BACHELOR´S THESIS / BIOMEDICAL ENGINEERING 2021

A First Study for the Establishment of a Source

of Vitamin B12 as of the Genetic Modification
of the Cyanobacteria Arthrospira platensis

Daniel Lechuga Morente

A First Study for the Establishment of a Source of
Vitamin B12 as of the Genetic Modification of the
Cyanobacteria Arthrospira platensis

Daniel Lechuga Morente

Bachelor’s thesis UPF 2020/2021

Thesis supervisor(s):

Dr. Marc Güell, (Department of Experimental and Health Sciences)

Dedicatory

I would like to dedicate this work, first of all, to my parents and my sister, who,
throughout my life, but especially these last four years, have supported me at all times,
both in the good and the not so good moments, have put up with me in times of stress that
even I could not stand, have motivated me to improve day by day and have tried to give
me what they had and what they had not to give me values and an education of which I
am proud. Secondly, to my partner for knowing how to understand me, support me,
motivate me at all times and making me feel proud of the person I am with. In third place,
to all my friends with whom I have unloaded in the difficult moments, and I have enjoyed
so much in the good times. And, last but not least, to my grandparents and my friend
David, who I know would be proud to see me achieving my goals.
Acknowledgments

Firstly, I would like to thank all the staff of the Translational Synthetic Biology of the
DCEXS from PRBB laboratory for welcoming me and allowing me to carry out the
experimental part of this work in their facilities. Secondly, I would like to thank Marc
Güell for his advice and supervision of the study, as well as his constant willingness to
offer me his help. Thirdly, I would like to give special thanks to Nastassia Knödlseder
for her patience in teaching me everything necessary to carry out this study, as well as
supervising all the experimental part of this work. Finally, I would also like to thank Javier
Macía for providing the Arthrospira platensis strain and all necessary materials and tips
to deal with it.
Summary/Abstract
Cobalamin de novo synthesis appears to be restricted solely to some bacteria and archaea.
In humans, this nutrient is usually acquired through the consumption of animal products.
However, it can lead to a vitamin B12 deficiency in people with plant-based lifestyle
where the consumption of animal products is minimal. Therefore, we investigated in this
study the possibility of creating a source of cobalamin from cyanobacteria, a
photosynthetic and non-nitrogen-fixing blue-green algae. Arthrospira platensis, an edible
cyanobacteria, can produce a pseudovitamin B12 but lack enzymes involved in the
production of the active variant which can be metabolized by humans and used as a
vitamin B12 source. Therefore, we compared the metabolic pathways of the
pseudovitamin B12 synthesized in the cyanobacteria Arthrospira platensis with the
canonical synthetic pathways of vitamin B12 discovering that the cobT, cobC and cobS
genes, key players in the binding of the lower ligand characteristic of vitamin B12, are
the main proteins absent in the metabolic pathways of cyanobacteria. Subsequently, we
designed a transformation system based on Tn5 transposition that could bridge the
differences between the two pathways. For this purpose, the genes cblT and cblS, from
the thermophilic bacillus Geobacillus (G.) Kaustophilus with the ability shown to
substitute the action of the cob genes in other species, have been selected to constitute the
Tn5 transposon, as well as a resistance to the antibiotic spectinomycin.

Keywords
Synthetic biology, cyanobacteria, vitamin B12, Tn5 transposition.
Prologue

It is thought that meat was incorporated into the diet of our ancestors at least 2.6 million
years ago playing a key evolutionary role in man. It has been suggested that without its
inclusion in the diet, it is unlikely that evolving man could have achieved their unusually
large and complex brain while simultaneously continuing their evolutionary trajectory as
large, active, and highly social primate [1]. This statement is mainly argued for the
nutritional value of this product. It is considered one of the most valuable foods due to its
content of B vitamin complex, vitamins A and D, iron, zinc and, especially, protein [2].
However, despite the important role that meat has played in our evolutionary process, the
constant increase of its consumption over the years have led to a situation where
environmental, nutritional, and ethical problems have raised [3]–[7]. This scenario has
led to widespread dissatisfaction in some sectors producing that public trends opposed to
the practices related with livestock have emerged refusing to consume animal products.
Nevertheless, as we have already mentioned, meat provides us with many nutrients that
are difficult to find in other foods, therefore, these collectives sometimes do not see their
nutritional demands fully satisfied and must resort to food supplements. Then, the present
study, Bachelor’s Thesis titled "A first study for the establishment of a source of vitamin
B12 as of the genetic modification of the cyanobacteria Arthrospira platensis" has been
developed trying to approach the difficulties that collectives, such as veganism and
vegetarianism, can experience regarding their nutritional requirements and, concretely,
their vitamin B12 demands.
According to several studies, deficiency vitamin B12 rates of these collectives for specific
populations were as follows: 62% among pregnant women, between 25% and almost 86%
among children, 21-41% among adolescents, and 11-90% among the elderly [8], [9]. So,
considering the high prevalence of this medical condition, the main aim of this study has
been to establish the first step for the development of a new source of vitamin B12 that
does not come from any animal product. In that sense, the edible cyanobacteria
Arthrospira platensis has been investigated to fulfil this role since, apart from containing
large amounts of high-quality proteins and hepatoprotective, antiviral and anticholesterol
properties, it is known that it can synthesize very similar corrinoid compounds as
pseudovitamin B12.
Achieving this ultimate goal, we will be closer to meet the needs of the new dietary trends
which are becoming increasingly popular and, consequently, we will contribute to the
improvement of a society that increasingly will have more alternatives to live in a freer
way where we will be able to follow our ideals with the same opportunities as others.
Index

1. Introduction ................................................................................................................ 1
1.1. Vitamin B12................................................................................................................. 1
1.2. Arthrospira platensis ................................................................................................... 4
1.3. CblT and cblS enzymes ............................................................................................... 6
2. Methods ................................................................................................................... 7
2.1. Microorganisms and culture conditions ....................................................................... 8
2.2. Growth assessment under the proposed culture conditions ......................................... 9
2.3. Metabolic pathways analysis: A bioinformatic approach .......................................... 10
2.4. Design of the customized Tn5 transposon pCblTS.................................................... 11
2.5. Preparation of the Tn5 transposome complex and A. platensis electroporation ........ 11
3. Results .................................................................................................................... 12
3.1. Arthrospira platensis growth assessment .................................................................. 12
3.2. Findings on metabolic pathways analysis .................................................................. 13
3.3. Designed Tn5 transposon pCblTS ............................................................................. 16
3.4. Identification and survival observation of A. platensis transformants ....................... 16
4. Discussion .............................................................................................................. 19
4.1. Full spectrum LED lamps performance for A. platensis culture................................ 19
4.2. Influence of initial inoculation on A. platensis growth .............................................. 20
4.3. Anaerobic synthesis of corrin ring by A. platensis .................................................... 20
4.4. Addition of the lower ligand of pseudovitamin B12 by A. platensis ......................... 21
BIBLIOGRAPHY ......................................................................................................... 26
5. Supporting material ............................................................................................. 33
5.1. Plasmid pCblTS sequence ......................................................................................... 33
5.2. A. platensis culture..................................................................................................... 35
List of figures

Figure 1. Different corrinoid-compounds ........................................................................ 1

Figure 2. Vitamin B12 synthetic pathways. .................................................................... 3
Figure 3. Arthrospira platensis.. ...................................................................................... 4
Figure 4. Differences between Vitamin B12 and Pseudovitamin B12 ............................ 5
Figure 5. CblT and cblS enzymatic activity. ................................................................... 7
Figure 6. LED lamp light spectrum emitted. ................................................................... 9
Figure 7. Set up for Spirulina culture .............................................................................. 9
Figure 8. Absorbance vs Wavelenghts. ......................................................................... 10
Figure 9. Growth curves of Spirulina cultures with different initial inoculations. ........ 13
Figure 10. Cultured Spirulina seen under microscope................................................... 13
Figure 11. Metabolic pathway for the inclusion of the lower ligand into the corrin ring in
Arthrospira platensis. ..................................................................................................... 14
Figure 12. Riboflavin metabolism. ................................................................................ 14
Figure 13. Synthetic metabolic pathway of corrin ring in Arthrospira platensis. ......... 15
Figure 14. Plasmid pCblTS ........................................................................................... 16
Figure 15. Cells on top of the Spirulina medium 0.8% agar with spectinomycin plates
seen under microscope (10x) .......................................................................................... 17
Figure 16. Cells inside of the Spirulina medium 0.8% agar with spectinomycin plates
seen under microscope (10x) .......................................................................................... 18
Figure 17. Sonicated cells plated on the spectinomycin containing medium ................ 18
List of tables

Table 1. Comparison of Zarrouk’s medium and the medium used in this study ............. 8
1. Introduction

1.1. Vitamin B12

Vitamin B12 (cyanocobalamin or cobalamin) is a water-soluble molecule that belongs to

the corrinoids family, a group of compounds characterized by its structural skeleton called
corrin ring [10], [11]. The corrin ring contains a central cobalt atom coordinated by four
pyrrole groups and two axial ligands (upper and lower) that are bonded to the central
cobalt atom [12]. The nature of these ligands determines the class of the present corrinoid.
On the one hand, the upper (𝛽) ligand can be a cyano (CN), methyl (CH3), hydroxyl (OH)
or 5'deoxyadenosyl group [13]. On the other hand, the lower (𝛼) ligand can be in the form
of the complex pseudonucleotide 5,6-dimethylbenzimidazole (DMB), an adenine or a 2-
methyl-adenine group [14]. In the case of cobalamin, the upper and lower axial ligands
are a CN group and DMB, respectively. In Figure 1, a graphical description of the above
explanation is provided.

