Professional Documents
Culture Documents
فطريات بشكل عام
فطريات بشكل عام
A Thesis
By
Sukayna Rasheed Majeed
Supervised by
Asst. Prof. Dr. Safaa Al-Deen Ahmed Al-Qaysi
Signature
/ /2023
Signature
/ /2023
Committees Certification
We, the members of the examining committee, certify that we have read this thesis
and have examined the student in its contents and that, according to our opinion, is
accepted as a thesis for the degree of Master in Biology/Microbiology.
Signature: Signature:
Name: Dr. Mohsen Hashem Risan Name: Dr. Thamer Abd Al_Shaheed Muhsen
Chairman Member
Signature: Signature:
Name: Teeba Hashim Mohammad Name: Dr. Safaa Al-Deen Ahmed Al-Qaysi
Signature:
Date: / / 2023
To the Almighty ALLAH for the guidance, Strength, Power,
Protection, Skills, and for his giving us a healthy life.
To the light of my eyes, the sociable my soul, and the joy of my life
My mother, then my mother, then my mother, for her love, prayer,
caring, sacrifices for educating and preparing me for future and
whose prayers accompanied me and for continues provide their
moral, spiritual, emotional, and financial support
To a precious soul that gone to its lord to whom I miss him with all my
heart To Dora, who enlightened my path with pride and honor, to my
brother, the heroic martyr Haider Rasheed
Sokayna
Acknowledgments
First and foremost, praises and thanks to ALLAH, the almighty, for his
showers of blessings throughout my research work to complete the research
successfully to be useful for the service of our dear country, Iraq
I would also like to extend my thanks to the Dean of the College, Prof. Dr.
Samira Naji Kadhim, and to all the staff of biology Department.
I extend my thanks to Prof. Dr. Mohsen Hashem Risan for all the helping
during my study.
I wish to express my special gratitude and love to my family for their guide
them and endless support.
Abstract
The main goal of this study was to isolate and identify Candida
albicans and investigate the prevalence of some virulence factors which include
biofilm formation, proteinase, coagulase, hemolysin production and
Candidalysin gene ECE1 distribution among C. albicans isolates depending on
several tests. The current study included 280 samples (swabs) were collected
during a period of 3 months from May to Augest 2022 of different ages and
genders of non-duplicated Iraqi patients who infected and suspected of
respiratory diseases and candidiasis from Baghdad hospitals (Medical City
Hospitals, Al-Yarmouk Teaching Hospital and AL-Imamein AL- Kadhimaein
Medical Educational City). The collected swabs were cultured on SDA medium
supplemented with chloramphenicol as antibacterial at a concentration 50 mg/l,
the plates of SDA were incubated at 37 °C for 24h
The culture results showed from 102 positave samples out of 280. 59
(57.84%) was female while 43 (42.16%) was male includes 58(56.86%) oral
cavity and 44 (43.14%) respiratory tract, while 178 of them were negative
Candida isolates were identified using conventional methods by morphological
and microscopic examination, grown on HiCrome Candida medium, germ tube
production, chlamydospore formation and confirmed using VITEK-2 system,
Morphological appearances colonies of C. albicans on SDA was white to
cream-colored smooth, glabrous, yeast-like, under microscopic examination,
the shape of Candida yeast cells was spherical to oval, with the presence of
budding, and much larger than bacterial cells. The results of the examinations
were shown in this study all C. albicans isolates were production of germ tube
and chlamydospores Will The other species did not produce any of them.
Abstract II
Out of 102 Candida isolates, C. albicans 70 (68.63 %) was the most frequent
isolate, followed by 11 (10.78%) C. trobicalis, and 6 (5.88%) C. kyfer and 6
(5.88 %) C. kruzei, and 5 (4.9%) C. Parapsilosis, and 4(3.9%) C. glabrata
respectively, Susceptibility of Candida isolates to antifungal drugs was
examined by disk diffusion method, performed as recommended by (CLSI)
M44-A document. The isolates showed a high level of susceptibility to
Amphotericin-B (93.14%), Clotrimazole (90.20%), Nystatin (85.92%) while
Candida isolates had a resistance of 42.86% to each of voriconazole and
ketoconazole. and that resulte of biofilm formation by using micro-titer plate
method was 48.57% from C. albicans isolates were strong producer for biofilm,
and 40% were moderately biofilm producer, while 4.29% non-producer of
biofilm and these results was matching with tube adherence methode results. C.
albicans isolates showed varied proteolytic activity, 42.86% was strong activity
and 4.86% of isolate have weak protolytic activity and the percentage of strong
hemolytic activity among C. albicans isolates was 28.57% while 51.43%
moderate in production, C. albicans isolates showed varied phospholipase
activity, 64.29% was strong activity and 7.14% of isolate have weak activity.
The percentage of positive coagulase production among C. albicans isolates
was 84.29% while 15.71% was negative in production and while, Prevalence of
Candidalysin gene ECE1 among 70 isolates of C. albicans was investigated
using polymerase chain reaction (PCR) technique, Molecular detection of
ECE1 gene among the 70 of C. albicans isolates collected revealed that there
were 15 (60%) isolates collected from oral cavity of males were positive for
ECE1 gene and 6(37.5%) from respiratory tract respectively, while 10(40%) of
isolates collected from oral cavity of females was positive of targeted gene in
oral cavity. Also, 10(62.5%) from respiratory tracts of females was harbouring
this gene.
List of Contents IV
List of Contents
No Subject Pag
e
Abstract I
List of Contents IV
List of Figures VIII
List of Tables X
List of Abbreviation XI
Chapter one: Introduction
1.1 Introduction 1
1.2 Aims of Study 4
Chapter two: literature review
2 Literature Review 5
2.1 Fungal Pathogen 5
2.2 Yeasts 5
2.3 Classification of Candida 7
2.4 Candida 8
2.5 Pathogenesis of Candida 13
2.6 Epidemiology of Candida 13
2.7 Candida spp 14
2.7.1 C. albicans 14
2.7.2 C. krusei 16
2.7.3 C. kyfer 17
2.7.4 C. parapsilosis 17
2.7.5 C. tropicalis 18
2.7.6 C. glabrata 18
2.8 Virulence Factors of C. albicans 20
2.8.1 Proteases 21
2.8.2 Phospholipases 21
2.8.3 Di-morphisms (Morphogenesis) 22
2.8.4 Hemolysin 22
List of Contents V
List of Figures
production
4-9 The proteolytic activity of isolates of 70 C. albicans on 82
BSA agar medium at 37 for 24 hrs.
4-10 Tube coagulase test of C. albicans 85
4-11 Electrophoresis of the PCR product of the ECE1 gene of 87
C. albicans isolates using a 2% agarose gel for 60 minutes
under a voltage of 70 volts and photographed under
ultraviolet light after staining it with ethidium bromide.
List of Table
(2.1) Candida species commonly isolated in clinical settings an 9
ecology
(3-1) Apparatus used in the present study 34
(3-2) General Equipment‘s utilized in this study 35
List of Abbreviations
°C Centigrade
AIDS Acquired Immune Disease Syndrome
AMB Amphotericin B
bp Base pair
BSA Bovine Serum Albumin
C. albicans Candida albicans
C. glabrata Candida glabrata
C. keyfer Candida keyfer
C. krusei Candida krusei
C. parapsilosis Candida parapsilosis
C. tropicalis Candida tropicalis
CLO Clotrimazole
CLSI Clinical and laboratory Standards Institute
CMA Corn Meal Agar
Co2 Carbon Dioxide
CV Crystal Violet
D.W Distilled Water
Da Dalton
DNA Deoxyribonucleic Acid
dNTPs Deoxyribonucleotide Triphosphates
ECO Econazole
EDTA Ethylene Diamine Tetra Acetic Acid
ELISA Enzyme-linked Immunosorbent assay
GT Germ Tube
H Hour(s)
HIV Human Immunodeficiency Virus
HRP Horseradish Peroxidase
Hz Hemolysin Activity
ICU Intensive Care Unit
ITZ Itraconazole
KH2PO4 Potassium Dihydrogen Phosphate
List of Contents XII
1.1. Introduction
The molecular biology part of the current thesis included the study
of the ECE1 gene in Candida fungus in terms of diagnosing the gene using
conventional PCR and sending some samples that carry this gene for the
purpose of determining the genetic sequence using the Sanger sequence
technique. According to national center for biotechnology information, the
ECE1 gene in C. albicans is located on the fourth chromosome and encodes
a protein with exon number 1, Gene ID number was 3646814 ( Naglik et
al.,2019).
Chapter One: Introduction 4
2. Literatures Review
2.2. Yeasts
Kingdom: Fungi
Phylum: Ascomycota
Subphylum: Saccharomycotina
Class: Saccharomycetes
Order: Saccharomycetales
Family: Saccharomycetacae
Genus: Candida
2.4. Candida
Most frequent
Ecology
species
Commensal yeast from the digest and respiratory
C. albicans
tract mucosa, more than 75% of yeasts isolated
C. glabrata Digestive mucosa and urogenital
C. parapsilosis Skin
Soil, water, digestive tract, urogenital and
C. tropicalis
respiratory tract
C. krusei Food (Dairy, Beer)
Less common species Ecology
C. dubliniensis Birds, digestive tract
C. guilliermondii Skin
C. lusitaniae Environment, digestive tract
C. kyfer Food, digestive tract, respiratory tract
C. lipolytica Animals and plants
C. ciferrii Onychomycosis
C. inconspicua Digestive tract, hospital environment
C. rugosa Water, Food (dairy products)
C. famata Skin
C. africana Vagina
Chapter Two: Literature Review 10
dubliniensis cells, is more extensive than the walls of those cell types,
according to ultrastructural investigations. This layer's structure and makeup
have not been adequately described. The structure of the chlamydospore
wall in C. dubliniensis was examined in previous study proved that chitosan
makes up the distinctive interior layer of the chlamydospore wall.
Additionally, genes encoding orthologs of Saccharomyces
cerevisiae proteins essential for the synthesis of the chitosan layer in
ascospores are likewise important for the assembly of the chlamydospore
wall (Bemena et al., 2021).
