinbas, R.; Bestepe Dursun, Z. 2020. Fungal profile and antifungal
susceptibility pattern in patients with oral candidiasis. Infez. Med., 28,
pp.392–396.
Schaller, M., Borelli, C., Korting, H.C. and Hube, B. 2005. Hydrolytic enzymes
as virulence factors of Candida albicans. Mycoses, 48(6), pp.365-377.
Scorzoni, L., de Paula e Silva, A.C., Marcos, C.M., Assato, P.A., de Melo, W.C.,
de Oliveira, H.C., Costa-Orlandi, C.B., Mendes-Giannini, M.J. and Fusco-
Almeida, A.M. 2017. Antifungal therapy: new advances in the
understanding and treatment of mycosis. Frontiers in microbiology, 8, p.36.
Seth-Smith, H. M. B., Büchler, A. C., Hinic, V., Medinger, M., Widmer, A. F.,
and Egli, A. 2020. Bloodstream infection with Candida
kefyr/Kluyveromyces marxianus: case report and draft genome. Clinical
Microbiology and Infection, 26(4), pp.522-524.
Silva, S., Rodrigues, C. F., Araujo, D., Rodrigues, M. E., and Henriques, M.
2017. Candida Species Biofilms‘ Antifungal Resistance. J. Fungi (Basel) 3,
p. 8.
Singh, D. K., Németh, T., Papp, A., Tóth, R., Lukácsi, S.,Heidingsfeld, O., and
Gácser, A. 2019. Functional characterization of secreted aspartyl proteases
in Candida parapsilosis. Msphere, 4(4), pp. e00484-19.
Sobel, J.D., Kauffman, C.A., McKinsey, D., Zervos, M., Vazquez, J.A.,
Karchmer, A.W., Lee, J., Thomas, C., Panzer, H., Dismukes, W.E. and
National Institute of Allergy and Infectious Diseases (NIAID) Mycoses
Study Group. 2000. Candiduria: a randomized, double-blind study of
References 114
treatment with fluconazole and placebo. Clinical infectious diseases, 30(1),

pp.19-24.
Staib, F. 1966. Serum-proteins as nitrogen source for yeastlike fungi.

Sabouraudia: Journal of Medical and Veterinary Mycology, 4(3), pp.187-
193.
Su, S., Yan, H., Min, L., Wang, H., Chen, X., Shi, J., and Sun, S. 2022. The
antifungal activity of caspofungin in combination with antifungals or non-
antifungals against Candida species in vitro and in clinical therapy. Expert
Review of Anti-infective Therapy, 20(2), pp.161-178.
Sudhan, S. S., Sharma, P., Sharma, M., and Shrivastava, D. 2016. Identification
of Candida Species in the Clinical Laboratory: A review of conventional,
commercial and molecular techniques. Int J Med Res Prof, 2(6), pp.1-8.
Sullivan, D. J., Moran, G. P., and Coleman, D. C. 2017. Fungal Infections of

Humans. Fungi: Biology and Applications, p.251.
Talapko, J., Juzbašić, M., Matijević, T., Pustijanac, E., Bekić, S., Kotris, I., and
Škrlec, I. 2021. Candida albicans—the virulence factors and clinical
manifestations of infection. Journal of Fungi, 7(2), p79.
Talapko, J.; Škrlec, I. 2020. The Principles, Mechanisms, and Benefits of

Unconventional Agents in the Treatment of Biofilm Infection.
Pharmaceuticals, 13, p.299.
Tamo, S.P.B. 2020. Candida Infections: Clinical Features, Diagnosis and

Treatment‘, Infectious Diseases and Clinical Microbiology, 2(2), pp. 91–
102.
Tan, C. T., Xu, X., Qiao, Y., and Wang, Y. 2021. A peptidoglycan storm caused
by β-lactam antibiotic‘s action on host microbiota drives Candida albicans
infection. Nature communications, 12(1), p. 2560.
Tay, S.T., Abidin, I.A.Z., Hassan, H. and Ng, K.P. 2011. Proteinase,
phospholipase, biofilm forming abilities and antifungal susceptibilities of
Malaysian Candida isolates from blood cultures. Medical mycology, 49(5),
pp.556-560.
References 115
Timmermans, B., De Las Peñas, A., Castaño, I., and Van Dijck, P. 2018.
Adhesins in Candida glabrata. Journal of Fungi, 4(2), p. 60.
Tintelnot, K., Haase, G., Seibold, M., Bergmann, F., Staemmler, M., Franz, T.
and Naumann, D. 2000. Evaluation of phenotypic markers for selection and
identification of Candida dubliniensis. Journal of Clinical Microbiology,
38(4), pp.1599-1608.
Tsang, C. S. P., Chu, F. C. S., Leung, W. K., Jin, L. J., Samaranayake, L. P., and
Siu, S. C. 2007. Phospholipase, proteinase and haemolytic activities of
Candida albicans isolated from oral cavities of patients with type 2 diabetes
mellitus. Journal of medical microbiology, 56(10), pp. 1393-1398.
Tsui, C., Kong, E. F., & Jabra-Rizk, M. A. 2016. Pathogenesis of Candida

