Skills Lab Book I.9 (2023)

TABLE OF CONTENTS
Developing Personal Formulary ...........................................................................................
Dressing, Bandaging and Splinting ......................................................................................
Pap’s Smear and Visual Inspection using Acetic Acid (IVA) ..............................................
Immunization/Vaccination ....................................................................................................
Skills Training Material Book year II | 1

2 | Skills Training Material Book year II
SKILLS TRAINING MATERIAL BOOK
YEAR II
DEVELOPING PERSONAL FORMULARY

BLOCK I.9
SKILLS LABORATORY
FACULTY OF MEDICINE, PUBLIC HEALTH AND NURSING
UNIVERSITAS GADJAH MADA
2023

THE GENERAL RULE IN SKILLS LABORATORY
1. Students must follow every practical session.

2. Students must arrive in practical session on time.
3. The time for each practical session is 100 minutes as written in the lesson plan in the student
book.
4. If a student arrives after the session starts, he/she has to sign a yellow card which can be
taken in the skills lab office (2rd floor) as a requirement to join the practical session. The
yellow card will be submitted to the skills lab and affects the corresponding student’s
professional behaviour.
5. Eating, drinking and use of phone or electronic devices not associated with lab materials is
prohibited during lab sessions. Rule breakers has to sign a yellow card which can be taken in
the skills lab office (2rd floor). The yellow card will be submitted to the skills lab and affects
the corresponding student’s professional behaviour.
6. Students are not allowed to leave the classroom without permission.
7. If the instructor is late, students must use the time to read the material which corresponds to
the session topic.
8. Students are allowed to borrow a mannequin or other tools by showing your student card.
Students should check if the tool is complete or not by referring to the tools mentioned in the
manual. If they find a damaged mannequin or broken tools, they should be immediately
reported. If the mannequin or tools are damaged because of the student’s mistakes, they
should replace the mannequin or tools.
9. Students must submit their work plan to the instructor. Work plan should be written by hand
on foolscap paper. The work plan consists of the student name, number, group, topics,
objectives, clinical correlation, step procedures, tools used, and relevant questions you want
to ask to the instructor.
10. Students who cannot attend the practical sessions with a very important reason should
submit a letter asking for a permission and take a follow-up class before the next block.
11. If there are special cases, for example:
a. In case the instructor could not attend the lab sessions, skills laboratory will refer the
students to the companying instructor.
b. If the lab session was delayed by an instructor who is responsible, practical sessions must
be rescheduled within the week. If it is not rescheduled within the week, the instructor in
charge will be substituted by the companying instructor.
12. Any skills lab announcement regarding assignments will be posted via Gamel and skills lab
bulletin board.
*Yellow card will be submitted to the skills lab office and will affect the
student’s professional behaviour.

YEAR II

BLOCK I.9
CONTRIBUTORS
Dr. dr. Rustamaji, M. Kes
Department of Pharmacology and Therapy
Faculty of Medicine, Public Health and Nursing Universitas Gadjah Mada
Yogyakarta
Dr. dr. Woro Rukmi Pratiwi, MKes, SpPD, FINASIM

Faculty of Medicine, Public Health and Nursing
Universitas Gadjah Mada
Yogyakarta
dr. Yolanda Dyah Kartika, M.Sc.

Yogyakarta
dr. Eggi Arguni M.Sc, PhD, Sp.A(K)

Yogyakarta
dr. Catharina Triwikatmini M.Kes., Sp.PD-KGEH

Yogyakarta
EDUCATIONAL DESIGN REVIEWED BY:

dr. Anastasia Evi Handayaningsih, PhD, SpPD
Year II Coordinator for Clinical Skills Training
Yogyakarta

PREFACE
The number of circulating drug in Indonesia is sometimes difficult for physicians to

understand and explore the advantages and disadvantages of each drug. In Indonesia there are
more items 13000 of drug that is allowed to be marketed. In clinical practice not all drugs needed
by a general practitioner
The topic of this material is one of the clinical skills topics that constitute the main topic
of Giving Rational Therapy, which will be studied continually in blocks throughout
undergraduate studies. Topics covered in the Giving Rational Therapy, which will be studied in
Year II, are as follows:
No. Topics for Clinical Skills Training Block

1. Developing Personal Formulary I.9
(Research and Basic Medical
Practice)
2. Counseling and Therapeutic Decision Making II.2
(Pain)
We hope that in the future, this material for clinical skills training can be useful for
students to improve their skills, especially in how to start rational therapy; and for instructors
who are involved in providing the trainings.
Yogyakarta, November 2023
Contributor

LESSON PLAN
I. Learning Objective of Block I.9

General Objectives:
After completing block I.9, students should be able to understand various obstetric and
gynecologic exam and understand various kind of drugs and counseling.
Specific Objectives:
The specific objectives of Block I.9 are that students should be able to:
1. Explain the class therapy of drugs
2. Explain the pharmaceutical dosage form of drugs
3. Explain some indication of drugs and the dosage regimen for each indication
4. Giving information about drug to the patient (dosage regimen, warning, and follow up,
etc)
II. Learning Objective Of Skills Training

At the end of this skill training, students should be skillful in developing personal formulary
III.Activities
 Attend to preparation briefing
 Read the manual of skills training
 Make your personal formulary (submit in printed version)
 Role play
Time Activity Students Instructor Materials

5 minutes Introduction Listen Explain -
5 minutes Collecting Submitting the Collecting Work plan
assignment assignment assignment (your
printed
personal
formulary
10x10 Role play of Role play Feedback
minutes giving
information
about drugs to
the patient
IV. Tools
1. Manual Book
2. Doctor patient setting

Background Fresh-graduate physicians are often difficults to understand and explore

the advantages and disadvantages of drugs due to the number of drugs
available in Indonesia. There are approximately more than 16,000 items
permitted to be distributed in Indonesia. However, in clinical practice not
all drugs are needed by a general practitioner.
To facilitate the selection of drugs in practice, it is necessary to

understand pharmacological therapy of the 10 most common diseases and
subsequently prepared a description of each drug. This is called a
personal formulary because the tool of each doctor to choose the drug .
After completing this activity, students are expected to develop and

explain their personal formulary to their patient based on the
diagnosis/indication, at least 1 drugs.
Objectives Improve the skills of developing personal formulary and how to give
some information related drugs to the patient
Methods Preparation lecture, role play and group discussion

During role play, student is not allowed to read their printed personal
formulary. Students will be asked to give some information related drug
to patient simulation (the name of the drug, pharmaceutical dosage form,
the indication and dosage, the effect of the drug, usage instruction,
warning and follow-up. For the pharmaceutical dosage form, choose the
most suitable form according to your patient condition, and give the
reason)
Materials
 National formulary (please download at
http://www.depkes.go.id/resources/download/general/KMK%20N
o.%20328%20ttg%20Formularium%20Nasional.pdf
 Textbook of Pharmacology
 Guideline therapy
Time allocation 100 minutes
***

Develop your personal formulary by following the format below:
THE NAME OF THE DRUG (GENERIC NAME)
For Example: AMOXICILLIN
Class Therapy
Pharmaceutical dosage form and picture:

For example:
1. Syrup Amoxicillin 125 mg/5 ml in bottle 60 ml
2. Tablet 500 mg
3..............(etc.)
Indication and Dosage:
 Indication :
Dosage :
 Indication :
Dosage :
 Indication :
Dosage :
etc.

Pharmacodynamic and pharmacokinetics profiles
Pharmakokinetic Profile
Pharmacodynamic profile
INFORMATION FOR THE PATIENT

For Indication 1:
a. The effect of the drug and how to explain to your patient
b. Usage instruction
c. Warning
d. Follow up
e. Some parameters which used during follow up
For Indication 2 :
a. The effect of the drug and how to explain to your patient
b. Usage instruction
10 | Skills Training Material Book year

c. Warning
d. Follow up
e. Some parameters which used during follow up
For Indication 3 (etc):

f. The effect of the drug and how to explain to your patient
g. Usage instruction
h. Warning
i. Follow up
j. Some parameters which used during follow up
Yogyakarta, Agustus 2021
Skills Training Material Book year II |

11
Example
Adjust to each patient individually start as low as possible. Raise the dose after 2 weeks, if needed.
Angina pectoris : 100 mg per day in 1 – 2 doses
(WHO Guide to Good Prescribing: A Practical Manual)

BASIC CLINICAL COMPETENCE MATERIAL BOOK
DRESSING, BANDAGING AND SPLINTING

BLOCK I.9

SKILLS LABORATORY
YOGYAKARTA
2023

13
DRESSING AND BANDAGING
BLOCK I.9
Contributor:
Prof. dr. Armis, MD, FICS
Department of Orthopaedic and Traumatology
dr. M. Rosadi Siswandhana , SpB, SpBP-RE(K)

Division Plastic Surgery – Department of Surgery
dr. Santosa Budiharjo, MKes, PA(K)

Department of Anatomy and Embryology
dr. Yudha Mathan Sakti, SpOT (K)

dr. Zikrina Abyanti Lanodiyu, Sp.OT

Dr. Christantie Effendy, S.Kp, M.Kes.

Prof. Dr. Christantie Effendy, S.Kep, M.Kes
Lucia Anik Purwaningsih, Skep, Ns

ETN Sardjito General Hospital
Co-Contributor:
dr. Yulia Wardhani, SpPD-KGH
Assistant of Content Development Team for Skills Training
Educational Design Reviewed by


15
PREFACE
Students of medical school need to learn and practice some clinical skills as preparing to
enter clinical rotation before they become real doctor. Medical school is nowadays convinced
that students should master the skills before they make contact with real patients. Therefore, an
early skills training is needed. Skills laboratory allows students to learn and practice their clinical
skills. The topic in this manual book is one of the topics under the main topic: Procedure &
Therapy Skills which will be studied continuously within blocks during undergraduate studies.
The skill included in this book is based on Competency-Based-Curriculum 2020. The topics
included under Basic Surgical Skills in Year 2 are listed as follows:
No. Skills Training Topic Block

1. Basic Locomotor Examination I.1
(Musculoskeletal System)
2. Aseptic Procedure 1.4

(Genitourinary &
Reproductive System)
3. Dressing, Bandaging and Splinting I.9
(Research and Basic
Medical Practice)
It is important for students to be aware that all topics included are related to each other.
Therefore, students are hoped to be able to group those topics under their main topic so that the
continuity of the topics is obtained. We hope this skills training manual book will be useful for
the students to improve their skills especially in physical examination and for instructors who
involved in the skills training.
Yogyakarta, October 2023

Content Development Team of Skills Training
UGM

TABLE OF CONTENTS
Preface
Table of Contents
General Objectives of Skills Training Year II
General Objectives of Dressing and Bandaging
Level Of Competence
Activities
Dressing and Bandaging Procedure
A. Dressing Procedure
Objectives
Definition
Equipment or Instruments Needed
The Goals
Procedures
Wound Care after Dressing
Indications
Types of Dressing
Selected Types of Wound Dressing
B. Bandage Procedure
Objectives
Definition
Equipment or Instruments Needed
Type of Bandage
Procedure
Principles of Bandage
Bandaging Procedure
Circular Turn
Spiral Turn
Spiral Reverse Turn
Spica Turn
Examples of Bandaging
Triangle Cloth
Tie-shaped Bandage
Stretchable Roller Bandage
Band-shaped Bandage for the Arm
Band-shaped Bandage for the Heel
Band-shaped Bandage for the Hand
Clinical Reasoning
Feedback Form for Dressing and Bandaging
Global Rating Scale for Professional Behavior
Global Rating Scale for Doctor-Patient Interaction
Reference

17
DRESSING BANDAGING AND SPLINTING
A. General Objectives of Skills Training Year 2

1. Students are able to perform basic skill procedures (communication, physical, procedural,
supporting examinations) and convey the results to the patient
2. Students are able to consider the clinical reasoning aspect of communication and its
procedure (communication, physical, procedural, supporting examinations)
B. Objectives of Dressing and Bandaging
The medical student should be able to:
a. Understand the definition of dressing, bandaging & splinting
b. Know the aim of dressing, bandaging & splinting
c. Describe the application of dressing, bandaging & splinting
d. Understand the indication of the dressing, bandaging & splinting
C. Level of Competence
Level of Competence for Clinical Skills:
The following is the division of competence level according to Miller Pyramid:
 Level of Competence 1: Understanding and Explaining
The graduates of medical school possess theoretical knowledge concerning these
skills, so that they are able to explain concepts, theories, principles or indications,
performing procedures, emerging complications and others to their colleagues.
 Level of Competence 2: Having seen or Having been demonstrated
The graduates of medical school possess theoretical knowledge concerning this skill
(concepts, theories, principles or indications, performing procedures, complications
and others). Besides, during their study, they had seen this skill or this skill had
been demonstrated to them.
 Level of Competence 3: Having done or Having applied under Supervision
been demonstrated to them or they had applied several times under supervision.
 Level of Competence 4: Able to perform independently
been demonstrated to them and they had applied several times under supervision; in
addition, they possess experience to use and apply this skill in the context of doctor
practices independently.
Accident and Emergency Level of Expected Ability

Assessment and care external injuries (wounds, bleeding, 1 2 3 4
burns, distortion, dislocation, fractures)
Apply a bandage 1 2 3 4
The Arm & The Leg Level of Expected Ability

To apply a dressing (sling, shoulder bandage, finger 1 2 3 4
bandage, hand bandage)
Therapeutic Skills Level of Expected Ability

Wound cleaning 1 2 3 4
Wound debridement with scalpel and scissors 1 2 3 4
Apply a pressure dressing 1 2 3 4

D. Activities

5 minutes Collecting Submitting the Collecting -
assignment assignment assignment
15 minutes Trial and error
Trying and Observing and a. Sterile gauzes
session observing preparing b. Antiseptic solution
(2 students) feedback c. Operating lamp
15 minutes Giving Asking Giving feedback d. Drapes
Feedback questions e. Irrigation solution
15 minutes Demonstration Observing and Demonstrating, (Saline solution)
discussing discussing f. Minor set surgery
10 x 5 Exercise Performing Observing and g. Elastic bandage
minutes and observing giving feedback
each other
(one by one)
15 minutes Evaluation Asking, giving Explaining and  Feedback form
comments closing session

19
Illustration
Hospital, there was an accident between two motorcycles. Both of the drivers get injured and admitted to the Emergency Room.
and the other one has his left leg broken.
How will you manage the patient?
If you have not been trained or you have no experience of managing trauma injury,
especially for dressing, bandaging, immobilization and transportation, you must be very
confused if you were in that situation. Now, it is a chance for you to practice those skills in Skills
Lab. The instructors will train you to do those skills. But, you have to read the manual first and
you will be more prepared. This manual mainly discussed about dressing and bandaging whereas
there is also other manual for transportation and immobilization.

Wound Healing and Bed Preparation
A. The medical student should:

1. Understand the definition of wound bed preparation
2. Know the goals and indication of wound bed preparation
3. Be able to assess the patient as a whole together with multi-disciplinary team
4. Be able to build emotional and communicative relationships with patients when
possible.
5. Be able to identify and describe the wound and its body part while performing Look
(inspection), Feel (palpation), and Move (assessing the range of movement).
6. Be able to identify the problems of the wound based on TIME framework
7. Correctly decide appropriate treatment and determine short-term goals based on
problems identified
8. Be familiar with materials and types of wound bed preparations available and also be
able to choose the appropriate dressing/treatment
9. Check the results of all the procedures
10. Evaluate and reassess the treatment and wound management outcomes
B. Definition : wound bed preparation is ‘the management of a wound in order to accelerate

endogenous healing or to facilitate the effectiveness of other therapeutic measures’. The
concept focuses the clinician on optimising conditions at the wound bed so as to
encourage normal endogenous healing. To assist with implementing the concept of
wound bed preparation, the TIME acronym was developed in 2002 by a group of wound
care experts, as a practical guide for use when managing patients with wounds.
The TIME consist of four main components of wound bed preparation: Tissue
management, Control of infection and inflammation, Moisture imbalance, Advancement
of the epithelial edge of the wound. The TIME framework is a useful practical tool based
on identifying the barriers to healing and implementing a plan of care to remove these
barriers and promote wound healing. Acute wounds usually follow a wel-defined process
described as : coagulation, inflammation, cell proliferation and repair of the matrix, and
epithelialisation and remodelling of scar tissue. Meanwhile the chronic wound is different
from acute wound healing that it becomes ‘stuck’ in the inflammatory and proliferative
stages of healing.
C. Equipment and instrumentation needed

1. Sterile gauzes
2. Antiseptic solution
3. Operating lamp
4. Drapes
5. Irrigation solution (Saline solution)
6. Minor set surgery
7. Sharp / surgical blade
8. Surfactant, autolytic or enzymatic wound care solution
9. Antimicrobial (topical antiseptic and/or antibiotic therapy)
10. Hydrogel, hydrocolloid or foam
11. Negative pressure wound therapy (NPWT) device
12. Elastic bandage

21
D. Goal : wound bed preparation goal is to optimise the conditions at the wound bed so as to
encourage normal endogenous healing, especially for all wound that are not progressing
to normal wound healing. Specific goal for TIME framework as follows:
1. T (tissue - non-viable or deficient) : to achieve viable healthy wound bed
2. I (infection or inflammation) : to achieve non-inflamed, non-infected wound
3. M (moisture imbalance) : to achieve optimal moisture balance
4. E (edge of wound – non-advancing or undermining) : to achieve advancement edge of
wound
E. Indications : application of TIME framework for wound bed preparation is:

1. Tissue non-viable
2. Infection and/or inflammation
3. Moisture imbalance
4. Edge of wound non-advancing
F. Procedure
For wound bed preparation by using TIME framework, the procedure should act in
accordance with these steps:
1. Assess patient, wellbeing and wound
Establish diagnosis and baseline characteristics for appropriate support and
comorbidities that may impact healing. Record wound type, location, size, wound bed
condition, signs of infection / inflammation, pain location and intensity,
comorbidities, adherence / concordance to treatment.
2. Bring in multi-disciplinary team and informal carers to promote holistic patient care
Record referral to others such as surgical team, wound specialist nurse, dietician, pain
team, vascular and diabetes team, podiatrist, physiotherapist, family carers and
trained counsellor
3. Control or treat underlying causes and barriers to wound healing
Record management plan for: systemic infection, diabetes, nutritional problems,
oedema, continence, mobility, vascular issues, pain, stress, anxiety, non-adherence /
concordance with offloading and compression, lifestyle choices
4. Decide appropriate treatment and determine short-term goals for TIME framework’s
problem :
a. Tissue (non-viable or defficient)
1) Identify : are there barriers to wound healing? Necrotic / slough present?
2) Select primary & secondary interventions : Cleansing and debridement, &
Surfactant, sharp / surgical or mechanical, autolytic or enzymatic, biological /
larval
b. Infection and/or inflammation
1) Identify : are there barriers to wound healing? infected / deep infected cavity
wound / suspected biofilm present?
2) Select primary & secondary interventions : manage bioburden &
antimicrobial administration (topical antiseptic, and/or antibiotic therapy)
c. Moisture imbalance
1) Identify : are there barriers to wound healing? Dry or low / moderate / high
moisture wound?
2) Select primary & secondary interventions : restore moisture balance by using
: hydrogel, hydrocolloid for dry wound. Foam, super absorbent, gelling fibre,
NPWT for low / moderate / high moisture wound.

d. Edge of wound
1) Identify : are there barriers to wound healing? Non-advancing or abnormal
wound edge
2) Select primary & secondary interventions : Promote epithelialisation and
healthy periwound skin & NPWT – atraumatic wound contact layer, cell or
tissue products, skin care and adjunct treatment according to wound type
5. Evaluate and reassess the treatment and wound management outcome. Evaluate:
Record wound progression within given timelines. Flag if no change, go back to A,
B, C and change treatment where indicated.
The schematic of deciding appropriate treatment and determine short-term goals based on
TIME Frameworks :

23
DRESSSING AND BANDAGING PROCEDURE
A. Dressing Procedure
1. Definition
Dressing is the intervention of temporarily covering the wound or covering post-operative
incision definitively by sterile gauze or others materials to promote healing and prevent
further harm or infection. Wound healing is a complex and dynamic process of tissue
regeneration that comprise of phases as coagulation and hemostasis, inflammatory,
proliferation and maturation (remodeling) . Ideal dressing will have to be able to facilitate
these event. Therefore, a dressing can be designed to be in direct contact with the wound and
it is usually used in the first aid. Meanwhile, a bandage is used to hold a dressing in place.
Dressing function include: Protection, Absorption, Compression, Immobilization,
and Aesthetics appearance.
2. Equipment or Instruments needed
a. Sterile gauzes
b. Antiseptic solution
c. Operating lamp
d. Drapes
e. Irrigation solution (Saline solution)
f. Minor set surgery
g. Elastic bandage
3. The goal
A dressing has some purposes depend on the type of dressing, severity of the wound and the
location of the wound. Therefore, the aim of a dressing is promoting recovery and preventing
further harm or infection from wound. So the purposes of wound dressing are:
a. Protection from infection and damage
Dressing may protect the infection and further tissue damage
b. Promote healing
Dressing can promote healing by granulation and epithelialization process
c. Stop bleeding
Dressing may seal the wound to expedite the clotting process.
d. Absorb exudates
Dressing soaks up blood, plasma, and fluid from the wound.
e. Pain relieving
Sometime dressing may have a pain relieving effect or may have a placebo effect.
f. Debride the wound
Dressing can remove the slough and foreign bodies from the wound
4. Procedures
According to the history, formerly, dressing used a piece of material such as: cloth, cobwebs,
dung, leaves and honey. Nowadays, sterile gauzes has been used which may be impregnated
with an agent designed to maintain sterility and to promote healing such as films, gels,
foams, hydrocolloids, alginates, hydrogels, polysachaccaride pastes, granules and beads.
Dressing can be soaked with antiseptic chemicals, as in boracic lint or where medicinal
Castor oil was utilized in the first surgical dressing. In 1960, George Winter published his
controversial study on moist healing. Advancement of technology has develop the ideal
objective of dressing. The function of a dressing has improved not to just to close the wound
but creating an environment to help the wound to heal faster.
Based on the wound type ideal and suitable dressing material must be based on its ability to:
a) Provide and maintain moist environment
b) Facilitate epidermal migration
c) Help tissue regeneration (promote angiogenesis and connective tissue synthesis)
d) Maintain tissue temperature (improve local blood flow to the wound bed)

e) Allow gas exchange between wounded tissue and environment
f) Provide protection against bacterial infection and have a debridement properties
g) Sterile, non-toxic and non-allergic, and
g) Non-adherent to the wound
Wound Care after Dressing

a. Keeping the wound clean is as important as cleaning it the first time
b. It is recommended to change the dressing every 12 hours
c. Make sure that the dressing stays clean and dry (change it if it gets wet or dirty)
d. Minor bleeding from the wound can easily be stopped with direct pressure using a sterile
dressing.
e. Cover the wound lightly with an adhesive dressing
f. Wrap the extremity with a wide roller gauze/ elastic bandages in medium tight (not too
tight but tight enough to prevent the bandages from slipping distally)
g. It is important to evaluate signs of infection:
- Fever
- Signs of inflammation around the wound
- Tenderness and swelling around the wound
5. Indications
Applying and changing dressing is one common task in health personnel, therefore the
dressings are:
a. First aid of wound covering
b. Prevent further infection and damage
c. Prevent infection of incision after surgery
d. Promote faster healing
6. Types of Dressing
The type of dressing used depends on the wound assessment :
a. The location, size, and type of the wound
b. Whether the wound requires debridement ?
Clinical appearance/ wounds bed :
- Necrotic or Black : Hardened, necrotic eschar. It may be dry or moist.
- Black wounds require debridement ( removal of the necrotic material )
- Sloughy or Yellow : Slough, Yellow, fibrous, devitalized tissue
- Yellow wounds require remove nonviable tissue and absorbs drainage
c. Is the wound infected ?
Clinical appearance/ wound bed :
- Infected or Green : Clinical signs of infection exist ; pain, heat. Swelling, redness
and increased exudates
- Infected wounds require removal of the infected with antimicrobial dressing
d. Granulating or Red : Healthy granulating tissue
e. Epithellating or Pink : Epithelialisation is occurring
Red wounds was kept a moist environment

25
7. Selected Types of Wound Dressing
Dressing Description Purpose Example

Transparent Adhesive plastic To provide protection Op-Site,
adhesive films semipremeable against contamination Tegaderm
nonadherent dressing that and friction; to maintain a
allow exchange of oxygen clean moist surface that
between the atmosphere facilitates cellular
and wound bed. They are migration; to provide
impermeable to bacteria insulation by preventing
and water fluid evaporation; and to
facilitate wound
assessment
Apply for : necrotic
tissue or Black wound,
Epithellating/ Pink
wound
Tulle grass,
Impregnated Woven or nonwoven To cover, soothe, and
Telfa, Melolin
nonadherent cotton or synthetic protect partial and full
dressing materials that are thickness wounds
impregnated with without exudates and
petroleum, paraffin, saline, surgical wound
zinc-saline, antimicrobials,
or other agent. Require
secondary dressings to
secure them in place,
retain moisture, and
provide wound protection.
Dressing Description Purpose Example

Hydrocolloids Waterproof adhesive To absorbs exudates; to Comfeel,
wafers, pastes, or produce a moist Duoderm
powders. Wafers designed environment that
to be worn for up to seven facilitates healing but
days. The criteria for ideal does not cause
dressing. They are maceration of
described as moisture- surrounding skin; to
retentive dressing. protect the wound from
bacterial contamination,
foreign debris, and urine
or feces, and to prevent
shearing.
Apply for : Red Wound,
surgical wound.
Hydrogels Glycerin or water-based To liquefy necrotic DuoDerm,

that are oxygen tissue or slough, Intrasite- gel
permeable, unless covered rehydrate the wound bed,
by plastic film. May and fill in dead space.
require secondary Support autolytic
debridement.

dressing. Have replaced Apply for Black and
enzyme dressing Yellow Wounds
Polyurethane Non adhesive, To absorb light to

foams nonadherent, hydrocolloid moderate amounts of
dressings that need to exudates, to debride Allevyn
have their edges taped wounds.
down or scaled. Require Apply for Yellow
secondary dressing to and Red wounds
obtain an occlusive
environment. Surrounding
skin must be protected to
prevent maceration.
Calcium Natural polysaccharide To provide a moist

Alginate from seaweed, wound surface by
dressing nonadherent dressing. interacting with Kaltostat,
Calcium alginate fibre exudates; to absorb Curasorb
dressings that conform to exudates, and to support
the wound surface and debridement
absorb up to 20 times their Apply for Yellow
weight in exudates, and Red wounds
require a secondary
dressing

27
CASES

B. Bandage Procedure
1. Objectives
The medical student should:
a. Understand the definition of bandage
b. Know the aim of bandage
c. Be able to describe the type and application of bandage

29
d. Be able to build emotional and communicative relationships with patients when
possible.
e. Be able to identify and describe the wound and its body part while performing Look
(inspection), Feel (palpation), and Move (assessing the range of movement).
The wound can be determined by its type (acute or chronic) based on thoroughly
evaluating the wound personality consist of wound location, size, edge, base, bone
involvement, degree of slough and contamination and active bleeding.
f. Familiar with materials and types of bandages available and also be able to choose
the appropriate bandage.
g. Be able to perform how to clean (medical aseptic) the wound before applying
bandage. And perform bandage using appropriate procedures.
h. Check the results of all the procedures, tightness of bandage (loose or tight).
i. It is apriority to evaluate Physical and Psychological responses of patient after we
perform any management and manipulation.
Pre and Post management evaluation of distal vascular status is mandatory. Vascular
evaluation for the distal part of extremities can be perform systematically by
Inspecting the color, feel the temperature, sensation, evaluate the CRT (Capillary
Refill Time of < 2 seconds) and palpate the distal pulse (measure its quantity and
quality).
j. Detection of circulatory embarrassment, bone involvement and/ joint movement
disturbance can be detected by comparison to the contralateral normal side of
extremity.
2. Definition
A bandage is a piece of material used either to support a medical device such as dressing
or splint, or on its own to provide support to the body or part of the body.
Bandages are available many types, from generic cloth strips, to special shaped designed
for a specific part of the body. Bandages frequently improvised depend on the situation
demands, using clothing, blankets or other material. A bandage is technically only used to
support a dressing and not directly on a wound.
3. Equipments or Instruments needed:

a. Any sizes of elastic bandage
b. Any sizes of padding
Figure 1. Bandages Equipments or Instruments
4. Type of Bandage
There are four types of bandages:
a. Gauze bandage
This is the most common type of bandage which is a simple woven strip material.
Gauze bandage has any number of widths and lengths and it can be used for almost
any bandage application, including holding a dressing in place.

b. Compression bandage
The compression bandage describes a wide variety of bandages with many different
applications that includes:
 Short stretch compression bandage
This bandage is applied to treat lymphedema or venous ulcers in the limb. It is not
increasing pressure during activity and safe or comfort for a long-term treatment;
the stability is very high resistance to stretch if pressure is applied through
internal muscle contraction and joint movement. This force is called working
pressure.
 Long stretch compression bandage
This bandage is named like above due to their long stretch properties, the high
compression power of these bandages can be easily adjusted. It also has a very
high resting pressure and should be removed at night or if the patient is in a
resting position.
c. Triangular bandage
This bandage is a piece of cloth cut in the shape of a right-angled triangle. It is felt by
many trainers to be the most versatile of the bandage available. It can be utilized fully
unrolled as a sling, folded as a normal bandage or for the head bandage.
Figure 2. Triangular Bandage
d. Tube bandage
This bandage has an applicator and it is woven in a continuous circle. It utilized to
hold dressing or splint on the limbs, or to provide support to sprains and strains.
5. Procedures
PRINCIPLES OF BANDAGES
a. Select a bandage of appropriate type, width and length.
b. Whenever possible, use new bandages. Elastic bandages, in particular, lose their
elasticity after usage or washing.
c. Ensure that the patient’s skin is clean and dry.
d. Cover any wounds before bandaging the injured area.
e. Check for pulse, if relevant.
f. If appropriate, add padding to pressure risk areas.
g. Seek assistance if the part of the part of the body affected needs to be supported
during the bandaging process.
h. Bandage the part of the body in the position you want it to be maintained.
i. Bandage from smaller to larger circumferences for closer shaping of the bandage to
the affected body part.
j. If possible, bandage in the direction of venous blood return to prevent blood pooling.
k. Keep an even tension on the bandage; this is helped by ensuring that the unrolled part
of the bandage is kept close to the body surface.
l. Ensure that overlaps of the bandage are even and that the bandage has no creases or
wrinkles.
m. Be sure to bandage the body part well above and bellow the affected area, but leave
the finger or toes exposed so that neurovascular observations may be performed.
n. Cut the bandage if it’s too long; never ‘use up’ the bandage by applying extra turns
when finishing.
o. Secure the ends of the bandage, ensuring that the patient cannot injure himself.
p. Re evaluate the distal neurovascular status after bandaging.

31
BANDAGING PROCEDURES
1. First answer these questions:
a. Which part of the body is injured?
b. Is the wound open or closed?
c. What is the approximate width or diameter of the wound?
d. Does the wound restrict the movement of any joint?
2. Choose the right bandages, you may combine more than one.
3. If there is a wound, you must clean it first with disinfectant. If there is a dislocation of a
joint, it must be repositioned first before being bandaged.
4. Decide the position of the bandage, based on:
a. Restricting any movements of the joint that need to be immobilized.
b. Do not restrict any other normal joints.
c. Try to bandage in a way that the patient may feel comfortable.
d. Do not restrict any blood vessels. If the bandage has to be rounded up, the deepest
round should be in the distal part.
e. Ensure the bandage cannot be easily loosened.
5. The basic turns for roller bandages are:
 Circular Turn (Figure 3)

When using the circular turn, the bandage is wrapped around the body part with
complete overlapping of the previous bandage turn. It is used primarily for anchoring
a bandage.
Figure 3. Techniques of circular turn with initial turn
 Spiral Turn (Figure 4)

When using spiral turn, the bandage ascends in a spiral manner so that each turn
overlaps the preceding one by one half or two third the width of the bandage. The
spiral turn is useful when the body part being bandaged is cylindrical, such as the area
around the wrist, the fingers, and the trunk.
Figure 4. Techniques of spiral turn with initial turn
 Spiral-Reverse Turn (Figure 5)

A spiral-reverse turn is a spiral turn in which reverses are made halfway to each turn.
Spiral-reverse turns are particularly effective for bandaging a cone-shaped body part,
such as the thigh, the leg, or the forearm.

Figure 5. Techniques of spiral reverse turn with initial turn
 Spica Turn (Figure 6)

The spica turn consists of ascending and descending turns that overlap and cross one
another to form an angle. It is particularly useful for bandaging the thumb, the breast,
the shoulder, the groin, and the hip.
Figure 6. Techniques of spica turn with initial turn

33
EXAMPLE OF BANDAGING
1. Triangle Cloth
a. Calvaria Cranium Wound

b. Chest Wound

35
c. Lower Arm Wound

d. Foot Wound

37
2. Tie Shape Bandage
Eye Wound
Chin Wound

Axilla Wound

39
Elbow Wound

3. Stretchable Roller Bandage
a. Head Wound Procedures 1

41
b. Head Wound Procedures 2
4. Band-Shape Bandage for the Arm

Arm Wound

5. Band-Shape Bandage for the Heel
Heel Wound
6. Band-Shape Bandage for the Hand

Hand Wound

43
CLINICAL REASONING
1. What examination will you take to manage the patient?

2. Do you need bandaging? Why?
3. What type of bandage will you choose? What equipments will you need?
4. How do you educate the patient about home care after doing the procedure?

FEEDBACK FORM FOR DRESSING
No. Point of Adjustment Feedback

1. Wash hands before and after caring for
surgical wounds
2. Greeting and emotional relationship, self
introduction
3. Explanation the aims of dressing
4. Put on disposable gloves; remove the old
dressing, put on sterile dressing equipment and
dressing material
5. Assess the wound and drainage
6. Remove and discard disposable
7. Put on sterile gloves
8. Clean the wound with the prescribe solution or
saline
9. Apply the appropriate dressing based on wound
assessment
10. Remove the sterile gloves
11. Tape all side of the dressing as require
12. Evaluation of the dressing for
leakage, dislodgement, odor, and
wrinkling
13. Document the technique and all wound
assessment
FEEDBACK FORM FOR BANDAGING

introduction
2. Explanation the aims of dressing and bandage
3. Inspecting wounded body part, palpation and
checked range of motion
4. Choosing the appropriate bandage for the wound.
5. Performing first aid (use of disinfectant, application
of sterile gauze, repositioning)
6. Tightening of bandage result: (Too tight or easily
loosened score = 0)
7. Evaluation of sensation pulse, temperature and
movement of distal part
8. To inform the disadvantages result after dressing and
bandage to the patient

45
No. Skills Scientific basis and Scale
1 2 3 4 5
explanation Unexpected Below Meet Exceeding Excellent
expectation expectation expectation
1. Demonstrate confidence Dealing with one-self:
during performing skills in (student able to behave
front of patient professionally without
showing his/her anxiety,
sadness and worries)

1 2 3 4 Exceeding 5
explanation Unexpected Below Meet expectation Excellent
expectation expectatio
n
1. GREETS Ability to build a good
Building and maintaining relationship
adequate relationship with (through active listening,
patients during the whole response properly, empathy,
consultation interpersonal communication
and putting patient at ease)
Explanation:
Scale 1: Unable to demonstrate respect and norms + More than 80 % error
Scale 2: Below observer’s expectation (demonstrate minimal respect and norms + 60%-80% error)
Scale 3: Meet observer’s expectation (demonstrate minimal respect and norms + 40%-60% error)
Scale 4: Exceed observer’s expectation (demonstrate minimal respect and norms + 20%-40% error)
Scale 5: Excellent (demonstrate minimal respect and norms + less than 20% error)
Yogyakarta, …………………..
Instructor
(……………………….)

REFERENCES
Anne, F; 1992; Orthophaedic Nursing; Bailliere Tindall; London.
Block, Bernard. 1978. Fracture & Dislocation (translation), T.M, Simandjuntak, Sudjono Aswin,
Prasetyo Hudaya & Hari Purnomo (Translator & Editor) Y.E.M Yogyakarta.
Janice, R; 1997; Modules for Basic Nursing Skills; Lippincot - Raven Publishers; Philadelphia.
Kartono, Mohammad. 1983. Pertolongan Pertama, Gramedia, Jakarta.
Oswari, E; 2000; Bedah dan Perawatannya; Balai Penerbit FK UI; Jakarta. Taylor; 1997;
Fundamentals of Nursing; Lippincot Raven Publishers; Philadelphia. Anonim. 2006.
Skills Lab Manual Block 3. Faculty of Medicine, GMU: Yogyakarta
Preuss S. Breuing KH, Eriksson E. Plastic Surgery Techniques. In [eds] Achauer BM et al.
PLASTIC SURGERY – Indications, Operations, and Outcomes. Mosby. 2000:147-162
Selvaraj Dhivya, Viswanadha Vijaya Padma, Elango Santhini, 2015, Wound Dressings – A Review,
Biomedicine (Taipei). 20105 Dec; 5(4): 22.

47
SPLINTING
A. General Objectives of Skills Training Year 2

1. Students are able to perform basic skill procedures (communication, physical, procedural,
supporting examinations) and convey the results to the patient
2. Students are able to consider the clinical reasoning aspect of communication and its
procedure (communication, physical, procedural, supporting examinations)
B. Objectives of Splinting
The medical student should be able to:
a. Understand the definition of splinting
b. Know the aim of splinting
c. Describe the application of splinting
d. Understand the indication of the splinting
C. Level of Competence
Level of Competence for Clinical Skills :
 Level of Competence 1: Understanding and Explaining
The graduates of medical school possess theoretical knowledge concerning these skills,
so that they are able to explain concepts, theories, principles or indications, performing
procedures, emerging complications and others to their colleagues.
 Level of Competence 2: Having seen or Having been demonstrated
(concepts, theories, principles or indications, performing procedures, complications and
others). Besides, during their study, they had seen this skill or this skill had been
demonstrated to them.
 Level of Competence 3: Having done or Having applied under Supervision
demonstrated to them or they had applied several times under supervision.
 Level of Competence 4: Able to perform independently
demonstrated to them and they had applied several times under supervision; in addition,
they possess experience to use and apply this skill in the context of doctor practices
independently.
Accident and Emergency Level of Expected Ability

Assessment of fractures 1 2 3 4
Apply a splint 1 2 3 4
The Arm & The Leg Level of Expected Ability

To do procedure of splinting (arm, forearm, thigh and lower 1 2 3 4
leg)

D. Activities

15 minutes Trial and error
Trying and Observing and
session observing preparing  Wooden splint
(2 students) feedback  Stockinette
15 minutes Giving Asking Giving feedback  Plaster
Feedback questions Upper extremity: 8–10
15 minutes Demonstration Observing and Demonstrating, layers
Lower extremity: 10–
discussing discussing
12 layers
10 x 5 Exercise Performing Observing and
 Fiberglass
minutes and observing giving feedback
 Padding
each other
 Elastic bandaging
(one by one)  Bucket/receptacle of
water (the warmer the
water, the faster the
splint sets)
15 minutes Evaluation Asking, giving Explaining and  Feedback form

49
Illustration
You are a doctor in District Hospital, there was a single motor accident, a scooter loss balance and hit the road separator.
rivers get injured and admitted to the Emergency Room. He came in full consciousness and deformity of the right fore arm with
How will you manage the patient?
In the situation when you manage trauma injury and fractures, you have to know the
basic concept of fractures in order to give the appropriate treatment. This is a chance for you to
practice those skills in Skills Lab. The instructors will train you to do those skills. But, you have
to read the manual first and you will be more prepared. This manual mainly discussed about
splinting using easily get material (wooden splint) and splint made of plaster of paris.
SPLINTING PROCEDURE
A. Splinting Procedure
1. Objectives
As a general practitioner, you should be able to :
a) Understand principles of splinting in management of acute trauma.
b) Learn how to apply padding
c) Learn how to manipulate plaster to optimize cast hardening.
d) Apply principles of splint molding for and maintenance of immobilization
e) Apply principles to 4 splints: forearm splint, posterior leg and ankle splint, long arm
splint, sugar tong arm splint (u-slab)
2. Definition
Splint is any material used for immobilize limb or other body part. Adequate splint
technique is needed for appropriate management of orthopaedic injuries, including
fractures, dislocations, and deformity. Splint technique requires multiple steps, including
adequate padding and immobilization during application, also safe removal.
3. Equipments or Instruments needed

a. Wooden splint
b. Stockinette
c. Plaster
d. Upper extremity: 8–10 layers
e. Lower extremity: 10–12 layers
f. Padding
g. Elastic bandaging
h. Bucket/receptacle of water (the warmer the water, the faster the splint sets)
4. The goal
Splinting as immobilization has many functions:
 Prevent movement of fracture fragments
 Prevent further soft tissue injury (especially the neurovascular tissue)
 Reduce pain
 Easier to transport
 Rest the injured limb

5. Principles of Splinting
a. Splint should be across 2 joints, proximal and distal to the fracture site
b. Any clothes or accesories covering the limb should be removed, inspect for any wounds
and deformity.
c. Check for vascular and neurological status distal to the injured area before and after
procedure.
d. Dressing the wound with sterile gauzes.
e. Do not transport the patient before the splinting procedure is done, except there is any
dangerous situation.
f. Appliances of soft padding if using stiff and hard material for splints. Soft padding
should cover bony prominences in the splinting area.
g. Check the splint if it is too loose or too tight.
h. Give attention to patient’s physical and psychological condition.
6. Procedures
a. Prepare the equipment
b. Remove any clothes and accessories, check for neurovascular status distal to injury.
c. Check for the length of splint in contralateral of injured limb. Splint should cover across
two joints proximal and distal of injury.
d. Apply the soft padding
e. Apply the splint
f. Check the splint, if the immobilization is good enough? Is it too loose? Is it too tight?
If you are going to apply a plaster of paris based splint, there is a baseline procedure that you
should understand before applying the splint.
Baseline procedures for splinting using plaster of paris:
 Plaster for upper extremity should be 8 – 10 layers thick, while for the lower
extremity 10-12 layers
 Apply the stockinette to extend 2" beyond the splinting material.
 Apply 2–3 layers of padding over the area to be splinted and between digits being
splinted. Add an extra 2–3 layers over bony prominences.
 Lightly moisten the splinting material. Place it and fold the ends of stockinette over
the splinting material.
 Apply the elastic bandaging.
 While still wet, use palms to mold the splint to the desired shape.
 Once hardened, check neruovascular status and motor function.
EXAMPLE OF SPLINTING

51
Wooden splint
humerus splint
Forearm splint
Splint for femur
Splint for lower leg

Plaster Splint
Volar splint
Long arm Splint
U-slab

53
Long leg posterior splint
short leg posterior

splint

FEEDBACK FORM FOR SPLINTING

1. Wash hands before and after caring for surgical
wounds
introduction
3. Explanation the aims of splinting
4. Assess the injury, check for any wound,
deformity, and distal neurovascular status
5. Put on sterile gloves
6. Clean the wound and cover the wound using
sterile gauzes
7. Remove the gloves
8. Check for splinting equipment, check the length
needed on contralateral limb
9. Apply the soft padding covering bony
prominences
10. Apply the appropriate splinting according to
injured area
11. Check the tightness of the splint.
12. Evaluation of distal neurovascular status
13. Document the technique and all wound
assessment

1 2 3 4 5
explanation Unexpected Below Meet Exceeding Excellent
expectation expectation expectation
1. Demonstrate confidence Dealing with one-self:
during performing skills in (student able to behave
front of patient professionally without
showing his/her anxiety,
sadness and worries)
1 2 3 4 Exceeding 5
explanation Unexpected Below Meet expectation Excellent
expectation expectatio
n
1. GREETS Ability to build a good
Building and maintaining relationship
adequate relationship with (through active
patients during the whole listening, response
consultation properly, empathy,
interpersonal
communication and
putting patient at ease)

55
Explanation:
Yogyakarta, …………………..
Instructor
(……………………….)

REFERENCES
Laboratorium Keterampilan Klinis FK UNS. 2018. Buku Pedoman Keterampilan Klinis :

Pembebatan dan Pembidaian
Boyd A, Benjamin H, Asplund C. Principles of Casting and Splinting. Am Fam Physician. 2009
Jan 1;79(1):16–22.
Eiff MP, Hatch RL. Fracture Management for Primary Care. Philadelphia, PA: Elsiver/Saunders,
2012.
Parsons, BO and Jeffries JT. Casting Techniques : Splint, Casts, and Removal.
BEM IKM FK UI. 2015. Modul Penanganan Patah Tulang dan Cedera Sendi

57
YEAR II
PAP’S SMEAR AND

VISUAL INSPECTION USING ACETIC ACID (VIA) EXAMINATION
BLOCK I.9
SKILLS LABORATORY
2023

59
PAP’S SMEAR
AND
BLOCK I.9
CONTRIBUTORS:
dr. Irwan Taufiqur Rachman, Dr. dr. Ardhanu Kusumanto,

Sp.OG,Subsp.K.Fm Sp.OG,Subsp.Onk.
Department of Obstetrics and Gynecology Department of Obstetrics and Gynecology
Faculty of Medicine, Public Health and Faculty of Medicine, Public Health and
Nursing Universitas Gadjah Mada Nursing Universitas Gadjah Mada
Yogyakarta Yogyakarta
CO-CONTRIBUTOR:
dr. Diannisa Ikarumi E.S., Sp.OG,Subsp.Obginsos
Department of Obstetrics and Gynecology
Yogyakarta
dr. Ide Pustaka Setiawan, M.Sc (HPE), Sp.OG

Department of Medical Education and Bioethics
Yogyakarta

Yogyakarta
2023

PREFACE
Medical school students need to learn and practice some clinical skills to prepare their
competence before entering clinical rotation as a part of their education process before they
become real doctor. Medical school is nowadays convinced that students should master the skills
before they make contact with real patients. To achieve this objective an early skills training,
therefore, is needed. Skills laboratory allows students to learn and practice their clinical skills.
The topic in this manual book is one of topics under the main topic i.e. “Reproductive
Health” which will be studied continuously within blocks during undergraduate studies. The skill
included in this book is based on Competency-Based-Curriculum 2020. Topics included under
Reproductive Health are listed as follows:

1. Gynecology Examination I.4
(Genitourinary & Reproductive
System)
2. Antenatal Care I.8
(Life Cycle)
3. Baby Delivery (Stage 1 to 4) I.8

(Life Cycle)
4. Lactation and Puerperium I.8

(Life Cycle)
5. Pap’s Smear and Visual Inspection using Acetic I.9
Acid (Research and Basic Medical
Practice)
6. IUD and Implant Insertion and Removal II.9
(Reproductive Problems)
It is important for students to be aware that all topics included are related to each other.
We hope this skills training manual book will be useful for the students to improve their skill
competencies and for instructors who involve in the skills training.

Contributors

61
TABLE OF CONTENTS
Preface
The General Rule in Skills Laboratory
Table of Contents
I. Overview
II. General Objectives of Skills Training Year 2
III. Objectives
IV. Level of Competence
V. Activity
Pap’s Smear
A. Introduction
B. Screening conditions
C. Procedure for Pap specimen collection
I. Equipment and Supplies
II. Procedure
III. Liquid based monolayer cytology
Visual Inspection using Acetic Acid (VIA) Examination

A. Test provider skills
B. Procedure
C. Carefully observe
D. Conclusion of the examination
E. Documentation of findings and advising the woman
F. Reporting the outcome of VIA
1. VIA negative (-)
2. VIA positive (+)
Appendix 1: Informed Consent
Appendix 2: Format for reporting results of VIA and VILI
References
Feedback Forms

63
PAP’S SMEAR AND
VAGINAL INSPECTION USING ACETIC ACID
I. OVERVIEW
Cervical cancer is the second most common malignancy in women worldwide,
and it remains a leading cause of cancer-related death for women in developing
countries. Based on Standar Kompetensi Dokter Indonesia (Konsil Kedokteran
Indonesia, 2006), a general physician should be able to perform additional
diagnostic
examinations i.e endocervical swab and cervical scraping.
The focus of this skills training session is to encourage the positive behavior of
the medical students for VIA and Pap’ smear precise uses and applications, to give
counseling skills on cervical pre-cancer and cancer test by VIA and Pap’ smear and to
give knowledge and skill for the medical students on VIA and Pap’ smear procedures
Before learning these skills, students should already master the skills in Block I.6
& I.4. Aseptic Procedure and Gynecologic Examination.
II. GENERAL OBJECTIVES OF SKILLS TRAINING YEAR 2

1. Students are able to explore data (communication, physical, procedural,
supporting examinations) and draw a conclusion from patient’s problems, the
sequence of diagnosis possibilities as well as to deliver the results to the patient.
2. Students are able to perform specific procedural actions relevant to patient’s
problems, by considering ethical aspects.
III. OBJECTIVES
After completing this session, the students are able to:
1. Conduct counseling on cervical pre-cancer and cancer prevention and early
detection
2. Select the appropriate client for via and pap’ smear
3. Provide instrument for via and pap’ smear
4. Prepare the client for via and pap’ smear
5. Advice the presence of potential side effects
6. Give further direction and counseling after VIA and Pap’ smear
IV. LEVEL OF COMPETENCE

Level of Competence for Clinical Skills :
The following is the division of competence level according to Miller
Pyramid:
 Level of Competence 1: Understanding and Explaining
The graduates of medical school understand theoretical knowledge concerning these
skills, so that they are able to explain concepts, theories, principles or indications,
performing procedures, emerging complications and others to their colleagues.
 Level of Competence 2: Having seen or Having been demonstrated
The graduates of medical school understand theoretical knowledge concerning this
skill (concepts, theories, principles or indications, performing procedures,
complications and others). Besides, during their study, they had seen this skill or this
skill had been demonstrated to them.
 Level of Competence 3: Having done or Having applied under Supervision
skill had been demonstrated to them or they had applied several times under
supervision.