Germ tube, the germ tube test is frequently regarded as the most
accurate technique for identifying Candida with a sensitivity of up to 98%,
the germ tube test is the most practical, quick, and simple method for
differentiating C. albicans and C. dubliniensis from other species (Moya-
Salazar and Rojas, 2018).However, this test is one of three screening assays
used to distinguish C. albicans from other species. This test is carried out
using a variety of media, with human serum (fresh, inactivated, or frozen)
being the most suitable and practical for filamentation (Moya-Salazar and
Rojas, 2018). These media include water agar with 1% milk, BHI,
commercial media (broth SST, TSA-BAP, BHI, YEPD free-serum, among
others), and others. The germ tube test has undergone some variations in
recent years, most of which are low-cost, low-benefit tests that are mostly
used in middle- and low-income countries for screening purposes (Moya-
Salazar and Rojas, 2018). The germ tube is crucial for the development of
pathogenicity during the invasion of the host tissues and possesses unique
phagocytosis resistance according to Faidal and others, the development of
the germ tube is correlated with an increase in the yeast's ability to adhere to
Chapter Two: Literature Review 13
and infiltrate the host's tissues Candida is the yeast that causes this.
Therefore, one of the primary causes of candidiasis is its capacity to produce
a germ tube without the assistance of other types (Abu Elteen, 2000).
2.7.2. C. krusei
2.7.3. C. kyfer
are variables contribute to its virulence, and how it interacts with the host
(Giri and Kindo., 2012; Asadzadeh et al., 2022).
2.7.5. C. tropicalis
C. tropicalis is widespread in the environment, human skin,
vagina, mouth, and digestive tract, which would become pathogenic rapidly
after an alteration of the host immune system, causing the localized and even
systemic infection (Zhai et al., 2021).
2.7.6. C. glabrata
2.8.1. Proteases
activity of the isolate was considered positive when a precipitation zone was
visible around the colony on the plate (Sachin et al., 2012).
2.8.4. Hemolysin
positive link between this metal and the development and spread of diseases
(Martins et al., 2014).
2.8.5. Biofilm Formation Among C. albicans
2.8.6 Coagulase
2.9. Candidalysin
Candida species that are found in the mouth (Aslani et al., 2018; Sav et al.,
2020; Rafiq et al., 2020). Pre-cancerous and cancerous oral lesions are
among the most common forms of cancer, mainly in developed countries
with a male prevalence mostly around the fifth and sixth decades of life (Di
Cosola et al., 2021).
Most molecules that can inhibit fungal growth are also highly
toxic to humans we still need to improve our knowledge of the biology of
these fungi during the infection and identify the key factors implicated in
their virulence. The implementation of new or recently improved
technologies in sequencing, metabolomics, or microscopy should help us to
get better insights into the cell biology, biochemistry, and genetics of
Chapter Two: Literature Review 33
pathogenic fungi (Mayer et al., 2013). Together with the progress in the
understanding of the immune response during fungal infections, and the
potential of innate immune system boosting in protecting adaptive-immune
deprived patients, this knowledge will be translated into the identification of
better diagnostic tools and specific drug targets. In that sense, the usage of
fungus-specific CD4 T cells as specific sensors for the diagnostic of fungal
infections is very promising. The other main challenge is societal. Fungal
diseases are mostly neglected and their impact on human health is not
widely appreciated this under-appreciation results in a limited amount of
resources specifically dedicated by funding agencies to this field, thus
limiting its development (Janbon et al., 2019).
Thus there is need to obtain a better knowledge of their
epidemiology and their impact on human health in developed countries but
also in the poorest ones. In that sense, the type of survey done by the
National Center of Mycosis and Antifungal of the Institut Pasteur is
instrumental. New fungal pathogens like C. aureus and Mucor sp. Have
been recently identified as emerging and will represent a challenge for
physicians and researchers in the coming years. Fungal research initiated by
Louis Pasteur in the middle of the 19th century has known fantastic
development in recent years but still needs to be further developed to better
fight these deadly pathogens (Mariottini et al,. 2016).
Chapter Three
Methodology
Chapter Three: Methodology 34
Antifungal disk that used in this work against Candida spp. are listed in
table (3-5).
3.2 Method’s
This medium was prepared according to (Staib et al., 1966) with few
modifications, using a medium composed of (Dextrose 2%, KH 2PO4 0.1%,
MgSO4 0.05% and supplemented with agar 2%), Autoclaved at 115 °C for
15 min, mixed well after cooling to 50°C and supplemented with 1% Bovine
serum albumin (BSA) solution and dispensed into a sterile petri dish, after
mixed thoroughly.
The egg yolk medium contained 10% sterile egg yolk, 11.7 g of sodium
chloride, 0.11 g of calcium chloride, and 13.0 g SDA (the are all placed in
184 ml distilled water) (Tsang et al,. 2007; Mohandas et al., 2011). All of
the substances were combined and sterilized, with the exception of the egg
yolk, which was then centrifuged at 500 g for 10 min at room temperature.
Twenty ml of the supernatant were then added to the sterilized medium that
had already been prepared. Inoculating 10 μl aliquots of yeast of the yeast
suspension (about 108 yeast cell/ml) were deposited onto the surface of egg
yolk agar medium after than left to dry at room temperature and incubated at
37 °C for 48 h (Tsang et al,. 2007).
Chapter Three: Methodology 42
The dye was taken from the stock of instruments and applied to the task of
staining yeasts in order to examine their microscopic characteristics (Zhao et
al., 2018).
It consists of (NaCl 8.5 g, KCl 0.2 g, KH2PO4 0.2 g, Na2HPO4 1.15 g) all
the constituents dissolved in 500 ml of D.W and the volume was completed
to 1 litter and the pH was adjusted to 7.2. Sterilize using autoclaving for 15
min at 121°C at 15 psi (Marks et al., 1975).
Chapter Three: Methodology 44
In this study all the glasses are sterilized, equipment‘s and culture media
accordance to (Quinn et al., 2001) as follow:
2. Dry heat sterilization (oven): this technique was used to sterilize forceps
and all glasses used during this study; a temperature of (160-180) was
maintained for two hours.
It was carried out by adding pure colonies to SDA broth that contained 15%
glycerol and storing it at -20°C for 12 to 18 months after 48 h at 30°C.
Procedure:
1. A test tube made of clear plastic was filled with 3 ml of sterile normal
saline (12 mm x 75 mm).
3. The cassette was loaded with the suspension tube and YST card.
The stuck was transferred to the cassette once the tape was placed into the
device's first opening, and the procedure took 7 minutes to finish. To
distinguish the organism at 37°C, it was removed and put in the second
entrance.
without digging into the agar, the sterilized inoculating loop was first
streaked back and forth across the two original streak lines after cooling.
Sterilized with flame, a 22 mm square cover glass was then put over the
streaks after cooling. All inoculating plats were cultured for one to two days
at 25° C. They were then examined under a light microscope to identify the
thick-walled chlamydospores (McGinnis., 1980).
crystal violet for 3 h. The stain was removed from the tubes then inverted
and left to dry and fixed with 200µl 95% methanol.
at 121 °C for 15 min and 15 psi, mixed well after cooling to 50°C and
supplemented with 1% Bovine serum albumin (BSA) solution. Yeast
suspension of 1×108 cells/ mL was prepared, and 10 μl of yeast suspension
was inoculated onto the surface of prepared medium. The Petri dishes were
incubated for 24-48 h at 37 °C. After that, the Petri dishes were fixed with
20% Trichloroacetic acid (TCA) and stained with 1.25% amidoblack, and
use Acetic acid (15%) for decolorization. The proteinase activity was seen
as opaqueness of the petri dishes agar, corresponding to a zone of proteolysis
around the yeast colony which not stained with amidoblack.
3.2.9.5. Coagulase
6 Proteinase K 20mg/ml 1 ml
7 Spin Column 50
8 RNase A20mg/ml 1 ml
9 Collection Tube 50
The primers listed in the Table (3-12), were used for PCR
amplification of ECE1 gene, in this study; these primers were purchased
lyophilized from (Alpha DNA, USA). The powder of primers was dissolved
in nuclease-free water. To achieve a final concentration of 100 pmol/μL in
nuclease-free water as a standby solution to prepare a 10 pmol/μL
concentration as work primer suspension, the stock solution of primers was
kept in refrigerator at -20 C.
Chapter Three: Methodology 59
Table (3-12) PCR Primers used in this study for amplification of ECE1
gene
and a comb with small holes. It is allowed to firm before being loaded with a
quantity (5µl) straight without the addition of a loading dye and finally
relayed at a voltage of 70 for roughly 60 or 90 minutes.
3.2.11. Sequencing and Alignment of Sequence
Following staining with Ethidium Bromide Stain, the PCR
products were separated on a (2%) agarose gel electrophoresis and examined
under ultraviolet light (302 nm). The current study's PCR products and
primers were sent to the South Korean business Macrogen
(dna.macrogen.com) for sequencing analysis to look for mutations. A
homology search was performed using the Basic Local Alignment Search
Tool (BLAST) tool, which is available online at
(http://www.ncbi.nlm.nih.gov) (NCBI), the Bioedit program.
3.2.12. Deposition of Sequences to GenBank
All the analyzed sequences were submitted to the NCBI bank.
3.2.13. Statistical Analysis
The data obtained during this study were analyzed using the
following software, Microsoft excel, IBM SPSS V26, and Minitab v.18. The
results reported in this study were expressed as N (%). Z-test was used to
compare two proportions. One-way analysis of variance was used for
biofilm analysis. The chi-square test of association and chi square goodness
of fit was used for categorical data. P≤ l 0.05, and 0.01 were considered
significantly and highly significantly different (Daniel and Cross., 2013).
Chapter Four
Results and Discussion
Chapter Four: Results And Discussion 62
Positive
36%
Negative
64%
In the current study, less than half (36.43%) of the visited patients
to targeted hospitals were positive grow of Candida spp. Previous reports
and studies reported that nearly 10% of the common species inhibits the oral
cavity behave as opportunistic yeast pathogens, and causing infections and
diseases like oral candidiasis (Sardi et al., 2013; Pinto- Almazán et al.,
2022). The opportunistic infections of oral cavity are the common frequently
among the compromised patients such as AIDS and HIV (Patel et al., 2006).