albicans biofilm. Pathogens and disease, 74(4).
Vadiraj, S., Nayak, R., Choudhary, G.K., Kudyar, N. and Spoorthi, B.R. 2013.
Periodontal pathogens and respiratory diseases-evaluating their potential
association: a clinical and microbiological study. The journal of
contemporary dental practice, 14(4), p.610.
Van Daele, R., Spriet, I., Wauters, J., Maertens, J., Mercier, T., Van Hecke, S.
and Brüggemann, R. 2019. Antifungal drugs: what brings the future?.
Medical Mycology, 57(Supplement_3), pp.S328-S343.
Vandepitte, J., Verhaegen, J., Engbaek, K., Piot, P., Heuck, C.C., Rohner, P. and
Heuck, C.C. 2003. Basic laboratory procedures in clinical bacteriology.
World Health Organization.
Vaňková, E., Kašparová, P., Dulíčková, N. and Čeřovský, V. 2020. Combined

effect of lasioglossin LL-III derivative with azoles against Candida albicans
virulence factors: biofilm formation, phospholipases, proteases and
hemolytic activity. FEMS Yeast Res., 20(3), pp. 1-16.
Vázquez‐González, D., Perusquía‐Ortiz, A. M., Hundeiker, M., and Bonifaz, A.

2013. Opportunistic yeast infections: candidiasis, cryptococcosis,
trichosporonosis and geotrichosis. JDDG: Journal der Deutschen
Dermatologischen Gesellschaft, 11(5), pp. 381-394.
References 116
Veen, M., Stahl, U. and Lang, C. 2003. Combined overexpression of genes of the
ergosterol biosynthetic pathway leads to accumulation of sterols in
Saccharomyces cerevisiae. FEMS yeast research, 4(1), pp.87-95.
Walker, K., Skelton, H. and Smith, K. 2002. Cutaneous lesions showing giant
yeast forms of Blastomyces dermatitidis. Journal of cutaneous pathology,
29(10), pp.616-618.
Wang, E., Farmakiotis, D., Yang, D., McCue, D.A., Kantarjian, H.M.,
Kontoyiannis, D.P. and Mathisen, M.S. 2015. The ever-evolving landscape
of candidaemia in patients with acute leukaemia: non-susceptibility to
caspofungin and multidrug resistance are associated with increased
mortality. Journal of Antimicrobial Chemotherapy, 70(8), pp.2362-2368.
White, P.L., Barton, R., Guiver, M., Linton, C.J., Wilson, S., Smith, M., Gomez,
B.L., Carr, M.J., Kimmitt, P.T., Seaton, S. and Rajakumar, K. 2006. A
consensus on fungal polymerase chain reaction diagnosis: a United
Kingdom-Ireland evaluation of polymerase chain reaction methods for
detection of systemic fungal infections. The Journal of Molecular
Diagnostics, 8(3), pp.376-384.
WHO identifies life-threatening fungal pathogens Oct 25. 2022.

https://www.cidrap.umn.edu/news-perspective/2022/10/who-identifies-life-
threatening-fungal-pathogens
WHO releases first-ever list of health-threatening fungi, 25 October

.2022. Departmental news: https://www.who.int/news/item/25-10-2022-
who-releases-first-ever-list-of-health-threatening-fungi
Willems, H.M., Lowes, D.J., Barker, K.S., Palmer, G.E. and Peters, B.M. 2018.
Comparative analysis of the capacity of the Candida species to elicit vaginal
immunopathology. Infection and immunity, 86(12), pp.e00527-18.
Wu, T., Samaranayake, L.P., Cao, B.Y. and Wang, J. 1996. In-vitro proteinase
production by oral Candida albicans isolates from individuals with and
without HIV infection and its attenuation by antimycotic agents. Journal of
medical microbiology, 44(4), pp.311-316.
References 117
Yasu, T., Konuma, T., Kuroda, S., Takahashi, S. and Tojo, A. 2018. Effect of
cumulative intravenous voriconazole dose on renal function in
hematological patients. Antimicrobial Agents and Chemotherapy, 62(9),
pp.e00507-18.
Yigit, N., Aktas, A.E. and Ayyildiz, A. 2008. Detection of coagulase activity in
pathogenic Candida species. Journal of International Medical Research,
36(6), pp.1378-1382.
Ying, S. and Chunyang, L. 2012. Correlation between phospholipase of Candida

albicans and resistance to fluconazole. Mycoses, 55(1), pp.50-55.
Zhai, L., Zhou, Y., Wu, Y., Jin, Y., Zhu, Q., Gao, S., and Tian, K. 2021. Isolation
and identification of Candida tropicalis in sows with fatal infection: a case
report. BMC veterinary research, 17(1), pp. 1-4.
Zhang, L., Zhou, S., Pan, A., Li, J. and Liu, B., 2015. Surveillance of antifungal
susceptibilities in clinical isolates of Candida species at 36 hospitals in
China from 2009 to 2013. International Journal of Infectious Diseases, 33,
pp.1-4.
Zhang, Y., Muend, S., and Rao, R. 2012. Dysregulation of ion homeostasis by
antifungal agents. Front. Microbiol. 3, p.133.
Zhao, Y., Lee, M.H., Paderu, P., Lee, A., Jimenez-Ortigosa, C., Park, S.,
Mansbach, R.S., Shaw, K.J. and Perlin, D.S. 2018. Significantly improved
pharmacokinetics enhances in vivo efficacy of APX001 against
echinocandin-and multidrug-resistant Candida isolates in a mouse model of
invasive candidiasis. Antimicrobial agents and chemotherapy, 62(10),
pp.e00425-18.
Appendix
Appendix
Table (1): showing the Biofilm production C.albicans strain
Biofilm Formation
No.ofstrains R1 R2 R3
1 0.215 0.303 0.184
2 0.375 0.295 0.209
3 0.266 0.131 0.274
4 0.503 0.356 0.225
5 0.264 0.151 0.190
6 0.187 0.115 0.144
7 0.093 0.169 0.151
8 0.172 0.093 0.147
9 0.508 0.317 0.184
10 0.737 0.288 0.164
11 0.493 0.388 0.222
12 0.215 0.379 0.215
13 0.136 0.276 0.263
14 0.346 0.156 0.134
15 0.143 0.169 0.106
16 0.245 0.085 0.157
17 0.538 0.283 0.128
18 0.376 0.320 0.100