 Level of Competence 4: Able to perform independently
skill had been demonstrated to them and they had applied several times under
supervision; in addition, they possess experience to use and apply this skill in the
context of doctor practices independently.
Gynaecology / obstetrics : Skills list Level of Expected Ability

Gynaecology
Physical examination
General physical examination including breast 1 2 3 4
Inspection and palpation of external genitalia 1 2 3 4
Speculum examination: inspection of vagina and 1 2 3 4
cervix
Bimanual examination: palpation of vagina, cervix, 1 2 3 4
uterine corpus, ovaries
Rectal examination: palpation of pouch of Douglas, 1 2 3 4
uterus
Combined recto-vaginal septum 1 2 3 4
Additional diagnostic examination
Genital discharge: smell 1 2 3 4
Genital discharge: ph 1 2 3 4
Genital discharge: gram stain 1 2 3 4
Genital discharge: vaginal swab 1 2 3 4
Genital discharge: examination with saline 1 2 3 4
Genital discharge: examination with potassium 1 2 3 4
hydroxide
Endocervical swab and cervical scraping 1 2 3 4
Colposcopy 1 2 3 4
Abdominal ultrasound examination of uterus 1 2 3 4
Vaginal ultrasound examination of uterus 1 2 3 4
Curettage 1 2 3 4
Suction curettage 1 2 3 4
Laparoscopy, diagnostic 1 2 3 4

65
V. ACTIVITY BCCT Pap’s Smear & VIA
Pre Session Assignment
Time Activity Students Materials

Pre session Reading material & Reading & Students book & Video VIA and
Watching Video Wathching papsmear provided in Gamel

assignment and assignment, assignment,
asking pre answering instructor asking question
session “verbal pretest” to the students
assigment question as “verbal
pretest”
10 minutes Trial and error Trying and observing Observing and Pelvic model
session (2 students) preparing Pap smear set
feedback VIA set
15 minutes Demonstration Observing and Demonstrating, Feedback form
discussing discussing
10 x 7.5 Exercise Performing and Observing and
minutes observing each other giving feedback
(one by one)
15 minutes Evaluation Asking, giving Explaining and -

CASE ILLUSTRATION
A P5A1 41-year-old woman PAPcomes

SMEAR to your clinic, complaining
smelly discharge from her birth canal. She worries because she
A. Introduction
heard that discharge is one of the symptoms of cervical cancer.
Considering her age and her complaints, she asks you whether
Cervical cancerthere
is theissecond most test
a screening common malignancy
for cervical cancer.in women worldwide, and it
remains a leading cause of cancer-related death for women in developing countries. In the
United States, cervical cancer is relatively uncommon. The incidence of invasive cervical
cancer has declined steadily in the United States over the past few decades; however, it
continues to rise in many developing countries. The change in the epidemiological trend in
the United States has been attributed to mass screening with Papanicolaou tests.
It is widely recognized that cervical cancer screening is one of the most effective
cancer screening tests reported to date. In countries where regular cervical screening is
performed, rates of cervical cancer have demonstrated a dramatic decrease.
The Papanicolaou test (also called Pap smear, Pap test, cervical smear, or smear test)
is a screening test used in gynecology to detect premalignant and malignant (cancerous)
processes in the ectocervix. Significant changes can be treated, thus preventing cervical
cancer. The test was invented by and named after the prominent Greek doctor Georgios
Papanikolaou, but was also independently invented by Aurel Babeş. An anal Pap smear is an
adaptation of the procedure to screen and detect anal cancers.
In taking a Pap smear, a tool is used to gather cells from the outer opening of the
cervix (Latin for "neck") of the uterus and the endocervix. The cells are examined under a
microscope to look for abnormalities. The test aims to detect potentially pre-cancerous
changes (called cervical intraepithelial neoplasia (CIN) or cervical dysplasia), which are
usually caused by sexually transmitted human papillomaviruses (HPVs). The test remains an
effective, widely used method for early detection of pre-cancer and cervical cancer. The test
may also detect infections and abnormalities in the endocervix and endometrium.
It is generally recommended that females who have had sex seek regular Pap smear
testing. Guidelines on frequency vary, from annually to every five years. If results are
abnormal, and depending on the nature of the abnormality, the test may need to be repeated
in three to twelve months. If the abnormality requires closer scrutiny, the patient may be
referred for detailed inspection of the cervix by colposcopy. The patient may also be referred
for HPV DNA testing, which can serve as an adjunct to Pap testing.
Screening Guidelines published by ACOG and ACS, which are as follows:

1. Annual cervical Pap screening should begin approximately 3 years after beginning sexual
intercourse, but no later than age 21 years.
2. Women younger than 30 years should undergo annual cervical Pap screening.

67
3. Women aged 30 years and older who have had three consecutive negative cervical Pap
screening tests and who have no history of CIN 2 or CIN 3, are not immunocompromised
and are not HIV infected, and were not exposed to diethylstilbestrol in utero may extend
the interval between cervical Pap examinations to every 3 years.
4. Cervical cancer screening (Pap) of low-risk women over age 70 is not recommended
based on the recommendations of the American Cancer Society and the U.S. Preventive
Services Task Force. Therefore, if a woman aged 70+ has at least 3 consecutive normal
Pap smears in the past 10 years and no history of abnormal screening, at the discretion of
the clinician, screening may be discontinued.
5. For a woman who has had a hysterectomy:
a. Total Hysterectomy:
1) With pathology “benign” for cancer: Women who have undergone hysterectomy
with removal of the cervix for benign indications and who have no prior history of
CIN 2 or CIN 3 or worse may discontinue routine vaginal cytology testing.
(ACOG Practice Bulletin No 45, p 8)
2) With pathology “positive” for cervical cancer: Vaginal Pap smear every 6 months
for 2 years; if negative, then every year.
b. Partial Hysterectomy with cervical stump present: Routine annual screening then
every three years after 3 consecutive negative Paps
B. Screening Conditions
New clients should be instructed over the phone when scheduling their initial exam.
Clinic phone clerks should routinely instruct clients making appointments for new and annual
exams to:
1. Make their appointment 1-2 weeks after their menstrual period.
2. Avoid having sex 24 hours before Pap smear.
3. Not to douche or put anything into the vagina for at least 24 hours before the Pap smear
appointment.
When scheduling clients who are returning for repeat Paps, regardless of the reason,
inform client about optimal preparation:
1. Patient is not on menses.
2. No contamination of the cervix (e.g., creams lubricants, semen).
3. No recent abrasion of the cervix (e.g., sex, douching, vaginal contraceptives, recent Pap
smear or cultures).
4. No cervicitis (if present, treat first and have patient return in 12 weeks near mid-cycle).
If Pap smear is deferred, the rest of the exam can be done and the client should be
rescheduled at a later date when conditions are more optimal.
Clinicians should remember that women with unexplained abnormal bleeding should
be referred for a complete gynecological evaluation to rule out endometrial/uterine
abnormalities, i.e., fibroid tumors, carcinoma.

Figure 1. Female pelvic anatomy
C. Procedure for Pap specimen collection
I. Equipment and Supplies
Supplies should be assembled before beginning exam.
If conventional testing is used, the following items are essential:

1. Glass slide with frosted end;
2. Extended tip spatula (either wood or plastic);
3. Endocervical brush (not for use during pregnancy or for friable cervix); and
4. Fixative spray (specifically designated cytology spray only).
If liquid based testing is used, the following supplies are essential:

1. Extended tip plastic spatula or cervical broom;
2. Endocervical brush (not for use during pregnancy); and
3. Vial with liquid base preservative.
Good light illumination and bivalve specula of different types and sizes should be
available for either test method.
II. Procedure
1. Utilize adequate space, time, light, and privacy for the exam.
2. Have the patient void and assist with undressing if needed.
3. To enhance the relaxation and comfort of the patient, explain all procedures
carefully and use a mirror if the patient desires.
4. Assist the patient into the lithotomy position if needed. For women with
disabilities or the elderly, other positions can be effectively used.
5. Write the patient’s name on the frosted end of the glass slide with a # 2 lead
pencil (or label the liquid based preservative vial). Make sure the name is correct.
6. Clean technique is used. Wear gloves when obtaining all specimens. Universal
precautions must be used during the entire procedure taking care not to touch
clean materials or equipment with the contaminated glove.
7. Inspect and palpate, with one gloved hand, the perineum, labia, vulva, and vagina.
Look for lesions, masses, drainage, or discoloration.
8. Avoid palpating the cervix prior to obtaining the Pap smear.
9. Choose the appropriate size and type of bivalve speculum. Lubricate the speculum
with water if necessary - DO NOT USE other lubricants. Following the path of
least

69
resistance, insert the speculum gently keeping the blades closed until completely
inserted. Do not turn the speculum to insert
10. Open the speculum gently. If the cervix is not visible, move the speculum slightly
to bring the cervix into view. The entire cervix should be visible to ensure the best
possible specimen collection. (Figure 2)
Figure 2. Specimen collection using Ayre spatula

Source: Bickley LS. 2007. Bates’ Guide to Physical Examination and History Taking 9th ed. Lippincott
Williams & Wilkins. Philadelphia.
11. Do not wipe the cervix before collecting the Pap smear. Excessive mucus should
be removed gently with a cotton swab without disturbing the epithelium. If heavy
vaginal discharge or infection is present, it may be better to delay the Pap smear
until the infection has been treated.
12. Use this recommended order for cervical specimen collection for women 29 years
and younger:
• Vaginal pH
• Wet Mount (Taking the wet prep specimen first does not disturb the cervix
and avoids contamination from blood or cervical mucus).
• Chlamydia/Gonorrhea DNA probe
• Pap Smear. In women 30 years and older, the cervical Pap is obtained first and
other tests as indicated based on history and symptoms.
13. Collect cells from the cervix with specific emphasis on obtaining cells from the
squamocolumar junction (SCJ) or transformation zone (TZ). The TZ is the area
where most abnormal cell changes occur.

Figure 3. Pap smear procedure
Variations exist in the location of the squamocolumnar junction (SCJ) or transformation zone
(TZ), as follows:
Ectocervix with ectropion Ectocervix without ectropion Ectocervix with small or

(SCJ visible) may be found may be found in parous stenotic os may be found in
in adolescent clients, clients. SCJ is mainly inside prememopausal nulliparous
premenopausal nulliparous canal, but a small portion is patients, post menopausal
clients, or clients on birth usually visible. clients, or clients with history
control pills. of treatment for abnormal
Pap(s). SCJ is completely
inside canal.
To collect the ectocervix sample: To collect the endocervical sample:

1. Place the spatula against the cervix; rotate it 1. Insert the instrument into the
360° using firm pressure keeping continuous endocervical canal far enough that only a
contact with the cervix. few bristles of the brush are visible.
2. Multiple scrapes may be necessary in a parous or 2. Rotate slowly, turning the brush 180°.
large cervix. 3. Withdraw carefully to avoid vaginal
3. Hold the spatula horizontally and withdraw contamination.
carefully to avoid vaginal contamination. 4. Hold the sample.
4. Hold the sample.

71
5. Spread the spatula sample(s) evenly on the glass slide using moderate pressure. Apply the
endocervical sample, to the same slide by rolling the brush along the slide using moderate
pressure.
6. Spray the slide immediately (within 10 seconds) with cytology fixative Hold 8-10 inches
away from the slide to avoid spraying cells off the slide. Do not use hair spray.
7. For liquid based Pap smears, place the spatula into the liquid vial and swirl vigorously 10
times. Remove the spatula and place the brush into the vial of liquid preservative and
rotate 10 times while pushing against the wall of the vial. Swirl vigorously to further
release material. If the SurePath™ test pack is used, the end of the broom is released
directly into the vial. Place the cap on the vial.
8. Always confirm the labeling of the specimens before leaving the patient. An assistant
may complete the lab requisition; however it is the clinician’s responsibility to ensure
complete and accurate labeling. The clinician should verify that the correct name is on the
frosted end of the slide and the specimen is properly packaged with the correct lab
requisition enclosed.
9. Package and ship slides in containers as recommended by the lab. Containers should be
substantial enough to avoid breakage during transport. Pap slides are sent to the lab daily,
but several specimens may be batched together, providing more protection and
economical shipping. Biohazard labels are not required. Local labs often pick up slides,
which limits breakage and helps prevent mishandling.
10. Keep a tracking record to ensure that all Pap smear reports are received.
The physician or operator collecting a sample for the test inserts a speculum into the
patient's vagina, to obtain a cell sample from the cervix. Pap smears can be performed during a
woman's menstrual period, especially if the physician is using a liquid-based test; if bleeding is
extremely heavy, endometrial cells can obscure cervical cells, and it is therefore inadvisable to
have a pap smear if bleeding is excessive. The patient's perception of the procedure ranges from
no discomfort at all to severe discomfort (especially in women with cervical stenosis). Many
women experience spotting or mild cramping afterward.
The endocervix may be partially sampled with the device used to obtain the ectocervical
sample, but due to the anatomy of this area, consistent and reliable sampling cannot be
guaranteed. As abnormal endocervical cells may be sampled, those examining them are taught to
recognize them.
The endometrium is not directly sampled with the device used to sample the ectocervix.
Cells may exfoliate onto the cervix and be collected from there, so as with endocervical cells,
abnormal cells can be recognised if present but the Pap Test should not be used as a screening
tool for endometrial malignancy.
Samples are collected from the outer opening or os of the cervix using an Aylesbury
spatula and an endocervical brush, or (more frequently with the advent of liquid-based cytology)
a plastic- fronded broom. The broom is not as good a collection device, since it is much less
effective at collecting endocervical material than the spatula and brush. The cells are placed on a
glass slide and checked for abnormalities in the laboratory.
The sample is stained using the Papanicolaou technique, in which tinctorial dyes and
acids are selectively retained by cells. Unstained cells cannot be visualized with light
microscopy. The stains chosen by Papanicolaou were selected to highlight cytoplasmic
keratinization, which actually has almost nothing to do with the nuclear features used to make
diagnoses now.
The sample is then screened by a specially trained and qualified cytotechnologist using a
light microscope. The terminology for who screens the sample varies according the country; in
the

UK, the personnel are known as Cytoscreeners, Biomedical scientists (BMS), Advanced
Practitioners and Pathologists. The latter two take responsibility for reporting the abnormal
sample which may require further investigation.
Studies of the accuracy of conventional cytology report:

 sensitivity 72%
 specificity 94%
III. Liquid based monolayer cytology
Since the mid-1990s, techniques based around placing the sample into a vial containing
a liquid medium which preserves the cells have been increasingly used. The media are
primarily ethanol based. Two of the types are Sure-Path (TriPath Imaging) and Thin-Prep
(Cytyc Corp). Once placed into the vial, the sample is processed at the laboratory into a cell
thin-layer, stained, and examined by light microscopy. The liquid sample has the advantage of
being suitable for low and high risk HPV testing and reduced unsatisfactory specimens from
4.1% to 2.6%. Proper sample acquisition is crucial to the accuracy of the test; clearly, a cell that
is not in the sample cannot be evaluated.
Studies of the accuracy of liquid based monolayer cytology report:

 sensitivity 61% to 66%
 specificity 82% to 91%
Some, but not all studies, report increased sensitivity from the liquid based smears.

73
A. Test provider skills
The test provider must have a good knowledge of the anatomy, physiology and pathology
of the cervix in relation to its visual examination. He/she should know the clinical features of
benign conditions, inflammation, precancerous lesions and invasive cancer of the cervix.
B. Procedure
Women coming for testing should have the screening procedure explained to them in
detail. Written informed consent should be obtained before screening. An example of a written
informed consent form is given in Appendix 1. Relevant obstetric and gynaecological history
should be obtained and recorded with the help of a form for this purpose (Appendix 2). The
woman should be reassured that the procedure is painless, and every effort should be made to
ensure that she is fully relaxed and remains at ease during testing.
The woman is invited to lie down in a modified lithotomy position on a couch with leg
rests or knee crutches or stirrups. After proper positioning of the woman, observe if there is any
vaginal discharge. Observe the external genitalia, and perineal region for any signs of
excoriations, oedema, vesicles, papules, sores, ulceration and warts. Look for any swelling in the
inguinal/femoral region.
Figure 4. Lithotomy position
Afterwards, gently introduce a sterile vaginal speculum, which has been immersed in
warm water and open the blades of the speculum to view the cervix. Adjust the light source so
that there is adequate light in the vagina and on the cervix. As the speculum is gently opened and
the lips are fixed, the cervix comes into view. Observe the size and shape of the cervix.
Identify the external os, columnar epithelium (red in colour), squamous epithelium (pink)
and the squamocolumnar junction. Proceed to identify the transformation zone, the upper limit of
which is formed by the squamocolumnar junction. Remember that cervical neoplasias occur in
the transformation zone nearest to the squamocolumnar junction. (Figure 5)

75
Figure 4. Location of squamocolumnar junction (SCJ)
a. Squamocolumnar junction is located in the ectocervix, far away from the external os during the reproductive years and
pregnancy. On visual inspection, ectropion is seen as a strikingly reddish ectocervix
; b. Woman passes through her reproductive life to the perimenopausal age group, the location of the squamocolumnar junction
progressively starts moving on the ectocervix towards the external os; c. Women perimenopausal period and after the onset of
menopause, the cervix shrinks, due to the lack of estrogen, and, consequently, the movement of the squamocolumnar junction
towards the external os and into the endocervical canal is further accelerated; d. In postmenopausal women, the squamocolumnar
junction is located in the endocervical canal and, hence, often cannot be seen on visual examination.
Look for ectropion, cervical polyp, nabothian cysts, healed laceration of the cervical lips,
leukoplakia, condylomata and signs of cervicitis. You may note that in post menopausal women,
the cervix appears pale and brittle, due to thinning and atrophy of the squamous epithelium.
Assess the characteristics of discharge in terms of quantity, colour, odour and thickness. Thread-
like, thin mucinous discharge from the external os indicates ovulation. If heavy blood flow
through the external os is observed in women during menstruation, they may be subjected to VIA
after 5-15 days.
In ectropion, the cervix has a large area of red appearance around the external os and the
squamocolumnar junction is far away from the os. Nabothian cysts appear as bulging blue-white
or yellow-white nodules, having a smooth delicate lining with branching blood vessels. In some
women, nabothian cysts can become large and distort the shape of the cervix. A cervical polyp
appears as a smooth mass protruding from the cervical canal beyond the external os, which may
appear dark red or pink-white. Sometimes a necrotic polyp resembles a cervical cancer. Healed
lacerations appear as tears on the lips of the cervix, with the external os appearing irregular.
Leukoplakia appears as a smooth-surfaced, white area on the cervix that cannot be removed or
scraped off. Cervical condylomata appear as raised, grey-white areas within or outside the

transformation zone in the squamous epithelium and may be accompanied by similar lesions in
the vagina and vulva.
Look for small blisters containing fluid or multiple, small ulcers on the cervix. Extensive
erosive red areas may be present on the cervix, extending to the vagina in instances of severe
cervical infection and inflammation. Observe whether there is any bleeding from the cervix,
especially on touch, or ulceroproliferative growth. A very early invasive cancer may present as a
rough, reddish, granular area that may bleed on touch. More advanced invasive cancers may
present as a large exophytic growth with an ulceroproliferative, bulging mass with polypoid or
papillary excrescences, arising from the cervix or as a predominantly ulcerating growth replacing
most of the cervix. In both of these types, bleeding on touch and necrosis are predominant
clinical features. Foul-smelling discharge is also common due to superadded infection.
Occasionally, invasive cancer can present as an infiltrating lesion with a grossly enlarged
irregular cervix.
Now, gently, but firmly, apply 5% acetic acid using a cotton swab soaked in acetic acid.
The secretions should be gently wiped off. The swabs after use should be disposed of in the
waste bucket. The curdy-white discharge associated with candidiasis is particularly sticky, and if
particular care is not taken to remove it properly, it may mimic an acetowhite lesion, thus leading
to a false-positive result. After removing the swab, carefully look at the cervix to see whether
any white lesions appear, particularly in the transformation zone close to the squamocolumnar
junction, or dense, non-removable acetowhite areas in the columnar epithelium. (Looks Atllas of
Visual Inspection of the Cervix with Acetic Acid (VIA) – Appendix 4). The results one minute
after application of acetic acid should be reported. Note how rapidly the acetowhite lesion
appears and then disappears.
C. Carefully observe:
 The intensity of the white colour of the acetowhite lesion: if it is shiny-white, cloudy-
white, pale-white, dull-white;
 The borders and demarcations of the white lesion: distinctly clear and sharp or indistinct
diffuse margins; raised or flat margins; regular or irregular margins;
 Whether the lesions are uniformly white in colour, or the colour intensity varies across
the lesion, or if there are areas of erosion within the lesion;
 Location of the lesion: is it in, near, or far away from the transformation zone? Is it
abutting (touching) the squamocolumnar junction? Does it extend into the endocervical
canal? Does it occupy the entire, or part of, the transformation zone? Does it involve the
entire cervix (which usually indicates early preclinical invasive cancer)?
 Size (extent or dimensions) and number of the lesions.
If in doubt, it is safe to repeat the test a few times, taking care not to induce bleeding.
Women with suspected invasive cancers should be referred for further investigations and
treatment.
D. Conclusion of the examination
Contaminated swabs, gauze and other waste material should be disposed of in the plastic
bag in a plastic bucket.
Withdraw the speculum gently, and inspect the vaginal walls for condyloma and
acetowhite lesions. Before removing the soiled gloves, immerse the hands briefly in a container
filled with 0.5% chlorine solution. Decontaminate the used gloves by soaking in the 0.5%
chlorine in a plastic bucket for 10 minutes.
The speculum and other instruments used for VIA should be immersed in 0.5% chlorine
solution for 10 minutes' decontamination, before cleaning with detergent and water. The cleaned
instruments may be reused after high-level disinfection by immersing them in boiling water for
20 minutes or by sterilizing the instruments using an autoclave.

77
E. Documentation of findings and advising the woman
Carefully document the outcome of testing in the reporting form (Appendix 2). Explain
the outcome of the test to the woman, as well as any further course of follow-up actions. If the
test is negative, the woman is reassured and she may be advised to repeat testing after five years.
If the test is positive, she should be referred for further investigations such as colposcopy and
biopsy as well as treatment for any confirmed lesions. If invasive cancer is suspected, she should
be referred to a cancer diagnosis and treatment facility.
F. Reporting the outcome of VIA
1. VIA negative (-)
VIA screening is reported as negative in the case of any of the following observations:
 No acetowhite lesions are observed on the cervix.

 Polyps protrude from the cervix with bluish-white acetowhite areas.
 Nabothian cysts appear as button-like areas, as whitish acne, or pimples.
 Dot-like areas are present in the endocervix, which are due to grape-like columnar
epithelium staining with acetic acid.
 There are shiny, pinkish-white, cloudy-white, bluish-white, faint patchy, or doubtful
lesions with ill-defined, indefinite margins, blending with the rest of the cervix.
 Angular, irregular, digitating acetowhite lesions, resembling geographical regions, distant
(detached) from the squamocolumnar junction (satellite lesions).
 Faint line-like or ill-defined acetowhitening is seen at the squamocolumnar junction.
 Streak-like acetowhitening is visible in the columnar epithelium.
There are ill-defined, patchy, pale, discontinuous, scattered acetowhite areas.
2. VIA positive (+)
The VIA test outcome is reported as positive in any of the following situations:
 There are distinct, well defined, dense (opaque, dull- or oyster-white) acetowhite areas
with regular or irregular margins, close to or abutting the squamocolumnar junction in the
transformation zone or close to the external os if the squamocolumnar junction is not
visible.
 Strikingly dense acetowhite areas are seen in the columnar epithelium.
 The entire cervix becomes densely white after the application of acetic acid.
Condyloma and leukoplakia occurr close to the squamocolumnar junction, turning

intensely white after application of acetic acid.

Appendix 1
Referral form for Pap Smear

79
Appendix 2
Informed consent
The doctor/health worker explained to me in detail about the vinegar (VIA)/iodine (VILI)
test(s)* for the early detection and prevention of cancer in the neck of my womb (uterine cervix).
I understand that the surface of my cervix will be visually inspected after application of 5%
acetic acid/dilute iodine solution to detect or to exclude precancer/-cancer. I understand that
these procedures are generally harmless, but may occasionally cause some irritation or mild
bleeding, which can be easily controlled.
I understand that, if the test is positive, other tests such as magnified inspection of the
cervix with an instrument called a colposcope and examination of a sample of the tissue in my
cervix (biopsy) may be recommended before treatment is provided. I have been informed that
treatment by medicines or cryotherapy (destroying the diseased portion of the cervix by an ice-
cold metal probe) or removing the diseased portion by minor surgery or major surgery and/or
treatment with with x-rays, may be required, in the event of any abnormality (infection or
precancer or cancer or complications) being detected.
I hereby express my willingness to undergo the above tests and treatment, if advised.* / I
am not willing to undergo the above procedures. *
Signature:
Date:
Name:
Address:
* Delete as appropriate

Appendix 3
Format for reporting results of VIA and VILI
Screening with VIA and VILI
1. Clinic/Serial/Unique number [ ][ ] [ ][ ]
2. Date of testing (day (2 digits)-month (2 digits)-year (2 digits)): [ ][ ]-[ ][ ]-[ ] [ ]
3. Name:
4. Address:
5. Age (in years) [ ][ ]
6. Education (1: Nil; 2: Primary; 3: Middle; 4: High school; 5: College; 9: []
Not known)
7. When did you have your last menstruation? (1: Less than 12 months []
ago;
2: More than 12 months ago)
8. Marital status: (1: Married; 2: Widowed; 3: Separated; 8: Other; 9: Not []
known)
9. Age at marriage or first sexual intercourse: (99, if not known) [ ][ ]
10. Total number of pregnancies/miscarriages: [ ][ ]
11. Do you suffer from the following? (use Y to indicate if the response is
yes; otherwise, leave blank):
Excessive vaginal discharge []
Itching in the external anogenitalia []
Ulcers in the external anogenitalia []
Lower abdominal pain []
Pain during sexual intercourse []
Bleeding after intercourse []
Intermenstrual bleeding []
Low back ache []
12. Visual examination findings? (use Y to indicate if the response is yes;
otherwise, leave blank):
Squamocolumnar junction fully seen []
Cervical polyp []
Nabothian follicles []
Cervicitis []
Leukoplakia []
Condyloma []
Growth []
13. Findings one minute after application of 5% acetic acid (VIA) (1: []
Negative; 2: Positive; 3: Positive, invasive cancer)
14. If VIA positive, does the acetowhite lesion extend in to the endocervical []
canal? (1: Yes; 2: No)
15. If VIA positive, how many quadrants are involved in the acetowhite []
lesion(s)? (1: Two or less; 2: Three; 3: Four quadrants)
16. Diagram (Draw the location of the squamocolumnar junction with a []
dotted line and the acetowhite/iodine non-uptake area(s) as a
continuous
line)

81
17. Findings after application of Lugol’s iodine (VILI) (1: Negative; 2: []
Positive; 3: Positive, invasive cancer)
18. If invasive cancer, stage (1: IA; 2: IB; 3: IIA; 4: IIB; 5: IIIA; 6: IIIB; 7: []
IVA; 8: IVB; 9: Not known)
19. Biopsy taken? (1: Yes; 2: No) []
(If yes, indicate the biopsy site(s) in the diagram with ‘x’ mark)
20. Action taken: (1: Advised follow-up after five years; 2: Advised
medication for cervicitis and follow-up after six months; 3: Referred
for colposcopy; 4: Referred for immediate treatment; 5: Referred for
staging and treatment of invasive cancer; 7: Other, specify
)

Appendix 4
Atlas of Visual Inspection of the Cervix with Acetic Acid (VIA)

83
REFERENCES
Bickley LS. 2007. Bates’ Guide to Physical Examination and History Taking 9th ed.
Lippincott Williams & Wilkins. Philadelphia
Sankaranarayanan R, Wesley RS. 2003. A Practical Manual on Visual Screening Of Cervical
Neoplasia. World Health Organization – International Agency for Reasearch on Cancer.
Lyon.
International Agency for Research on Cancer (IARC). 2017. Chapter 1: Anatomical and
pathological basis of visual inspection with acetic acid (VIA) and with Lugol’s iodine
(VILI). World Health Organization – International Agency for Reasearch on Cancer.
Lyon.

FEEDBACK FORM
PAP’S SMEAR PROCEDURE
Name : …………………………………….………………….
Student No. : …………………………………….………………….
No. Aspects Score Feedback

0 1 2
A. PREPARATION
Instrument and Medication
1. Checking all needed instruments:
a. Examination table and chair
b. Examination lamp
c. Glove, apron
d. Grave’s speculum
e. Cervico/cyto brush, ayre spatula
f. Labeled object glass
2. Checking fixation solution:
a. alcohol solution/ethanol 90%
b. cytofix/hairspray
3. Preparing referral form for cytology examination
Clients
4. Identifying the client’s identity and checking the
completeness of informed consent
5. Making sure that the client has not have sexual
intercourse and had vaginal irrigation in the last 3 days
6. Explaining to the client about the examination procedure
that is going to be performed
7. Making sure that the client has already urinated and
washed her perineum area
8. Making sure that the client has taken off her underwear
(assisted by a nurse)
9. Asking the client to lie down on the examination table
B. PROCEDURE
10. Explaining to the client that during the examination, she
may feel a bit painful. Asking the client to informed the
examiner if she feels pain.
11. Positioning and turning on the examination lamp
12. Using apron, washing hands, and using gloves
(infection- prevention procedure)
13. Sitting down on an appropriate chair to perform the
examination. Checking the genital area, inspecting vulva-
perineum area and meatus urethra
14. Taking Grave’s speculum with right hand and separating
major labia with left hand. Inserting the speculum tip
into vaginal introitus parallel with the labia. Making sure
that there are no clamped tissues between speculum’s
leaf,
then slowly inserting the speculum
15. Rotating the speculum’s leaf 90o clockwise. Opening the
speculum’s leaf slowly while pushing it until its tip
reaches the fornix.
16. Speculum’s leafs are located at the anterior and posterior
vaginal wall. Opening the leafs widely, until the vagina
and cervix are clearly visible and locking the speculum.
17. Performing examination on cervix, fornices, and vaginal
wall. Examining whether there are discharge, bleeding,
erosion, fragile mass or other abnormal conditions

18. Taking cervico-brush. Inserting the cervico-brush
correctly into cervical canal, rotating it 360o to swab all
cervical surface
19. Taking off cervico-brush slowly without touching the
surrounding tissues
20. Smearing the cervico-brush over the provided object
glass. Making sure that all taken part at cervico-brush
has fully been smeared
21. Fixating the slide using ethanol solution 90%, or
cytofix/hair spray and drying it
22. Unlocking the speculum, rotating it 90o anti-clockwise so
that speculum’s leaf parallel with labia and removing it
slowly
23. Informing the client that the examination is done
C. POST ACTION MANAGEMENT
24. Collecting the instruments and putting them in
decontaminating solution (0.5% chlorine solution).
Putting the waste in the provided place
25. Cleaning up the blood/secrete sticking to gloves, then
taking off and soaking them into 0.5% chlorine solution
a. Washing hands and arms under running water
b. Drying them with a clean towel
26. Turning off the examination lamp
D. POST ACTION COUNSELING
27. Re-informing the client that Pap’s smear examination has
been completed
28. Discussing with the client about the findings during
examination and the next plan of actions
29. Making a referral letter for cytology examination by
attaching the clinical findings obtained during the
examination
30. Writing the findings on medical record
31. Giving medication if needed
32. Explaining and informing the client when she should
return for follow-up examination
Total
Explanation:
Score 0= Not performed at all
Score 1= Performed imperfectly
Score 2= Performed perfectly
Total score
% coverage skills =-------------------x 100% = …………%
64
Yogyakarta, ........................
Instructor, Observer,
(.............................................) (.............................................)

FEEDBACK FORM
VAGINAL INSPECTION USING ACETIC ACID (VIA) EXAMINATION
Name : …………………………………….………………….
Student No. : …………………………………….………………….
No. Aspects Score Feedback

0 1 2
A. Preparation of Instruments and Material
1. Checking all needed instruments:
a. Examination table and chair
b. Examination lamp
c. Grave’s speculum
d. Cotton tip applicator to swab acetate acid to cervix
e. NaCl solution to clean the mucous
f. Acetic acid solution 3 – 5%
B. Patient and Examiner Preparation
2. Asking the patient to empty her bladder so that her
cervix can be well visualized
3. Positioning the client in lithotomy position on
gynecologic examination table
4. Positioning and turning on the examination lamp
5. Washing hands with soap and water and drying them a
clean and dry towel
6. Placing sterile linen under patient’s buttock and over her
lower abdomen
C. Steps of VIA Examination
7. Sitting down on an appropriate chair to perform the
examination.
8. Inserting Grave’s speculum that has been smeared with
gynecologic lubricant, into the patient’s vagina to expose
the cervix
9. Cleaning up excessive mucus using NaCl solution
soaked-cotton tip applicator
10. Observing the cervix
a. If the cervix looks normal and squamo-columnar
junction (SCJ) is visible, continue to step no. 11
b. If the cervix looks normal but SCJ is not visible,
perform pap test
c. If infection is suspected, give initial treatment and
reschedule a VIA examination
d. If cancer is suspected, perform biopsy
11. Giving acetate acid 3%-5% using cotton tip applicator
12. Waiting for 1-2 minutes to observe the transformation in
the cervix
13. Conducting observation to assess the transformation in
the cervix
a. It is called negative if there is no white epithelia in
transformation area
b. It is called positive if there is white epithelia in
transformation area
14. Conducting management in accordance with the result of
VIA examination
a. Doing the next step if VIA is positive
b. Doing examination periodically if VIA is negative

E. Decontamination and Washing Hands Post Action
15. Collecting and putting all dirty instruments into a
container containing 0.5% chlorine solution for 10
minutes
16. Putting the waste in the provided place. Wipe out all
parts that are contaminated with blood or body
discharge with
0.5%chlorine solution
17. Cleaning gloved hands in 0.5% chlorine solution, taking
off the gloves and then soaking them in the solution for
10 minutes
a. Washing hands with soap under running water
b. Drying hands with a clean towel
18. Turning off the examination lamp
F. Monitoring, Medical Record and Post Action
Counseling
19. Examining client’s complaints
20. Noting the result of VIA examination and other
important findings and write them on medical record
21. Explaining to the client for further examination/planning
if the result of VIA examination is positive
22. Explaining to the client to undergo VIA examination
periodically if the result of VIA examination is negative
Total
Explanation:
Score 0= Not performed at all
Score 1= Performed imperfectly
Score 2= Performed perfectly
Total score
% coverage skills = ------------------ x 100% =.................%
44
Yogyakarta, ........................
Instructor, Observer,
(.............................................) (.............................................)

1 2 3 4 5
explanation Unexpected Below
expectation
Meet
expectation
Exceeding
expectation
Excellent
1. GREET Ability to build a good

Building and relationship (through
maintaining adequate active listening,
relationship with response properly,
patients during the empathy, interpersonal
whole consultation communication and
putting patient at ease)
2. INVITES Ability to build a good
Exploration on patient relationship, explore
problem and patient’s problem and
summarize the summarize it (through
problem exploration, data
gathering, history
taking, allo-anamnesis,
checking and
summarization)

1 2 3 4 5
explanation Unexpected Below
expectation
Meet
expectation
Exceeding
expectation
Excellent
1. Demonstrate Dealing with one-self:

confidence during (student able to behave
performing skills in professionally without
front of patient showing his/her
anxiety, sadness and
worries)
2. Ethics (Respect the Dealing with others:
patient, demonstrate (student able to behave
local values and professionally without
norms) showing his/her
assumptions about
patient)
Explanation:
Scale 2: Below observer’s expectation (demonstrate minimal respect and norms + 60%-80%
error)
Scale 3: Meet observer’s expectation (demonstrate minimal respect and norms + 40%-60%
error)
Scale 4: Exceed observer’s expectation (demonstrate minimal respect and norms + 20%-40%
error)

BASIC CLINICAL COMPETENCE MATERIAL BOOK
IMMUNIZATION / VACCINATION
BLOCK I.9

SKILLS LABORATORY
YOGYAKARTA
2023

IMMUNIZATION / VACCINATION
BLOCK I.9
CONTRIBUTOR:
dr. Braghmandita W I, MSc, SpA(K)

Department of Child Health
Yogyakarta
dr. Deshinta Putri Mulya, M.Sc.,SpPD-KAI

Department of Internal Medicine
Yogyakarta

Yogyakarta
SECRETARY
Desinta Mindaryanti, Amd. Kep.
Assistant Year II Coordinator for Clinical Skills Training
Yogyakarta

PREFACE
Medical school students should study and practice several clinical skills as preparation
for entering clinical rotation prior to becoming certified doctor. Currently, the medical
profession compels medical students to be competent in clinical skills before they directly
deal with real patients experiencing real life medical cases. For this reason, clinical skills are
trained as early as possible. This clinical skills laboratory provides an opportunity for
students to study and practice the clinical skills on their own.
The topic of this manual is one of the clinical skills topics that constitute the main topic
of Specific Physical Examination, which will be studied continually in blocks throughout
undergraduate studies. The skill included in this book is based on Competence-Based-
Curriculum of 2020. Topics covered in Specific Physical Examination, which will be studied
in Year II, are as listed as follows:

1. Injection Block I.7
(Hematology and Immune
System)
2. Immunization/Vaccination Block I.9
(Research and Basic Medical
Practice)
It is important for students to recognize that all topics, including those listed above, are
interrelated. Therefore, students are expected to categorize the topics based on the main topics,
so that continuity from one topic to another can be achieved. We hope that in the future, this
manual for clinical skills training can be useful for students to improve their skills, especially in
physical examination; and for instructors who are involved in providing the trainings.
Contributor

IMMUNIZATION/VACCINATION
GENERAL OBJECTIVES OF SKILLS TRAINING YEAR 2
1. The medical student should be able to explore the data to determine the patient’s problem.
2. The medical student should be able to perform specific procedure skills based on their
competence.
OBJECTIVES
After completing this session students are able to:
1. The medical student should be able to do communication related to the vaccination,

including indication and contraindication of the procedure.
2. The medical student should be able to obtain inform consent from the patient/parent
3. The medical student should be able to do vaccination procedure
4. The medical student should be able to explain the examination result correctly and further
advice.
5. The medical student should be able to write on medical record sheet/vaccination
card/KIA (Buku Kesehatan Ibu dan Anak)

LEVEL OF COMPETENCE
1. Level of Competence 1: Understanding and Explaining

The graduates of medical school possess theoretical knowledge concerning these skills so
they are able to explain concepts, theories, principles or indications, performing procedures,
emerging complications and others to their colleagues.
2. Level of Competence 2: Having seen or Having been demonstrated

demonstrated to them.
3. Level of Competence 3: Having done or Having applied under Supervision

demonstrated to them or they had applied several times under supervision.
4. Level of Competence 4: Able to perform independently

demonstrated to themand they had applied several times under supervision; in addition, they
possess experience to use and apply this skill in the context of doctor practices
independently.
Skills Level of Expected Ability

Mengetahui penyakit-penyakit yang dapat 1 2 3 4
dicegah dengan imunisasi dan
pengendaliannya
Melaksanakan 6 program dasar Puskesmas: 1) 1 2 3 4
promosi kesehatan, 2) Kesehatan Lingkungan,
3) KIA termasuk KB, 4) Perbaikan gizi
masyarakat, 5) Penanggulangan penyakit:
imunisasi, ISPA, Diare, TB, Malaria 6)
Pengobatan

ACTIVITY
Session I (Practice with Manikin)
15 minutes Trial and error Trying and Observing and Immunization set,
session observing preparing feedback KIA book,
(2 students) vaccine card
15 minutes Giving Asking Giving feedback -
Feedback questions
15 minutes Demonstration Observing and Demonstrating, Immunization set,
discussing discussing KIA book,
vaccine card
10 x 5 minutes Exercise Performing Observing and Immunization set,
and observing giving feedback KIA book,
each other vaccine card
(one
by one)
15 minutes Evaluation Asking, giving Explaining and Check list
STUDENT WORK PLAN
Before the beginning of session, students are required to make a written workplan.

IMMUNIZATION (CHILDREN)
A. CASE ILLUSTRATION
A mother brought her 18 months old girl to primary health

B. CONTENTS care to evaluate her child growth and development and to get a
routine vaccination.
Immunization
Questionsis: categorized as active immunity, it is the process of stimulating the
immune system to produce long-term humoral and/or
Docellular immuneprocedure!
responses to a particular
1. What vaccination should be given? the vaccination
disease through the administration of next
vaccines or that
toxoids.
has toAs
be aadministered
result of effective and safe
2. When and what is the vaccine
vaccines, the incidence of most vaccination-preventable diseases (VPD) in children was reduced
to this girl?
by 99% compared to the annual morbidity in the 20th century. The national immunization
3. Please make notes in the MCH handbook (Buku KIA)
program in Indonesia is currently regulated by the Minister of Health Regulation no. 12 in 2017
regarding the implementation of immunization in Indonesia, some vaccination in children were
also recommended by the Indonesian Pediatrics Society (IPS) in 2020. Based on the national
immunization program, there are three programs such as routine immunization, additional
immunization, and choose immunization.
1. Routine Immunization :
a. Basic Immunization: immunization given to infants before the age of 1 year. Consist of
several types of vaccine and their specific schedule
Age Types of Immunization Interval
0 - 24 jam Hepatitis B
1 month BCG, Polio 1
2 months DPT-HB-Hib 1, Polio 2
3 months DPT-HB-Hib 2, Polio 3 1 month
4 months DPT-HB-Hib 3, Polio 4, IPV
9 months Measles & Rubella
b. Booster Immunization
Booster immunization is immunization intended for children who are the under
two years and primary school-aged children. All these programs are designated to
administer the booster dosage to increase antibody titers after the basic immunization.

Age Vaccination Minimum interval after basic dosage
Under two years

DPT-HB-Hib 12 months after DPT-HB-Hib 3
18 months
Measles & Rubella 6 months after the first MR
School age program (Bulan Imunisasi Anak Sekolah/BIAS in elementary school)
Measles & Rubella August
Grade 1
DT November
Grade 2 Td November
Grade 5 Td November
Tetanus Toxoid doses are given to a premarital woman or childbearing age women to
prevent tetanus for themselves and their infants and unborn babies. Tetanus is a dangerous
infection caused by bacteria found in the soil, dirt and rusted metals.
Immunization
Interval Protection Period
Status
T1 - -
T2 4 weeks after T1 3 years
T3 6 months after T2 5 years
T4 1 year after T3 10 years
T5 1 year after T4 More than 25 years
2. Additional Immunization
Additional Immunization is defined as certain immunizations that are given to certain age
groups who are most at risk of contracting the disease according to epidemiological studies over
a certain period. It is done to complete basic and/or advanced immunization on targets that have
not been achieved.
This program does not eliminate the obligation to provide routine immunizations. Decisions are
taken by the Minister, the head of the provincial health office, or the head of the district/city
health office.
- Backlog fighting is an active effort at the primary health care (PHC) level to increase
coverage for children < 3 years, priority in villages that have not reached universal
coverage of immunization (UCI) for 2 years
- Crash program in the primary health care (PHC) level is an effort to prevent outbreaks
- National Immunization Week (PIN) is a mass immunization carried out simultaneously to
break the chain of transmission, and increase herd immunity, regardless of immunization
status
- Catch up campaign (Campaign) is a mass immunization program in the region and at
certain times to break the chain of transmission
- Outbreak Response Immunization (ORI) in outbreak conditions

Types of Vaccine available in Indonesia
1) Live-attenuated vaccine :
- Bacteria : BCG
- Virus : OPV, MR, MMR, Varicella, Yellow Fever
2) Inactive Vaccine
- Bacteria : DPT, Meningococcal, Pneumococcal, Typhoid
- Virus : Influenza, Hepatitis B, Hepatitis A, IPV
Characteristics of vaccines
Live-Attenuated Vaccine Inactive Vaccine

Freeze-sensitive --> frozen vaccine cant be used,
Heat-sensitive
have to undergo shake test
Freeze-resistant -
Route : Oral, Intradermal, Subcutaneous Route : Deep Intramuscular
Interval between 2 Live attenuated Interval between 2 inactive vaccines : no interval

vaccines : >=4 weeks (can be administered at one time)
Contraindicated for
Safe for immunocompromised patients
immunocompromised patients
Proper vaccine administration is important to ensure that vaccine given is safe and effective.
There are several steps to perform vaccine administration
a. Welcomes parent and patient
b. Look at the MCH Handbook (Buku KIA, immunization section), assess the immunization
needs, and explain to parents the type of vaccine and how to administer it.
c. Screen for contraindications and precaution for preventing adverse events following
immunization
General Contraindications of Immunization:
 Temporary :
o Moderately/severely ill
o Live vaccines: pregnancy, immunocompromised patients, underwent blood
transfusion/immunoglobulin therapy
 Permanent :
o Anaphylactic shock after previous vaccine administration
o Specific for DPT : Encephalopathy, Hypotonic Hyporesponsive episode
 Precaution:
1. Children with Cyanotic Congenital Heart Diseases

2. DPT vaccine
o The baby cries continuously for 3 hours
o Elevated body temperature > 40.5 C in 48 hours
o Presence of seizures within three days after the administration, GBS within six
weeks after the previous DPT administration
d. Proper preparation is critical for maintaining the integrity of the vaccine, using an aseptic
technique, and following infection prevention guidelines when preparing vaccines. Prepare
vaccines in a clean and away from any potentially contaminated items.
e. Always check the expiration dates, date and time opened, and vaccine vial monitor (VVM)
on the vaccine and diluent, if needed.
Vaccine vial monitor (VVM)

A vaccine vial monitor (VVM) is a label containing a heat-sensitive material that is
placed on a vaccine vial to register cumulative heat exposure over time. The combined effects of
time and temperature cause the inner square of the VVM to darken gradually and irreversibly.
The rate of color change increases with temperature.
The point to focus on is the color of the inner square relative to the color of the outer circle:
1) Rule 1: If the inner square is lighter than the outer circle, the vaccine can be used (provided
that the expiry date has not passed). 2) Rule 2: If the inner square is the same color or darker
than the outer circle, the vaccine must not be used.
Expiry date
- If the date (day) of the expiration were mentioned in the vial, do NOT use the vaccine
on the day after the day mentioned
- If the expiration date only contains the month of expiration, use through the last day
of the month. Do NOT use the vaccine on the first day of the new month

Recommendations for using the Residual Vaccines
Residual vaccines in static services (Puskesmas, Hospitals or private practice) can be used on
the next day's service. Some of the requirements that must be met are:
1. Stored at a temperature of 2°C s.d. 8°C
2. VVM in state A or B
3. Have not expired
4. Have not submerged in water during storage
5. Have not exceeded the usage period.

Table of vaccine usage period
Types of Vaccine Usage Period Notes

Polio 2 weeks
IPV 4 weeks Please write down when was the
DT 4 weeks first time that the vaccine being
Td 4 weeks used
DPT-HepB-HiB 4 weeks
BCG 3 hours Please write down when was the
time that the vaccine being diluted
Measles 6 hours
with the solvent
f. Administer the vaccine

Each vaccine has a recommended administration route and site. Deviation from the
recommended route may reduce vaccine efficacy or increase local adverse reactions.
Multiple injections/co-administration of vaccine is possible. If multiple vaccines are
administered at a single visit, administer each injection at a different site.
Routes of Administration :

g. Documentation of vaccination is important, always provide personal vaccine records and
inform the next vaccination types and dates for parents /patients. To ensure that the
permanent medical record and/or MCH Handbook of the recipient indicates:
 Date of administration
 Vaccine manufacturer
 Vaccine lot/batch number
 Name, title, a signature of the person who administered the vaccine, and address of the
facility where the permanent record will reside
h. Monitoring the adverse event following immunization (AEFI) for local and systemic
manifestations. Most AEFI is a mild symptom and resolves after 2-3 days. The severe AEFI
are emergency conditions but extremely rare, requiring rapid assessment and management.
Investigation and reporting of AEFI should be carried out to ensure vaccine safety in the
community

VACCINATIONS (ADULTS)
A. CASE ILLUSTRATION
B. OBJECTIVEA 66 year-old man came to your practice for consultation, he is a

businessman who frequently travels abroad. After hearing the
Adults Vaccination Objective
information and on the recommendation of his friends, the patient asked
1. Students arethe
about able to take a proper
vaccinations history
he should before he
get because vaccinating to abroad.
often travels assess indications,
In
the near future
contraindications, andthe patient
safety plans to
aspects oftravel to Johannesburg
vaccine for business
administration.
purposes.
2. Students arethe
From able to provide
anamnesis good
it was education
found that theand motivation
patient was fullybefore vaccinating
immunized.
3. Theare
Students patient’s
able tolastcarry
vaccination were yellow
out vaccination fever andproperly.
procedures pneumococcal at the
age of 59 years, influenza and meningitis 10 months ago. The history od
4. Studentsthe
aredisease
able tosounderstand and overcome Post-Immunization Adverse Events.
far is diabetes mellitus but the patient’s sugar level is
5. Students are able to perform vaccination in Adults
controlled.
C. CONTENTS
Immunization and vaccination are often considered as the same thing and are often
used interchangeably. Technically, immunization is induction in order to form an immunity
either actively or passively. While vaccination shows the act of giving a vaccine. Therefore,
vaccination is not necessarily an act of immunization and immunization may also not
involve vaccines.
Provision of vaccinations pays attention to several important things known as the
abbreviation HALO (Health Age Lifestyle Occupation). Health, is paying attention to the
health condition of the patient to be vaccinated. Are there certain chronic diseases that
underlie certain vaccinations, such as pneumonia and influenza vaccines for asthmatics, or
on the contrary, are there health conditions that are considered when giving vaccines, such
as immunodeficiency conditions in patients with HIV infection or patients receiving
chemotherapy. Age, at a certain age there is an increase in comorbidities for being infected
with certain diseases so that the type of vaccination to be given can be considered. For
example, at the age of teenagers who are vulnerable to the risk of being infected with HPV
or

the geriatric age who is susceptible to the occurrence of lung infections. Lifestyle, lifestyle
affects the determination of the type of vaccination to be given. For those who like to travel,
vaccinations to prevent diseases that are endemic in the destination country are
recommended to be given in addition to basic vaccinations. Occupation, certain types of
work have a higher risk of being infected with diseases that can be prevented by vaccination.
For example, health workers in hospitals should receive vaccinations that can prevent them
from being infected with hospital germs.
Each vaccination must comply with the correct procedures, including the following
procedures:
1. Vaccine preparation
In addition to paying attention to the HALO principle, in giving vaccines, the
concept of "Rights of Medication Administration" must be carried out before vaccination.
Those include :
a. Right patient
b. Correct vaccine and solvent
c. On time (including the right age, the right interval for administering the vaccine,
using the vaccine before the expiration date and time)
d. Right dose
e. Correct route of administration (including correct needle size, needle length, and
injection technique)
f. Correct injection location
g. Proper documentation ( Recording and medical record)
2. Injection technique
In general, the administration of vaccine injections begins with aseptic technique
and determines the location of the injection. In determining the injection site, care must
be taken that the injection site must be free from any injury. The depth of injection must
be precise because it will affect the immune response.
In adults, the injection is made into the patient's upper arm (deltoid). Vaccine injection is
done by intramuscular and subcutaneous routes. Vaccines containing adjuvants must be
injected into the muscle mass, otherwise it can cause Adverse Events after Immunization
at the injection site.

