Biomedicine & Pharmacotherapy 116 (2019) 109054

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Baicalin regulates depression behavior in mice exposed to chronic mild T

stress via the Rac/LIMK/cofilin pathway
Ye Lua,b, Guoqiang Sunb, Fan Yanga, Zhenwei Guanb, Zui Zhangb, Jing Zhaob, Yongyong Liua,b,
⁎⁎ ⁎
Li Chua, , Lin Peia,b,
a
Hebei University of Chinese Medicine, No. 3, Xingyuan Road, Shijiazhuang 050200, China
b
Hebei Province Academy of Chinese Medicine Sciences, No. 209, Jianhua south Road, Shijiazhuang 050031, China

A R T I C LE I N FO A B S T R A C T

Keywords: Background: Depression is a common disease that endangers people’s physical and mental health. Traditional
Baicalin Chinese medicine has advantages in treating the emotional and cognitive symptoms of depressive disorders.
Depression Objective: To study the effects of baicalin on the behavior and to clarify the underlying mechanism through
Synaptic plasticity evaluation of the Rac1-LIMK1-cofilin pathway.
Rac1
Methods: A chronic mild stress (CMS) model of depression was used. Baicalin was administered to the mice for
Cofilin
the intervention, and the positive control group was treated with fluoxetine. Behavioral tests were conducted to
observe the degree of depressive disorders. Synaptophysin (SYP), postsynaptic density protein-95 (PSD95),
brain-derived neurotrophic factor (BDNF), tyrosine kinase receptors (TrkB), Rac1 and cofilin expression was
determined using Western blot analysis, and mRNA was quantified using real-time PCR.
Results: Mice in the CMS group showed an increase in depression-like behavior (p < 0.01), while mice in the
baicalin and fluoxetine groups showed a decrease in depression-like behavior (p < 0.01), compared with the
control group. Electron microscopy showed ultrastructural changes in the hippocampal CA3 area of the CMS
group, which were alleviated by baicalin treatment. SYP, PSD95, BDNF, TrkB, Rac1 and cofilin protein ex-
pression levels were decreased in the CMS group compared with the control group, while these levels were
increased in the baicalin and fluoxetine groups (p < 0.01). There was no significant difference among the
baicalin and fluoxetine groups (p > 0.05).
Conclusion: Baicalin markedly alleviated depression-like behavioral changes, exerted effects on SYP, PSD95,
BDNF, and TrkB expression, activated the Rac1-cofilin pathway, and subsequently improve synaptic plasticity.

1. Introduction of neurotrophins, such as brain-derived neurotrophic factor (BDNF) and

Depression is the most common psychiatric disorder, and it occurs
in 14.1% of females and 14.8% of males worldwide [1]. The core
symptoms of depression include depressed mood, anhedonia (reduced
ability to feel pleasure from natural rewards), irritability, difficulty
concentrating, poor appetite, and insomnia [2]. Depression has a high
incidence, and it seriously affects people’s work, interpersonal com-
munication and social activities [3]. The mechanism of depression has
not been fully described, but several studies have indicated that re-
duced hippocampal serotonin (5-HT) and neuropeptide Y neuro-
transmission are involved in chronic unpredictable mild stress (CMS)-
induced depression-like behaviour [4]. In addition, clinical studies have
shown that depression-like behavior is associated with decreased levels
nerve growth factor [5]. Increased expression of BDNF and other
trophic/growth factors may mediate changes in adult hippocampal
neurogenesis and other forms of neuronal plasticity that are required
for the therapeutic effect of antidepressant treatments [6]. Numerous
studies have confirmed the close relationship between depression-like
behavior and neuroplasticity [7,8]. The latest theoretical research on
the pathogenesis of depression-like behavior has shown that changes in
neuroplasticity are related to the occurrence of depressive symptoms
and that antidepressants can alleviate depressive symptoms by inter-
fering with neuronal morphological plasticity [9]. There is considerable
evidence that BDNF is a regulator of synaptic plasticity; decreased
BDNF expression leads to atrophy and loss of hippocampal neurons,
while short-term BDNF treatment can induce the release of glucuronic

⁎
Corresponding author at: Hebei Province Academy of Chinese Medicine Sciences, No. 209, Jianhua South Road, Shijiazhuang 050031, China.
⁎⁎
Corresponding author.
E-mail addresses: chuli0614@126.com (L. Chu), peilin1383119030@126.com (L. Pei).

https://doi.org/10.1016/j.biopha.2019.109054
Received 11 February 2019; Received in revised form 30 May 2019; Accepted 30 May 2019
0753-3322/ © 2019 Hebei university of traditional Chinese medicine. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Y. Lu, et al. Biomedicine & Pharmacotherapy 116 (2019) 109054

