Mol Biol Rep (2015) 42:345–353
DOI 10.1007/s11033-014-3774-5
Development and imprinted gene expression in uniparental
preimplantation mouse embryos in vitro
Minhua Hu • Li-Chi TuanMu • Hengxi Wei •
Fenglei Gao • Li Li • Shouquan Zhang
Received: 10 March 2013 / Accepted: 20 September 2014 / Published online: 1 October 2014
Ó Springer Science+Business Media Dordrecht 2014
Abstract Increasing numbers of reports show that
imprinted genes play a crucial role in fetal development,
and uniparental embryos, which possess two paternally or
two maternally derived pronuclei, are excellent tools for
investigating the biological significance of imprinted
genes. In the present study, to examine the in vitro devel-
opmental ability and expression pattern of eight imprinted
genes in uniparental embryos, we produced androgenones,
gynogenones, and parthenogenones using enucleation. Our
data confirmed the previously observed restriction in hap-
loid androgenetic development potential and first indicated
that diploid androgenetic embryos were arrested in the 3/4-
cell stage. Some imprinted genes were expressed in
androgenetic, gynogenetic, and parthenogenetic blasto-
cysts, suggesting that they were unable to maintain their
imprinted expression status in uniparental embryos and that
both paternal and maternal alleles are required for the
specific expression of some imprinted genes.
Keywords Androgenetic  Gynogenetic 
Parthenogenetic  Development  Imprinted genes
Introduction
Development of mammalian embryos to term requires the
presence of both paternal and maternal genomes. A reliable
nuclear transfer technique [1] allows generation of unipa-
rental embryos that possess two paternally derived pronuclei
M. Hu  L.-C. TuanMu  H. Wei  F. Gao  L. Li  S. Zhang (&)
Agricultural Animal Genomics and Molecular Breeding Key Lab
of Guangdong Province, College of Animal Science, South China
Agricultural University, Guangzhou 510642, China
e-mail: sqzhang@scau.edu.cn
(androgenones) or two maternally derived pronuclei (gyno-
genones and parthenogenones), providing useful models for
the investigation of genome imprinting and its role in onto-
genesis. Although these uniparental embryos are capable of
development to blastocysts and implantation, none of them
develop to term and die shortly after implantation [2–4].
Hoppe reported that mouse diploid androgenetic and gyno-
genetic embryos can develop to term and the failed devel-
opment of parthenogenetic embryos is due to the absence of
an extragenomic contribution from the spermatozoon [5, 6].
However, similar results could not be obtained by other
investigators [7, 8]. Previous reports showed that the con-
tribution of the paternal and maternal genome to embryo
development is not equivalent. The maternal genome largely
contributes to the embryo proper, and gynogenones and
parthenogenones have poorly developed extraembryonic
membranes. The paternal genome contributes to extraem-
bryonic structures, and androgenones have a retarded
embryonic component [2–4, 9, 10]. These different pheno-
typic features are largely a consequence of imprinting
mechanisms, which determine the loci expression according
to their parental origin. In humans, a number of diseases such
as Beckwith-Wiedemann Syndrome, Wilms’s tumor [11],
Complete Hydatidiform Moles [12], and ovarian teratomas
[13] are suspected to be due to the abnormal expression of
imprinted genes. Cancer is the most common consequence
due to the malfunction of imprinted genes [14]. In addition,
developmental disorders of language and social cognition
[15] and neurobehavioral disorders [16] are also associated
with incorrect imprinted gene expression. Thus, uniparental
embryos are important tools for investigating the biological
significance of imprinted genes in mammals.
The aim of this study was to evaluate the developmental
ability of different kinds of uniparental embryos that were
created with enucleation of one pronucleus followed by
123
346
electrofusion at the 2-cell stage and partheno-activation
in vitro. Furthermore, the expression patterns of four
paternally and four maternally expressed genes in diploid
androgenetic/gynogenetic and parthenogenetic blastocysts
were examined. The results demonstrated that YY diploid
androgenetic mouse embryos were arrested at the 3/4-cell
stage, and expression of some imprinted genes in unipa-