Figure 1. Different corrinoid-compounds

Regarding cobalamin availability, it is only found in products fermented by some

bacteria, foods derived from the animals' tissues which have ingested B12-containing
organisms, or which have obtained the vitamin from B12-producing elements of their
commensal microflora [13]. In our case, vitamin B12 is obtained from our daily diet, on
the one hand, consumers of animal products acquire the vitamin most often from the flesh
of other animals [15], and, on the other hand, non-meat-eating people, acquire it from
vitamin B12 supplements or from fortified foods such as fortified plan-based milk and
fortified cereals [8].
After cobalamin absorption by the distal ileum [16] and its entry into the circulation 3-4
hours later [17], it is only required for two enzymatic activities, but it is nonetheless
essential. On the one hand, (R)-methyl-malonyl-CoA mutase is involved in the
metabolism of propionyl-CoA which is derived from the degradation of compounds such
as thymine, valine, methionine and odd-chain fatty acids. This B12-dependent enzyme
1
catalyses the rearrangement of propionyl-CoA after its carboxylation and epimerization
to succinyl-CoA, which then enters the Krebs cycle. On the other hand, vitamin B12 is
also involved in the generation of the methionine amino acid. Methionine synthase
requires vitamin B12 to methylate homocysteine to form the amino acid [18].
According to US National Institutes of Health, 2.4 mg is the recommended daily intake
to be able to perform the previous explained enzymatic processes for people over 14 years
old. Nevertheless, these levels are not always reached being pernicious anaemia,
malabsorption, or a dietary insufficiency (due to following a strict vegan diet), the main
reasons for the deficiency development of the vitamin in question [10].
Cobalamin has the most complex structure of all the vitamins synthesised by bacteria with
around thirty genes being required for its biosynthesis. Bacteria such as Pseudomonas
denitrificans, Salmonella typhimurium or Propionibacterium freudenreichii (shermanii)
synthesize vitamin B12 by two complex different ways, one oxygen dependent
(Pseudomonas denitrificans) and other oxygen-independent (Salmonella typhimurium
and Propionibacterium freudenreichii (shermanii)) [19], [20]. The two existing routes are
very similar, however, due to the early insertion of cobalt in the anaerobic pathway the
remaining intermediates are cobalto-complexes and therefore require enzymes with
different substrate specificities than the intermediates in the aerobic pathway although
many of the reactions catalysed are similar [11]. As it can be seen in Figure 2, both routes
start from the formation of porphobilinogen from aminolevulinic acid (ALA). Then, via
the hemBCD gene complex, Uroporphyrinogen III is synthesized. At this point, the two
pathways begin to differentiate. In the case of anaerobic case, CysG methylates
Uroporphyrinogen III to obtain Syrohidrochlorin (Precorrin 2). Then, the central cobalt
atom of the ring is inserted via CysG and cbiK generating Co-syrohidrochlorin (Cobalt-
precorrin 2). Consecutively, gene complex cbi (cbiL, cbiH, cbiF, cbiG, cbiD, cbiJ, cbiT,
cbiE, cbiC, cbiA) produce, from precorrin, 2 Cob(II)yrinate a,c diamide. Afterwards,
cobA, cbiP, cbiB and cobU modulates the final synthetic steps of the corrin ring obtaining,
finally, Adenosine-GDP-cobinamide (Ado-GDP-cobinamide).
Conversely, in the case of aerobic pathway, starting from Uroporphyrinogen III, cobA
methylates this intermediary and obtains Precorrin 2. Next, cobI, cobG, cobJ, cobM,
cobF, cobK, cobL, cobH and cob modulates the intermediary steps to create the different
pre corrin molecules until create Hydrogenobyrinate a,c diamide. At this moment, in the
oxygen-dependent pathway, the cobalt atom insertion takes place through the action of
cobN, cobS and cobT [11], [12].
Once the corrin ring is formed, the lower axial ligand is inserted. To perform this step,
the two pathways are again similar. First of all, cobT activates the lower ligand base at
the expense of nicotinate mononucleotide (NaMN) to yield 𝛼-ribazole-5'-phosphate (𝛼-
RP), and finally cobS attach 𝛼-RP to Ado-GDP-cobinamide [12], [19]–[21]. However,
some studies have suggested the possibility of an additional enzyme (cobC) responsible
for dephosphorylating 𝛼-RP, producing 𝛼-ribazole (𝛼-R), before the final attachment to
the corrin ring [22].
As it can be seen, the two metabolic pathways are very similar. Nevertheless, some main
differences have to be taken into account. The first one is the moment in which the central
cobalt atom is inserted to the corrin ring, being at the initial steps of the corrin ring
synthesis in the anaerobic pathway (after the precorrin 2 synthesis) and, in the aerobic
case at the final of the corrin ring formation (after hydrogenobyrinate a,c diamide
production). The second one, and very related with the first, is the name of the genes
responsible to perform the corrin ring synthesis; called cob in the oxygen-dependent case
and cbi in the oxygen-independent.

2
Figure 2. Vitamin B12 synthetic pathways.

3
1.2. Arthrospira platensis

As it has been stated in the previous subsection, cobalamin synthesis is restricted to some
bacteria and archaea, however this does not mean that other organisms cannot produce
very similar compounds that have been confused with cobalamin for a long time. One
example is the case of the vitamin B12 synthesis by Arthrospira platensis or, as it is better
known, Spirulina.
The term Spirulina refers to various species such as Arthrospira argentina, Arthrospira
miniata or Arthrospira tenuis among others. However, Arthrospira platensis is the
predominant species and which we normally refer to as Spirulina. A. platensis is an
unbranched, helicoidal, filamentous blue-green algae or cyanobacterium [23] (see Figure
3).

Figure 3. Arthrospira platensis. An unbranched, helicoidal, filamentous blue-green algae seen under
microscope.

In certain lakes in Sub-Saharan Africa and formerly in Mexico and Central America,
alkaline conditions of pH 10-12 are found to promote the growth of this microalgae. This
fact has allowed certain communities to use A. platensis as a food source. There are even
cases where Spirulina has been known to serve as the sole source of nutrition in certain
communities in times of famine, and the entire native populations have existed eating
only Spirulina for over a month at a time [24].
Spirulina contains about 60 to 70% of proteins, nucleic acids and amino acids
recommended by the Food and Agriculture Organization [23]. It also contains beta-
carotene and absorbable iron and high levels of vitamins, phenolic compounds, gamma-
linolenic acid, and other essential fatty acids [25]. Moreover, many preclinical studies
suggest that Spirulina cells have therapeutic properties such as hepatoprotective, antiviral
and anticholesterol activities [26]–[28].
In addition to these important nutritional and therapeutic qualities, there are other factors
that make this cyanobacterium an organism of great interest. Spirulina can fix CO2
through photosynthesis (a fact that has allowed to explore applications for environmental
purposes), it is easy to cultivate, has a high growth rate and, apart from the high protein
levels mentioned above, the low levels of nucleic acids compared to other species used
for similar purposes such as fungi or bacteria means that the risk of having high levels of
uric acid is lower when this product is consumed [29], [30]. All and possessing these

4
characteristics, Spirulina did not gain the importance it deserved until it was used recently
as a dietary supplement in long-term space missions for NASA and European Space
Agency [31].
Nevertheless, not all its nutritional capabilities have always been so clear and some of its
qualities have been called into question. Regarding its vitamin B12 content and its
bioavailability have been widely discussed. Spirulina was initially believed to contain
large amounts of vitamin B12 or cyanocobalamin, however, as Herbert and Drivas (1982)
reported, most of vitamin B12 found in the cyanobacteria are biologically inactive
corrinoid-compounds [32]. Moreover, other studies suggested that these corrinoids-
compounds could block the metabolism of B12 and showed that they were also not
bioavailable in mammals [33]. Finally, Watanabe et al. (1999) finally concluded that the
predominant cobamide of Spirulina is Co-[𝛼-(7-adenyl)]-Co-𝛽-cyanocobamide
(pseudovitamin B12) [34].
Pseudovitamin B12, as vitamin B12, is a corrinoid-compound that its unique difference
remains on the nature of their 𝛼 ligands. As it has been explained before, in the case of
cobalamin, DMB is the natural lower ligand. Conversely, the group that performs this
role in pseudovitamin B12 is an adenine (see Figure 4).

Figure 4. Differences between Vitamin B12 and Pseudovitamin B12. A: Vitamin B12. B: Pseudo-vitamin
B12

Despite the similarities between the structure of the two molecules, pseudovitamin B12
and the idea of modifying the metabolic pathways to convert this molecule into active
vitamin B12 have never been a popular subject of study. This fact is most likely since
Spirulina's potential is limited by the lack of a transforming system that is able to improve
the quality of its biotechnological capacity [35].
It has been well documented that the digestion of transforming DNA by host nucleases,
especially endonucleases, is a major barrier for the successful DNA transfer in
cyanobacteria and other organisms [36], [37]. Preventing transforming DNA from

5
digestion by nucleases, such as by DNA methylation [38], [39] and the use of a nuclease-
deficient host [40]–[42], has been reported to increase the efficiency of gene transfer,
provided that the host is transformable. Indeed, the first research group that achieved a
gene transfer system in a filamentous cyanobacterium developed a specific shuttle vector
and transformation procedure to overcome the problem [43]. However, the genome
sequences of Arthrospira spp. revealed a large number of restriction–modification (RM)
systems [44], [45]. A fact that makes highly impractical to protect its DNA. In order to
overcome the limitations above mentioned in the process of Spirulina transformation,
some articles have made several attempts to create a standardized method for the
transformation of this cyanobacterium in which they have used various tools and methods
[35], [46], [47].
The first and common in previous studies has been the use of the Tn5 transposon. A Tn5
transposon is a DNA sequence flanked by 19 bp corresponding to the recognition
sequences for the Tn5 transposases. These 19 bp are named Mosaic Ends (ME). Tn5
transposon mechanism is used to incorporate the sequence flanked by MEs into the
genomic DNA of a host organism [48]. This element was used effectively in many studies
to create stable mutant strains in cyanobacteria [49]–[51] and was also reported for
introducing DNA into the genome of A. platensis strain C1 [35], [46], [47].
The second tool used is the Type I Restriction Inhibitor (Type I RI) [35], developed from
a phage protein called Ocr. Ocr protein of bacteriophage T7 is the most studied DNA
mimic and functions to block the DNA-binding groove of Type I DNA
restriction/modification enzymes. This binding prevents the enzyme from cleaving
invading phage DNA [52]. Therefore, the use of Type I RI, theoretically, significantly
increases transformation efficiencies of unmodified DNA in bacterial strains with type I
Restriction-modification systems as in the case of Spirulina [53].
Moreover, another key point in creating an efficient transformation system is the selection
of a strong host promoter that controls the expression of the selectable marker gene.
Previous studies have already concluded the ability of the phycocyanin promoter (PCp)
to regulate the expression of the reporter green fluorescent protein (GFP) in heterologous
hosts [35], [54].
Another tool used to facilitate the insertion of DNA into Spirulina is sonication.
Sonication refers to the process of applying sound energy with ultrasonic frequencies
(>20 kHz) to agitate particles or discontinuous fibers in a liquid [55]. In previous studies
[46], [47], this technique has been used to break the spiral filaments characteristic of
Spirulina and to obtain single cells facilitating the delivery of foreign DNA.
Finally, electroporation has been a tool commonly used in the attempt of describing a
protocol for Spirulina transformation [35], [46], [47]. It is a physical transformation
method that uses an electrical pulse to create temporary pores in cell membranes through
which substances like nucleic acids can pass into cells. It is a highly efficient strategy for
the introduction of foreign nucleic acids into many cell types [56]. Also, this procedure
has advantages over other methods since it requires only exogenous DNA and washed
host cells.

1.3. CblT and cblS enzymes

Salmonella (S.) enterica synthesizes the corrin ring de novo following the anaerobic
pathway [57], [58]. This bacterium incorporates different ligand bases as a function of
oxygen in the environment. Under microaerophilic conditions, S. enterica synthesizes
cobalamin, but under anoxic conditions S. enterica incorporates adenine or 2-

6
methyladenine into the final product of the pathway [59] producing pseudovitamin B12.
However, when cobT enzyme is lacked, the species is unable to produce vitamin B12.
In that sense, T.A Mattes et al. (2016) discovered the action of cblT and cblS enzymes to
substitute the activity of cobT when it was lacked. CblT and cblS, originally from the
thermophilic bacillus Geobacillus Kaustophilus, were described as two proteins which
can salvage, with the presence of 𝛼-R in the medium, 𝛼-R exogenous and phosphorylate
it producing 𝛼-RP (the molecule inserted as a lower axial ligand in cobalamin). As it can
be seen in Figure 5, cblT is responsible for recruiting exogenous 𝛼-R and cblS acts as a
𝛼-R kinase.

Figure 5. CblT and cblS enzymatic activity.