3. Recording
Before giving the vaccine, doctor must take a history and physical examination to
find out if there are contraindications to giving the vaccine, after that the doctor must
make sure the patient understands the benefits and risks of vaccination. All of these can
be listed on the vaccination consent form. Things that must also be included in the
vaccine approval form include: the identity of the vaccine recipient, medical history,
history of allergies, history of reactions to vaccines, history of drugs that affect immunity
and the condition of pregnancy or pregnancy planning.
After the vaccination is done, documentation of the action needs to be written in
the medical record and vaccination card. Data that needs to be recorded include: Identity
of the vaccine recipient, type of vaccine, method of administering the vaccine, dose of
vaccine, vaccine brand, vaccine lot number, date of administration of vaccine, date of
return if re-immunization is required and name and signature of the doctor who perform
vaccination.
4. Storage, transportation and disposal of vaccines

In general, vaccines are divided into two types, namely live attenuated and
inactivated. Most live attenuated vaccines are stored in the freezer (-15 C - -25 C), MMR
can be stored in the freezer or in the refrigerator. While the oral typhoid vaccines, LAIV,
YF and JE are stored in the refrigerator. Besides being sensitive to temperature changes,
some vaccines are also sensitive to light, including MMR, varicella, zoster, HPV, JE,
rabies and oral typhoid vaccines.
The use of Vaccine Vial Monitor (VVM) can help assess vaccine damage due to
heat. Some vaccines such as hepatitis B and Td vaccines cannot be stored at < 0 C,
monitoring can be done using a special tool, namely Freeze Tag, where if a temperature
change of < 0 C is indicated for 1 hour, a cross sign will appear on the display.
Mistakes that often occur when transporting vaccines are placing frozen ice packs
in the vaccine carrier which can cause damage to vaccines that are sensitive to low
temperatures. Another mistake is not to provide a separator between the vaccine and the
ice pack which causes direct contact.
Post-vaccination waste management also requires attention, medical waste must
be collected and disposed according to applicable protocols. Needles and syringes are
also disposed in a special safety box to avoid needle stick injury. Expired vaccines must
be collected, made a report and destroyed, to avoid environmental pollution and
irresponsible use.

5. Monitoring of Adverse Events after Vaccination.
Adverse events after immunization both local and systemic can occur. Most are
mild and go away on their own. Severe and unpredictable reactions are possible but are
extremely rare. Observation and reporting of adverse events after immunization should be
carried out to ensure vaccine safety in the community

FEEDBACK FORM FOR IMMUNIZATION (ADULT)
INTRAMUSCULAR INJECTION
Name : …………………………………….………………….
Student No. : …………………………………….………………….
No. Aspects Feedback
1. Greeting and self-introduction

2. Explaining the examination procedures, including the
objectives and expected result. Asking the patient to void if
necessary
3. Asking for patient’s consent
4. Standing on the right side of patient, facing the lateral side
5. Check and prepare tools for vaccination
6. Check vaccine condition (type, route of administration, expire
date)
7. Wash hand and wear gloves
8. Take new 23G or 25G needle
9. Expel the remaining air in the needle by pushing the plunger
10. Take the vaccine vial and apply an alcohol swab on the
surface of the vial
11. Perform aspiration of vaccines according to the required
dose/volume
12. Expel air from the syringe
13. Determine the place to be injected:
- Deltoid, or
- Vastus lateralis, or
- The upper quadrant of the gluteus muscle
14. Clean the injection area with an alcohol swab. Starting from
the center to the periphery. Wait until the alcohol dries
15. The thumb and forefinger of the free hand stretch the skin at
the injection site
16. Insert the needle at an angle of 900 quickly and straight into
the muscle
17. Inject vaccine
18. Withdraw the needle quickly and then press the injection site
with an alcohol swab
19. Remove the alcohol swab and see if there is bleeding at the
injection site
20. Allow patient to return to seat
21. Organize tools and dispose of consumable medical materials
in the medical waste bin
22. Take off gloves then wash your hands
23. Conclude the procedure result and give educati n
24. Write the injection procedure (name of the medication, dose,
route, time, and signature) in the patient’s medical
record/vaccine card

FEEDBACK FORM FOR IMMUNIZATION (ADULT)
SUBCUTAN INJECTION
Name : …………………………………….………………….
Student No. : …………………………………….………………….
No. Aspects Feedback
1 Greeting and self-introduction

2 Explaining the examination procedures, including the
objectives and expected result. Asking the patient to void if
necessary
3 Asking for patient’s consent
4 Standing on the right side of patient, facing the lateral side
5 Check and prepare tools for vaccination
6 Check vaccine condition (type, route of administration, expire
date)
7 Wash hand and wear gloves
8 Take new 23G or 25G needle
9 Wash your hand, dry it and wear the gloves aseptically
10 Expel the remaining air in the needle by pushing the plunger
11 Take the vaccine vial and apply an alcohol swab on the
surface of the vial
12 Perform aspiration of vaccines according to the required
dose/volume
13 Determine the site to be injected: arm or upper thigh
14 Clean the injection area with an alcohol swab. Starting from
the center to the periphery. Wait until the alcohol dries.
15 The thumb and forefinger of the free hand pinch the skin
around the injection site
16 Insert the needle at a 450 angle position quickly and straightly.
17 Inject vaccine
18 Withdraw the needle quickly and then press the injection site
with an alcohol swab
19 Remove the alcohol swab and see if there is bleeding at the
injection site
20 Allow patient to return to seat
21 Organize tools and dispose of consumable medical materials
in the medical waste bin
22 Take off gloves then wash your hands
23 Conclude the procedure result
24 Write the injection procedure (name of the medication, dose,
route, time, and signature) in the patient’s medical record

GLOBAL RATING SCALE FOR PROFESSIONAL BEHAVIOR
No. Skills Scientific basis and explanation Scale
1 2 3 4 5
1. Demonstrate Dealing with one-self:
confidence during (student able to behave professionally
performing skills in without showing his/her anxiety, sadness and
front of patient worries)
2. Ethics (Respect the Dealing with others:

patient, (student able to behave professionally
demonstrate local without showing his/her assumptions about
values and norms) patient)
GLOBAL RATING SCALE FOR DOCTOR-PATIENT INTERACTION

No. Skills Scientific basis and explanation Scale
1 2 3 4 5
1. Building and Ability to build a good relationship
maintaining (through active listening, response
adequate properly, empathy, interpersonal
relationship with communication and putting patient
patients during the at ease)
whole consultation
2. Exploration on Ability to explore patient’s problem
patient problem and summarize it (through
and summarize the exploration, data gathering, history
problem taking, allo-anamnesis, checking and
summarization)
Explanation:

REFERENCES
Ikhwan Rinaldi, dkk, 2017, Panduan Teknik Pemeriksaan dan Prosedur Klinis Ilmu Penyakit
Dalam.
General Best Practice Guidelines for Immunization: Best Practices Guidance of the Advisory
Committee on Immunization Practices (ACIP)
“Vaccine Administration” chapter, Epidemiology and Prevention of Vaccine-Preventable

Diseases (the Pink Book), Centre for disease control and prevention

BASIC CLINICAL COMPETENCE TRAINING MATERIAL BOOK
INTEGRATED PATIENT MANAGEMENT

BLOCK I.9

SKILLS LABORATORY
YOGYAKARTA
2023

BLOCK I.9
CONTRIBUTOR:
dr. Santosa Budiharjo, M.Kes, PA (K)
Department of Anatomy, Embryology, and Anthropology
dr. Prattama Santoso Utomo, MHPEd

Department of Medical Education
dr. Hikmawati Nurokhmanti, MSc

Department of Medical Education
CO-CONTRIBUTORS:
Desinta Mindaryanti, Amd. Kep
Assistant of Second Year Coordinator for Skills Laboratory
EDUCATIONAL DESIGN REVIEWED BY

Second Year Coordinator for Skills Laboratory

TABLE OF CONTENTS
Lesson plan
Introduction
Skills Acquisition
Integrated skills and Integrated patient Management (IPM)
The clinical competences deliver in IPM
Encounter to standardize patient
Scenarios of IPM

LESSON PLAN
Three Session of IPM
Each session : 100 minutes
1. Opening & introducing the procedure of simple IPM, borrow equipment, doctor room
setting, standardize patient confirmation, organize student as the doctor (15 minutes)
2. Demonstration integrated skills : IPM 1st session : Obsgyn Case – ANC, Baby Delivery,
Pap’s Smear (one case @ 15 minutes)
3. Feedback from peer and instructor
4. Demonstration integrated skills : IPM 2nd session : Injection, immunization, pediatric
examination (one case @ 15 minutes)
6. Demonstration integrated skills : IPM 3rd session : BLS, EKG, Lymphatic and Anemia
Examination (one case @ 15 minutes)
8. Reflection and closing (10 minutes)

BLOCK I.9
INTRODUCTION
In the basic clinical competence block, students learn clinical competence in a simulated setting
in the Skills Laboratory. The skills training includes character education and professional
behaviour awareness, and reinforcement of clinical knowledge and clinical reasoning in
performing clinical skills. Students are expected to acquire essential skills needed for clinical
practice in Phase 4 (Clinical Rotation).
Clinical skills Acquisition (mastering or be skills-full)
On Bloom theory of psychomotor acquisition, there are four stage that show in this figure below.
Learning delivery Principle on Basic Clinical Competence Training (BCCT)
The learning principles pay attention to the SPICES (Students centred, Problem based
learning, Community based, Early exposure, and Structured). The principles to achieve a skills,
attitude, and psychomotor level. Cases are contained in the 2012 SKDI. Learning skills is
prioritized on simple skills followed by complex skills, from fragmented skill to integrated skills,
various skills will be taught continuously throughout the education period (longitudinal), there is
repetition (repetition) and spiral pattern (accumulative) so that at the end of the learning becomes
comprehensive.
Integrated Skills and Patient Management in BCCT
Our program on integrated skills has goals, such as to retrain learned skills, Train a
comprehensive doctor-patient relationship and service pattern, especially in training there is a
Simulation Patient (PS) or standardize patient, assemble the clinical skills 'puzzle' that has been
learned, move-on from imitation to manipulation next to precision and achieve an articulation

stage of Bloom. Realistic and contextual more interesting and applicable. Practice skills within
the time limit (OSCE preparation) (see the diagram below). In the phase 1 of our curriculum, the
integrated skills are called simple integrated patient management due to not involving, diagnose,
pharmacotherapy and non-pharmacotherapy, that those will be delivered comprehensively in
phase 2 and phase 3, so it called integrated patient management.
Topic Tree of BCC based on themes and the curriculum map
The Basic Clinical Competence themes represent the topics of skills delivered throughout Stage
1 to Stage 3, as described in the topic tree below.
Basic Clinical Competences
Communication
General Physical Examination
Specific Physical
Skills Examination
Mental
Skills
ExaminationSupportive
Skills Examination
Procedural
Skills and Therapeutics Skills
Skills
Prescription and Medical Record (medicolegal skills), Writing

Prescription,
Integrated Patient Management, Telemedicine and Clinical Reasoning

Skills
CURRICULUM MAP UNDERGRADUATE MEDICINE

THE COVERAGE COMPETENCES IN SIMPLE INTEGRATED SKILLS: SIMPLE
INTEGRATED PATIENTS’ MANAGEMENT IN SKILLS LAB
In general, medical doctors should have 3 area of competencies, such as (see the picture below)
1. Knowledge: natural history of diseases (pathognomonic sign symptoms, diagnosis,

treatment, education)
2. Skills, particularly Clinical Skills
3. Attitudes/Professionalism
The clinical competences of this BCCT simple integrated patient management, are:
1. Communication and simple education skills, that divided into two areas, firstly the
communication skills, secondly the information will gather and the message will be delivered
in simple education. Such as:
 Develop interpersonal relationship (greeting, introducing, taking identity)
 Gather information about the patient problems (chief complaints, Recent history: Onset,
Location, Duration, Character, aggravating / aggravating factors, Time, and Severity,
treatment, History, family history, Lifestyle) and specific information related the gender, live
cycle (infant, childhood, adolescent, adulthood, old age), organ problem (skin, heart, eye,
ENT, musculoskeletal, etc.), and mental problem.

The medical doctor competencies area.
 Making summary of patient problems and Explain to the patient about the examination.
 Ask for permission for the examination.
 Reporting the result completely, using daily language.
 Deliver simple education to patients regarding their complaints and CERDIK (acronym
from cek Kesehatan, enyahkan rokok, rajin olahraga, diet seimbang, istirahat cukup dan
Kelola stress: health checks, get rid of cigarettes, exercise diligently, have a healthy and
balanced diet, get enough rest and manage stress).
2. Professionnalisme
The medical profesionalism are natural involved in doctor patient interaction, such as :
 Patient safety by washing hands before and after examination.
 Demonstrate professionalism as a healthcare professional:

Perform each action carefully and thoroughly so as not to endanger the patient and
yourself, paying attention to patient comfort, acting according to priorities,
show respect for the patient, know the limitations by referring or consulting when
necessary).
3. Compétences of define general condition by inspection, and or vital signs examination, and or
specific physical examination such as examinations of eye, ENT, and thyroid gland
examination
4. Self awarness, receiving feedback and reflection.

The students will be recieved feedback from standardised patient, peer students and from
instructor. But the important one, before receiving feedback, just after closing doctor patient
interaction, the doctor should be given time to express emotion or say statement of his her
experience when facing the standardise patient.
5. Doctor patient interaction proceses are as a kind of art chorographe.

Art of doctor patient interaction dépends on case or patient problems, medical ethics,
profesionalism and the strategy of clinical reasoning to solve the patient problems and
expectation. In general the patient has expectaion in about their worries, and complaints are as
soon as handled by the doctor, in the other hand the doctor want to as soon as possible to find
the clinical diagnose, after short anamnèses, relevant physical examination, and further
investigation. In phase 1, BCCT session of simple integrated patient management.
6. Clinical reasoning making correct diagnosis, and threatment

Diagnosis is a crucial process that : (1) labels and classifies the patient’s illnesses, (2)
identifies the likely prognosis, and (3) propels us toward specific treatment.
Clinical Diagnostic Strategies

There are four strategies for Clinical Diagnosis :
1. Jot down diagnosis by pattern recognition
Pattern recognition means the instantaneous realization that patient’s
presentation conforms to a previously learned picture of disease. Pattern
recognition can occur by odour (diabetic acidosis, liver failure, etc), hearing (patient
with cleft palate), sight (parkinsonism, psoriasis) and touch (ganglion on the back
hand, stony hard cancer of the breast or prostate). Pattern recognition is reflexive,
not reflective, and its use increases with experience, therefore it is used by seasoned
clinicians. Pattern recognition is only a start to the diagnostic process and is results
in several possible diagnoses, rather than a definite single one.

2. Multiple branching or arborisation strategy using “algorithms”
Multiple branching strategy is the progression of the diagnostic process down
through a large number of potential, pre-set paths by a method in which the response
to each diagnostic inquiry to be carried out and, ultimately, the correct diagnosis.
This strategy is mainly used when diagnosis is delegated from those who have
traditionally performed it (e.g., physician) to those who traditionally have not (e,g,.
nurses)
3. Doing a complete physical examination and taking a complete history
The strategy is also called Strategy of exhaustion. The strategy of exhaustion is a
two stages process : (1) collect all the data that is possibly pertinent, and then
proceed to the second stage which is searching through the data for the diagnosis.
So, create the data bank first, and then pose the diagnostic question. The strategy of
exhaustion is the method of novice, and is often abandoned with experience. This
exhaustive testing doesn’t produce any improvement in mortality, morbidity,
duration of monitoring, disability, medical opinion of patients’ progress, or length of
stay. However, it increases the total cost of caring for the patients by about 5%, and
also reduces the patients’ satisfaction with the treatment process
4. Hypothetico- deductive strategy
This method is used by virtually all clinicians, virtually all the time. It is the
formulation, from the earliest clues about the patient, of a short list of potential
diagnoses or actions, followed by the performance of clinical (history and physical)
and paraclinical (eg laboratory test, Xray) manoeuvres that will best reduce the
length of the list. For example, if clinical hears about a 56 year old man with chest
pain and shortness of breath, they might immediately call out a diagnosis of
“myocardial infarction” “pulmonary embolism” or “pneumothorax”. At the same
time as generating a list of hypotheses, the clinicians would take the history and
perform a physical examination that would help them shorten the list, keeping their
working hypotheses at any one time about three, and directing their history taking
and physical examination to these hypotheses.
The hypothetico-deductive model is the most appropriate current description of the
diagnostic process, and is used by both seasoned clinicians and earliest trainees.
Two elements are important in improving our diagnostic skills : (1) A mastery of the
dynamic models of structure, function and response to stimuli, that comprise the
importance of basic sciences, acquisition, and interpretation of clinical and
paraclinical data that will shorten the list of hypotheses.

In summary, the diagnostic approach can be described as one or a combination of four
types :
1. Pattern recognition approach of the seasoned clinicians
2. Multiple branching method of the delegate
3. Exhaustion methods of the novice
4. Hypothetico-deductive approach which is the most widely used strategy.
7. Writing the data of patient in medical record form

While taking anamnesis, doctor should write briefly the result, and after physical examination
should write the findings, continued to write the diagnoses, and differential diagnosis,
treatment: prescription and education. Below is the form of medical record.

This is a simple example for clinical reasoning (Bickley, 2003)
CLINICAL REASONING
Steps on identifying problems and making diagnosis
1. Identifying abnormal findings
Make a list of patient’s symptoms and signs that you get from anamnesis and physical examination
2. Localize findings anatomically
Think about organs in that area that can be caused that sign or symptom
3. Interpret findings in terms of probable process
Think about pathologic process (pathophysiologic and psychopathologic).

There are numbers of pathologic process : congenital, inflammation, infection, etc
4. Make hypotheses about the nature of patient problems
Here you will draw on all the knowledge and experience you can muster, and it is here that reading will be
most helpful in learning about patterns of abnormalities and disease; and clustering your patient’s findings
accordingly
Use systematic thinking on making hypothesis
The following steps should help :

Select the most specific and critical findings to support your hypothesis Match your
findings against all the conditions that you know that can produce them
Eliminate the diagnostic possibilities that fail to explain the findings Weigh
the competing possibilities and select the most likely diagnosis
Give special attention to potentially life threatening and treatable conditions
5. Test the hypotheses
Clarify with further history taking, additional maneuvers on physical examination, and laboratory studies. X-
rays, etc
6. Establish a working diagnosis
Make this at a highest level of explicitness and certainly that the data allow
7. Develop a plan agreeable to the patient
Identify and record a plan for each patient problem until further medication. Here your assessment and clinical
thinking with the patient and seek out his or her opinions. Consider about their concern and willingness to
proceed any further testing or evaluation
8. Make a plan for the next meeting

PRACTICING INTEGRATED PATIENT MANAGEMENT USING
STANDARDIZED PATIENTS.
ENCOUNTER TO STANDARDIZE PATIENT
Like colours on an artist’s palette, clinical data lacks form and meaning. The clinician must
not only gather data through interviewing and examinations; but he or she must also analyse it,
identify the patient’s problems, evaluate the patient’s responses to the illness, and together with
the patient, formulate care plans.
Since the assessment takes place in the clinician’s mind, its processes often seem
inaccessible, even mysterious, to beginning students. Experienced clinicians, moreover, think so
quickly, with little overt or conscious effort, that they sometimes have difficulty in explaining
their own logic. They also think in different ways, with different, individualistic personal styles.
The thinking process starts at the beginning of your patient encounter, not at the end, but assume
for the moment that you already have a database to consider.
The goal of this chapter in the manual is to help students understand clinical thinking and
apply it effectively and efficiently in the management of patients.
In this block, you have learned about holistic patient management. The encounter with a
patient is started by building an interpersonal relationship (greeting, introducing self/role, non-
verbal attitude). As a clinician, we should always remember that our patients are human beings,
with their own ideas, opinions, expectations, fears, hopes, and so on. Showing empathy to the
patient by listening and responding properly is treating the patient with humanity.
After building an interpersonal relationship with the patient, a doctor can start the interview
by asking RELEVANT information about the patient’s identity and the purpose of the patient's
visit. During history taking (anamnesis), we should use logical thinking based on clinical
reasoning. Ask RELEVANT questions only. Every question has its own meaning for diagnosis
making and the next step in managing the patient. Physical examination must be performed with
the correct procedure (lege artis) and based on clinical reasoning.
How can we obtain the case history? You should consider CLINICAL REASONING AND
EVIDENT-BASED DATA. You also have to translate “illness data” from the patient into
“disease data” which is more objective, so you can decide the diagnosis and management of that
patient.
The next step is producing hypotheses or a diagnosis, which must also be based on logical
clinical reasoning. Deciding therapy or other medical procedures should include the patient’s
participation and must be logical and reasonable. Negotiation with the patient increases the

patient’s compliance. The doctor should also give adequate explanations or education to the
patient, relating to his/her condition. Don’t forget to record your interview result (findings,
diagnosis, treatment, and other important things) on the medical record sheet. During the patient
encounter, you should always show professional behaviour and self confidence to increase the
patient’s trust in you.
In order to give students an example of the clinical process of managing patients. Read
about the case and do the task (using hypothetico-deductive strategy).

Scenarios of IPM Block I.9
First Session
Kasus 1
SKENARIO KLINIK:
Seorang wanita G1P1A0 hamil 36 minggu umur 25 tahun, datang untuk melakukan pemeriksaan
antenatal rutin.
TUGAS :
1. Lakukan eksplorasi permasalahan pada pasien tersebut!
2. Tanyakan hasil pemeriksaan fisik umum yang diperlukan kepada penguji!
3. Lakukan pemeriksaan obstetrik!
4. Lakukan konseling sederhana agar kehamilan dan persalinan berjalan baik!
5. Catat informasi ke dalam rekam medis yang tersedia!
Kasus 2
SKENARIO KLINIK:
Seorang wanita 27 th G2P1A0 hamil 38 minggu. Pasien baru saja mengalami pecah ketuban dan
sekarang merasa ingin mengejan. Pada pemeriksaan diperoleh hasil pemeriksaan sebagai
berikut:
1. His: 4-5 kali dalam 10 menit kuat durasi 45-50 detik
2. Leopold: Janin tunggal, letak memanjang, presentasi kepala, punggung kiri, kepala masuk
panggul 4/5 bagian
3. Auskultasi: Denyut Jantung Janin (DJJ) 144 x/ menit/ teratur dengan punctum maksimum
disebelah kiri bawah pusat; intensitas kuat
4. Bimanual: Serviks tidak teraba, pembukaan lengkap, kepala turun di station +3, ubun-ubun
kecil di pukul 12, selaput ketuban pecah
TUGAS:
1. Lakukan tatalaksana non farmakoterapi untuk kasus ini sampai lahirnya plasenta!
2. Lakukan edukasi sederhana!
Kasus 3
SKENARIO KLINIK:
Seorang wanita P5A1 umur 55 tahun, datang ke klinik umum Anda dan meminta untuk
dilakukan pemeriksaan Pap smear.
TUGAS :
1. Lakukan eksplorasi singkat!
2. Lakukan pemeriksaan Pap Smear pada manikin!
3. Berikan edukasi sederhana yang relevan kepada pasien!

Second Session
Kasus 1
SKENARIO KLINIK:
Seorang laki-laki umur 25 tahun datang ke poli RS meminta untuk dilakukan imunisasi. Pasien
sudah pernah mendapatkan imunisasi tersebut 1 tahun yang lalu. Kondisi umum dan tanda-tanda
vital pasien dalam batas normal.
TUGAS :
1. Lakukan eksplorasi permasalahan dan edukasi tindakan pada pasien tersebut!
2. Lakukan prosedur imunisasi!
3. Lakukan konseling terkait tindakan yang telah dilakukan dan rencana selanjutnya!
Kasus 2
SKENARIO KLINIK:
Seorang Ibu membawa bayi laki-lakinya yang berusia 9 bulan ke pusat kesehatan masyarakat
(puskesmas) untuk imunisasi. Riwayat persalinan dan kehamilan ibu, dan perawatan pasca lahir
baik. Keadaan umum bayi baik dan pemeriksaan fisik bayi dalam batas normal.
TUGAS :
1. Lakukan sambung rasa dan eksplorasi permasalahan pasien!
2. Lakukan persiapan dan tindakan imunisasi yang sesuai secara lege artis!
3. Lakukan edukasi: kepada orang tua, kapan anak harus datang dan imunisasi apa yang
diberikan selanjutnya ?
4. Lakukan pencatatan dalam buku KIA!
Kasus 3
SKENARIO KLINIK:
Seorang anak usia 2 tahun 3 bulan di bawa orang tuanya ke klinik karena anak susah makan.
Anak jarang menghabiskan porsi makanan yang diberikan di rumah dan lebih mudah
menghabiskan biscuit atau jajanan, sangat pemilih dalam menu makanan. Ibu telah berusaha
memberi anak susu pertumbuhan namun anak tidak mau minum susu. Anak sangat aktif, tidak
didapatkan keluhan lain. Riwayat perkembangan baik.
TUGAS :
1. Lakukan pemeriksaan tanda vital, pemeriksaan fisik umum pada anak tersebut!
2. Sampaikan simpulan hasil pemeriksaan fisik pada penguji!
3. Lakukan edukasi sederhana!

Third Session
Kasus 1
SKENARIO KLINIK:
Seorang pasien laki-laki 30 tahun datang ke Puskesmas dengan keluhan mudah lelah, letih, dan
lesu. Pasien juga mengeluhkan adanya benjolan yang muncul di lehernya beberapa hari yang lalu.
TUGAS :
1. Lakukan eksplorasi permasalahan pada pasien tersebut!
2. Lakukan pemeriksaan fisik anemia dan limfonodi!
3. Lakukan edukasi sederhana pada pasien!
4. Catat informasi ke dalam rekam medis yang tersedia!
Kasus 2
SKENARIO KLINIK:
Seorang pria berusia 55 tahun jatuh dan tidak sadarkan diri di ruang tunggu rumah sakit saat
akan berobat.
TUGAS:
1. Lakukan bantuan hidup dasar dan pemasangan EKG!

WORK PLAN for IPM Session
Full fill the table below, and bring when you attend the BCCT session of IPM
First Session of IPM
Topik Level Anamnesis Pemeriksaan Edukasi
Keterampilan kompetensi (informasi, sign fisik Sederhana
SKDI and symptom Pathognomonic
pathognomonis)
ANC
Pap’s Smear
Topik Keterampilan Level Langkah-langkah Edukasi Sederhana

kompetensi Tatalaksana
SKDI
Baby Delivery
Second Session of IPM

pathognomonis)
Pediatric
Examination
Lymphatic &
anemia
Examination

SKDI
Immunization
Injection
Third Session of IPM

pathognomonis)
Lymphatic &
anemia
Examination

SKDI
BLS
EKG

Student’s Book
Block I.9
Research and Basic Medical
Practice
Second Edition
SCHOOL OF MEDICINE
Faculty of Medicine, Public Health, and Nursing
Yogyakarta
2023
Student’s Book Block I.9 |

136 | Faculty of Medicine, Public, Health and
Block I.9 Research and Basic Medical Practice
Student’s Book
Arranged by Block Manager Team of Block I.9, Contributor Team of Block I.9, Circular Redesign Facilitators.
© Undergraduate Program in Medicine,
Faculty of Medicine, Public Health, and Nursing Universitas Gadjah Mada
Published by Undergraduate Program in Medicine

Faculty of Medicine, Public Health, and Nursing Universitas Gadjah Mada
Jl. Farmako, Sekip Utara, Yogyakarta, 55281
All rights reserved.
Second edition, November 2023
This publication is protected by Copyright law and permission should be obtained from the publisher prior to any
prohibited reproduction, storage in a retrieval system, or transmission in any form by any means, electronic,
mechanical, photocopying, and recording or likewise.
Skills Lab Material Book Block I.9 |

Block I.9 Research and Basic Medical Practice
Block Contributors Team
1. Dr. dr. Osman Sianipar, DMM., M.Sc., Sp.PK-K.
2. Prof. Dr. Dra. Erna Kristin, M.Si., Apt.
3. Prof. dr. Jarir At Thobari, D.Pharm., Ph.D.
4. Prof. Tri Wibawa, Sp.MK.
5. Prof. dr. Adi Utarini, M.Sc., MPH., Ph.D.
6. Dr. dr. Hanevi Djasri, MARS., FISQua.
7. dr. Fatwa Sari Tetra Dewi, MPH., Ph.D.
8. Prof. dr. E. Elsa Herdiana Murhandarwati, M.Kes., Ph.D.
9. Luthfi Azizatunnisa', S.Ked., MPH.
10. dr. Amirah Ellyza Wahdi, MSPH
11. dr. Idha Arfianti Wira Agni, M.Sc., Sp.F.
12. Prof. Dr. dr. Eti Nurwening Sholikhah, M.Med.Ed, M.Kes.
13. Dr. dr. Guardian Yoki Sanjaya, MHlthInfo.
14. dr. Wika Hartanti, MIH.
Block Manager Team

1. Prof. dr. Gunadi, PhD., Sp.BA., Subsp. D.A. (K)
2. Anis Fuad, S.Ked, DEA.
3. dr. Ratih Yuniartha, Ph.D.
4. dr. Tri Ratnaningsih, M.Kes., Sp.PK(K).
Phase Coordinator Team

1. dr. Rachmadya Nur Hidayah, M.Sc., Ph.D.
2. Dr. dr. Setyo Purwono, M.Kes., Sp.PD.
Curricular Redesign Facilitators Team

1. dr. Widya Wasityastuti, M.Sc., M.Med.Ed., Ph.D.
2. dr. Rachmadya Nur Hidayah, M.Sc., Ph.D.
Secretariat
1. Nur Azizah Kirana Tidar, S.Gz
2. Ary Purwanti, S.Kep, Ns

Curriculum Map
CURRICULUM MAP OF UNDERGRADUATE MEDICINE 2020
FACULTY OF MEDICINE, PUBLIC HEALTH AND NURSING UGM
Phase 4: Clinical Rotation
SEMESTER 11
Clerkship in Clinical Departments
Phase 4: Clinical Rotation

SEMESTER 9 SEMESTER 10
Clerkship in Clinical Departments
Phase 3: Enhancing Personal Competences Phase 4: Clinical Rotation

III. Elective Blocks/Modules* (18 weeks), model examples:
3 weeks 3 weeks 3 weeks 3 weeks 3 weeks 3 weeks
6 weeks 3 weeks 3 weeks 6 weeks Clerkship in Clinical Departments
9 weeks 6 weeks 3 weeks
18 weeks
Phase 2: Complaints and Diseases

II.8 II.10
II.4 II.5 II.6 II.7 Trauma, II.9 Anxiety, II.11
Diarrhea, Vomitting and Oedema, Urinary and Dyspnea, Cough and Tumor, Pruritus Movement Reproductive Depression and Health System and
and Discharge Problems and Problems Behavioural
Jaundice Metabolic Disorders Cyanosis Hemorrhage Problems Disaster Management
(5 weeks) (5 weeks) (5 weeks) (2,5 weeks) (2,5 weeks) (2,5 weeks) (2,5 weeks) (5 weeks)
Longitudinal: CFHC-IPE; Learning Skills; Bioethics & Medico-legal; Health Prevention & Promotion; EBM, CA and Skripsi ; Longitudinal: CFHC-IPE; Learning Skills; Bioethics & Medico-legal; Health Prevention & Promotion; EBM, CA and Skripsi ;
Clinical Skills; MKWK (Citizenship) Clinical Skills; MKWK (Religious Studies/Agama)
Phase 1: Foundation in Medicine and Transition to Practice Phase 2: Complaints and Diseases
I.7 I.9 II.3
I.8 II.2 II.2
Hematology and Research and Basic Seizure, Unconsciousness,
Life Cycle Fever Pain and Sense Organ Problems
Immune System Medical Practice
(5 weeks) (5 weeks) (5 weeks) (5 weeks) (5 weeks) (5 weeks)
Clinical Skills; MKWK (Digital Transformation) Clinical Skills; MKWK (Pancasila)
Phase 1: Foundation in Medicine and Transition to Practice

I.2 I.4 I.5 I.6
I.1 I.3
Cardiorespiratory Genitourinary and Nervous System and Sense Organ and
Musculoskeletal System Digestive System
System Reproduction System Behaviour Endocrine System
(5 weeks) (5 weeks) (5 weeks) (5 weeks) (5 weeks) (5 weeks)
Clinical Skills Clinical Skills; MKWK (Bahasa Indonesia)
Block Phase 1 * Refer to explanation of Elective Block in the report for detailed information
Block Phase 2
Inter-block recess
Legend:
Longitudinal Blocks
Phase 3
Phase 4

PREFACE
Welcome to Block I.9 with the theme Research and Basic Medical Practice. This block introduces health
and medical science research and how to plan and conduct, and the basic knowledge and skills of being a
medical doctor in different practice settings with an understanding of the quality of care, patient safety,
and standard of care.
The core principle of practicing as a medical doctor is a professionalism in providing care to patients,
families, and the community. This block also provides students with knowledge and skills on basic
principles of Evidence-Based Medicine, how to use the current best available evidence for clinical
decision making and how to keep up to date with recent and valid evidence.
This block provides learning activities such as lectures, integrated lectures, panel discussions, tutorials,
and practical sessions. This block also provides additional learning experiences through field visits
exploring different practice settings (health centers and hospitals) for the purpose of gaining a
comprehensive understanding of practicing as a medical doctor. This block will be completed in five
weeks, consisting of 5 learning modules and three scenarios.
After completing Block I.9, we hope all students will be able to achieve the competencies required in this
block.

Table of Content
Block I.9 Research and Basic Medical Practice.............................................................................138
Curriculum Map..........................................................................................................................139
PREFACE.....................................................................................................................................140
Table of Content.........................................................................................................................141
Block Learning Objectives...........................................................................................................143
Mapping of Block Learning Outcomes I.9 Research and Basic Medical Practice to
Graduate Learning Outcomes...........................................................................................144
Block Graduate Learning Outcome..............................................................................................146
Blok Description.................................................................................................................148
Block Longitudinal.............................................................................................................148
Learning Activities.............................................................................................................149
Block Total Learning Activities and Hours...................................................................152
Longitudinal Block Total Learning Activities and Hours............................................152
Block Assessment Systems..............................................................................................153
Longitudinal Block Activities............................................................................................154
Topic Tree...........................................................................................................................156
Module 1: Introduction of Health and Medical Science Research.................................157
Learning Objectives.....................................................................................................................157
Module Learning Objectives and Activities Mapping of Module 1............................................157
Blueprint of Module 1.................................................................................................................158
Blueprint of Longitudinal Block Activities in Module 1............................................................160
Topic & Activities Description....................................................................................................161
Unit Activity Table......................................................................................................................167
Module 2: Application of Research Method.....................................................................168
Module 3: Clinical Epidemiology and Evidence-Based Medicine..................................181
Scenario 1....................................................................................................................................182

Module 4: Quality of Care..................................................................................................192
Module Learning Objectives to Activities Mapping of Module 4..............................................192
Scenario 2....................................................................................................................................193
Module 5: Patient Safety and Standard of Care...............................................................202
Module Learning Objectives to Activities Mapping of Unit 5....................................................202
Scenario 3....................................................................................................................................203

Block Learning Objectives
After completing this block, students should be able to:
1. Develop research proposal

a. Understand the foundation of scientific research.
b. Develop research proposal.
c. Select types of research that is in accordance to relevant health issues.
d. Understand the use of statistical methods in making scientific decisions.
e. Understand the ethics of conducting research.
f. Develop a research proposal.
g. Present a research proposal.
2. Understand the scientific basic of medical knowledge and technology development.
3. Understand health issues and means of handling them, and therefore they may enrich their own
knowledge and support their career development in accordance with their own skill and interest.
4. Understand the profession of medical doctors in clinical practice
a. Explain the principles of patient safety
b. Explain the standard of care and clinical practice guidelines
c. Understand clinical competences
d. Understand quality of care
e. Perform and appraise basic patient examination
f. Understand code of ethics, laws, and regulatory aspects of patient care
g. Understand the professional behaviour
h. Understand scientific inquiry
i. Understand the principles of evidence-based medicine
j. Perform critical appraisal on diagnosis, therapy, and harm
5. Understand the concept of family and community as part of medical practice
a. Identify patient, family, and community factors affecting care seeking behavior
b. Understand social determinants
c. Understand principles of epidemiology.
6. Understand the systems affecting medical practice settings
a. Understand the principles of family medicine approach
b. Understand working and learning in a multiprofessional team
c. Understand continuity of care
d. Perform and analyse patient records
e. Understand referral system
f. Understand quality improvement
g. Understand the components of health care system.

Mapping of Block Learning Outcomes I.9 Research and Basic Medical Practice to
Graduate Learning Outcomes

BLOCK I.9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
1. Develop research proposal. X X X
a. Understand the foundation of scientific research. X X X
b. Explain various types of research in the field of medicine and health. X X X
c. Select types of research that is in accordance to relevant health X X X

issues.
d. Understand the use of statistical methods in making scientific decisions. X X X X
e. Understand the ethics of conducting research. X X X X

f. Develop a research proposal. X X X X X
g. Present a research proposal. X X X X X X
2. Understand the scientific basic of medical knowledge and technology X X X X X X X
development.
3. Understand health issues and means of handling them, and therefore they X X X X X X X X X X
may enrich their own knowledge and support their career development in
accordance with their own skill and interest.
4. Understand the profession of medical doctors in clinical practice X X X X X X X X X X X
a. Explain the principles of patient safety X X X X X X X X X X X X
b. Explain the standard of care and clinical practice guidelines X X X X X X X X X X X X X X
c. Understand clinical competence X X X X X X X X X X X X X X X X
d. Understand quality of care X X X X X X X X X X X X X X X X
e. Perform and appraise basic patient examination X X X X X X X X X X X
f. Understand code of ethics, laws and regulatory aspects of X X X X X X X X
patient care
g. Understand the professional behaviour X X X X X X X X X X X X X X X X
h. Understand scientific inquiry X X X X X X X X X X X X X X X
i. Understand the principles of evidence-based medicine X X X X X X
j. Perform critical appraisal on diagnosis, therapy and harm X X X X X X X X X X X
5. Understand the concept of family and community as part of medical X X X X X X X X X X X X X X X X
practice
a. Identify patient, family and community factors affecting care seeking X X X X X X X X X X X X X X X X
behavior

BLOCK I.9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
b. Understand social determinants X X X X X X X X X
c. Understand principles of epidemiology X X X X X X
6. Understand the systems affecting medical practice settings X X X X X X X X X X X X X X X X
a. Understand the principles of family medicine approach X X X X X X X X X X X X X X X X
b. Understand working and learning in a multiprofessional team X X X X X X X X X X X X X
c. Understand continuity of care X X X X X X X X X X X X X X X X
d. Perform and analyse patient records X X X X
e. Understand referral system X X X X X X X X X X X X X X X X
f. Understand quality improvement X X X X
g. Understand the components of health care system X X X X X X X X X X X X X X X X

Block Graduate Learning Outcome
1. Professional
Conduct medical practice based on values and principles of divinity, virtue, ethics,
discipline, legal, and sociocultural in the local, regional, and global contexts.
2. Self-Awareness
Continuously develop themselves while aware of their limitations for the sake of patient
safety.
3. Scientific
Utilise scientific medical concepts, theories, procedures, and clinical practice, develop
questions and draw conclusions based on scientific evidence for decision-making on
medical and health phenomena, promote change towards medical and health
phenomena through individual, family and community-based interventions for human
welfare and scientific development.
4. Managerial Capability
Utilise and manage assets, resources, and health finance systems to provide effective,
efficient, and sustainable health services based on applicable regulation.
5. Sociocultural Competent
Appreciate differences in cultural, religion and social groups in managing health
problems.
6. Creative and Innovative
Use, share, evaluate, discover, and produce scientific ideas and products based on
current evidence.
7. Digital Information-Technology Competence
Utilise and pursue progression of information-technology, conduct innovations based on
technology and sciences to resolve health problems.
8. Managing Health Problems
Manage and resolve individual, family and community health problems thoroughly and
sustainably in the context of comprehensive health service.
9. Clinical Skills Capability
Perform effective and safe clinical skills and procedures based on available standards.
10. Communicative
Collect, receive, and exchange verbal and non-verbal information and showing empathy
to patients from all age-groups, family members, community, and colleagues, in various
local, national, and international cultures.
11. Collaborative
Cooperate and collaborate with medical colleagues, other health professions and other
professions in managing health problems effectively based on appropriate values, ethics,
roles, and responsibility.

12. Patient Safety and Quality of Care
Apply principles of patient safety and improve quality of healthcare in individual, family,
and community levels.
13. Leadership Capability
Lead and manage healthcare services at individual, family, and community levels.
14. Disaster Management
Play roles in disaster management, prevention, and mitigation, including natural
disasters, human-made disasters and outbreaks based on medical authority and
competency.
15. Research Capability
Develop scientific research questions, plan, and conduct research, and report research
results based on scientific and research ethics principles.
16. Humanist
Build relationships and rapport in interaction with communities based on local culture
and manners to perform health assessment and promotion, disease prevention,
management of health problems, design plan of actions, and community empowerment.

Blok Description
This block consists of 5 learning modules, those are:

1. Introduction of Health and Medical Science Research
2. Application of Research Method
3. Clinical Epidemiology & Evidence Based Medicine
4. Quality of Care
5. Patient Safety and Standard of Care
Block Research and Basic Medical Practice run for five weeks along with longitudinal blocks
side-by-side.
Block Longitudinal
Meanwhile longitudinal blocks which run alongside this block are:

1. Basic Clinical Skills Block (6 topics)
2. Bioethics and Medicolegal Block (3 topics)
3. Evidence Basic Medicine, Critical Appraisal & Thesis Block (12 topics)
4. Health Promotion and Disease Prevention Block (2 topics)
5. Leadership Block (1 topic)

Learning Activities
Topics in this block use following learning methods.
1. Lecture
Lectures have long been used in health professional education. The classic form of lectures in
large classes is no longer considered an option, as the lectures with a student- centered approach
prioritize interaction in order for the learning process to be more constructive. At the moment,
presenters/lecturers would deliver lecture materials using presentation slides or other materials
and the lecture method can be delivered face-to- face or online. Online lectures can be done
synchronously by using online lecture applications (Webex, Zoom, Google Classroom, and so
on), or asynchronously by providing lecture recordings. One lecture topic is equivalent to 1 x 50
minutes per activity.
2. Integrated Lecture
Integrated lecture is a large class learning method in which the lecturers from one department
who provide lecture materials are affiliated together in an integrated manner. Integrated lectures
are suitable for providing material or topics that can be discussed from a multi-departmental point
of view so that integration between branches of knowledge can be done clearer and students will
get a multi-perspective material. Ideally, teaching materials in the form of lecture slides will have
been combined beforehand so that the presenters could present their presentations alternately
according to their fields/expertise. Integrated lectures are not followed by structured self-study,
but tutors can provide materials for unstructured self-study.
To facilitate the process of coordinating the preparation of integrated lecture materials, TMB will
assign one of the facilitators as the PIC for the implementation. The PIC will then coordinate with
other lecturers in determining the flow, the distribution of integrated lecture materials, and the
distribution of the number of questions that must be prepared by each teacher with the assistance
of the Implementation Team (Sekretariat Pelaksana). One integrated lecture topic is equivalent to
2 x 50 minutes per activity.
3. Blended Learning
Blended learning (flipped class) is a modification of lecture or practical with pre-session
assignments and learning resources (such as articles, videos, and others) to enhance student
understanding of the learning resources. In the lecture or practical sessions, students can discuss
complex concepts or complete the independent learning resources. This method can be
accompanied by several expert lectures, practical sessions, or other learning activities.

4. Panel Discussion
A panel discussion is a large class learning method in which more than one panellist would
discuss a relatively complex concept or case. The use of cases, scenarios, small discussions, pre-
session assignments, and other triggers can be carried out according to the learning objectives and
panel discussions to increase students' understanding of the case or phenomenon being studied.
The panellists can identify discussion points to study prior to the panel discussion. Panel
discussions can be preceded by structured self-study in accordance with applicable regulations.
To facilitate the process of coordinating the preparation of the panel discussion material, TMB
will assign a Person in Charge (PIC) for the implementation of the panel discussion session. The
PIC will then coordinate with all panellists in designing the flow, distributing panel discussion
materials, and distributing the number of questions that must be prepared by each panellist
assisted by the Planning Team (Sekretariat Perencana) and Implementing Team (Sekretariat
Pelaksana). One panel discussion topic is equivalent to 2x50 minutes per activity.
5. Small Group Discussion

Small group learning is usually carried out with less than 20 students, ideally less than 12 people.
Small group learning is also often called a tutorial (please note that it may not always be
considered a tutorial which uses the seven jumps method). Small group discussions always
begin with a trigger for discussion in the form of a case or scenario. Small group learning can be
done face to face or asynchronously online. The selection of small group learning methods can be
adjusted to the level of competence of the expected learning objectives of each learning
module/material. One small group discussion topic is equivalent to 2x50 minutes per activity.
6. Practical session
Practical is a practical learning activity which has purpose for supporting achievement of block
learning objectives. Practical is directed as part of blended learning. Practical can be run for
several topics. Practical is run for 2x50 minutes for each session.
7. Field Visit
Field visits are learning activities outside the classroom/ campus meaning to support the
achievement of block learning objectives. Field visits provide opportunities for students to see
real-world examples of the implementation of learning that has been done in the community,
health facilities, or other organizations. Field visits can be designed using an experience-based
learning approach as a bridge between theory and real practice. The implementation of field visits
must comply with the applicable safety rules and permits. Field visits must also be equipped with
clear learning objectives and required facilitators

who can facilitate the achievement of these learning objectives. One field visit topic is equivalent
to 1 activity consisting of 2 hours of field visit activities (2x50 minutes) and 1 hour of
unstructured preparation (1x50 minutes). Field visits to the general block contribute to the
cumulative exam and semester block exams, while field visits to the longitudinal block can
contribute to the summative assessment of the longitudinal block by the applicable assessment
provisions.
8. Basic Clinical Competence (BCC)

Basic clinical competence (BCC) is a learning method for clinical skill acquisition in line of
purpose and expected competence level. Medical skills learning encompass communication,
physical examination, procedure, clinical reasoning, prescription, integrated patient management
and other related skills. BCC in general applies simulation- based learning with mannequin, standard
patient or real-life cases. BCC is designed to support theoretical learning and its application in
clinical situation. Skill hardness and complexity are adjusted with student learning stage. This
activity is directed as part of blended learning. BCC is held for several topics. This activity is run
for 2x50 minutes for each session.
9. Case Study
A case study is an instructional method that assigns scenarios based on situations in which
students identify or observe, discuss, analyze, conclude, summarize, and recommend concepts or
theories related to the scenario. The case offers details of problems and contexts to stimulate
analysis from a variety of viewpoints. Case studies can be either single or multiple-case designs.
Students are expected to actively analyze cases and solve problems by collaborating with their
groups.
10. Independent learning/ self-study

As an adult learner, student need time to have independent learning as part of learning purpose
achievement method. Independent learning can be related as preparation or continuation of other
learning activities. Independent learning accommodate student for achieving learning objectives
with partial or without full facilitation from lecturer. Structured independent learning can be done
with assignment to student. Assignment can be done as student read article, book or summary,
watch video, finish a game or quiz, compose a short summary and many others. Assignment must
be directed to block learning objectives or activity learning objectives. Instruction for student is a
must as student must learn as directed, with learning resources or link to access the learning
resources. Structured independent learning is equal to 2x50 minutes for each session.
This block has 3 semester credit units which run for 5 weeks alongside with other related
longitudinal blocks.