acid and increase the density of dendritic spines [10]. Studies have
shown that the expression of BDNF and the BDNF receptor (TrkB)
changes under stress conditons, which can lead to neuronal death, and
this is related to pathogenesis in central nervous system diseases [11].
Agonist recombination plays an important role in the growth and de-
velopment of the nervous system and the regulation of synaptic plas-
ticity. It promotes the formation of dendritic spines and maintains the
normal structure of dendritic spines by phosphorylating the actin de-
polymerization factor cofilin [12,13].
Classic antidepressants are widely used as a first-line treatment for
depression because of their ability to increase monoamine neuro-
transmitter levels in the synapse [14]. However, the clinical effect of
these drugs needs to be improved, and the drugs also have clinical side
effects in addition to symptom recurrence, residual symptoms, and drug
tolerance [15]. Therefore, the development of more effective and safer
antidepressants is required [16].
Scutellaria (also known as Huang Qin [HQ]) is a commonly used
traditional Chinese medicine that was first listed in the ancient Chinese
book Shennong Grass Classic [17]. Traditional Chinese medicines have
gained increasing attention in recent years because of their low cost and
abundant availability. Baicalin (5, 6-dihydroxy-7-O-glucuronide flavo-
noid glycoside) is a flavonoid compound that is extracted from the dried
roots of scutellaria, and it has been used in East Asia for thousands of
Fig. 1. Chemical structure of baicalin (BAL).
years. Baicalin is the main pharmacological component of scutellaria.
Previous studies suggested that baicalin has anti-inflammatory, anti-
oxidant and neuroprotective effects, and that it can bind to the BZ site 2.3. Groups and drug administration
of the GABA-A receptor, exerting an antidepressant effect without se-
dative and muscle relaxant effects [18–20]. In addition, baicalin has The mice were randomly divided into six groups (eight mice in each
potent antidepressant effects, which likely occur through up-regulating group), as follows: the control group, the CMS group, the fluoxetine
AMPA receptor expression and suppressing neuronal apoptosis in CMS- (Flu) group (10 mg/kg), the high-dose BAL group (H-BAL, 100 mg/kg),
treated rats [21]. the medium-dose BAL group (M-BAL, 50 mg/kg) and the low-dose BAL
Although the diagnosis and treatment of depression has been ex- group (L-BAL, 25 mg/kg). Fluoxetine was administered by gastric ga-
tensively investigated in recent years, existing drugs have the dis- vages, and baicalin was administered by intraperitoneal injection be-
advantage of more side effects compared to TCM. Further research is tween 9:00 and 10:00 AM during the treatment period.
needed to develop drugs with better efficacy and fewer side effects.
Based on these findings, the present study was designed to verify the 2.4. CMS procedure
antidepressant action of baicalin and the mechanism for the improve-
ment of synaptic plasticity. The flow chart for the experiment is shown in Fig. 2. After 1 week of
normal feeding, the control group continued regular feeding (four
mice/cage) and the mice from the other five groups were placed in
2. Materials and methods
single cages (one mouse/cage). All mice ate and drank normally. The
method we used was modified from the CMS procedure described by
2.1. Animals
Willner et al [22]. Overall, there were 14 stressors: day and night re-
versal for 24 h; fasting for 24 h; binding for 2 h; removing water for
Forty-eight healthy male mice from the Institute of Cancer Research
24 h; tilting for 24 h; empty cage for 24 h; ice water swimming for
(ICR) were supplied by the Animal Experiment Centre of Hebei Medical
5 min; noise for 2 h; shaking for 5 min; humidity for 24 h; thermal sti-
University, (license number SCXK 2013-1-003, certificate number
mulation; peculiar smell for 24 h (different for each week); clipping for
15,101,900). The mice were approximately 8 weeks old and weighed
1 min and foreign body for 24 h (different for each week). Two stimuli
20–25 g. The animals were housed in a normal size cage, with the room
were randomly selected each day, and each method was used 2–3 times.
temperature maintained at a constant 24 ± 2 ℃, 60 ± 5% relative
The stimulus used was unpredictable and the CMS lasted for 21 days.
humidity, and a 12 h:12 h light: dark cycle (lights on at 8:00 PM, and off
at 8:00 AM) light/dark cycles. Except for during stress administration
2.5. Sucrose preference test
and the sugar- water test, mice were allowed free access to water and
food at all other times. All animal experiments were conducted ac-
After 1 week of individual housing, the sucrose preference test (SPT)
cording to the guidelines of the National Institutes of Health Guide for
was performed and all of the mice were trained with two bottles of
the Care and Use of Laboratory Animals. The experimental procedures
water: one that contained 1% sucrose (purchased from Hebei Bohai
were approved by the local committee on Animal Care and Use and
biological co., Ltd, Shijiazhuang, China) water and one that contained
Protection at Hebei University of Chinese Medicine.
distilled water for 1 day. Then, all of the mice were given 20 mL of
sucrose water and distilled water for 1 h after fasting. The sugar water
2.2. Drugs consumption experiment was conducted again in the afternoon of day
21 of the CMS administration to calculate the sugar water preference
Baicalin was purchased from Xi'an Yunyue Biotechnology Co., Ltd index.
(Xi'an, China). The structure of baicalin is indicated in Fig. 1. Fluoxetine
hydrochloride was purchased from Lilly Suzhou Pharmaceutical Co., 2.6. Open-field test
Ltd (Suzhou, China). All other chemicals and reagents were of analy-
tical grade. The open-field test (OFT) was performed on day 33 at 8:00 AM and