Appendix
19 0.328 0.333 0.174
20 0.191 0.445 0.275
21 0.252 0.330 0.184
22 0.214 0.169 0.122
23 0.211 0.078 0.148
24 0.350 0.084 0.137
25 0.408 0.349 0.132
26 0.192 0.333 0.171
27 0.495 0.335 0.196
28 0.368 0.388 0.126
29 0.242 0.356 0.225
30 0.175 0.111 0.281
31 0.163 0.316 0.174
32 0.269 0.295 0.209
33 0.321 0.172 0.323
34 0.350 0.388 0.222
35 0.311 0.291 0.160
36 0.522 0.180 0.56
37 0.278 0.398 0.275
38 0.284 0.324 0.163
39 0.221 0.086 0.087
40 0.284 0.093 0.100

Appendix
41 0.499 0.443 0.221
42 0.254 0.364 0.198
43 0.548 0.121 0.190
44 0.628 0.236 0.290
45 0.214 0.381 0.224
46 0.152 0.112 0.150
47 0.238 0.197 0.193
48 0.219 0.134 0.200
49 0.532 0.480 0.308
50 0.199 0.295 0.160
51 0.230 0.263 0.158
52 0.265 0.157 0.184
53 1.235 0.282 0.188
54 0.249 0.155 0.177
55 0.243 0.397 0.087
56 0.428 0.322 0.211
57 0.284 0.487 0.185
58 0.292 0.296 0.178
59 0.257 0.115 0.119
60 0.278 0.191 0.214
61 0.474 0.488 0.245
62 0.173 0.108 0.149

Appendix
63 0.063 0.100 0.099
64 0.066 0.150 0.071
65 0.030 0.033 0.35
66 0.050 0.033 0.45
67 0.091 0.100 0.105
68 0.040 0.065 0.055
69 0.115 0.101 0.111
70 0.098 0.120 0.080
control 0.050 0.033 0.045
Bankit 2667133 Ca 7 OQ343341

1->H221108-013_M03_S7_SF.ab1 408
CTGCGTCTCAGAGAGTGGAGCTAATGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATT
GTTGCTCGTGTTGCCACTGGTGTTCAACAATCTATTGAAAATGCCAAGAGAGATGGCGTTCCAGACGTTG
GTCTTAATCTTGTTGCTAACGCTCCAAGACTTTTCTCTGATGTTTTTGATGGTGTCCTGGAAACTGTTAAGC
AAGCTAAAAGAGAAGGTATTGAAGATGTTCTTGAAGAACTTCTTCAAAAACTCCCAGAACTCATTACTAG
ATCAGCAGAGTCTAATTTGAAAGACAGTCAACCAGTTAAAAGAGATGCCGGCTCAGTAGCACTTAGCAA
TTTAATCAAAAAGAGTATTGAAACTGTCGGTATTGAAAGTGCTGCTCATGGTTTTTCAGATAA
Appendix
Banlit 2667133 Ca 10 OQ 343342

2->H221108-013_O03_S10_SF.ab1 408
CTGGCTTTCTACAAGAGAGTGGAGCTAATGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATTGT
TGCTCGTGTTGCCACTGGTGTTCAACAATCTATTGAAAATGCCAAGAGAGATGGCGTTCCAGACGTTGGT
CTTAATCTTGTTGCTAACGCTCCAAGACTTTTCTCTGATGTTTTTGATGGTGTCCTGGAAACTGTTAAGCAA
GCTAAAAGAGAAGGTATTGAAGATGTTCTTGAAGAACTTCTTCAAAAACTCCCAGAACTCATTACTAGAT
CAGCAGAGTCTAATTTGAAAGACAGTCAACCAGTTAAAAGAGATGCCGGCTCAGTAGCACTTAGCAATTT
AATCAAAAAGAGTATTGAAACTGTCGGTATTGAAAGTGCTGCTCAATGGTTTCAGA
Bankit 2667133 Ca 14 OQ 343343

3->H221108-013_A05_S14_SF.ab1 408
CTTGCTACCAGAGAGTGGAGTTAACGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATTGTTGCT
CGTGTTGCCACTGGTGTTCAACAATCTGTCGAAAATGCCAAGAGAGATGGCGTTCCAGACATTGGTCTTA
ATCTTGTTGCTAATGCTCCAAGACTTTTCTCTGACGTTTTTGATGGCGTCCTGGAAACTGTTCAACAAGCT
AAGAGAGATGGTATTGAAGATGCTCTTAATGAACTTCTTGAGCAACTCCCAAAACTTATTACTAGATCGG
CTGAATCTGCTTTGAAAGACAGTCAACCAGTTAAAAGAGATGCCGGCTCAGTAGCACTTAGCAATTTAAT
TAAAAAGAGTATTGAAACTGTCGGTGTTGAAAATGCTGCTCAATGGTTTCAAAAAGT
Bankit 22667133 Ca 17 OQ 343344