Block Total Learning Activities and Hours
Total Activities Total Allocated Time (hours)
1 2 3 4 5 1 2 3 4 5
Expert Lecture 10 8 8 3 4 10 8 8 3 4
Integrated Lecture - - - - 1 - - - - 2
Flipped Class - 1 - - 1 - 1 - - 1
Panel Discussion - - - - 1 - - - - 2
Practical Session - 1 - 1 1 - 2 - 2 2
Small Group - - - -
1 1 1 4 4 4
Discussion
Field Visit - - - 1 1 - - - 3 3
Independent - - - - - - - - - -
Learning/
Self-Study
10 10 9 6 10 10 11 12 12 18
Total 45 63
Longitudinal Block Total Learning Activities and Hours

Total Activities Total Allocated Time (hours)
1 2 3 4 5 1 2 3 4 5
Expert Lecture 1 2 1 2
Integrated Lecture 1 2 2 4
Practical Session 1 3 3 2 2 2 6 6 4 4
BCCT/ Skills Lab 1 1 1 1 1 2 2 2 2 2
Case Study 1 2
4 4 4 6 5 7 8 8 10 10
Total 23 43

Block Assessment Systems
This block assessed in both formative and summative formats. Formative assessment included quiz,
assignment, and others. Summative assessment included final block exam, objective structured clinical
examination and other. Each learning objective is contributed to assessment as the component in
formative and summative assessments.
Further explanation can be seen on assessment regulation from assessment team.
Examination Percentage (%)

Cumulative 1 17,12
Cumulative 2 49,55
Semester 33,33
100

Longitudinal Block Activities
Week 1 Week 2 Week 3 Week 4 Week 5
Basic Clinical Competences
 Integrated Briefing Block I.9 (Integrated  Pap's smear and Integrated Skills Integrated Skills Integrated Skills Session & Patient
Lecture) visual inspection Session & Patient Session & Patient Medical Record 3(BCC)
 Dressing, Bandaging, and Splinting (BCC) using acetic acid Medical Record Medical Record 2
 Developing Personal Formulary (BCC) (BCC) 1 (BCC) (BCC)
 Immunization
(BCC)
Bioethics and Medicolegal
 Ethics in emergency and
disaster (Expert Lecture)
 Medical
Disciplinary/Professionalism
Misconduct and Its
Institutional Approach
(MKDKI) (Expert Lecture)
 Critical thinking on KODEKI
and medical professionalism
practice in Indonesian context
(Case Study)
Evidence Basic Medicine – Critical Appraisal and Thesis*

Practical Work – Research Methodology 1:  Practical Work –  Practical Work –  Practical Work  Practical Work – Evidence
Research Question, Conceptual Framework, and Research Biostatistics: – Evidence- Based Medicine: Critical
Hypothesis (Practical Session) Methodology 2: Correlation and Based Appraisal on Therapy
Research Design, Regression Medicine: (Practical Session)
Population & (Practical Session) Critical  Practical Work – Research
Sample Size  Practical Work – Appraisal on Methodology 5: Writing and
(Practical Evidence Based Diagnosis Presenting (Practical
Session) Medicine: Advance (Practical Session)
 Practical Work – Searching and Session)
Biostatistics: Critical Appraisal  Practical Work
Hypothetical test (Practical Session) – Research
for continues  Practical Work – Methodology
variable (Practical Research 4: Data
Session) Methodology 3: Management

Week 1 Week 2 Week 3 Week 4 Week 5
 Practical Work – Variable and and Analysis
Biostatistics: Measurement (Practical
Hypothetical test (Practical Session) Session)
for categorical
variable (Practical
Session)
Health Promotion and Disease Prevention

 Basic evidence
and best
practices in
order to enhance
the quality of
care, as well as
patient and
program safety
in preventive
and promotion
medicine
(Expert
Lecture)
 Exposure and
prevention in
healthcare
setting
(Integrated
Lecture)
Leadership
Developing emotional intelligent (Expert Lecture)
Note:
* The topics from this longitudinal block are integrated with the current block and contribute to the block learning objectives
but do not contribute to the block assessment.

Topic Tree
Continuation topics will be delivered in Evidence-Based Medicine – Critical Appraisal and Thesis
(EBM-CAS) longitudinal block.

Module 1: Introduction of Health and Medical Research
Learning Objectives
By the end of this learning unit, students should be able to:

1. Understand the importance of in health and medical research
2. Understand the step of research methodology: from research question to data analysis
3. Practice how to design health and medical research
4. Explain the underlying paradigm and the use of qualitative research design
5. Describe the research design in public health
Module Learning Objectives and Activities Mapping of Module 1
Learning Objectives
Learning Topics
1 2 3 4 5
Overview of Block Research & BMP X
General Introduction of Research Design X X X
Research Question, Conceptual Framework, and
X X
Hypothesis
Type and Design of Basic Medical Research X X
Research Design: Observational Studies
X X
(Descriptive and Cross-Sectional)
Research Design: Observational Studies (Case- X X
Control and Cohort)
Research Design: Experimental (RCT) X X
Research Design: Experimental (Quasi) X X
Qualitative Research Methods X
Research in Public Health X
Longitudinal
Practical Work – Research Methodology 1:
Research Question, Conceptual Framework, and X X
Hypothesis
Developing emotional intelligent
Integrated Briefing Block I.9 (all topics)
Immunization

Blueprint of Module 1
Module Learning Methods Assessments

Learning Responsible
Learning Duration
Activities Staff(s) Method(s) In-block Final
Objectives (hours)
1 Overview of Team Managers Expert 1 - -
Block BMP & Block Lecture
Research
1, 2, 3 General Clinical Expert 1 Cumulative Semester

Introduction of Epidemiology and Lecture Examination Examination
Research Biostatistics Unit /
Design Dept. of Clinical
Pathology and
Laboratory
Medicine
2, 3 Research Clinical Expert 1 Cumulative Semester

Question, Epidemiology and Lecture Examination Examination
Conceptual Biostatistics Unit /
Framework and Dept. of
Hypothesis Pharmacology and
Therapy
2, 3 Type and Design Expert 1 Cumulative Semester

Dept. of Histology
of Basic Medical Lecture Examination Examination
and Biology Cell
Research

Design: Epidemiology and Lecture Examination Examination
Observational Biostatistics Unit /
Studies Dept. of Clinical
(Descriptive Pathology and
and Cross Laboratory
Sectional) Medicine

Observational Biostatistics Unit /
Studies (Case Dept. of
Control and Pharmacology and
Cohort) Therapy

Experimental Biostatistics Unit /
(RCT) Dept. of
Pharmacology and
Therapy

Experimental Biostatistics Unit /
(Quasi) Dept. of
Pharmacology and
Therapy
4 Qualitative Dept. of Health Expert 1 Cumulative Semester

Research Policy and Lecture Examination Examination
Methods Management

Learning Duration
Activities Staff(s) Method(s) (hours) In-block Final
Objectives
5 Research in Dept. of Expert 1 Cumulative Semester
Public Health Biostatistics, Lecture Examination Examination
Epidemiology and
Population Health
Total Allocated Time (hours) 10

Total Learning Activities 10

Blueprint of Longitudinal Block Activities in Module 1
Activity Learning Methods Assessments

Objectives Duration
(hour)
To develop skills Practical a. TMB Practical 2 Assignment
on how to write Work – Longitudinal Session
the outline for Research – Evidence
study proposal, Methodology Based
starting from 1: Research Medicine,
how to formulate Question, Critical
a research Conceptual Appraisal, and
question until Framework, Thesis
planning for data and b. Clinical
analysis Hypothesis Epidemiology
and
Biostatistics
Unit
To understand Integrated a. TMB Integrated 2 - -
the knowledge Briefing Longitudinal – Seminar
of basic facts Block I.9 (all Basic Clinical
(know) and topics) Competences
application b. Dept. of
(know-how) of Surgery
related clinical c. Dept. of
skills before Dermatology
skill and
demonstration Venereology
during practical d. Dept. of
sessions or Internal
hands-on Medicine
sessions of e. Dept. of
Basic Clinical Paediatrics
Skills f. Dept. of
Competences Obstetrics
Block. and
Gynecology
g. Dept. of
Pharmacology
and Therapy
Able to apply Immunization a. TMB BCC 2 Portfolio, a. Mini-
clinical reasoning Longitudinal – google OSCE
when managing a Basic Clinical form b. OSCE 1
patient during Competences questions
immunizations b. Dept. of Child
Health
c. Dept. of
Internal
Medicine
a. To describe Developing a. TMB Expert 1 - Block

the meaning Emotional Longitudinal – Lecture Examination
of emotional Intelligent Leadership
intelligence b. Dept. of Medical
b. To describe Education and
the role of Bioethics
emotional c. Dept. of Health
intelligence Policy &
in a group Management
dynamic


Topic & Activities Description
1. Title : Overview of Block Research & Basic Medical Practice

Activity To describe the learning outcomes, activities, and assessment of Block
:
Objectives Research and Basic Medical Practice
Responsible
: Block Managers Team & EBM-CAS Longitudinal Team
Staff(s)
Method(s) : Expert Lecture (1 hour)
a. Overview learning outcomes, activities, and assessment in Blok
Research & Basic Medical Practice
Content(s) :
b. Continuation of research contents and activities in EBM-CAS
Longitudinal Block
Prerequisite : -
Continuation : -
Reference(s) : -
Assessment : -
2. Title : General Introduction of Research Design

a. To describe the importance of research in health and medical
Activity science
:
Objectives b. To understand the step of research methodology: from research
question until data analysis
Responsible Clinical Epidemiology and Biostatistics Unit / Dept. of Clinical Pathology and
:
Staff(s) Laboratory Medicine
a. Concept of research design and importance of appropriate design,
Introduction to quantitative study (observational and experimental study)
Content(s) : b. Introduction to qualitative study
c. The use of research design
a. Booth WC, Colomb GG, and Williams JM. 2008. The craft of Research.
Third Edition. USA: University of Chicago Press.
Reference(s) :
b. Day RA and Gastel B. 2006. How to Write and Publish a Scientific
Paper. Sixth Edition. London: Greenwood Press
a. Cumulative Examination
Assessment : b. Semester Examination
3. Title : Research Question, Conceptual Framework, and Hypothesis

Activity To practice how to formulate: research question, conceptual framework, and
:
Objectives hypothesis
Responsible Clinical Epidemiology and Biostatistics Unit / Dept. of Pharmacology and
:
Staff(s) Therapy
The importance of research in health and medical sciences, including how to
Content(s) : formulate proper research question, conceptual framework, and
hypothesis.
a. Creswell JW. 2003. Research Design Qualitative, Quantitative and Mixed
Method Approaches. London: Sage Publication. London: Wiley & Sons.
Reference(s) : b. Machin D, Day S, and Green S. 2006. Textbook of Clinical Trials.
Second Edition.
4. Title : Type and Design of Basic Medical Research

Activity To practice how to design basic medical research and experimental
:
Objectives research in laboratory setting
Responsible Dept. of Histology
:
Staff(s)

The importance of animal model and cell culture in
Content(s) :
basic medical research.
Paper. Sixth Edition. London: Greenwood Press.
c. Fletcher RH, Fletcher SW and Wagner EH. 1996. Clinical Epidemiology
the Essentials. Third Edition. Baltimore: William & Wilkins.
d. Hall GM (editor). 2003. How to Write a Paper. Third Edition. London:
BMJ Publishing Group.
e. Hulley SB, et al. (editors). 2006. Designing Clinical Research - an
Epidemiological Approach. Third Edition. Philadelphia: Williams &
Wilkins.
f. Hulley SB, et al. 2007. Designing Clinical Research. Philadelphia:
Reference(s) : William & Wilkins.
g. Newman and Kohn. 2009. Evidence Based Diagnosis. New York:
Cambridge University.
h. Rothman KJ, et al. 2009. Modern Epidemiology. Philadelphia: William
& Wilkins.
i. Turabian KL. 2007. A Manual for Writers of Research Papers, Thesis and
Dissertations. Seventh Edition. London: The University of Chicago Press.
j. Varkevisser CM, Pathmanathan I and Brownlee A. 2003. Designing and
conducting Health system research projects. Volume 1: Proposal
development and Fieldwork. The Netherlands: KIT Publishers,
International Development Research Centre and WHO
Regional Office for Africa.
Assessment :
b. Semester Examination
Research Design: Observational Studies (Descriptive and Cross

5. Title : Sectional)
Activity To practice how to design descriptive and cross sectional, conduct data
:
Objectives analyses and interpret the finding
Responsible Clinical Epidemiology and Biostatistics Unit / Dept. of Clinical Pathology
:
Staff(s) and Laboratory Medicine
Definition, purpose, method, limitation and strength of descriptive and
Content(s) : cross-sectional study
Wilkins.
Reference(s) : f. Hulley SB, et al. 2007. Designing Clinical Research. Philadelphia:
William & Wilkins.
& Wilkins.
i. Turabian KL. 2007. A Manual for Writers of Research Papers, Thesis
and Dissertations. Seventh Edition. London: The University of Chicago
Press.
development and Fieldwork. The Netherlands: KIT

Publishers, International Development Research Centre and WHO Regional
Office for Africa.
6. Title : Research Design: Observational Studies (Case Control and Cohort)

Activity To practice how to design a case control and cohort study, conduct data
:
Objectives analyses, and interpret the finding
:
Staff(s) Therapy
Definition, purpose, method, limitation and strength of case control and
Content(s) : cohort
e. Hulley SB, et al. (editors). 2006. Designing Clinical Research-an
Wilkins.
William & Wilkins.
Reference(s) : g. Newman and Kohn. 2009. Evidence Based Diagnosis. New York:
& Wilkins.
i. Turabian KL. 2007. A Manual for Writers of Research Papers, Theses
Press.
International Development Research Centre and WHO Regional
Office for Africa.
7. Title : Research Design: Experimental (RCT)

Activity To practice how to design a randomized controlled trial, conduct data
:
Objectives analysis, and interpret the finding
:
Staff(s) Therapy
Definition, purpose, method, limitation and strength of randomized
Content(s) : control trial
Reference(s) : c. Fletcher RH, Fletcher SW and Wagner EH. 1996. Clinical Epidemiology

Wilkins.
William & Wilkins.
& Wilkins.
Press.
8. Title : Research Design: Experimental (Quasi)

Activity To practice how to design a quasi-experimental, conduct data analysis,
:
Objectives and interpret the finding
:
Staff(s) Therapy
Content(s) : Definition, purpose, method, limitation and strength of quasi experimental
Wilkins.
& Wilkins.
Press.
9. Title : Qualitative Research Methods

Activity To explain the underlying paradigm of qualitative research design and
:
Objectives the use of qualitative research design
Responsible Dept. of Health Policy and Management
:
Staff(s)

a. Paradigm underlying qualitative research and design of qualitative
research
b. Application of qualitative research
Content(s) :
c. The use of qualitative research in public health research to enhance
understanding of community needs, implementation and evaluation
of public health used and clinical practice
b. Machin D, Day S, and Green S. 2006. Textbook of Clinical Trials.
Second Edition.
c. Milles MB and Huberman AM.1992. Analisis Data Qualitatif
(Terjemahan Tjetjep Rohendi-Rohidi). Jakarta: Penerbit Universitas
Indonesia.
Reference(s) :
d. Oppenheim AN. 1992. Questionnaire Design, Interviewing and Attitude
Measurement. London: Pinter Publisher.
e. Rice PL and Ezzy D. 2002. Qualitative Research Methods. A Health
Focus. Victoria: Oxford University Press.
f. Fletcher RH, Fletcher SW, Wagner EH. 1996. Clinical Epidemiology
– The Essentials. Third ed. Baltimore: Williams & Wilkins.
10. Title : Research in Public Health

Activity To describe the importance and design research in public health
:
Objectives
:
Staff(s)
a. The importance of public health study concerned with the on the
influence of the determinants of health which determine population
health.
Content(s) : b. Interventions aiming to improve population health, prevent disease, and
compensate for disabilities and loss of independence.
c. Innovations in terms of the organization of health services, social services
and medical/social services.
Second Edition.
c. Milles MB and Huberman AM.1992. Analisis Data Kualitatif
Indonesia.
Reference(s) :
Assessment :
Longitudinal
Practical Work – Research Methodology 1: Research Question,
1. Title : Conceptual Framework, and Hypothesis
Activity To develop skill on how to write the outline for study proposal, starting
:
Objectives from how to formulate a research question until planning for data analysis
a. TMB Longitudinal – Evidence Based Medicine, Critical Appraisal, and
Responsible
: Thesis
Staff(s)
b. Clinical Epidemiology and Biostatistics Unit
Method(s) : Practical Session (2 hours)

Content(s) : Research Question, Conceptual Framework, and Hypothesis
Wilkins.
& Wilkins.
Press.
Assessment : Assignment
2. Title : Integrated Briefing Block I.9 (all topics)

To understand the knowledge of basic facts (know) and application (know-
how) of related clinical skills before skill demonstration during practical
sessions or hands-on sessions of Basic Clinical Skills Competences Block.
a. Immunization
Activity
: b. Dressing, Bandaging, and Splinting
Objectives
c. Developing Personal Formulary
d. Pap’s Smear and Visual Inspection using Acetic Acid
e. Integrated Skills Session and Patient Medical Record.
a. TMB Longitudinal – Basic Clinical Competences

b. Dept. of Surgery
c. Dept. of Dermatology and Venereology
Responsible
: d. Dept. of Internal Medicine
Staff(s)
e. Dept. of Paediatrics
f. Dept. of Obstetrics and Gynecology
g. Dept. of Pharmacology and Therapy
Method(s) : Integrated Seminar (2 hours)
Basic facts and application of these clinical skills
Detailed descriptions are available on each topic.
a. Immunization
Content(s) : b. Dressing, Bandaging, and Splinting
c. Developing Personal Formulary
d. Pap’s Smear and Visual Inspection using Acetic Acid
e. Integrated Skills Session and Patient Medical Record
3. Title : Immunization
Activity Able to apply clinical reasoning when managing a patient during
:
Objectives immunizations
a. TMB Longitudinal – Basic Clinical Competences
Responsible
: b. Dept. of Child Health
Staff(s)
c. Dept. of Internal Medicine
Method(s) : BCCT (2 hours)

Synchronous Practical / Supervised Training Session / Hands-on &
Feedback
a. Immunization in pediatrics
Content(s) : b. Immunization in adult and geriatrics patient
a. Pediatric Physical Examination
Prerequisite : b. Injection skills
c. Integrated skills
Continuation : Integrated Patient Management topics
Reference(s) : Appropriate references based on related module
a. Portfolio, google form questions
Assessment : b. Mini-OSCE
c. OSCE 1
4. Title : Developing emotional intelligent

Activity a. To describe the meaning of emotional intelligence
:
Objectives b. To describe the role of emotional intelligence in a group dynamic
a. TMB Longitudinal – Leadership
Responsible
: b. Dept. of Medical Education and Bioethics
Staff(s) c. Dept. of Health Policy & Management
a. Emotional intelligence
Content(s) : b. Emotional intelligence in leading a small team
a. Leadership sessions
Prerequisite : b. Teamwork sessions
Topics related to Contextual Leadership in Block II.11 Health System and
Continuation :
Disaster Management
Assessment : Block Examination
Unit Activity Table
Longitudinal
Block Total Longitudinal
Block Total Block Total
Allocated Block Total
Activities Allocated
Time Activities
Time
Integrated Lecture - - 1 2
Flipped Class - - - -
Panel Discussion - - - -
Practical Session - - 1 2
BCCT/Skills Lab - - 1 2
Small Group Discussion - - - -
Case Study - - - -
Field Study - - - -
Independent Learning/Self - - - -
Study
Total 10 10 4 7

Module 2: Research Methodology
Learning Objectives
By the end of this learning module, students should be able to:

1. Know how to choose and apply analysis for different types of data and hypothesis
2. Describe research on diagnosis and prognosis (including how to design, conduct data analysis
and interpret the finding)
3. Demonstrate how to develop quantitative and qualitative instruments
4. Describe various sampling strategies and data collection methods in qualitative research
5. Understand the strategies to improve the trustworthiness of qualitative data
6. Describe the analysis of qualitative data
7. Build the skill on how to conduct a hypothesis test for continuous variables and how to
interpret the result
8. Give an outline on how to calculate sample size
9. Develop skills on how to write the outline for a study proposal, started from how to
formulate a research question until planning for data analysis
10. Practice how to interpret the research finding
11. Practice how to conduct data analysis
Learning Objectives
Learning Activities 1 2 3 4 5 6 7 8 9 10 11
Data Analysis Strategy X X X
Correlation and Regression Analysis X X X
Research on Diagnostic Test X
Research on Prognosis X
Development of Instrument X
Qualitative Data Collection X X
Qualitative Data Analysis X X
Sample Size X
Hypothesis Test for Continuous
Scale
X X X
Hypothesis Test for Nominal and
Ordinal Scale
X X
Longitudinal
Practical Work – Biostatistics:
Hypothetical Test for Continues X X
Variable
Hypothetical Test for Categorical X X
Variable
Practical Work – Research
Methodology 2: Research Design, X
Population & Sample Size
Dressing, Bandaging, and Splinting


Learning Duration
Objectives (hours)
1, 10, 11 Data Analysis Clinical Expert 1 Cumulative Semester
Strategy Epidemiology Lecture Examination Examination
and Biostatistics
Unit
1, 10, 11 Correlation Clinical Expert 1 Cumulative Semester

and Epidemiology Lecture Examination Examination
Regression and Biostatistics
Unit
Analysis
2 Research on Clinical Expert 1 Cumulative Semester
Diagnostic Epidemiology Lecture Examination Examination
Test and Biostatistics
Unit / Dept. of
Clinical
Pathology and
Laboratory
Medicine

Prognosis Epidemiology Lecture Examination Examination
and Biostatistics
Unit
3 Development Dept. of Health Expert 1 Cumulative Semester

of Instrument Behavior, Lecture Examination Examination
Environmental
and Social
Medicine
4, 5 Qualitative Dept. of Health Practical 2 Cumulative Semester

Data Behavior, Session Examination Examination
Collection Environmental
and Social
Medicine
6, 11 Qualitative Dept. of Health Flipped 1 Cumulative Semester
Data Analysis Policy and Class Examination Examination
Management (Lecture
+…)
8 Sample Size Clinical Expert 1 Cumulative Semester

Epidemiology Lecture Examination Examination
and Biostatistics
Unit / Dept. of
Pharmacology
and Therapy
7, 9, 11 Hypothesis Clinical Expert 1 Cumulative Semester

Test for Epidemiology Lecture Examination Examination
Continuous and Biostatistics
Scale Unit
9, 11 Hypothesis Clinical Expert 1 Cumulative Semester

Test for Epidemiology Lecture Examination Examination
Nominal and and Biostatistics
Ordinal Scale Unit

Learning Duration
Objectives (hours)

Learning Methods Assessments

Activity Learning Responsible
Duration
Objectives Activities Staff(s) Method(s) In-block Final
(hours)
To build the skill Practical a. TMB Practical 2
on how to conduct Work – Longitudinal – Session
hypothesis test for Biostatistics: Evidence
continuous Hypothetical Based
variable and how Test for Medicine,
to interpretate the Continues Critical
result Variable Appraisal, and
Thesis
b. Dept. of
Biostatistics,
Epidemiology,
and Public
Health
To build the skill Practical a. TMB Practical 2

on how to conduct Work – Longitudinal – Session
hypothesis test for Biostatistics: Evidence
categorical Hypothetical Based
variable and how Test for Medicine,
to interpretate the Categorical Critical
result Variable Appraisal, and
Thesis
b. Dept. of
Biostatistics,
Epidemiology,
and Public
Health
To develop skills Practical a. TMB Practical 2 Assignment

on how to write Work - Longitudinal – Session
the outline for Research Evidence
study proposal, Methodology Based
starting from how 2: Research Medicine,
to formulate Design, Critical
research question Population & Appraisal, and
until planning for Sample Size Thesis
data analysis b. Clinical
Epidemiology
and
Biostatistics
Unit

Learning Methods Assessments
Duration
(hours)
a. To explain Dressing, a. TMB BCC 2 Portfolio, a. Mini-
dressing Bandaging, Longitudinal – google OSCE
definition, and Basic Clinical form b. OSCE
aims, Splinting Competences questions 1
applications, b. Dept. of
and Surgery
indications
b. To explain
bandaging
definition,
aims, type
and
applications.
c. To describe
wound and
body parts
d. To choose
appropriate
bandage from
available
bandage
e. To perform
appropriate
wound
cleaning,
bandaging
and post-
application
evaluation
f. To explain
splinting
definition,
aims,
applications
and
indications
g. To apply
padding,
manipulate
plaster, apply
splint moulding
and
immobilisation


1. Title : Data Analysis Strategy

Activity To illustrate how to choose and applied the analyses for different type of data
:
Objectives related to the hypothesis
Responsible Biostatistics, Epidemiology and Population Health
:
Staff(s)
Content(s) : How to analyse different type of data related to the hypothesis
a. Indriati E (editor). 2008. Etika Penelitian dan Publikasi
KedokteranKesehatan dan Modul Pelatihan WHO. Yogyakarta: FK
UGM.
Reference(s) :
b. Straus SE, Richardson WS, Glasziou P, Haynes RB. 2005.
EvidenceBased Medicine – How to Practice and Teach EBM. Third
Edition. Edinburgh: Elsevier Churchill Livingstone.
2 Title : Hypothesis Test for Continuous Scale

To discuss how to choose and applied hypothesis test for continuous
Activity data (for 1 population, 2 population, and more than 2 population) (for
:
Objectives
paired data or unpaired data), normal or not normal distribution
:
Staff(s)
Continuous data (for 1 population, 2 population, and more than 2
Content(s) : population) (for paired data or unpaired data) normal or not normal
distribution
Wilkins.
William & Wilkins.
Reference(s) : g. Newman and Kohn. 2009. Evidence Based Diagnosis. New York:
& Wilkins.
i. Turabian KL. 2007. A Manual for Writers of Research Papers, Thesis and
Dissertations. Seventh Edition. London: The University of Chicago Press.
Varkevisser CM, Pathmanathan I and Brownlee A. 2003. Designing and
conducting Health system research projects. Volume 1: Proposal development
and Fieldwork. The Netherlands: KIT Publishers, International Development
Research Centre and WHO Regional Office
for Africa.
a. Cumulative Examination Semester

Assessment : Examination
3. Title : Research on Diagnostic Test

Activity To describe research on diagnosis, how to design, conduct data analyses, and
:
Objectives interpret the finding

Responsible Clinical Epidemiology and Biostatistical Unit / Dept. of Clinical Pathology
:
Staff(s) and Laboratory Medicine
a. Explanation about research on diagnostic
Content(s) : b. How to calculate sample size on research diagnostic test
Second Edition.
Reference(s) :
Indonesia.
Assessment :
4. Title : Research on Prognosis

Activity To describe research on prognosis, how to design, conduct data
:
Objectives analyses and interpret the finding
Responsible Clinical Epidemiology and Biostatistical Unit
:
Staff(s)
Content(s) : Purpose and research method on prognosis
Second Edition. Milles MB and Huberman M.1992. Analisis Data
Qualitatif (Terjemahan Tjetjep Rohendi-Rohidi). Jakarta: Penerbit
Reference(s) : Universitas Indonesia.
c. Oppenheim AN. 1992. Questionnaire Design, Interviewing and Attitude
d. Rice PL and Ezzy D. 2002. Qualitative Research Methods. A Health
5. Title : Development of Instrument

Activity To demonstrate how to develop quantitative and qualitative instrument,
:
Objectives understand how to develop questionnaire
Responsible Dept. of Health Behavior, Environmental, and Social Medicine
:
Staff(s)
a. Steps to develop quantitative and qualitative instrument
Content(s) : b. How to achieve the quality of quantitative and qualitative data via
appropriate instrument
Second Edition.
Reference(s) :
Indonesia.

6. Title : Qualitative Data Collection

a. To describe various sampling strategy and data collection methods in
Activity qualitative research
:
Objectives b. To understand the strategies to improve trustworthiness of
qualitative data
Responsible Dept. of Health Behavior, Environmental and Social Medicine
:
Staff(s)
a. Ways to collect data in qualitative research that includes elaboration of
questionnaire, in depth interview and focus group discussion
Content(s) :
b. The main techniques in data collection methods and strategies to
improve trustworthiness
Second Edition.
Indonesia.
Reference(s) :
7. Title : Qualitative Data Analysis

Activity To describe the steps in the analysis of qualitative data
:
Objectives
:
Staff(s)
Flipped Class (1 hour)
Method(s) :
(Lecture)
The importance of field notes and transcripts produced during data
Content(s) : collection period, content analysis and steps in conducting the analysis,
findings from qualitative studies in health care
Second Edition.
Indonesia.
Reference(s) :
Assessment :

8. Title : Sample Size
Activity To give an outline on how to calculate sample size
:
Objectives
Clinical Epidemiology and Biostatistics Unit / Dept. of Pharmacology and
Responsible
: Therapy
Staff(s)
Content(s) : The important, related factors and how to calculated sample size
Second Edition.
Indonesia.
Reference(s) :
9 Title : Hypothesis Test for Nominal and Ordinal Scale

To discuss how to choose and applied hypothesis test for categorical data
Activity
: (for 1 population, 2 population, and more than 2 population) (for
Objectives
paired data or unpaired data), odds ratio, relative
:
Staff(s)
Categorical data (for 1 population, 2 population, and more than 2 population)
Content(s) : (for paired data or unpaired data) normal or not normal
distribution, odds ratio, relative
Reference(s) :
Assessment : Semester Examination
10. Title : Correlation and Regression Analysis

Activity To describe statistics analysis for correlation: linear, logistic regression,
:
Objectives and survival analysis
:
Staff(s)
a. Simple correlation and regression (for categorical and continuous scale)
b. Understand regression correlation from published data
c. Understand hazard ratio
Content(s) : d. Introduction logistic regression
e. Understand OR and RR adjusted
Understand the analysis from published data

Second Edition.
Reference(s) :
Indonesia.

j. Rice PL and Ezzy D. 2002. Qualitative Research Methods. A Health
Assessment :
Longitudinal
1. Title : Practical Work – Biostatistics: Hypothetical Test for Continuous Variable
Activity To build the skill on how to conduct hypothesis test for continuous
:
Objectives variable and how to interpretate the result
Responsible
: Thesis
Staff(s)
b. Dept. of Biostatistics, Epidemiology, and Public Health
Content(s) : Hypothetical test for continues variable
b. Creswell JW. 2003. Research Design Qualitative, Quantitative and Mixed
Method Approaches. London: Sage Publication. London: Wiley & Son.
Reference(s) :
c. Fletcher RH, Fletcher SW and Wagner EH. 1996. Clinical
Epidemiology the Essentials. Third Edition. Baltimore: William &
Wilkins.
a. Presence of practical session

Assessment :
b. Assignment
2. Title : Practical Work – Biostatistics: Hypothetical Test for Categorical Variable

Activity To build the skill on how to conduct hypothesis test for categorical
:
Objectives variable and how to interpretate the result
Responsible
: Thesis
Staff(s)
Content(s) : Hypothetical test for categorical variable
b. Creswell JW. 2003. Research Design Qualitative, Quantitative and Mixed
Method Approaches. London: Sage Publication. London: Wiley & Son.
Reference(s) :
a. Presence of practical session

Assessment : b. Assignment
3. Practical Work – Research Methodology 2: Research Design,

Title : Population, and Sample Size
:
Responsible
: Thesis
Staff(s)
Content(s) : Research Design and Population
a. Booth WC, Colomb GG, and Williams JM. 2008. The craft of
Research.Third Edition. USA: University of Chicago Press.
Reference(s) :

Wilkins.
William & Wilkins.
& Wilkins.
Press.
4. Title : Dressing, Bandaging, and Splinting

a. To explain dressing definition, aims, applications, and indications
b. To explain bandaging definition, aims, type and applications.
c. To describe wound and body parts
d. To choose appropriate bandage from available bandage
Activity
: e. To perform appropriate wound cleaning, bandaging and post-
Objectives
application evaluation
f. To explain splinting definition, aims, applications and indications
g. To apply padding, manipulate plaster, apply splint moulding and
immobilisation
Responsible a. TMB Longitudinal – Basic Clinical Competences
:
Staff(s) b. Dept. of Surgery
BCCT (2 hours)
Method(s) : Synchronous Practical / Supervised Training Session / Hands-on &
Feedback
a. Dressing: definition, goals, instruments, procedures, wound care,
indication, type of dressing
Content(s) : b. Perform Bandaging (definition, instruments, type of bandage, procedure
(principle).
c. Perform Splinting (definition, instruments, principles, procedure)
Prerequisite : Basic locomotor examination
Continuation : Integrated patient management in surgery patient
a. Anne, F; 1992; Orthophaedic Nursing; Bailliere Tindall; London.
b. Block, Bernard. 1978. Fracture & Dislocation (translation), T.M,
Simandjuntak, Sudjono Aswin, Prasetyo Hudaya & Hari Purnomo
(Translator & Editor) Y.E.M Yogyakarta.
c. Janice, R; 1997; Learning Units for Basic Nursing Skills; Lippincot - Raven
Publishers; Philadelphia.
d. Kartono, Mohammad. 1983. Pertolongan Pertama, Gramedia, Jakarta.
e. Oswari, E; 2000; Bedah dan Perawatannya; Balai Penerbit FK UI; Jakarta.
Reference(s) : f. Taylor; 1997; Fundamentals of Nursing; Lippincot Raven Publishers;
Philadelphia.
g. Anonim. 2006. Skills Lab Manual Block 3. Faculty of Medicine, GMU:
Yogyakarta
h. Preuss S. Breuing KH, Eriksson E. Plastic Surgery Techniques. In
[eds] Achauer BM et al. PLASTIC SURGERY – Indications,
Operations, and Outcomes. Mosby. 2000:147-162

i. Selvaraj Dhivya, Viswanadha Vijaya Padma, Elango Santhini, 2015,
Wound Dressings – A Review, Biomedicine (Taipei). 20105 Dec; 5(4): 22.
j. Boyd A, Benjamin H, Asplund C. Principles of Casting and Splinting. Am
Fam Physician. 2009 Jan 1;79(1):16–22.
k. Eiff MP, Hatch RL. Fracture Management for Primary Care.
Philadelphia, PA: Elsiver/Saunders, 2012.
l. Parsons, BO and Jeffries JT. Casting Techniques : Splint, Casts, and
Removal.

c. OSCE 1

Unit Activity Table
Total Longitudinal Longitudinal

Total
Allocated Block Total Block Total
Activities
Time Activities Allocated Time
Lecture 8 8 - -
Integrated Lecture - - - -
Flipped Class 1 1 - -
Seminar - - - -
Practical Session 1 2 3 6
Small Group Discussion - - - -
Assignments (structured) - - - -
Case Study - - - -
Field Study - - - -
Study
Total 10 11 4 8

Module 3: Clinical Epidemiology and Evidence-Based
Medicine
Learning Objectives

1. Understand the principles of clinical epidemiology
2. Identify factors which may affect and modify clinical course and prognosis of disease
3. Understand the concepts and theories of evidence-based medicine
4. Explain the research method used in causation
5. Understand present and strength of causal relationship
6. Explain bias and confounding in research and how to control in research
7. Explain the reliability and clinical disagreement (kappa test, reliability test)
8. Explain the difference method to research on drug efficacy and safety and how
interpretate the result
9. Develop the skill on how to conduct correlation and regression analyses and how to
interpretate the result
10. Search the article, conduct critical appraisal and answer the clinical questions
11. Practice skills on how to write the outline for study proposal, starting from how to
formulate a research question until planning for data analysis
Learning Objectives
Learning Activities
1 2 3 4 5 6 7 8 9 10 11
Tutorial-1 X X X X X X X X
Reliability and Clinical
X
Disagreement
Risk Assessment and Measurement
X X
Causation
Bias and Confounding Control X
Basic Epidemiology X
Evidence Based Medicine:
X
Diagnosis
Evidence Based Medicine: Therapy X
Evidence Based Medicine:
X
Prognosis and Harm
Research on Drugs Efficacy and
X
Safety
Longitudinal
X
Correlation and Regression
Practical Work – Evidence-Based
Medicine: Advance Searching and X
Critical Appraisal
Practical Work – Research
Methodology 3: Variable and X
Measurement
Pap's smear and visual inspection
using acetic acid

Scenario 1
Making a correct diagnosis
Mr. Hendra, a 22-year-old male, presented to the emergency department with a chief complaint of
abdominal pain. He also suffered from anorexia, nausea, and fever. He described the pain as sharp,
constant, and aggravated by movement. He had no bowel or urinary symptoms and no previous
abdominal problems. The pain started in the mid-abdominal region 6 hours ago and is now in the right
lower quadrant of the abdomen. The pain was steady and aggravated by coughing. Physical examination
revealed fever (38°C) and pain on palpation at the right lower quadrant. A laboratory finding showed
15,000/microlitre with neutrophils of 85%. Were these findings sufficient to make an accurate diagnosis?

Module Learning Method Assessments

Learning Duration
Objectives (hours)
1, 2, 3, 4, 5, Tutorial-1 Small 4
6, 7, 10 Group
Discussion
7 Reliability and Clinical Expert 1 Cumulative Semester

Clinical Epidemiology Lecture Examination Examination
Disagreement Biostatistics Unit /
Dept. of
Pharmacology
and Therapy
4, 5 Risk Clinical Expert 1 Cumulative Semester

Assessment Epidemiology Lecture Examination Examination
and Biostatistics Unit /
Measurement Dept. of Clinical
Causation Pathology and
Laboratory
Medicine
6 Bias and Clinical Expert 1 Cumulative Semester

Confounding Epidemiology Lecture Examination Examination
Control Biostatistics Unit /
Dept. of
Obstetrics and
Gynaecology
1 Basic Dept. of Expert 1 Cumulative Semester

Epidemiology Biostatistics, Lecture Examination Examination
Epidemiology,
and Population
Health
3 Evidence Clinical Expert 1 Cumulative Semester

Based Epidemiology Lecture Examination Examination
Medicine: Biostatistics
Diagnosis Unit / Dept. of
Obstetrics and
Gynaecology

Medicine: Biostatistics
Therapy Unit / Dept. of
Pharmacology
and Therapy

Medicine: Biostatistics Unit /
Prognosis and Dept. of
Harm Obstetrics and
Gynaecology

Learning Duration
Objectives (hours)
Drugs Efficacy Epidemiology Lecture Examination Examination
and Safety Biostatistics Unit /
Dept. of
Pharmacology
and Therapy


Learning Method Assessments

Duration
(hours)
To develop the Practical a. TMB Practical 2 - Assignment
skill on how to Work – Longitudinal – Session
conduct Biostatistics: Evidence
correlation and Correlation Based
regression and Medicine,
analyses and Regression Critical
how to Appraisal, and
interpretate the Thesis
result b. Dept. of
Biostatistics,
Epidemiology,
and Public
Health
Able to search Practical a. TMB Practical 2 - Assignment

the article, Work – Longitudinal – Session
conduct critical Evidence Evidence
appraisal, and Based Based
answer the Medicine: Medicine,
clinical Advance Critical
questions Searching Appraisal, and
and Critical Thesis
Appraisal b. Clinical
Epidemiology
and Biostatistics
Unit
To practice skills Practical Work a. TMB Practical 2 - Assignment

on how to write – Research Longitudinal – Session
the outline for Methodology Evidence
study proposal, 3: Variable and Based
starting from how Measurement Medicine,
to formulate a Critical
research question Appraisal, and
until planning for Thesis
data analysis b. Clinical
Epidemiology
and Biostatistics
Unit

Learning Method Assessments
Duration
(hours)
a. To perform Pap's smear a. TMB BCCT 2 Portfolio, a. Mini-
early and visual Longitudinal – google OSCE
detection inspection Basic Clinical form b. OSCE 1
cervical pre- using acetic Competences questions
cancer and acid (VIA) b. Dept. of
cancer examination Obstetrics and
detection Gynaecology
counselling
b. To choose
appropriate
VIA and
Pap’s smear
examinations
for client
c. To choose
appropriate
instruments
for VIA and
Pap’s smear
d. To perform
VIA and
Pap’s smear
client
preparation
e. To perform
potential side
effect, advise,
and further
direction and
counselling
after VIA or
Pap’s smear
examination.


1. Title : Tutorial-1
2. Title : Reliability and Clinical Disagreement

Activity To explain the reliability and clinical disagreement (Kappa test, reliability test)
:
Objectives
Responsible Clinical Epidemiology Biostatistics Unit / Dept. of Pharmacology and
:
Staff(s) Therapy
Content(s) : Risk reliability and clinical disagreement
a. Creswell JW. 2003. Research Design Qualitative, Quantitative and
Mixed Method Approaches. London: Sage Publication. London: Wiley
& Sons.
Second Edition.
Reference(s) :
Indonesia.
3. Title : Risk Assesment and Measurement Causation

Activity a. To explain the research method used in causation
: b. To understand present and strength of causal relationship
Objectives
Responsible Clinical Epidemiology Biostatistics Unit / Dept. of Clinical Pathology and
:
Staff(s) Laboratory Medicine
Content(s) : Risk assessment and measurement causation
& Sons.
Second Edition.
Reference(s) :
Indonesia.
4. Title : Bias and Confounding Control

Activity To explain bias and confounding in research and how to control in research
:
Objectives
Responsible Clinical Epidemiology Biostatistics Unit / Dept. of Obstetrics and Gynecology
:
Staff(s)
Content(s) : Types of bias in research and how to control confounding factors
Reference(s) : & Sons.
Second Edition.

Indonesia.
Assessment :
5. Title : Basic Epidemiology

Activity To understand the principles of epidemiology
:
Objectives
Responsible Dept. of Biostatistics, Epidemiology and Population Health
:
Staff(s)
a. Principles of epidemiology
Content(s) : b. Use of epidemiology in medical practice and public health
c. Concepts of risk factors, causation and health outcomes
Rossignol, A. 2007 Principles and Practice of Epidemiology: An Engaged
Reference(s) : Approach, McGraw-Hill, Toronto.
6. Title : Evidence Based Medicine: Diagnosis

Activity To understand the concepts and theories of Evidence Based Medicine
:
Objectives on Diagnosis
Responsible Clinical Epidemiology Biostatistics Unit / Dept. of Obstetrics and
:
Staff(s) Gynecology
a. Validity of diagnostic test
Content(s) : b. Sensitivity and specificity
c. Predictive value and likelihood ratio
a. Sharon E., Strauss S.E., Glassziou P., Richardson W.S., and Haynes R.B.
2011. Evidence Based Medicine: How to practice and teach it. 4th ed.
Edinburg: Churchill Livingstone.
Reference(s) :
b. Zakowski, L., Seibert, C., & VanEyck, S. (2004). Evidence-based
medicine: answering questions of diagnosis. Clinical medicine &
research, 2(1), 63–69. https://doi.org/10.3121/cmr.2.1.63
7. Title : Evidence Based Medicine: Therapy

:
Objectives on Therapy
:
Staff(s) Therapy
How to critically appraise articles on therapy, interpreting result of randomized
Content(s) : controlled trial, calculating relative risks, relative risk
reduction, absolute risk reduction and number need to treat
Sharon E., Strauss S.E., Glassziou P., Richardson W.S., and Haynes
Reference(s) : R.B. 2011. Evidence Based Medicine: How to practice and teach it. 4th ed.
8. Title : Evidence Based Medicine: Prognosis and Harm

:
Objectives on Prognosis and Harm

Responsible Clinical Epidemiology Biostatistics Unit / Dept. of Obstetrics and
:
Staff(s) Gynecology
How to critically appraise articles on harm, interpreting result of study on
Content(s) : harm, calculating number need to harm
Cardarelli R. and Seater M.M., 2007. Evidence-Based Medicine, Part 4.
Reference(s) : An Introduction to Critical Appraisal of Articles on Harm. J Am Osteopath
Assoc 107: 310-314.
9. Title : Research on Drugs Efficacy and Safety

Activity To explain the difference method to research on drug efficacy and safety
:
Objectives and how interpretate the result
:
Staff(s) Therapy
Different methods and specific purposes for research on drugs efficacy
Content(s) : and safety
& Sons.
Second Edition.
Reference(s) :
Indonesia.
Longitudinal
1. Title : Practical Work – Biostatistics: Correlation and Regression
Activity To develop the skill on how to conduct correlation and regression
:
Objectives analyses and how to interpretate the result
Responsible
: Thesis
Staff(s)
Content(s) : Calculation of the correlation and regression
b. Creswell JW. 2003. Research Design Qualitative, Quantitative and
Reference(s) :
& Son.
the Essentials. Third Edition. Baltimore: William &
Wilkins.
Practical Work – Evidence Based Medicine: Advance Searching and

2. Title : Critical Appraisal
Activity Able to search the article, conduct critical appraisal and answer the
:
Objectives clinical questions
Responsible
: Thesis
Staff(s)

Search the article, conduct critical appraisal, and answer the clinical
Content(s) :
questions
Reference(s) : R.B.2018. Evidence based medicine: How to practice and teach EBM
5th ed. Edinburg: Churchill Livingstone.
3. Title : Practical Work – Research Methodology 3: Variable and Measurement

Activity To practice skills on how to write the outline for study proposal, starting
:
Responsible
: Thesis
Staff(s)
Content(s) : Variable and Measurement
Wilkins.
& Wilkins.
Press.
4. Title : Pap's smear and visual inspection using acetic acid (VIA) examination
a. Perform early detection cervical pre-cancer and cancer detection
counselling
b. Choose appropriate VIA and Pap’s smear examinations for client
Activity
: c. Choose appropriate instruments for VIA and Pap’s smear
Objectives
d. Perform VIA and Pap’s smear client preparation
e. Perform potential side effect advise, and further direction and
counselling after VIA or Pap’s smear examination.
:
Staff(s) b. Dept. of Obstetrics and Gynaecology
BCCT (2 hours)
Feedback
a. Pap’s smear: screening condition, equipment, procedure
Content(s) : b. VIA: skills, procedures, observation, conclusion, documentation, and
counselling
Prerequisite : Integrated patient management of obsgyn cases
a. Bickley LS. 2007. Bates’ Guide to Physical Examination and History
Reference(s) : Taking 9th ed. Lippincott Williams & Wilkins. Philadelphia.

b. Sankaranarayanan R, Wesley RS. 2003. A Practical Manual on Visual
Screening Of Cervical Neoplasia. World Health Organization
–International Agency for Research on Cancer. Lyon.
c. International Agency for Research on Cancer (IARC). 2017. Chapter 1:
Anatomical and pathological basis of visual inspection with acetic acid
(VIA) and with Lugol’s iodine (VILI). World Health Organization
– International Agency for Research on Cancer. Lyon.
c. OSCE 1
Unit Activity Table
Longitudinal
Total Longitudinal
Total Block Total
Time Activities Time
Expert Lecture 8 8 - -
Practical Session - - 3 6
Small Group Discussion 1 4 - -
Case Study - - - -
Field Study - - - -
Study
Total 9 12 4 8

Module 4: Quality of Care
Learning Objectives

1. Understand the concept quality of care
2. Explain the concept and implementation on continuity of care
3. Understand the concept of standard of care
4. Understand various method for improving quality of clinical care
5. Understand the health care system component, the care processes, and the supporting system
(such as medical report, information system, medical supplies, drug and related activities)
6. Capable to conduct literature search and critical appraisal on therapy
7. Develop skill on how to write the outline for study proposal, from how to formulate a
research question until data analysis
Module Learning Objectives to Activities Mapping of Module 4
Learning Objectives
Title 1 2 3 4 5 6 7
Quality of Care X X
Standard of Care X X
Improving Quality of Clinical Care X X
Drug Information X X
Tutorial-2 X X X X X X
Field Visit to Hospital X X X X
Longitudinal
Practical Work – Evidence Based Medicine: Critical
X
Appraisal on Therapy (Practical Session)
Practical Work - Research Methodology 4: Data X
Management and Analysis
Ethics in emergency and disaster
Critical thinking on KODEKI and medical
professionalism practice in Indonesian context
Medical Disciplinary/Professionalism Misconduct
and Its Institutional Approach (MKDKI)
Integrated Skills Session & Patient Medical
Record

Scenario 2
Referring a patient to hospital

Mr. Mukidi, a 67-year-old male, a member of the national health insurance program (JKN), has been
feeling unwell for the last five days and has shortness of breath and more wheezing. He could not walk
farther than five meters from his chair to the toilet. He has a worsening productive cough and has been
producing yellow/green sputum. He called his family doctor in the morning, told the nurse in charge of
his symptoms, and scheduled an appointment with his family doctor later that afternoon. His wife
accompanied him and said he had become breathless, even to speak or eat. The patient felt quite confused
and disorientated. During history taking, the doctor found that Mr. Mukidi has been a heavy smoker
since he was 15. After having a few physical examinations, the doctor advised Mr. Mukidi to be
referred to a hospital. While a referral letter was prepared, Mr. Mukidi asked the doctor why he should be
referred to the hospital.