2
Y. Lu, et al.
Fig. 2. A: Flow chart for the experiment. Mice were randomly divided into six groups, n = 8 per group. All groups except the control group were subjected to a
variety of CMS over 3 weeks; B: The stressors schedule; C: Stressors descriptions.
12:00 AM. The main observational indexes were the total length of the
activity, the time spent in the central area, the number of rearings, the
number of posture modifications, and the number of urinations. The
whole experiment was conducted in a low-light environment. During
the experiment, each mouse was placed in the center of the open box
(60 cm × 60 cm) for video recording. The video captured the mouse’s
path, and its total activity for 5 min. The activity path in the central
area of the open box was continuously recorded using an animal ana-
lysis system (SLY-ETS-WIN7, Beijing Sunny Instruments Co. Ltd.,
Beijing, China). After the experiment, the mice were removed, the
bottom of the box was cleaned and 75% alcohol was used to remove the
residual odor. The scores were calculated as the averaged score given
by two people, which was corrected using the video.
2.7. Forced swimming test
The forced swim test (FST) was performed on day 32. A 20 cm ×
35 cm (diameter × height) plastic cylinder was filled to a depth of
20 cm with water (23–25 ℃). Mice were introduced into the water for a
6-min test session. The floating time in the last 4 min of the test session
was recorded to reflect depression-like behavior of mice, based on the
Biological and Pharmaceutical Bulletin Advance Publication. The la-
tency to floating time (maximum latency time, 2 min) was noted in the
first 2 min of this 6-min session, which measured the time from first
placing the mouse into the water until it stopped moving. Floating
status of the mice was defined as the absence of movement, except for
motion necessary to keep their head above the water to breathe.
2.8. Observation of neuronal morphology
After the behavior tests, two mice from each group were fully an-
esthetized with a 10% chloral hydrate (Yongda Chemical Preparation
3
Biomedicine & Pharmacotherapy 116 (2019) 109054
Development Center, Tianjin, China) intraperitoneal injection, full an-
ethesia was defined as no movement in response to a tail and toe pinch.
Then, the chest was immediately opened and the heart was subse-
quently exposed. A needle was then used to administer 0.9% saline
inserted into the left ventricle of the mouse, hemostatic forceps stabi-
lized the needle, and the right auricle was cut open to collect ap-
proximately 80–100 mL of the heart perfusate. A 2.5% glutaraldehyde
fixation solution (Yongda Chemical Preparation Development Center)
was administered when the mouse fluids, limb spasms, rigidity, and
bleached-out liver demonstrated that the fixation was complete. After
removing the whole brain, the tissue was fixed in 2.5% glutaraldehyde
for 1 h and 1 mm3 tissue cubes were prepared in wax dishes. The tissue
was stored at 4 °C overnight, dehydrated using an ethanol gradient,
embedded in epoxy resin, and sliced with an ultra-thin slicing machine
(RM2016, Leica, Germany) at a thickness of 500–700 Å. Uranium and
lead double staining were observed under a transmission electron mi-
croscope (H-7650, Hitachi, Japan).
2.9. Western blotting
The other animals in each group (n = 3) that were not used for the
behavior tests were used for the subsequent research. The mouse’ brain
was removed, and the hippocampus was isolated and placed on ice,
weighed, and cryopreserved at –80℃. The crushed tissue was placed
into a mortar, and then liquid nitrogen was added. Lysate (1 mL) of was
added and ground until it became liquid. The samples were transferred
to an EP tube, incubated for 10 min on ice, and centrifuged for 10 min.
Then, the supernatant (cytoplasmic protein) was removed, aliquoted
and cryopreserved at −80℃. According to the protein concentration
results, the appropriate volume of the total protein sample was added to
5 × protein gel electrophoresis buffer, gently mixed, denatured at 95 ℃
for 10 min, and immediately stored on ice. The sample was gently
Y. Lu, et al.
added to the well, the power was turned on, and the voltage was ad-
justed to 80 V to allow the sample to pass through the concentrated gel
and separate. The dye and sample migrated on the gel until the elec-
trophoresis ended. After gel electrophoresis, the isolated protein bands
on the gel were transferred to the PVDF (Millipore, USA) membrane by
transfer electrophoresis, and then the membranes were incubated and
probed with the anti-SYP (1:200, Abcam, UK), anti-PSD95 (1:100,
Abcam, UK), anti-BDNF polyclonal (1:200, ThermoFisher, USA), anti-
TrkB polyclonal (1:200, ThermoFisher, USA), anti-Rac1 (1:100, Abcam,
UK), anti-cofilin Polyclonal (1:200, ThermoFisher, USA), and anti-p-
cofilin polyclonal (1:200, ThermoFisher, USA) unlabeled primary an-
tibodies. Next, the membranes were then incubated with a horseradish
peroxidase-labelled secondary antibody (ZB2301/ZB2305, Zsbio
Commerce Store, China).The film was scanned with a Tanon1600, and
the Tanon Gis software (Tanon Science & Technology, China) was used
for analysis. Then, with every band included, the grey value was au-
tomatically generated by the system. The protein levels were normal-
ized to β-actin (BS-0061R, Bioss Antibodies, Beijing, China) as a loading
control.
2.10. Real-time PCR
Total RNA was extracted from tissue samples using Trizol
(Cat15596-026, Invitrogen, USA). Reverse transcription with
TIANScript RT kit (Tiangen Biotech Co., Ltd., China) was performed.