4->H221108-013_C05_S17_SF.ab1 410
CGCTCTCAGAGAGTGGAGCTAATGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATTGTTGCTCG
TGTTGCCACTGGTGTTCAACAATCTGTCGAAAATGCCAAGAGAGATGGCGTTCCAGACATTGGTCTTAAT
CTTGTTGCTAATGCTCCAAGACTTTTCTCTGACGTTTTTGATGGCGTCCTGGAAACTGTTCAACAAGCTAA
GAGAGATGGTCTTGAAGATGTTCTTCAACAACTCCTTGATCAACTCCCACAACTCATTGCTAGATCAGCTG
AATCTGCTTTGAAAGACAGTCAACCAGTTAAAAGAGATGCTGGCTCAGTAGCACTTAGCAATTTAATCAA
AAAGAGTATTGAAACTGTCGGTATTGAAAATGCTGCTCAATGATTTTAAAAAAATCGA
‫المستخلص‬
‫اىٖذف اىشئ‪ٞ‬س‪ٕ ٍِ ٜ‬زٓ اىذساسخ ٕ٘ اىزؾقق ٍِ اّزشبس ثعط ع٘اٍلو اىعلشاٗح اىزل‪ٜ‬‬
‫ٗاىف٘سلللللف٘ى‪ٞ‬ج‪ٞ‬ض‬ ‫رشلللللَو رنللللل٘‪ ِٝ‬األغشللللل‪ٞ‬خ اىؾ‪ٝ٘ٞ‬لللللخ )‪ٗ ،(Biofilm‬اىجشٗر‪ْٞٞ‬لللللض )‪)Proteinase‬‬
‫)‪ٗ (Phospholipase‬اىلزغيػ (‪ٗ ، (Coagulase‬إّزلبط اىٖ‪َ٘ٞ‬ال‪ٝ‬سل‪ٗ ،) Hymolysine)ِٞ‬اّزشلبس‬
‫ع‪ Candidalysin ECE1 ِٞ‬ث‪ ِٞ‬عضالد ‪C. albicans‬‬
‫ف‪ ٜ‬اىذساسخ اىؾبى‪ٞ‬خ شَيذ ‪ 280‬ع‪ْٞ‬خ (ٍسؾخ)‪ .‬رٌ عَعٖب خاله فزشح ‪ 3‬اشلٖش ٍلِ ا‪ٝ‬لبس‬
‫‪ 2022‬اىل‪ ٚ‬اة ‪ 2022‬ىَشظلل‪ ٚ‬علشاي‪ٍ ِٞٞ‬خزيفلل‪ ِٞ‬فلل‪ ٜ‬االعْلبط ٗاالعَللبس غ‪ٞ‬لش ٍنللشس‪ٍ ِٝ‬صللبث‪ِٞ‬‬
‫ٗاخللش‪ٝ ِٝ‬ش لزجٔ ثبصللبثزٌٖ ث لبٍشاض اىغٖللبص اىزْفسلل‪ٗ ٜ‬داء اىَج‪ٞ‬عللبد اىفَلل٘‪ ٛ‬فلل‪ٍ ٜ‬سزشللف‪ٞ‬بد ثغللذاد‬
‫(ٍسزشف‪ٍ ٚ‬ذ‪ ْٔٝ‬اىطت ٗ ٍسزشف‪ ٚ‬اى‪ٞ‬شٍ٘ك اىزعي‪ٍٗ َٜٞ‬سزشلف‪ٍ ٚ‬ذ‪ْٝ‬لٔ االٍلبٍ‪ ِٞ‬اىطج‪ٞ‬لخ اىزعي‪َٞٞ‬لخ) رلٌ‬
‫صساعللخ اىع‪ْٞ‬للبد اىزلل‪ ٜ‬رللٌ عَعٖللب عيلل‪ٗ ٚ‬سللػ امللبس اىسللبثشٗ‪ٝ‬ذ دمسللزشٗص (‪ٍ )SDA‬عللبف اى‪ٞ‬للٔ‬
‫مي٘ساٍف‪ْٞٞ‬ن٘ه مَعبد ىيجنز‪ٞ‬ش‪ٝ‬ب ثزشم‪ٞ‬ض ‪ٍ 0.5‬يغٌ ‪ /‬ىزش ‪ٗ ،‬رٌ رؾعل‪ ِٞ‬اغجلب ‪SDA‬عْلذ ‪ 37‬دسعلخ‬
‫ٍئ٘‪ٝ‬خ ىَذح رزشاٗػ ث‪ 48-24 ِٞ‬سبعخ‪.‬‬
‫أظٖشد ّزبئظ اىفؾ٘صبد ف‪ٕ ٜ‬زٓ اىذساسخ أُ عَ‪ٞ‬ل علضالد اىَج‪ٞ‬علبد اىج‪ٞ‬علبء يلبدسح‬
‫عيلل‪ ٚ‬رنلل٘‪ ِٝ‬أالّجلل٘ة اىغشصللٍ٘‪ٗ ٜ‬االثلل٘ا اىنالٍ‪ٞ‬ذ‪ٝ‬للخ اٍللب األّلل٘ا األخللش‪ ٙ‬فيللٌ رْللزظ أ‪ًٝ‬للب ٍَْٖللب‪ ،‬مَللب‬
‫اظٖشد ّزبئظ اىضس ٍِ ‪ 102‬ع‪ْٞ‬خ ٍ٘عجخ ٍِ اصو ‪ 280‬اُ ‪ )%57.84( 59‬مبّذ أّلبس ث‪َْٞ‬لب ‪43‬‬
‫(‪ )%42.16‬رم٘س رشَو ‪ ٍِ )%56.86( 58‬رغ٘‪ٝ‬ف اىفٌ ٗ ‪ٍ )%43.14( 44‬لِ اىغٖلبص اىزْفسل‪، ٜ‬‬
‫ث‪َْٞ‬ب ‪ٍْٖ 178‬ب مبّذ سبىجخ ‪ ،‬رٌ اىنشف علِ علضالد اىَج‪ٞ‬علبد اىج‪ٞ‬علبء ثبسلزعَبه اىطلش اىزقي‪ٞ‬ذ‪ٝ‬لخ‬
