Questions:

1. Why did you mash the banana fruit?

The DNA can be extracted from a larger surface area by mashing the banana. The
liquid soap aids in the breakdown of cell membranes, allowing the DNA to be
released. The DNA and other biological components are collected during the
filtration process (pouring the mixture through the strainer).
2. Why do we use liquid soap?
Soap contains a fat- and protein-removing ingredient called sodium laurel
sulfate. Because cell membranes are made up of fats and proteins, soap will cut
through them. Dish soap rips the membranes apart, allowing the DNA to escape.
3. What does the salt do?
By adding the salt, we can help neutralize the DNA charge and make the
molecule less hydrophilic, which means it's less soluble in water.
4. What does the cold ethanol do?
The cold ethanol helps the DNA precipitate and come out of solution so it can be
collected and form the bananas DNA.
5. Why can’t you use room temperature ethanol?
It is because the amount of DNA precipitated increases as the ethanol becomes
cooler.
6. How will you describe the appearance of the DNA you extracted both from
banana fruit and your cheek cells.
The DNA extraction appearance looked like tiny cotton or wool fibers, which
makes sense because the DNA is made of tiny interwoven fibers. The purpose of the
mashing was to break down the cell walls. The addition of the soap solution then
causes those weakened cell walls to lyse by dissolving the lipid and nuclear
membranes and releases DNA, and salt helps bring DNA together and with the help
of alcohol DNA precipitate and come out of the solution with a tiny cotton
appearance.
7. Compare the results of A & B to C activity. Explain the result.
The result of the activity A, the DNA that was instracted from the banana is like
tiny cotton in which the soap contributes in the breakdown of cell membranes and
the release of DNA. The salt increases in the adsorption of DNA, while the cold
alcohol facilitates in the extraction of DNA out of solution, allowing it to be collected.
The result of the activity B, The extraction of own DNA is likely a white strings and
clumps in which some of the cheek cells become suspended in the salt water and
washing up liquid breaks down your cheek cell membranes, DNA is not soluble in
alcohol so it forms a solid where the alcohol and salt water layers meet forming a
white string apperance. The result of the activity C, using plain water instead of saline
solution is just same as Activity B, however the DNA that was extracted without the
saline solution is not evident, in which the salt or the saline solution helps suspended
or form the cheek cells. yet a single DNA molecules are far too small to see with a
naked eye.
Activity # 2 Mutations

Objective: Identify the types of mutations, and explain the molecular effects that
each has on base sequences of DNA

Instructions:

A. Consider this original template DNA strand:

5’---AAGCAGCCATAACGAACGCAT---3’

1. For what sequence of amino acids does this DNA strand code? (assume it doesn’t
contain introns)
Answer: LYS - GLN - PRO – STOP – ARG – THR – HIS

2. The table below lists 5 different mutations that may occur in this DNA strand.
What happens to the amino acid sequence produced as a result of each
mutation? (All positions are from the 5’ end of the DNA template.)

Mutation Effect on amino acid sequence Type of mutation

Substitution 5’ – AAGCAGCCAUAACUAACGCAU – 3’ Point Mutation: Non-

of T for G at There is an amino acid alteration, which conservative
may result in protein dysfunction and Missense
position 14
disease in an organism.

Insertion of 5’ – AAGCAGCCAUAACGUAACGCA U – 3’ Frameshift mutation:

T between The insertion affects the arrangement of Insertion
codons, generating amino acid alterations.
positions
This causes protein dysfunction.
14
and 15

Deletion 5’ – AAGCAGC*AUAACGAACGCAU – 3’ Frameshift mutation:

of C at The organization and sequencing of the Deletion
codon will be altered if a nucleotide is
position 7
deleted. The function of the resultant
protein will be altered as a result.
Substitution 5’ – AAGUAGCCAUAACGAACGCAU – 3’ Point mutation: Nonsense
of T for C at The substitution of T for C at position 4
results in a change in the 2nd codon from
position 4
Gln to STOP. This will very certainly result in
a protein that is no longer functional.
B. Answer the following:
1. A template strand of a gene has this base sequence:
3´−TACAT*CCGATAGGGTCAT−5´. Exposure to radiation causes a mutation in this
gene. The thymine at the site of the mutation (*) is deleted. This will most likely result
in:

A. mRNA codons preceding (towards the 3’ end) the mutation to be

misread
B. mRNA codons downstream to the start codon to be misread
C. no change of any kind
D. no change in the polypeptide coded by this gene
E. the AUG triplet functioning as a chain terminator

Answer: B. mRNA codons downstream to the start codon to be misread

2. Which of the following is analogous to a frameshift mutation?

A. THERATATETHECAT
B. THETACATETHERAT
C. THECATARETHERAT
D. THECATATTHERAT
E. CATATETHERAT

Answer: D. THECATATTHERAT

3.Assume that the following polypeptide chain is produced by a wild-type gene in an

organism:
N-met-lys-trp-leu-his-ala-glu-gly-lys-C

Assume that a phenotypically observable mutation occurred in the coding region of

the mRNA that coded for this polypeptide. Assume that a base substitution occurred
in the 7 base positions counting from the 5' end of that coding region. Without
referring to actual codons, what is a likely sequence resulting from such an
alternation?

A. N-met-lys-arg-leu-his-ala-glu-gly-lys-C
B. N-met-C
C. N-met-lys-trp-leu-his-ala-ala-gly-lys-C
D. N-met-lys-trp-leu-his-ala-glu-gly-lys-C
E. None of the above

Answer: A. N-met-lys-arg-leu-his-ala-glu-gly-lys-C
4.

a. b. c. d.

Answer: B.

5.

a.

b.

c.

d.

Answer: D.
Activity #1 DNA Extraction

Documentation A: DNA Extraction from banana fruit

Documentation B: Extraction of your OWN
Documentaion C: Using Plain water instead of Saline Solution
 Group members Contribution
Jakosalem, Anna Myrtle F. Experimenting (Activity 1 B)
Escala, April Mae Observing and Answered 1,2,3,5
Popus, Russel Mae Experimenting (Activity 1 A and C)
Candazo, Sheena Mae Observing and Answered 4,6,7
Biaco, Sofia Denise Answered (Activity 2 A and B)