The target gene primers and internal reference gene primers (Table 1)
were used for amplification at 60–95 ℃ for the dissociation curve
analysis. The target genes were detected using real-time PCR (Applied
Biosystems, USA). The primer sequence were showed in Table 1.
2.11. Statistical analysis
SPSS19.0 software (SPSS Inc., Chicago, IL, USA) was used to es-
tablish the database and conduct the statistical analysis. The experi-
mental data are presented as the mean values ± S.E.M. and the com-
parison between groups was performed using a one-way ANOVA
followed by Fisher’s LSD test. Differences among experimental groups
were considered significant at p < 0.05.
3. Results
3.1. Effect of baicalin on SPT
Fig. 3 shows that the sucrose preference in the CMS group was
significantly less than that of the control group (F5,42 = 5.49, p =
0.001), indicating that the model was successfully established. The
fluoxetine group and the high and medium-dose baicalin groups had
significantly higher sucrose preference indexes than the CMS group
(p < 0.01), and the baicalin low-dose group of baicalin was not sig-
nificantly different from the control group (p > 0.05). There was no
significant difference between the fluoxetine group and the high-dose
baicalin group (p = 0.242).
Table 1
The primer sequence of BDNF, SYP, PSD and β-actin.
Gene Primer sequence Fragment size
BDNF Forward: TGGATGAGGACCAGAAG 117 bp
Reverse: GCAGAAAGAGTAGAGGAGGC
SYP Forward: TGGAGTGTGCCAACAAGAC 173 bp
Reverse: AGCCACGGTGACAAAGAA
PSD Forward: TGTAATCCTGAAGCCCTGTC 130 bp
Reverse: GGTTTCCGATGAAGTCCC
β-actin Forward: GGCACCACACCTTCTAC 107 bp
Reverse: CTGGGTCATCTTTTCAC
4
Biomedicine & Pharmacotherapy 116 (2019) 109054
3.2. Effect of baicalin on OFT
The OFT evaluated depression- and anxiety-associated behaviors in
animals, as shown in Fig. 4. The number of times a mouse crossed the
grid in the unfamiliar box over 5 min was used as the horizontal
movement score, and the number of times a mouse climbed the box
wall with the two upper limbs was used as the vertical movement score.
In the open field experiment, the vertical scores (F5,42 = 23.57, p =
0.001) and horizontal scores (F5,42 = 118.23, p = 0.000) of the CMS
group and the control group were significantly lower than the scores of
the fluoxetine group and the high-, medium- and low-dose baicalin
groups, and there were no significant differences among the fluoxetine
group and the baicalin groups (p = 0.092 or p = 0.061). The time in
the central area (F5,42 = 5.314, p = 0.000) and the total distance(F5,42
= 2.8, p = 0.025) of the CMS group and the control group were sig-
nificantly lower than the scores of the fluoxetine group and the high-,
and medium-dose baicalin groups, and there were no significant dif-
ferences among the fluoxetine group and the baicalin groups (p =
0.248 or p = 0.523).
3.3. Effect of baicalin on mice in the forced swimming test
The FST evaluated depression-like behaviors in animals, as shown in
Fig. 5. In the FST, the immobility time (F5,42 = 3.638, p = 0.008) in
the CMS group was higher than that of the fluoxetine group and the
high-, medium- and low-dose baicalin groups, and there were no sig-
nificant differences among the fluoxetine group and the baicalin groups
(p = 0.289). The latency to immobility in the FST (F5,42 = 13.216, p =
0.000) for the CMS group was lower than that of the fluoxetine group
and the high and medium-dose baicalin groups. There were no sig-
nificant differences among the fluoxetine group and the baicalin groups
(p = 0.106).
3.4. Effect of baicalin on hippocampal ultrastructure
The effects of baicalin on the hippocampal ultrastructure are shown
in Fig. 6. Electron microscopy results showed that the neurons in the
hippocampal CA3 region in the control group were arranged in an or-
derly manner, with complete cell membranes, round nuclei, clear nu-
cleoli, and abundant organelles in the cytoplasm. At a high magnifi-
cation, the nuclear membrane of the nucleus was intact, the
mitochondria and endoplasmic reticulum were clearly visible, the sy-
napses were dense, and there were many synaptic vesicles. In the CMS
group, cell atrophy, unclear membrane structure, widening gap, mi-
tochondrial inner and outer membrane fusion, disintegration, synapse
fusion, vesicle reduction and nerve edema were observed. In the high-
dose baicalin group, the cell membrane was clearly visible, cytoplasmic
edema was present, some mitochondria were incomplete, the dense
matter was visible in the synapse, the synaptic cleft was present, and
there were many clear vesicles. In the fluoxetine group, the cells were
also in alignment, and the cell membrane was clear, few mitochondria
showed swelling, few dense matter were visible in the synapse, the
synaptic cleft was fairly clear and there were some clear vesicles.
3.5. Effect of baicalin on SYP and PSD95 protein expression in the
hippocampus
As shown in Fig. 7, compared with the control group, SYP (F5,12 =
53.33, p = 0.000) and PSD95 (F5,12 = 12.95, p = 0.000) expression
level in the CMS group was significantly reduced. Compared with the
control group, SYP and PSD95 expression levels in the fluoxetine group
and the high-dose and medium-dose baicalin groups were significantly
increased (p < 0.01), while the SYP and PSD95 expression levels in
the low-dose group were not significantly different from control (p >
0.05). There were no significant differences (p = 0.208 or p = 0.278)
between the fluoxetine group and the high- and medium-dose groups,
Y. Lu, et al. Biomedicine & Pharmacotherapy 116 (2019) 109054