Therefore, taking into account all the information explained during this section regarding
the nature of the pseudovitamin B12 produced by Spirulina, the similarities with its
functional homologous, the limitations that we find when improving the filamentous
microalgae in a biotechnological way, and the enzymatic activity of cblT and cblS, in this
study, first of all, the metabolic pathways of the pseudovitamin B12 synthesized by the
cyanobacteria A. platensis has been compared with the canonical synthetic pathways of
vitamin B12. Then, bearing in mind the results of that first research, the design of a DNA
sequence that could bridge the differences between the two pathways, including the gene
sequences of cblT and cblS, has been carried out. And, finally, the transformation of
Spirulina for the insertion of the designed sequence has been performed. The present
study has allowed to increase the knowledge of A. platensis, to test which
biotechnological techniques are the most promising for the genetic manipulation of the
cyanobacteria, and, finally, to suggest the establishment of a first contact for the creation
of a source of vitamin B12 that is not based on animal products.

2. Methods

In the present section, the procedures performed, and the materials required for each
technique are described in detail. In first place, the methodology to culture A. platensis is
reported. Secondly, the pipeline followed as well as the bioinformatic tools used for
investigating the metabolic pathways related with pseudovitamin B12 and vitamin B12

7
are outlined. Then, it is exposed the way in which the plasmidic DNA sequence has been
designed. And, at the end of this section, the techniques implemented regarding the
transformation system for A. platensis are described.

2.1. Microorganisms and culture conditions

An initial culture with different strains of A. platensis was obtained as a gift from
Professor Javier Macía (Department of Experimental and Health Sciences, Universitat
Pompeu Fabra, Barcelona, Spain), who previously acquired it from the Spirulina farm
Espirulina.BIO1 (Almenar, Lleida, Spain). Cyanobacteria were grown in a liquid medium
composed by the macro and micronutrients that appears in Table 1. In the same table, it
can be seen the differences between the medium used with the one that is normally
employed for Spirulina culture, called Zarrouk’s medium [60].

Medium used in the present study Zarrouk’s Medium

Concentration Concentration
Constituent Constituent
(g/L) (g/L)
K2HPO4 0.5 K2HPO4 0.5
NaNO3 2.0 NaNO3 2.5
NaCl 5.0 NaCl 1.0
MgSO4 · 7H2O 0.2 MgSO4 · 7H2O 0.2
CaCl2 0.04 CaCl2 0.04
FeSO4 0.01 FeSO4 0.01
NaHCO3 16 NaHCO3 16.8
EDTA 0.08
A5 micronutrient sol.* 1 mL/L
K2SO4 1.0

Table 1. Comparison of Zarrouk’s medium and the medium used in this study. On the left, composition of
the medium used for the culture of Arthrospira platensis in this study. On the right, composition of
Zarrouk’s medium.

Apart from the culture medium, there are other vitally important factors that one has to
bear in mind [61]. In first place, like photosynthetic plants, growth of microalgae depends
mainly on the quality and quantity of light, particularly in a controlled environment [62].
Usually, the light source used for its cultivation is the sun, due to it radiates all light
spectrum, including short (450-475nm) and long (650-675nm) wavelengths necessary for
photosynthesis [63]. In addition, sunlight ensures, along with periods of light, periods of
darkness perfect for the microalgae to respire and, moreover, to prevent the culture from
dying by photolysis, i.e., excess of light. However, since the days the experiments were
carried out the sky was overcast and the culture did not receive the enough light to grow
optimally, the explained light conditions were replicated using a light emitting diodes
(LED) lamp for plant cultivation (Bozily 150W Waterproof Grow Light, BozilyEU) with
the light spectrum shown in Figure 6. Light and darkness periods of 12h were ensured

1
Espirulina.BIO https://espirulina.bio/

8
with a programmable switch (Orbegonzo PG 02, Orbegonzo) and the intensity of light
applied to the culture was determined computing the Photosynthetic Photon Flux Density
(PPFD). To do that, an online convertor of luminous flux (lux) to PPFD2 was applied over
the lux measured by luxmeter LX1330B (Dr.Meter). Finally, the intensity light used was
100 𝜇mol photons m-2 s-1 (≈ 7400 lux).

Figure 6. LED lamp light spectrum emitted.

In second place, and very important is the temperature of the culture medium, this
condition affects directly on the growth rate and quality of spirulina [64]. In this study,
Spirulina was grown at room temperature (22-25ºC), a slightly low temperature compared
to the optimum (35ºC), but which prevented rapid evaporation of the medium of a small-
sized culture. Finally, agitation and aeration of the culture are also required [65]. To
satisfy these requirements, a beaker with rounded angles as a container to avoid the
sedimentation of cells in the corners, and an air pump (BOYU S-4000b) to aerate and
agitate the culture by bubbling were selected. In Figure 7, a picture of the final culture set
up is provided.

Figure 7. Set up for Spirulina culture

2.2. Growth assessment under the proposed culture conditions

Once the conditions to culture Spirulina were selected and applied, the growth of the
cyanobacteria was assessed. For this purpose, the optical density (OD) was the parameter

2
Online convertor of luminous flux (lux) to PPFD:
https://www.waveformlighting.com/horticulture/convert-lux-to-ppfd-online-calculator

9
selected to stipulate the number of microalgae present in the culture and, therefore, to be
able to see the changes in growth.
First, to determine the wavelength at which the OD would be calculated, the OD of the
culture medium (blank) was measured at different wavelengths, from 250nm to 750nm
with 10nm intervals through the plate reader Infinite® 200 Pro (Tecan). In that way, we
observed at which wavelength the possibility of appreciating changes in absorbance was
more susceptible. As it can be seen in Figure 8, the absorbance peak was obtained at
470nm, coherent value if we take into account that this wavelength is one of those
reflected by the chlorophyll (pigment produced by cyanobacteria) [66]. Then, different
cultures with different initial inoculations, i.e., different initials OD (0.123, 0.232, 0.352)
were obtained from an initial 0.4 OD470 saturated culture illuminated with sunlight and
aerated with a pump air. The three cases were assessed during the first 10 h, measuring
the OD470 after each hour.

Figure 8. Absorbance vs Wavelenghts.

2.3. Metabolic pathways analysis: A bioinformatic approach

Since no studies have determined why Spirulina cells have the ability to synthesize
pseudovitamin B12 but not cobalamin, a research about Spirulina’s and the B12-
synthesizing bacteria’s pathways has been carried out looking for the place in which the
two metabolic paths differ from each other and, consequently, find the places in which
we could apply genetic techniques to bridge these differences between pathways.
To reach this objective, the Kyoto Encyclopedia of Genes and Genomes (KEGG)3, the
BioCyc Database Collection4 and the freely accessible database of protein sequence and
functional information UniProt5 have been the main resources for this first approach. In
first instance, KEGG database was used for the localization of vitamin B12 inside the
different metabolic networks of Spirulina and the B12-synthesizing prokaryotic bacteria
Salmonella typhirium and Pseudomonas denitrificans. Then, once we had the two

3
KEGG: https://www.genome.jp/kegg/
4
BioCyc Database Collection: https://biocyc.org/
5
UniProt: https://www.uniprot.org/

10
molecules of interest localized, the two pathways were travelled in a retrograde way. The
gene activity of each metabolic step was determined using BioCyc website, and the
presence or lack of enzymes in Spirulina was investigated consulting the KEGG database
and the Spirulina’s genome information compiled in the A. platensis entry of the UniProt
database, previously determined by Fujisawa et al. (2010).

2.4. Design of the customized Tn5 transposon pCblTS

For plasmid sequence design, first, the sequence present in the supplementary materials
of Wattana Jeamton et al. (2017), which contains the sequences of the phycocyanin
promoter (PCp), green fluorescent protein (GFP) and the genes for spectinomycin
resistance (SpecR), was used as a basis. Next, the GFP fragment was replaced with the
sequence of the cblT and cblS genes searched in the Integrated microbial genomes and
microbiomes6 database, specifically at the 2256 and 2255 tag locus of the thermophilic
bacillus Geobacillus (G.) Kaustophilus. Succeeding, in order to increase the translation
efficiency of the target genes by improving its expression levels in Spirulina, codon
optimization was implemented for cblT and cblS through the action of the Expected
Codon Adaptation Index (E-CAI) server7 applying the commonly used genetic codon
frequency table. The codon usage table was acquired from the A. platensis entry in the
Kazusa Codon Usage Database8. Additionally, the sequences for the recruitment of a
ribosome during the initiation of the translation (RBS) for cblT and cblS were designed
using the designer mode of RBS Calculator9(in the sequence of SpecR there already was
its RBS). Finally, forward (FP_ME) and reverse (RP_ME) primers were designed for
subsequent Tn5 flanking of the DNA of interest. For this purpose, two nucleotide
sequences with 3' sequences homologous to the DNA template and with 19 bp non-
homologous sequences corresponding to the mosaic sequence at the 5' ends were designed
with the help of the Oligonucleotide Properties Calculator (OligoCalc)10 software. Twist
Bioscience11 was the company that manufactured the plasmid sequence and Sigma-
Aldrich12 which manufactured the primers. The final plasmid was called pCblTS.

2.5. Preparation of the Tn5 transposome complex and A. platensis

electroporation

First, the fragments of the transposon expression cassette region were amplified from the
plasmid pCblTS with the PCR primers FP_ME and RP_ME by means of the action of
KAPA HiFi HotStart DNA Polymerase available in the ReadyMix KAPA HiFi PCR Kit
(Roche) and the thermocycler Vapo.protect Mastercycler® Pro (Eppendorf). Concretely,
1 µL de KAPA HiFi PCR Kit, 1.5 µL of each primer and 21 µL of water composed each
PCR mix. The amplified fragments were then purified using the QIAquick® PCR
Purification Kit (Qiagen) and the concentration was adjusted to 100 ng/microL in TE
buffer. Next, a 2 µl aliquot of purified fragments were mixed with 4 µl of EZ-Tn5 Hyper

6
Integrated microbial genomes and microbiomes: https://img.jgi.doe.gov/
7
E-CAI server: http://genomes.urv.es/CAIcal/E-CAI/
8
Kazusa Codon Usage Database: https://www.kazusa.or.jp/codon/
9
RBS Calculator: https://salislab.net/software/design_rbs_calculator
10
OligoCalc: http://biotools.nubic.northwestern.edu/OligoCalc.html
11
Twist Bioscience: https://www.twistbioscience.com/
12
Sigma-Aldrich: https://www.sigmaaldrich.com/

11
transposase (Epicentre) and 2 µl of 100% glycerol. Finally, the reaction mixture was
incubated for 30 min at room temperature to form the transposome complex.
For electroporation, an aliquot of 2 ml of Spirulina with an OD470 higher than 0.5 (middle-
log phase of growth) was spin down for 1 min at 10000 r.p.m. Then, the medium was
removed. After that, to make the cells competent, they were washed three times in an ice-
cold buffer of 1.0 mM, pH 7.2 HEPES and suspended in the same buffer. Further on,
three different samples were prepared for electroporation. The first one consisting of 40
µL of cells was used as the control reaction. The second one, 40 𝜇L of competent cells
plus 1 µL of the previously prepared Tn5 transposome were added. Finally, the third one
contained 40 µL of competent Spirulina cells, 1 µL of Tn5 transposome complex and,
additionally, 1 µL of Type I RI. Each of the tubes were transferred to 2 mm
electroporation cuvettes after incubating 10 minutes on ice. The applied electric pulses
were single pulses of 200 Ω, 0.8 kV and 25 µF at 5 ms using the Gene Pulser XCell™
Electroporation system (Bio-Rad).
Additionally to this methodology, an alternative to this experiment was carried out. In
this case, before the initial centrifugation, following the described protocol in Kawata et
al. (2004), 10 mL of Spirulina was sonicated at 50% amplitude with the Branson 450
Digital Sonifier (Branson), and incubated at 30 ºC overnight with dim light (5 µmol
photons m–2 s–1) to have mostly single cells. After that, the next steps were the same as in
the previous methodology without sonication.
Next, for both experiments, NaHCO3 (5 g/L) was immediately added into each
electroporated cell reaction, and the cell culture was transferred to incubation at 30 ºC for
2 days under dim light.
The transformants were selected by two ways. The first one, by plating 200 ml aliquots
of cell culture on the top of Spirulina medium containing 0.8% agar and 0.5 µg/mL
spectinomycin. The second one, by plating the same aliquot of cell culture inside the
Spirulina medium containing 0.8% agar and 0.5 mg/mL spectinomycin. Then, both plates
were incubated at 30ºC, under dim light and half-opening the covers of the plates. Every
day, an aliquot of culture medium was added to each plate to overcome the agar plates
medium evaporation. Finally, transformant growth was periodically observed under a
microscope and compared with the control reaction of electroporated A. platensis
competent cells without any additional transformation component.