Candida spp. colonization the oral cavity in varied levels according to the
age, in new born patients ranged between 42-45%, in good healthy children
about 50-64%, in healthy adults ranged between 30-45%, in wearers of
denture 55-65%, in peoples infected with oral microbes 65-85%, while in
individuals who immunocompromised like those infected with HIV and/or
undergoing to treatment by chemotherapy include patients with acute
leukaemia, it is ranged between 90-95% (Akpan and Morgan., 2002; Patil et
al., 2015).
each Candida type based on the basic substance of those enzymes on the
medium (Tintelnot et al., 2000). This test is accurate and high in diagnosing
the different species of Candida, this due to contains a substrate which is
called the chromogenic mixture, where the enzymes of each type of Candida
yeast to interact with its substrate in this medium Such as type C. albicans
produces specific an enzyme (BN-Acetylgalactosaminidase) that work on its
substrate in the medium (Jabra-Rizk et al., 2001).
Table (4-4) Antifungal susceptibility of Candida spp isolated from the oral cavity and respiratory tract of
patients.
Species (No)
C. albicans C. tropicalis C. kruzei C. kayfer C. parapsilosis C. glabrata Total
No (70) No (11) No (6) No (6) No (5) No (4) (102)
Antifungal
S (%) 50(71.43) 7(63.64) 4(66.67) 5 (83.33) 3(60) 3(75) 72(70.59)
Fluconazole SDD (%) 5(7.14) 1(9.09) 0(0) 0 (0) 0(0) 0(0) 6(5.88)
R (%) 15(21.43) 3(27.27) 2(33.33) 1(16.67) 2(40) 1(25) 24(23.53)
S (%) 65(92.86) 9(83.33) 4(66.67) 6(100) 4(80) 4(100) 92(90.20)
Clotrimazole SDD (%) 0(0) 1(9.09) 0(0) 0(0) 0(0) 0(0) 1(0.98)
R (%) 5(7.14) 1(9.09) 2(33.33) 0(0) 1(20) 0(0) 9(8.82)
S (%) 30(42.86) 6(54.55) 3(50) 2(33.33) 4(80) 3(75) 48(47.06)
Ketoconazole SDD (%) 10(14.29) 1(9.09) 1(16.67) 1(16.67) 0(0) 1(25) 14(13.73)
R (%) 32(45.71) 4(33.33) 2(33.33) 3(50) 1(20) 0(0) 40(39.22)
S (%) 35(50) 6(54.55) 3(50) 3(50) 2(40) 4(100) 53(51.96)
Voriconazole SDD (%) 5(7.14) 1(9.09) 0(0) 2(33.33) 0(0) 0(0) 8(7.84)
R (%) 30(42.86) 4(33.33) 3(50) 1(16.67) 3(60) 0(0) 41(40.19)
S (%) 30(42.86) 8(72.73) 4(66.67) 2(33.33) 2(40) 4(100) 50(49.02)
Micaconazole SDD (%) 20(28.57) 2(18.18) 0(0) 2(33.33) 1(20) 0(0) 25(24.51)
R (%) 20(28.57) 1(9.09) 2(33.33) 2(33.33) 2(40) 0(0) 27(26.47)
S (%) 65(92.86) 8(72.73) 4(66.67) 4(66.67) 3(60) 3(75) 87(85.29)
Nystatin SDD (%) 3(4.29) 2(18.18) 1(16.67) 2(33.33) 1(20) 0(0) 9(8.82)
R (%) 2(2.86) 1(9.09) 1(16.67) 0(0) 1(20) 1(25) 6(5.88)
S (%) 68(97.14) 9(83.33) 5(83.33) 5(83.33) 4(80) 4(100) 95(93.14)
Amphotericin-B SDD (%) 2(2.86) 1(9.09) 0(0) 1(16.67) 0(0) 0(0) 4(3.92)
R (%) 0(0) 1(9.09) 1(16.67) 0(0) 1(20) 0(0) 3(2.94)
S (%) 30(42.86) 8(72.73) 2(33.33) 2(33.33) 2(40) 4(100) 48(47.06)
Itraconazole
SDD (%) 15(21.43) 1 (16.67) 2(33.33) 3(50) 1(20) 0(0) 22(21.57)
R (%) 25(35.71) 2 (18.18) 2(33.33) 1(16.67) 2(40) 0(0) 32(31.37)
Chi square test P-value 0.001** 0.006** 0.121N.S 0.015* 0.369 N.S 0.007**
Chapter Four: Results And Discussion 74
A- Tube Method
The biofilm formation was tested by using tube adherence methods; Biofilm
formation for 70 isolates of C. albicans was evaluated. The results showed
that most isolates 67(95.7%) were the ability to attach and build
multicellular structures at the surface of the test tube after 48 h incubation,
and staining by crystal violate while 3 isolates (4.29%) were haven‘t attach
and developed biofilm as showed in Figure (4-7). These results are identical
to those of the mico-titer plate method.
C. albicans (N=70)
3.3.4. Phospholipase
This is to detect the ECE1 gene, and after electrophoresis of the PCR
product, the results were positive for male from oral cavity in 15(60.0) and
6(37.5) in respiratory tract whereas negative result was 5(29.4) in oral cavity
and 4(33.3) in respiratory tract, while in female the result was as follows, 10
(40.0) of sample was positive in oral cavity and 10 (62.5) in respiratory tract,
while the negative result 12(70.7) in oral cavity and 8(66.7) in respiratory
tract as shown in Table (4-12) .
Chapter Four: Results And Discussion 88
Female 10(40.0) 12(70.6) 10(62.5) 8(66.7) 40(57.1) 1.00 N.S 0.197 N.S
P-value 0.149 N.S 0.008** 0.144 N.S 0.083 N.S
Data presented as N (%), ¥: Z-test was used to test two proportions. N.S: Not significant
(P>0.05). *, ** Significant and highly significant (P ≤ 0.05) and (P ≤ 0.01) respectively.
In 2016 Moyes et al. and Birse et al. in (1993) who discovered the new type
of fungal toxin called candidalysin, this cytolytic toxin is the first fungal
peptide toxin detected in a human fungal pathogen (Rogiers et al., 2019;
Russell et al., 2022) Candidalysin produced by strains of C. albicans and its
very important for infections during invasion of mucosa and other human
tissues ( Salvin., 1951). In previous studies and reports to elucidate the
activity of candidalysin in the lysis of red blood cells, the wild type of C.
albicans was incubated in parallel with another harbouring ECE1 gene
(mutant strain) on blood agar medium, the obtained data showed both the
mutant and wild strains have the ability to produce beta-hemolysis
(Mogavero et al., 2021; Richardson et al., 2022). This may referred to there
are another factors caused the hemolysis in RBCs and produce hemolytic
halo zone around the colonies of yeast strain, possibly produced aspartic
protease, that responsible to hemolysis in RBCs found in blood agar medium
(Pendark and Roberts., 2007). However, some studies revealed that the
strains of C. albicans have the ability to synthetic and secret candidalysin
and its direct precursor P3 considered are strong hemolytic peptides
Chapter Four: Results And Discussion 89
4- The current results revealed that 48.57% from C. albicans isolates were
strong producer for biofilm, and 40% were moderately biofilm producer,
while 4.29% non-producer of biofilm.
5.2 Recommendations
Refrence
Abood, M.S. 2014. Immunological and molecular study of Candida spp causing
vulvovaginal candidiasis and the role of Lactic acid bacteria as probiotic in
vivo and in vitro. College of Science, University of Baghdad, Iraq.
Ahmad, A., Husain, A., Khan, S. A., Mujeeb, M., and Bhandari, A. 2015.
Design, synthesis, molecular properties and antimicrobial activities of some
novel 2 (3H) pyrrolone derivatives. Journal of Saudi Chemical Society,
19(3), pp. 340-346.
Aldossary, M.A., Almansour, N.A. and Abdulraheem, B.S. 2016. Isolation and
identification of Candida species from the oral cavity of cancer patients
undergoing chemotherapy in Basrah, Iraq. Journal of Biology Agriculture
and Healthcare, 6(18), pp.22-30
Ali, G. Y., Algohary, E. H. S., Rashed, K. A., Almoghanum, M., and Khalifa, A.
A. 2012. Prevalence of Candida colonization in preterm newborns and
VLBW in neonatal intensive care unit: role of maternal colonization as a risk
factor in transmission of disease. The Journal of Maternal-Fetal & Neonatal
Medicine, 25(6), pp. 789-795.
Al-Jumaily, E.F., Mahdi, A.A.A.H. and Jumma, I.M. 2015. Study the purified
cell wall mannoproteins Candida albicans CA18 as immunomodulators on
vaccination of mice., pp.118-122.
Arastehfar, A., Gabaldón, T., Garcia-Rubio, R., Jenks, J. D., Hoenigl, M.,
Salzer, H. J., and Perlin, D. S. 2020. Drug-resistant fungi: an emerging
challenge threatening our limited antifungal
armamentarium. Antibiotics, 9(12), p 877.
Asadzadeh, M., Al-Sweih, N., Ahmad, S., Khan, S., Alfouzan, W., and Joseph, L
. 2022. Fatal Lodderomyces elongisporus Fungemia in a Premature,
Extremely Low-Birth-Weight Neonate. Journal of Fungi, 8(9), p. 906.
Aslani, N., Janbabaei, G., Abastabar, M., Meis, J. F., Babaeian, M., Khodavaisy,
S., and Badali, H. 2018. Identification of uncommon oral yeasts from cancer
patients by MALDI-TOF mass spectrometry. BMC Infectious Diseases, 18,
pp.1-11.
Aittakorpi, A.; Kuusela, P.; Kähkölä, P.K.; Vaara, M.; Petrou, M.; Gant, V. and
Mäkia, M. 2012. Accurate and Rapid Identification of Candida spp.
Frequently Associated with Fungemia by Using PCR and the Microarray-
Based, J of Clin Microbiol., 50 (11). pp. 3635–3640.
Atriwal, T., Azeem, K., Husain, F. M., Hussain, A., Khan, M. N., Alajmi, M. F.,
and Abid, M. 2021. Mechanistic understanding of Candida albicans biofilm
formation and approaches for its inhibition. Frontiers in Microbiology, 12, p.
638609.