Fig. 3. Results of SPT. Data are marked with means ± S.E.M., n = 8, compared with CMS group, CON: p = 0.000; FLU: p = 0.004; H-BAL: p = 0.001; M-BAL:
p = 0.004; L-BAL: p = 0.235.

Fig. 4. Results of the OFT. A: An image of the OFT field. B: The comprehensive OFT score. The horizontal movement score was the distance the mice traveled
(10 cm = one point). The vertical movement score was the number of bipedal upright movement or wall climbing attempts and the number of grooming behaviors
(one vertical movement = one point). Data are presented as the mean ± S.E.M. (n = 8). The vertical and horizonal scores were compared with the CMS group, as
follows: CON, p = 0.000; FLU, p = 0.000; H-BAL, p = 0.000; M-BAL, p = 0.000; and L-BAL. p = 0.000. The time in central area was compared with CMS group, as
follows: CON, p = 0.001; FLU, p = 0.039; H-BAL, p = 0.000; M-BAL, p = 0.026; and L-BAL,: p = 0.204. In the total distance, compared with CMS group, as follows:
CON, p = 0.025 ; FLU, p = 0.026 ; H-BAL, p = 0.001; M-BAL, p = 0.045; and L-BAL, p = 0.047. C: Graphic representation of the OFT movement.

respectively.
3.6. Effect of baicalin on BDNF, TrkB, Rac1, and cofilin protein expression
in the hippocampus
Compared with the control group (7), BDNF expression was sig-
nificantly reduced in the CMS group (F5,12 = 20.88, p = 0.000).
Compared with the CMS group, BDNF expression was significantly in-
creased in the fluoxetine group and the high- and medium-dose baicalin
groups (p < 0.01). There was no significant difference (p = 0.212)
between the high-and medium-dose groups and the fluoxetine group.
The results were similar for TrkB expression (F5,12 = 59.56, p =
0.000).
Compared with the control group (Fig. 8), Rac1 expression was
significantly reduced in the CMS group (F5,12 = 22.30, p = 0.000).
Rac1 expression was significantly increased in the fluoxetine group and
the baicalin group (p < 0.01 or p < 0.05).
There was no significant change in the total cofilin expression
among the groups (F5,12 = 4.18, p = 0.050). Compared with the
control group, p-cofilin expression was significantly reduced in the CMS
group (F5,12 = 12.21, p = 0.000). Compared with the CMS group, p-
cofilin expression was significantly increased in the fluoxetine group
(p < 0.01) and in the high-and medium-dose baicalin groups (p <
0.05). There were no significant differences between the high-dose

5
Y. Lu, et al. Biomedicine & Pharmacotherapy 116 (2019) 109054

Fig. 5. Results of FST. A: The immobility time

of FST; compared with CMS group, CON,
p = 0.001 ; FLU, p = 0.04; H-BAL, p = 0.002;
M-BAL, p = 0.004; L-BAL,: p = 0.015. B: The
latency to immobility of FST. compared with
CMS group, CON, p = 0.000 ; FLU, p = 0.008;
H-BAL, p = 0.001; M-BAL, p = 0.095; L-BAL,
p = 0.157.

group and the fluoxetine group (p = 0.271).
3.7. Effect of baicalin on the expression of SYP, PSD95 and BDNF mRNA in
the hippocampus
Compared with the control group (Fig. 9), SYP mRNA expression in
the CMS group was significantly reduced (F5,12 = 5.15, p = 0.009),
while in the high- and medium-dose groups, it was significantly in-
creased (p < 0.05). SYP mRNA expression in the low-dose group was
not significantly different compared with the control group (p >
0.05). There were no significant differences between the high- and
medium-dose groups (p = 0.791). Similar results were observed for

Fig. 6. Morphological changes of neuronal cells of CA3 zone of hippocampus. (scale bar = 5um; original magnification 10,000 ×, 20,000× and 40,000×).

6
Y. Lu, et al. Biomedicine & Pharmacotherapy 116 (2019) 109054

Fig. 7. BDNF, TrkB, SYP and PSD95 protein

expression. A: The expression of BDNF and
TrkB; B: The expression of SYP and PSD95; C:
The expression of BDNF compared with CMS
group are as follows: CON, p = 0.001 ; FLU,
p = 0.039; H-BAL, p = 0.000; M-BAL,
p = 0.026; L-BAL, p = 0.204. The expressions
were decreased in CMS group compared with
control group, which was increased in the bai-
calin group and fluoxetine group. There was no
significance between the baicalin group and
fluoxetine group (p > 0.05). D: The expres-
sion of SYP compared with CMS group are as
follows: CON, p = 0.000 ; FLU, p = 0.000; H-
BAL, p = 0.000; M-BAL, p = 0.000; L-BAL, p
= 0.203. The expressions were decreased in
CMS group compared with control group,
which was increased in the baicalin group and
fluoxetine group. There was no significance
between the baicalin group and fluoxetine
group (p > 0.05). E: The expression of TrkB
compared with CMS group are as follows: CON,
p = 0.000; FLU, p = 0.000; H-BAL, p = 0.000;
M-BAL, p = 0.000; L-BAL, p = 0.000. The
expressions were decreased in CMS group
compared with control group, which was in-
creased in the baicalin group and fluoxetine
group. There was no significance between the
baicalin group and fluoxetine group (p >
0.05). F: The expression of PSD95 compared
with CMS group are as follows: CON, p = 0.000
; FLU, p = 0.000; H-BAL, p = 0.001; M-BAL, p
= 0.006; L-BAL, p = 0.297. The expressions
were decreased in CMS group compared with
control group, which was increased in the bai-
calin group and fluoxetine group. There was no
significance between the baicalin group and
fluoxetine group (p > 0.05). Data are marked
with means ± S.E.M., (n = 3 per group).

Fig. 8. Expressions of Rac1 and cofilin protein.

A: Rac1, cofilin and p-cofilin expression. B:
Rac1expression results compared with CMS
group are as follows: CON, p = 0.000 ; FLU,
p = 0.001; H-BAL, p = 0.013; M-BAL,
p = 0.058; L-BAL, p = 0.533. C: Cofilin ex-
pression results compared with CMS group are
as follows: CON, p = 0.003; FLU, p = 0.015; H-
BAL, p = 0.044; M-BAL, p = 0.119; L-BAL,
p = 0.734. D: p-cofilin expression results com-
pared with CMS group are as follows : CON,
p = 0.000; FLU, p = 0.000; H-BAL, p = 0.000;
M-BAL, p = 0.001; L-BAL, p = 0.041. The ex-
pressions were decreased in CMS group com-
pared with control group, which was increased
in the baicalin group and fluoxetine group
(p < 0.01). There was no significance be-
tween the baicalin group and fluoxetine group
(p > 0.05). Data are presented as
means ± S.E.M., (n = 3 per group).