3. Results

3.1. Arthrospira platensis growth assessment

After culturing A. platensis with the explained conditions in the Methods section,
cyanobacteria growth was assessed measuring the OD470 at each hour during 8h. Here
below, the growth curves for three different cultures with different initial inoculations
(0.1, 0.2, 0.3) are shown.
As it can be seen in Figure 9, an increase in the OD470 was only observed when the initial
inoculation was above 0.3 (green line). In the cases where the OD470 was lower than this
value, the culture stagnated, without being able to rebound in growth.

12
 Figure 9. Growth curves of Spirulina cultures with different initial inoculations.

In Figure 10, it can be seen the differences between the strain cultured before applying
the conditions used in this work. In A, cyanobacteria were cultured in the same way as it
was done in B, however, in A, the light applied was the sunlight that come through the
laboratory window and, in B, a full spectrum LED was the light source. The filaments
experienced a generalized change in its length and shape.

Figure 10. Cultured Spirulina seen under microscope. A: Spirulina cultured under sunlight. B: Spirulina
cultured under full spectrum LED lamp light.

3.2. Findings on metabolic pathways analysis

From the bioinformatic analysis on the synthesizing metabolic pathways of vitamin B12
and comparing them with the ones present in A. platensis, in first place, we found that
vitamin B12 and its cyanobacteria homologue are synthesized in chlorophyll and
porphyrin metabolism. Secondly, we were able to verify that, as in vitamin B12-
synthesizing bacteria, the synthesis of pseudovitamin B12 also consists of two parts. At
first, the synthesis of the corrin ring and, a posteriori, the addition of the lower axial α-

13
ligand. Regarding the synthesis of the corrin ring, by searching for the cbi or cob gene
complex and testing its enzymatic activity, we discovered the presence of all the genes
necessary for the cyanobacterium to synthesize the corrin ring anaerobically, very similar
to how Salmonella spp. carry out this process. In Figure 13, we can find the genes
involved in the synthesis of the corrin ring by A. platensis.
In terms of the synthesis and addition of the lower axial ligand 𝛼, first, it has been
discovered that the missing genes in the cyanobacterial pathway are cobT (function), cobS
(function) and cobC (function) (see Figure 11). Secondly, it was discovered that the lack
of these genes is linked to the inability of cyanobacteria to synthesize DMB (natural 𝛼 -
ligand of vitamin B12). This fact was discovered by analyzing the metabolism of
riboflavin (a DMB precursor) and failing to identify the NADH-dependent flavin
reductase (c1-hpah gene) and 5,6-dimethylbenzimidazole synthase (bluB gene) enzymes
(see Figure 12).

Figure 11. Metabolic pathway for the inclusion of the lower ligand into the corrin ring in Arthrospira
platensis. No enzymes have been labelled since any enzyme is present in cyanobacteria.

C1-hpah

bluB

Figure 12. Riboflavin metabolism. Metabolic pathway of DMB. The green boxes show the present
enzymes in cyanobacteria.

14
Figure 13. Synthetic metabolic pathway of corrin ring in Arthrospira platensis. The green boxes show the
present enzymes in cyanobacteria.

15
3.3. Designed Tn5 transposon pCblTS

From the process described in section 2.4 of the Methods, we finally created a plasmid
named pCblTS, which harbors the transposon cassette containing a chimeric operon of
the cblT and cblS genes originating from the bacterium G. kaustophilus and the gene that
provides resistance to spectinomycin, all under the control of the PC promoter.
The engineered plasmid can be seen in Figure 14 and the sequence of each part of the
plasmid in Section 5.1 from Supporting Material.

Figure 14. Plasmid pCblTS

3.4. Identification and survival observation of A. platensis transformants

In the present subsection we will show the results obtained from the combination of
different transformation techniques. In that way, we assessed the transformation
effectiveness when, in first place, the two types of transformant cells were plated on top
of the 0.8% agar-Spirulina’s medium with spectinomycin; in second place, when the
transformant cells were placed inside the 0.8% agar-Spirulina’s medium with
spectinomycin; and, in last place, when the transformant cells had been sonicated before
transformation.
Regarding the first mentioned scenario, as it can be seen in Figure 15, First, the
untransformed control trichomes (A) started to decompose after only two days. By the
fourth day, it was impossible to see living filaments of the microalgae. Secondly, as we
can see in the second row of images (B) according to the trichomes transformed only with

16
the Tn5 transposon, in general, the cells managed to survive at least two days longer than
the control, however, after one week, we began to witness the same pattern of
decomposition seen in the control cells on day 2. Finally, in the last row of the grid, cells
transformed with the Tn5 transposon and using the restriction inhibitor repeated the
behavior seen in B.

Figure 15. Cells on top of the Spirulina medium 0.8% agar with spectinomycin plates seen under
microscope (10x). A: Control plates. B: Tn5 transformant cell plates. C: Tn5 plus Type I RI transformant
cell plates. The images with an asterisk (*) indicates the detection of C. elegans in the plates.

In the case of placing the transformed cells inside the medium composed of Spirulina,
agar and spectinomycin, as we can see in Figure 16, In general, the cells survived longer
than in the cells plated on the surface of the medium. In the control case, the cells did not
start to degrade until after the fourth day, being at day 6 the moment in which the
decomposition of the cells was noticeable. As for the dishes containing transformed cells,
the behavior of the trichomes with the transposon alone was very similar to that of the
filaments with the transposon and the restriction inhibitor, as had already happened when
the cells were plated on top of the medium. However, in this case, survival increased
considerably in terms of time, starting to decompose after 12 days, or even maintaining
large filaments as seen in the image of day 13 of row C.
Finally, by sonicating the Spirulina cells, moments prior to transformation, over the
course of the days, no filaments were obtained from the single cells. Therefore, the
evolution of the control cases, Tn5 transposon and Tn5 transposon plus Type I have been
common in the three scenarios. Figure 17 shows what has been discussed in this
paragraph.

17
In addition, it should be noted that approximately 4 - 5 days after the preparation of the
different dishes, another type of bacteria, specifically the species Caenorhabditis.
elegans, began to be easily visualized. (Figure 15, row A, Day 4). The presence of this
nematode has been expressed with an asterisk (*) in the different images of Figure 15,
Figure 16,Figure 17.

Figure 16. Cells inside of the Spirulina medium 0.8% agar with spectinomycin plates seen under
microscope (10x). A: Control plates. B: Tn5 transformant cell plates. C: Tn5 plus Type I RI transformant
cell plates. The images with an asterisk (*) indicates the detection of C. elegans in the plates.

Figure 17. Sonicated cells plated on the spectinomycin containing medium. The images with an asterisk
(*) indicates the detection of C. elegans in the plates.

18
4. Discussion

The limited knowledge of transformation systems that are able to overcome the restriction
enzymatic barriers acting on exogenous DNA present in Spirulina limits the potential of
this microalgae in many aspects. This fact has restricted the possibility that, from the
metabolic functions already existing in cyanobacteria, more interesting ones could be
created for our own benefit and consumption. Therefore, in this study, based on the
similarities between the pseudovitamin B12 synthesized in cyanobacteria and vitamin
B12, we have tried to increase the knowledge of this microalgae to establish a first step
towards the creation of a non-animal source of vitamin B12. For this purpose, a
transformation system has been established that covers the procedures from the definition
of the culture conditions capable of growing the microalgae to a minimum OD necessary
for its transformation, to the steps following the electroporation of competent cells.
In the following, what was observed during the different procedures carried out will be
discussed and justified.

4.1. Full spectrum LED lamps performance for A. platensis culture

Light is one of the most important factors during microalgae and cyanobacteria
cultivation, so that this energy is captured by the pigments to carry out the photosynthesis
process [67]. On a large scale, most cultivations use sun light as energy source. However,
for the high added value biocompounds production, such as phycocyanin and essential
fatty acids, artificial light is more commonly used in the cultivations, with efficient and
standardized control of PPFD, resulting in high productivities [68]. Fluorescent lamps are
the most commonly artificial energy sources used in microalgae cultures. LEDs are
considered an ecologically correct energy source and an economical technology which
have some main advantages: (1) high efficiency of electricity conversion; (2) reduced
energy consumption; (3) smaller material mass and volume; (4) non-polluting and
durable; (5) lower heat dissipation [67], [69], [70].
dissipation.
In Figure 9, the growth curves observed during the culture of A. platensis show us that in
the case of having a minimum initial OD470 above 0.3, the strain cultivated under a full
spectrum LED lamp achieved to duplicate its OD in 9 hours. Additionally, replicating this
procedure we were able to scale-up our initial culture of 60 mL to 250 mL in 5 days
maintaining an OD above 0.5 with a nice green color similar to one shown in
Supplementary Figure 1. Moreover, when the filaments were observed under the
microscope, we were able to perceive clear changes in length and shape when the culture
was illuminated with the LED light (Figure 10) compared with the initial culture
cultivated under sunlight.
In first place, the increase of the OD indicates the increase of absorbance of the sample,
i.e., that the number of cells present in the culture is greater. Furthermore, we know that
this increase of the OD was not due to the presence of dead cells or cell debris, since,
when viewed under the microscope, the vast majority of the cells had a healthy
appearance (Figure 10, B). Secondly, the increase in the length of the filaments indicates
the good health of the trichomes. In the case of the culture illuminated with sunlight, many
filaments do not have the four spirals necessary to claim that they are healthy [71]. In

19
contrast, in the case of the artificially illuminated culture, the number of coils is much
higher than four.
Lastly, in reference to the shape, in the original culture we can see how more straight
filaments appear than in the one cultured with artificial light. This fact, as explained by
Wu et al. (2005) and Yadav et al. (2015), is due to the mechanism called auto-shading
present in this filamentous cyanobacterium. Auto-shading consists of self-changing
morphologically according to light conditions, spiraling in cases with high illumination
as a protection against UV rays and elongating in cases where light is scarce, trying to
capture as much light as possible [72], [73].
Therefore, based on the aspects discussed above, we can conclude, firstly, that the
conditions proposed in this study are suitable for the cultivation of A. platensis. Secondly,
we can affirm that the full spectrum LED lamps provide the wavelength band required by
the microalgae growth. Thirdly, we can determine that, for this energy source, a light
intensity of 100 𝜇mol photons m-2 s-1 applied in 12 h pulses provides the light intensity to
make cyanobacteria grow preventing their cell death by photolysis. And, finally,
considering that the culture was not carried out at an optimal temperature for growth (35
degrees) but between 22 and 25 degrees, we can conclude that the light aspects have a
greater influence on cell growth than temperature.