rental blastocyst embryos was disrupted.
Materials and methods
Animals
The mice used in these experiments were of the Kunming
(KM) strain. To obtain fertilized 1-cell zygotes, 4- to
6-week-old females were superovulated by intraperitoneal
injection of 5 IU pregnant mare serum gonadotrophin fol-
lowed by 5 IU human chorionic gonadotrophin (HCG)
46–48 h later. After the HCG injection to induce super-
ovulation, these female mice were mated with male mice of
the same strain. Females were screened for vaginal plugs
the following morning; the day of finding the plug was
designated day 1.
Preparation of androgenetic and gynogenetic embryos
Zygotes were collected from KM females 17–18 h after
HCG injection. They were freed from the cumulus cells
with a 5-min treatment with 300 IU/ml hyaluronidase in
Hepes-potassium simplex optimized medium (KSOM).
The zygotes were rinsed and kept in KSOM medium at
37 °C in 5 % CO2 in air for less than 2 h before further
treatments. The zygotes were transferred to a droplet of
Hepes-KSOM containing 5 lg/ml cytochalasin B, which
had previously been placed in the operation chamber on the
microscope stage, and were kept there for 5–10 min before
enucleation.
Haploid androgenetic embryos were made by enucleation
of the female pronucleus, which was distinguished from the
male pronucleus based on the size and distance from the
polar body, by piercing the zona pellucida using a Piezo drive
(Prime Tech, Japan) and aspirating with a micromanipulator.
Similarly, the haploid gynogenetic embryos were made by
enucleation of the male pronucleus. The haploid androge-
netic/gynogenetic embryos were rinsed and cultured in
KSOM medium at 37 °C in 5 % CO2 in air.
Diploid androgenetic/gynogenetic embryos were
obtained by electrofusion of sister blastomeres at the 2-cell
stage (day 2). For electrofusion, the haploid 2-cell embryos
were placed into a 1-mm wire stainless electrode chamber
filled with 0.3 M mannitol solution. After orientation of the
cleavage plane in parallel with the electrodes, one AC
123
Mol Biol Rep (2015) 42:345–353
pulse of 140 V was introduced into the chamber for 25 ls
with an electric cell-fusion processor (BTX, Inc., San
Diego, CA). The embryos were rinsed and cultured in
KSOM medium. One hour later, the fusion was completed,
and perfectly fused embryos were selected and incubated in
KSOM medium under oil at 37 °C in 5 % CO2.
Parthenogenetic embryos
To obtain parthenogenetic embryos, mature oocytes (with
the first polar body) were activated with 7 % ethanol for
5 min at room temperature, washed three times with
Hepes-KSOM, and cultured in KSOM medium containing
2 mM 6-dimethylaminopurine for 3 h. After this time,
embryos that had formed a single female pronucleus and a
second polar body or two distinct pronuclei were selected
and cultured in KSOM medium at 37 °C in 5 % CO2 in air.
Sex determination of diploid androgenetic embryos
by polymerase chain reaction (PCR)
Individual diploid androgenetic embryos were sexed with
PCR using X- and Y-specific sequences. Individual
embryos were transferred into a 200-ll PCR tube con-
taining 20 ll lysis buffer, which was supplemented with
0.5 mg/ml proteinase K [17]. PCR with DNA from a single
embryo was performed in a programmed thermal cycler
(Bio-Rad, Hercules, CA) at 56 °C for 1 h to break the
embryos and release the DNA. The tube was incubated at
95 °C for 10 min to inactivate the proteinase K. Amplifi-
cation of sequences from the Y chromosome-specific gene,
Zfy, was carried out using the primer set forward: 50 -
GACTAGACATGTCTTAACATCTGTCC-30 and reverse:
50 -CCTATTGCATGGACAGCAGCTTATG-30 [18], and
the X chromosome specific-sequences in the Xist gene
were amplified using the primer set forward: 50 -AGGA-
TAATCCTTCATTATCGCGC-30 and reverse: 50 -
AAACGAGCAAACATGGCTGGAG-30 [19]. The PCR
conditions consisted of a 5-min denaturation at 94 °C,
followed by 40 cycles of 94 °C for 30 s, 55 °C (Zfy) or
65 °C (Xist) for 30 s, and 72 °C for 1 min, followed by a
10-min extension at 72 °C. The resulting PCR products
were electrophoresed on a 1.5 % agarose gel and visualized
under ultraviolet light.
Cell counting
To assess the quality of the androgenetic embryos, the
total cell number of the diploid androgenetic embryos was
counted after staining with 5 lg/ml Hoechst 33342.
Mol Biol Rep (2015) 42:345–353 347