7
Y. Lu, et al.
PSD95 mRNA expression (F5,12 = 16.86, p = 0.000).
BDNF mRNA expression in the CMS group was significantly reduced
(F5,12 = 3.11, p = 0.05). Compared with the CMS group, BDNF mRNA
expression in all baicalin groups was significantly increased (p <
0.05), while there were no significant differences among the three
groups (p = 0.602).
4. Discussion
The CMS-induced model of depression-like behavior was used to
evaluate the effectiveness of antidepressant drugs based on the results
of the SPT and OFT. Anhedonia is the central symptom of severe de-
pression-like behavior, and the SPT reflects anhedonic behavior. In the
SPT, reduced consumption was thought to be a sign of depression-like
behavior [23]. This study revealed that compared with the control
group, the SPT score in the CMS group was significantly reduced, and
baicalin treatment significantly reversed this behavioral change. Simi-
larly, in the OFT, selective processing significantly reduced the hor-
izontal and vertical movement scores, indicating a lack of natural in-
terest in exploring novel environments [24]. The reduction in this kind
of activity could also be reversed by baicalin. Overall, the behavioral
test results showed that CMS can induce depression-like behavior, and
chronic baicalin treatment can reduce depression-like disorder in CMS
mice.
There are three main excitatory synaptic connection systems that
are formed by the afferent fibers of the hippocampus and the internal
loop of the hippocampus, and the CA3 region is involved in two of these
circuits [25]. A major feature of the CA3 region is its recurrent col-
lateral circuitry, through which the CA3 pyramidal cells make ex-
citatory synaptic contacts with each other [26]. In the experiment, the
CMS stimulus impacted the hippocampal CA3 synaptic structure,
through a reduced numbers of synapses, decreased synaptic membrane
thickness, mitochondrial degeneration, death of neurons in the nucleus,
cytoplasm dispersion, and increased cytoplasm hollow bubbles, as
shown in Fig.3. The incidence of depression-like behavior was related
to neuronal cell apoptosis, hippocampal volume reduction and partial
neuronal loss [27]. Recent studies have shown that the expression of
BDNF and its receptor TrkB during stress varies depending on the type
of stress, the duration of the stress, and the parts of the brain that are
involved. These changes can lead to neuronal death and are related to
8
Biomedicine & Pharmacotherapy 116 (2019) 109054
Fig. 9. BDNF mRNA, SYP mRNA and PSD95
mRNA expression. A: BDNF mRNA expression
results compared to the CMS group are as fol-
lows: CON, p = 0.025; FLU, p = 0.028; H-BAL,
p = 0.004; M-BAL, p = 0.022; L-BAL,
p = 0.189. B: PSD95 mRNA expression results
compared to the CMS group are as follows:
CON, p = 0.000; FLU, p = 0.073; H-BAL,
p = 0.000; M-BAL, p = 0.002; L-BAL,
p = 0.036. C: SYP mRNA expression results
compared to the CMS group are as follows:,
CON, p = 0.001 ; FLU, p = 0.007; H-BAL,
p = 0.010; M-BAL, p = 0.022; L-BAL,
p = 0.430. All mRNA levels tested were de-
creased in the CMS group compared with the
control group, and the expression increased in
the baicalin group and fluoxetine group (p <
0.05). There were no significance differences
between the baicalin group and fluoxetine
group (p > 0.05). Data are presented as the
means ± S.E.M., (n = 3 per group).
pathogenesis of many central nervous system diseases. The signal in-
tensity of BDNF-TrkB is an important source of information for the
nervous system [28]. Moreover, this study confirmed that BDNF, TrkB,
PSD95, SYP protein and mRNA levels in the hippocampus of CMS
model animals that exhibited depression-like behavior were lower than
those of the control animals, and the reduction of these proteins could
be effectively reversed by baicalin. In addition, numerous studies have
shown that changes in synaptic function are accompanied by changes in
several structure-related proteins within the synapse [29]. This is con-
sistent with our results. Therefore, we speculated that the neuro-
structural plasticity in the hippocampus may be involved in the neu-
robiochemical changes of depression-like behavior and that baicalin
may exert an anti-depressive effect by regulating the neural structure
plasticity.
To further investigate the signaling pathways that are associated
with the changes in synaptic structure in depressed mice and the un-
derlying mechanism of baicalin’s antidepressant effect, we examined
the Rac1 and LIMK levels. Western blot results showed that the ex-
pression levels of Rac1 and LIMK1 expression levels were significantly
reduced in the CMS group compared with the control group, and bai-
calin reversed this reduction. Rho GTPase (guanosine triphosphate) is a
key regulator of the cytoskeleton and is closely related to synaptic
plasticity [30]. In activity-dependent dendritic remodeling, the s478
phosphorylation of TrkB that results from BDNF binding to TrkB reg-