4.2. Influence of initial inoculation on A. platensis growth

Spirulina cells are aggregated into filaments that tend to form spirals [74]. The cells of
this species require a period of acclimation [75], [76]. In this process, cyanobacterial
growth is not usually experienced, but more likely cell lysis of part of the filaments.
During their acclimation, the cells accumulate alkaline protease activity that causes the
cell lysis [75].
Ogawa and Terui (1970, 1972) already found that one way to overcome this fact was to
use a larger inoculum. In this way, the possibility of having a higher number of healthy
cells at the end of the acclimatization period would be higher and, therefore, the culture
could regrow more efficiently [77], [78].
In Figure 9, we can observe the growth curves of A. platensis that we witnessed in this
study when using three different initial inoculations. As can be clearly observed, the only
culture that managed to regrow in the first hours was the one that was prepared from a
higher initial inoculum, specifically with an OD 0.3 (green line). In the other two
scenarios (yellow and red lines) with lower initial concentrations, growth stagnated
during the 10 h of assessment.
Relating what was seen in the present study with what has already been defined in
previous studies, firstly, we can corroborate the importance of the initial inoculum
concentration for growing Spirulina. Secondly, we can suggest that, under the conditions
proposed in this study, an inoculum higher than 0.3 allows accelerating the cell
acclimatization period and thus doubling the initial OD in 9 hours. And, thirdly, we can
affirm that an inoculation lower than 0.3 requires an acclimatization period longer than
10 hours and does not guarantee the rebound of cell growth.

4.3. Anaerobic synthesis of corrin ring by A. platensis

Ever since the pioneering work of Dorothy Hodgkin revealed the complexity of vitamin
B12 [79], chemists and biochemists have endeavored to unravel the step-by-step
biosynthesis of this essential cofactor and coenzyme. Research into the biosynthesis of

20
the corrin ring, as commented before, has revealed the presence of two similar, although
distinct, biochemical pathways, which differ on the timing of cobalt insertion and a
requirement for molecular oxygen [80].
Recapitulating the results regarding our research on vitamin B12-biosynthesizing
metabolic pathways in cyanobacteria (Figure 13), although each anaerobic intermediary
between uroporphyrinogen III and cobyrinic acid has been found in A. platensis genome,
genes cobG, cobF, cobK, which are involved in the aerobic corrin ring biosynthesis, were
not found. This finding, as suggested by Watanabe et al. (2014) and Y. Yabuta et al.
(2009), corroborates that the mechanism used by A. platensis to de novo synthesize the
corrin ring is under anoxic conditions. Therefore, considering this conclusion, we can also
affirm that cbi genes are the responsible to intermediate the tetrapyrrole pathway and the
addition of the cobalt atom to macrocyclic occurs early and regulated by the action of the
cbiK gene.

4.4. Addition of the lower ligand of pseudovitamin B12 by A. platensis

DMB is a natural benzidimazole derivative which serves as lower ligand for the cobalt
atom of vitamin B12. Its synthesis takes place from the metabolism of riboflavin (vitamin
B2) [81]. First, riboflavin kinase acts on vitamin B2 to produce riboflavin-5-phosphate
(FMN). Then the enzyme FMN reductase acts on FMN to produce FMNH2, and,
eventually, bluB triggers the fragmentation and contraction of FMNH2 and the cleavage
of the ribityl tail to form DMB [82]. However, this process in A. platensis, as we observed
in Figure 12, cannot take place. Spirulina can produce FMN from vitamin B2, but the
reduction of FMN and the subsequent action of bluB are absent.
From this finding, we can conclude that the origin of the differences between the
pseudovitamin B12 and vitamin B12 synthesizing pathways lies mainly in the lack of the
bluB enzyme. The subsequent differences that we found in the mechanisms of binding of
the lower ligand to the tetrapyrrole ring are a consequence of this fact. Given the inability
of Spirulina to produce DMB, cyanobacteria also do not contain the enzymes cobT, which
would be responsible for catalyzing the synthesis of 𝛼-RP from DMB and nicotinate β-
D-ribonucleotide, nor cobC, suggested in some studies to be responsible for
dephosphorylating 𝛼-RP (see Figure 11). However, referring to the other enzyme present
in this subpathway, in this study we have found present in the cyanobacterial genome the
cobS gene, in charge of the insertion of the lower ligand to the corrin ring. This
observation is opposite to that reported in Y. Yabuta et al. (2009) (study published years
prior to establishment of the A. platensis genome by T. Fujisawa et al. (2010) and
Cheevadhanarak et al. (2012)), which also suggested that the corrin ring was formed
anaerobically but indicated the absence of cobS during the process [83].
The presence of cobS in Spirulina could lead to interpretations suggesting that this
enzyme is able to act on adenine (lower pseudovitamin B12 ligand) and not specifically
on DMB. However, further studies would be required to confirm this hypothesis.

4.5. A. platensis transformation efficiency

It is well known that restriction enzymes are the main barrier to transformation in
cyanobacteria. Data retrieved from the genome of A. platensis revealed that there are four
types of restriction enzymes, of which type II is the most abundant, followed by type I,
type IV, and type III [44], [45]. Therefore, in the present work, we have attempted to
combine methodologies used in the past to elucidate which techniques are suitable to

21
avoid digestion of foreign DNA, thus allowing insertion and expression of transformed
DNA in A. platensis.
From the results shown in Figure 15, Figure 16,Figure 17, we can conclude a number of
aspects. First, the fact that the control colonies suffered to a greater extent the action of
the antibiotic than the transformed cells, either with the transposon alone or also using
the restriction inhibitor, indicates that, most probably, the cells acquired the transposon
gene set successfully, and were able to express the spectinomycin resistance gene.
Second, observing that cells plated inside the medium survived longer than cells plated
on top suggests that, plating the cells inside the medium, cells’ chances of survival are
increased. In the following, we will try to discuss the reason for this observed
improvement.
During the period of incubation, several factors affected the condition of the agar plates.
Firstly, due to the need to keep the plates half-open during incubation, the temperature of
30 ºC and the long incubation period to which they were subjected, the medium in the
plates evaporated to a great extent and, although medium was added every day to
compensate for this fact, it was not possible to reverse its effect completely. Secondly,
due to the addition of medium with a high degree of salinity added to the salt already
present in the medium and which does not evaporate, it is possible that the salinity of the
plates will increase considerably compared to the initial salinity. And, thirdly, the
presence of C. elegans, a nematode that grows in rich plant material, sighted from day 4-
5 (Figure 15, A, day 4) in every plate are the facts that, independent of the action of the
antibiotic, could have influenced the survival of the cells and contributed to the fact that
the cells placed on top of the medium did not manage to survive in the same way as we
observed in the cells placed inside the agar.
The third conclusion we can draw is that the use of sonication is not a good resource for
transforming Spirulina. As we can see in Figure 17, when we tried to incorporate
exogenous DNA following the procedures described in Toyomizu et al. (2001) and
Kawata et al. (2004), after a few days, no live cells, let alone any filaments, could be
identified. This agrees with what was witnessed in the two previous commented studies
where, unfortunately, no stable transforming clone could be isolated from the culture of
the transformed cells.
And the last conclusion suggested by the observed results is that, as clearly seen in Figure
16, the filaments that were transformed with the transposon and Type I RI system
increased the expression of spectinomycin resistance, since it is in the only case where
after 13 days we were still able to see complete filaments without cracks or degradation.
Therefore, recapitulating the conclusions drawn in the previous paragraphs, we can
establish that the greatest effectiveness of Spirulina transformation occurred in the case
where exogenous DNA in the form of Tn5 transposon was introduced, Type I restriction
inhibitor was used, the cells were not sonicated before electroporation and, finally, the
cells were incubated inside the agar and not on top of it. However, the failure to obtain
visible colonies does not allow us to corroborate the success of the transformation in the
way we would like to.

4.6. Future approaches and outlook

The present study has managed to increase the knowledge about Spirulina by establishing
from a simple and economical method of indoor cultivation to which techniques are more
efficient to transform the cyanobacterium. All this trying to address the metabolic
pathways of pseudovitamin B12 and vitamin B12 and to propose a pathway that bridges
the differences between them. However, the results obtained fail to resolve our initial

22
questions in their entirety and propose new ones, which is why future studies will be
essential to complement the present work.
Firstly, given that we did not evaluate the action of the cblT and cblS genes once added
to the Spirulina genome, but only observed whether the cyanobacterium had acquired the
plasmid, future studies should focus on analyzing whether the cblT and cblS genes
manage to restore α-R from the medium and transform it into α-RP, as was achieved in
the S. enterica species [21]. In this way, it will also be possible to elucidate whether a
cobC gene is required in A. platensis to dephosphorylate α-RP and subsequently include
it in the corrin ring. Secondly, another question raised by this study is whether cobS,
present in the A. platensis genome, is only able to act on DMB or, as we suggest in this
study, it can also act on adenine. Studies focused on this point could shed light on the
specific mechanisms of adenine binding to the corrin ring in the synthesis of
pseudovitamin B12, an aspect on which, throughout the study, insufficient information
has been found.
It is well known that in creating genetically modified algae or plants, antibiotic resistance
genes are commonly used as marker genes for the selection of transformed cells. In
parallel, concern has been addressed about whether horizontal genes transfer of these
genes from the plant material to environmental microorganisms can take place, thereby
compromising the therapeutic value of antibiotics in human and veterinary medicine [84].
Therefore, future studies ought to consider the option of eliminating the antibiotic
resistance gene (in this case spectinomycin resistance) for safety purposes. Site-specific
recombination systems such as Cre-lox, Mob/oriT or Dre-rox have shown be effective for
this objective and could be evaluated [85]–[87].
Finally, on the way to creating a standardized system of Spirulina transformation that will
allow increasing the potential of this interesting cyanobacteria, other techniques such as
the use of liposomes that have been shown to facilitate gene delivery and protection of
trapped DNA from exonucleases and endonucleases in the host cell cytoplasm should be
studied [40], [88]–[90]. Moreover, to overcome the problems seen in this study during
the incubation of the cells after the electroporation process, new studies that seek to create
mechanisms capable of overcoming medium evaporation and medium contamination that
enhance cell survival and facilitate the creation of visible colonies would be of great
value.
As it has been pointed out throughout the study, this work intends to take the first step to
propose Spirulina as a future source of active vitamin B12. Achieving this ultimate goal
would bring great benefits to our society from both dietary and environmental points of
view. First of all, regarding nutritional aspects, Spirulina, which is already a very common
food in the diet of vegans and vegetarians for its nutritional qualities in terms of high
levels of protein, beta-carotene, absorbable iron, high levels of vitamins, phenolic
compounds, gamma-linolenic acid, and other essential fatty acids [25], the fact of also
possessing the quality of producing active vitamin B12, would make Spirulina the perfect
substitute for the current sources of vitamin B12 to which these groups resort, whether
they are vitamin B12 supplements or foods fortified with vitamin B12. This would allow
groups opposed to meat consumption to satisfy their nutritional demands without having
to resort to another food that is not already in their daily diet and that does not belong to
a source in accordance with their ideology. In this way, it would be possible to reduce the
levels of vitamin B12 deficiency which, nowadays, is estimated to affect 60% of all
vegans (47,4 million people) [91]. On the other hand, from an environmental point of
view, this approach would provide an alternative to the usual source of vitamin B12 and
protein, meat. Providing an alternative to meat also means counteracting the negative
effects of its production. Currently, conventional livestock practices produce 14.5% of all