Ayeni, O., Riederer, K.M., Wilson, F.M. and Khatib, R. 1999. Clinicians'
reaction to positive urine culture for Candida organisms. Mycoses, 42(4),
pp.285-289.
Bacher, P., Hohnstein, T., Beerbaum, E., Röcker, M., Blango, M. G., Kaufmann,
S., and Scheffold, A. 2019. Human anti-fungal Th17 immunity and
pathology rely on cross-reactivity against Candida albicans. Cell, 176(6),
pp. 1340-1355.
References 96
Bain, J.M., Louw, J., Lewis, L.E., Okai, B., Walls, C.A., Ballou, E.R., Walker,
L.A., Reid, D., Munro, C.A., Brown, A.J. and Brown, G.D. 2014. Candida
albicans hypha formation and mannan masking of β-glucan inhibit
macrophage phagosome maturation. MBio, 5(6), pp.e01874-14.
Bemena, L. D., Min, K., Konopka, J. B., and Neiman, A. M. 2021. A conserved
machinery underlies the synthesis of a chitosan layer in the Candida
chlamydospore cell wall. Msphere, 6(2), pp. e00080-21.
Beneke, F.S. and Rpgers, A.L. 1980. Medical mycology manual 4th edition
Burgess Pub. Co. Minn, pp.33-36.
Bhalla, K., Qu, X., Kretschmer, M., and Kronstad, J. W. 2022. The phosphate
language of fungi. Trends in Microbiology, 30(4), pp.338-349.
Bhattacharjee, S. 2016. DLS and zeta potential–what they are and what they are
not?. Journal of controlled release, 235, pp.337-351.
Bilal, H., Hou, B., Shafiq, M., Chen, X., Shahid, M.A. and Zeng, Y. 2022.
Antifungal susceptibility pattern of Candida isolated from cutaneous
candidiasis patients in eastern Guangdong region: A retrospective study of
the past 10 years. Frontiers in Microbiology, 13, p.981181.
Birse, C. E., Irwin, M. Y., Fonzi, W. a., and Sypherd, P. S. 1993. Cloning and
characterization of ECE1, a gene expressed in association with cell
elongation of the dimorphic pathogen Candida albicans. Infection and
Immunity, 61(9), pp. 3648–3655.
Bongomin, F., Gago, S., Oladele, R.O. and Denning, D.W. 2017. Global and
multi-national prevalence of fungal diseases—estimate precision. Journal of
fungi, 3(4), p.57.
Böttcher, B., Pöllath, C., Staib, P., Hube, B., and Brunke, S. 2016. Candida
species rewired hyphae developmental programs for chlamydospore
formation. Frontiers in microbiology, 7, p. 1697.
References 97
Brown, G.D., Denning, D.W., Gow, N.A., Levitz, S.M., Netea, M.G. and White,
T.C. 2012. Hidden killers: human fungal infections. Science translational
medicine, 4(165), pp.165rv13-165rv13.
Chaffin, W.L., Lopez-Ribot, J.L., Casanova, M., Gozalbo, D. and Martinez, J.P.
1998. Cell wall and secreted proteins of Candida albicans: identification,
function, and expression. Microbiology and molecular biology reviews,
62(1), pp.130-180.
Chen, H., Zhou, X., Ren, B. and Cheng, L. 2020. The regulation of hyphae
growth in Candida albicans. Virulence, 11(1), pp.337-348
Christensen, G.D., Simpson, W.A., Younger, J.J., Baddour, L.M., Barrett, F.F.,
Melton, D.M. and Beachey, E.H. 1985. Adherence of coagulase-negative
staphylococci to plastic tissue culture plates: a quantitative model for the
adherence of staphylococci to medical devices. Journal of clinical
microbiology, 22(6), pp.996-1006.
References 98
Cirak, M. Y., Kalkanci, A., and Kustimur, S. 2003. Use of molecular methods in
identification of Candida species and evaluation of fluconazole resistance.
Memórias do Instituto Oswaldo Cruz, 98, pp.1027-1032.
da Silva Dantas, A., Lee, K.K., Raziunaite, I., Schaefer, K., Wagener, J., Yadav,
B. and Gow, N.A. 2016. Cell biology of Candida albicans–host interactions.
Current opinion in microbiology, 34, pp.111-118.
Davarzani, F., Saidi, N., Besharati, S., Saderi, H., Rasooli, I. and Owlia, P. 2021.
Evaluation of antibiotic resistance pattern, alginate and biofilm production in
clinical isolates of Pseudomonas aeruginosa. Iranian Journal of Public
Health, 50(2), p.341.
De Maria, L., Vind, J., Oxenbøll, K.M., Svendsen, A. and Patkar, S. 2007.
Phospholipases and their industrial applications. Applied microbiology and
biotechnology, 74, pp.290-300.
Delavy, M., Dos Santos, A. R., Heiman, C. M., and Coste, A. T. 2019.
Investigating antifungal susceptibility in Candida species with MALDI-TOF
MS-based assays. Frontiers in cellular and infection microbiology, 9, p.19.
References 99
Di Cosola, M., Cazzolla, A. P., Charitos, I. A., Ballini, A., Inchingolo, F., and
Santacroce, L. 2021. Candida albicans and oral carcinogenesis. A brief
review. Journal of Fungi, 7(6), p. 476.
Ellis, D.H., Davis, S., Alexiou, H., Handke, R. and Bartley, R. 2007. Descriptions
of medical fungi (Vol. 2). Adelaide: University of Adelaide.
Engku Nasrullah Satiman, E. A. F., Ahmad, H., Ramzi, A. B., Abdul Wahab,
R., Kaderi, M. A., Wan Harun, W. H. A.,& Arzmi, M. H. 2020. The role of
Candida albicans candidalysin ECE1 gene in oral carcinogenesis. Journal of
Oral Pathology & Medicine, 49(9), pp.835-841.
Ferreira, A. V., Prado, C. G., Carvalho, R. R., Dias, K. S. T., and Dias, A. L. T.
2013. Candida albicans and non-C. albicans Candida species: comparison
of biofilm production and metabolic activity in biofilms, and putative
virulence properties of isolates from hospital environments and
infections. Mycopathologia, 175, pp. 265-272.
Gallis, H.A., Drew, R.H. and Pickard, W.W. 1990. Amphotericin B: 30 years of
clinical experience. Reviews of infectious diseases, 12(2), pp.308-329.
Galocha, M., Pais, P., Cavalheiro, M., Pereira, D., Viana, R., and Teixeira, M. C.
2019. Divergent Approaches to Virulence in C. albicans and C. glabrata:
Two Sides of the Same Coin. International journal of molecular sciences,
20(9), p. 2345.
Gandhi, T.N., Patel, M.G. and Jain, M.R., 2015. Antifungal susceptibility of
Candida against six antifungal drugs by disk diffusion method isolated from
References 100
Giri, S., and Kindo, A. J. 2012. A review of Candida species causing blood
stream infection. Indian journal of medical microbiology, 30(3), pp.270-278.
González Gravina, H., González de Morán, E., Zambrano, O., Lozano Chourio,
M., Rodríguez de Valero, S., Robertis, S. and Mesa, L. 2007. Oral
Candidiasis in children and adolescents with cancer: Identification of
Candida spp. Medicina Oral, Patología Oral y Cirugía Bucal (Internet),
12(6), pp.419-423.
Gupta, V., Abhisheik, K., Balasundari, S., Devendra, N. K., Shadab, K., and
Anupama, M. 2019. Identification of Candida albicans using different
culture media and its association in leukoplakia and oral squamous cell
carcinoma. Journal of oral and maxillofacial pathology: JOMFP, 23(1), p28.
Hasan, F., Xess, I., Wang, X., Jain, N. and Fries, B.C. 2009. Biofilm formation in
clinical Candida isolates and its association with virulence. Microbes and
infection, 11(8-9), pp.753-761.
References 101
Hajjeh, R.A.; Sofair, A.N.; Harrison, L.H.; Lyon, G.M.; Arthington- Skaggs,
B.A. and Mirza, S.A. 2004. Incidence of blood stream infections due to
Candida species and invitro susceptibilities of isolates collected from 1998
to 2000 in a population based active surveillance program, J. Clin.
Microbiol., 42. pp. 1519- 1527.
Hibbett, D.S., Blackwell, M., James, T.Y., Spatafora, J.W., Taylor, J.W. and
Vilgalys, R. 2018. Phylogenetic taxon definitions for fungi, dikarya,
ascomycota and basidiomycota. IMA fungus, 9, pp.291-298.
Horvath, L.L., Hospenthal, D.R., Murray, C.K. and Dooley, D.P. 2003. Direct
isolation of Candida spp. from blood cultures on the chromogenic medium
CHROMagar Candida. Journal of clinical microbiology, 41(6), pp.2629-
2632.
Hospenthal, D.R., Beckius, M.L., Floyd, K.L., Horvath, L.L. and Murray, C.K.
2006. Presumptive identification of Candida species other than C. albicans,
C. krusei, and C. tropicalis with the chromogenic medium CHROMagar
Candida. Annals of clinical microbiology and antimicrobials, 5(1), pp.1-5.
Ibrahim, A.S., Mirbod, F., Filler, S.G., Banno, Y., Cole, G.T., Kitajima, Y.,
Edwards Jr, J.E., Nozawa, Y. and Ghannoum, M.A. 1995. Evidence
implicating phospholipase as a virulence factor of Candida albicans.
Infection and immunity, 63(5), pp.1993-1998.
Isenberg, H.D. 1998. Essential procedures for clinical microbiology (pp. 216-
221). Washington, DC: ASM press.
Ito, M., Yamada, T., Makimura, K., Ishihara, Y., Satoh, K., Kikuchi, K., and
Abe, S., 2010. Intracellular serine protease from Candida glabrata species
detected and analyzed by zymography. Med Mycol, 1, pp. 29-35.
References 102
Janbon, G., Quintin, J., Lanternier, F., and d‘Enfert, C. 2019. Studying fungal
pathogens of humans and fungal infections: Fungal diversity and diversity of
approaches. Microbes and Infection, 21(5-6), pp.237-245.
Jenks, J.D., Salzer, H.J., Prattes, J., Krause, R., Buchheidt, D. and Hoenigl, M.