‫ٗاىز‪ ٜ‬رشَو (اىفؾص اىَظٖش‪ٗ ٛ‬اىَغٖش‪ ،ٛ‬اىَْ٘ عي‪ٗ ٚ‬سػ ‪ ، Chrome Candida‬إّزبط األّج٘ة‬
‫اىغشصٍ٘‪ ، Germ tube ٜ‬رنل٘‪ ِٝ‬االثل٘ا اىنالٍ‪ٞ‬ذ‪ٝ‬لٔ ‪ٗ Clamydospore‬رلٌ ركم‪ٞ‬لذ ّزلبئظ اىزعش‪ٝ‬لف‬
‫ثبسللزعَبه ّظللبً ‪ VITEK-2‬مبّللذ اىَظللبٕش اىَظٖش‪ٝ‬للخ ىَسللزعَشاد ‪ C. albicans‬عيلل‪SDA ٚ‬‬
‫ث‪ٞ‬عللبء إىلل‪ ٚ‬مش‪َٞٝ‬للخ ّبعَللخ ‪ٍ ،‬يسللبء ‪ ،‬رشللجٔ اىخَ‪ٞ‬للشح ‪ ،‬رؾللذ اىفؾللص اىَغٖللش‪ ، ٛ‬مللبُ شللنو خال‪ٝ‬للب‬
‫خَ‪ٞ‬شح اىَج‪ٞ‬عبد مشٗ‪ًٝ‬ب إى‪ ٚ‬ث‪ٞ‬عبٗ‪ٗ ٍ ، ٛ‬ع٘د ثشاعٌ ‪ٗ ،‬أمجش ثنض‪ٞ‬ش ٍِ اىخال‪ٝ‬ب اىجنز‪ٞ‬ش‪ٝ‬خ‪ .‬أظٖشد‬
‫ّزبئظ اىفؾ٘صبد ف‪ٕ ٜ‬زٓ اىذساسخ أُ عَ‪ ٞ‬عضالد ‪ C. albicans‬مبّذ ٍْزغلخ ىالّجل٘ة اىغشصلٍ٘‪ٜ‬‬
‫ٗاالثلللللللللللل٘ا اىنالٍ‪ٞ‬ذ‪ٝ‬للللللللللللخ أٍللللللللللللب األّلللللللللللل٘ا األخللللللللللللش‪ ٙ‬فيللللللللللللٌ رْللللللللللللزظ أ‪ًٝ‬للللللللللللب ٍَْٖللللللللللللب‪.‬‬
‫ث‪ْٞ‬للذ اىْزللبئظ اُ ٍللِ ثلل‪ 102 ِٞ‬عضىللخ مبّللذ ‪ٕ C. albicans‬لل‪ ٜ‬االمضللش شلل‪٘ٞ‬عب ثلل‪ ِٞ‬االّلل٘ا ثْسللجخ‬
‫‪ (% 68.63)70‬صٌ ريزٖب ‪ C. tropicalis‬ثْسجخ ‪ (%10.78)11‬صٌ ‪C.ٗ C. krusei ( %5.88)6‬‬
‫‪ C. parapsilosis (% 4.9)5 kyfer (%5.88)6‬ث‪َْٞ‬ب مبّذ ‪ٗ C. glabrata (% 3.9) 4‬رَضلو‬
‫اىْسللجخ االيللو ثلل‪ ِٞ‬االّلل٘ا رللٌ فؾللص يبثي‪ٞ‬للخ عللضالد اىَج‪ٞ‬عللبد ىألدٗ‪ٝ‬للخ اىَعللبدح ىيفطش‪ٝ‬للبد ثطش‪ٝ‬قللخ‬
‫‪ٗ ،‬اىزل‪ ٜ‬أعش‪ٝ‬لذ عيل‪ ٚ‬اىْؾل٘ اىَ٘صل‪ ٚ‬ثلٔ فل‪ٗ ٜ‬ص‪ٞ‬قلخ ‪ (CLSI) M44-A.‬أظٖلشد‬ ‫اّزشلبس اىقلش‬
‫اىعللضالد دسعللخ عبى‪ٞ‬للخ ٍللِ اىؾسبسلل‪ٞ‬خ ىألٍف٘رش‪ٝ‬سلل‪-ِٞ‬ة )‪ٗ (%93.14‬مي٘رش‪َٝ‬للبصٗه )‪(%90.20‬‬
‫ّٗ‪ٞ‬سزبر‪ (%85.92) ِٞ‬ث‪َْٞ‬ب مبّذ علضالد اىنبّذ‪ٝ‬لذا رَزيلل ٍقبٍٗلخ ثْسلجخ (‪ )% 42.86‬ىنلو ٍلِ‬
‫ف٘س‪ٝ‬نّ٘بصٗه ٗ م‪ٞ‬ز٘مّ٘بصٗه ‪.‬‬
‫ٗيذ مبّذ ّز‪ٞ‬غخ رن٘‪ ِٝ‬األغش‪ٞ‬خ اىؾ‪ٝ٘ٞ‬خ ثبسزخذاً غش‪ٝ‬قخ اىصفبئؼ اىذي‪ٞ‬قخ ‪ ٍِ %48.57‬علضالد ‪C.‬‬
‫‪ albicans‬مبّذ ٍْزغخ ي٘‪ٝ‬خ ىألغش‪ٞ‬خ اىؾ‪ٝ٘ٞ‬لخ ‪ % 40 ٗ ،‬مبّلذ ٍز٘سلطخ االّزلبط ىيغشلبء اىؾ‪ٞ‬ل٘‪، ٛ‬‬
‫ث‪َْٞ‬ب ‪ % 4.29‬غ‪ٞ‬ش ٍْزغخ ىيغشبء اىؾ‪ٗ ٛ٘ٞ‬مبّذ ٕزٓ اىْزبئظ ٍزطبثقخ ٍ ّزبئظ اخزجبس األّج٘ة‪.‬‬
‫‪ 20‬عضىللخ (‪ )%28.57‬ىللذ‪ٖٝ‬ب اىقللذسح اىق٘‪ٝ‬للٔ عيلل‪ ٚ‬اّؾللاله اىللذً ث‪َْٞ‬للب‪ %51.43‬مبّللذ‬