23
anthropogenic greenhouse gas emissions, approximately equivalent to all the direct
emissions from transportation releasing annually 2.400.000.000 tons of CO2 [5]. Over
the 70% of all grasslands have already been tilled for livestock purposes.
[6]. Furthermore, manure effluents and the excessive use of fertilizers to produce raw
materials have polluted many waterways and have contributed greatly to the more than
400 dead zones at river mouths around the world [7]. Conversely, vitamin B12 and protein
production by Spirulina would not contribute to the greenhouse gases emissions and could
fix the atmospheric CO2 due to the ability to make photosynthesis by cyanobacteria. It
does not need crop fields to grow, so it would favor reforestation and, eventually, its fast
growth rate and its independence of seasonal factors would allow us to have a constant
source of these nutrients [28]–[30]. Considering these nutritional and environmental
aspects, Spirulina aims to be in a few years a possible candidate to occupy a great place
in our daily diet both for non-consumers of animal products, as for those who do consume
them; being much more sustainable than the current sources of vitamin B12 and protein
among other nutrients.

24
25
BIBLIOGRAPHY

[1] K. Milton, “The Critical Role Played by Animal Source Foods in Human (Homo)
Evolution,” J. Nutr., vol. 133, no. 11, Nov. 2003, doi: 10.1093/jn/133.11.3886S.
[2] M. Z. Baltic and M. Boskovic, “When Man Met Meat: Meat in Human Nutrition
from Ancient Times till Today,” Procedia Food Sci., vol. 5, 2015, doi:
10.1016/j.profoo.2015.09.002.
[3] R. York and M. H. Gossard, “Cross-national meat and fish consumption: exploring
the effects of modernization and ecological context,” Ecol. Econ., vol. 48, no. 3,
Mar. 2004, doi: 10.1016/j.ecolecon.2003.10.009.
[4] L. Oberlander, A.-C. Disdier, and F. Etilé, “Globalisation and national trends in
nutrition and health: A grouped fixed-effects approach to intercountry
heterogeneity,” Health Econ., vol. 26, no. 9, Sep. 2017, doi: 10.1002/hec.3521.
[5] P. J. Gerber et al., Tackling climate change through livestock - A global assessment
of emissions and mitigation opportunities. Rome: Food and Agricultural
Organization of the United Nations (FAO)., 2013.
[6] R. P. White, S. Murray, M. Rohweder, Prince. S. D., and K. M. Thompson,
Grassland ecosystems. Washington, DC: World Resources Institute, 2000.
[7] B. Machovina, K. J. Feeley, and W. J. Ripple, “Biodiversity conservation: The key
is reducing meat consumption,” Sci. Total Environ., vol. 536, Dec. 2015, doi:
10.1016/j.scitotenv.2015.07.022.
[8] G. Rizzo et al., “Vitamin B12 among Vegetarians: Status, Assessment and
Supplementation,” Nutrients, vol. 8, no. 12. Multidisciplinary Digital Publishing
Institute (MDPI), Nov. 29, 2016, doi: 10.3390/nu8120767.
[9] R. Pawlak, S. J. Parrott, S. Raj, D. Cullum-Dugan, and D. Lucus, “How prevalent
is vitamin B12 deficiency among vegetarians?,” Nutrition Reviews, vol. 71, no. 2.
Nutr Rev, pp. 110–117, Feb. 2013, doi: 10.1111/nure.12001.
[10] A. Ankar and A. Kumar, Vitamin B12 Deficiency. StatPearls Publishing, 2020.
[11] C. M. Burgess, E. J. Smid, and D. van Sinderen, “Bacterial vitamin B2, B11 and
B12 overproduction: An overview,” Int. J. Food Microbiol., vol. 133, no. 1–2, Jul.
2009, doi: 10.1016/j.ijfoodmicro.2009.04.012.
[12] H. B. M. W. D. J. J.-H. Martens, “Microbial production of vitamin B 12,” Appl.
Microbiol. Biotechnol., vol. 58, no. 3, Mar. 2002, doi: 10.1007/s00253-001-0902-
7.
[13] T. K. Basu and J. W. T. Dickerson, Vitamins in human health and disease.
Wallingford, UK: CAB INTERNATIONAL, 1996.
[14] T. S. Crofts, E. C. Seth, A. B. Hazra, and M. E. Taga, “Cobamide Structure
Depends on Both Lower Ligand Availability and CobT Substrate Specificity,”
Chem. Biol., vol. 20, no. 10, Oct. 2013, doi: 10.1016/j.chembiol.2013.08.006.
[15] S. P. Stabler and R. H. Allen, “VITAMIN B12 DEFICIENCY AS A
WORLDWIDE PROBLEM,” Annu. Rev. Nutr., vol. 24, no. 1, Jul. 2004, doi:
10.1146/annurev.nutr.24.012003.132440.
[16] Rosalind S Gibson, Principles of nutritional assessment, 2nd ed. New York:
Oxford University Press, 2005.
[17] F. O’Leary and S. Samman, “Vitamin B12 in Health and Disease,” Nutrients, vol.
2, no. 3, Mar. 2010, doi: 10.3390/nu2030299.
[18] L. Ellenbogen and B. A. Cooper, “Handbook of vitamins.,” 1991.
[19] A. I. Scott and C. A. Roessner, “Biosynthesis of cobalamin (vitamin B12),”
Biochem. Soc. Trans., vol. 30, no. 4, Aug. 2002, doi: 10.1042/bst0300613.

26
[20] A. I. Scott, “Discovering Nature’s Diverse Pathways to Vitamin B 12 : A 35-Year
Odyssey,” J. Org. Chem., vol. 68, no. 7, Apr. 2003, doi: 10.1021/jo020728t.
[21] T. A. Mattes and J. C. Escalante-Semerena, “Salmonella enterica synthesizes 5,6-
dimethylbenzimidazolyl-(DMB)-α-riboside. Why some Firmicutes do not require
the canonical DMB activation system to synthesize adenosylcobalamin,” Mol.
Microbiol., vol. 103, no. 2, Jan. 2017, doi: 10.1111/mmi.13555.
[22] C. L. Zayas and J. C. Escalante-Semerena, “Reassessment of the Late Steps of
Coenzyme B12 Synthesis in Salmonella enterica: Evidence that
Dephosphorylation of Adenosylcobalamin-5′-Phosphate by the CobC Phosphatase
Is the Last Step of the Pathway,” J. Bacteriol., vol. 189, no. 6, Mar. 2007, doi:
10.1128/JB.01665-06.
[23] A. Belay, Y. Ota, K. Miyakawa, and H. Shimamatsu, “Current knowledge on
potential health benefits of Spirulina,” J. Appl. Phycol., vol. 5, no. 2, Apr. 1993,
doi: 10.1007/BF00004024.
[24] Arpita Mohan, Neeta Misra, Deepak Srivastav, Deepak Umapathy, and Shiva
Kuma, “Spirulina-The Nature’s Wonder: A Review,” Sch. J. Appl. Med. Sci., vol.
2, no. 4, pp. 1334–1339, 2014.
[25] D. Von der Weid, Malnutrition a silent massacre. Geneva: Antenna Technologies,
2000.
[26] E. E. Mazokopakis, M. G. Papadomanolaki, A. A. Fousteris, D. A. Kotsiris, I. M.
Lampadakis, and E. S. Ganotakis, “The hepatoprotective and hypolipidemic
effects of Spirulina (Arthrospira platensis) supplementation in a Cretan population
with non-alcoholic fatty liver disease: a prospective pilot study.,” Ann.
Gastroenterol., vol. 27, no. 4, pp. 387–394, 2014.
[27] A. HERNANDEZCORONA, I. NIEVES, M. MECKES, G. CHAMORRO, and B.
BARRON, “Antiviral activity of Spirulina maxima against herpes simplex virus
type 2,” Antiviral Res., vol. 56, no. 3, Dec. 2002, doi: 10.1016/S0166-
3542(02)00132-8.
[28] Kelechi M. Ukaegbu-Obi, “Single Cell Protein: A Resort to Global Protein
Challenge and Waste Management,” J Microbiol Microb Technol, vol. 1, no. 1,
2016.
[29] Lidiane Muniz Moreira, “Nutritional evaluation of single-cell protein produced by
Spirulina platensis,” African J. Food Sci., vol. 5, no. 15, Dec. 2011, doi:
10.5897/AJFS11.184.
[30] A. T. Nasseri, S. Rasoul-Ami, M. H. Morowvat, and Y. Ghasemi, “Single Cell
Protein: Production and Process,” Am. J. Food Technol., vol. 6, no. 2, Jan. 2011,
doi: 10.3923/ajft.2011.103.116.
[31] R. Maddaly, “The beneficial effects of spirulina focusing on its
immunomodulatory and antioxidant properties,” Nutr. Diet. Suppl., Jul. 2010, doi:
10.2147/NDS.S9838.
[32] V. Herbert and G. Drivas, “Spirulina and Vitamin B12,” JAMA J. Am. Med. Assoc.,
vol. 248, no. 23, Dec. 1982, doi: 10.1001/jama.1982.03330230018017.
[33] P. C. Dagnelie, W. A. van Staveren, and H. van den Berg, “Vitamin B-12 from
algae appears not to be bioavailable,” Am. J. Clin. Nutr., vol. 53, no. 3, Mar. 1991,
doi: 10.1093/ajcn/53.3.695.
[34] F. Watanabe et al., “Pseudovitamin B 12 Is the Predominant Cobamide of an Algal
Health Food, Spirulina Tablets,” J. Agric. Food Chem., vol. 47, no. 11, Nov. 1999,
doi: 10.1021/jf990541b.
[35] W. Jeamton, S. Dulsawat, M. Tanticharoen, A. Vonshak, and S. Cheevadhanarak,
“Overcoming intrinsic restriction enzyme barriers enhances transformation