2018. Spotlight on isavuconazole in the treatment of invasive aspergillosis
and mucormycosis: design, development, and place in therapy. Drug design,
development and therapy, pp.1033-1044.
Jin, Y.Y.H.K., Yip, H.K., Samaranayake, Y.H., Yau, J.Y. and Samaranayake,
L.P. 2003. Biofilm-forming ability of Candida albicans is unlikely to
contribute to high levels of oral yeast carriage in cases of human
immunodeficiency virus infection. Journal of clinical microbiology, 41(7),
pp.2961-2967.
Kauffman, C.A., Vazquez, J.A., Sobel, J.D., Gallis, H.A., McKinsey, D.S.,
Karchmer, A.W., Sugar, A.M., Sharkey, P.K., Wise, G.J., Mangi, R. and
Mosher, A. 2000. Prospective multicenter surveillance study of funguria in
hospitalized patients. Clinical Infectious Diseases, 30(1), pp.14-18.
Kaur, R., Dhakad, M.S., Goyal, R., Haque, A. and Mukhopadhyay, G. 2016.
Identification and antifungal susceptibility testing of Candida species: a
References 103
Kaur, R., Domergue, R., Zupancic, M. L., and Cormack, B. P., 2005. Yeast by
any other name: Candida glabrata and its interaction with the host. Current
opinion in microbiology, 8(4), pp.378-384.
Kounatidis, I., Ames, L., Mistry, R., Ho, H. L., Haynes, K., and Ligoxygakis, P.
2018. A host-pathogen interaction screen identifies ada2 as a mediator of
Candida glabrata defenses against reactive oxygen species. G3: Genes,
Genomes, Genetics, 8(5), pp. 1637-1647.
Kumar, C.G., Kumar, S.S.J. and Menon, T. 2006. Phospholipase and proteinase
activities of clinical isolates of Candida from immunocompromised patients.
Mycopathologia, 161(4), p.213.
Kumar, K., Askari, F., Sahu, M. S., and Kaur, R. 2019. Candida glabrata: a lot
more than meets the eye. Microorganisms, 7(2), pp .39.
Kurtzman, C.P. and Fell, J.W. 2006. Yeast systematics and phylogeny—
implications of molecular identification methods for studies in ecology.
Biodiversity and ecophysiology of yeasts, pp.11-30.
Lewis, M. A. O., and Williams, D. W., 2017. Diagnosis and management of oral
candidasis. British dental journal, 223(9), pp.675-681.
References 104
Li, Y., Sun, L., Lu, C., Gong, Y., Li, M., and Sun, S. 2018. Promising antifungal
targets against Candida albicans based on ion homeostasis. Frontiers in
Cellular and Infection Microbiology, 8, p286.
Linares, C.E.B., Loreto, É.S.D., Silveira, C.P., Pozzatti, P., Scheid, L.A.,
Santurio, J.M. and Alves, S.H. 2007. Enzymatic and hemolytic activities of
Candida dubliniensis strains. Revista do Instituto de Medicina Tropical de
São Paulo, 49, pp.203-206.
Liu, M., Chen, M. and Yang, Z. 2017. Design of amphotericin B oral formulation
for antifungal therapy. Drug Delivery, 24(1), pp.1-9.
Lohse, M.B., Gulati, M., Johnson, A.D. and Nobile, C.J. 2018. Development and
regulation of single-and multi-species Candida albicans biofilms. Nature
Reviews Microbiology, 16(1), pp.19-31.
Luo G, Samaranayake LP and Yau JY. 2001. Candida species exhibit differential
in vitro hemolytic activities. J Clin Microbiol, 39(8), pp. 2971-2974.
Lyon, J.P., Moreira, L.M., Cardoso, M.A.G., Saade, J. and Resende, M.A. 2008.
Antifungal suscepitibility profile of Candida spp. oral isolates obtained from
denture wearers. Brazilian Journal of Microbiology, 39, pp.668-672.
Magaldi, S., Mata-Essayag, S., De Capriles, C.H., Pérez, C., Colella, M.T.,
Olaizola, C. and Ontiveros, Y. 2004. Well diffusion for antifungal
susceptibility testing. International journal of infectious diseases, 8(1),
pp.39-45.
Malcok, H.K., Aktas, E., Ayyildiz, A., Yigit, N. and Yazgi, H. 2009. Hemolytic
activities of the Candida species in liquid medium. The Eurasian Journal of
Medicine, 41(2), p.95.
Manns, J.M., Mosser, D.M. and Buckley, H.R. 1994. Production of a hemolytic
factor by Candida albicans. Infection and immunity, 62(11), pp.5154-5156.
References 105
Martin, R., Albrecht-Eckardt, D., Brunke, S., Hube, B., Hünniger, K. and Kurzai,
O. 2013. A core filamentation response network in Candida albicans is
restricted to eight genes. PloS one, 8(3), p.e58613.
Martins, N., Ferreira, I. C., Barros, L., Silva, S., and Henriques, M. 2014.
Candidiasis: predisposing factors, prevention, diagnosis and alternative
treatment. Mycopathologia, 177(5), pp. 223-240.
Mayer, F. L., Wilson, D., and Hube, B. 2013. Candida albicans pathogenicity
mechanisms. Virulence, 4(2), pp.119-128.
McCall, A. D., Pathirana, R. U., Prabhakar, A., Cullen, P. J., and Edgerton, M.
2019. Candida albicans biofilm development is governed by cooperative
attachment and adhesion maintenance proteins. NPJ biofilms and
microbiomes, 5(1), p.21.
McCarthy, M.W., Kontoyiannis, D.P., Cornely, O.A., Perfect, J.R. and Walsh,
T.J. 2017. Novel agents and drug targets to meet the challenges of resistant
fungi. The Journal of infectious diseases, 216(suppl_3), pp.S474-S483.
McEvoy, G.K. ed., 2000. AHFS drug information. 2000. American society of
health-system pharmacists
Meurman, J. H., Siikala, E., Richardson, M., and Rautemaa, R. 2007. Non-
Candida albicans Candida yeasts of the oral cavity. Communicating current
research and educational topics and trends in applied microbiology, 1(1),
p719-731.
Mogavero, S., Sauer, F.M., Brunke, S., Allert, S., Schulz, D., Wisgott, S.,
Jablonowski, N., Elshafee, O., Krüger, T., Kniemeyer, O. and Brakhage,
A.A. 2021. Candidalysin delivery to the invasion pocket is critical for host
epithelial damage induced by Candida albicans. Cellular Microbiology,
23(10), p.e13378.
Moris, D.V.; Melhem, S.C.; Martins, M.A. and Mendes, R.P. (2008). Oral
Candida spp. Colonization in Human Immunodeficiency Virus – Infected
Individuals, J. Venom. Anim. Toxins incl. Trop. Dis., 14 (2), pp. 224-257.
Mulet Bayona, J.V., Salvador García, C., Tormo Palop, N., Valentín Martín, A.,
González Padrón, C., Colomina Rodríguez, J., Pemán, J. and Gimeno
References 107
Nafisa, G., Hidana, R. and Virgianti, D.P. 2020. Influence of the Growth of
Candida albicans on Several Alternative Medium. In 2nd Bakti Tunas
Husada-Health Science International Conference (BTH-HSIC 2019) (pp. 5-
8). Atlantis Press.
Naglik, J.R., Challacombe, S.J. and Hube, B. 2003. Candida albicans secreted
aspartyl proteinases in virulence and pathogenesis. Microbiology and
molecular biology reviews, 67(3), pp.400-428.
Naglik, J.R., Gaffen, S.L. and Hube, B. 2019. Candidalysin: discovery and
function in Candida albicans infections. Current opinion in microbiology,
52, pp.100-109.
Nieminen, M.T., Novak-Frazer, L., Rautemaa, V., Rajendran, R., Sorsa, T.,
Ramage, G., Bowyer, P. and Rautemaa, R. 2014. A novel antifungal is
active against Candida albicans biofilms and inhibits mutagenic
acetaldehyde production in vitro. Plos one, 9(5), p.e97864.
Nobile, C.J. and Johnson, A.D. 2015. Candida albicans biofilms and human
disease. Annual review of microbiology, 69, pp.71-92.
Nurdin, R. S. C., Vitayani, S., Amin, S., Kadir, D., Djamaluddin, W., and
Adriani, A. 2021. Cutaneous candidiasis caused by Candida kefyr. The Pan
African Medical Journal, 38.
Oksuz, S., Sahin, I., Yildirim, M., Gulcan, A., Yavuz, T., Kaya, D. and Koc,
A.N. 2007. Phospholipase and proteinase activities in different Candida
References 108
Opulente, D.A., Langdon, Q.K., Buh, K.V., Haase, M.A., Sylvester, K.,
Moriarty, R.V., Jarzyna, M., Considine, S.L., Schneider, R.M. and Hittinger,
C.T. 2019. Pathogenic budding yeasts isolated outside of clinical settings.
FEMS yeast research, 19(3), p.foz032.
Ost, K. S., O‘Meara, T. R., Stephens, W. Z., Chiaro, T., Zhou, H., Penman, J.,
and Round, J. L. 2021. Adaptive immunity induces mutualism between
commensal eukaryotes. Nature, 596(7870), pp. 114-118.
Passos, X.S., Sales, W.S., Maciel, P.J., Costa, C.R., Miranda, K.C., Lemos,
J.D.A., Batista, M.D.A. and Silva, M.D.R.R. 2005. Candida colonization in
intensive care unit patients' urine. Memórias do Instituto Oswaldo Cruz, 100,
pp.925-928.
Patil, S., Rao, R.S., Majumdar, B. and Anil, S. 2015. Clinical appearance of oral
Candida infection and therapeutic strategies. Frontiers in microbiology, 6,
p.1391.
Pelletier, R., Alarie, I., Lagacé, R., and Walsh, T. J. 2005. Emergence of
disseminated candidiasis caused by Candida krusei during treatment with
caspofungin: case report and review of literature. Medical Mycology, 43(6),
pp. 559–564.
Perfect, J.R. 2017. The antifungal pipeline: a reality check. Nature reviews Drug
discovery, 16(9), pp.603-616.