‫ٍز٘سللطٔ‪ . .‬أظٖللشد عللضالد ‪ّ C. albicans‬شللبغب ٍزفبٗرللب فلل‪ ٜ‬اّزللبط اىجشٗر‪ْٞ‬للبص‪ ،‬ؽ‪ٞ‬للش أظٖللشد‬
‫عضالرٖب ثْسلجخ ‪ّ % 42.86‬شلبغ يل٘‪ٍ ٪4.86 ٗ ٛ‬لِ اىعلضالد ظلع‪ٞ‬فخ االّزلبط اىجشٗر‪ْٞ‬ل‪ ،ٜ‬أظٖلشد‬
‫عضالد ‪ّ C. albicans‬شبغ ف٘سلف٘ى‪ٞ‬جض ٍزْل٘ ‪ %64.29 ،‬ملبُ ىلذ‪ٖٝ‬ب ّشلبغًب ي٘‪ًٝ‬لب ٗ ‪ %7.14‬ملبُ‬
‫ىذ‪ٖٝ‬ب ّشبغًب ظلع‪ٞ‬فًب‪ .‬مبّلذ اىْسلجخ اىَئ٘‪ٝ‬لخ ىإلّزلبط اإل‪ٝ‬غلبث‪ ٜ‬ىلزغيػ اىلذً فل‪ ٜ‬علضالد ‪C. albicans‬‬
‫‪ %84.29‬ث‪َْٞ‬ب مبّذ ‪ %15.71‬سبىجخ ف‪ ٜ‬اإلّزبط‪.‬‬
‫رٌ فؾص اّزشبس ع‪ ECE1 ِٞ‬ث‪ 70 ِٞ‬عضىخ ٍِ عضالد اىَج‪ٞ‬عبد اىج‪ٞ‬عبء ثبسزخذاً رقْ‪ٞ‬خ رفبعو‬
‫اىجيَشح اىَزسيسو (‪ٗ ، )PCR‬أظٖش اىنشف اىغض‪ٝ‬ئ‪ ٜ‬ىغ‪ ECE1 ِٞ‬ث‪ 70 ِٞ‬عضىخ ٍِ عضالد‬
‫اىَج‪ٞ‬عبد اىج‪ٞ‬عبء اىز‪ ٜ‬رٌ عَعٖب أُ ْٕبك ‪ )%60( 15‬عضىخ رٌ عَعٖب ٍِ رغ٘‪ٝ‬ف فٌ اىزم٘س‬
‫ٍ٘عجًب ىيغ‪ ٍِ )%37.5( 6 ٗ ECE1 ِٞ‬اىغٖبص اىزْفس‪ ٜ‬عي‪ ٚ‬اىز٘اى‪ ، ٜ‬ث‪َْٞ‬ب مبّذ ‪ٍِ )٪40( 10‬‬
‫اىعضالد اىز‪ ٜ‬عَعذ ٍِ رغ٘‪ٝ‬ف اىفٌ ىإلّبس ٍ٘عجخ ىيغ‪ ِٞ‬اىَسزٖذف ٗأ‪ٝ‬عب ‪ٍِ )٪62.5( 10 ،‬‬
‫اىغ‪.ِٞ‬‬ ‫ٕزا‬ ‫عي‪ٚ‬‬ ‫رؾز٘‪ٛ‬‬ ‫مبّذ‬ ‫ىإلّبس‬ ‫اىزْفس‪ٜ‬‬ ‫اىغٖبص‬
‫الشكر واالمتنان‬
‫اٗال ٗيجو مو ش‪ٜ‬ء اىؾَذ ٗاىشنش هلل رعبى‪ ٚ‬عي‪ ٚ‬مضشح اىجشمبد غ٘اه عَي‪ٜ‬‬
‫‪.‬اىجؾض‪ ٜ‬السزنَبه اىجؾش ثْغبػ ى‪ٞ‬نُ٘ ٍف‪ٞ‬ذا ىخذٍخ ٗغْْب اىغبى‪ ٜ‬اىعشا‬
‫أٗد أُ أعجش عِ اٍزْبّ‪ ٜ‬اىعَ‪ٞ‬ق ٗاىصبد ٗشنش‪ ٛ‬ىَششف‪ ٜ‬اىَ٘يش األستار‬
‫المساعذ الذكتىر صفاء الذَه أحمذ القُسٍ ‪،‬اىز‪ ٛ‬عيَْ‪ٍْٖ ٜ‬غ‪ٞ‬خ إعشاء‬
‫اىجؾش ٗرقذ‪ ٌٝ‬أعَبه اىجؾش ثكٗظؼ ص٘سح ٍَنْخ ‪ ،‬مبُ ششف مج‪ٞ‬ش ى‪ ٜ‬أُ‬