Table 1 Primer sequences for real-time PCR

Gene Primer sequences (50 - [ 30 ) Gene accession no. Length (bp)
Forward Reverse

Igf2r TTTGTGTGCCCATCTGAGCGG GCAGGTAATCTCTGTGGCAGGC NM_010515 115

Impact TTGCTGCTTGCCAGTCGTCTC CTGCCTCTGGCTGTTCCCTACT NM_008378 103
Peg10 AACCCTGACATGCTGGGTCCT AAGCACACACGGATGCGGTC NM_130877 95
Dlk1 TGGCAGTGCATCTGCAAGGAT TCCAGGTCCACGCAAGTTCC NM_010052 107
Asb4 TCCTGCTGCACAGCCTGAGAT TTCGGGCAAGAGTGGCAAGC NM_023048 111
Mest GGCATGGGATAATGCGGCCA ATGTGCAGGTACGCAGCCAG NM_008590 111
Phlda2 GCGCATTTGGTGCAACCTTTCG ACAGGCTGTCGCTTCGCTTC NM_009434 118
Cdkn1c CCCGACTGAGAGCAAGCGAA CGCTGTTCTGCTGGCTGATTG NM_009876 117
GAPDH TTCTTGTGCAGTGCCAGCCTCG CTGCAAATGGCAGCCCTGGTGA NM_008084 103

Gene expression analysis
Total RNA from pools of 15–20 diploid androgenetic/
gynogenetic, parthenogenetic, and control blastocysts was
extracted using the RNeasy Micro Kit (Qiagen, Hilden,
Germany) according to the manufacturer’s instructions.
The cDNA was synthesized and amplified using the
QuantiTect Whole Transcriptome Kit (Qiagen). Quantita-
tive gene expression analysis was carried out with the ABI
7500 real-time PCR (Applied Biosystems, Foster City, CA)
system using SYBR Green PCR Master Mix kit (ABI)
under the following conditions: 95 °C for 30 s, 40 cycles of
denaturation at 95 °C for 5 s, annealing at 60 °C for 34 s,
and extension at 72 °C for 30 s. The primer information is
listed in Table 1. Results for each group were obtained at
least three times, and the expression of each gene was
evaluated based on the GAPDH expression in each group
and represented as a relative level to that in the controls.
Statistical analysis
Developmental data were evaluated using analysis of variance
along with Duncan’s Multiple Range Test. For blastocyst cell
number and gene expression data, the statistical significance
of differences was evaluated using the Student’s t test.
Results
Enucleation of zygotes
Zygotes with a distinct pronucleus and normal morphology
were selected and prepared for enucleation (Fig. 1a). Those
that could not be distinguished were discarded. In the
presence of cytochalasin B, the whole pronucleus could be
enucleated easily without destruction of the cytoplasmic
membrane through the formation of a cytoplasmic bridge
(Fig. 1b–d). To ensure successful enucleation, embryos in
which the pronucleus could not be fully enucleated
(nuclear membrane disrupted) were discarded.
In vitro development of uniparental mouse embryos
We generated five types of uniparental embryos, including
haploid/diploid androgenetic, haploid/diploid gynogenetic,
and parthenogenetic mouse embryos. Figure 2 shows the
different developmental stages of androgenetic diploid
mouse embryos. Table 2 shows the developmental ability
of different kinds of embryos.
Most of the enucleated embryos (Fig. 2a) cleaved to the
2-cell stage on day 2. The cleavage rate was more than 95 %,
which was not significantly different from the control group.
However, the cleavage rate of parthenogenetic embryos was
significantly lower than the other groups (p \ 0.05), indicat-
ing that the micromanipulation did not interfere with the
cleavage. On day 4 (48 h after electrofusion), the diploidized
androgenetic/gynogenetic embryos developed to the 3/4-cell
stage. Two typical types of morphology were seen: embryos
with the same morphology as normal 4-cell stage embryos
with blastomeres that were independent and that had sharp
edges (Fig. 2c, white arrow); the other type was the same as
normal embryos with a morula that had already compacted
(Fig. 2c, black arrow). Although there were no significant
differences between the haploid/diploid androgenetic and
gynogenetic embryos, due to the electrofusion, the rate of
embryos that cleaved to the 3/4-cell stage was significantly
different between haploid and diploid androgenetic/gynoge-
netic embryos (p \ 0.05). The following day (day 5), we
found that only the compacted 3/4-cell embryos could develop
to the blastocyst stage. Those that failed to compact were
retarded in their development. Compared with normal blas-
tocysts, diploid androgenetic embryos displayed small blas-
tocoele cavities and abnormal morphologies (Fig. 2d). The
blastocyst formation rate of the four manipulated groups was
significantly different. Among the four manipulated groups,
the diploid androgenetic group had the highest rate (9.8 %),