Peters, B. A., Wu, J., Hayes, R. B., and Ahn, J. 2017. The oral fungal
mycobiome: characteristics and relation to periodontitis in a pilot
study. BMC microbiology, 17, pp.1-11.
Price, M.F., Wilkinson, I.D. and Gentry, L.O. 1982. Plate method for detection of
phospholipase activity in Candida albicans. Sabouraudia: Journal of Medical
and Veterinary Mycology, 20(1), pp.7-14.
Priya, A., and Pandian, S. K. 2020. Piperine impedes biofilm formation and
hyphal morphogenesis of Candida albicans. Frontiers in microbiology, 11,
p. 756.
Quinn, P.J., Markey, B.K., Leonard, F.C., Hartigan, P., Fanning, S. and
Fitzpatrick, E. 2011. Veterinary microbiology and microbial disease. John
Wiley and Sons.
Quinn, P.K., Coffman, D.J., Bates, T.S., Miller, T.L., Johnson, J.E., Voss, K.,
Welton, E.J. and Neusüss, C. 2001. Dominant aerosol chemical components
and their contribution to extinction during the Aerosols99 cruise across the
Atlantic. Journal of Geophysical Research: Atmospheres, 106(D18),
pp.20783-20809.
Ramos‐Pardo, A., Castro‐Álvarez, R., Quindós, G., Eraso, E., Sevillano, E. and
Kaberdin, V.R. 2023. Assessing pH‐dependent activities of virulence factors
secreted by Candida albicans. MicrobiologyOpen, 12(1), p.e1342.
Rao, C., Coyte, K. Z., Bainter, W., Geha, R. S., Martin, C. R., and Rakoff-
Nahoum, S. 2021. Multi-kingdom ecological drivers of microbiota assembly
in preterm infants. Nature, 591(7851), pp. 633-638.
Ream, K., Sandhu, A., Valle, J., Weber, R., Kaizer, A., Wiktor, D.M., Borne,
R.T., Tumolo, A.Z., Kunkel, M., Zipse, M.M. and Schuller, J. 2019.
Ambulatory rhythm monitoring to detect late high-grade atrioventricular
block following transcatheter aortic valve replacement. Journal of the
American College of Cardiology, 73(20), pp.2538-2547.
Reda, N. M., Hassan, R. M., Salem, S. T., and Yousef, R. H. A. 2022. Prevalence
and species distribution of Candida bloodstream infection in children and
adults in two teaching university hospitals in Egypt: first report of Candida
kefyr. Infection, pp. 1-7.
Richardson, J.P., Brown, R., Kichik, N., Lee, S., Priest, E., Mogavero, S.,
Maufrais, C., Wickramasinghe, D.N., Tsavou, A., Kotowicz, N.K. and
References 111
Richardson, J.P., Brown, R., Kichik, N., Lee, S., Priest, E., Mogavero, S.,
Maufrais, C., Wickramasinghe, D.N., Tsavou, A., Kotowicz, N.K. and
Hepworth, O.W. 2022. Candidalysins are a new family of cytolytic fungal
peptide toxins. MBio, 13(1), pp.e03510-21.
Richardson, J.P., Mogavero, S., Moyes, D.L., Blagojevic, M., Krüger, T.,
Verma, A.H., Coleman, B.M., De La Cruz Diaz, J., Schulz, D., Ponde, N.O.
and Carrano, G. 2018. Processing of Candida albicans Ece1p is critical for
candidalysin maturation and fungal virulence. MBio, 9(1), pp.e02178-17.
Richardson, J.P., Willems, H.M., Moyes, D.L., Shoaie, S., Barker, K.S., Tan,
S.L., Palmer, G.E., Hube, B., Naglik, J.R. and Peters, B.M. 2018.
Candidalysin drives epithelial signaling, neutrophil recruitment, and
immunopathology at the vaginal mucosa. Infection and immunity, 86(2),
pp.e00645-17.
Roberts, G.D. 1990. Laboratory methods in basic mycology. Bailly and Scott‘s
Diagnostic Microbiology. 9th ed. St Louis: CV Mosby Company Ltd,
pp.715-24.jm
Rogiers O, Frising UC, Kucharikova S, Jabra-Rizk MA, van Loo G, Van Dijck P,
Wullaert A. 2019. Candidalysin crucially contributes to Nlrp3 inflamma-
some activation by Candida albicans hyphae. mBio 10:e02221-18.
References 112
Rossney, A.S., English, L.F. and Keane, C.T. 1990. Coagulase testing compared
with commercial kits for routinely identifying Staphylococcus aureus.
Journal of clinical pathology, 43(3), pp.246-252.
Russell, C.M., Schaefer, K.G., Dixson, A., Gray, A.L., Pyron, R.J., Alves, D.S.,
Moore, N., Conley, E.A., Schuck, R.J., White, T.A. and Do, T.D. 2022. The
Candida albicans virulence factor candidalysin polymerizes in solution to
form membrane pores and damage epithelial cells. Elife, 11, p.e75490.
Salvin SB. 1951. Hemolysin from the yeast-like phases of some pathogenic
fungi. Proc Soc Exp Biol. Med., 76: 852–854.
Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Gel electrophoresis of DNA.
In Sambrook, J., Fritsch, E.F. and Maniatis, T. (Eds.) Molecular Cloning: a
References 113
Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, USA, chapter 6.
Sav, H.; Altinbas, R.; Bestepe Dursun, Z. 2020. Fungal profile and antifungal
susceptibility pattern in patients with oral candidiasis. Infez. Med., 28,
pp.392–396.
Schaller, M., Borelli, C., Korting, H.C. and Hube, B. 2005. Hydrolytic enzymes
as virulence factors of Candida albicans. Mycoses, 48(6), pp.365-377.
Scorzoni, L., de Paula e Silva, A.C., Marcos, C.M., Assato, P.A., de Melo, W.C.,
de Oliveira, H.C., Costa-Orlandi, C.B., Mendes-Giannini, M.J. and Fusco-
Almeida, A.M. 2017. Antifungal therapy: new advances in the
understanding and treatment of mycosis. Frontiers in microbiology, 8, p.36.
Seth-Smith, H. M. B., Büchler, A. C., Hinic, V., Medinger, M., Widmer, A. F.,
and Egli, A. 2020. Bloodstream infection with Candida
kefyr/Kluyveromyces marxianus: case report and draft genome. Clinical
Microbiology and Infection, 26(4), pp.522-524.
Silva, S., Rodrigues, C. F., Araujo, D., Rodrigues, M. E., and Henriques, M.
2017. Candida Species Biofilms‘ Antifungal Resistance. J. Fungi (Basel) 3,
p. 8.
Singh, D. K., Németh, T., Papp, A., Tóth, R., Lukácsi, S.,Heidingsfeld, O., and
Gácser, A. 2019. Functional characterization of secreted aspartyl proteases
in Candida parapsilosis. Msphere, 4(4), pp. e00484-19.
Sobel, J.D., Kauffman, C.A., McKinsey, D., Zervos, M., Vazquez, J.A.,
Karchmer, A.W., Lee, J., Thomas, C., Panzer, H., Dismukes, W.E. and
National Institute of Allergy and Infectious Diseases (NIAID) Mycoses
Study Group. 2000. Candiduria: a randomized, double-blind study of
References 114
Su, S., Yan, H., Min, L., Wang, H., Chen, X., Shi, J., and Sun, S. 2022. The
antifungal activity of caspofungin in combination with antifungals or non-
antifungals against Candida species in vitro and in clinical therapy. Expert
Review of Anti-infective Therapy, 20(2), pp.161-178.
Sudhan, S. S., Sharma, P., Sharma, M., and Shrivastava, D. 2016. Identification
of Candida Species in the Clinical Laboratory: A review of conventional,
commercial and molecular techniques. Int J Med Res Prof, 2(6), pp.1-8.
Talapko, J., Juzbašić, M., Matijević, T., Pustijanac, E., Bekić, S., Kotris, I., and
Škrlec, I. 2021. Candida albicans—the virulence factors and clinical
manifestations of infection. Journal of Fungi, 7(2), p79.
Tan, C. T., Xu, X., Qiao, Y., and Wang, Y. 2021. A peptidoglycan storm caused
by β-lactam antibiotic‘s action on host microbiota drives Candida albicans
infection. Nature communications, 12(1), p. 2560.
Tay, S.T., Abidin, I.A.Z., Hassan, H. and Ng, K.P. 2011. Proteinase,
phospholipase, biofilm forming abilities and antifungal susceptibilities of
Malaysian Candida isolates from blood cultures. Medical mycology, 49(5),
pp.556-560.
References 115
Timmermans, B., De Las Peñas, A., Castaño, I., and Van Dijck, P. 2018.
Adhesins in Candida glabrata. Journal of Fungi, 4(2), p. 60.
Tintelnot, K., Haase, G., Seibold, M., Bergmann, F., Staemmler, M., Franz, T.
and Naumann, D. 2000. Evaluation of phenotypic markers for selection and
identification of Candida dubliniensis. Journal of Clinical Microbiology,
38(4), pp.1599-1608.
Tsang, C. S. P., Chu, F. C. S., Leung, W. K., Jin, L. J., Samaranayake, L. P., and
Siu, S. C. 2007. Phospholipase, proteinase and haemolytic activities of
Candida albicans isolated from oral cavities of patients with type 2 diabetes
mellitus. Journal of medical microbiology, 56(10), pp. 1393-1398.
Vadiraj, S., Nayak, R., Choudhary, G.K., Kudyar, N. and Spoorthi, B.R. 2013.
Periodontal pathogens and respiratory diseases-evaluating their potential
association: a clinical and microbiological study. The journal of
contemporary dental practice, 14(4), p.610.
Van Daele, R., Spriet, I., Wauters, J., Maertens, J., Mercier, T., Van Hecke, S.
and Brüggemann, R. 2019. Antifungal drugs: what brings the future?.
Medical Mycology, 57(Supplement_3), pp.S328-S343.
Vandepitte, J., Verhaegen, J., Engbaek, K., Piot, P., Heuck, C.C., Rohner, P. and
Heuck, C.C. 2003. Basic laboratory procedures in clinical bacteriology.
World Health Organization.