27
 efficiency in arthrospira platensis C1,” Plant Cell Physiol., vol. 58, no. 4, pp. 822–
830, Apr. 2017, doi: 10.1093/pcp/pcx016.
[36] M. G. C. Duyvesteyn, J. Korsuize, A. de Waard, A. Vonshak, and C. P. Wolk,
“Sequence-specific endonucleases in strains of Anabaena and Nostoc,” Arch.
Microbiol., vol. 134, no. 4, Jul. 1983, doi: 10.1007/BF00407802.
[37] O. K. C. Wolk, “Genetic tools for cyanobacteria,” Appl. Microbiol. Biotechnol.,
vol. 58, no. 2, Jan. 2002, doi: 10.1007/s00253-001-0864-9.
[38] D. . Moser, D. Zarka, and T. Kallas, “Characterization of a restriction barrier and
electrotransformation of the cyanobacterium Nostoc PCC 7121,” Arch. Microbiol,
vol. 160, pp. 229–237.
[39] J. Elhai, A. Vepritskiy, A. M. Muro-Pastor, E. Flores, and C. P. Wolk, “Reduction
of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain
PCC 7120.,” J. Bacteriol., vol. 179, no. 6, 1997, doi: 10.1128/JB.179.6.1998-
2005.1997.
[40] A. Elouahabi and J.-M. Ruysschaert, “Formation and Intracellular Trafficking of
Lipoplexes and Polyplexes,” Mol. Ther., vol. 11, no. 3, Mar. 2005, doi:
10.1016/j.ymthe.2004.12.006.
[41] H. Dong, Y. Zhang, Z. Dai, and Y. Li, “Engineering Clostridium Strain to Accept
Unmethylated DNA,” PLoS One, vol. 5, no. 2, Feb. 2010, doi:
10.1371/journal.pone.0009038.
[42] J. Bian and C. Li, “Disruption of a Type II Endonuclease (TDE0911) Enables
Treponema denticola ATCC 35405 To Accept an Unmethylated Shuttle Vector,”
Appl. Environ. Microbiol., vol. 77, no. 13, Jul. 2011, doi: 10.1128/AEM.00417-
11.
[43] C. P. Wolk, A. Vonshak, P. Kehoe, and J. Elhai, “Construction of shuttle vectors
capable of conjugative transfer from Escherichia coli to nitrogen-fixing
filamentous cyanobacteria.,” Proc. Natl. Acad. Sci., vol. 81, no. 5, Mar. 1984, doi:
10.1073/pnas.81.5.1561.
[44] T. Fujisawa et al., “Genomic Structure of an Economically Important
Cyanobacterium, Arthrospira (Spirulina) platensis NIES-39,” DNA Res., vol. 17,
no. 2, Apr. 2010, doi: 10.1093/dnares/dsq004.
[45] S. Cheevadhanarak et al., “Draft genome sequence of Arthrospira platensis C1
(PCC9438),” Stand. Genomic Sci., vol. 6, no. 1, Mar. 2012, doi:
10.4056/sigs.2525955.
[46] Y. Kawata, S. Yano, H. Kojima, and M. Toyomizu, “Transformation of Spirulina
platensis strain C1 (Arthrospira sp. PCC9438) with Tn5 transposase-transposon
DNA-cation liposome complex,” Mar. Biotechnol., vol. 6, no. 4, pp. 355–363,
Aug. 2004, doi: 10.1007/s10126-003-0037-1.
[47] M. Toyomizu, K. Suzuki, Y. Kawata, H. Kojima, and Y. Akiba, “Effective
transformation of the cyanobacterium Spirulina platensis using electroporation,”
2001.
[48] Lucigen, “EZ-Tn5TM Transposase,” https://www.lucigen.com/EZ-Tn5-
Transposase/#subcat-tabs2. .
[49] J. McCarren and B. Brahamsha, “Transposon Mutagenesis in a Marine
Synechococcus Strain: Isolation of Swimming Motility Mutants,” J. Bacteriol.,
vol. 187, no. 13, Jul. 2005, doi: 10.1128/JB.187.13.4457-4462.2005.
[50] A. C. Tolonen, G. B. Liszt, and W. R. Hess, “Genetic Manipulation of
Prochlorococcus Strain MIT9313: Green Fluorescent Protein Expression from an
RSF1010 Plasmid and Tn5 Transposition,” Appl. Environ. Microbiol., vol. 72, no.
12, Dec. 2006, doi: 10.1128/AEM.02034-06.

28
[51] A. Taton et al., “Gene Transfer in Leptolyngbya sp. Strain BL0902, a
Cyanobacterium Suitable for Production of Biomass and Bioproducts,” PLoS One,
vol. 7, no. 1, Jan. 2012, doi: 10.1371/journal.pone.0030901.
[52] G. A. Roberts et al., “Exploring the DNA mimicry of the Ocr protein of phage T7,”
Nucleic Acids Res., vol. 40, no. 16, pp. 8129–8143, 2012, doi: 10.1093/nar/gks516.
[53] Lucigen, “TypeOneTM Restriction Inhibitor,” https://www.lucigen.com/TypeOne-
Restriction-Inhibitor/. .
[54] W. Jeamton, S. Dulsawat, K. Laoteng, M. Tanticharoen, and S. Cheevadhanarak,
“Phycocyanin promoter of Spirulina platensis controlling heterologous expression
in cyanobacteria,” J. Appl. Phycol., vol. 23, no. 1, pp. 83–88, Feb. 2011, doi:
10.1007/s10811-010-9540-8.
[55] Deborah Chung, Carbon Composites, 2nd Edition. ACADEMIC PRESS, 2017.
[56] H. Potter, “Transfection by Electroporation,” Curr. Protoc. Mol. Biol., vol. 62, no.
1, Apr. 2003, doi: 10.1002/0471142727.mb0903s62.
[57] J. C. Escalante-Semerena and J. R. Roth, “Regulation of cobalamin biosynthetic
operons in Salmonella typhimurium.,” J. Bacteriol., vol. 169, no. 5, 1987, doi:
10.1128/JB.169.5.2251-2258.1987.
[58] R. M. Jeter and J. R. Roth, “Cobalamin (vitamin B12) biosynthetic genes of
Salmonella typhimurium.,” J. Bacteriol., vol. 169, no. 7, 1987, doi:
10.1128/JB.169.7.3189-3198.1987.
[59] B. Keck and P. Renz, “Salmonella typhimurium forms adenylcobamide and 2-
methyladenylcobamide, but no detectable cobalamin during strictly anaerobic
growth,” Arch. Microbiol., vol. 173, no. 1, Jan. 2000, doi:
10.1007/s002030050011.
[60] Zarrouk. C., “Contribution a l’ étude d’une cyanophycée’. Influence de diverse
facteures physiques et chimiques sur la croissance et la photosynthese de Spirulina
maxima.,” University of Paris, France, 1966.
[61] R. A. Soni, K. Sudhakar, and R. S. Rana, “Comparative study on the growth
performance of Spirulina platensis on modifying culture media,” Energy Reports,
vol. 5, Nov. 2019, doi: 10.1016/j.egyr.2019.02.009.
[62] U. Niangoran, F. Tian, L. Canale, C. T. Haba, D. Buso, and G. Zissis, “Study of
the LEDs Spectrums Influence on the Spirulina Platensis Growth in Batch
Culture,” Jun. 2018, doi: 10.1109/EEEIC.2018.8493759.
[63] D. da F. Prates, E. M. Radmann, J. H. Duarte, M. G. de Morais, and J. A. V. Costa,
“Spirulina cultivated under different light emitting diodes: Enhanced cell growth
and phycocyanin production,” Bioresour. Technol., vol. 256, May 2018, doi:
10.1016/j.biortech.2018.01.122.
[64] G. Torzillo and A. Vonshak, “Effect of light and temperature on the photosynthetic
activity of the cyanobacterium Spirulina platensis,” Biomass and Bioenergy, vol.
6, no. 5, Jan. 1994, doi: 10.1016/0961-9534(94)00076-6.
[65] S. R. Ronda, C. S. Bokka, C. Ketineni, B. Rijal, and P. R. Allu, “Aeration effect
on Spirulina platensis growth and γ-linolenic acid production,” Brazilian J.
Microbiol., vol. 43, no. 1, Mar. 2012, doi: 10.1590/S1517-83822012000100002.
[66] H. S. H. Munawaroh et al., “Characterization and physicochemical properties of
chlorophyll extract from Spirulina sp.,” J. Phys. Conf. Ser., vol. 1280, Nov. 2019,
doi: 10.1088/1742-6596/1280/2/022013.
[67] M. Atta, A. Idris, A. Bukhari, and S. Wahidin, “Intensity of blue LED light: A
potential stimulus for biomass and lipid content in fresh water microalgae
Chlorella vulgaris,” Bioresour. Technol., vol. 148, Nov. 2013, doi:
10.1016/j.biortech.2013.08.162.

29
[68] W. Blanken, M. Cuaresma, R. H. Wijffels, and M. Janssen, “Cultivation of
microalgae on artificial light comes at a cost,” Algal Research, vol. 2, no. 4.
Elsevier, pp. 333–340, Oct. 01, 2013, doi: 10.1016/j.algal.2013.09.004.
[69] Y. Zhao, J. Wang, H. Zhang, C. Yan, and Y. Zhang, “Effects of various LED light
wavelengths and intensities on microalgae-based simultaneous biogas upgrading
and digestate nutrient reduction process,” Bioresour. Technol., vol. 136, pp. 461–
468, May 2013, doi: 10.1016/j.biortech.2013.03.051.
[70] C. L. Teo, M. Atta, A. Bukhari, M. Taisir, A. M. Yusuf, and A. Idris, “Enhancing
growth and lipid production of marine microalgae for biodiesel production via the
use of different LED wavelengths,” Bioresour. Technol., vol. 162, pp. 38–44, Jun.
2014, doi: 10.1016/j.biortech.2014.03.113.
[71] Fresh Spirulina, “Spirulina under the microscope,”
https://www.freshspirulina.com.au/spirulina/spirulina-under-the-microscope/,
2017. .
[72] H. Wu, K. Gao, V. E. Villafañe, T. Watanabe, and E. W. Helbling, “Effects of
Solar UV Radiation on Morphology and Photosynthesis of Filamentous
Cyanobacterium Arthrospira platensis,” Appl. Environ. Microbiol., vol. 71, no. 9,
Sep. 2005, doi: 10.1128/AEM.71.9.5004-5013.2005.
[73] G. Yadav, A. Karemore, S. K. Dash, and R. Sen, “Performance evaluation of a
green process for microalgal CO2 sequestration in closed photobioreactor using
flue gas generated in-situ,” Bioresour. Technol., vol. 191, Sep. 2015, doi:
10.1016/j.biortech.2015.04.040.
[74] M. Nicoletti, “Microalgae Nutraceuticals,” Foods, vol. 5, no. 4, Aug. 2016, doi:
10.3390/foods5030054.
[75] M. Mühling, A. Belay, and B. A. Whitton, “Screening Arthrospira (Spirulina)
strains for heterotrophy,” J. Appl. Phycol., vol. 17, no. 2, Mar. 2005, doi:
10.1007/s10811-005-7214-8.
[76] O. Ciferri, “Spirulina, the edible microorganism.,” Microbiol. Rev., vol. 47, no. 4,
1983, doi: 10.1128/MR.47.4.551-578.1983.
[77] T. Ogawa and G. Terui, “Studies on the growth of Spirulina platensis. (I) On the
pure culture of Spirulina platensis,” J. Ferment. Technol, vol. 48, pp. 361–367,
1970.
[78] T. Ogawa and G. Terui, “ Growth kinetics of Spirulina platensis in auxotrophic
and mixotrophic cultures.,” J. Ferment. Technol, pp. 543–549, 1972.
[79] D. C. HODGKIN, J. PICKWORTH, J. H. ROBERTSON, K. N. TRUEBLOOD,
R. J. PROSEN, and J. G. WHITE, “Structure of Vitamin B12 : The Crystal
Structure of the Hexacarboxylic Acid derived from B12 and the Molecular
Structure of the Vitamin,” Nature, vol. 176, no. 4477, Aug. 1955, doi:
10.1038/176325a0.
[80] F. Blanche, D. Thibaut, L. Debussche, R. Hertle, F. Zipfel, and G. Müller,
“Parallels and Decisive Differences in Vitamin B12 Biosyntheses,” Angew.
Chemie Int. Ed. English, vol. 32, no. 11, Nov. 1993, doi: 10.1002/anie.199316511.
[81] W. L. Alworth and H. N. Baker, “Biosynthesis of the 5,6-dimethylbenzimidazole
moiety of vitamin B12,” Biochem. Biophys. Res. Commun., vol. 30, no. 5, Mar.
1968, doi: 10.1016/0006-291X(68)90079-X.
[82] M. E. Taga, N. A. Larsen, A. R. Howard-Jones, C. T. Walsh, and G. C. Walker,
“BluB cannibalizes flavin to form the lower ligand of vitamin B12,” Nature, vol.
446, no. 7134, Mar. 2007, doi: 10.1038/nature05611.
[83] Y. Yabuta and F. Watanabe, Y. Yabuta, F. Watanabe, Handbook on
Cyanobacteria. New York: Nova Science Publications, 2009.