‫أعَو ثبششافٔ‬
‫مَب أٗد أُ أيذً اىشنش إى‪ ٚ‬عَ‪ٞ‬ذح اىني‪ٞ‬خ األستارة الذكتىرة سمُرة واجٍ كاظم‬
‫ٗا‪ٝ‬عب اى‪ ٚ‬يسٌ عيً٘ اىؾ‪ٞ‬بح مبفخ‪.‬‬
‫أيذً اىشنش إى‪ ٚ‬األستار الذكتىر محسه هاشم رسه‬
‫عي‪ ٚ‬مو اىَسبعذح اصْبء فزشٓ دساسز‪ٜ‬‬
‫ٗمزىل خبىص شنش‪ٗ ٛ‬رقذ‪ٝ‬ش‪ ٛ‬لألستار المساعذ الذكتىر أحمذ عبذ الجبار‬
‫سلُمان واالستارة الذكتىرة ماجذة هادٌ مهذٌ عي‪ ٚ‬رقذ‪ ٌٝ‬اىَش٘سح اىعيَ‪ٞ‬خ‬
‫اىق‪َٞ‬خ ى‪ٜ‬‬
‫ٗؽج‪ ٜ‬ىعبئيز‪ ٜ‬إلسشبدٌٕ ٗدعٌَٖ اىالٍزْبٕ‪ٜ‬‬ ‫ٗأٗد أُ أعجش عِ اٍزْبّ‪ ٜ‬اىخب‬
‫أٗد أُ أعجش عِ خبىص اٍزْبّ‪ ٜ‬ىصذ‪ٝ‬قبر‪ ٜ‬وىر الهذي ‪ ،‬سالٍ خضُر‬
‫ٗخزبٍب ً شنش ٗرقذ‪ٝ‬ش ىنو ٍِ اسٌٖ ف‪ ٜ‬دعٌ ٕزا اىجؾش‪ ٍِٗ ...‬دعب ى‪ ٜ‬ثذع٘ح‬
‫صبديخ عضإٌ هللا عْ‪ ٜ‬مو خ‪ٞ‬ش عضاء اىَؾسْ‪ٜ‬‬
‫سكينه‬
‫االهداء‬
‫إى‪ ٚ‬هللا اىقذ‪ٝ‬ش عي‪ ٚ‬اىٖذا‪ٝ‬خ ٗاىق٘ح ٗاىؾَب‪ٝ‬خ ٗاىَٖبساد ٗإعطبئْب اىصؾٔ‬
‫إى‪ ٚ‬صبؽت اىشرجخ اىعبى‪ٞ‬خ اىز‪ ٛ‬ششفْ‪ ٜ‬ثؾَو اسَٔ‪ ...‬والذٌ العزَز‬
‫إى‪ّ٘ ٚ‬س ع‪ٍ ، ْٜٞ‬ؤّسخ سٗؽ‪ ، ٜ‬اى‪ ٚ‬س‪ٞ‬ذح اىقيت ٗاىؾ‪ٞ‬بح ‪ ،‬أمٍ ‪ ،‬ثم أمٍ ‪ ،‬ثم‬
‫أمٍ ‪ ٍِ ،‬أعو ؽجٖب ‪ٗ ،‬دعبئٖب ‪ٗ ،‬عْب‪ٝ‬زٖب ‪ٗ ،‬رعؾ‪ٞ‬برٖب ٍِ أعو رضق‪ٞ‬ف‪ٜ‬‬
‫ٗرٖ‪ٞ‬ئز‪ ٜ‬ىيَسزقجو ٗاىز‪ ٜ‬سافقزْ‪ ٜ‬صالرٖب ٗالسزَشاسٕب ف‪ ٜ‬رقذ‪ ٌٝ‬اىذعٌ‬
‫اىَعْ٘‪ٗ ٛ‬اىشٗؽ‪ٗ ٜ‬اىعبغف‪ٗ ٜ‬اىَبى‪ٜ‬‬
‫إى‪ ٚ‬سٗػ صَ‪ْٞ‬خ رٕجذ إى‪ ٚ‬ثبسئٖب اىز‪ ٛ‬أفزقذٓ ٍِ مو ييج‪ ٜ‬إى‪ ٚ‬اىذسح اىز‪ ٜ‬أّبسد‬
‫غش‪ٝ‬ق‪ ٜ‬ثنو فخش ٗاعزضاص إى‪ ٚ‬أخ‪ ٜ‬اىشٖ‪ٞ‬ذ اىجطو حُذر رشُذ‬
‫إلً إخىتٍ اىشائع‪ ِٞ‬األعضاء‬
‫إى‪ ٚ‬مو ٍِ سبّذّ‪ٗ ٜ‬مبُ ىٔ دٗس ٍِ يش‪ٝ‬ت أٗ ثع‪ٞ‬ذ ف‪ ٜ‬اسزنَبه ٕزٓ‬