ulates the interaction between TrkB and Tiam 1 and promotes Rac1
activation [31]. Rac1 activation regulates the remodeling of the cy-
toskeleton, which is, at least in part, regulated through the downstream
effector cofilin, which completes the shearing and aggregation of the
cytoskeleton [32]. In this study, the relationship between the activating
effects of baicalin on neuronal plasticity and the Rac1 signaling
pathway was studied. LIMK1 is a serine/threonine protein kinase that
phosphorylates and inactivates cofilin [33]. Cofilin activity is mainly
regulated by phosphorylation (inactivation) and dephosphorylation
(activation), and the phosphorylation site is the third serine residue
[34]. Phosphorylated LIMK1 can phosphorylate cofilin, while cofilin
dephosphorylation is mainly mediated by phosphorylated Slingshot
(SSH) [35]. Cofilin phosphorylation and dephosphorylation is related to
the morphological changes of dendritic spines and it is also involved in
the post-synaptic transport and membrane transport of AMPA receptors
in the process of synaptic plasticity [36]. In this study, p-cofilin protein
Y. Lu, et al.
Fig. 10. The schema graph of the experiment.
levels in the hippocampus were also detected. Western blot results in-
dicated that CMS stimulation resulted in decreased p-cofilin protein
levels in the hippocampus, and thus, the long-term administration of
baicalin could reverse this biochemical change.
Our results indicated that CMS stimulation reduced Rac1 and LIMKl
expression in the mouse hippocampus, thereby reducing the cofilin
phosphorylation level and leaving more cofilin in the activated, de-
phosphorylated, state. This leads to changes in the synaptic structure
such as thinning of the presynaptic membrane. Chronic treatment with
baicalin can activate this pathway to regulate the synaptic plasticity of
neural structures and thereby exert antidepressant effects(Fig.10).
In summary, the present study found that baicalin can alleviate
depression-like behavioral changes and increase t SYP, PSD95, BDNF,
TrkB, Rac1 and cofilin protein expression. In addition, the anti-
depressant effect of baicalin may be mediated by changes in the sy-
naptic plasticity through activation of the Rac1-LIMK1-cofilin pathway.
Declaration of interest
The authors report no conflicts of interests.
Acknowledgements
This work was supported by Research Foundation of the Hebei
Province government funds the clinical medicine outstanding talented
person project (grant number 360601); Major medical research projects
of traditional Chinese medicine of Hebei Province supported by Hebei
provincial finance department and Hebei provincial health and family
planning commission (grant number zyzd2013014); Scientific research
program of Hebei administration of traditional Chinese medicine, China
(grant number 2018060) and postgraduate innovation funding project
of Hebei university of Chinese medicine (grant number
XCXZZBS2018002).
References
[1] G.B.D. Dalys, H. Collaborators, Global, regional, and national disability-adjusted
life-years (DALYs) for 359 diseases and injuries and healthy life expectancy (HALE)
for 195 countries and territories, 1990-2017: a systematic analysis for the Global
Burden of Disease Study 2017, Lancet 392 (10159) (2018) 1859–1922.
[2] R.S. Duman, G.K. Aghajanian, Synaptic dysfunction in depression: potential ther-
apeutic targets, Science 338 (6103) (2012) 68–72.
9
Biomedicine & Pharmacotherapy 116 (2019) 109054
[3] S.B. Guze, E. Robins, Suicide and primary affective disorders, Br. J. Psychiatry 117
(539) (1970) 437–438.
[4] D.D. Luo, S.C. An, X. Zhang, Involvement of hippocampal serotonin and neuro-
peptide Y in depression induced by chronic unpredicted mild stress, Brain Res. Bull.
77 (1) (2008) 8–12.
[5] E. Shimizu, K. Hashimoto, M. Iyo, [Major depressive disorders and BDNF (brain-
derived neurotrophic factor)], Nihon Shinkei Seishin Yakurigaku Zasshi 24 (3)
(2004) 147–150.
[6] C. D’Sa, R.S. Duman, Antidepressants and neuroplasticity, Bipolar Disord. 4 (3)
(2002) 183–194.
[7] H.R. Sim, T.Y. Choi, H.J. Lee, E.Y. Kang, S. Yoon, P.L. Han, S.Y. Choi, J.H. Baik, Role
of dopamine D2 receptors in plasticity of stress-induced addictive behaviours, Nat.
Commun. 4 (2013) 1579.
[8] J.C. Morales-Medina, I. Juarez, E. Venancio-Garcia, S.N. Cabrera, C. Menard, W. Yu,
G. Flores, N. Mechawar, R. Quirion, Impaired structural hippocampal plasticity is
associated with emotional and memory deficits in the olfactory bulbectomized rat,
Neuroscience 236 (2013) 233–243.
[9] K.T. Ota, R.S. Duman, Environmental and pharmacological modulations of cellular
plasticity: role in the pathophysiology and treatment of depression, Neurobiol. Dis.
57 (2013) 28–37.
[10] A. Yoshii, M. Constantine-Paton, Postsynaptic BDNF-TrkB signaling in synapse
maturation, plasticity, and disease, Dev. Neurobiol. 70 (5) (2010) 304–322.
[11] M.G. Lykissas, A.K. Batistatou, K.A. Charalabopoulos, A.E. Beris, The role of neu-