30
[84] T. Midtvedt, “Antibiotic resistance and genetically modified plants,” Microb. Ecol.
Heal. Dis., vol. 25, no. 0, Sep. 2014, doi: 10.3402/mehd.v25.25918.
[85] M. Leibig, B. Krismer, M. Kolb, A. Friede, F. Götz, and R. Bertram, “Marker
removal in staphylococci via Cre recombinase and different lox sites,” Appl.
Environ. Microbiol., vol. 74, no. 5, pp. 1316–1323, Mar. 2008, doi:
10.1128/AEM.02424-07.
[86] P. Wang et al., “Mob/oriT, a mobilizable site-specific recombination system for
unmarked genetic manipulation in Bacillus thuringiensis and Bacillus cereus,”
Microb. Cell Fact., vol. 15, no. 1, p. 108, Jun. 2016, doi: 10.1186/s12934-016-
0492-9.
[87] L. Sevillano, M. Díaz, and R. I. Santamaría, “Antibiotic-free selection plasmids in
Streptomyces,” Jul. 2018, Accessed: Jun. 03, 2021. [Online]. Available:
https://digital.csic.es/handle/10261/164029.
[88] W. B. Rizzo, J. D. Schulman, and A. B. Mukherjee, “Liposome-mediated Transfer
of Simian Virus 40 DNA and Minichromosome into Mammalian Cells,” J. Gen.
Virol., vol. 64, no. 4, Apr. 1983, doi: 10.1099/0022-1317-64-4-911.
[89] B. E. Houk, G. Hochhaus, and J. A. Hughes, “Kinetic modeling of plasmid DNA
degradation in rat plasma,” AAPS PharmSci, vol. 1, no. 3, Sep. 1999, doi:
10.1208/ps010309.
[90] A. C. Oliveira, M. P. Ferraz, F. J. Monteiro, and S. Simões, “Cationic liposome–
DNA complexes as gene delivery vectors: Development and behaviour towards
bone-like cells,” Acta Biomater., vol. 5, no. 6, Jul. 2009, doi:
10.1016/j.actbio.2009.02.019.
[91] M. E. Buil Arasanz, F. Bobé Armant, A. I. Allué Buil, and G. Trubat Muñoz,
“Vitamina B12 y dieta vegetariana,” Semergen, vol. 35, no. 8, pp. 412–414, Oct.
2009, doi: 10.1016/S1138-3593(09)72679-6.

31
32
5. Supporting material

5.1. Plasmid pCblTS sequence

5’ Mosaic End:
CTGTCTCTTATACACATCT

PCp:
GAATTCGAGCTCGGTACCCATCATTTGTGATCGCACTCTTGAGGTAGTTTGCTGATG
GGTGCGAGTTGTTTCGTGGCTTTATCTGATGTCTCGTGCTAAAGCGCTGCAATTTTA
TGTGATTACTCGGCTGTTGTTGGCCCCGCTGATGTTGTGGACGATTACTTCCGTGGT
GTTTCTATTGTTGCGGGCGACACCCGGTGATCCAGTAGATGCTATTCTTGGCCCTAG
AGCGCCTAGTGCCGCTAAGGAAGCCTTGCGATCGCAGTTAGGTTTGGGGGGGTCCT
TGCTAGAACAATATATAAGTTATATGGGCGCTCTACTGCGCTTCGATTTGGGCATTT
CTATAACTACTCAAGGACAGTCCGTCTGGCAGATTATTGGTGATCATTTTCCCGCTA
CCGTCGAATTAGCAGTTTTTAGTATGTTGGTCGCCCTCGTCGTGGGAATTACTGTCG
GGGCTGTGGCCGCTTTTAAACCTAATACTATTTGGGACACTGGGGGACGCTTATTTG
GAATTATTACTTATTCGGTTCCCGCTTTTTGGGCGGGGATGCTGTTGCAGTTGATTTT
TGCCGTGTGGTTGGGCTGGTTTCCTTTGGGGACCCGTTTTCCGGTGACCGTGACTCC
TCCTCCTAGTTATACCGGACTTTATACCGTTGATAGTTTGTTGAGTGGCAATTTGGG
CGCTTTCTGGACGACTATATATTATCTGTGTCTACCCTGTGTGACTTTGGGGATTTTG
CTGAGTGGCATTTTCGAGCGCATTGTCCGGGTGAATTTGAGACAAACTCTACAAGC
TGATTATGTCGAGGCGGCGCGGGCGCGGGGGGTCTCCGAGTTACGGATTTTGCTGG
CTCATGCTCTCAAAAATGCCATGATTCCCGTGATTACCGTTTTGGGGCTGACTTTTG
CCGCTTTGTTGGGAGGGGCGATTTTAACTGAGGTGACTTTTTCTTGGCCGGGATTAG
CTAATCGCTTGTATGAGGCTATTCGTCTGCGAGATTATCCCACAGTCCAGGGGGTG
GTTGTGTTTTTGGCCGTAATTGTCGTGATCGCTAGTTTGGCGATCGATATTTTGAAT
GCTTGCATTGACCCCCGGATTCGCTATTAATTGCTTCTCAGAAAATATACTTAGTTA
TTAATACTTAGTAAATTTTGAAGAGACTTTAATAAATTTTAACAAACTAAAAGGCA
CTGGCAGTGTATAAATGATATTTGAAGGGGTGAGAAGGAAGGCGAATGTTGGTTTA
TGAAGTTTCATTAACATTTGTATCAAAATATTAAATTCTTCTCATAAACCGCGTACA
ATCTTTTAAGATTTCAGAAAGTGTTCTAGGATACTTGAGAAATGGACCACGGGGCA
ATTGTGAAAAGCCTTTGTCCAGGGTTCACCCCGGAAGGGGTCTGAGGAGATGGCAC
CAGTGGATTGATTGTAGTAATCATTCATGGTGTGTAGAATCCCAAGCTAACTCTAA
GCAAGTCAACAAGTAGGAGATAAGTCCATGTTTGATGCCTTCACTAAGGTGGTTTC
TCAGGCTGATACTCGCGGCGAAATGCTGAGTACAGCTCAAATCGATAAGCTAGCTT
GGATCCTCTAGATTTAAGAAGGAGATATACAT

RBS-cblT:
TTTAAGAAGGAGATATACAT

CblT:
ATGAATCGCCGCTTAGCTTGGACCGCTGTTTGTTTAGCTTTATCTGCTATTGGTTCTT
TTATTAAATTACCCACCTTTGTTGGTTCTATTGCTTTAGATTCTGCTCCCGCTTTAGT
TGCTGCTGGTGTTTTAGGTCCCCGCGCTGGTGCTGCTGTTGCTGGTTTAGGTCATTT
AGTTTCTGCTTTAATTGGTGGTTTTCCCTTAGGTCCCGTTCATTGGTTTGTTGCTTTA
GAAATGGCTGGTTTAGGTGCTTTATTTGCTGTTTTACATCGCCGCGGTTGGAAAATT
GGTTCTGCTGTTGTTTTTTTTATTGGTAATGCTTTTTTAGCTCCCTTACCCTTAGCTGT
TTCTTTTGGTTGGCCCTTTGTTTTTGCTGTTATTCCCCCCTTATCTGCTGCTGCTGCTG
TTAATGTTTTAATTGCTTTAGCTGTTATGCCCGTTGTTGTTCGCTTAGCTGCTAAAGC
TGGTGTTGAAGCTCCCCATGCTTGA

33
RBS-cblS:
CTGAGATATTTCTAAAGGAGGTCTTTT

CblS:
ATGCGCGATGTTTTATTTTTACCCTTTGCTGATGGTATGGAATTAGCTGTTGCTGCTG
ATGGTTCTGCTGCTGTTGGTGATAAACCCGGTGATGTTGTTTCTGTTCCCGTTGATG
TTGTTGCTTATTTTTCTGCTCGCGTTGCTTTAATGGAATTATTATCTGTTGGTGCTGA
AGCTCGCGTTGTTGTTTTACAAAATTTTATTGCTGATGATCGCTGGGAAGCTTTATG
TCGCGGTGTTCGCCGCACCTGTCGCGAATTAGGTATTGATTTACCCATTACCGGTTC
TACCGAATCTAATTTTCCCACCGTTCAATCTGCTTTAGGTGTTACCGCTATTGGTAC
CGTTGCTAATGAACGCAAACGCATTGGTATTACCCCCGAAGAAGCTAAATTTGCTG
TTATTGGTCGCCCCTTAGTTGGTTCTGCTGTTTTATCTCATCCCGAATGGGTTGCTCC
CTTACCCTTATTTGCTGCTTTATTACGCACCCCCTATATTTATGAATTAATTCCCATT
GGTTCTAAAGGTATTTATTATGAATGGACCCAATTATTAGCTGCTAATGGTCGCCAA
GGTCGCGCTTGTGCTTGTCCCTTACCCTTATTTTCTTCTGGTGGTCCCGCTACCTCTG
TTTTAGTTTCTTATGATCCCGATGGTGAACGCGAAATTAAAAAACAAGCTGGTTCTT
TATTTTTTCCCTTACATGTTGAATGGTAA

RBS-SpecR:
ATGTCCAGACCTGCAGGGAGATAAC

SpecR:
ATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGC
AGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCG
GGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCA
GCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAG
GGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCG
AGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGAT
GGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCT
TGGTGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCC
CTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGAC
ATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCG
CAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTAT
CTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAG
GAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTA
ACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTAC
GTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCG
CTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAA
GCTGGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCA
GTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAAT
AA

3’ Mosaic End:
AGATGTGTATAAGAGACAG

34
5.2. A. platensis culture

Supplementary Figure 1. A. platensis culture with the proposed culture conditions in this study. Its dark-
green colour shows its good health.

35
36