123
348
Fig. 1 The process of enucleation of zygotes. a The small pronucleus
located beneath the second polar body was judged as maternal
(arrow); b The pronucleus was sucked into the pipette with the
application of Piezopipet micromanipulator; c The pipette was
and the haploid androgenetic group was the lowest (4.0 %).
The parthenogenetic groups showed intermediate rates of
blastocyst formation (p \ 0.05).
Sex chromosome determination of diploid androgenetic
embryos
A total of 38 diploid androgenetic embryos were sexed
with PCR using specific primers (Table 3). YY and XX
embryos could be detected until the 3/4-cell (day 4) stage
of diploid androgenetic embryos (Fig. 3a), but at the
blastocyst stage, only XX androgenetic embryos remained
(Fig. 3b), indicating that YY androgenetic embryos were
arrested at the 3/4-cell stage.
Cell number analysis of diploid androgenetic
blastocysts
Diploid androgenetic (day 5) and normal blastocysts were
stained with Hoechst 33342 (Fig. 4), and the cell number
123
Mol Biol Rep (2015) 42:345–353
withdrawn, and a cytoplasmic bridge (arrow) was formed between
the cytoplasm of the embryo and the pronucleus karyoplast; d The
pronucleus (arrow) was surrounded by a small volume of cytoplasm
and a portion of the embryo’s plasma membrane. Scale bar = 50 lm
is shown in Table 4. The average cell number of diploid
androgenetic blastocysts (22.3 ± 1.15) was significantly
lower compared with control biparental blastocysts
(35.9 ± 0.74, p \ 0.01), indicating the poor develop-
mental ability and morphology of diploid androgenetic
blastocysts.
Imprinted gene expression in diploid uniparental
blastocysts
The expression pattern of eight imprinted genes in the
diploid androgenetic/gynogenetic and parthenogenetic
blastocysts was analyzed with real-time PCR (Fig. 5).
Two maternally expressed genes, Igf2r (Fig. 5b) and
Phlda2 (Fig. 5c), and one paternally expressed gene,
Impact (Fig. 5d), were expressed in all samples, sug-
gesting that the imprinting was relaxed in these genes.
The paternally expressed gene Impact was expressed at
negligible levels in gynogenetic embryos. Two paternally
expressed genes, Mest (Fig. 5e) and Peg10 (Fig. 5f), were
Mol Biol Rep (2015) 42:345–353 349

Fig. 2 Development of diploid androgenetic embryos. a Embryos Some embryos had already compacted (black arrow), and the others
after enucleation of one pronucleus; b On day 3, the diploidized showed arrested development (white arrow); d On day 5, the embryos
embryos cleaved to the 2-cell stage after electrofusion; c On day 4, had developed to the blastocyst stage (72 h after electrofusion). Scale
the embryos developed to the 3/4-cell stage (48 h after electrofusion). bar = 50 lm

Table 2 In vitro development of different types of embryos

Type of embryos Number of manipulated embryos Number developing to the indicated stage (%)
2-cell 3/4-cellb Blastocystc
Before fusion After fusiona

Diploid androgenetic 845 827 (97.8)d 342 (43.5) 201 (26.2)fg 77 (9.8)j
Diploid gynogenetic 316 306 (96.6)d 99 (34.4) 59 (19.5)g 14 (4.4)j
d h
Haploid androgenetic 273 260 (95.2) / 123 (45.2) 11 (4.0)j
Haploid gynogenetic 330 322 (96.9)d / 157 (47.0)h 15 (4.6)j
Parthenogenetic 228 200 (86.9)e / 101 (42.6)fh 45 (19.4)k
d i
Control 154 149 (97.4) / 140 (91.2) 131 (84.7)l
Number of replicates, C 3
a
Cleavage number of the diploidized androgenetic/gynogenetic embryos 24 h later
b
According to embryo morphology, data of diploid androgenetic/gynogenetic embryos were collected on day 4 (48 h after electrofusion), and
data for the others were collected on day 3
c
Blastocyst on day 5
d–l
Values with different superscript letters differ significantly; p \ 0.05

detected only in androgenetic but not gynogenetic or the controls. Asb4 (Fig. 5a) was detected in androgenetic
parthenogenetic embryos. These genes seemed to main- and parthenogenetic embryos, but not in gynogenetic
tain the expression patterns specific to their parental ori- embryos. Cdkn1c and Dlk1 were not detected in any
gins. In particular, Mest expression was 7.8-fold of that in samples.