rotrophins in axonal growth, guidance, and regeneration, Curr. Neurovasc. Res. 4
(2) (2007) 143–151.
[12] Y. Meng, Y. Zhang, V. Tregoubov, D.L. Falls, Z. Jia, Regulation of spine morphology
and synaptic function by LIMK and the actin cytoskeleton, Rev. Neurosci. 14 (3)
(2003) 233–240.
[13] Y. Meng, H. Takahashi, J. Meng, Y. Zhang, G. Lu, S. Asrar, T. Nakamura, Z. Jia,
Regulation of ADF/cofilin phosphorylation and synaptic function by LIM-kinase,
Neuropharmacology 47 (5) (2004) 746–754.
[14] S. Hiroi, K. Yamabe, S. Inoue, M. Kobayashi, Study on cost-effectiveness analysis for
treatment of major depression disease: a systematic review of literature from 2004-
2014, Value Health 18 (7) (2015) A410.
[15] T. Westergren, S. Narum, M. Klemp, Critical appraisal of adverse effects reporting in
the’ Treatment for Adolescents with Depression Study (TADS)’, BMJ Open 9 (3)
(2019) e026089.
[16] G.A. Carrasco, L.D. Van de Kar, Neuroendocrine pharmacology of stress, Eur. J.
Pharmacol. 463 (1-3) (2003) 235–272.
[17] G.G. Gu, P.J. Yang, annotated.THe Book of Shen Nong Herbs, Xueyuan Press,
Beijing, 2007, p. 159.
[18] J.F. Liao, W.Y. Hung, C.F. Chen, Anxiolytic-like effects of baicalein and baicalin in
the Vogel conflict test in mice, Eur. J. Pharmacol. 464 (2-3) (2003) 141–146.
[19] F. Wang, Z. Xu, L. Ren, S.Y. Tsang, H. Xue, GABA A receptor subtype selectivity
underlying selective anxiolytic effect of baicalin, Neuropharmacology 55 (7) (2008)
1231–1237.
[20] K.M. Hui, X.H. Wang, H. Xue, Interaction of flavones from the roots of Scutellaria
baicalensis with the benzodiazepine site, Planta Med. 66 (1) (2000) 91–93.
[21] H.Y. Yu, Z.J. Yin, S.J. Yang, S.P. Ma, Baicalin reverse AMPA receptor expression and
neuron apoptosis in chronic unpredictable mild stress rats, Biochem. Biophys. Res.
Commun. 451 (4) (2014) 467–472.
[22] P. Willner, A. Towell, D. Sampson, S. Sophokleous, R. Muscat, Reduction of sucrose
preference by chronic unpredictable mild stress, and its restoration by a tricyclic
Y. Lu, et al.
antidepressant, Psychopharmacology 93 (3) (1987) 358–364.
[23] P. Willner, Chronic mild stress (CMS) revisited: consistency and behavioural-neu-
robiological concordance in the effects of CMS, Neuropsychobiology 52 (2) (2005)
90–110.
[24] R.J. Katz, K.A. Roth, B.J. Carroll, Acute and chronic stress effects on open field
activity in the rat: implications for a model of depression, Neurosci. Biobehav. Rev.
5 (2) (1981) 247–251.
[25] H.D. Schmidt, R.S. Duman, The role of neurotrophic factors in adult hippocampal
neurogenesis, antidepressant treatments and animal models of depressive-like be-
havior, Behav. Pharmacol. 18 (5-6) (2007) 391–418.
[26] I. Lee, D. Yoganarasimha, G. Rao, J.J. Knierim, Comparison of population coherence
of place cells in hippocampal subfields CA1 and CA3, Nature 430 (6998) (2004)
456–459.
[27] T. Frodl, E.M. Meisenzahl, T. Zetzsche, C. Born, C. Groll, M. Jager, G. Leinsinger,
R. Bottlender, K. Hahn, H.J. Moller, Hippocampal changes in patients with a first
episode of major depression, Am. J. Psychiatry 159 (7) (2002) 1112–1118.
[28] M.G. Lykissas, A.K. Batistatou, K.A. Charalabopoulos, A.E. Beris, The role of neu-
rotrophins in axonal growth, guidance, and regeneration, Curr. Neurovasc. Res. 4
(2) (2007) 143–151.
[29] D.J. Christoffel, S.A. Golden, S.J. Russo, Structural and synaptic plasticity in stress-
related disorders, Rev. Neurosci. 22 (5) (2011) 535–549.
[30] K.F. Tolias, J.G. Duman, K. Um, Control of synapse development and plasticity by
10
Biomedicine & Pharmacotherapy 116 (2019) 109054
Rho GTPase regulatory proteins, Prog. Neurobiol. 94 (2) (2011) 133–148.
[31] K.O. Lai, A.S. Wong, M.C. Cheung, P. Xu, Z. Liang, K.C. Lok, H. Xie, M.E. Palko,
W.H. Yung, L. Tessarollo, Z.H. Cheung, N.Y. Ip, TrkB phosphorylation by Cdk5 is
required for activity-dependent structural plasticity and spatial memory, Nat.
Neurosci. 15 (11) (2012) 1506–1515.
[32] N. Yang, O. Higuchi, K. Ohashi, K. Nagata, A. Wada, K. Kangawa, E. Nishida,
K. Mizuno, Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated
actin reorganization, Nature 393 (6687) (1998) 809–812.
[33] S. Arber, F.A. Barbayannis, H. Hanser, C. Schneider, C.A. Stanyon, O. Bernard,
P. Caroni, Regulation of actin dynamics through phosphorylation of cofilin by LIM-
kinase, Nature 393 (6687) (1998) 805–809.
[34] M. Endo, K. Ohashi, Y. Sasaki, Y. Goshima, R. Niwa, T. Uemura, K. Mizuno, Control
of growth cone motility and morphology by LIM kinase and Slingshot via phos-
phorylation and dephosphorylation of cofilin, J. Neurosci. 23 (7) (2003)
2527–2537.
[35] M. Van Troys, L. Huyck, S. Leyman, S. Dhaese, J. Vandekerkhove, C. Ampe, Ins and
outs of ADF/cofilin activity and regulation, Eur. J. Cell Biol. 87 (8-9) (2008)
649–667.
[36] H.J. Carlisle, P. Manzerra, E. Marcora, M.B. Kennedy, SynGAP regulates steady-
state and activity-dependent phosphorylation of cofilin, J. Neurosci. 28 (50) (2008)
13673–13683.