‫األغشٗؽخ‬
‫إى‪ ٚ‬سٗاد اىعيٌ ٗغالثٔ‬
‫سكينه‬
‫س َّما أ ُ ْخف َِي لَ ُهم من قُ َّر ِة أَ ْع ُي ٍن َج َزاء ِب َما َكا ُنوا‬
‫َفال َت ْعلَ ُم َن ْف ٌ‬
‫َي ْع َملُونَ‬
‫سوره السجدة – اآلية ‪11‬‬

‫جمهوريه العراق‬
‫وزارة التعليم العالي والبحث العلمي‬
‫جامعة بغداد‬
‫كلية العلوم للبنات‬
‫قسم علوم حياة‬
‫انتشار جين ‪ Candidalysin ECE1‬بين خميرة‬

‫المبيضات المعزولة من القناة التنفسية والتجويف الفمي‬
‫في المرضى العراقيين‬
‫رساله‬
‫مقدمة الى مجلس كلية العلوم للبنات ‪ /‬جامعة بغداد وهي جزء من متطلبات نيل درجة‬
‫ماجستير في علوم الحياة‪/‬علم األحياء المجهرية‬
‫تقدم بها‬
‫سكينه رشيد مجيد دخان‬
‫بأشراف‬
‫ا‪.‬م‪.‬د‪ .‬صفاء الدين احمد شنتر القيسي‬
‫‪2023‬م‬ ‫‪1444‬هـ‬

فطريات بشكل عام

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

فطريات بشكل عام

Uploaded by

Copyright:

Available Formats

Republic of Iraq

Ministry of Higher Education and

Prevalence of Candidalysin ECE1Gene

Submitted to the Council of College of Science for Women

2023 A.D. 1444 A.H.

‫سىره السجذة ‪ -‬اَِت ‪71‬‬

I certify that this thesis entitled (Prevalence of Candidalysin ECE1

Asst. Prof. Dr. Safaa Al-Deen Ahmed Al-Qaysi

In view of the available recommendation, I forward this thesis to debate by

Assist. Prof. Dr. Mushtak Faraj Karomi

Head of the department

Chairman of higher studies committee

Title: Professor Title: Professor

Date: Date: / / 2023 Date: / / 2023

Title: Lecturer Title: Assistant Professor

Date: / / 2023 Date: / / 2023

Member Member (supervisor)

Approved by the Council of the C ollege of Science for women / University of

Name and title: professor. Dr. Samira Naji Kadhim,

Dean of the college of Science for Women

To the high-ranking one who honored me with his name... my dear

To my dear wonderful brothers

To everyone who supported me and had a role from near or far in

To the pioneers of science and its students .

I would like to express my deep and sincere gratitude and thanks to my

As well as my sincere thanks and appreciation to Dr. Ahmed Abdul Jabbar

I would like to express my sincere gratitude to my friends, Noorulhuda

Finally, thanks and appreciation to everyone who contributed to the support

2.8.5 Biofilm Formation of C. albicans 23

3.2.1.1 Sabouraud Dextrose Agar (SDA) 39

3.2.2.3 Ethidium Bromide 43

3.2.10.5 The Casting of The Agarose Gel 58

2-1 C. albicans (Candidiasis,Online site.,2022) 16

2-3 Biofilm formation 24

(3-3) Solution used through the study 36

(3-4) Kits used in this study 36

(3-5) Antifungal agents employed in this work 37

(3-6) Culture media used during this current study 37

(3-7) Stains used in the current study 38

(3-9) Zone interpretation for fungi in millimeter. 50

(3-12) PCR Primers used in this study for amplification of ECE1 59

(3-13) Reaction components for amplification of ECE1 gene in 59

(3-14) The optimum conditions of PCR technique used in the 60

(4-1) Distribution of clinical Candida spp isolated from 64

KOH Potassium Hydroxide

Fungi are make up approximately 7% of all eukaryotic organisms

Yeasts are eukaryotic microorganisms classified in the kingdom of

additional virulence factors, such as adhesions, invasions, metal acquisition

changes, decreased saliva secretion, and difficulty swallowing, but it can

1.2. Aims of the Current Study:

1- Determining some the virulent factors among the isolated C. albicans

2.1. Fungal Pathogens

Humans are affected by a pathogenic fungus, although superficial

Yeasts are eukaryotic microorganisms classified in the kingdom

albicans continues to be the most prevalent, counting to 50-90% of the

2.3. Classification of Candida

Candidiasis is an infection caused by a yeast species of the genus

About 20 species are known to cause infections in humans (Moris et al.,

The word "Candida" is derived from the Latin word "'candid,"

Table (2-1) Candida species commonly isolated in clinical settings

Disseminated Candidiasis, It can also be called invasive or

Diagnosis of C. albicans, the diagnosis of candidiasis depends on

Morphological Identification, the identification of the germ that

Molecular identification In order to overcome the limitations of