123
350 Mol Biol Rep (2015) 42:345–353

Discussion androgenesis. Edwards reported that they can successfully

To date, uniparental mouse embryos have been obtained with
various procedures, such as irradiation of spermatozoa with
X-rays [20] or ultraviolet rays [21] or by the action of
chemical compounds [22] to induce gynogenesis, and by
colchicine [23, 24] or delayed insemination [25] to induce
induce gynogenesis and androgenesis by treating mouse
oocytes with colchicine at fertilization, although the degree
of heteroploidy is not perfectly controlled [26]. Bisection of
zygotes has been used to generate haploid mouse embryos.
Although some blastocysts were obtained, they were not all
haploid [27, 28]. In 1975, Modlinski performed

Table 3 Sex chromosome determination of diploid androgenetic

Table 4 Analysis of blastocyst cell number in diploid androgenetic
embryos
embryos
Developmental stage Type of embryos Androgenones Control
Type of embryo Number of embryos Number of blastocyst cells*
Sex chromosome XX YY XX XY
Androgenones 16 22.3 ± 1.15a
2-cell 4 2 2 2 Control 27 35.9 ± 0.74b
3/4-cell 2 6 3 2
* Mean ± standard error of the mean
blastocyst* 24 0 5 10 a,b
Values with different superscript letters differ significantly;
*
Androgenetic and control blastocyst were collected on day 5 p \ 0.01

Fig. 3 Sex chromosome determination of diploid androgenetic
embryos. Each embryo is shown in two lanes. The PCR product
from the X-linked Xist is 234 bp (left lane); the PCR product from the
Y-linked Zfy is 183 bp (right lane); a In 3/4-cell stage androgenetic
embryos, only the 234-bp band was detected in XX androgenones
(sample numbers 1 and 8), whereas in YY androgenones, the 183-bp
band was detected (sample numbers 2, 3, 4, 5, 6, 7); b Blastocyst-
stage androgenetic embryos. All samples had only the 234-bp band,
indicating that all were XX androgenones. M; DL 1,200-bp DNA
Marker; N: H2O as the negative control; m: Male mouse; f: female
mouse

Fig. 4 Cell nuclei staining of a diploid androgenetic blastocyst. a Staining of a normal diploid blastocyst; b Staining of a diploid androgenetic
blastocyst. Scale bar = 20 lm