Module Learning Method Assessments (Tentative)

Learning Duration
Objectives (hour)
1, 2 Quality of Dept. of Expert 1 Cumulative Semester
Care Health Policy Lecture Examination Examination
Management (Case
Study)
2, 3 Standard of Dept. of Expert 1 Cumulative Semester
Care Health Policy Lecture Examination Examination
Management
3, 4 Improving Dept. of Expert 1 Cumulative Semester

Quality of Health Policy Lecture Examination Examination
Clinical Management (Case
Care Study)
5,6 Drug Dept. Practical 2 Cumulative Semester
Information Pharmacology Session Examination Examination
and Therapy
1, 2, 3, 4, Tutorial-2 Small 4 - -
5,6 Group
Discussion
1, 2,3 4 Field Visit to Dept. of Field Visit 3 a. Individual Semester

Hospital Health Policy Assignment Examination
Management b. Cumulative
Examination


Activity Objectives Learning Method Assessments

Method Duration In-
Activities Staff(s) Final
(s) (hour) block
Able to conduct literature Practical Work – a. TMB Practical 2 Assignment
search and critical appraisal Evidence Based Longitudin Session
on therapy Medicine: Critical al –
Appraisal on Therapy Evidence
Based
Medicine,
Critical
Appraisal,
and Thesis
b. Clinical
Epidemiolog
y and
Biostatistics
Unit
To develop skill on how to Practical Work - a. TMB Practical 2 Assignment

write the outline for study Research Methodology Longitudin Session
proposal, starting from how 4: Data Management al –
to formulate a research and Analysis Evidence
question until data analysis Based
Medicine,
Critical
Appraisal,
and Thesis
b. Clinical
Epidemiolog
y and
Biostatistics
Unit
a. To understand the Ethics in emergency TMB Longitudinal Expert 1 Block

context and scope of and disaster – Bioethics and Lecture Examination
issues in medical Medicolegal
practice during
emergency and
disaster
b. To understand the
relevant medical
ethics principles
guiding medica
practice during
emergency and
disaster

Activity Objectives Learning Method Assessments
Method Duration In-
Activities Staff(s) Final
(s) (hour) block
a. To understand the Medical 1. TMB Expert 1 Block
landscape of various Disciplinary/Professio Longitudinal – Lecture Examination
disciplinary / nalism Misconduct and Bioethics and
professionalism Its Institutional
Medicolegal
misconducts in Approach (MKDKI)
Indonesian medical 2. Dept. of
practice context Forensic and
b. To recognize the Medicolegal
critical factors
underlying
misconducts
c. To understand the
institutional approach/
mechanism available
for managing/
processing such
misconducts.
a. To exercise critical Critical thinking on TMB Longitudinal Case 2 Group

thinking in examining KODEKI and medical – Bioethics and Study Report
the relevance of professionalism Medicolegal
KODEKI with current practice in Indonesian
context of medical context
practice and society
b. To exercise
constructing
argument and
recommendation for
solution/
improvement of
medical
professionalism
practice in Indonesia
a. To integrate several Integrated Skills TMB BCCT 2 Portfolio, a. Mini-
skills in order and Session & Patient Longitudinal google OSCE
systematic based on Medical Record BCC form b. OSCE 1
clinical reasoning question s
b. To perform holistic
and comprehensive
individual, family,
and societal health
problems
management
c. To behave
professionally and
aware to self-
limitation and refer
patient in correct
time and condition

1. Title : Quality of care (include Continuity of Care)

Activity To explain the concept and implementation on continuity of care
:
Objectives
:
Staff(s)
Expert Lecture (1 hour)
Method(s) : (Case Study)
a. The concept of continuity of care
Content(s) : b. Components of continuity of care
c. Case study
a. Donabedian, A., 2003. Donabedian A. Quality of care: How can it be
assessed. JAMA, 1988, 260(12): 174301748 (Landmark article)
(accessible on internet)
b. NCQA. The essential guide for health care quality. US: NCQA.
Reference(s) :
c. Kringos DS et al. The European primary care monitor: structure,
process and outcome indicators. BMC Family Practice 2010, 11:81
2. Title : Standard of Care

Activity To understand the concept of standard of care
:
Objectives
:
Staff(s)
a. Standar of care definition
b. Input standard
Content(s) :
c. Process standard
d. Output standard
a. Donabedian, A., 2003. An Introduction to Quality Assurance in
Health Care. Oxford: Oxford University Press.
Reference(s) : b. McKinley, R.K., Fraser, R.C., Baker, R., 2001. Model for directly
assessing and improving clinical competence and performance in
revalidation of clinicians. BMJ, 322: 712–5.
3. Title : Improving Quality of Clinical Care

Activity To understand various method for improving quality of clinical care
:
Objectives
:
Staff(s)
a. Quality of clinical care conceptual framework
Content(s) : b. Methods to improve quality of clinical care
c. Case study
a. Institute for Healthcare Improvement. 2009. Nolan Model for
Improvement. Available at: www.ihi.org.
b. Dawda P, Jenkins R, Varnam R. 2010. Quality improvement in general
practice. The King’s Fund, United Kingdom (Accessible on the internet).
Reference(s) :
c. WHO. Topic 7: Using quality improvement methods to improve care.
Patient safety curriculum guide. Geneva: WHO. (Accessible
on the internet)

4 Title Drug Information
1. Critical analyse on prescribing scenario and complete (i) the form of
Activity monograph of drug information and (ii) form of potential drug-drug
Objectives interaction
2. Reporting Adverse Drug reaction
Responsible Dept. Pharmacology and Therapy
Staff(s)
Method(s) Practical Session
Content(s)
(1) http://www.drugs.com/; (2)
Reference(s) http://www.who.int/medicines/publications/essentialmedicines/en/; (3)
2)http://www.whocc.no/atc_ddd_index
6. Title : Field Visit to Hospital

a. To give experiences of visiting the hospital as part of the health care
system component
Activity b. To give an exposure to the care processes in the hospital
:
Objectives c. To give an opportunity to understand the supporting system (such as
medical report, information system, medical supplies, drug and related
activities) at the hospital
:
Staff(s)
Method(s) : Field Visit (3 hours)
a. Hospital organization and health services.
Content(s) : b. Hospital preventive and community involvement
c. Hospital insurance and finance
Prerequisite :
Continuation :
a. Humphris D. Multiprofessional working, interprofessional learning and
primary care: A way forward? Contemporary Nurse 2007, 26: 48-55.
b. Birn A, Pillay Y, Holtz TH. 2009. Textbook of International Health:
Reference(s) :
Global Health in a Dynamic World. 3rd ed. Oxford University Press,
USA.
a. Individual Assignment
Assessment : b. Cumulative Examination
c. Semester Examination
Longitudinal
Practical Work – Evidence Based Medicine: Critical Appraisal on
1. Title : Therapy
Activity Able to conduct literature search and critical appraisal on therapy
:
Objectives
Responsible
: Thesis
Staff(s)
Content(s) : The literature search and critical appraisal on therapy
Reference(s) : R.B.2018. Evidence based medicine: How to practice and teach EBM
5th ed. Edinburg: Churchill Livingstone.
Practical Work - Research Methodology 4: Data Management and

2. Title :
Analysis

:
Objectives from how to formulate a research question until data analysis
Responsible
: Thesis
Staff(s)
Content(s) : Data Management and Analysis
Wilkins.
d. Hall GM (editor). 2003. How to Write a Paper. Third Edition.
London: BMJ Publishing Group.
Wilkins.
William & Wilkins.
h. Rothman KJ, et al. 2009. Modern Epidemiology. Philadelphia:
William & Wilkins.
Press.
3. Title : Ethics in Emergency and Disaster

c. To understand the context and scope of issues in medical practice during
Activity emergency and disaster
:
Objectives d. To understand the relevant medical ethics principles guiding medica
practice during emergency and disaster
Responsible TMB Longitudinal – Bioethics and Medicolegal
:
Staff(s)
a. dr. Hendro Wartatmo, Sp.B-KBD.
Lecturer : b. dr. Nur Azid Mahardinata
a. Landscape of medical ethics issues in the context of emergency and
disaster
b. Medical ethics principles relevant for the emergency and disaster
Content(s) :
contexts
c. Challenges and best practices of ethical medical practice during
emergency and disaster
Identifying Ethical Dilemmas and Problems in Medical Practice (Block
Prerequisite : 1.8 Life Cycle)
Continuation : Public Health Ethics (Block II.4 Diarrhea, Vomiting, and Jaundice)
a. https://www.who.int/publications/i/item/health-emergency-and-
disaster- risk-management-ethics
b. Bruce Jennings and John Arras, "Emergency Ethics: Public Health
Reference(s) :
Preparedness and Response" (Oxford University Press, 2016)
c. WHO. Ethics in Epidemics, Emergencies and Disasters: Research,
Surveillance and Patient Care. WHO Training Manual (2015).

d. Barilan YM, Brusa M, Halperin P. Triage in disaster medicine: ethical
strategies in various scenarios. InDisaster bioethics: Normative issues when
nothing is normal 2014 (pp. 49-63). Springer, Dordrecht.
e. Handbook HH. HUMANITARIAN HEALTH ETHICS ANALYSIS
TOOL. http://www.humanitarianhealthethics.net
Medical Disciplinary/ Professionalism Misconduct and Its Institutional

4. Title : Approach (MKDKI)
d. To understand the landscape of various disciplinary / professionalism
misconducts in Indonesian medical practice context
Activity
: e. To recognize the critical factors underlying misconducts
Objectives
f. To understand the institutional approach/ mechanism available for
managing/ processing such misconducts.
Responsible a. TMB Longitudinal – Bioethics and Medicolegal
:
Staff(s) b. Dept. of Forensic and Medicolegal
a. Prof. Dr. dr. Herkutanto, Sp.F(K)., S.H., LLM., FACLM.
Lecturer : b. dr. Beta Ahlam Gizela, Sp.FM(K)., DFM.
a. Illustration of various disciplinary/ professionalism misconduct cases in
medical practice
b. Challenges and critical factors underlying the misconducts
Content(s) :
c. Institutional approach and mechanism to manage the misconducts
d. Role of MKDKI in dealing with the disciplinary/ professionalism
misconduct
a. The Physicians’ (Hipocratic) Oath and KODEKI (Block 1.2
Cardiorespiratory System)
Prerequisite :
b. The Indonesian Medicolegal Logic and Systems (Block 1.4
Genitourinary and Reproduction System)
Assignment 5: Critical thinking on KODEKI and Indonesian medical
Continuation : professionalism practice (Block 1.9 Research and Basic Medical
Practice)
Himpunan Peraturan tentang Majelis Kehormatan Disiplin Kedokteran
Reference(s) :
Indonesia (MKDKI)
Critical Thinking on KODEKI and Medical Professionalism Practice in

5. Title : Indonesian Context
c. To exercise critical thinking in examining the relevance of KODEKI
Activity with current context of medical practice and society
:
Objectives d. To exercise constructing argument and recommendation for solution/
improvement of medical professionalism practice in Indonesia
Responsible TMB Longitudinal – Bioethics and Medicolegal
:
Staff(s)
a. dr. Wika Hartanti, MIH
PIC : b. dr. Beta Ahlam Gizela, Sp.FM(K)., DFM.
Case Study (2 hours)
Method(s) :
Guided essay, group work
a. Critical review of KODEKI and examine its relevance for current
context of medical practice and the society construct
Content(s) :
b. Construct argument and recommendation for improvement/
modification considering the contextual factors
a. The Physicians’ (Hipocratic) Oath and KODEKI (Block 1.2
Cardiorespiratory System)
Prerequisite :
b. Medical disciplinary/ professionalism misconduct and its institutional
approach (MKDKI) (Block 1.9 Research and Basic Medical Practice)
Continuation : None
a. Association of American Physicians and Surgeons. Various
Physicians Oaths (including the classic Hippocratic Oath).
Reference(s) : b. Parsa-Parsi RW. The Revised Declaration of Geneva: A Modern-Day
Physician’s Pledge. JAMA. 2017;318(20):1971–1972.
doi:10.1001/jama.2017.16230

c. KODEKI 2012.
d. American Medical Association. Why does medical profession need a code
of ethics?
a. Group Report
Assessment : b. Grading of assignment with rubric assessment
6. Title : Integrated Skills Session & Patient Medical Record

d. To integrate several skills in order and systematic based on clinical
reasoning
Activity e. To perform holistic and comprehensive individual, family, and
:
Objectives societal health problems management
f. To behave professionally and aware to self-limitation and refer
patient in correct time and condition
Responsible TMB Longitudinal – Basic Clinical Competences
Staff(s) :
Skills Lab (2 hours)
Method(s) : a. Assignment
b. Hands-on & feedback
Content(s) : Integration of previous clinical skills.
Prerequisite : Previous clinical skills sessions
Continuation : Integrated patient management sessions
a. Bickley LS, Szilagyi PG, Hoffman RM, Soriano RP. Bates’ guide to
physical examination and history taking. Thirteenth edition.
Philadelphia: Wolters Kluwer; 2021.
b. Kurtz S, Silverman J, Draper J. Teaching and learning communication
Reference(s) :
skills in medicine. 2. Ed., reprinted. Oxford: Radcliffe; 2006. 369 p.
c. Cole SA, Bird J. The medical interview: the three-function approach.
Third edition. Philadelphia, PA: Elsevier, Saunders; 2014. 316 p.

c. OSCE 1
Unit Activity Table
Longitudinal
Total Longitudinal
Total Block Total
Time Activities
Time
Case Study - - 1 2
Field Visit 1 3 - -
Independent Learning/Self
- - - -
Study
Total 6 12 6 10

Module 5: Patient Safety and Standard of Care
Learning Objectives
By the end of this learning unit, students are able to:

1. Explain the principles of patient safety
2. Explain the preparation process of clinical practice guideline (CPG) and clinical pathway (CP)
3. Implement clinical audit
4. Describe the principles of therapy
5. Identify problems in diagnosis and therapy (diagnostic test, rational use of drugs,
surgery)
6. Develop skill on how to write the outline for study proposal, from how to formulate a
research question to data analysis
7. Identify potential quantitative and qualitative sources of data available about drug use in
community health
8. Practice the principles of evidence-based medicine
Module Learning Objectives to Activities Mapping of Unit 5
Learning Objectives
Title 1 2 3 4 5 6 7 8
Tutorial-3 X X X X X X X
Field Visit to Community
Health Center X
(PUSKESMAS)
Learn on Drug Use in
X X X
Primary Health Centers
Principles of Patient Safety X
Rational Use of Drugs X
Diagnosis, Therapeutic, and
X
Safety Practices
Clinical Practice Guidelines
(CPG), Clinical Pathway, and X X
Clinical Audit
Briefing Field visit to Primary
X
Health Center
Principles of Pharmacotherapy X
Wrap Up
Longitudinal
Practical Work – Evidence
Based Medicine: Critical X
Appraisal on Diagnosis
Practical Work - Research
Methodology 5: Writing and X
Presenting (Practical Session)
Developing Personal
Formulary
Basic evidence and best
practices to enhance the quality
of care, as well as patient and
program safety in
preventive and promotion
medicine
Exposure and prevention in
healthcare setting

Scenario 3
Antibiotic prescription
Rahayu, a 5-year-old girl, was brought to a primary care doctor in the primary health center
(Puskesmas), located around 5 km from his house. Her chief complaints were fever in the last
three days, malaise, and nasal stuffiness. She also suffered from a cough and runny nose. Her
mom said that Rahayu’s older brother had experienced the same sign and symptoms a week ago,
but all symptoms had subsided. During the physical examination, the doctor found Rahayu
coughed and had a runny nose. Physical examinations showed fever (38.5 C), cervical
lymphadenopathy, and nasopharyngeal congestion. Rahayu’s mom requested the doctor to
prescribe antibiotics because the doctor also prescribed antibiotics on the last two visits. Doctor
prescribed antibiotics and cough mixture to Rahayu and several medicines in a powder
preparation. Was it appropriate to prescribe antibiotics in this case?


Learning Learning Activities Responsible Staff(s) Duration
Objectives Method(s) In-block Final
(hour)
1, 2, 3, 4,5, Tutorial-3 Small Group 4 - -
7, 8 Discussion
7 Field Visit to Dept. of Pharmacology Field Visit 3 a. Individual Semester

Community Health and Therapy Assignment Examination
Center b. Cumulative
(PUSKESMAS) Examination
3,4,5 Learn on Drug Use in Dept. of Pharmacology Practical Work 2 Group report -
Primary Health Centers and Therapy
1 Principles of Patient Dept. of Pharmacology Flipped 1 Cumulative Semester

Safety and Therapy Classroom Examination Examination
(Video+Lecture)
5 Rational Use of Drugs Dept. of Pharmacology Flipped 1 Cumulative Semester

and Therapy Classroom Examination Examination
(Video+Lecture)
1 Diagnosis, a. Dept. of Integrated 2 Cumulative Semester

Therapeutic, and Pharmacology and Seminar Examination Examination
Safety Practices Therapy
b. Dept. of Clinical
Pathology and
Laboratory
Medicine
c. Dept. of Surgery
2, 3 Clinical Practice Dept. of Health Policy Expert Lecture 1 Cumulative Semester

Guidelines (CPG), Management (Case Study) Examination Examination
Clinical Pathway, and
Clinical Audit

Learning Learning Activities Responsible Staff(s) Duration
Objectives Method(s) In-block Final
(hour)
4,5 Briefing Field visit to Dept. of Pharmacology Expert Lecture 1 Cumulative Semester
Primary Health Center and Therapy Examination Examination
4 Principles of Dept. of Pharmacology Flipped 1 Cumulative Semester

Pharmacotherapy and Therapy Classroom Examination Examination
(Video+Lecture)
- Wrap Up Panel 2 - -
TMB Research & Basic
Discussion
Medical Practice

Activity Objectives Assessments
Learning Method
Learning Responsible (Tentative)
Topics/Activities Staff(s) Duration
Method(s) In-block Final
(hour)
To practice the Practical Work – a. TMB Practical 2 - Assignment
principles of Evidence Based Longitudinal Session
Evidence-Based Medicine: Critical – Evidence
Medicine Appraisal on Based
Diagnosis Medicine,
Critical
Appraisal,
and Thesis
b. Clinical
Epidemiology
and
Biostatistics
Unit
To develop skill on how Practical Work - a. TMB Practical 2 - Assignment
to write the outline for Research Longitudinal Session
study proposal, starting Methodology 5: – Evidence
from how to formulate a Writing and Based
research question until Presenting (Practical Medicine,
data analysis Session) Critical
Appraisal,
and Thesis
b. Clinical
Epidemiology
and
Biostatistics
Unit
a. To explain class Developing Personal a. TMB BCC 2 Portfolio, a. Mini-
therapy, Formulary Longitudinal – google OSCE
pharmaceutical Basic Clinical form b. OSCE
dosage form, questions 1
Competences
indication, and
dosage regiment b. Dept. of
of drugs Pharmacology
b. To perform and Therapy
drug education
(dosage
regiment,
warning, follow
up etc.) to the
patient

Activity Objectives Assessments
Learning Method
Learning Responsible (Tentative)
Topics/Activities Staff(s) Duration
Method(s) In-block Final
(hour)
Able to understand Basic evidence and 1. TMB Integrated 2
and practice best practices to Longitudinal – Seminar
evidence-based enhance the quality Health
medicine in health of care, as well as
Promotion and
promotion and patient and program
disease prevention safety in preventive Disease
and promotion Prevention
medicine 2. Dept. of
Internal
Medicine
3. Department of
Biostatistics,
Epidemiology,
and Population
Health
4. Dept. of Health
Behaviour,
Environment
and Social
Medicine
a. To understand Exposure and 1. TMB Integrated 2

the potential risk Prevention in Longitudinal – Seminar
exposure in a Healthcare Setting Health
health care
Promotion and
setting
b. To understand Disease
the prevention Prevention
program of 2. Dept. of Health
primary health Behaviour,
care Environment
c. To understand and Social
the hierarchy of
Medicine
hazard control
strategy in a 3. Dept. of
health care Internal
setting Medicine


2. Title : Field Visit to Community Health Center (PUSKESMAS)

a. To identify potential quantitative and qualitative sources of data
available about drug use in community health centers
Activity b. To plan the logistical aspects of the data collection process in these
:
Objectives facilities
c. To give experiences of visiting the Puskesmas
d. To give an exposure to the care processes in Puskesmas
Responsible Dept. of Pharmacology and Therapy
:
Staff(s)
Method(s) : Field Visit (3 hours)
a. Community Health Center organization and health services
Content(s) : b. Drug use in community health centers
c. Drug Information
a. Humphris D. Multiprofessional working, interprofessional learning and
primary care: A way forward? Contemporary Nurse 2007, 26: 48-55.
b. Birn A, Pillay Y, Holtz TH. 2009. Textbook of International Health:
Reference(s) :
Global Health in a Dynamic World. 3rd ed. Oxford University Press,
USA.
a. Individual Assignment
Assessment : b. Cumulative Examination
c. Semester Examination
3 Title Learn on Drug Use in Primary Health Centers

Based on Pirmary heatlh care visit, the students will presenting the result of
Activity
visit, using the WHO form on how to learn drug use in primary health centers
Objectives
Staff(s)
Method(s) Practical Work
Content(s)
1. https://www.who.int/activities/promoting-rational-use-of-medicines/
Reference(s) 2. https://iris.who.int/bitstream/handle/10665/67438/WHO_E
DM_2002.3.pdf
Assessment Group report
4. Title : Principles of Patient Safety

Activity To explain the principles of patient safety
:
Objectives
:
Staff(s)
Flipped Classroom (1 hour)
Method(s) :
(Video+Lecture)
Definition, epidemiology, types and causes of medical error, diagnostic
Content(s) :
errors, risk factors, and how to prevent them
a. Aspden P., Corrigan J.M., Wolcott, J., Erickson S.M. (eds),
Committee on Data Standards for Patient Safety. Patient Safety:
Achieving a New Standard for Care. Washington: The National
Academic Press.
b. Department of Health and Human Services. Agency for Healthcare
Reference(s) :
Research and Quality. 2003 AHRQ Quality Indicators. Guide to Patient
Safety Indicators. Agency for Healthcare Research and Quality,
Rockville.
c. Fletcher, RH., Fletcher, SW., Wagner, EH., Clinical Epidemiology: The
Essentials, 5th ed. William & Wilkins, Baltimore,2012.

d. Kohn LT, Corrigan JM and Donaldson MS (eds). 2000. To Err is Human:
Building a Safer Health System. Washington: The National
Academy Press.
5. Title : Rational use of drugs

Activity To identify problems rational use of drugs
:
Objectives
:
Staff(s)
Method(s) : (Video+Lecture)
Rational Use of Medicine
(Definition, epidemiology of inappropriate use of medicine, problems in
Content(s) :
the use of medicine, factors influencing clinical decision-making process in the
use of medicine)
a. Brunton, L., Lazo, J., Parker, K.2011. Goodman and Gilman’s The
Pharmacological Basis of Therapeutics, 12th ed. McGraw-Hill Med.
Publication, New York.
b. DiPiro, J.T., Talbert, R.L., Yee, G.C., Matzke, G.R., Posey, L.M.2006,
Reference(s) :
Pharmacotherapy, a pathophysiologic approach, 6th ed. McGraw-Hill
Med. Publication, New York.
c. Katzung, B.G.2004, Basic and Clinical Pharmacology, 9th ed.
Appleton & Lange, New York.
6. Title : Diagnosis, Theurapetic, and Safety Practices

Activity To define medication safety practices, identify medication error, and
:
Objectives explain how to prevent patients from medication error
a. Dept. of Pharmacology and Therapy
Responsible
: b. Dept. of Clinical Pathology and Laboratory Medicine
Staff(s)
c. Dept. of Surgery
a. Awareness, problems, type of medication safety practices,
interventions to improve medication safety
Content(s) :
b. Surgery (site marking, timeout, sign in sign out)
Camire E., Moyen E., Stelfox H.T. Medication errors in critical care: risk
Reference(s) : factors, prevention, and disclosure. CMAJ, 2009, 180(9): 936-943.
7. Title : Clinical Practice Guidelines (CPG), Clinical Pathway, and Clinical Audit
Activity To understand the concept of CPG, to explain the preparation process of
:
Objectives CPG and CP, students are expected to be able to implement CA
:
Staff(s)
a. Understanding CPG
b. CPG preparation steps
Content(s) :
c. CP preparation steps
d. Implementation of CA
a. MRC. 1999. A Guide to the Development, Implementation and Evaluation
of Clinical Practice Guidelines. Australia: National Health and Medical
Reference(s) : Research Council.
b. NICE. 2007. The Guideline Manual. UK: National Institute for
Health and Clinical Excellence.

c. Turner T, Misso M, Harris C, Green S. Development of evidence- based
clinical practice guidelines (CPGs): comparing approaches.
Implementation Science, 2008, 3: 45.
8. Title : Briefing on Pharmacology

Activity To understand the preparation for practical sessions in the pharmacology
:
Objectives laboratory.
:
Staff(s)
Content(s) : Briefing on Pharmacology
Reference(s) :
Med, Publication, New York.
c. Katzung, B.G. 2004, Basic and Clinical Pharmacology, 9th ed.
9. Title : Principles of Pharmacotherapy

Activity Able to describe the principles of pharmacotherapy
Objectives :
:
Staff(s)
Method(s) : (Video+Lecture)
a. The role of pharmacodynamics and pharmacokinetics in
pharmacotherapy
Content(s) : b. Personalized medicine, pharmacotherapy for specific conditions
c. Drug-disease and drug–drug interactions
d. Adverse drug reaction.
Reference(s) :
Med, Publication, New York.
c. Katzung, B.G. 2004, Basic and Clinical Pharmacology, 9th ed.
10. Title : Wrap Up

Activity To summarize learning objectives of the block
:
Objectives To obtain feedback from students
a. TMB Research and Basic Medical Practice
Responsible
: b. Representative of Contributors
Staff(s)
c. Representative of Lecturers for this block
Method(s) : Panel Discussion
a. Review of block activities
Content(s) :
b. Q&A Discussion

Longitudinal
Practical Work – Evidence Based Medicine: Critical Appraisal on
1. Title :
Diagnosis
Activity To practice the principles of Evidence-Based Medicine
:
Objectives
Responsible
: Thesis
Staff(s)
Content(s) : The principles of evidence-based medicine
Prerequisite :
Continuation :
Reference(s) : R.B.2018. Evidence based medicine: How to practice and teach EBM 5th ed.
2. Title : Practical Work - Research Methodology 5: Writing and Presenting

:
Objectives from how to formulate a research question until data analysis
Responsible
: Thesis
Staff(s)
Content(s) : The writing and presenting of study proposal/ graduate thesis
Prerequisite :
Continuation :
Wilkins.
d. Hall GM (editor). 2003. How to Write a Paper. Third Edition.
London: BMJ Publishing Group.
Wilkins.
William & Wilkins.
h. Rothman KJ, et al. 2009. Modern Epidemiology. Philadelphia:
William & Wilkins.
Press.
3. Title : Developing Personal Formulary

c. To explain class therapy, pharmaceutical dosage form, indication, and
Activity dosage regiment of drugs
:
Objectives d. To perform drug education (dosage regiment, warning, follow up etc.)
to the patient

:
Staff(s) b. Dept. of Pharmacology and Therapy
BCCT (2 hours)
Feedback
Content(s) : Personal formulary
Prerequisite : Lecture and practical session of pharmacology department
Continuation : Drugs prescription
Reference(s) : WHO Guide to Good Prescribing: A Practical Manual
1. Portfolio, google form questions
Assessment : 2. Mini-OSCE
3. OSCE 1
4. Title : Exposure and prevention in healthcare setting

d. To understand the potential risk exposure in a health care setting
Activity e. To understand the prevention program of primary health care
:
Objectives f. To understand the hierarchy of hazard control strategy in a health care
setting
a. TMB Longitudinal Health Promotion and Disease Prevention
Responsible
: b. Dept. of Health Behavior, Environment and Social Medicine
Staff(s) c. Dept. of Internal Medicine
Health care facilities have several potential risks for disease transmission and
developing health problems. As a doctor's workplace, the various potential risk
needs to be recognized by students. Furthermore, students also need to
Content(s) :
understand the principles and hierarchy of the potential
risks control in health care settings and various prevention programs
carried out by health services.
Prerequisite : -
1. Exposure and prevention in healthcare settings
2. Principles of infection control and laws supporting access to
treatment:
a. Vaccination
b. Malaria
c. Access to improved sanitation and clean drinking water
Continuation :
3. Promotion and prevention for:
a. Metabolic syndrome, DM-type 2, and cardiac rehabilitation
b. Asthma, chronic obstructive pulmonary disease, and
congenital heart disease
c. Osteoarthritis and cancer
d. Depression and anxiety
1. https://www.ilo.org/dyn/travail/docs/1965/osh.pdf
2. https://aohp.org/aohp/Portals/0/Documents/ToolsForYourWork
Reference(s) :
/free_publications/Health%20Hazards%20Hospital%Workers.p df
Basic evidence and best practices to enhance the quality of care, as well
5. Title : as patient and program safety in preventive and promotion medicine
Activity Able to understand and practice evidence-based medicine in health
:
Objectives promotion and disease prevention
a. TMB Longitudinal – Health Promotion and Disease Prevention
Responsible b. Dept. of Internal Medicine
:
Staff(s) c. Department of Biostatistics, Epidemiology, and Population Health
d. Dept. of Health Behaviour, Environment and Social Medicine
Method(s) : Integrated Lecture (Overview before field study) (2 hours)
a. Principles of prevention and promotion medicine
b. Classification of health prevention
Content(s) :
c. Health prevention strategies
d. Ethics of disease prevention
Prerequisite : -

a. Exposure and prevention in healthcare settings
b. Principles of infection control and laws supporting access to
treatment:
i. Vaccination
ii. Malaria
iii. Access to improved sanitation and clean drinking water
Continuation :
c. Promotion and prevention for:
i. Metabolic syndrome, DM-type 2, and cardiac rehabilitation
ii. Asthma, chronic obstructive pulmonary disease, and
congenital heart disease
iii. Osteoarthritis and cancer
iv. Depression and anxiety
a. https://www.researchgate.net/publication/310453018_Disease_
b. Prevention_An_Overview DOI:10.1016/B978-0-12-803678-
5.00117-X
Reference(s) :
c. In book: International Encyclopedia of Public Health (pp.338-349).
Edition:Second. Publisher: Oxford: Academic Press. Editors: Quah,
S.R. and Cockerham, W.C.
Assessment : -
Unit Activity Table
Longitudinal
Total Longitudinal
Total Block Total
Time Activities
Time
Expert Lecture 2 2 - -
Integrated Lecture 1 2 2 4
Flipped Class 3 3 - -
Panel Discussion 1 2 - -
Case Study - - - -
Field Visit 1 3 - -
Study
Total 10 18 5 10

PRACTICAL SESSIONS
RESEARCH METHODOLOGY 2023
Clinical Epidemiology and Biostatistics Unit (CEBU)
Coordinator
Dr. dr. Osman Sianipar, DMM, M.Sc, Sp.PK(K)
Dr. dr. Andaru Dahesihdewi, M.Kes, Sp.PK(K)

RESEARCH METHODOLOGY
This practical session contains of 5 (five) times face to face discussion. The overall objective of this
practical session is to develop skill on how to write the outline for study proposal. It will be started from
how to formulate a research question until planning for data analysis. Every student has to be active in
group discussion guided by an instructor to discuss scheduled topics. Every meeting is scheduled once a
week.
Learning Objectives:
After this practical session, students are able to:
 Formulate research question, study objectives and hypothesis
 Select the appropriate research design
 Decide population scope and select the appropriate sample selection method
 Calculate minimal sample size
 Define research variables
 Develop data collection method
 Design and select measurement
 Assess the validity and reliability of measurement
 Understand considerations of statistical test selection process & select the appropriate statistical test
 Identify ethical issues related to the study
 Present the outline of research proposal in the poster
PROCEDURE OF PRACTICAL WORK

1. Students work in a group and guided by an instructure
2. See the meeting’s scheduled in student’s agenda
3. Select a group’s chairman and notulen
4. Divided group into 4 subgroups
a. Subgroup 1: basic science
b. Subgroup 2: clinical science
c. Subgroup 3: public health
d. Subgroup 4: qualitative
5. Each subgroup receive 2-3 articles and choose one of those articles to be reviewed and used as a
source for the assignment
6. See all articles in practical guide book
7. Used this following template for study structure
Template for quantitative research as follows:
Title :
Research question :
Objective :
Hypothesis :
Design :
Subject and sample size :
a. Inclusion criteria
b. Exclusion criteria
c. Sample size
including how to

calculate if
available
d. Sampling
technique
Main variable:
1. Independent variable :
2. Dependent variable :
3. Other variable :
Measurement:
a. Measurement :
tool (main)
:
b. Measurement
methods (main)
Other variable
c. Validity and
reliability :
Data analysis and :

statistical test
Ethical consideration :
Template for qualitative research as follows:
Title :
Problem formulation :
Aim/objective :
Research question (if any) :
Qualitative approach or design :
Participants:
a. Sampling strategy :
b. How and why they were
selected (like inclussion :
criteria)

Types of data collected (like :
variables in quantitative method)
Data collection methods
a. Data collection technique :

(in-depth or semi-structure
interview/FGD, document
etc)
b. Description of instrument
(interview guide etc) :
c. Details of data collection
:
procedures
d. Technique to enhance
trustworthiness and
credibility of data analysis
(triangulation/member
checking, etc)
Data processing (methods for :
processing data prior & during
analysis – transcription,
management etc)
Data analysis (Process by which

inferences, themes, etc., were
identified and developed, including
the researchers involved in data
analysis
Ethical consideration :
8. Below is acitvities in each meeting
A. ACTIVITY IN FIRST MEETING (WEEK-1)

• Divided group into 4 subgroup
• Each subgroup read a choosen article
• Each subgroup review a choosen article
• Complete the study structure using the template
B. ACTIVITY IN SECOND MEETING (WEEK-2)

• Each subgroup presenting the complete study structure using the template, starting from
subgroup basic science, followed by clinical science, public health science and qualitative
study,
• Each subgroup present the study for half an hour
• During presentation, all students have to follow the presentation and active give comments
and input for this study outline
• Each subgroup will get assigment to develop new/alternative research question, study
objectives, hypothesis and research design. This assigment should be conducted at home
and will be presented in the next meeting

C. ACTIVITY IN THIRD MEETING (WEEK-3)
• Each subgroup presenting in class the new/ alternative research question, study objectives,
hypothesis and research design, starting from subgroup basic science, followed by clinical
science, public health science and qualitative study.
and input for this study proposal
• Each subgroup will get assigment to develop new/alternative study subject (inclusion and
exclusion criteria), variables (independent, dependent, other, operational definition,
measurement), sample size and sampling technique. This assigment should be conducted at
home and will be presented in the next meeting
D. ACTIVITY IN FOURTH MEETING (WEEK-4)

• Each subgroup presenting in class the new/ alternative study subject (inclusion and
exclusion criteria), variables (independent, dependent, other, operational definition,
measurement), sample size and sampling technique, starting from subgroup basic science,
followed by clinical science, public health science and qualitative study.
• Each subgroup will get assigment to develop new/alternative data analysis and statistical
test, ethical consideration and choose appropriate study title. This assigment should be
conducted in this meeting
• Each subgroup will get assigment to develop a poster for this study proposal. This assigment
should be conducted at home and will be presented in the next meeting.
E. ACTIVITY IN FIFTH MEETING (WEEK-5)

• Each subgroup presenting the poster in the class on this new/alternative study proposal
starting from basic science, clinical science, public health science and qualitative study.
• Final poster should be uploaded into Gamel

EVALUATION FORM
RESEARCH METHODOLOGY PRACTICAL WORK
Student Name/NIM :
Group :
Instructure :
Point Description Week Total

evaluation 1 2 3 4 5
A. Substance 1. Capable to present the study method of article 20
into template
2. Capable to formulate research question, 10
objective, hypothesis, plan study design
3. Capable to define study population, subject, 10
variable, sampling technique dan sample size
4. Capable to define the measurement, data analisis, 10
statistical test method, and considerate ethical
issue in the study
B. Presentation 1. Understanding of material 30
2. Presentation method & contribution in subgroup 30
C. Professional 1. Respect for others: appreciate the difference, 10
Behaviour active listening attentively
2. Maintain trust: responsible to the task, discipline 10
(join/arrive on time, clothing neatly)
3. Critical thinking: give opinion and input according 10
practical topic, for other subgroup proposal
4. Communication: using clear and appropriate 10
language, including nonverbally
5. Using bahasa Indonesia/English according the 10
rules on scientific writing
D. Poster Poster is designed completly according to proposal 40
template, with appropriate design, color, and using
good and correct grammar
Notes :
Item C.5 : Reguler Class using bahasa Indonesia, Internasional Class using English
Item ‘A, B & C’ : given score in every meeting with the maximum 10 for very good. Maximal total
score after the 5 meetings is 200. Final score :  A-D /200 x 100 = .....................................
Signature,

LIST OF ARTICLE
RESEARCH METHODOLOGY PRACTICAL WORK - BLOCK 1.9 (2023)
Research Type Tittle
Basic medical 1. Characteristics of gut microbiota in people with obesity

research 2. Effects of long-term smoking on the activity and mRNA expression of CYP
isozymes in rats
Clinical research 3. Capital Bio Mycobacterium real-time polymerase chain reaction detection
test: Rapid diagnosis of Mycobacterium tuberculosis and nontuberculous
mycobacterial infection
4. Cemiplimab monotherapy for first-line treatment of advanced non-small-
cell lung cancer with PD-L1 of at least 50%: a multicentre, open-label,
global, phase 3, randomised, controlled trial
Public health 5. Healthy lifestyle and life expectancy free of cancer, cardiovascular disease,
(causation) and type 2 diabetes: prospective cohort study
6. Socioeconomic status and its relation with breast cancer recurrence and
survival in young women in the Netherlands
7. Pregnancy duration and endometrial cancer risk: nationwide cohort study
Qualitative study 8. “Alas … my sickness becomes my family’s burden”: A nested qualitative
study on the experience of advanced breast cancer patients across the
disease trajectory in Indonesia
9. Barriers and facilitators for individualized rehabilitation during breast
cancer treatment – a focus group study exploring health care professionals’
experiences
10. Men’s Sexual Issues After Breast Cancer in Their Wives
11. Exploring Possible Causes For Delays Seeking Medical Treatment Among
Indonesian Women With Breast Cancer

PLOS ONE
RESEARCH ARTICLE
Characteristics of gut microbiota in people with

obesity
Mengmeng Duan1, Yuezhu Wang2, Qiang Zhang3, Rong Zou1, Min Guo1,
Huajun Zheng 1*
1 NHC Key Lab. of Reproduction Regulation (Shanghai Institute of Planned Parenthood Research), Fudan University,
Shanghai, China, 2 Shanghai-MOST Key Laboratory of Health and Disease Genomics, Chinese National Human
Genome Center at Shanghai, Shanghai, China, 3 Department of Obstetrics and Gynecology, Affiliated Hospital of
Zunyi Medical College, Zunyi, China
* zhenghj@chgc.sh.cn
Abstract
Background
Obesity is the cause of cardiovascular diseases and other diseases, leading to increased
OPEN ACCESS
medical costs, and causing a great burden to individuals, families and society. The prevalence of
Citation: Duan M, Wang Y, Zhang Q, Zou R, Guo obesity is increasing and has become a global health problem. There is growing evidence that gut
M, Zheng H (2021) Characteristics of gut microbiota
microbiota plays an important role in obesity. In this article, we revealed the differences in the gut
in people with obesity. PLoS ONE 16(8): e0255446.
https://doi.org/10.1371/journal. pone.0255446 microbiota between 21 people with obesity and 21 control subjects, and predicted the functional
potential changes by 16S rRNA sequencing of the fecal bacteria of the subjects.
Editor: Zongxin Ling, State Key Laboratory for
Diagnosis and Treatment of Infectious Diseases,
CHINA Methods
Received: April 23, 2021 The raw sequencing data of 21 healthy Beijing volunteers was downloaded from Microbial Genome
Accepted: July 19, 2021 Published: Database System. Microbial 16S rRNA genes of 21 adults with obesity were sequenced on an Illumina
MiSeq instrument and analyzed by using bioinformatics and statistical methods.
August 10, 2021
Copyright: © 2021 Duan et al. This is an open access Results

article distributed under the terms of the Creative
Commons Attribution License, which permits The diversity of gut microbiota in people with obesity decreased significantly. There were significant
unrestricted use, distribution, and reproduction in any differences in gut microbiota between the Obesity and Control group at different levels. At the
medium, provided the original author and source are
phylum level, Firmicutes, Bacteroidetes, Actinobacteria and Fusobacteria are significantly
credited.
different between the Obesity and Control group. In people with obesity, the ratio of
Data Availability Statement: The datasets analyzed
Firmicutes/Bacteroidetes decreased significantly. At the genus level, there were significant
during the current study are available in the Microbial
Genome Database System repository, differences among the 16 major genera, of which four genera Prevotella, Megamo- nas,
(http://data.mypathogen.org, ID= ICDC-20180224- Fusobacterium and Blautia increased significantly in people with obesity, while the remaining 12
143509). The datasets generated during the current genera, Faecalibacterium, Lachnospiracea_incertae_sedis, Gemmiger and Clostridium XlVa,
study are available in the GenBank Sequence Read
Archive repository, (accession number etc. decreased significantly. At the species level, nine species including Bacteroides uniformis and
PRJNA593870). Prevotella copri had significant differences. Compared with the control group, subjects with obesity
Funding: This work was supported by the were abnormalities in 57 pathways, mainly in Carbohy- drate metabolism and Lipid metabolism.
Development Fund for Shanghai Talents [Grant
number 201567].
PLOS ONE | https://doi.org/10.1371/journal.pone.0255446 August 10, 2021 1/

PLOS ONE Gut microbiota of obesity
Competing interests: The authors have declared

that no competing interests exist.
Conclusions
Overall, our study revealed differences in the gut microbiota between people with obesity and control
subjects, providing novel target for the treatment of individuals with obesity.
Introduction
The most common method used to classify obesity is body mass index (BMI), which is calcu-
lated as weight divided by the square of height (kg/m2). When the BMI value is greater than
or equal to 30 kg/m2, it is obese [1]. A number of studies have shown that the prevalence of
obesity in different countries is increasing year by year [2–4]. In 2005, there were approxi-
mately 396 million adults with obesity in the world. By 2030, the number of adults with
obesity may increase to 573 million [5]. The prevalence of childhood obesity has also
increased significantly worldwide [6]. Hayes A et al. studied the relationship between
childhood obe-
sity and direct medical expenses, and found that their medical expenses were 1.62 times than
that of normal-weight children [7]. Childhood obesity can also lead to high medical costs for
a lifetime [8]. Obesity is a major cause of kidney and cardiovascular diseases [9]. Obesity
will always be a serious health risk [1] and imposes a heavy burden on individuals and
society.
Therefore, it is necessary to study the causes of obesity and intervene to effectively reduce
obesity.
A variety of factors including food choices, behavior, heredity and gut microbiota may
contribute to obesity [10]. The choice of food directly affects calorie intake [10], and the
daily consumption of sugary drinks increases the risk of obesity [11]. There is evidence
that variations in the microbiota play a larger role in the pathogenesis of obesity [12]. The
gut microbiota is important for human health, affecting the development of metabolic
diseases
and gastrointestinal diseases. Diet and the environment have an important impact on shap-
ing the gut microbiota [13]. Newborns are born without gut microbiota and gradually form a
stable gut microbiota structure at the age of 3–4 [14]. At present, the complete bacterial spe-
cies of human gut microbiota is still uncertain. In addition to the 553 species previously cul-
tured from the intestinal tract, Almeida A et al. also identified 1,952 candidate species that
were not cultured [15]. Bacteroidetes, Firmicutes, and Actinobacteria are the three most
abundant phyla in the intestine [14]. The gut microbiota of obesity and lean people is
different, and the microbiota of people with obesity has an increased ability to get energy
from
their diet. Colonization of ‘obesity microbiota’ in sterile mice resulted in a significant
increase in fat than colonization of ‘lean microbiota’ [16]. Intestinal anaerobic bacteria,
including Firmicutes and Bacteroidetes, could hydrolyze carbohydrates that are indigestible
in the gut, producing short-chain fatty acids (SCFAs) including acetate, propionate and
butyrate, which have an effect on human health [17]. Free fatty acid receptor 3/G-protein
coupled receptor 41 (FFAR3/GPR41) is the receptor for SCFAs, which is related to reduced
food intake, increased energy consumption and expression of leptin hormone [18]. There-
fore, anaerobic bacteria can inhibit obesity.
In order to study the characteristics of the gut microbiota of people with obesity, we com-
pared the gut microbiota of 21 people with obesity from Shandong Province of China and 21
normal people from Beijing by 16S rRNA sequencing of fecal samples. The results of this
study provide strong support for regulating gut microbiota to reduce obesity.
Materials and methods

Sample collection
Twenty-one adults with obesity were recruited from a gym of Jinan, Shandong Province
(mean BMI 35.3, ranging from 31.4 to 49.5, 16 males, 5 females, with an average age of 35
years). All of them were not under dietary or medication control to lose weight, and did not
take antibiotics for one month before fecal sample collection. Subject feces were collected and
stored at -80 ˚C for subsequent analysis to reveal the differences in gut microbiota between
people with obesity and control subjects. The study was approved by the Medical Ethical Com-
mittee of Shanghai Institute of Planned Parenthood Research (NO: PJ2019-17), and written
informed consents were obtained from all subjects involved in this study. The raw sequencing
data of 21 healthy Beijing volunteers (mean BMI 20.2, ranging from 16.5 to 25.4, 10 females,
11 males, with an average age of 26 years) was used as healthy control [19], which was
sequenced using the same method as this study and downloaded from Microbial Genome
Database System (http://data.mypathogen.org, ID = ICDC-20180224-143509).
Genomic DNA extraction, PCR amplification and 16S rRNA

gene sequencing
Total genomic DNA was extracted using QIAamp DNA Stool Mini Kit (QIAGEN). V3-4
region of 16S rRNA genes in people with obesity was amplified with primers 338F (5’-CCTA
CGGGNGGCWGCAG-3’) and 806R (5’-GACTACHVGGGTATCTAATCC-3’) using TransStart Fas-
tpfu DNA Polymerase (TransGen). Cycling conditions were as follows: denaturation at 95˚C
for 2 min, 20 cycles of amplification (45 s at 95˚C, 30 s at 55˚C and 30 s at 72˚C), extension
72˚C for 5 min. Three repeat PCR amplifications of each sample were purified with AxyPrep
DNA Gewendul Extraction kit (AXYGEN) and assessed by spectrophotometry (QuantiFluor-
ST, Promega). The equivalent pooled 16S rRNA PCR amplicons were sequenced on an Illu-
mina MiSeq instrument.
Bioinformatics and statistical analysis

Raw paired FASTQ files were processed using Mothur (version 1.39.5) [20]. The following
criteria were used to remove low quality sequences: containing ambiguous bases, the length
shorter than 380bp, chimeric sequence, and contaminant sequence. After data normalization,
the SILVA reference database [21] (V138) was used as reference for OTU (Operational
taxonomic unit) identification under the threshold of 97% similarity. The taxonomic affiliation
assignments were based on Ribosomal Database Project [22] at default parameter (80%
threshold). Commu- nity richness, evenness and diversity analysis (ACE, Chao, Simpsonenven,
Shannon, Simpson, and Good’s coverage) were performed using Mothur. Differences between
obesity and control samples were assessed using Analysis of Molecular Variance (AMOVA) in
Mothur. Microbiome functions were predicted using PICRUSt2 [23] through normalizing the
16S rRNA copy numbers. The taxonomy (OTU, genus, family and phylum) abundance
differences and microbiome functional differences between the Obesity and Control groups
were analyzed by STAMP [24] (P<0.05, difference between proportions >0.5 or ratio of
proportion >1.2). The correlation coefficients of abundant genera were calculated using SparCC
and visualized using Cytoscape version 3.8.2, and only correlations with SparCC > 0.35 or <-
0.35 and P < 0.01 were included.
Accession numbers
The sequence data have been submitted to the GenBank Sequence Read Archive (accession
number PRJNA593870).