Veen, M., Stahl, U. and Lang, C. 2003. Combined overexpression of genes of the
ergosterol biosynthetic pathway leads to accumulation of sterols in
Saccharomyces cerevisiae. FEMS yeast research, 4(1), pp.87-95.
Walker, K., Skelton, H. and Smith, K. 2002. Cutaneous lesions showing giant
yeast forms of Blastomyces dermatitidis. Journal of cutaneous pathology,
29(10), pp.616-618.
Wang, E., Farmakiotis, D., Yang, D., McCue, D.A., Kantarjian, H.M.,
Kontoyiannis, D.P. and Mathisen, M.S. 2015. The ever-evolving landscape
of candidaemia in patients with acute leukaemia: non-susceptibility to
caspofungin and multidrug resistance are associated with increased
mortality. Journal of Antimicrobial Chemotherapy, 70(8), pp.2362-2368.
White, P.L., Barton, R., Guiver, M., Linton, C.J., Wilson, S., Smith, M., Gomez,
B.L., Carr, M.J., Kimmitt, P.T., Seaton, S. and Rajakumar, K. 2006. A
consensus on fungal polymerase chain reaction diagnosis: a United
Kingdom-Ireland evaluation of polymerase chain reaction methods for
detection of systemic fungal infections. The Journal of Molecular
Diagnostics, 8(3), pp.376-384.
Willems, H.M., Lowes, D.J., Barker, K.S., Palmer, G.E. and Peters, B.M. 2018.
Comparative analysis of the capacity of the Candida species to elicit vaginal
immunopathology. Infection and immunity, 86(12), pp.e00527-18.
Wu, T., Samaranayake, L.P., Cao, B.Y. and Wang, J. 1996. In-vitro proteinase
production by oral Candida albicans isolates from individuals with and
without HIV infection and its attenuation by antimycotic agents. Journal of
medical microbiology, 44(4), pp.311-316.
References 117
Yasu, T., Konuma, T., Kuroda, S., Takahashi, S. and Tojo, A. 2018. Effect of
cumulative intravenous voriconazole dose on renal function in
hematological patients. Antimicrobial Agents and Chemotherapy, 62(9),
pp.e00507-18.
Yigit, N., Aktas, A.E. and Ayyildiz, A. 2008. Detection of coagulase activity in
pathogenic Candida species. Journal of International Medical Research,
36(6), pp.1378-1382.
Zhai, L., Zhou, Y., Wu, Y., Jin, Y., Zhu, Q., Gao, S., and Tian, K. 2021. Isolation
and identification of Candida tropicalis in sows with fatal infection: a case
report. BMC veterinary research, 17(1), pp. 1-4.
Zhang, L., Zhou, S., Pan, A., Li, J. and Liu, B., 2015. Surveillance of antifungal
susceptibilities in clinical isolates of Candida species at 36 hospitals in
China from 2009 to 2013. International Journal of Infectious Diseases, 33,
pp.1-4.
Zhang, Y., Muend, S., and Rao, R. 2012. Dysregulation of ion homeostasis by
antifungal agents. Front. Microbiol. 3, p.133.
Zhao, Y., Lee, M.H., Paderu, P., Lee, A., Jimenez-Ortigosa, C., Park, S.,
Mansbach, R.S., Shaw, K.J. and Perlin, D.S. 2018. Significantly improved
pharmacokinetics enhances in vivo efficacy of APX001 against
echinocandin-and multidrug-resistant Candida isolates in a mouse model of
invasive candidiasis. Antimicrobial agents and chemotherapy, 62(10),
pp.e00425-18.
Appendix
Appendix
Biofilm Formation
No.ofstrains R1 R2 R3
1 0.215 0.303 0.184
CTGCGTCTCAGAGAGTGGAGCTAATGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATT
GTTGCTCGTGTTGCCACTGGTGTTCAACAATCTATTGAAAATGCCAAGAGAGATGGCGTTCCAGACGTTG
GTCTTAATCTTGTTGCTAACGCTCCAAGACTTTTCTCTGATGTTTTTGATGGTGTCCTGGAAACTGTTAAGC
AAGCTAAAAGAGAAGGTATTGAAGATGTTCTTGAAGAACTTCTTCAAAAACTCCCAGAACTCATTACTAG
ATCAGCAGAGTCTAATTTGAAAGACAGTCAACCAGTTAAAAGAGATGCCGGCTCAGTAGCACTTAGCAA
TTTAATCAAAAAGAGTATTGAAACTGTCGGTATTGAAAGTGCTGCTCATGGTTTTTCAGATAA
Appendix
CTGGCTTTCTACAAGAGAGTGGAGCTAATGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATTGT
TGCTCGTGTTGCCACTGGTGTTCAACAATCTATTGAAAATGCCAAGAGAGATGGCGTTCCAGACGTTGGT
CTTAATCTTGTTGCTAACGCTCCAAGACTTTTCTCTGATGTTTTTGATGGTGTCCTGGAAACTGTTAAGCAA
GCTAAAAGAGAAGGTATTGAAGATGTTCTTGAAGAACTTCTTCAAAAACTCCCAGAACTCATTACTAGAT
CAGCAGAGTCTAATTTGAAAGACAGTCAACCAGTTAAAAGAGATGCCGGCTCAGTAGCACTTAGCAATTT
AATCAAAAAGAGTATTGAAACTGTCGGTATTGAAAGTGCTGCTCAATGGTTTCAGA
CTTGCTACCAGAGAGTGGAGTTAACGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATTGTTGCT
CGTGTTGCCACTGGTGTTCAACAATCTGTCGAAAATGCCAAGAGAGATGGCGTTCCAGACATTGGTCTTA
ATCTTGTTGCTAATGCTCCAAGACTTTTCTCTGACGTTTTTGATGGCGTCCTGGAAACTGTTCAACAAGCT
AAGAGAGATGGTATTGAAGATGCTCTTAATGAACTTCTTGAGCAACTCCCAAAACTTATTACTAGATCGG
CTGAATCTGCTTTGAAAGACAGTCAACCAGTTAAAAGAGATGCCGGCTCAGTAGCACTTAGCAATTTAAT
TAAAAAGAGTATTGAAACTGTCGGTGTTGAAAATGCTGCTCAATGGTTTCAAAAAGT
CGCTCTCAGAGAGTGGAGCTAATGATGACGTTGCTAATGCCGTCGTCAGATTGCCAGAAATTGTTGCTCG
TGTTGCCACTGGTGTTCAACAATCTGTCGAAAATGCCAAGAGAGATGGCGTTCCAGACATTGGTCTTAAT
CTTGTTGCTAATGCTCCAAGACTTTTCTCTGACGTTTTTGATGGCGTCCTGGAAACTGTTCAACAAGCTAA
GAGAGATGGTCTTGAAGATGTTCTTCAACAACTCCTTGATCAACTCCCACAACTCATTGCTAGATCAGCTG
AATCTGCTTTGAAAGACAGTCAACCAGTTAAAAGAGATGCTGGCTCAGTAGCACTTAGCAATTTAATCAA
AAAGAGTATTGAAACTGTCGGTATTGAAAATGCTGCTCAATGATTTTAAAAAAATCGA
المستخلص
المستخلص
اىٖذف اىشئٞسٕ ٍِ ٜزٓ اىذساسخ ٕ٘ اىزؾقق ٍِ اّزشبس ثعط ع٘اٍلو اىعلشاٗح اىزلٜ
ٗاىف٘سلللللف٘ىٞجٞض رشلللللَو رنللللل٘ ِٝاألغشلللللٞخ اىؾٝ٘ٞلللللخ )ٗ ،(Biofilmاىجشٗرْٞٞلللللض ))Proteinase
)ٗ (Phospholipaseاىلزغيػ (ٗ ، (Coagulaseإّزلبط اىَٖ٘ٞالٝسلٗ ،) Hymolysine)ِٞاّزشلبس
ع Candidalysin ECE1 ِٞث ِٞعضالد C. albicans
ف ٜاىذساسخ اىؾبىٞخ شَيذ 280عْٞخ (ٍسؾخ) .رٌ عَعٖب خاله فزشح 3اشلٖش ٍلِ اٝلبس
2022اىل ٚاة 2022ىَشظلل ٚعلشايٍ ِٞٞخزيفلل ِٞفلل ٜاالعْلبط ٗاالعَللبس غٞلش ٍنللشسٍ ِٝصللبثِٞ
ٗاخللشٝ ِٝش لزجٔ ثبصللبثزٌٖ ث لبٍشاض اىغٖللبص اىزْفسللٗ ٜداء اىَجٞعللبد اىفَلل٘ ٛفللٍ ٜسزشللفٞبد ثغللذاد
(ٍسزشفٍ ٚذ ْٔٝاىطت ٗ ٍسزشف ٚاىٞشٍ٘ك اىزعيٍٗ َٜٞسزشلفٍ ٚذْٝلٔ االٍلبٍ ِٞاىطجٞلخ اىزعيَٞٞلخ) رلٌ
صساعللخ اىعْٞللبد اىزلل ٜرللٌ عَعٖللب عيللٗ ٚسللػ امللبس اىسللبثشٗٝذ دمسللزشٗص (ٍ )SDAعللبف اىٞللٔ
مي٘ساٍفْٞٞن٘ه مَعبد ىيجنزٞشٝب ثزشمٞض ٍ 0.5يغٌ /ىزش ٗ ،رٌ رؾعل ِٞاغجلب SDAعْلذ 37دسعلخ
ٍئ٘ٝخ ىَذح رزشاٗػ ث 48-24 ِٞسبعخ.