123
Mol Biol Rep (2015) 42:345–353
Fig. 5 Relative expression levels of six imprinted genes in diploid
uniparental blastocysts. Quantitative real-time PCR analyses of
maternally (a, b, c) and paternally (d, e, f) expressed imprinted
genes in androgenetic (And), gynogenetic (Gyn), parthenogenetic
(Par), and control (Con) blastocysts. The mean expression was
microsurgical removal of one pronucleus from zygotes [29],
a technique that was first used for the enucleation of sea
urchin eggs [30] to generate haploid embryos. Based on this
technique, a more reliable method of nuclear transplantation
was developed to generate uniparental mouse embryos [1].
Then the researchers performed in vitro fertilization (IVF)
[31] and intracytoplasmic sperm injection (ICSI) [32] with
Piezo micromanipulation to generate androgenetic mouse
embryos. In this experiment, we first remove the pronucleus
of the zygotes with the Piezo to generate haploid androge-
netic/gynogenetic embryos, and then hemizygous diploid
embryos were created by electrofusion of sister blastomeres
at the 2-cell stage [31]. Parthenogenetic embryos were
obtained by ethanol [33] and 6-dimethylaminopurine acti-
vation [34].
Although the cleavage rate of the manipulated embryos
(except the parthenogenetic embryos) was not significantly
different from the controls, the blastocyst formation rate
was significantly lower than in the controls. The devel-
opmental data indicated that fewer than half of the 2-cell
stage embryos developed to the 3/4-cell stage and that the
others were arrested. In the diploid androgenetic/gynoge-
netic embryos, the percent developing to the 3/4-cell stage
was significantly lower than those developing to haploid
embryos. Thus, electrofusion impaired the development of
the embryos. Previous reports showed that most haploid
351
calculated as a percentage of the expression in the controls. Data
represent the mean ± standard error of the mean (n = 3). Asterisks
denote means that were significantly different from the fertilized
controls
androgenetic embryos arrest after the first few cleavage
divisions, and few develop to blastocysts [3, 35]. In the
present study, haploid androgenetic blastocyst formation
was the lowest (4.0 %), and diploid androgenetic forma-
tion was less than 10 %. These results are lower than other
reports showing that the rate of diploid androgenetic
blastocyst formation can reach 56.5 % [36] and 11 % in
haploid embryos [31]. The reasons for these low blastocyst
development rates may be associated with the method for
generating uniparental embryos. In this study, we used
electrofusion to generate the diploid androgenetic/gyno-
genetic embryos. To some extent, electrofusion influences
the development of the embryos to the 3/4-cell stage
compared with the IVF and ICSI methods. Combinations
of bispermic embryos exist in the ratio of 1 XX: 2 XY: 1
YY. Embryos with Y or YY are arrested after a few
cleavage divisions [32, 37]. Our data first indicated that
YY embryos were arrested in the 3/4-cell stage (48 h after
electrofusion), and none could be detected in the blastocyst
stage. With electrofusion, we could only yield hemizygous
diploid androgenetic/gynogenetic embryos that were only
comprised of XX and YY. Thus, the chance of blastocyst
formation was reduced to 50 % compared with IVF and
ICSI methods. Reports have shown that hemizygous dip-
loid androgenetic blastocyst formation is significantly
lower than heterozygous diploid formation [31]. Although
123
352
50 % of the Y/YY chromosome-bearing embryos were
arrested, the blastocyst formation rate was far below 50 %,
indicating an effect of factors other than just the absence of
an X chromosome. Reports have shown that diploid
androgenetic blastocyst formation is significantly impacted
by the egg composition [38, 39]. The culture medium can
also significantly influence the development of diploid
androgenetic embryos. The low sodium chloride medium
(CZB) group was superior (56.6 %) to the high sodium
chloride (M16) (45 %) group in blastocyst formation [36].
In our experiment, the low blastocyst formation may be
largely due to inappropriate use of the mouse strain (KM)
and/or the medium.
Imprinted genes are expressed solely from either the
paternal or maternal allele, depending on their parental
origin. Because the androgenones, gynogenones, and par-
thenogenones possess two sets of paternal and maternal
genomes, respectively, assuming that imprinted gene
expression is maintained in the uniparental embryos, the
transcription level in the diploid uniparental embryos
should theoretically be double and/or undetectable of those
in normal embryos. In the present study, three imprinted
genes, the maternally expressed Igf2r and Phlda2 and
paternally expressed Impact, were expressed in androge-