Results
Bacterial populations in Obesity and Control gut
A total of 1,943,896 (39,477~ 59,690) high-quality sequences of 16S rRNA genes from 42 sam-
ples were obtained by high-throughput DNA sequencing. To normalize data avoiding
statistical bias, 39,477 16S rRNA genes of each sample were chosen to calculate richness,
evenness and diversity of the bacterial community at 97% similarity. After 42 samples were
classified into two groups (Obesity and Control), a total of 10,875 OTUs were obtained. Of
which 40.41% of OTUs were shared by the two groups, and the Obesity group had 1,454
OTUs less than the Control group (Fig 1) The Good’s coverage was over 99.88% for the two
groups, indicating that the sequencing depth was sufficient for gut microbiota investigation
of obesity and health people.
According to the alpha diversity (Fig 2), obese adults showed lower richness (ACE index
and Chao index), lower evenness (Shannon even index), and lower diversity (Shannon
index), coinciding with the lower OTUs number observed in the Obesity group.
Microbiota of Obesity and Control

The total gut microbiota was revealed through the phylogenetic and taxonomic assessments of
the 16S rRNA V3-V4 regions. About 99.20% (±0.0014) of microbiota could be aligned to nine
phyla, 94.92% (±0.0254) to 58 families and 84.04% (±0.0641) to 136 genera. At the phylum
level, Bacteroidetes (average 43.12%, ±0.1069), Firmicutes (average 49.38%, ±0.1208), Proteo-
bacteria (average 3.64%, ±0.0032) and Fusobacteria (average 1.78%, ±0.0176) were the four
Fig 1. Venn chart illustrating the common and unique OTUs between Obesity and Control groups.
https://doi.org/10.1371/journal.pone.0255446.g001

Fig 2. Comparison of bacterial richness, evenness and diversity between Obesity and Control groups.
most abundant bacterial divisions in the gut, which were also the common phyla in all samples.
At the family level, 12 families were most abundant in two groups (>1% in at least one group,
accounting for over 87.55% in each group, Fig 3). Among them, Lachnospiraceae, Ruminococ-
caceae, Veillonellaceae, Prevotellaceae and Bacteroidaceae were dominant families (>80.38% of
each group). In 136 identified genera, 25 genera were relatively abundant (>0.5% in at least
one group, Fig 4), including Bacteroides, Prevotella, Megamonas and Faecalibacterium, etc.
Among major genera, there were five ubiquitous (core) genera which were consistently found
across all analyzed samples and comprised >24.63% of each group, that were genus Bacter-
oides, Lachnospiracea_incertae_sedis, Clostridium XlVa, Escherichia/Shigella and Blautia.
Bacterial composition changes between Obesity and Control

AMOVA test showed a significant difference (P<0.05) between the Obesity and Control
groups, and the PCoA analysis (Fig 5) also revealed that subjects of Obesity and Control
were apart from each group based on the gut microbiota composition.
At the phylum level, four major abundant phyla showed significant variations between the
Obesity (95.19%) and Control (95.70%) group, including Bacteroidetes, Actinobacteria, Fuso-
bacteria and Firmicutes (Table 1). In our study, the abundance of Firmicutes decreased, while
the abundance of Bacteroidetes increased in people with obesity. The ratio of Firmicutes/Bac-
teroidetes also decreased. At the family level (Fig 3), a total of six major families had significant
difference between the Obesity (56.80%) and Control (47.92%) group. The six major families
are Prevotellaceae, Veillonellaceae, Ruminococcaceae, Fusobacteriaceae, Porphyromonadaceae

Fig 3. Major abundant families in Obesity and Control groups. The families with significant richness differences between the two groups were
labeled with an asterisk.
and Rikenellaceae, and three of them belong to Bacteroidetes. At the genus level (Fig 6), a total
of 16 major genera had a significant difference between the Obesity (54.29%) and Control
(45.52%) group, and 10 of them belong to Firmicutes. Of the 16 major genera, the abundance
of four genera increased, while the remaining 12 decreased among the people with obesity. At
the species level (OTUs from top 50, Table 2), we found nine abundant species had differences
between the Obesity and Control group. Six of them were decreased in obesity gut microbiota,
including Faecalibacterium prausnitzii, Barnesiella intestinihominis, Alistipes putredinis, Bac-
teroides uniformis, Parabacteroides distasonis and Fusicatenibacter saccharivorans. Three spe-
cies were increased in obesity gut microbiota, including Megamonas funiformis, Prevotella
copri and Fusobacterium mortiferum.
Microbial co-abundance networks

To characterize the microbial interactions of gut microbiota, correlation patterns of the top 25
genera were calculated (Fig 7). In total, 48 positive and 20 negative significant correlations were
found between 21 genera, of which Blautia showed only negative correlation while Bifidobacter-
ium, Fusicatenibacter and Parasutterella showed only positive correlation with other genera.
Predicted functional potential change between Obesity and

Normal microbiome
We used PICRUSt2 to predict the functional potential changes for Obesity (Fig 8). A total
of 57 pathways showed significant differences between the Obesity and Control group, with

Fig 4. Major abundant genera in Obesity and Control groups. The genera with significant richness differences between the two groups were
labeled with an asterisk.
several pathways involved in Carbohydrate metabolism and sugar transport enriched in the
Obesity group.
Discussion
Gut microbes can influence obesity by regulating metabolism, homoeostasis, appetite and
energy balance, which together play crucial roles in obesity [25]. The structure, function and
diversity of the gut microbiota among people with obesity are different from those of normal
people [26]. Individuals with obesity usually show lower biodiversity and richness [12]. Our
results indicated that microbiota compositions were different between the Obesity and Control
group, with the Obesity group showing lower diversity compared with the Control group (Fig
2). Many literatures have shown that obesity is related to the abundance of Firmicutes and Bac-
teroidetes and the ratio of Firmicutes/Bacteroidetes, but their changes are controversial in dif-
ferent studies [27–29]. The research of Ley RE et al. found that compared with normal people,
Bacteroidetes are 50% lower in people with obesity, but their Firmicutes are higher, and losing
weight by fat restricted or carbohydrate restricted dietary intervention can increase the abun-
dance of Bacteroidetes [30]. In people with obesity induced by glucocorticoid (GC), the abun-
dance of Firmicutes was increased and Bacteroidetes was decreased [31]. The research of
Schwiertz A et al. showed that Firmicutes were significantly reduced in people with obesity,
while Bacteroidetes were significantly increased, which led to a significant decrease in the ratio
of Firmicutes/Bacteroidetes [27]. In our study, compared with normal subjects, Firmicutes of
subjects with obesity were significantly decreased (control: 61.45%, obesity: 37.39%), while

Fig 5. Principal co-ordinates analysis (PCoA) with Bray-Curtis dissimilarity based on genera.
Bacteroidetes were significantly increased (control: 32.44%, obesity: 53.73%) (Table 1), and the
ratio of Firmicutes/Bacteroidetes was decreased, which was consistent with the research results
of Schwiertz A et al. [27]. The dispute about the changes of Firmicutes and Bacteroidetes may
be related to the region, environment and diet, for example, people in the Shandong Province
of China prefer food made of flour. At the family level, Prevotellaceae, Porphyromonadaceae
and Rikenellaceae belong to Bacteroidetes. Among them, Prevotellaceae is increased in people
with obesity, while the other two are decreased in people with obesity. Veillonellaceae and
Table 1. Significantly different phyla of gut microbiota between the Obesity and Control groups.
phylum Control: mean rel. Control: std. dev. Obesity: mean rel. Obesity: std. dev. p- Difference between 95.0% lower 95.0% upper
freq. (%) (%) freq. (%) (%) values means CI CI
Firmicutes 61.45 12.61 37.39 20.09 6.94E- 24.06 13.28 34.85
05
Bacteroidetes 32.44 12.29 53.73 21.74 6.01E- -21.29 -32.67 -9.91
04
Actinobacteria 1.79 2.05 0.56 0.71 1.83E- 1.22 0.23 2.22
02
Fusobacteria 0.02 0.08 3.51 6.57 2.75E- -3.49 -6.55 -0.43
02
https://doi.org/10.1371/journal.pone.0255446.t001

Fig 6. Gut microbiota comparison between obesity and control on the genus level. The genera with significant richness difference (P < 0.05,
computed by STAMP) between the two groups were shown.
Ruminococcaceae belong to Firmicutes, and Veillonellaceae is increased in people with obesity,

while Ruminococcaceae is decreased in people with obesity. Similarly, at the genus level, differ-
ent genera belonging to the same phylum do not change in the same way. These may also be
the reason why the changes of Firmicutes and Bacteroidetes are controversial in different
studies.
Table 2. Significantly different species of gut microbiota between the Obesity and Control groups.
species Control: mean rel. Control: std. Obesity: mean rel. Obesity: std. p- Difference between 95.0% 95.0%
freq. (%) dev. (%) freq. (%) dev. (%) values means lower CI upper CI
Faecalibacterium 13.34 6.65 2.96 5.05 2.40E- 10.38 6.60 14.16
prausnitzii 06
Barnesiella 0.53 0.51 0.03 0.09 2.90E- 0.50 0.26 0.74
intestinihominis 04
Alistipes putredinis 0.96 1.01 0.04 0.13 6.25E- 0.92 0.44 1.39
04
Bacteroides uniformis 2.22 2.55 0.20 0.27 2.07E- 2.02 0.83 3.21
03
Megamonas funiformis 0.79 1.83 8.45 10.31 3.59E- -7.66 -12.53 -2.80
03
Prevotella copri 5.74 11.97 24.86 25.18 4.71E- -19.12 -31.88 -6.36
03
Parabacteroides 0.62 1.03 0.09 0.10 3.22E- 0.53 0.05 1.01
distasonis 02
Fusobacterium 0.02 0.08 2.84 5.81 4.22E- -2.82 -5.53 -0.11
mortiferum 02
Fusicatenibacter 0.64 0.62 0.27 0.49 4.57E- 0.37 0.01 0.73
saccharivorans 02
https://doi.org/10.1371/journal.pone.0255446.t002

Fig 7. SparCC correlation networks observed between genera. The pie charts show relative genera proportions in the Obesity
(yellow) and Control groups (blue), and the circle size represents the reads number. Line color: red (positive relationship) and grey
(negative relationship).
The intestinal permeability and metabolites of people with obesity are different from nor-
mal people. High-fat diet reduces the expression of tight junction proteins including zonula
occludens-1 (ZO-1) and occludin, thereby disrupting the integrity of the intestinal
epithelium and increasing intestinal permeability [32,33].
SCFAs are metabolites of intestinal microbiota, which are generated through the fermenta-
tion of indigestible substances by gut microbiota [34]. SCFAs, primarily butyrate, propionate
and acetate, can stimulate the release of the anorexigenic peptides including Peptide YY
(PYY), amylin and Glucagon-like peptide 1 (GLP-1) and inhibit obesity caused by a high-fat
diet. Among them, Butyrate significantly inhibits food intake [35]. Butyrate can also reduce
intestinal permeability and improve intestinal barrier function by up-regulating tight
junction protein expression [36].
The high concentration of SCFAs in feces is related to obesity, which may be caused by
the low absorption efficiency of SCFAs [37]. The concentration of SCFAs in the feces of
people with obesity is increased, while the higher concentration of SCFAs in feces is related
to the lower gut microbiota diversity [37]. Therefore, the gut microbiota diversity of people
with obesity is decreased, which is consistent with our conclusion. Bacteroides uniformis is
negatively correlated with fecal butyrate, while Blautia and Prevotella copri are positively
correlated with
PLOS ONE | https://doi.org/10.1371/journal.pone.0255446 August 10, 2021 10 /

Fig 8. Predict the functional potential changes between obesity and control by using PICRUSt2. Panel a shows
the changes of 45 pathways belonging to Metabolism between the Obesity and Control group. Panel b shows the
changes of 7 pathways belonging to Genetic Information Processing between the Obesity and Control group. Panel c
shows the changes of 5 pathways belonging to Environmental Information Processing and Cellular Processes
between the Obesity and Control group.
fecal butyrate and propionate [37]. In our study, the concentration of Bacteroides uniformis is
significantly reduced while Blautia and Prevotella copri are significantly increased in individu-
als with obesity (Table 2), indicating that fecal SCFAs in the Obesity group is increased. The
study of Lin H et al. had found that Blautia was positively correlated with deoxycholic acid
(DCA), which was increased in rat with obesity on high-fat diet [38]. Increased DCA can pro-
mote obesity-associated diseases [39].
Our study showed that the abundance of Bifidobacterium is significantly reduced in the
Obesity group (0.33%) compared to the Control group (1.21%) (Fig 6). Bifidobacterium can
reduce obesity-related inflammation by restoring the balance of lymphocyte-macrophage, so it
has an anti-obesity effect [40]. Other literature also reports that some species or strains of Bifi-
dobacterium have anti-obesity effects [41], and the concentration of Bifidobacterium in the
stool of individuals with obesity is significantly reduced [27]. Our results also showed that Pre-
votellaceae and Veillonellaceae were significantly increased in people with obesity. Serena C

et al. reported that obesity is associated with increased levels of succinate produced by Prevotel-
laceae and Veillonellaceae which were increased in individuals with obesity [42]. In our study,
a significant difference between the Obesity group (30.57%) and the Control group (7.22%)
was found on Prevotella. Hu HJ et al. reported that Prevotella was positively correlated with tri-
glycerides (TG) and high-sensitive C-reactive protein (hs-crp), and increased significantly in
individuals with obesity [43]. Gao R et al. reported that among individuals with obesity, the
beneficial bacteria such as Bifidobacterium, Faecalibacterium and butyrate-producing Rumino-
coccaceae are significantly reduced, while the potential opportunistic pathogens including
Fusobacterium and Escherichia/Shigella are increased [44]. In our results, the changes of Bifido-
bacterium, Faecalibacterium Ruminococcaceae Fusobacterium and Escherichia/Shigella are con-
sistent with the study of Gao R et al.
We predicted the functional potential changes between control and obesity using
PICRUSt2. It can be seen that metabolic pathways have undergone significant changes in
people with obesity, with pathways involved in carbohydrate metabolism and transport
enriched in the the Obesity group, including Fructose and mannose metabolism, Galactose
metabolism, Starch and sucrose metabolism, TCA cycle and PTS system, while pathways
involved in Lipid metabolism reduced in the Obesity group (Fig 8).
The major limitation of this study is that the average age and geographical location are
different between the two groups. The Obesity group was recruited from Jinan with an
average age of 35 years, while the Control group was located in Beijing with an average age of
26 years. Since both Jinan and Beijing are located in the north of China, with a distance of
about 410 km and sharing the same environment and eating habits, we ignored the impact of
geographical differences on the gut microbiota. Meanwhile, the human gut microbiota is
reported to be established in early life [45], and the composition is relatively stable throughout
adulthood [46,47]. Based on this reason, we think the data from these two groups are
comparable. Never- theless, subsequent studies will consider the impact of these two factors
and select samples with the same geographical location and ages.
Conclusions
In our study, significant differences in microbiota between obesity and control subjects were
revealed at different levels. The genus Prevotella, Megamonas, Fusobacterium and Blautia were
significantly increased in subjects with obesity, while the genus Faecalibacterium, Parabacter-
oides, Bifidobacterium and Alistipes were significantly decreased. At the species level, we found
that there were significant differences between the Control and the Obesity group in nine spe-
cies, of which Prevotella copri was significantly increased in the obesity group. We also found
that subjects with obesity have abnormalities in Carbohydrate metabolism. These findings pro-
vide support that gut microbiota can be used as target for treatment of obesity.
Acknowledgments
We would like to acknowledge all the participants who kindly took part in this research.
Author Contributions
Conceptualization: Huajun Zheng.
Data curation: Mengmeng Duan, Qiang Zhang.
Formal analysis: Yuezhu Wang.
Funding acquisition: Huajun Zheng.

Methodology: Yuezhu Wang, Rong Zou, Min Guo.

Project administration: Huajun Zheng.
Writing – original draft: Mengmeng Duan, Yuezhu Wang.
Writing – review & editing: Huajun Zheng.
References
1. Engin A. The Definition and Prevalence of Obesity and Metabolic Syndrome. Adv Exp Med Biol. 2017; 960: 1–
17. https://doi.org/10.1007/978-3-319-48382-5_1 PMID: 28585193
2. Twells LK, Gregory DM, Reddigan J, Midodzi WK. Current and predicted prevalence of obesity in Can- ada: a
trend analysis. CMAJ Open. 2014; 2: E18–26. https://doi.org/10.9778/cmajo.20130016 PMID: 25077121
3. Wang Y, Beydoun MA, Liang L, Caballero B, Kumanyika SK. Will All Americans Become Overweight or
Obese? Estimating the Progression and Cost of the US Obesity Epidemic. Obesity (Silver Spring). 2008; 16:
2323–2330. https://doi.org/10.1038/oby.2008.351 PMID: 18719634
4. Hayes AJ, Lung TWC, Bauman A, Howard K. Modelling obesity trends in Australia: unravelling the past and
predicting the future. Int J Obes (Lond). 2017; 41: 178–185. https://doi.org/10.1038/ijo.2016.165 PMID:
27671035
5. Kelly T, Yang W, Chen CS, Reynolds K, He J. Global burden of obesity in 2005 and projections to 2030. Int J
Obes (Lond). 2008; 32: 1431–1437. https://doi.org/10.1038/ijo.2008.102 PMID: 18607383
6. Ebbeling CB, Pawlak DB, Ludwig DS. Childhood obesity: public-health crisis, common sense cure. Lan- cet. 2002;
360: 473–482. https://doi.org/10.1016/S0140-6736(02)09678-2 PMID: 12241736
7. Hayes A, Chevalier A, D’Souza M, Baur L, Wen LM, Simpson J. Early childhood obesity: Association with
healthcare expenditure in Australia. Obesity. 2016; 24: 1752–1758. https://doi.org/10.1002/oby. 21544 PMID:
27380909
8. Sonntag D, Ali S, Bock FD. Lifetime indirect cost of childhood overweight and obesity: A decision analytic
model. Obesity. 2016; 24: 200–206. https://doi.org/10.1002/oby.21323 PMID: 26638187
9. Wang XX, Wang D, Luo YH, Myakala K, Dobrinskikh E, Rosenberg AZ, et al. FXR/TGR5 Dual Agonist
Prevents Progression of Nephropathy in Diabetes and Obesity. J Am Soc Nephrol. 2018; 29: 118–137.
https://doi.org/10.1681/ASN.2017020222 PMID: 29089371
10. Apovian CM. Obesity: definition, comorbidities, causes, and burden. Am J Manag Care. 2016; 22: s176–
185. PMID: 27356115
11. Pereira MA. Sugar-Sweetened and Artificially-Sweetened Beverages in Relation to Obesity Risk. Adv Nutr.
2014; 5: 797–808. https://doi.org/10.3945/an.114.007062 PMID: 25398745
12. Isolauri E. Microbiota and Obesity. Nestle Nutr Inst Workshop Ser. 2017; 88: 95–105. https://doi.org/10.
1159/000455217 PMID: 28346926
13. Hills RD Jr, Pontefract BA, Mishcon HR, Black CA, Sutton SC, Theberge CR. Gut Microbiome: Pro- found
Implications for Diet and Disease. Nutrients. 2019; 11: 1613. https://doi.org/10.3390/nu11071613 PMID:
31315227
14. den Besten G, van Eunen K, Groen AK, Venema K, Reijngoud DJ, Bakker BM. The role of short-chain fatty acids
in the interplay between diet, gut microbiota, and host energy metabolism. J Lipid Res. 2013; 54: 2325–2340.
https://doi.org/10.1194/jlr.R036012 PMID: 23821742
15. Almeida A, Mitchell AL, Boland M, Forster SC, Gloor GB, Tarkowska A, et al. A new genomic blueprint of the
human gut microbiota. Nature. 2019; 568: 499–504. https://doi.org/10.1038/s41586-019-0965-1 PMID:
30745586
16. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. An obesity-associated gut microbiome
with increased capacity for energy harvest. Nature. 2006; 444: 1027–1031. https://doi.org/ 10.1038/nature05414
PMID: 17183312
17. Andoh A. Physiological Role of Gut Microbiota for Maintaining Human Health. Digestion. 2016; 93: 176–
181. https://doi.org/10.1159/000444066 PMID: 26859303
18. Ohira H, Tsutsui W, Fujioka Y. Are Short Chain Fatty Acids in Gut Microbiota Defensive Players for
Inflammation and Atherosclerosis? J Atheroscler Thromb. 2017; 24: 660–672. https://doi.org/10.5551/
jat.RV17006 PMID: 28552897
19. Zhang W, Li J, Lu S, Han N, Miao JJ, Zhang TT, et al. Gut microbiota community characteristics and disease-
related microorganism pattern in a population of healthy Chinese people. Sci Rep. 2019; 9: 1594.
https://doi.org/10.1038/s41598-018-36318-y PMID: 30733472

20. Schloss PD, Gevers D, Westcott SL. Reducing the effects of PCR amplification and sequencing arti- facts on
16S rRNA-based studies. PLoS One. 2011; 6: e27310. https://doi.org/10.1371/journal.pone. 0027310 PMID:
22194782
21. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database
project: improved data processing and web-based tools. Nucleic Acids Res. 2012; 41: D590– D596.
https://doi.org/10.1093/nar/gks1219 PMID: 23193283
22. Cole JR, Wang Q, Fish JA, Chai B, McGarrell DM, Sun Y, et al. The Ribosomal Database Project: improved
alignments and new tools for rRNA analysis. Nucleic Acids Res. 2009; 37: D141–D145.
https://doi.org/10.1093/nar/gkn879 PMID: 19004872
23. Douglas GM, Maffei VJ, Zaneveld JR, Yurgel SN, Brown JR, et al. (2020) PICRUSt2 for prediction of
metagenome functions. Nat Biotechnol 38: 685–688. https://doi.org/10.1038/s41587-020-0548-6 PMID:
32483366
24. Parks DH, Tyson GW, Hugenholtz P, Beiko RG. STAMP: statistical analysis of taxonomic and functional
profiles. Bioinformatics. 2014; 30: 3123–3124. https://doi.org/10.1093/bioinformatics/btu494 PMID:
25061070
25. Torres-Fuentes C, Schellekens H, Dinan TG, Cryan JF. The microbiota-gut-brain axis in obesity. Lancet
Gastroenterol Hepatol, 2017; 2: 747–756. https://doi.org/10.1016/S2468-1253(17)30147-4 PMID: 28844808
26. Cheng L, Chen YH, Zhang X, Zheng XJ, Cao JX, Wu ZF, et al. A metagenomic analysis of the modula- tory
effect of Cyclocarya paliurus flavonoids on the intestinal microbiome in a high-fat diet-induced obesity mouse
model. J Sci Food Agric. 2019; 99: 3967–3975. https://doi.org/10.1002/jsfa.9622 PMID: 30719705
27. Schwiertz A, Taras D, Scha¨ fer K, Beijer S, Bos NA, Donus C, et al. Microbiota and SCFA in Lean and
Overweight Healthy Subjects. Obesity (Silver Spring). 2010; 18(1): 190–195. https://doi.org/10.1038/
oby.2009.167 PMID: 19498350
28. Koliada A, Syzenko G, Moseiko V, Budovska L, Puchkov K, Perederiy V, et al. Association between body mass
index and Firmicutes/Bacteroidetes ratio in an adult Ukrainian population. BMC Microbiol. 2017; 17: 120.
https://doi.org/10.1186/s12866-017-1027-1 PMID: 28532414
29. Riva A, Borgo F, Lassandro C, Verduci E, Morace G, Borghi E, et al. Pediatric obesity is associated with an altered
gut microbiota and discordant shifts inFirmicutes populations. Environ Microbiol. 2016; 19: 95–105.
https://doi.org/10.1111/1462-2920.13463 PMID: 27450202
30. Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Human gut microbes associated with obesity. Nature. 2006; 444:
1022–1023. https://doi.org/10.1038/4441022a PMID: 17183309
31. Qiu DX, Xia ZW, Deng J, Jiao X, Liu LZ, Li J. Glucorticoid-induced obesity individuals have distinct signatures
of the gut microbiome. BioFactors. 2019; 45: 892–901. https://doi.org/10.1002/biof.1565 PMID: 31588658
32. Chang CJ, Lin CS, Lu CC, Martel J, Ko YF, Ojcius DM, et al. Ganoderma lucidum reduces obesity in mice by
modulating the composition of the gut microbiota. Nat Commun. 2015; 6: 7489. https://doi.org/
10.1038/ncomms8489 PMID: 26102296
33. Brun P, Castagliuolo I, Leo VD, Buda A, Pinzani M, Palu` G, et al. Increased intestinal permeability in
obese mice: new evidence in the pathogenesis of nonalcoholic steatohepatitis. Am J Physiol Gastrointest Liver
Physiol. 2007; 292: G518–G525. https://doi.org/10.1152/ajpgi.00024.2006 PMID: 17023554
34. Zhi C, Huang J, Wang J, Cao H, Bai Y, Guo J, et al. Connection between gut microbiome and the development of
obesity. Eur J Clin Microbiol Infect Dis. 2019; 38: 1987–1998. https://doi.org/10.1007/ s10096-019-03623-x
PMID: 31367997
35. Lin HV, Frassetto A, Kowalik EJ Jr, Nawrocki AR, Lu MM, Kosinski JR, et al. Butyrate and propionate protect
against diet-induced obesity and regulate gut hormones via free fatty acid receptor 3-independent mechanisms.
PloS One. 2012; 7: e35240. https://doi.org/10.1371/journal.pone.0035240 PMID: 22506074
36. Wang HB, Wang PY, Wang X, Wan YL, Liu YC. Butyrate Enhances Intestinal Epithelial Barrier Function via Up-
Regulation of Tight Junction Protein Claudin-1 Transcription. Dig Dis Sci. 2012; 57: 3126–3135.
https://doi.org/10.1007/s10620-012-2259-4 PMID: 22684624
37. de la Cuesta-Zuluaga J, Mueller NT, A´ lvarez-Quintero R, Vela´ squez-Mej´ıa EP, Sierra JA, Corrales-
Agudelo V, et al. Higher Fecal Short-Chain Fatty Acid Levels Are Associated with Gut Microbiome Dys- biosis,
Obesity, Hypertension and Cardiometabolic Disease Risk Factors. Nutrients. 2019; 11: 51.
38. Lin H, An Y, Tang H, Wang Y. Alterations of Bile Acids and Gut Microbiota in Obesity Induced by High Fat
Diet in Rat Model. J Agric Food Chem. 2019; 67: 3624–3632. https://doi.org/10.1021/acs.jafc. 9b00249 PMID:
30832480

39. Yoshimoto S, Loo TM, Atarashi K, Kanda H, Sato S, Oyadomari S, et al. Obesity-induced gut microbial
metabolite promotes liver cancer through senescence secretome. Nature. 2013; 499: 97–101. https://
doi.org/10.1038/nature12347 PMID: 23803760
40. Hou YP, He QQ, Ouyang HM, Peng HS, Wang Q, Li J, et al. Human Gut Microbiota Associated with Obesity
in Chinese Children and Adolescents. Biomed Res Int. 2017; 2017: 7585989. https://doi.org/
10.1155/2017/7585989 PMID: 29214176
41. Chang CS, Ruan JW, Kao CY. An overview of microbiome based strategies on anti-obesity. Kaohsiung J Med
Sci. 2019; 35: 7–16. https://doi.org/10.1002/kjm2.12010 PMID: 30844145
42. Serena C, Ceperuelo-Mallafre´ V, Keiran N, Queipo-Ortuño MI, Bernal R, Gomez-Huelgas R, et al. Ele- vated
circulating levels of succinate in human obesity are linked to specific gut microbiota. ISME J. 2018; 12: 1642–
1657. https://doi.org/10.1038/s41396-018-0068-2 PMID: 29434314
43. Hu HJ, Park SG, Jang HB, Choi MK, Park KH, Kang JH, et al. Obesity Alters the Microbial Community Profile
in Korean Adolescents. PLoS One. 2015; 10: e0134333. https://doi.org/10.1371/journal.pone. 0134333 PMID:
26230509
44. Gao R, Zhu C, Li H, Yin M, Pan C, Huang L, et al. Dysbiosis Signatures of Gut Microbiota Along the Sequence
from Healthy, Young Patients to Those with Overweight and Obesity. Obesity (Silver Spring). 2018; 26: 351–361.
https://doi.org/10.1002/oby.22088 PMID: 29280312
45. Derrien M, Alvarez AS, de Vos WM. The Gut Microbiota in the First Decade of Life. Trends Microbiol. 2019;
27: 997–1010. https://doi.org/10.1016/j.tim.2019.08.001 PMID: 31474424
46. Faith JJ, Guruge JL, Charbonneau M, Subramanian S, Seedorf H, et al. The long-term stability of the human gut
microbiota. Science. 2013; 341: 1237439. https://doi.org/10.1126/science.1237439 PMID: 23828941
47. Saraswati S, Sitaraman R. Aging and the human gut microbiota-from correlation to causality. Front
Microbiol. 2014; 5: 764. https://doi.org/10.3389/fmicb.2014.00764 PMID: 25628610

Original Article
Effects of long-term smoking on the activity and mRNA expression

of CYP isozymes in rats
Xiao-Meng He, Ying Zhou, Ming-Zhen Xu, Yang Li, Hu-Qun Li, Wei-Yong Li
Institute of Clinical Pharmacy, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China
Contributions: (I) Conception and design: XM He, WY Li; (II) Administrative support: WY Li; (III) Provision of study materials or patients: HQ Li,
Y Li; (IV) Collection and assembly of data: Y Zhou; (V) Data analysis and interpretation: MZ Xu; (VI) Manuscript writing: All authors; (VII)
Final approval of manuscript: All authors.
Correspondence to: Wei-Yong Li. Institute of Clinical Pharmacy, Union Hospital, Tongji Medical College, Huazhong University of Science and
Technology, Wuhan 430022, China. Email: hxm1987@hust.edu.cn.
Background: To investigate the effect of long-term smoking on the activity and mRNA expression of
cytochrome P450 (CYP) enzymes.
Methods: Sprague-Dawley rats were exposed to passive smoking 6 cigarettes per day for 180 days.
A cocktail solution which contained phenacetin (20 mg/kg), tolbutamide (5 mg/kg), chlorzoxazone
(20 mg/kg) and midasolam (10 mg/kg) was given orally to rats. Blood samples were collected at pre−specified
time points and the concentrations of probe drugs in plasma were determined by HPLC-MS/MS. The
corresponding pharmacokinetic parameters were calculated by DAS 3.0. In addition, real-time RT-PCR
was used to analyze the mRNA expression of CYP1A2, CYP2C11, CYP2E1 and CYP3A1 in rat liver.
Results: Yhere were no significant inóuences of pharmacokinetic profiles of chlorsoYasone in long−term
smoking pretreated rats. But many pharmacokinetic profiles of phenacetin, tolbutamide, and midasolam in
long−term smoking pretreated rats were affected significantly (P<0.0S). Yhe results suggested that long−term
smoking had significant inhibition effects on CYP2C11 and CYPLA1 while CYP1A2 ensyme activity
was induced. Furthermore, Long-term smoking had no effects on rat CYP2E1. The mRNA expression results
were consistent with the pharmacokinetic results.
Conclusions: Alterations of CYP450 enzyme activities may fasten or slow down excretion with corresponding
inóuence on drug efficacy or toYicity in smokers compared to nonsmokers, which may lead to clinical failures
of lung cancer therapy or toxicity in smokers.
Keywords: Cytochrome P450 (CYP); long-term smoking; pharmacokinetics; lung cancer
Submitted Apr 15, 2015. Accepted for publication Sep 09, 2015.
doi: 10.3978/j.issn.2072-1439.2015.10.07
View this article at: http://dx.doi.org/10.3978/j.issn.2072-1439.2015.10.07
Introduction hepatic enzyme activity variation, one of the most important

mechanisms involved in alteration of therapeutic response
Tobacco smoking (TS) is proven a leading cause of
to drugs for treating lung cancer (4).
morbidity and mortality worldwide. Prevalence rates of
Cytochrome P450 (CYP) enzymes is a superfamily
smoking are very high, about 20.2% of adults in the
involved in the phase I drug metabolism of a variety of
United States are current smokers (1). TS is a high risk
drugs, chemicals, and endogenous. It is widely expressed
factor for lung cancer, cause millions of death per year (2).
in liver, lung, intestine, kidney, heart, and brain (5,6).
Meanwhile, there is a high prevalence of TS in patients
Approximately 75% of known therapeutic drugs are
even with a lung cancer diagnosis (3), making them more metabolized by members of the CYP1, CYP2, CYP3
likely to develop clinically drug-drug interactions (DDIs). families. Among them, CYP1A2, 2C9, 2E1 and 3A4 play
This may relate to
© Journal of Thoracic Disease. All rights www.jthoracdis.c J Thorac Dis 2015;7(10):1725-

1726 He et al. Long-term smoking on CYP isozymes
a dominant role in the metabolism of drugs and other chamber and exposed to commercially filtered cigarette
xenobiotics in human (7). The activity change of a certain (Hongyunhonghe Tobacco Co., Ltd. Guangzhou, China,
kind of enzyme can result in differences in the plasma levels 11 mg tar/1 mg nicotine) smoke generated from
of substrate drugs, leading to DDIs. Cigarette smoke is 6 cigarettes/day over a 2-h period for 5 days every week
known to have more than 4000 compounds, some of which lasting 180 days. For control group, SD rats were treated
are known poisonous and carcinogenic, such as nicotine, 4- similarly but did not receive cigarette smoke.
(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone (NNK), After complete the modeling, a cocktail solution at a
and polycyclic aromatic hydrocarbons (PAHs) (8). dose of 5 mL/kg, which contained phenacetin (20 mg/kg),
Additionally, previous studies showed that the constituents tolbutamide (5 mg/kg), chlorzoxazone (20 mg/kg) and
of TS can affect P450 cytochrome, resulting in alteration midazolam (10 mg/kg) (Sigma-Aldrich Company) in
of the metabolism of certain chemotherapies and targeted CMC-Na solution, was administered orally to all rats in
therapies for lung cancer (9,10). each group. Blood samples of each rat were collected as
Up to now, the ‘Cocktail’ method is widely used to the following times: pre-dose (0 h) and then at 0.25, 0.5,
evaluate CYP450 enzymes activities for it can simultaneously 0.75, 1, 1.5, 2, 3, 4, 6, 8, 12, 24, 48 h after probe drugs
reflect multiple isoenzyme activities, saving lots of the administration through the tail vein and immediately
experimental time and cost (11). Studies of smoking separated by centrifugation at 13,000 rpm for 10 min to
effects on CYP450 enzymes are mainly focused on one obtain plasma. The total volume of blood taken from each
or a part of CYP450 enzymes (12-14). Little is known animal did not exceed 2.2 mL. A total of 100 μL plasma
concerning toxicological effects of smoking on the samples were transferred to a new tube and stored frozen at
activity of CYP isozymes after long-term exposure time –80 Ԩ until analyzed. Rats of smoking group and control
in laboratory animals. The purpose of this paper was to group (n=4) were killed. Each liver sample was quickly
investigate the effect of long-term smoking on the activities removed and store at –80 Ԩ.
and mRNA expression levels of CYP isozymes in rats.
Activities of CYP1A2, CYP2C11, CYP2E1 and CYP3A1
were determined by pharmacokinetic parameters of four Measurement of drug concentration in plasma
probe drugs: phenacetin, tolbutamide, chlorzoxazone and Chromatography analysis was performed using an Agilent
midazolam, respectively. In addition, real-time RT-PCR 1200 HPLC system equipped with a quaternary pump,
was used to analyze long-term smoking effect on the mRNA a degasser, an autosampler, a thermostatted column
expression levels. compartment, and an API 4,000 triple quadrupole
instrument (AB/MDSSciex, Ontario, Canada).
Methods The separation was achieved on a 150 mm × 2.1 mm,
3.5 μm particle, Agilent Zorbax SB-C 18 column at 30 Ԩ.
Animals and treatment The mobile phase consisted of a mixture of 0.1% formic
Male Sprague-Dawley rats ranging in weight from 180~200 g, acid in water and acetonitrile (45:55, v: v) (Merck KGaA,
Germany) at a óow rate of 0.4 mL/min. A typical
obtained from Center of Experimental Animals, Wuhan
injection volume was 10 μL.
University, were housed under controlled environmental
conditions (23±1 Ԩ and a 12-h light/dark cycle). Animals The quantification was performed by the peak-area
method. The determination of target ions were performed
had free access to a commercial food diet and tap water. The
in SIM mode (m/z 180 for phenacetin, m/z 271 for
studies were approved by the Animal Ethics Committee
tolbutamide, m/z 167 for chlorzoxazone, m/z 327 for
of Huazhong University of Science and Technology and
midazolam and m/z 237 for IS) and positive ion electrospray
were in accordance with the Guide for the care and Use of
ionization interface. Drying gas flow was set to 6 L/min
Laboratory Animals by National Institute of Health.
and temperature to 350 Ԩ. Nebulizer pressure and capillary
Following 1 week of acclimatization, rats were randomly
voltage of the system were adjusted to 20 psi and 3,500 V,
divided into 2 groups (total 12 rats, n=6): long-term
respectively. The limits of quantification for phenacetin,
smoking group and control group. The passive smoke
tolbutamide, chlorzoxazone, and midazolam were 10, 20,
exposure was performed in a tightly sealed perspex
15 and 8 ng/mL.
chamber (80 cm × 60 cm × 60 cm). Rats were placed in the
The sample preparation was as follows: 0.2 mL

Journal of Thoracic Disease, Vol 7, No 10 October 2015 1727
Table 1 Primers sequences used for real-time PCR reaction
Gene 5'→3' Forward primer 3'→5' Reverse primer

CYP1A2 TCAACCTCGTGAAGAGCAGCA CCGAAGAGCATCACCTTCTC
CYP2C11 AAAAGCACAATCCGCAGTCT GCATCTGGCTCCTGTCTTTC
CYP2E1 CCTACATGGATGCTGTGGTG CTGGAAACTCATGGCTGTCA
CYP3A1 TCTGTGCAGAAGCATCGAGTG TGGGAGGTGCCTTATTGGG
β-actin CCAGATCATGTTTGAGACCTTCAA GTGGTACGACCAGAGGCATACA
acetonitrile with carbamazepine (500 ng/mL) as the Version 3.0, Mathematical Pharmacology Professional
internal standard was added to 0.1 mL collected plasma Committee of China, China). The results are expressed
sample. After the tube was vortex-mixed for 1.0 min, the as mean values ± SD. Statistical analyses were determined
sample was centrifuged at 13,000 rmp for 10 min. Then using analysis of variance (ANOVA), followed by Dunnett t-
10 μL supernatant was injected into the LC-MS system for test (2-sided). Significance of the expression of mRNA was
analysis. Each sample was tested in triplicate. calculated by a two-tailed, two sample t-test that assumed
equal variance. A P value of <0.0S was considered
significant.
RNA extraction and quantitative RT-PCR analysis
RNA was isolated using the RNAsimple Total RNA

Results
kit (TIANGEN BIOTECH CO., Ltd. Beijing, China)
according to the manufacturer’s instructions. The
Effect of long-term smoking on rat CYP1A2
concentration of RNA was determined, and isolated RNA
quality was assessed by the 260/280 nm absorbance ratio The effects of long-term smoking on pharmacokinetic
(1.8~2.0). Yhe RNA pellet was stored at –80 Ԩ until assay. profiles of phenacetin in rats are presented in Table 2. Mean
The 2 μL RNA was converted to cDNA in a 10 μL plasma concentration-time curves of phenacetin in smoking
reaction mixture using PrimeScriptTM RT Master Mix group and control group are presented in Figure 1A.
(Takara Bio Inc., Japan) according to the manufacturer’s The results showed that after pretreated with long-term
instructions. Resulting reverse transcription products were smoking, the AUC(0-∞), t1/2, and Cmax of phenacetin in smoking
stored at –20 Ԩ until use. group were decreased significantly by L2%, 64%, and 27%
The 10 μL cDNA was diluted with RNase Free ddH2O (P<0.0S) compared to those of control group, CL of
to a volume of 100 µL. Reactions were performed in a phenacetin in smoking group was increased significantly
final volume of 10 μL which contained SYBR® Premix Ex by LS% (P<0.0S), which indicated that CYP1A2 activity
TaqTM 5 μL, 1 μL diluted cDNA, 0.2 μL forward primer was induced by long-term smoking in rats.
(10 μM),
0.2 μL reverse primer (10 μM), and 3.6 μL RNase Free Effect of long-term smoking on rat CYP2C11
ddH2O. PCR was carried out in a light cycle 480 RT-PCR
system (Roche Diagnostics Ltd, Rotkreuz, Switzerland). The effects of long-term smoking on pharmacokinetic
The sequences of primers for real-time RT-PCR are shown profiles of tolbutamide in rats are presented in Table 2. Mean
in Table 1. The amplification conditions were as follows: plasma concentration-time curves of tolbutamide in smoking
initial denaturation at 95 Ԩ for 30 s, followed by 45 cycles group and control group are presented in Figure 1B.
of denaturation at 95 Ԩ for 5 s, annealing at 60 Ԩ for 30 s. After pretreated with long-term smoking, the AUC(0-∞),
The relative mRNA expression of control and long-term
smoking groups were calculated by using the 2–CT method. MRT (0-∞), t 1/2 , and C max of tolbutamide in smoking group
were increased significantly by 46%, 38%, 40% and 51%
(P<0.0S) compared to those of control group, CL of
Statistical analysis
tolbutamide in smoking group was decreased significantly
The pharmacokinetic parameters of each probe drug by L7% (P<0.0S). Yhe results indicated that metabolism of
were analyzed by The Drug and Statistics Software (DAS, tolbutamide in smoking group was evidently slowed down,

Table 2 Main pharmacokinetic properties of phenacetin, tolbutamide, chlorzoxazone, and midazolam in rat plasma after a cocktail
solution administration
Parameter t1/2 (h) Tmax (h) Cmax (μg/L) AUC0-∞ (μg·h/L) MRT0-∞ (h) CLz/F (L/h/kg)
Phenacetin
Control 2.06±0.65 0.25±0.07 6,728.3±52.4 10,971.1±238.4 1.37±0.41 1.641±0.469
Smoking 0.75±0.10* 0.26±0.02 4,940.0±18.0* 7,451.6±123.9* 1.50±0.24 2.209±0.494*
Tolbutamide
Control 16.81±2.37 2.63±0.60 18,425.0±6,409.6 449,565.0±70,733.9 24.79±9.37 0.008±0.002
Smoking 23.46±6.92* 2.58±0.15 27,766.7±6,833.1* 658,288.6±33,820.6* 34.25±4.70* 0.005±0.001*
Chlorzoxazone
Control 2.13±0.33 0.26±0.00 9,287.5±1,925.2 19,899.7±394.0 2.17±0.82 1.129±0.403
Smoking 2.32±0.60 0.25±0.00 11,396.7±567.7 20,978.0±398.4 1.96±0.51 1.162±0.590
Midazolam
Control 1.69±0.34 0.25±0.00 974.8±70.4 1,447.4±48.8 1.75±0.49 9.089±0.614
Smoking 2.60±0.68* 0.29±0.10 1,808.3±83.6* 2,237.1±50.5* 3.31±0.82* 5.376±0.204*
Values are expressed as mean ± SD, n=6. AUC 0-∞, area under concentration-time curve extrapolated to infinity, t 1/2 elimination half-
time, Tmax time to maximum concentration, Cmax maximum concentration, MRT0-∞ mean residence time extrapolated to infinity,
CL/F apparent clearance. *, P<0.05 vs. control.
and long-term smoking had the potential to inhibit rat profiles in these treatment groups. Yhe results indicated
hepatic CYP2C11 activity in vivo. that metabolism of midazolam in smoking group was
evidently slowed down, and long-term smoking had the
Effect of long-term smoking on rat CYP2E1 potential to inhibit rat hepatic CYP3A1 activity in vivo.
The effects of long-term smoking on pharmacokinetic

profiles of chlorzoxazone in rats are presented in Table 2. Effect of long-term smoking on mRNA expression of CYP
Mean plasma concentration-time curves of chlorzoxazone in enzymes in rat liver
smoking group and control group are presented in Figure As shown in Figure 2, compared to control group, the mRNA
1C. The pharmacokinetic profiles of chlorzoxazone in rats expression levels of CYP2C11 and CYP3A1 in smoking
showed no significant difference between smoking group group were significantly decreased to 0.47 and 0.L1 times,
and control group. The results indicated that long-term respectively. Meanwhile, the mRNA expression level of
smoking did not affect rat hepatic CYP2E1 activity in vivo. CYP1A2 in smoking group was significantly increased to
1.60 times. Almost no difference in the mRNA expression
Effect of long-term smoking on rat CYP3A1 level of CYP2E1 was observed between smoking group
and control group. The results suggested CYP1A2 enzyme
The effects of long-term smoking on pharmacokinetic activity was induced while CYP2C11 and CYP3A1 enzyme
profiles of midasolam in rats are presented in Table 2. activities were inhibited. In this study, the mRNA expression
Mean plasma concentration-time curves of midazolam in results were in accordance with the pharmacokinetic results.
smoking group and control group are presented in Figure
1D. After pretreated with long-term smoking, the AUC (0-∞),
Discussion
MRT(0-∞), t1/2, and Cmax of midazolam in smoking group were
increased significantly by SS%, 89%, SL% and 86% (P<0.0S) Compared to traditional method, the “Cocktail” probe drugs
compared to those of control group, CL of midazolam in approach can simultaneously investigate activity alteration
smoking group was decreased significantly by 41% of multiple CYP450 enzymes. The most advantage is to
(P<0.0S). No apparent inóuences were observed on other minimize individual differences and the experimental time
pharmacokinetic

Control Smoking B 30000

Control Smoking
Concentration
0 2 4 6 8 10 12 0 10 20 30 40 50
A 8000
Time (h) 25000 Time (h)
20000
6000
15000
Concentration
4000
10000
5000
2000
C 16000
D 2500
Control Smoking Control Smoking
14000
12000 2000
10000
1500
Concentration
Concentration
8000
1000
6000
4000 500
2000
0
0
0 2 4 6 8 10 12 0 2 4 68 10 12
Time (h) Time (h)

Figure 1 Time course of mean concentrations of (A) phenacetin, ( ) tolbutamide, (C) chlorzoxazone, and (D) midazolam in plasma after a
cocktail solution administration (n 6, mean E).
1.8
smoking on P450s in rats in vivo. In this study, the effects of
1.6 * Control Smoking
long-term smoking on probe drugs of CYP1A2, CYP2C11,
1.4
CYP2E1 and CYP3A1 metabolism suggest that long-term
1.2
smoking had significant inhibition effects on CYP2C11
1.0
and CYP3A1 while CYP1A2 enzyme activity was induced.
Normalized
0.8
There was no difference in rat CYP2E1 enzyme activity.
0.6 The mRNA expression levels of CYP isoforms were in good
0.4 *
agreement with pharmacokinetic results.
*
0.2 The most common isoforms which play an important
0.0 role in the metabolism of used systemic therapy for lung
CYP1A2 CYP2C11 CYP2E1 CYP3A1 cancer include CYP1A2 and CYP3A4 (10). CYP1A2 is
Figure 2 Effect of long-term smoking on mRNA expression almost exclusively expressed in the liver. It is involved
of CYP1A2, CYP2C11, CYP2E1 and CYP3A1 in rats (n 4). in the bioactivation of diverse procarcinogens as well as
*, P<0.0S vs. control. metabolism of many drugs including flutamide, caffine,
and theophylline (15). Previous studies have reported that
increased expression and activity of CYP1A2 were observed
and cost. Thus, it has been more and more widely used for in different tissues of mice after exposure to cigarette
detecting potential DDI in vivo (11). The cocktail method smoke (16,17). In smokers, plasma concentrations of
was successfully used to detect the effect of long-term many prescribed drugs metabolized primarily by CYP1A2
smoking on various CYP isoforms activities. were lower than nonsmokers. In our work, CYP1A2
Our study first reported toYicological effects of enzyme activity was induced significantly by long-term
long−term

the brain: emerging evidence of biological significance.
in vivo
strategies in drug development: valuable tool or óawed
Acknowledgements
Footnote
$on9iczs of Jnzevesz: Yhe authors have no conóicts of interest
References
© Journal of Thoracic Disease. All rights www.jthoracdis.c JJThorac

ThoracDis
Dis 2015;7(10):1725-
2L. de Graan AJ, Loos WJ, Гriberg LI, et al. Inóuence of

smoking on the pharmacokinetics and toYicity profiles of
Cite this article as:
J Thorac Dis
International Journal of Infectious Diseases 98 (2020) 1–5
Contents lists available at ScienceDirect
International Journal of Infectious

Diseases
CapitalBio Mycobacterium real-time polymerase chain reaction

detection test: Rapid diagnosis of Mycobacterium tuberculosis
and nontuberculous mycobacterial infection
Yanqin Shen, Likui Fang, Xudong Xu, Bo Ye, Guocan Yu*
Zhejiang Tuberculosis Diagnosis and Treatment Center, Zhejiang Chinese Medicine and Western Medicine Integrated Hospital, Hangzhou, Zhejiang, China
A R T I C L E I N F O
A B S T R A C T
Article history:
Received 22 April 2020 Objectives: To evaluate the accuracy of the CapitalBio Mycobacterium real-time polymerase chain reaction
Received in revised form 10 June 2020 (RT-PCR) detection test for pulmonary Mycobacterium tuberculosis (MTB) and nontuberculous
Accepted 11 June 2020 mycobacterial (NTM) infection.
Methods: This study analyzed 2,460 samples from patients with suspected pulmonary mycobacterial
Keywords: infection collected between 01 June 2018 and 31 July 2019. It aimed to determine the sensitivity,
Mycobacterium tuberculosis specificity, positive predictive value (PPV), negative predictive value (NPV), and area under the curve
CapitalBio (AUC) of the CapitalBio Mycobacterium detection test for MTB and NTM infections, and to evaluate its
Xpert MTB/RIF diagnostic accuracy compared with mycobacterial culture.
Nontuberculous mycobacterial infection Results: The sensitivity, specificity, PPV, NPV, and AUC of the CapitalBio Mycobacterium detection test for
Real-time polymerase chain reaction MTB was 83.0%, 79.9%, 80.8%, 82.2%, and 0.81, respectively. This was similar to the diagnostic accuracy of
Xpert MTB/RIF for MTB and was significantly higher than that of smear. For pulmonary NTM infection,
the sensitivity, specificity, PPV, NPV, and AUC of the test was 82.0%, 99.6%, 94.1%, 98.5%, and 0.91,
respectively. The diagnostic accuracy of the CapitalBio Mycobacterium detection test was also significantly
higher than that of smear for
NTM. Conclusions: The CapitalBio Mycobacterium detection test had good diagnostic accuracy for MTB
and NTM infections. This is of great significance for the differential diagnosis of early pulmonary
mycobacterial infection.
© 2020 The Author(s). Published by Elsevier Ltd on behalf of International Society for Infectious
Diseases. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-
nd/4.0/).
Introduction
positive rates. Thus, in clinical practice, it is difficult to
distinguish early-stage MTB infection from early-stage NTM
Mycobacteria include Mycobacterium tuberculosis (MTB), non-
infection, and it is easy to misdiagnose NTM infection as MTB
tuberculous mycobacteria (NTM) and Mycobacterium leprae
infection (Griffith et al., 2007). Because the treatment plans for
(Jagielski et al. 2016). At present, the most common clinical
MTB and NTM infections differ, early misdiagnosis results in the
mycobacterial infections are pulmonary tuberculosis (PTB) and
administration of inappropriate treatment, which worsens the
pulmonary NTM infection, which have become serious public
condition, increases the incidence of adverse effects and
health threats (WHO, 2019). The infection rates of MTB and NTM
seriously affects patient prognosis. Therefore, it is crucial to
are increasing with the increase in the number of immunodeficient
diagnose and treat mycobacterial infection at an early stage. At
patients (Forbes, 2017). As the morphology, staining and imaging
present, the diagnosis of pulmonary MTB and NTM infections is
changes in MTB and NTM are similar and both show positive
exceptionally challenging and usually lagging behind in terms of
acid- fast bacilli (AFB) smear findings (Waman et al., 2019),
the initiation of treatment (Kwon and Koh, 2016).
mycobacterial culture is usually required to distinguish MTB
Nucleic acid amplification tests (NAATs) such as Xpert MTB/RIF
from NTM, but this method is time-consuming and provides
(Cepheid, Sunnyvale, CA) and loop-mediated isothermal amplifi-
unsatisfactory
cation (LAMP) have increased the diagnostic efficiency of
tuberculosis (TB) and considerably improved the rate of early
diagnosis of PTB infection (Detjen et al., 2015; Sharma et al., 2019).
* Corresponding author. Therefore, Xpert MTB/RIF and LAMP are recommended by the
E-mail address: dabaitwo@163.com (G. Yu).
https://doi.org/10.1016/j.ijid.2020.06.042
1201-9712/© 2020 The Author(s). Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
2 Y. Shen et al. / International Journal of Infectious Diseases 98 (2020) 1–5
World Health Organization (WHO) for the diagnosis of PTB