أظٖشد ّزبئظ اىفؾ٘صبد فٕ ٜزٓ اىذساسخ أُ عَٞل علضالد اىَجٞعلبد اىجٞعلبء يلبدسح
عيلل ٚرنلل٘ ِٝأالّجلل٘ة اىغشصللٍ٘ٗ ٜاالثلل٘ا اىنالٍٞذٝللخ اٍللب األّلل٘ا األخللش ٙفيللٌ رْللزظ أًٝللب ٍَْٖللب ،مَللب
اظٖشد ّزبئظ اىضس ٍِ 102عْٞخ ٍ٘عجخ ٍِ اصو 280اُ )%57.84( 59مبّذ أّلبس ثَْٞلب 43
( )%42.16رم٘س رشَو ٍِ )%56.86( 58رغ٘ٝف اىفٌ ٗ ٍ )%43.14( 44لِ اىغٖلبص اىزْفسل، ٜ
ثَْٞب ٍْٖ 178ب مبّذ سبىجخ ،رٌ اىنشف علِ علضالد اىَجٞعلبد اىجٞعلبء ثبسلزعَبه اىطلش اىزقيٞذٝلخ
ٗاىز ٜرشَو (اىفؾص اىَظٖشٗ ٛاىَغٖش ،ٛاىَْ٘ عيٗ ٚسػ ، Chrome Candidaإّزبط األّج٘ة
اىغشصٍ٘ ، Germ tube ٜرنل٘ ِٝاالثل٘ا اىنالٍٞذٝلٔ ٗ Clamydosporeرلٌ ركمٞلذ ّزلبئظ اىزعشٝلف
ثبسللزعَبه ّظللبً VITEK-2مبّللذ اىَظللبٕش اىَظٖشٝللخ ىَسللزعَشاد C. albicansعيللSDA ٚ
ثٞعللبء إىلل ٚمشَٞٝللخ ّبعَللخ ٍ ،يسللبء ،رشللجٔ اىخَٞللشح ،رؾللذ اىفؾللص اىَغٖللش ، ٛمللبُ شللنو خالٝللب
خَٞشح اىَجٞعبد مشًٗٝب إى ٚثٞعبٗٗ ٍ ، ٛع٘د ثشاعٌ ٗ ،أمجش ثنضٞش ٍِ اىخالٝب اىجنزٞشٝخ .أظٖشد
ّزبئظ اىفؾ٘صبد فٕ ٜزٓ اىذساسخ أُ عَ ٞعضالد C. albicansمبّذ ٍْزغلخ ىالّجل٘ة اىغشصلٍٜ٘
ٗاالثلللللللللللل٘ا اىنالٍٞذٝللللللللللللخ أٍللللللللللللب األّلللللللللللل٘ا األخللللللللللللش ٙفيللللللللللللٌ رْللللللللللللزظ أًٝللللللللللللب ٍَْٖللللللللللللب.
المستخلص
ثْٞللذ اىْزللبئظ اُ ٍللِ ثلل 102 ِٞعضىللخ مبّللذ ٕ C. albicansلل ٜاالمضللش شلل٘ٞعب ثلل ِٞاالّلل٘ا ثْسللجخ
(% 68.63)70صٌ ريزٖب C. tropicalisثْسجخ (%10.78)11صٌ C.ٗ C. krusei ( %5.88)6
C. parapsilosis (% 4.9)5 kyfer (%5.88)6ثَْٞب مبّذ ٗ C. glabrata (% 3.9) 4رَضلو
اىْسللجخ االيللو ثلل ِٞاالّلل٘ا رللٌ فؾللص يبثيٞللخ عللضالد اىَجٞعللبد ىألدٗٝللخ اىَعللبدح ىيفطشٝللبد ثطشٝقللخ
ٗ ،اىزل ٜأعشٝلذ عيل ٚاىْؾل٘ اىَ٘صل ٚثلٔ فلٗ ٜصٞقلخ (CLSI) M44-A.أظٖلشد اّزشلبس اىقلش
اىعللضالد دسعللخ عبىٞللخ ٍللِ اىؾسبسللٞخ ىألٍف٘رشٝسلل-ِٞة )ٗ (%93.14مي٘رشَٝللبصٗه )(%90.20
ّٗٞسزبر (%85.92) ِٞثَْٞب مبّذ علضالد اىنبّذٝلذا رَزيلل ٍقبٍٗلخ ثْسلجخ ( )% 42.86ىنلو ٍلِ
ف٘سٝنّ٘بصٗه ٗ مٞز٘مّ٘بصٗه .
ٗيذ مبّذ ّزٞغخ رن٘ ِٝاألغشٞخ اىؾٝ٘ٞخ ثبسزخذاً غشٝقخ اىصفبئؼ اىذيٞقخ ٍِ %48.57علضالد C.
albicansمبّذ ٍْزغخ ي٘ٝخ ىألغشٞخ اىؾٝ٘ٞلخ % 40 ٗ ،مبّلذ ٍز٘سلطخ االّزلبط ىيغشلبء اىؾٞل٘، ٛ
ثَْٞب % 4.29غٞش ٍْزغخ ىيغشبء اىؾٗ ٛ٘ٞمبّذ ٕزٓ اىْزبئظ ٍزطبثقخ ٍ ّزبئظ اخزجبس األّج٘ة.
رٌ فؾص اّزشبس ع ECE1 ِٞث 70 ِٞعضىخ ٍِ عضالد اىَجٞعبد اىجٞعبء ثبسزخذاً رقْٞخ رفبعو
اىجيَشح اىَزسيسو (ٗ ، )PCRأظٖش اىنشف اىغضٝئ ٜىغ ECE1 ِٞث 70 ِٞعضىخ ٍِ عضالد
اىَجٞعبد اىجٞعبء اىز ٜرٌ عَعٖب أُ ْٕبك )%60( 15عضىخ رٌ عَعٖب ٍِ رغ٘ٝف فٌ اىزم٘س
ٍ٘عجًب ىيغ ٍِ )%37.5( 6 ٗ ECE1 ِٞاىغٖبص اىزْفس ٜعي ٚاىز٘اى ، ٜثَْٞب مبّذ ٍِ )٪40( 10
اىعضالد اىز ٜعَعذ ٍِ رغ٘ٝف اىفٌ ىإلّبس ٍ٘عجخ ىيغ ِٞاىَسزٖذف ٗأٝعب ٍِ )٪62.5( 10 ،
اىغ.ِٞ ٕزا عيٚ رؾز٘ٛ مبّذ ىإلّبس اىزْفسٜ اىغٖبص
الشكر واالمتنان
اٗال ٗيجو مو شٜء اىؾَذ ٗاىشنش هلل رعبى ٚعي ٚمضشح اىجشمبد غ٘اه عَيٜ
.اىجؾض ٜالسزنَبه اىجؾش ثْغبػ ىٞنُ٘ ٍفٞذا ىخذٍخ ٗغْْب اىغبى ٜاىعشا
أٗد أُ أعجش عِ اٍزْبّ ٜاىعَٞق ٗاىصبد ٗشنش ٛىَششف ٜاىَ٘يش األستار
المساعذ الذكتىر صفاء الذَه أحمذ القُسٍ ،اىز ٛعيٍَْْٖ ٜغٞخ إعشاء
اىجؾش ٗرقذ ٌٝأعَبه اىجؾش ثكٗظؼ ص٘سح ٍَنْخ ،مبُ ششف مجٞش ى ٜأُ
أعَو ثبششافٔ
مَب أٗد أُ أيذً اىشنش إى ٚعَٞذح اىنيٞخ األستارة الذكتىرة سمُرة واجٍ كاظم
ٗاٝعب اى ٚيسٌ عيً٘ اىؾٞبح مبفخ.
أيذً اىشنش إى ٚاألستار الذكتىر محسه هاشم رسه
عي ٚمو اىَسبعذح اصْبء فزشٓ دساسزٜ
ٗمزىل خبىص شنشٗ ٛرقذٝش ٛلألستار المساعذ الذكتىر أحمذ عبذ الجبار
سلُمان واالستارة الذكتىرة ماجذة هادٌ مهذٌ عي ٚرقذ ٌٝاىَش٘سح اىعيَٞخ
اىقَٞخ ىٜ
ٗؽج ٜىعبئيز ٜإلسشبدٌٕ ٗدعٌَٖ اىالٍزْبٕٜ ٗأٗد أُ أعجش عِ اٍزْبّ ٜاىخب
أٗد أُ أعجش عِ خبىص اٍزْبّ ٜىصذٝقبر ٜوىر الهذي ،سالٍ خضُر
ٗخزبٍب ً شنش ٗرقذٝش ىنو ٍِ اسٌٖ ف ٜدعٌ ٕزا اىجؾش ٍِٗ ...دعب ى ٜثذع٘ح
صبديخ عضإٌ هللا عْ ٜمو خٞش عضاء اىَؾسْٜ
سكينه
االهداء
إى ٚهللا اىقذٝش عي ٚاىٖذاٝخ ٗاىق٘ح ٗاىؾَبٝخ ٗاىَٖبساد ٗإعطبئْب اىصؾٔ
إى ٚصبؽت اىشرجخ اىعبىٞخ اىز ٛششفْ ٜثؾَو اسَٔ ...والذٌ العزَز
إىّ٘ ٚس عٍ ، ْٜٞؤّسخ سٗؽ ، ٜاى ٚسٞذح اىقيت ٗاىؾٞبح ،أمٍ ،ثم أمٍ ،ثم
أمٍ ٍِ ،أعو ؽجٖب ٗ ،دعبئٖب ٗ ،عْبٝزٖب ٗ ،رعؾٞبرٖب ٍِ أعو رضقٞفٜ
ٗرٖٞئز ٜىيَسزقجو ٗاىز ٜسافقزْ ٜصالرٖب ٗالسزَشاسٕب ف ٜرقذ ٌٝاىذعٌ
اىَعْ٘ٗ ٛاىشٗؽٗ ٜاىعبغفٗ ٜاىَبىٜ
إى ٚسٗػ صَْٞخ رٕجذ إى ٚثبسئٖب اىز ٛأفزقذٓ ٍِ مو ييج ٜإى ٚاىذسح اىز ٜأّبسد
غشٝق ٜثنو فخش ٗاعزضاص إى ٚأخ ٜاىشٖٞذ اىجطو حُذر رشُذ
سكينه
س َّما أ ُ ْخف َِي لَ ُهم من قُ َّر ِة أَ ْع ُي ٍن َج َزاء ِب َما َكا ُنوا
َفال َت ْعلَ ُم َن ْف ٌ
َي ْع َملُونَ
جامعة بغداد
رساله
مقدمة الى مجلس كلية العلوم للبنات /جامعة بغداد وهي جزء من متطلبات نيل درجة
تقدم بها
سكينه رشيد مجيد دخان
بأشراف
ا.م.د .صفاء الدين احمد شنتر القيسي
2023م 1444هـ