netic, gynogenetic, and parthenogenetic blastocysts, sug-
gesting that the imprinting was relaxed in these genes.
Previous reports demonstrated that mouse androgenetic and
gynogenetic 8-cell embryos exhibit significant amounts of
Igf2r mRNA compared to 2-cell embryos [40]. In addition,
Igf2r was unexpectedly found to be expressed in E9.5
androgenetic fetuses [41]. On the other hand, Phlda2
(Tssc3) and Impact were detected in E9.5 androgenetic and
parthenogenetic fetuses [42]. These results indicate that
these imprinted genes are unable to maintain their
expression pattern in uniparental embryos. In certain cases,
both parental alleles are required to establish imprinted
gene expression [43]. In this study, Mest and Peg10, which
are expressed only from the paternal allele, seemed to
maintain expression patterns that were similar to their
parental origins. Indeed, Mest and Peg10 can be detected in
androgenetic but not in parthenogenetic fetuses at E9.5 [41,
42]. A maternally expressed gene, Asb4, was detected in
androgenones and parthenogenones in accordance with a
previous report [42], but interestingly, Asb4 was unde-
tectable in gynogenones. Further research is needed to
explain this observation. Dlk1 and Cdkn1c were undetect-
able in all samples, in contrast to a previous report showing
expression in E9.5 mouse fetuses [42]. Similar results have
been found in other species. Dlk1 was not detected in
parthenogenetic, androgenetic, or control bovine blasto-
cysts [44], and Cdkn1c was not detected in sheep blasto-
cysts [45]. Although some imprinted genes may exhibit
differences in different species [46], Dlk1 and Cdkn1c may
123
Mol Biol Rep (2015) 42:345–353
be completely imprinted and coordinately activated during
post-implantation development.
Finally, our findings suggest that some imprinted genes
lost their expression patterns in uniparental embryos. Fur-
ther investigation of the mechanism of imprinted gene
regulation is needed to explain the disruption of the
imprinted status.
Acknowledgments This study was supported by the National Basic
Research and Development Program of China (973 Program)
(No.2011CB944202, 2010CB945001 and 2009CB941601) and the
National Science Supporting Plan of China (2011BAD19B03). The
funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript. The authors are
grateful to the anonymous reviewers for their comments that helped to
improve the earlier versions of this manuscript.
References
1. McGrath J, Solter D (1983) Nuclear transplantation in the mouse
embryo by microsurgery and cell fusion. Science 220:1300–1302
2. Barton SC, Surani MA, Norris ML (1984) Role of paternal and
maternal genomes in mouse development. Nature 311:374–376
3. McGrath J, Solter D (1984) Completion of mouse embryogenesis
requires both the maternal and paternal genomes. Cell 37:179–183
4. Surani MA, Barton SC, Norris ML (1984) Development of
reconstituted mouse eggs suggests imprinting of the genome
during gametogenesis. Nature 308:548–550
5. Hoppe PC, Illmensee K (1977) Microsurgically produced
homozygous-diploid uniparental mice. Proc Natl Acad Sci USA
74:5657–5661
6. Hoppe PC, Illmensee K (1982) Full-term development after
transplantation of parthenogenetic embryonic nuclei into fertil-
ized mouse eggs. Proc Natl Acad Sci USA 79:1912–1916
7. Modlinski JA (1980) Preimplantation development of microsur-
gically obtained haploid and homozygous diploid mouse embryos
and effects of pretreatment with Cytochalasin B on enucleated
eggs. J Embryol Exp Morphol 60:153–161
8. Markert CL (1982) Parthenogenesis, homozygosity, and cloning
in mammals. J Hered 73:390–397
9. Kaufman MH, Barton SC, Surani MA (1977) Normal postim-
plantation development of mouse parthenogenetic embryos to the
forelimb bud stage. Nature 265:53–55
10. Barton SC, Adams CA, Norris ML et al (1985) Development of
gynogenetic and parthenogenetic inner cell mass and trophecto-
derm tissues in reconstituted blastocysts in the mouse. J Embryol
Exp Morphol 90:267–285
11. Nakao M, Sasaki H (1996) Genomic imprinting: significance in
development and diseases and the molecular mechanisms. J Bio-
chem 120:467–473
12. Kajii T, Ohama K (1977) Androgenetic origin of hydatidiform
mole. Nature 268:633–634
13. Kaplan CG, Askin FB, Benirschke K (1979) Cytogenetics of
extragonadal tumors. Teratology 19:261–266
14. Feinberg AP (2000) DNA methylation, genomic imprinting and
cancer. Curr Top Microbiol Immunol 249:87–99
15. Skuse DH, James RS, Bishop DV et al (1997) Evidence from
Turner’s syndrome of an imprinted X-linked locus affecting
cognitive function. Nature 387:705–708
16. Nicholls RD (2000) The impact of genomic imprinting for neu-
robehavioral and developmental disorders. J Clin Invest
105:413–418
Mol Biol Rep (2015) 42:345–353
17. Zhan A, Bao Z, Hu X et al (2008) Accurate methods of DNA