Direct microscopy and culture
infection. However, these assays only target MTB, and the lack
of markers for the identification of NTM indicates that NTM
The samples were subjected to direct AFB smear microscopy
infection cannot be directly diagnosed. Although NAATs such as
using the Ziehl-Neelsen method (Vilchèze and Kremer, 2017). They
polymerase chain reaction (PCR) are used in NTM diagnosis,
were also cultured on Lowenstein-Jensen solid medium and in a
there are few relevant studies and they are not available in China.
liquid culture medium using the BACTEC MGIT 960 Mycobacteria
Presently, the diagnosis of NTM infection mainly depends on
Culture System (BD Diagnostic Systems, Sparks, MD) according to
mycobacterial culture, making early diagnosis difficult (Kwon
the manufacturer’s instructions.
and Koh, 2016), especially in China. Thus, there is an urgent need
for a rapid, efficient and cost-effective diagnostic test for MTB
CapitalBio Mycobacterium RT-PCR detection test
and NTM infections in China.
The CapitalBio Mycobacterium RT-PCR detection kit (CapitalBio
The test was performed according to the manufacturer’s
Technology Inc., Beijing, China; http://www.capitalbiotech.com)
instructions. The samples were liquefied in pretreatment tubes
provides simultaneous screening of MTB and NTM infections. It
and centrifuged to obtain sediment. Then, the sediment and
employs duplex fluorescence RT-PCR and TaqMan probe technol-
nucleic acid extract were added into a nucleic acid extraction
ogy to detect both MTB and NTM infections in one test (Yu et al.,
tube.
2020). The cost of a single test is US$9.8, which is approximately ◦
After subjecting the samples to vibration and incubation in a 95 C
one-ninth of that of Xpert MTB/RIF. However, its diagnostic
water bath for 10 min, the centrifuged samples were used to
efficiency for pulmonary MTB and NTM infections remains unclear.
extract the mycobacterial DNA. The extracted DNA was used
This study aimed to evaluate the accuracy of the CapitalBio
according to the manufacturer’s instructions. RT-PCR was per-
Mycobacterium RT-PCR detection test for the direct detection of
formed using a fluorescence quantification RT-PCR instrument
MTB and NTM DNA in pulmonary samples using a culture standard,
(SLAN-96S Real-Time PCR System ZEESAN Xiamen CN) to
thereby providing a new test for the concurrent early detection
amplify and detect IS6110 and HSP65 multicopy elements for
of
MTB and NTM within 3 h. In the presence of co-infection, the test
MTB and NTM infections.
results will only show positive results for MTB, and NTM-positive
results cannot be concurrently observed.
Materials and methods
Xpert MTB/RIF
Study design
Sample reagent was mixed in a 2:1 ratio with 1 mL of the

This retrospective observational study was conducted at the
uncentrifuged sample. Then, 1 mL was placed in a pretreatment
Zhejiang Chinese Medicine and Western Medicine Integrated
tube and 2 mL of pretreatment solution was added. The solution
Hospital, which is the TB diagnosis and treatment center of
was agitated for 20 seconds and left to stand for 15 min. Next, 2 mL
Zhejiang Province, China. Medical records were reviewed of
of the treated sample solution was added into the first generation
patients suspected of Mycobacterium infection without NTM or
of Xpert MTB/RIF reaction box, which was arranged in the
MTB treatment between 01 June 2018 and 31 July 2019, for
detection module to start automatic detection. The system
whom the CapitalBio Mycobacterium RT-PCR detection test, Xpert
automatically read the results of MTB detection within 2 h (Yu
MTB/ RIF and mycobacterial culture using pulmonary samples
et al., 2017). The Xpert MTB/RIF reaction box and detection
were performed. The criteria for establishing patients suspected
modules were developed by Cepheid (US).
of Mycobacterium infection were as follows: (1) clinical
symptoms such as long-term cough, expectoration and repeated
Data processing and statistical analysis
low- grade fever; (2) imaging features such as tree-in-bud
pattern, cavity and bronchiectasis; (3) positive laboratory tests
SPSS v24.0 (IBM Corp., Armonk, NY) was used to determine
such as microbiological smear and gamma interferon release
mean values, standard deviation, cross-tabulation, and frequency
test; and
calculations. MedCalc Statistical v15.2.2 (MedCalc Software bvba,
(4) no evidence of other microbial infections. Written informed
Ostend, Belgium; http://www.medcalc.org) was used to analyze
consent was obtained from patients who did not have
the sensitivity, specificity, positive predictive value (PPV),
sufficient sputum samples with abnormal radiological features
negative predictive value (NPV), and area under the curve (AUC)
for the acquisition of pulmonary samples by bronchoscopy.
of the CapitalBio Mycobacterium RT-PCR detection test and Xpert
Ethical approval was received from the Human Research Ethics
MTB/ RIF to evaluate their diagnostic efficiency. The CapitalBio
Committee of Zhejiang Chinese Medicine and Western Medi-
Mycobacterium RT-PCR detection test detects both MTB and
cine Integrated Hospital.
NTM. Thus, its effectiveness for the diagnosis of MTB and NTM
The patients were categorized into three groups according to
infections was separately analyzed. NTM infection was regarded as
the mycobacterial culture results: confirmed MTB, MTB detected
non-MTB and MTB infection as non-NTM in the evaluation of the
by mycobacterial culture; confirmed NTM, NTM detected by
diagnostic efficiency of the test for NTM infection. Mycobacterial
mycobacterial culture; and non-MTB and non-NTM,
culture was chosen as the reference diagnostic criteria. Individuals
mycobacterial cultures negative for both MTB and NTM and
with missing data were excluded from the diagnostic analysis.
another diagnosis was established.
The paired data were tested by McNemar’s test. Chi-square test
and Fisher’s exact test were performed for comparing proportions.
Diagnostic specimen collection and handling
The Z-test was performed for comparing AUCs. Differences with
p- values of <0.05 were considered statistically significant.
Fresh sputum or bronchoalveolar lavage fluid (BALF) samples
were collected for detecting correlations. Bronchoscopy was
Results
performed on the abnormal segment of lung containing BALF. A
total of 2,460 pulmonary samples (1,218 sputum samples and 1,242
A total of 2,460 pulmonary samples (1,218 sputum samples and
BALF samples) were collected. The samples were divided for use in
1,242 BALF samples) were collected from 2,460 patients with
AFB smear, mycobacterial culture, CapitalBio Mycobacterium RT-
suspected pulmonary mycobacterial infection without NTM or
PCR detection test, and Xpert MTB/RIF.
Y. Shen et al. / International Journal of Infectious Diseases 98 (2020) 1–5 3
MTB treatment between 01 June 2018 and 31 July 2019. Their MTB/RIF (p < 0.001, Table 2). However, the accuracy of the
average age was 51.3 (range 4–93) years and 1,621 were male. CapitalBio Mycobacterium RT-PCR detection test and Xpert MTB/
Among the 2,460 samples, positive AFB smear, MTB culture and RIF was similar, suggesting that the diagnostic efficiency of these
NTM culture were found in 788 (32.0%), 1,239 (50.4%) and 194 two nucleic acid tests is similar (p > 0.05). The diagnostic efficiency
(7.9%) samples, respectively. The NTM accounted for 194 of of these two nucleic acid tests for smear-positive samples was
1,433 (13.5%) positive mycobacterial culture samples, and Xpert better than that for smear-negative samples (p < 0.05; Table 2).
MTB/RIF showed positive results in 1,342 of 2,460 (54.6%) For cases of pulmonary NTM infection, the CapitalBio Myco-
samples. Regarding the CapitalBio Mycobacterium RT-PCR bacterium RT-PCR detection test could only preliminarily screen for
detection test, MTB-positive and NTM-positive results were and distinguish between MTB and NTM. Compared with myco-
detected in 1,273 of 2,460 (51.7%) and 169 of 2,460 (6.9%) bacterial culture, the overall sensitivity, specificity, PPV, NPV, and
samples, respectively. Among the 788 smear-positive samples, 639 AUC were 53.1% (45.8–60.3%), 69.8% (67.8–71.7%), 13.1% (10.8–
(81.1%) were considered confirmed MTB and 103 (13.1%) were 15.6%), 94.6% (93.4–95.6%), and 0.61 (0.58–0.78) for AFB smear and
considered confirmed NTM, and these values were 600 (35.9%) 82.0% (75.8–87.1%), 99.6% (9.2–99.8%), 94.1% (89.4–97.1%), 98.5%
and 91 (5.4%) in the 1,672 smear-negative samples, respectively. (97.9–98.9%), and 0.91 (0.90–0.92) for the CapitalBio Mycobacteri-
According to mycobacterial culture results, 1,239 (50.4%) samples um RT-PCR detection test, respectively. The sensitivity,
were considered confirmed MTB, 194 (7.9%) were considered specificity, PPV, NPV, and AUC of the CapitalBio Mycobacterium
confirmed NTM and 1,027 (41.7%) were considered confirmed RT-PCR detection test were 88.4% (80.5–93.8%), 100.0% (99.5-
non-MTB and non-NTM (Figure 1). 100.0%),
Based on culture as the gold reference, the overall sensitivity, 100.0 (96.0–100.0%), 98.3% (97.0–99.1), and 0.94 (0.92–0.96) for
specificity, PPV, NPV, and AUC of AFB smear was 51.6% (95% CI smear-positive samples and 74.7% (64.5–83.3%), 99.4% (98.8–
48.8–54.4%), 87.8% (85.8–89.6%), 81.1% (78.2–83.8%), 64.1% (61.8– 99.7%), 87.2% (77.7–93.7%), 98.6% (97.8–99.1%), and 0.87 (0.85–
66.4%), and 0.70 (0.68–0.71). The sensitivity, specificity, PPV, NPV, 0.89) for smear-negative samples, respectively (Table 1).
and AUC of CapitalBio Mycobacterium RT-PCR detection test for The accuracy of the CapitalBio Mycobacterium RT-PCR detection
MTB was 83.0% (80.8–85.0%), 79.9% (77.6–82.2%), 80.8% (78.5– test was significantly higher than that of the AFB smear (p < 0.001;
82.9%), 82.2% (79.9–84.3%), and 0.81 (0.80–0.83), and those of Table 2). Moreover, the diagnostic accuracy of the CapitalBio
Xpert MTB/RIF were 84.4% (82.3–86.4%), 75.8% (73.3–78.1%), 77.9% Mycobacterium RT-PCR detection test for smear-positive samples
(75.6–80.1%), 82.7% (80.4–84.9%), and 0.80 (0.78–0.82), respec- was better than that for smear-negative samples (p < 0.05;
tively. Table 2).
Regarding smear-positive samples, the overall sensitivity,
specificity, PPV, NPV, and AUC of the CapitalBio Mycobacterium RT- Discussion
PCR detection test were 95.2% (93.2–96.7%), 77.9% (70.3–84.2%),
94.9% (92.9–96.4%), 78.9% (71.4–85.2%), and 0.87 (0.84–0.89), Early and accurate diagnosis of pulmonary mycobacterial
and infection remains extremely challenging, particularly in cases of
those of smear-positive samples using Xpert MTB/RIF were 95.2% NTM infection (Watterson and Drobniewski, 2000). In addition to
(93.2–96.7%), 76.5% (68.9–83.1%), 94.6% (92.5–96.2%), 78.6% (71.1– TB, NTM infection has also become a public health threat. The
85.0%), and 0.86 (0.83–0.88), respectively. Regarding smear- global prevalence of NTM infection is rapidly increasing (Waman
negative samples, the overall sensitivity, specificity, PPV, NPV, et al., 2019). In low burden areas, the NTM detection rate has
and AUC using the CapitalBio Mycobacterium RT-PCR detection test exceeded that of TB, and the prevalence of NTM infection is
were 70.0% (66.2–73.6%), 80.2% (77.7–82.6%), 66.5% (62.6–70.1%), increasing with the emergence of acquired immunodeficiency
82.7% (80.3–84.9%), and 0.75 (0.73–0.77), and those using Xpert syndrome (Bjerrum et al., 2016; Hoza et al., 2016). Although AFB
MTB/RIF were 73.0% (69.2–76.5%), 75.7% (73.0–78.2%), 62.7% smear is convenient, it cannot distinguish MTB from NTM. Because
(59.0–-66.3%), 83.4% (80.9–85.6%), and 0.74 (0.72–0.76), respec- a positive smear result is usually considered evidence of MTB
tively. These results are summarized in detail in Table 1. infection, inappropriate treatment could be administered, result-
The accuracy of AFB smear was significantly lower than that ing in increased adverse consequences. On the other hand, the
of the CapitalBio Mycobacterium RT-PCR detection test and
Xpert
Figure 1. Diagnostic classification of the study participants.

MTB, Mycobacterium tuberculosis; NTM, Nontuberculosis mycobacteria.
4 Y. Shen et al. / International Journal of Infectious Diseases 98 (2020) 1–5
Table 1
Accuracy of AFB smear, the CapitalBio Mycobacterium real-time polymerase chain reaction detection test and Xpert MTB/RIF for the detection of pulmonary tuberculosis and
nontuberculous mycobacterial infection compared with mycobacterial culture.
Mycobacterium Test Smear status Sensitivity Specificity PPV NPV AUC

species
Mycobacterium AFB smear Overall 51.6% (48.8–54.4%) 87.8% (85.8–89.6%) 81.1% (78.2–83.8%) 64.1% (61.8–66.4%) 0.70 (0.68–0.71)
tuberculosis CapitalBio test Overall 83.0% (80.8–85.0%) 79.9% (77.6–82.2%) 80.8% (78.5–82.9%) 82.2% (79.9–84.3%) 0.81 (0.80–0.83)
Smear-positive 95.2% (93.2–96.7%) 77.9% (70.3–84.2%) 94.9% (92.9–96.4%) 78.9% (71.4–85.2%) 0.87 (0.84–0.89)
Smear negative 70.0% (66.2–73.6%) 80.2% (77.7–82.6%) 66.5% (62.6–70.1%) 82.7% (80.3–84.9%) 0.75 (0.73–0.77)
Xpert MTB/RIF Overall 84.4% (82.3–86.4%) 75.8% (73.3–78.1%) 77.9% (75.6–80.1%) 82.7% (80.4–84.9%) 0.80 (0.78–0.82)
Smear-positive 95.2% (93.2–96.7%) 76.5% (68.9–83.1%) 94.6% (92.5–96.2%) 78.6% (71.1–85.0%) 0.86 (0.83–0.88)
Smear negative 73.0% (69.2–76.5%) 75.7% (73.0–78.2%) 62.7% (59.0–66.3%) 83.4% (80.9–85.6%) 0.74 (0.72–0.76)
Nontuberculous AFB smear Overall 53.1% (45.8–60.3%) 69.8% (67.8–71.7%) 13.1% (10.8–15.6%) 94.6% (93.4–95.6%) 0.61 (0.58–0.78)
mycobacteria CapitalBio test Overall 82.0% (75.8–87.1%) 99.6% (9.2–99.8%) 94.1% (89.4–97.1%) 98.5% (97.9–98.9%) 0.91 (0.90–0.92)
Smear-positive 88.4% (80.5–93.8%) 100.0% (99.5–100.0%) 100.0 (96.0–100.0%) 98.3% (97.0–99.1) 0.94 (0.92–0.96)
Smear-negative 74.7% (64.5–83.3%) 99.4% (98.8–99.7%) 87.2% (77.7–93.7%) 98.6% (97.8–99.1%) 0.87 (0.85–0.89)
PPV, positive predictive value; NPV, negative predictive value; AUC, area under the curve; AFB, acid-fast bacilli, CapitalBio test, CapitalBio Mycobacterium RT-PCR detection
test.
Table 2
Comparison of diagnostic efficiency between the CapitalBio Mycobacterium RT-PCR detection test and Xpert MTB/RIF for the detection of mycobacterial infections.
Mycobacterium species Test Sensitivity Specificity PPV (p-Value) NPV (p-Value) AUC (p-Value)
(p-value) (p-Value)
Mycobacterium tuberculosis Smear vs. CapitalBio test <0.001 <0.001 0.850 <0.001 <0.001
Smear vs. Xpert MTB/RIF <0.001 <0.001 0.084 <0.001 <0.001
CapitalBio test vs. Xpert MTB/RIF 0.173 <0.001 0.076 0.746 0.071
CapitalBio test (smear-positive vs. negative) <0.001 0.498 <0.001 0.262 <0.001
Xpert MTB/RIF (smear-positive vs. negative) <0.001 0.819 <0.001 0.160 <0.001
Nontuberculous Smear vs. CapitalBio test <0.001 <0.001 <0.001 <0.001 <0.001
mycobacteria CapitalBio test (smear-positive vs. negative) 0.014 0.037 <0.001 0.617 0.029
PPV, positive predictive value; NPV, negative predictive value; AUC, area under the curve; AFB, acid-fast bacilli; CapitalBio test, CapitalBio Mycobacterium RT-PCR detection
test.
sensitivity of a smear is low and it cannot meet the requirements of

negative results can only indirectly indicate the possibility of
accurate examination. Although mycobacterial culture can distin-
NTM infection. Therefore, Xpert MTB/RIF cannot effectively
guish MTB infection from NTM infection, the slow growth of
distinguish the species in cases of mycobacterial infection.
colonies indicates that the opportunity for early treatment is lost
The current study compared these two assays for detecting MTB
unless treatment is administered before confirmation of the
in pulmonary samples. It showed that 32% of all patients were
diagnosis via mycobacterial culture. Therefore, early and rapid
smear-positive. The sensitivity of AFB smear for MTB and NTM was
diagnosis and the differentiation of Mycobacterium species play a
51.6% and 53.1%, respectively, which was significantly lower
key role in treatment.
than that of the CapitalBio Mycobacterium RT-PCR detection
To meet the current requirement of rapid and accurate TB
test. In smear-positive patients, 83.1% were positive for MTB
diagnosis, NAATs play an increasingly important role (Scott et al.,
culture and 13.1% were positive for NTM culture. These results
2014). One such test is fluorescent RT-PCR. Compared with
suggest that the smear test was ineffective in identifying
traditional PCR, fluorescent RT-PCR has the advantage of simulta-
mycobacterial infection. The accuracy of the CapitalBio
neous amplification and detection of DNA via a fluorescence
Mycobacterium RT-PCR detection test using pulmonary samples
system (Santos et al., 2018). This method determines values
was high for detecting both MTB and NTM infections, particularly
throughout the exponential phase of the reaction, making the
for NTM infection. In the diagnosis of pulmonary MTB infection,
quantification of nucleic acids precise and reproducible (Santos
the diagnostic efficiency of the Capital- Bio Mycobacterium RT-
et al., 2018). Limited research has demonstrated the efficacy of this
PCR detection test and Xpert MTB/RIF was similar, and there
test in detecting mycobacterial DNA for MTB and NTM infection
was no significant difference, which indicated excellent
(Armand et al., 2011; Lira et al., 2013). The CapitalBio Mycobacteri-
diagnostic accuracy. However, in the current study, the
um RT-PCR detection test is a commercial fluorescent RT-PCR-
specificity of these two tests was low, which might have been
TaqMan assay based on IS6110 for MTB and HSP65 for NTM. It can
related to the study model, which was a retrospective study with
simultaneously detect both MTB and NTM DNA. IS6110 is a credible
mycobacterial culture as the gold standard and was not a case-
gene target that has good diagnostic efficiency in the detection of
control study. Limited by the positive rate of mycobacterial culture,
TB (Raj et al., 2016). However, the sensitivity and specificity of
mycobacterial infection cannot be completely ruled out in
this test in the diagnosis of pulmonary MTB and NTM infections
patients with negative culture, but it also needs to be
are unclear. In contrast, Xpert MTB/RIF, another NAAT, is based
evaluated in combination with imaging, immunology and other
on hemi-nested PCR. It is recommended in WHO guidelines for
related results. There are still large numbers of patients with
the diagnosis of PTB and extrapulmonary TB infections and has
mycobacterial infection, leading to NAATs being positive in
been widely used in clinical practice with excellent diagnostic
many patients with negative culture, resulting in decreased
efficiency (Khan et al., 2018; Perez-Risco et al., 2018;
specificity. In a study by Armand et al., sensitivity was 53% for
Rakotoarivelo et al., 2018). Xpert MTB/RIF also has limitations: it
Xpert MTB/RIF compared with 78% for the IS6110-TaqMan assay
can only diagnose TB infection, and because it cannot directly
(Armand et al., 2011), which is contrary to the current findings.
detect NTM infections,
Thus, the comparison of the accuracy of these two tests
for MTB infection remains
Y. Shen et al. / International Journal of Infectious Diseases 98 (2020) 1–5 5
controversial, and multicenter and large sample studies are References

necessary to further compare them. In the diagnosis of NTM
infection, the CapitalBio Mycobacterium RT-PCR detection test Armand S, Vanhuls P, Delcroix G, Courcol R, Lemaître N. Comparison of the Xpert
MTB/RIF test with an IS6110-TaqMan real-time PCR assay for direct detection
performed better than Xpert MTB/RIF because it could distinguish of Mycobacterium tuberculosis in respiratory and nonrespiratory specimens. J
NTM from MTB in the early stages of infections. Although this Clin Microbiol 2011;49:1772–6, doi:http://dx.doi.org/10.1128/JCM.02157-10.
test cannot identify NTM species, it can perform early diagnosis Bjerrum S, Oliver-Commey J, Kenu E, Lartey M, Newman MJ, Addo KK, et al.
Tuberculosis and non-tuberculous mycobacteria among HIV-infected individu-
and help avoid delayed diagnosis. NTM species can be further als in Ghana. Trop Med Int Health 2016;21:1181–90, doi:http://dx.doi.org/
determined using the CapitalBio Mycobacterium species identifi- 10.1111/tmi.12749.
cation array test, with a turnaround of 6 h. However, this test was Detjen AK, DiNardo AR, Leyden J, Steingart KR, Menzies D, Schiller I, et al. Xpert
MTB/RIF assay for the diagnosis of pulmonary tuberculosis in children: a
not included in the current study. systematic review and meta-analysis. Lancet Respir Med 2015;3:451–61, doi:
Subgroup analysis according to the smear status showed that http://dx.doi.org/10.1016/S2213-2600(15)00095-8.
the sensitivity of these two tests in smear-positive patients was Forbes BA. Mycobacterial taxonomy. J Clin Microbiol 2017;55:380–3, doi:http://dx.
doi.org/10.1128/JCM.01287-16.
significantly better than that in smear-negative patients, regard-
Griffith DE, Aksamit T, Brown-Elliott BA, Catanzaro A, Daley C, Gordin F, et al. An
less of whether the infection was MTB or NTM. Regarding NTM official ATS/IDSA statement: diagnosis, treatment, and prevention of non-
infection, 91 of 103 (88.3%) smear-positive patients and 68 of 91 tuberculous mycobacterial diseases. Am J Respir Crit Care Med 2007;175:367–
416, doi:http://dx.doi.org/10.1164/rccm.200604-571ST.
(74.7%) of smear-negative patients were confirmed to be NTM
Hoza AS, Mfinanga SG, Rodloff AC, Moser I, Kö nig B. Increased isolation of
positive using the CapitalBio Mycobacterium RT-PCR detection test, nontuberculous mycobacteria among TB suspects in Northeastern, Tanzania:
providing strong support for the early identification of NTM. public health and diagnostic implications for control programmes. BMC Res
Based on these results, when pulmonary mycobacterial Notes 2016;9:109, doi:http://dx.doi.org/10.1186/s13104-016-1928-3.
Jagielski T, Minias A, van Ingen J, Rastogi N, Brzostek A, Z_ aczek A, et al.
infection is suspected, the CapitalBio Mycobacterium RT-PCR Methodological and clinical aspects of the molecular epidemiology of
detection test might play a role in distinguishing NTM and MTB Mycobacterium tuberculosis and other Mycobacteria. Clin Microbiol Rev.
in the early stages. This would be helpful in reducing the 2016;29:239–90, doi:http://dx.doi.org/10.1128/CMR.00055-15.
Khan AS, Ali S, Khan MT, Ahmed S, Khattak Y, Abduljabbar, et al. Comparison of
misdiagnosis of NTM infection as MTB infection. GeneXpert MTB/RIF assay and LED-FM microscopy for the diagnosis of extra
This study had some limitations. First, it was a retrospective pulmonary tuberculosis in Khyber Pakhtunkhwa, Pakistan. Braz J Microbiol
study and patient selection may have been biased. Second, the 2018;49:909–13, doi:http://dx.doi.org/10.1016/j.bjm.2018.02.011.
Kwon YS, Koh WJ. Diagnosis and treatment of nontuberculous mycobacterial lung
study was conducted in an area with a high TB burden, which disease. J Korean Med Sci 2016;31:649–59, doi:http://dx.doi.org/10.3346/
may have limited the universality of the findings. Third, the jkms.2016.31.5.649.
CapitalBio Mycobacterium RT-PCR detection test has detection- Lira LA, Santos FC, Carvalho MS, Montenegro RA, Lima JF, Schindler HC, et al.
Evaluation of a IS6110-Taqman real-time PCR assay to detect Mycobacterium
related limitations: in the presence of co-infection, the test tuberculosis in sputum samples of patients with pulmonary TB. J Appl Microbiol
results will only show positive results for MTB, and NTM-positive 2013;114:1103–8, doi:http://dx.doi.org/10.1111/jam.12119.
results cannot be concurrently observed. In addition, this test can Perez-Risco D, Rodriguez-Temporal D, Valledor-Sanchez I, Alcaide F. Evaluation of
the Xpert MTB/RIF ultra assay for direct detection of Mycobacterium
only preliminarily distinguish MTB from NTM, and it cannot
tuberculosis complex in smear-negative extrapulmonary samples. J Clin
distinguish the NTM species and detect MTB drug resistance. Microbiol 2018;56:, doi:http://dx.doi.org/10.1128/JCM.00659-18.
Therefore, the distribution of NTM species and MTB drug resistance Raj A, Singh N, Gupta KB, Chaudhary D, Yadav A, Chaudhary A, et al. Comparative
evaluation of several gene targets for designing a multiplex-PCR for an early
were not discussed in this study. Fourth, the difference in
diagnosis of extrapulmonary tuberculosis. Yonsei Med J 2016;57:88–96, doi:
diagnostic efficacy of related tests in different specimens was not http://dx.doi.org/10.3349/ymj.2016.57.1.88.
analyzed in this study because it was a retrospective study, the Rakotoarivelo R, Ambrosioni J, Rasolofo V, Raberahona M, Rakotosamimanana N,
collection of different specimens was not random, the number Andrianasolo R, et al. Evaluation of the Xpert MTB/RIF assay for the diagnosis of
smear-negative pulmonary and extrapulmonary tuberculosis in Madagascar. Int
was different, and the basic characteristics of patients were also J Infect Dis 2018;69:20–5, doi:http://dx.doi.org/10.1016/j.ijid.2018.01.017.
different. Santos FCF, Lira LAS, Montenegro RA, Lima JFDC, Lima AS, Schindler HC, et al.
Performance of the IS6110-TaqMan(R) assay in the diagnosis of
extrapulmonary tuberculosis from different biological samples. Rev Soc Bras
Conclusions Med Trop 2018;51:331–7, doi:http://dx.doi.org/10.1590/0037-8682-0372-
2017.
The CapitalBio Mycobacterium RT-PCR detection test had Scott LE, Beylis N, Nicol M, Nkuna G, Molapo S, Berrie L, et al. Diagnostic accuracy of
Xpert MTB/RIF for extrapulmonary tuberculosis specimens: establishing a
good accuracy for pulmonary MTB infection, similar to that of laboratory testing algorithm for South Africa. J Clin Microbiol 2014;52:1818–23,
Xpert MTB/RIF, and it had better diagnostic accuracy for NTM doi:http://dx.doi.org/10.1128/JCM.03553-13.
infection than Xpert MTB/RIF. Furthermore, two types of Sharma G, Tewari R, Dhatwalia SK, Yadav R, Behera D, Sethi S. A loop-mediated
isothermal amplification assay for the diagnosis of pulmonary tuberculosis. Lett
mycobacteria can be simultaneously detected, which is of great Appl Microbiol 2019;68:219–25, doi:http://dx.doi.org/10.1111/lam.13115.
significance in the differential diagnosis of early pulmonary Vilchè ze C, Kremer L. Acid-fast positive and acid-fast negative Mycobacterium
mycobacterial infection. tuberculosis: the Koch paradox. Microbiol Spectr 2017;5(10) 10.1128/micro-
biolspec.TBTB2-0003-2015.
Waman VP, Vedithi SC, Thomas SE, Bannerman BP, Munir A, Skwark MJ, et al.
Funding Mycobacterial genomics and structural bioinformatics: opportunities and
challenges in drug discovery. Emerg Microbes Infect 2019;8:109–18, doi:http://
dx.doi.org/10.1080/22221751.2018.1561158.
None. Watterson SA, Drobniewski FA. Modern laboratory diagnosis of mycobacterial
infections. J Clin Pathol 2000;53:727–32, doi:http://dx.doi.org/10.1136/
Declaration of interest jcp.53.10.727.
WHO. Global tuberculosis report 2019. Geneva: World Health Organization; 2019.
https://www.who.int/tb/publications/global_report/en/.
None. Yu G, Shen Y, Ye B, Chen D, Xu K. Comparison of CapitalBio Mycobacterium nucleic
acid detection test and Xpert MTB/RIF assay for rapid diagnosis of
extrapulmonary tuberculosis. J Microbiol Methods 2020;168:105780, doi:
Acknowledgements http://dx.doi.org/10.1016/j.mimet.2019.105780.
Yu G, Ye B, Chen D, Zhong F, Chen G, Yang J, et al. Comparison between the
We are thankful to all the patients who enrolled in the work and diagnostic validities of Xpert MTB/RIF and interferon-gamma release assays for
tuberculous pericarditis using pericardial tissue. PLoS One 2017;12:e0188704,
their families, as well as the medical staff at Zhejiang Chinese doi: http://dx.doi.org/10.1371/journal.pone.0188704.
Medicine and Western Medicine Integrated Hospital.
Articles
Cemiplimab monotherapy for first-line treatment of

advanced non-small-cell lung cancer with PD-L1 of at least
50%: a multicentre, open-label, global, phase 3, randomised,
controlled trial
Ahmet Sezer, Saadettin Kilickap, Mahmut Gümüş, Igor Bondarenko, Mustafa Özgüroğlu, Miranda Gogishvili, Haci M Turk, Irfan Cicin,
Dmitry Bentsion, Oleg Gladkov, Philip Clingan, Virote Sriuranpong, Naiyer Rizvi, Bo Gao, Siyu Li, Sue Lee, Kristina McGuire, Chieh-I Chen,
Tamta Makharadze, Semra Paydas, Marina Nechaeva, Frank Seebach, David M Weinreich, George D Yancopoulos, Giuseppe Gullo, Israel Lowy,
Petra Rietschel
Summary
Lancet 2021; 397: 592–604 Background We aimed to examine cemiplimab, a programmed cell death 1 inhibitor, in the first-line treatment of
See Comment page 557 advanced non-small-cell lung cancer with programmed cell death ligand 1 (PD-L1) of at least 50%.
Department of Medical
Oncology, Başkent University, Methods In EMPOWER-Lung 1, a multicentre, open-label, global, phase 3 study, eligible patients recruited in
Adana, Turkey (A Sezer MD);
138 clinics from 24 countries (aged ≥18 years with histologically or cytologically confirmed advanced non-small-
Oncology, Hacettepe cell lung cancer, an Eastern Cooperative Oncology Group performance status of 0–1; never-smokers were
University Cancer Institute, ineligible) were randomly assigned (1:1) to cemiplimab 350 mg every 3 weeks or platinum-doublet chemotherapy.
Ankara, Turkey Crossover from chemotherapy to cemiplimab was allowed following disease progression. Primary endpoints
(Prof S Kilickap MD);
were overall survival and progression-free survival per masked independent review committee. Primary
Oncology, School of Medicine, endpoints were assessed in the intention-to-treat population and in a prespecified PD-L1 of at least 50% population
Istanbul Medeniyet University, (per US Food and Drug Administration request to the sponsor), which consisted of patients with PD-L1 of at
Istanbul, Turkey least 50% per 22C3 assay done according to instructions for use. Adverse events were assessed in all patients
(Prof M Gümüş MD);
Department of Oncology and
who received at least one dose of the assigned treatment. This study is registered with ClinicalTrials.gov,
Medical Radiology; NCT03088540 and is ongoing.
Dnipropetrovsk Medical
Academy, Dnipro, Ukraine Findings Between June 27, 2017 and Feb 27, 2020, 710 patients were randomly assigned (intention-to-treat population).
(Prof I Bondarenko MD);
Cerrahpaşa Medical Faculty,
In the PD-L1 of at least 50% population, which consisted of 563 patients, median overall survival was not reached
Istanbul University-Cerrahpaşa, (95% CI 17·9–not evaluable) with cemiplimab (n=283) versus 14·2 months (11·2–17·5) with chemotherapy (n=280;
Istanbul, Turkey hazard ratio [HR] 0·57 [0·42–0·77]; p=0·0002). Median progression-free survival was 8·2 months (6·1–8·8) with
(Prof M Özgüroğlu MD); cemiplimab versus 5·7 months (4·5–6·2) with chemotherapy (HR 0·54 [0·43–0·68]; p<0·0001). Significant
High Technology Medical
Centre, University Clinic, Tbilisi,
improvements in overall survival and progression-free survival were also observed with cemiplimab in the intention- to-
Georgia (M Gogishvili MD); treat population despite a high crossover rate (74%). Grade 3–4 treatment-emergent adverse events occurred in
Department of Medical 98 (28%) of 355 patients treated with cemiplimab and 135 (39%) of 342 patients treated with chemotherapy.
Oncology, Bezmialem Vakif
University, Medical Faculty,
Istanbul, Turkey
Interpretation Cemiplimab monotherapy significantly improved overall survival and progression-free survival
(Prof H M Turk MD); compared with chemotherapy in patients with advanced non-small-cell lung cancer with PD-L1 of at least 50%,
Department of Medical providing a potential new treatment option for this patient population.
Oncology, Trakya University,
Edirne, Turkey (Prof I Cicin
MD); Radiotherapy
Funding Regeneron Pharmaceuticals and Sanofi.
Department, Sverdlovsk
Regional Oncology Centre, Copyright © 2021 Elsevier Ltd. All rights reserved.
Sverdlovsk, Russia
(D Bentsion MD); LLC,
“EVIMED”, Chelyabinsk, Russia
(O Gladkov MD); Southern Introduction Although immune checkpoint inhibitors (ICIs) have
Medical Day Care Centre and Inhibitors of programmed cell death 1 (PD-1) and transformed the advanced non-small-cell lung cancer
Illawarra Health and Medical programmed cell death ligand 1 (PD-L1), either as treatment landscape, especially in patients without
Research Institute, University
of Wollongong–Illawarra
monotherapy or in combination with chemotherapy or EGFR, ALK, or ROS1 aberrations,7 there is still a need for
Cancer Centre, Wollongong other immunotherapy, have become a key component of additional treatment options that improve survival
Hospital, Wollongong, NSW, systemic treatment of advanced non-small-cell lung benefits, as well as a need to optimise chemotherapy-
Australia (Prof P Clingan, MBBS); cancer without epidermal growth factor receptor free treatments in the proportion of patients with high
Division of Medical Oncology,
Department of Medicine,
(EGFR), anaplastic lymphoma kinase (ALK), or C-ROS PD-L1 expression who could avoid chemotherapy-
Faculty of Medicine, oncogene 1 (ROS1) aberrations.1,2 An estimated 25–35% associated toxicity. At this time, only one anti-PD-1,
Chulalongkorn University and of advanced non-small-cell lung cancer cases are pembrolizumab, and one anti-PD-L1, atezolizumab, are
the King Chulalongkorn expected to test positive for PD-L1 in at least 50% of approved by the US Food and Drug Administration
tumour cells.3–6 (FDA) and have
5 www.thelancet.com Vol 397 February 13,

Articles
Memorial Hospital, Bangkok,

Research in context Thailand (V Sriuranpong MD);
Division of Hematology–
Evidence before this study uncertainty as to the real magnitude of benefit of anti-PD-1 Oncology, Columbia University
Medical Center, New York,
Platinum-doublet chemotherapy was the standard of care monotherapy compared with chemotherapy, even in New York, NY, USA
patients first-line treatment for patients with advanced non-small-cell with PD-L1 expression of at least 50%, and there (Prof N Rizvi MD); Regeneron
remains an lung cancer without epidermal growth factor receptor, unmet medical need for additional chemotherapy-free first- Pharmaceuticals, Basking
line anaplastic lymphoma kinase, or C-ROS oncogene receptor treatments in this patient population. Ridge, New Jersey, USA
(B Gao PhD, S Li PhD, S Lee MD,
tyrosine kinase aberrations,
anti-programmed cell death before theantibody
1 (PD-1) approvalinofthis
thesetting.
first C-I Chen MPH); High
Added
Findingsvalue
fromofthe
this study study, the largest in this setting
present Technology Hospital
to our At the time at which the present study of cemiplimab knowledge,
was showed that cemiplimab was superior to Medcenter, Batumi, Georgia
designed, and per PubMed search for articles published (T Makharadze MD);
chemotherapy in improving progression-free survival and Department of Medical
between
overall July 1, 2013, and June 30, 2016, by use of the search Oncology, Faculty of Medicine,
survival in patients with advanced non-small-cell lung cancer Cukurova University, Adana,
term “non-small cell lung cancer OR NSCLC AND
with PD-L1 of at least 50%. The study also included a Turkey (Prof S Paydas MD);
immunotherapy OR PD-L1”, only one agent in this class,
proportion Arkhangelsk Clinical Oncology
of patients with locally advanced non-small-cell lung cancer Center, Arkhangelsk, Russia
pembrolizumab, had shown superiority over chemotherapy
who (M Nechaeva MD); Regeneron
were not candidates for definitive chemoradiation, and those Pharmaceuticals, Tarrytown,
(median progression-free survival of 10·3 months [95% CI New York, NY, USA
with treated and clinically stable brain metastases. These
6·7–not reached] vs 6·0 months [4·2–6·2; hazard ratio (K McGuire PhD, F Seebach MD,
patients are usually under-represented in clinical trials, making D M Weinreich MD,
(HR) 0·50, 0·37–0·68; p<0·001]; and 6-month overall survival
the present study more reflective of real-world clinical practice. G D Yancopoulos MD,
estimate of 80·2% vs 72·4% [HR 0·60, 0·41–0·89, p=0·005]). G Gullo MD, I Lowy
Furthermore, there was no data published on the relationship Implications of all the available evidence
MD, P Rietschel MD)
between proportions of programmed cell death ligand 1 Results from this study provide a strong rationale for
Correspondence to:
cemiplimab (PD-L1) expression above the 50% threshold and survival as a new first-line monotherapy option for patients Dr Ahmet Sezer, Department of
with benefits of immune checkpoint inhibitors. Another study advanced non-small-cell lung cancer with PD-L1 of at least Medical Oncology, Başkent
50%. published around the time the first patient was enrolled in the Further exploratory analysis provides additional University, Dadaloglu Mh 39 SK,
Adana, Turkey
evidence of cemiplimab study showed that another agent, nivolumab, PD-L1 as an effective tumour biomarker that can
drasezer@hotmail.com.tr
support
shown survival benefit as monotherapy in this setting. 3,6,8

monotherapy versus investigator’s choice of platinum-
In the EU, pembrolizumab is approved for advanced non-
doublet chemotherapy in the first-line treatment of
small-cell lung cancer treatment in the same setting,
patients with advanced non-small-cell lung cancer
whereas atezolizumab is approved for use as a mono-
whose tumours express PD-L1 in at least 50% of tumour
therapy only after previous chemotherapy.3,9
cells. Patients were recruited in 138 clinics from 24
Cemiplimab is a highly potent, fully human, hinge-
countries (see appendix pp 3–11). See Online for appendix
stabilised, immunoglobulin G4, monoclonal antibody
The study protocol and all amendments were
directed against PD-1, derived by means of VelocImmune
approved by the appropriate institutional review board
technology (Regeneron Pharmaceuticals, Tarrytown, NY,
or independent ethics committee at each participating
USA).10–12 Cemiplimab is approved for the treatment of
study site. The study protocol, statistical analysis plan,
metastatic cutaneous squamous cell carcinoma or locally
and amendments are available in the appendix. The
advanced cutaneous squamous cell carcinoma not
study was done in accordance with the principles of the
amenable to curative surgery or curative
Declaration of Helsinki and the International Conference
radiotherapy.13,14 Cemiplimab showed antitumour activity
on Harmonisation Good Clinical Practice guidelines.
with a safety profile similar to that described for other
All patients provided written informed consent before
PD-1 inhibitors in advanced solid tumours.15,16
enrolment.
In EMPOWER-Lung 1, cemiplimab monotherapy was
compared with investigator’s choice of platinum-doublet
Participants
chemotherapy in the first-line treatment of patients with
Eligible patients were aged 18 years or older, had
advanced non-small-cell lung cancer whose tumours
histologically or cytologically confirmed stage IIIB or IIIC
express PD-L1 in at least 50% of tumour cells. The
or stage IV squamous or non-squamous non-small-cell
primary objective was to compare survival benefits of
lung cancer with PD-L1 expressed in at least 50% of
cemiplimab with those of chemotherapy.
tumour cells (those with stage IIIB or IIIC disease were
not candidates for definitive chemoradiotherapy; those
Methods
with stage IV disease were untreated; however, patients
Study design
who had received adjuvant or neoadjuvant
EMPOWER-Lung 1 is a multicentre, open-label, global,
chemotherapy were eligible if they met protocol criteria);
phase 3 randomised, controlled trial of cemiplimab
an Eastern Cooperative Oncology Group performance
status score of 0 or 1;
www.thelancet.com Vol 397 February 13, 5

Articles
adequate organ and bone marrow function; and presence

22C3 pharmDx assay (Agilent, Santa Clara, CA, USA) to
of at least one measurable lesion per the Response
measure tumour proportion score. Per protocol, all
Evaluation Criteria in Solid Tumors, version 1.1
patients were enrolled per PD-L1 of at least 50% by
(RECIST 1.1).17
means of the 22C3 assay done at a central laboratory.
Patients were ineligible if they had never smoked
However, sponsor monitoring revealed that samples
(defined as ≤100 cigarettes in a lifetime); or had active or
from patients tested before August, 2018 were not
untreated brain metastases; tumours positive for EGFR
consistently analysed per assay instructions for use
mutations, ALK translocations, or ROS1 fusions; active,
(with omitted or incorrect controls used) and were
known, or suspected autoimmune disease that required
affected by test instrument failures. Consequently,
systemic treatment during the previous 2 years; or
per FDA request to the sponsor, a PD-L1 of at least
uncontrolled infection with hepatitis B or C or HIV.
50% population was prespecified to include only
Patients with adequately treated, clinically stable CNS
patients with PD-L1 of at least 50% per assay results
metastases, controlled hepatitis B or C, or HIV were
based on assay’s manufacturer’s instructions for use
allowed to enrol. Details of eligibility criteria are in the
(ie, those who had PD-L1 of at least 50% on retest and
study protocol available in the appendix (p 39).
those who were tested after August, 2018, and were not
affected by the testing issue).
Randomisation and masking
Radiographic tumour assessments were done every
Patients were randomly assigned (1:1) to either
three cycles, at week 9, and every 9 weeks thereafter
cemiplimab monotherapy or investigator’s choice of
until disease progression. Response was assessed
chemotherapy. Assignment of chemotherapy choice
according to RECIST 1.1 by masked IRC. Patients were
was decided for each patient before randomisation.
followed up 2–4 weeks after the last dose of study
Randomisation was done according to a central ran-
treatment, then 6 weeks after last follow-up and every 9
domisation scheme provided by an interactive web
weeks thereafter for the first year. Patients were then
response system manual. Randomisation was stratified
followed up for survival every 3 months. The severity of
by patient’s tumour histology (squamous vs non-
treatment- emergent adverse events and laboratory
squamous) and geographical region (Europe, Asia, or
abnormalities was graded according to the National
rest of the world). The stratification by geographical
Cancer Institute Common Terminology Criteria for
region was to balance the treatment assignment within
Adverse Events, version 4.03. The full assessment
the regions, and, per protocol, was not included in the
schedule is available in the study protocol available in
analysis of efficacy endpoints, as the number might be
the appendix.
too small for some of the stratification categories. There
There were several protocol changes throughout the
was no masking of either investigators or patients to
duration of the study (appendix p 39). Major amend-
treatment allocation.
ments included changing overall survival from being a
secondary endpoint to a primary endpoint, the inclusion
Procedures
of an additional four timepoints for the interim analyses,
Patients were randomly assigned to receive either
and an update to the target enrolment from 300 to
cemiplimab 350 mg administered intravenously over a
700 patients to accommodate the expected weaker effect
period of 30 min every 3 weeks (for up to 108 weeks
of progression-free survival because of emerging data
[ie, up to 36 treatment cycles]) or four to six cycles of
from other studies of anti-PD-1s in a similar setting.
investigator’s choice of platinum-doublet chemotherapy
(appendix p 20). Cemiplimab dose modification was not Outcomes
allowed. Chemotherapy dose modification was allowed
The primary endpoints were overall survival (defined as
according to regional guidelines and standard of care.
the time from randomisation to death of any cause) and
Maintenance pemetrexed was permitted per standard
progression-free survival (the time from randomisation
of care. Treatments were continued for the specified
to the date of first documented disease progression,
duration or number of cycles or until RECIST 1.1-defined
per IRC, or death from any cause). Secondary endpoints
disease progression. Crossover from chemotherapy to
included objective response rate (a key secondary
cemiplimab was allowed following disease progression,
endpoint, defined as the proportion of patients with a
verified by the masked independent review committee
best overall response of confirmed complete or partial
(IRC). Patients randomly assigned to cemiplimab who
response), duration of response (defined, for patients
had IRC-confirmed disease progression, per protocol
with best overall response of complete or partial
amendment, were allowed to continue cemiplimab
response, as the time between the date of first complete
with the addition of four cycles of histology-specific
or partial response and the date of first documented
chemotherapy.
disease progression or death from any cause), health-
PD-L1 expression was assessed in formalin-fixed,
related quality of life (HRQoL; measured by means of the
paraffin-embedded tumour samples at a central
Global Health Status–HRQoL scale of the European
laboratory by means of PD-L1 immunohistochemistry
Organization for Research and Treatment of Cancer
quality of life questionnaire [EORTC QLQ-C30]; patients

3662 entered screening
2952 screen failures

2793 did not meet eligibility criteria 59 withdrew consent
41 died
54 other
Articles
5 adverse events
710 randomly assigned
completed questionnaires before any study procedures

or visits), and safety of cemiplimab versus
chemotherapy. Additional secondary outcomes were
pharmacokinetics, immunogenicity, and exposure–
response analyses; analyses of these outcomes will be
published when the analyses are completed. Per
protocol, an exploratory objective included the
assessment of correlation between the PD-L1 treated ogression rting t treated consent et criteria
proportions at baseline and efficacy of cemiplimab. treatment 2 patient decision
Efficacy endpoints were assessed in the intention-to- physician decision
other
treat population (ie, all randomly assigned patients) as
well as in the prespecified PD-L1 of at least
50% population. Safety was assessed in all patients who
received at least one dose of the assigned treatment.
356
355 allocated
received to cemiplimab
cemiplimab 354342
allocatedreceived
to chemotherapychemotherapy
128treatment
paclitaxel plus
127 paclitaxel plus
Statistical analysis carboplatin
carboplatin
Enrolment of 700 patients was planned and was estimated 102 98
pemetrexed
pemetrexedplusplus
carboplatin
carboplatin
39 pemetrexed
40 plus cisplatin plus
gemcitabine
to be attainable over a period of 38 months. Median 37 gemcitabine
carboplatin 35plus carboplatinplus
pemetrexed
overall survival of 13 months for patients treated with 37 gemcitabine
cisplatin plus cisplatin
11 paclitaxel plus cisplatin
26 gemcitabine plus cisplatin
chemotherapy and a non-proportional hazard ratio (HR)
9 paclitaxel plus cisplatin
between cemiplimab and chemotherapy, with an HR of 7 other platinum-based regimens
1·05 for the first 6 months and an HR of 0·58 after 1 patient d treatment ssive disease
210 discontinue 12 patients d treatment sive disease
not
6 months, was assumed. With five planned interim 133 progre
1 disease pr
no
148 discontinue
29 before
died 5 withdrew
analyses, by means of the Lan-DeMets approach with eventsevents
23 adverse
84not
2 did progres
O’Brien-Fleming spending function and 476 total deaths 9 patient decision9 withdrew consent me 25 died
8 withdrew consent7 patient decision 14 adverse
at final analysis of overall survival, the study had 5 physician decision5 physician decision
approximately 86% power to detect a significant overall 3 lost to follow-up4 lost to follow-up
survival effect at two-sided α of 0·04 and approximately

88% power to detect a significant overall survival effect 139 ongoing treatment 45 ongoing treatment
at two-sided α of 0·05. Median progression-free survival 6 completed treatment 149 completed treatment
of 6·4 months for patients treated with chemotherapy
and a non-proportional HR between cemiplimab and 356 intention-to-treat population 354 intention-to-treat population
chemotherapy, with an HR of 1·3 for the first 3 months 355 treated population 342 treated population
and an HR of 0·5 after 3 months, was assumed. With 525
progression-free survival events, the study had
Figure 1: Trial profile
approximately 76% power to detect a significant
progression-free survival effect at two-sided α of 0·01 and
approximately 90% power to detect a significant survival were evaluated by the baseline characteristics
progression-free effect at two-sided α of 0·05. of age, sex, region of enrolment, Eastern Cooperative
The primary endpoints were analysed by stratified log- Oncology Group performance status, histology, brain
rank test by use of tumour histology as stratification metastases at randomisation, and cancer stage at
factor. HRs and associated 95% CIs were estimated by a screening. For Global Health Status–HRQoL, the mean
stratified Cox regression model by means of the change from baseline score to each post-baseline visit
treatment as covariate and tumour histology as were summarised descriptively, with a ten-point change
stratification factor. Median overall survival and considered to be clinically meaningful.18 Correlations of
progression-free survival were estimated by means of the
Kaplan-Meier method. For overall survival analysis,
patients who did not have events, including those who
dropped out or were lost to follow-up, were censored at
the time of the last contact. For progression-free survival
analysis, patients who did not have events were
censored at the time of the last tumour assessment.
Objective response rate and associated odds ratio were
analysed by means of the Cochran-Mantel- Haenszel test
stratified by tumour histology. Objective response rates
and the associated 95% CIs were calculated by the
Clopper-Pearson method for each treatment. HRs for
overall survival and progression-free