extraction and PCR-based genotyping for single scallop embryos/
larvae long preserved in ethanol. Mol Ecol Resour 8:790–795
18. Kay GF, Barton SC, Surani MA et al (1994) Imprinting and X
chromosome counting mechanisms determine Xist expression in
early mouse development. Cell 77:639–650
19. Zuccotti M, Monk M (1995) Methylation of the mouse Xist gene
in sperm and eggs correlates with imprinted Xist expression and
paternal X-inactivation. Nat Genet 9:316–320
20. Edwards RG (1957) The experimental induction of gynogenesis
in the mouse. I. Irradiation of the sperm by x-rays. Proc R Soc
Lond B Biol Sci 146:469–487
21. Edwards RG (1957) The experimental induction of gynogenesis
in the mouse. II. Ultra-violet irradiation of the sperm. Proc R Soc
Lond B Biol Sci 146:488–504
22. Edwards RG (1958) The experimental induction of gynogenesis in
the mouse. III. Treatment of sperm with trypaflavine, toluidine
blue, or nitrogen mustard. Proc R Soc Lond B Biol Sci 149:117–129
23. Edwards RG (1958) Colchicine-induced heteroploidy in the
mouse. I. The induction of triploidy by treatment of the gametes.
J Exp Zool 137:317–347
24. McGaughey RW, Chang MC (1969) Inhibition of fertilization
and production of heteroploidy in eggs of mice treated with
colchicine. J Exp Zool 171:465–480
25. Marston JH, Chang MC (1964) The fertilizable life of ova and
their morphology following delayed insemination in mature and
immature mice. J Exp Zool 155:237–251
26. Edwards RG, Sirlin JL (1959) Identification of C14-labelled male
chromatin at fertilization in colchicine-treated mouse eggs. J Exp
Zool 140:19–27
27. Tarkowski AK, Rossant J (1976) Haploid mouse blastocysts
developed from bisected zygotes. Nature 259:663–665
28. Tarkowki AK (1977) In vitro development of haploid mouse
embryos produced by bisection of one-cell fertilized eggs.
J Embryol Exp Morphol 38:187–202
29. Modlinski JA (1975) Haploid mouse embryos obtained by
microsurgical removal of one pronucleus. J Embryol Exp Mor-
phol 33:897–905
30. Hiramoto Y (1962) An analysis of the mechanism of fertilation by
means of enucleation of sea urchin eggs. Exp Cell Res 28:323–334
31. Kono T, Sotomaru Y, Sato Y et al (1993) Development of
androgenetic mouse embryos produced by in vitro fertilization of
enucleated oocytes. Mol Reprod Dev 34:43–46
32. Latham KE, Akutsu H, Patel B et al (2002) Comparison of gene
expression during preimplantation development between diploid
and haploid mouse embryos. Biol Reprod 67:386–392
353
33. Cuthbertson KS, Whittingham DG, Cobbold PH (1981) Free
Ca2 ? increases in exponential phases during mouse oocyte
activation. Nature 294:754–757
34. Szollosi MS, Kubiak JZ, Debey P et al (1993) Inhibition of
protein kinases by 6-dimethylaminopurine accelerates the tran-
sition to interphase in activated mouse oocytes. J Cell Sci 104(Pt
3):861–872
35. Surani MA, Barton SC, Norris ML (1986) Nuclear transplanta-
tion in the mouse: heritable differences between parental gen-
omes after activation of the embryonic genome. Cell 45:127–136
36. Obata Y, Ono Y, Akuzawa H et al (2000) Post-implantation
development of mouse androgenetic embryos produced by in vitro
fertilization of enucleated oocytes. Hum Reprod 15:874–880
37. Morris T (1968) The XO and OY chromosome constitutions in
the mouse. Genet Res 12:125–137
38. Latham KE, Solter D (1991) Effect of egg composition on the
developmental capacity of androgenetic mouse embryos. Devel-
opment 113:561–568
39. Hagemann LJ, First NL (1992) Embryonic cytoplasmic extracts
rescue murine androgenones to the blastocyst stage. Development
114:997–1001
40. Latham KE, Doherty AS, Scott CD et al (1994) Igf2r and Igf2
gene expression in androgenetic, gynogenetic, and parthenoge-
netic preimplantation mouse embryos: absence of regulation by
genomic imprinting. Genes Dev 8:290–299
41. Sotomaru Y, Katsuzawa Y, Hatada I et al (2002) Unregulated
expression of the imprinted genes H19 and Igf2r in mouse uni-
parental fetuses. J Biol Chem 277:12474–12478
42. Ogawa H, Wu Q, Komiyama J et al (2006) Disruption of
parental-specific expression of imprinted genes in uniparental
fetuses. FEBS Lett 580:5377–5384
43. Ruf N, Dunzinger U, Brinckmann A et al (2006) Expression
profiling of uniparental mouse embryos is inefficient in identi-
fying novel imprinted genes. Genomics 87:509–519
44. Cruz NT, Wilson KJ, Cooney MA et al (2008) Putative imprinted
gene expression in uniparental bovine embryo models. Reprod
Fertil Dev 20:589–597
45. Thurston A, Taylor J, Gardner J et al (2008) Monoallelic
expression of nine imprinted genes in the sheep embryo occurs
after the blastocyst stage. Reproduction 135:29–40
46. Arnaud P, Monk D, Hitchins M et al (2003) Conserved methyl-
ation imprints in the human and mouse GRB10 genes with
divergent allelic expression suggests differential reading of the
same mark. Hum Mol Genet 12:1005–1019
123