Articles
for overall type 1 error. The key secondary endpoint of

Intention-to-treat population PD-L1 ≥50% population
objective response rate was tested hierarchically when
Cemiplimab Chemotherapy Cemiplimab Chemotherapy both analyses of overall survival and progression-free
group (n=356) group (n=354) group (n=283) group (n=280)
survival were significant. The first interim analysis of
Age overall survival was to be done after approximately a third
Median (IQR) 63 (58–69) 64 (57–69) 63 (58–69) 64 (58–70) of overall survival events (159 deaths) and the second
≥65 156 (44%) 164 (46%) 126 (45%) 133 (48%) interim analysis was to be done after approximately 50%
Sex (238 deaths) were observed.
Female 44 (12%) 60 (17%) 35 (12%) 49 (18%) The first interim analysis was done after 164 deaths
Male 312 (88%) 294 (83%) 248 (88%) 231 (83%) had occurred and the overall survival result did not
Region of enrolment meet the significance boundary. The second interim
Europe 275 (77%) 278 (79%) 215 (76%) 216 (77%) analysis was done after 249 deaths had occurred and
Asia 39 (11%) 38 (11%) 31 (11%) 29 (10%) was based on data cutoff date of March 1, 2020. The
Rest of the world 42 (12%) 38 (11%) 37 (13%) 35 (13%) nominal alpha for the second interim analysis of overall
Eastern Cooperative Oncology Group nce status score survival was adjusted to 0·00255 by means of the
performa
0 96 (27%) 96 (27%) 77 (27%) 75 (27%) Lan-DeMets approach with O’Brien-Fleming spending
1 260 (73%) 258 (73%) 206 (73%) 205 (73%) function based on actual number of events observed.
Smoking status The IDMC reviewed the results on April 23, 2020.
Current smoker 133 (37%) 120 (34%) 105 (37%) 92 (33%) At the time of review of the results by the IDMC,
Past smoker 223 (63%) 234 (66%) 178 (63%) 188 (67%) study enrolment was complete. Given that cemiplimab
Histology met the prespecified boundary for demonstration of
Squamous 159 (45%) 152 (43%) 122 (43%) 121 (43%) superior overall survival benefit over chemotherapy, the
BrainNon-squamous
metastases 197(12%)
44 (55%) 202(11%)
39 (57%) 161(12%)
34 (57%) 159 (57%)
34 (12%)
IDMC
the recommended
study that theThe
should be stopped. randomised portionthe
sponsor accepted of
Cancer stage at screening recommendation and all eligible patients randomly
Locally advanced 63 (18%) 52 (15%) 45 (16%) 42 (15%) assigned to chemotherapy were offered crossover to
Metastatic 293 (82%) 302 (85%) 238 (84%) 238 (85%)
cemiplimab. All data reported herein are based on the
Previous systemic 4 (1%) 7 (2%) 3 (1%) 4 (1%)
second interim analysis. This study is registered with
neoadjuvant therapy ClinicalTrials.gov, NCT03088540.
Previous systemic 9 (3%) 15 (4%) 5 (2%) 12 (4%)
adjuvant therapy Role of the funding source
Data were collected by investigators, analysed by
statisticians employed by the funders, and interpreted by
the authors, including employees of the funders. The
authors had full access to the data and were responsible
for all content and editorial decisions. The first draft of
the manuscript was prepared by a medical writer
(funded by the funders) and was based on the authors’
change in target tumour measurement at each visit from comments on the manuscript outline; also prepared by
baseline (last observation carried forward if no tumour the medical writer. Thereafter, the first draft was
measurement at that visit) with baseline PD-L1 proportions critically reviewed and revised by the authors,
Data are n (%) or median (IQR). PD-L1=programmed cell death ligand 1. *The intention-to-treat population included all patients who were randomly assigned. †The PD-L1 ≥50% population included pat
were summarised descriptively. Correlations of overall including employees of the funders.
Table 1: Baseline demographic survival, progression-free
and disease characteristics survival,
of patients in and objective
the intention-to-treat* and PD-L1 ≥50% populations†
response rate with baseline PD-L1 proportions were
summarised descriptively.
To control for type 1 error, the two-sided α value of 0·05 Figure 2: Overall survival and progression-free survival in the PD-L1
≥50% population
was split between the analyses of overall survival (0·04) (A)Kaplan-Meier estimates of overall survival, according to treatment
and progression-free survival (0·01). The α allocated to group, in the PD-L1 ≥50% population. (B) Kaplan-Meier estimates of
progression-free survival was subject to reallocation to progression-free survival per IRC, according to treatment group, in the PD-L1
overall survival, provided the progression-free survival ≥50% population.
(C)analysis of overall survival by subgroups in the PD-L1 ≥50% population.
analysis was positive, and vice versa. The protocol (D)analysis of progression-free survival by subgroups in the PD-L1
specified five interim analyses before the final analysis, ≥50% population. Overall survival and progression-free survival were also
to be done by an independent statistics group and analysed in the intention-to-treat population and the results were consistent
reviewed by the independent data monitoring committee with the PD-L1 ≥50% population (see appendix p 16). The overall survival and
progression-free survival benefits with cemiplimab were evident in all
(IDMC). The overall survival interim analyses were done subgroups examined, except for overall survival in female patients (in the
by means of the protocol specified Lan-DeMets approach PD-L1 ≥50% population; n=84) and in patients enrolled in Asia (in
with O’Brien-Fleming spending function in order to the intention-to-treat population; n=77 [see appendix pp 17–18]).
IRC=independent review committee. PD-L1=programmed cell death-ligand 1.
control

Articles
Results June 27, 2017 and Feb 27, 2020, 710 patients from
As of data cutoff, 3662 patients across 188 sites in
138 clinics in 24 countries who met eligibility criteria
24 countries were screened for enrolment. Between
were randomly assigned to receive cemiplimab (n=356)
A Overall survival in the PD-L1 ≥50% population B Progression-free survival in the PD-L1 ≥50% population
Number of Median overall survival months Number of Median progression-free survival months
patients (95% CI) patients (95% CI)
Cemiplimab 283 Not reached (95% CI 17·9–NE) Cemiplimab 283 8·2 (95% CI 6·1–8·8)
Chemotherapy 280 14·2 (95% CI 11·2–17·5) Chemotherapy 280 5·7 (95% CI 4·5–6·2)
100 100
90 90
80 Hazard ratio for death 80 Hazard ratio for disease progression
0·57 (95% CI 0·42–0·77) or death 0·54 (95% CI 0·43–0·68)
70 70
Progression-free survival
p=0·0002 p<0·0001
Overall survival
60 60
50 50
40 40
30 30
20 20
10 10
0 0
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32
Time (months) Time (months)
Number at risk
(number censored)
Cemiplimab 283 244 203 177 154 108 83 55 42 24 18 15 10 6 3 1 0 283 221 162 123 92 59 43 28 20 14 11 9 3 0 0 0
5
(0) (21) (46) (65) (82) (119)(140)(165)(177) (192)(197)(199)(203)(207)(210)(212)(213) (0) (24) (42) (55) (73) (93) (107)(118)(123) (127)(129)(130)(133) (135)(136)(136)(136)
Chemotherapy 280 239 198 153 125 87 57 41 25 15 11 6 4 1 0 280 220 157 104 42 20 8 4 0 0 0 0 0 0 0 0
0
2 3
(0) (24) (45) (66) (82) (110)(130)(144)(156)(163)(165)(170) (171) (173) (174)(175) (175) (0) (31) (48) (56) (67) (75) (78) (80) (80) (83) (83) (83) (83) (83) (83) (83) (83)
C Overall survival by subgroups in the PD-L1 ≥50% population D Progression-free survival by subgroups in the PD-L1 ≥50% population
Events/number of patients Hazard ratio for pinteraction Events/number of patients Hazard ratio for pinteraction
overall survival value progression-free value
(95% CI) survival (95% CI)
Cemiplimab Chemotherapy Cemiplimab Chemotherapy
Age (years) 0·31 Age (years) 0·21

<65 41/157 50/147 0·66 (0·44–1·00) <65 83/157 104/147 0·51 (0·37–0·69)
≥65 29/126 55/133 0·48 (0·30–0·76) ≥65 64/126 93/133 0·60 (0·43–0·84)
Sex 0·05 Sex 0·11
Male 58/248 92/231 0·50 (0·36–0·69) Male 127/248 169/231 0·50 (0·40–0·64)
Female 12/35 13/49 1·11 (0·49–2·52) Female 20/35 28/49 0·79 (0·43–1·46)
Region of enrolment 0·94 Region of enrolment 0·65
Europe 55/215 84/216 0·54 (0·39–0·77) Europe 114/215 155/216 0·50 (0·39–0·65)
Asia 5/31 7/29 0·76 (0·24–2·41) Asia 16/31 20/29 0·70 (0·36–1·37)
Rest of the world 14/35 0·59 (0·26–1·33) Rest of the 17/37 22/35 0·59 (0·30–1·14)
10/37 world
Eastern Cooperative Oncology Group 0·32 Eastern Cooperative Oncology Group 0·37
performance status score performance status score
0 18/77 23/75 0·77 (0·41–1·44) 0 39/77 46/75 0·59 (0·38–0·92)
1 52/206 82/205 0·54 (0·38–0·76) 1 108/206 151/205 0·52 (0·41–0·68)
Histology 0·53 Histology 0·69
Squamous 30/122 48/121 0·48 (0·30–0·77) Squamous 67/122 90/121 0·48 (0·34–0·67)
Non-squamous 40/161 57/159 0·64 (0·43–0·96) Non-squamous 80/161 107/159 0·60 (0·44–0·81)
Brain metastases at baseline 0·23 Brain metastases at baseline 0·42
Yes 4/34 12/34 0·17 (0·04–0·76) Yes 13/34 26/34 0·45 (0·22–0·92)
No 66/249 93/246 0·60 (0·44–0·83) No 134/249 171/246 0·56 (0·44–0·71)
Cancer stage at screening 0·55 Cancer stage at screening 0·95
Locally advanced 9/45 15/42 0·1 0·48 (0·20–1·14) 1 Locally Metastatic Overall
Metastatic 61/238 90/238 0·59 (0·43–0·82) advan
1
Overall 70/283 105/280 0·57 (0·42–0·77) 0 ced

27/45 2 2 0·1 0 9 0·7 4 (0·43–0·68)
120/238 8/ 169/238 · (0· 1)
27 1 10
147/283 4 197/280 4 0·5
Favours cemiplimab Favours chemotherapy Favours cemiplimab Favours chemotherapy

Articles
was not reached (95% CI 17·9–not evaluable) with

Cemiplimab group (n=283)Chemotherapy group (n=280)
cemiplimab versus 14·2 months (11·2–17·5) with
Objective response
Number of patients11157 chemotherapy (HR 0·57; 95% CI 0·42–0·77; p=0·0002;
% (95% CI)39% (34–45)20% (16–26) figure 2A). The estimated probability of overall survival
Odds ratio (95% CI)*2·53 (1·74–3·69); p<0·0001·· from baseline through 24 months was 50% (36–63)
for cemiplimab and 27% (14–43) for chemotherapy
Best overall response Complete response Partial response Stable disease (appendix p 22). With 344 events of progressive disease
Non-complete response or non-progressive disease
6 (2%)
Progressive disease Not evaluable 105 (37%)
3 (1%) or deaths, cemiplimab also significantly improved pro-
54 (19%)
gression-free survival (HR 0·54; 0·43–0·68; p<0·0001).
76 (27%) 135 (48%)
2 (1%) 1 (<1%) Median progression-free survival was 8·2 months
(95% CI 6·1–8·8) with cemiplimab versus 5·7 months
(4·5–6·2) with chemotherapy (figure 2B). The estimated
52 (18%) 41 (15%) probability of progression-free survival from baseline
42 (15%) 46 (16%)
through 12 months was 41% (34–48) for cemiplimab
Kaplan-Meier estimated median duration16·7of(12·5–22·8)
response, months (95% 6·0CI)†(4·3–6·5) and 7% (4–12) for chemotherapy (appendix p 22). The
overall survival and progression-free survival benefits
Median observed time to response, months†
2·1 (2·1–2·3) 2·1 (2·1–3·1) with cemiplimab were evident in all subgroups
examined, except for overall survival in female patients
Data are n (%) unless otherwise specified. PD-L1=programmed cell death ligand 1. RECIST 1.1=Response(n=84;
Evaluation Criteria in
figures 2CSolid
andTumors
2D).version
An 1.1. *Per two-sided p
IRC-assessed value and odds ratios us
objective
Table 2: Summary of tumour response per RECIST 1.1 according to independent review committee in the PD-L1 ≥50% population
response was observed in 111 (39%; 95% CI 34–45) of
283 patients who had received cemiplimab and 57 (20%;
16–26) of 280 patients who had received chemotherapy.
The median duration of response was 16·7 months
(95% CI 12·5–22·8) for cemiplimab and 6·0 months
(4·3–6·5) for chemotherapy (table 2). Characteristics of
tumour responses are shown in the appendix (p 14).
In the intention-to-treat population (n=710; consisting
of n=563 patients from the aforementioned PD-L1 of at
or chemotherapy (n=354; figure 1). Two additional least 50% population, and also the 56 patients who were
patients were enrolled after the data cutoff and are not definitively PD-L1<50% based on validated retest and
included in the intention-to-treat population. the 91 patients for whom PD-L1 expression could not be
A total of 150 (74%) of 203 patients who progressed established because validated retest could not be
on chemotherapy received cemiplimab as a crossover performed), the overall median duration of follow-up
treatment; 50 (32%) of 158 patients who progressed on was 13·1 months (IQR 8·6–20·2) for cemiplimab and
cemiplimab received extended treatment with the addition 13·1 months (IQR 8·7–20·1) for chemotherapy.
of chemotherapy. Significant improvement in overall survival (median
The PD-L1 of at least 50% population (the intended 22·1 months [95% CI 17·7–not evaluable] versus
study population and as requested by the FDA) consisted 14·3 months [11·7–19·2]; HR 0·68 [0·53–0·87];
of 563 patients (n=88 from those who were retested as p=0·0022) and progression-free survival (median
PD-L1 of at least 50% or more and n=475 tested per 6·2 months [4·5–8·3] versus 5·6 months [4·5–6·1];
prescribed instructions by the test manufacturer from HR 0·59 [0·49–0·72]; p<0·0001) were also observed
the outset; n=283 for cemiplimab, n=280 for with cemiplimab (appendix p 16). An additional
chemotherapy; see Methods and appendix p 13 for more sensitivity analysis requested by the FDA for a patient
details). The baseline demographic and disease population excluding those with known PD-L1
characteristics were well balanced between the expression <50% (n=654; including 563 patients in the
cemiplimab and chemotherapy groups, in both the PD-L1 of at least 50% population and 91 patients for
intention-to-treat and the PD-L1 of at least 50% whom PD-L1 expression could not be determined
populations (table 1). because validated retest could not be done) also
In the PD-L1 of at least 50% population, the overall revealed similar HRs for overall survival (0·65 [95% CI
median duration of follow-up was 10·8 months 0·50–0·85]) and progression-free survival (0·58 [95% CI
(IQR 7·6–15·8) for cemiplimab and 10·9 months 0·47–0·70]). In the intention-to-treat population, the
(IQR 7·8–15·6) for chemotherapy. A total of 129 (46%) overall survival and progression-free survival benefits
of 283 patients were still receiving cemiplimab and 45 with cemiplimab were evident in all subgroups
(16%) of 280 patients were still receiving chemotherapy examined, except for overall survival in patients enrolled
as of data cutoff. Summary of treatment exposures is in Asia (n=77; appendix pp 17–18). Tumour response
shown in the appendix p 21. results are also consistent with the PD-L1 of at least 50%
In the PD-L1 of at least 50% population (n=563), population (appendix p 23). Early and sustained
there were 175 deaths. The median overall survival clinically meaningful

Articles
improvements in HRQoL were observed with 342 patients treated with chemotherapy. The events
cemiplimab but not with chemotherapy (appendix p 19).
Exploratory analysis of PD-L1 expression proportions
(PD-L1 ≥90%; PD-L1 >60% to <90%; PD-L1 ≥50% to
≤60%) showed that PD-L1 proportions correlate with
Percentage change from baseline in the

depth of changes in tumour measurement, as well as
diameter of target tumour measurement

with incremental improvements in overall survival,
progression-free survival, and objective response rate
(figure 3 and table 3). Patients who were treated with
cemiplimab who had PD-L1 less than 50% or unknown
did not do as well as patients with PD-L1 of at least 50%.
However, they did broadly as well as chemotherapy-
treated patients. Depth of tumour reduction and other
measures were similar for the chemotherapy patients
regardless of PD-L1 expression proportion score (figure 3).
A total of 355 patients received at least one dose of
cemiplimab, and 342 received at least one dose of
chemotherapy. The proportion of patients with at least
one dose delay was lower with cemiplimab (89 [25%])
versus chemotherapy (109 [32%]). At least one infusion
interruption was reported in 14 (4%) of the 355 patients
treated with cemiplimab and six (2%) of the 342
patients treated with chemotherapy. Grade 3–4 treatment-
emergent adverse events, regardless of attribution,
occurred in 98 (28%) of 355 patients treated with
cemiplimab, with the most common being pneumonia in
16 (5%), anaemia in
12 (3%), and hyponatraemia in nine (3%); grade 3–4
treatment-emergent adverse events occurred in 135 (39%)
of 342 patients treated with chemotherapy, with the
most common being anaemia in 56 (16%),
neutropenia in
35 (10%), and thrombocytopenia in 28 (8%; appendix
p 24). Treatment-emergent adverse events that led to
treatment discontinuation occurred in 23 (6%) of
355 patients who received cemiplimab and 14 (4%) of
342 patients who received chemotherapy. Serious
treatment-emergent adverse events occurred in 100 (28%)
of 355 patients who received cemiplimab with 38 (11%)
considered treatment-related; serious treatment-emergent
adverse events occurred in 94 (27%) of 342 patients
who received chemotherapy with 53 (15%) considered
treatment-related.
Treatment-related adverse events occurred in 204 (57%)
of 355 patients who received cemiplimab and 303 (89%)
of 342 patients who received chemotherapy; the events
were grade 3–4 in 41 (12%) of 355 patients who
received
cemiplimab and 127 (37%) of 342 patients who received
chemotherapy. The most common grade 3–4 treatment-
related adverse events were increased aspartate amino-
transferase in five (1%) and pneumonia in four (1%)
patients treated with cemiplimab, and anaemia in
51 (15%) and neutropenia in 35 (10%) patients treated
with chemotherapy. Treatment-related adverse events
are summarised in table 4.
Treatment-emergent adverse events, regardless of
attribution, that led to death occurred in 34 (10%)
of 355 patients treated with cemiplimab and 31 (9%) of

Cemiplimab PD-L1 <50% or unknownCemiplimab PD-L1 >60% to <90% Chemotherapy PD-L1 <50
Cemiplimab PD-L1 ≥50% to ≤60%
–10
–20
–30
–40 0 3 6 9 12 15 18 21 24 27
Time (months)
Figure 3: Correlation of change in target tumour measurement (last

observation carried forward) with baseline PD-L1 proportion –50
scores
Correlation of percentage change in target tumour measurement with
baseline PD-L1 in intention-to-treat patients, based on PD-L1 assessment
by 22C3 per instructions for use. LOCF=last observation carried forward.
PD-L1=programmed cell death ligand 1.
PD-L1 ≥90% PD-L1 >60 to <90% PD-L1 ≥50 to ≤60% PD-L1 <50% o
leading to death were unknown
considered related to treatment
Number of patients98 vs 9489 vs 9096 vs 9673 vs 74
in nine (3%) patients treated
Overall survival
with cemiplimab and were Median, monthsNR (17·3–NE) vs22·1 (17·9–NE) vs21·9 (13·2–NE) vs16·5 (11·6–NE) vs
autoimmune myocarditis, (95% CI)15·1 (11·1–NE)12·0 (9·6–19·2)14·0 (9·4–19·3)15·2 (10·2–NE)
cardiac failure, cardiopul- Hazard ratio0·46 (0·25–0·85)0·47 (0·27–0·80)0·77 (0·49–1·23)1·082 (95% CI)(0·68–1·72)
monary failure,
cardiorespiratory arrest, Progression-free survival
nephritis, respiratory failure, Median, months15·3 (10·4–18·7) vs6·2 (4·2–8·4) vs4·3 (2·8–6·3) vs4·1 (2·6–6·1) vs
septic shock, tumour (95% CI)5·9 (4·3–6·2)4·2 (4·1–5·7)6·2 (5·0–6·2)5·0 (4·2–6·2)
Hazard ratio0·28 (0·17–0·46)0·55 (0·38–0·80)0·79 (0·56–1·12)0·82 (95% CI)(0·56–1·18)
hyperprogression, and unknown
cause (n=1 each). The events
leading to death were Tumour response
Objective response 46 (36–56) vs
considered related to 39 (29–50) vs 32 (23–43) vs 26 (17–38) vs
rate, % (95% CI)18 (11–27) 20 (12–30) 23 (15–33) 22 (13–33)
treatment in seven (2%)
patients treated with Data are median (95% CI), hazard ratio (95% CI), and objective response rate % (95% CI). NE=not evaluable. NR=
chemotherapy and were Table 3: Correlation of survival and objective response with baseline PD-L1 proportion scores f
pneumonia and pulmonary

embolism (n=2 each), and
cardiac arrest, lung abscess, and
myocardial infarction (n=1
each).
Immune-related adverse
events based on a sponsor-
defined list of terms occurred
in 62 (17%) patients in

Articles
Cemiplimab group (n=355) Chemotherapy group (n=342)

Grade 1–2 Grade 3 Grade 4 Grade 5 Grade 1–2 Grade 3 Grade 4 Grade 5
Any 154 (43%) 36 (10%) 5 (1%) 9 (3%) 169 (49%) 92 (27%) 35 (10%) 7 (2%)
Increased alanine 18 (5%) 3 (1%) 0 0 12 (4%) 0 0 0
aminotransferase
Decreased appetite 17 (5%) 1 (<1%) 0 0 48 (14%) 1 (<1%) 0 0
Increased aspartate 17 (5%) 5 (1%) 0 0 11 (3%) 1 (<1%) 0 0
aminotransferase
Anaemia 16 (5%) 2 (1%) 0 0 101 (30%) 49 (14%) 2 (1%) 0
Rash 15 (4%) 3 (1%) 0 0 8 (2%) 0 0 0
Diarrhoea 14 (4%) 1 (<1%) 0 0 17 (5%) 6 (2%) 0 0
Nausea 14 (4%) 0 0 0 87 (25%) 3 (1%) 1 (<1%) 0
Arthralgia 13 (4%) 0 0 0 20 (6%) 1 (<1%) 0 0
Fatigue 12 (3%) 3 (1%) 0 0 38 (11%) 4 (1%) 0 0
Vomiting 11 (3%) 0 0 0 41 (12%) 3 (1%) 1 (<1%) 0
Increased amylase 10 (3%) 1 (<1%) 0 0 1 (<1%) 1 (<1%) 0 0
Pneumonitis 10 (3%) 0 1 (<1%) 0 1 (<1%) 0 0 0
Constipation 9 (3%) 0 0 0 35 (10%) 0 0 0
Increased blood alkaline 9 (3%) 2 (1%) 0 0 3 (1%) 1 (<1%) 0 0
phosphatase
Increased blood creatinine 8 (2%) 0 0 0 19 (6%) 1 (<1%) 0 0
Asthenia 7 (2%) 0 0 0 24 (7%) 1 (<1%) 0 0
Stomatitis 7 (2%) 0 0 0 11 (3%) 1 (<1%) 0 0
Back pain 6 (2%) 0 0 0 3 (1%) 1 (<1%) 0 0
Increased weight 5 (1%) 2 (1%) 0 0 0 0 0 0
Hyperkalaemia 5 (1%) 1 (<1%) 0 0 1 (<1%) 1 (<1%) 0 0
Hypoalbuminaemia 5 (1%) 1 (<1%) 0 0 13 (4%) 3 (1%) 0 0
Thrombocytopenia 5 (1%) 0 0 0 24 (7%) 12 (4%) 13 (4%) 0
Dyspnoea 4 (1%) 1 (<1%) 1 (<1%) 0 6 (2%) 1 (<1%) 0 0
Hypomagnesaemia 4 (1%) 0 0 0 19 (6%) 1 (<1%) 0 0
Neutropenia 3 (1%) 1 (<1%) 1 (<1%) 0 26 (8%) 24 (7%) 11 (3%) 0
Hypocalcaemia 3 (1%) 0 0 0 2 (1%) 2 (1%) 1 (<1%) 0
Hypokalaemia 3 (1%) 0 1 (<1%) 0 6 (2%) 4 (1%) 0 0
Increased bilirubin 3 (1%) 0 0 0 2 (1%) 1 (<1%) 0 0
Increased lipase 3 (1%) 1 (<1%) 0 0 0 0 0 0
Maculopapular rash 3 (1%) 1 (<1%) 0 0 2 (1%) 0 0 0
Acute kidney injury 2 (1%) 0 0 0 1 (<1%) 2 (1%) 0 0
Alopecia 2 (1%) 0 0 0 79 (23%) 1 (<1%) 1 (<1%) 0
Decreased weight 2 (1%) 1 (<1%) 0 0 10 (3%) 0 0 0
Decreased white blood cell 2 (1%) 0 0 0 15 (4%) 10 (3%) 3 (1%) 0
count
Hyperuricaemia 2 (1%) 1 (<1%) 0 0 1 (<1%) 0 0 0
Peripheral neuropathy 2 (1%) 1 (<1%) 0 0 34 (10%) 1 (<1%) 0 0
Peripheral sensory neuropathy 2 (1%) 0 0 0 10 (3%) 1 (<1%) 0 0
Autoimmune hepatitis 1 (<1%) 1 (<1%) 0 0 0 0 0 0
Decreased lymphocyte count 1 (<1%) 0 0 0 6 (2%) 3 (1%) 1 (<1%) 0
Decreased platelet count 1 (<1%) 0 0 0 23 (7%) 5 (1%) 7 (2%) 0
Deep vein thrombosis 1 (<1%) 0 0 0 0 1 (<1%) 0 0
Drug hypersensitivity 1 (<1%) 0 0 0 1 (<1%) 1 (<1%) 0 0
Hepatitis 1 (<1%) 1 (<1%) 0 0 0 0 0 0
Hepatotoxicity 1 (<1%) 0 0 0 0 1 (<1%) 0 0
Hyponatraemia 1 (<1%) 2 (1%) 0 0 3 (1%) 6 (2%) 0 0
Hypophosphataemia 1 (<1%) 0 1 (<1%) 0 1 (<1%) 0 1 (<1%) 0
Leukopenia 1 (<1%) 1 (<1%) 0 0 21 (6%) 9 (3%) 0 0
(Table 4 continues on next page)

Articles
Cemiplimab group (n=355) Chemotherapy group (n=342)

Grade 1–2 Grade 3 Grade 4 Grade 5 Grade 1–2 Grade 3 Grade 4 Grade 5
(Continued from previous
page)
Lymphopenia 1 (<1%) 0 0 0 3 (1%) 1 (<1%) 0 0
Nephritis 0 0 0 1 (<1%) 0 0 0 0
Pain in extremity 1 (<1%) 1 (<1%) 0 0 10 (3%) 0 0 0
Pleural effusion 1 (<1%) 2 (1%) 0 0 0 2 (1%) 0 0
Pneumonia 1 (<1%) 4 (1%) 0 0 5 (1%) 4 (1%) 1 (<1%) 2 (1%)
Pulmonary haemorrhage 1 (<1%) 0 0 0 1 (<1%) 0 1 (<1%) 0
Urinary tract infection 1 (<1%) 0 0 0 2 (1%) 1 (<1%) 0 0
Abnormal hepatic function 0 0 0 0 2 (1%) 1 (<1%) 0 0
Anaphylactic reaction 0 0 0 0 0 1 (<1%) 0 0
Arterial embolism 0 0 0 0 0 1 (<1%) 0 0
Arterial insufficiency 0 0 0 0 0 0 1 (<1%) 0
Atrial tachycardia 0 1 (<1%) 0 0 0 0 0 0
Autoimmune myocarditis 0 0 0 1 (<1%) 0 0 0 0
Biliary tract infection 0 1 (<1%) 0 0 0 0 0 0
Cardiac arrest 0 0 0 0 0 0 0 1 (<1%)
Cardiac failure 0 0 0 1 (<1%) 0 0 0 0
Cardiorespiratory arrest 0 0 0 1 (<1%) 0 0 0 0
Cardiopulmonary failure 0 0 0 1 (<1%) 0 0 0 0
Cataract 0 0 0 0 0 1 (<1%) 0 0
Cerebrovascular insufficiency 0 1 (<1%) 0 0 0 0 0 0
Death 0 0 0 1 (<1%) 0 0 0 0
Decreased neutrophil count 0 0 0 0 24 (7%) 12 (4%) 6 (2%) 0
Dehydration 0 0 0 0 0 1 (<1%) 0 0
Delirium 0 0 0 0 0 1 (<1%) 0 0
Diabetic metabolic 0 0 1 (<1%) 0 0 0 0 0
decompensation
Dysphagia 0 0 0 0 1 (<1%) 1 (<1%) 0 0
Embolism 0 1 (<1%) 0 0 0 0 0 0
Encephalopathy 0 1 (<1%) 0 0 0 0 0 0
Febrile neutropenia 0 0 0 0 0 6 (2%) 2 (1%) 0
Gastroenteritis 0 0 0 0 0 1 (<1%) 0 0
Hypercalcaemia 0 0 0 0 3 (1%) 1 (<1%) 0 0
Hypertension 0 0 0 0 0 2 (1%) 0 0
Hypoesthesia 0 0 0 0 2 (1%) 1 (<1%) 0 0
Hypochloraemia 0 0 0 0 0 1 (<1%) 0 0
Hypophagia 0 0 0 0 2 (1%) 1 (<1%) 1 (<1%) 0
Immune-mediated 0 1 (<1%) 0 0 0 0 0 0
enterocolitis
Immune-mediated hepatitis 0 0 2 (1%) 0 0 0 0 0
Immune-mediated 0 0 1 (<1%) 0 0 0 0 0
pneumonitis
Interstitial lung disease 0 1 (<1%) 0 0 0 0 0 0
Ischaemic stroke 0 0 0 0 0 0 1 (<1%) 0
Lichen planus 0 1 (<1%) 0 0 0 0 0 0
Lung abscess 0 0 0 0 0 0 0 1 (<1%)
Muscular weakness 0 0 0 0 2 (1%) 1 (<1%) 0 0
Myocardial infarction 0 0 0 0 0 0 0 1 (<1%)
Pancytopenia 0 0 0 0 0 0 1 (<1%) 0
Peripheral swelling 0 1 (<1%) 0 0 1 (<1%) 0 0 0
Pleural infection 0 0 0 0 0 1 (<1%) 0 0
Proteinuria 0 0 0 0 0 1 (<1%) 0 0
(Table 4 continues on next page)

Articles
Cemiplimab
Grade 1–2 group
Grade 3 (n=355)
Grade 4 Grade 5 Chemotherapy
Grade 1–2 group
Grade 3 (n=342)
Grade 4 Grade 5
(Continued from previous
page) 0 0 1 (<1%) 0 0 0 0 2 (1%)
Pulmonary embolism
Respiratory failure 0 0 1 (<1%) 1 (<1%) 0 0 0 0
Septic shock 0 0 0 1 (<1%) 0 0 1 (<1%) 0
Syncope 0 0 0 0 0 1 (<1%) 0 0
Superficial thrombophlebitis 0 0 0 0 0 1 (<1%) 0 0
Toxicity to various agents 0 0 0 0 0 0 1 (<1%) 0
Tumour hyperprogression 0 0 0 1 (<1%) 0 0 0 0
Ventricular extrasystoles 0 1 (<1%) 0 0 0 0 0 0
Data are n (%) in all treated patients. Treatment-related adverse events, by investigator assessment, reported in at least 10% of patients (grades 1–2) in either treatm
Table 4: Treatment-related adverse events by investigator assessment
the cemiplimab group and eight (2%) patients in the

survival benefit with cemiplimab in the present
chemotherapy group (appendix p 36). One patient in
study. Additionally, although this study could not be run
the cemiplimab group died from immune-related
in certain countries (including the USA and many
nephritis.
western European countries) owing to the availability
of alternative anti-PD-1 therapy, the results from the
Discussion chemotherapy group are consistent with previous reports
In EMPOWER-Lung 1, cemiplimab was superior to
of patients receiving platinum-doublet chemotherapy
chemotherapy in the first-line treatment of advanced
in these regions,24 supporting the idea that patients in
non- small-cell lung cancer with PD-L1 of at least 50%
this trial had a similar quality of care to those regions
and without EGFR, ALK, or ROS1 aberrations.
where the study could not be run. The survival benefit
Treatment with cemiplimab resulted in significantly
was shown with cemiplimab despite most patients
longer overall survival and progression-free survival,
crossing over to cemiplimab from chemotherapy on
reducing the risk of death by 43·4% in the PD-L1 of at
progression, underscoring the importance of sequencing.
least 50% population and by 32·4% in the intention-to-
Exploratory analysis emphasises PD-L1 as an effective
treat population. These results are consistent with those
tumour biomarker for this patient group, with increasing
reported for pembrolizumab (defined by the same 22C3
PD-L1 expression correlating with even better outcomes
immunohistochemistry test) and atezolizumab (defined
with cemiplimab. Although the numbers are too small
with a different test; the SP142 assay). 3,6 However, it has
to draw firm conclusions, it was notable that, for
been shown that, owing to differences in sensitivity
cemiplimab-treated patients with PD-L1 less than 50%,
between the two assays, SP142 tends to identify a
tumour responses were on a par with those for chemo-
population of patients with higher mean proportions of
therapy. Thus, the extent of PD-L1 expression appears to
PD-L1 expression than 22C3.6,19,20
be a somewhat continuous measure describing potential
Survival benefits with cemiplimab were observed in all
responsiveness to the PD-1 pathway blockade.
subgroups analysed, regardless of the study population, In the absence of randomised clinical trials comparing
except for overall survival in female patients (in the PD- single-agent ICI with a combination of ICI and chemo-
L1 ≥50% population) and overall survival in patients therapy in advanced non-small-cell lung cancer patients
enrolled in Asia (in the intention-to-treat population). with PD-L1 of at least 50%, physicians might be faced
However, the small number of events (25 in 84 female with a decision on whether to offer ICI monotherapy or
patients and 18 in 77 patients enrolled in Asia) precludes us ICI combined with chemotherapy. Available data suggest
from drawing any firm conclusions on the benefit of that combination therapies provide patients with
cemiplimab in these subpopulations. Of note, the low survival benefits regardless of PD-L1 expression
proportion of female patients in our study is in keeping proportions.25–27 However, sparing patients the risk of
with other studies in a similar setting in which the increased toxicity with chemotherapy is an important
proportion of male patients is significantly higher,3,6 and consideration.7 Data from the present study suggest that
also reflects the epidemiology of non-small-cell lung patients with very high PD-L1 proportions, especially
cancer in the regions that enrolled most patients for this those of at least 90%, could be ideal candidates for
study.21 Median overall survival observed with monotherapy with cemiplimab, as this option could
chemotherapy was consistent with previous reports of provide the most favourable risk–benefit ratio compared
platinum-doublet chemotherapy,22,23 underscoring the with an ICI- chemotherapy combination.
robustness of the

Articles
The safety profile was consistent with the previously the addition of chemotherapy.
reported profile for cemiplimab and other PD-1 or PD-L1
inhibitors in non-small-cell lung cancer and other
tumour types.3,6,13,14,28 The safety profile for the
chemotherapy group was as expected. More immune-
related adverse events were reported with cemiplimab
compared with chemotherapy. The immune-related
adverse event profile with cemiplimab in the present
study appeared to be consistent and possibly better than
those previously reported for cemiplimab in other
tumour types.14,28 Overall, despite substantially longer
exposure to cemiplimab, the patient- reported HRQoL
and safety profile of cemiplimab appeared to be better
than that of chemotherapy.
This study is not without limitations. The requirement
of PD-L1 of at least 50% in tumour cells necessary for
patient enrolment in this study used the 22C3 IHC test
(for comparability with one approved anti-PD-1 for this
indication). During sponsor monitoring, it was found
that the original central laboratory deviated from the
manufacturer’s assay instructions for use. As a result of
the findings during sponsor monitoring, corrective
actions were taken per FDA recommendations and, on
retesting of available samples from affected patients,
56 patients had PD-L1 less than 50%, and validated
retest could not be done for 91 patients. This resulted
in two patient populations: the PD-L1 of at least
50% population (per the FDA recommendation) and the
intention-to-treat population. These findings
substantiate the importance of adherence to
manufacturer’s instructions for use for assay conduct.
Despite inclusion of the patients whose tumours did not
have PD-L1 of at least 50%, the study showed
significant improvements of overall survival and
progression-free survival in the intention-to-treat
population, with outcomes further accentuated in the
PD-L1 of at least 50% population.
The present study excluded patients who were never-
smokers (defined as those who had smoked ≤100 cigarettes
in their lifetime), as previous studies have shown that
this relatively infrequently occurring patient group does
not benefit from PD-1 monotherapy.3,29 However, the
present study included a notable proportion of patients
with locally advanced non-small-cell lung cancer who
were not candidates for definitive chemoradiation (15%
in the PD-L1 ≥50% population and 16% in the intention-
to-treat population), and those with brain metastases
(12% in both PD-L1 ≥50% and intention-to-treat
populations). Historically, these patients have been under-
represented in clinical trials of first-line PD-1 or PD-L1
inhibitors.3,30 The enrolment of a higher number of
patients with brain metastases in this study compared
with other studies of ICIs in the same setting is a result of
inclusion criteria that are more reflective of real-world
clinical practice (eg, resolution of neurological symptoms
after treatment of brain metastases was sufficient rather
than radiological stability proven several weeks later).
Moreover, the present study allowed patients who
progressed on cemiplimab to continue cemiplimab with
32% of eligible patients received immunotherapy (PCT/US2015/062208) licensed to Personal Genome
Diagnostics. BG, SLi, SLe, KM, C-IC, FS, DMW,
this extended cemiplimab
and GG are employees and shareholders of Regeneron Pharmaceuticals.
treatment with the addition of GDY is an employee of, shareholder in, and a member of Board of
chemotherapy. This did not have Directors at Regeneron Pharmaceuticals. IL and PR are employees of,
an effect on the overall survival have a patent pending (PCT/US2018/018747), and are shareholders of
Regeneron Pharmaceuticals.
data interpretation at this time.
Longer follow-up is ongoing to Data sharing
Qualified researchers can request access to study documents (including
further describe outcomes in the clinical study report, the study protocol with any amendments,
these subgroups. a blank case report form, and a statistical analysis plan) that support the
In conclusion, the results of methods and findings reported in this manuscript. Individual
EMPOWER-Lung 1 showed a anonymised participant data will be considered for sharing once the
product and indication has been approved by major health authorities
clinically meaningful and (eg, FDA, European Medicines Agency, Pharmaceuticals and Medical
statistically significant Devices Agency, etc), if there is legal authority to share the data and
improvement in overall survival there is not a reasonable likelihood of participant re-identification.
and progression-free survival Submit data-sharing requests to https://vivli.org/.
with first-line cemiplimab Acknowledgments
monotherapy over platinum- The study was sponsored by Regeneron Pharmaceuticals and Sanofi and
was designed by employees of Regeneron Pharmaceuticals in
doublet chemotherapy in patients
with advanced non-small-cell
lung cancer with PD-L1 of at
least 50%, despite a high
crossover rate and broadened
inclusion criteria. Of the
approved PD-1 antibodies, only
one, pembrolizumab, has shown
survival benefit as mono-
therapy in this non-small-cell
lung cancer setting. These data
provide a strong rationale for
cemiplimab as a potential new
treatment option for this patient
population.
Contributors
IB, PC, VS, NR, FS, DMW, GDY, GG, IL,
and PR conceived and designed the
study. AS, SK, MGü , IB, MÖ , MGo, HMT,
IC, DB, OG, PC, VS, TM, SP, and MN
recruited patients and collected the
data. SLi and BG analysed the data. All
authors had full access to the data,
verified the data, and contributed to data
interpretation, as well as critical review,
revision, and approval of the report.
Declaration of interests
AS reports institutional research support
from Roche, Merck Sharp & Dohme,
Merck Serono, AstraZeneca, Lily, Novartis,
Johnson & Johnson, Regeneron
Pharmaceuticals, and Sanofi outside the
submitted work.
MGü reports an honorarium to
institution for lecture from Roche, Merck
Sharp & Dohme, Gen İlaç, and Novartis
outside the submitted work.
IC reports personal fees (paid to
institution) from Pfizer, Merck Sharp &
Dohme Oncology, Roche, Novartis–Ipsen,
Eli Lilly, Bristol Myers Squibb, SERVIER,
Abdi Ibrahim, Nobelpharma, AbbVie,
Teva, and Janssen Oncology; and
speakers’ bureau fees (paid to
institution) from Novartis, Roche, Bristol
Myers Squibb, Pfizer, and Abdi Ibrahim,
all outside the submitted work. SK, IB,
MÖ , MGo, HMT, DB, OG, PC, VS, TM, SP,
and MN declare no competing interests.
NR reports personal fees for advisory or
consulting from AbbVie, Apricity,
AstraZeneca, Boehringer Ingelheim,
Calithera, Dracen, Editas, EMD Sorono,
G1 Therapeutics, Genentech, Gilead, GSK,
Illumina, Lilly, Merck, Neogenomics,
Novartis, Brooklyn ImmunoTherapeutics,
Takeda, and Bellicum; stock options from
Brooklyn ImmunoTherapeutics and
Bellicum; stock from Gritstone, all outside
the submitted work and patent (pending)
filed by Memorial Sloan Kettering Cancer
Center, in the form of royalties, on
determinants of cancer response to

Articles
collaboration with the investigators. An independent masked IRC 16 Moreno Garcia V, Calvo E, Olmedo Garcia ME, et al. Tolerability
reviewed all tumour assessments to determine tumour response per and antitumor activity of cemiplimab, a human monoclonal
RECIST 1.1. Safety monitoring was done by an IDMC. The authors anti-PD-1, in patients with non-small cell lung cancer (NSCLC):
thank the patients, their families, all other investigators, and all interim data from a phase I dose escalation and NSCLC expansion
investigational site members involved in this study. Medical writing and cohort. Proc Am Soc Clin Oncol 2019; 37 (suppl 8; abstr 116).
editorial support under the direction of the authors were provided by 17 Eisenhauer EA, Therasse P, Bogaerts J, et al. New response
Emmanuel Ogunnowo, of Prime (Knutsford, UK) and funded by evaluation criteria in solid tumours: revised RECIST guideline
Regeneron Pharmaceuticals and Sanofi according to Good Publication (version 1.1). Eur J Cancer 2009; 45: 228–47.
Practice guidelines. Responsibility for all opinions, conclusions, and data 18 Osoba D, Rodrigues G, Myles J, Zee B, Pater J. Interpreting the
interpretation lies with the authors. significance of changes in health-related quality-of-life scores.
J Clin Oncol 1998; 16: 139–44.
References 19 Hirsch FR, McElhinny A, Stanforth D, et al. PD-L1
1 Gridelli C, Casaluce F. Frontline immunotherapy for NSCLC: Immunohistochemistry Assays for Lung Cancer: Results from
alone or not alone? Nat Rev Clin Oncol 2018; 15: 593–94. Phase 1 of the Blueprint PD-L1 IHC Assay Comparison Project.
2 Ernani V, Ganti AK. Immunotherapy in treatment naïve advanced J Thorac Oncol 2017; 12: 208–22.
non-small cell lung cancer. J Thorac Dis 2018; 10 (suppl 3): S412– 20 Rimm DL, Han G, Taube JM, et al. A prospective, multi-institutional,
21. pathologist-based assessment of 4 immunohistochemistry assays for
3 Reck M, Rodríguez-Abreu D, Robinson AG, et al. Pembrolizumab PD-L1 expression in non-small cell lung cancer. JAMA Oncol 2017;
versus chemotherapy for PD-L1–positive non-small-cell lung cancer. 3: 1051–58.
N Engl J Med 2016; 375: 1823–33. 21 Ulas A, Tokluoglu S, Kos M, et al. Lung cancer in women,
4 Herbst RS, Baas P, Kim DW, et al. Pembrolizumab versus docetaxel a different disease: survival differences by sex in Turkey.
for previously treated, PD–L1-positive, advanced non-small-cell Asian Pac J Cancer Prev 2015; 16: 815–22.
lung cancer (KEYNOTE-010): a randomised controlled trial. Lancet 22 Pilkington G, Boland A, Brown T, Oyee J, Bagust A, Dickson R.
2016; 387: 1540–50. A systematic review of the clinical effectiveness of first-line
5 Garon EB, Rizvi NA, Hui R, et al. Pembrolizumab for the chemotherapy for adult patients with locally advanced or
treatment of non-small-cell lung cancer. N Engl J Med 2015; metastatic non-small cell lung cancer. Thorax 2015; 70: 359–67.
372: 2018–28. 23 Scagliotti GV, Gridelli C, de Marinis F, et al. Efficacy and safety of
6 Herbst RS, Giaccone G, de Marinis F, et al. Atezolizumab for first- maintenance pemetrexed in patients with advanced nonsquamous
line treatment of PD-L1-selected patients with NSCLC. N Engl J Med non-small cell lung cancer following pemetrexed plus cisplatin
2020; 383: 1328–39. induction treatment: a cross-trial comparison of two phase III trials.
7 Hanna NH, Schneider BJ, Temin S, et al. Therapy for stage IV Lung Cancer 2014; 85: 408–14.
non-small-cell lung cancer without driver alterations: ASCO and 24 Reck M, Rodríguez-Abreu D, Robinson AG, et al. Updated analysis
OH (CCO) joint guideline update. J Clin Oncol 2020; 38: 1608–32. of KEYNOTE-024: pembrolizumab versus platinum-based
8 National Comprehensive Cancer Network. NCCN clinical practice chemotherapy for advanced non-small-cell lung cancer with PD-L1
guidelines in oncology: non-small cell lung cancer. Version 6. 2020. tumor proportion score of 50% or greater. J Clin Oncol 2019;
https://www.nccn.org/professionals/physician_gls/PDF/nscl.pdf 37: 537–46.
(accessed July 21, 2020). 25 Gandhi L, Rodríguez-Abreu D, Gadgeel S, et al. Pembrolizumab
9 Rittmeyer A, Barlesi F, Waterkamp D, et al. Atezolizumab versus plus chemotherapy in metastatic non-small-cell lung cancer.
docetaxel in patients with previously treated non-small-cell lung N Engl J Med 2018; 378: 2078–92.
cancer (OAK): a phase 3, open-label, multicentre randomised 26 West H, McCleod M, Hussein M, et al. Atezolizumab in
controlled trial. Lancet 2017; 389: 255–65. combination with carboplatin plus nab-paclitaxel chemotherapy
10 Macdonald LE, Karow M, Stevens S, et al. Precise and in situ compared with chemotherapy alone as first-line treatment for
genetic humanization of 6 Mb of mouse immunoglobulin metastatic non-squamous non-small-cell lung cancer (IMpower130):
genes. Proc Natl Acad Sci USA 2014; 111: 5147–52. a multicentre, randomised, open-label, phase 3 trial. Lancet Oncol
11 Murphy AJ, Macdonald LE, Stevens S, et al. Mice with megabase 2019; 20: 924–37.
humanization of their immunoglobulin genes generate antibodies 27 Socinski MA, Jotte RM, Cappuzzo F, et al. Atezolizumab for first-
as efficiently as normal mice. Proc Natl Acad Sci USA 2014; line treatment of metastatic nonsquamous NSCLC. N Engl J Med
111: 5153–58. 2018; 378: 2288–301.
12 Burova E, Hermann A, Waite J, et al. Characterization of the 28 Rischin D, Migden MR, Lim AM, et al. Phase 2 study of
anti-PD-1 antibody REGN2810 and its antitumor activity in human cemiplimab in patients with metastatic cutaneous squamous cell
PD-1 knock-in mice. Mol Cancer Ther 2017; 16: 861–70. carcinoma: primary analysis of fixed-dosing, long-term outcome of
13 Migden MR, Rischin D, Schmults CD, et al. PD-1 blockade with weight-based dosing. J Immunother Cancer 2020; 8: e000775.
cemiplimab in advanced cutaneous squamous-cell carcinoma. 29 Carbone DP, Reck M, Paz-Ares L, et al. First-line nivolumab in
N Engl J Med 2018; 379: 341–51. stage IV or recurrent non-small-cell lung cancer. N Engl J Med 2017;
14 Migden MR, Khushalani NI, Chang ALS, et al. Cemiplimab in 376: 2415–26.
locally advanced cutaneous squamous cell carcinoma: results from 30 Mok TSK, Wu YL, Kudaba I, et al. Pembrolizumab versus
an chemotherapy for previously untreated, PD-L1-expressing, locally
open-label, phase 2, single-arm trial. Lancet Oncol 2020; 21: 294–305. advanced or metastatic non-small-cell lung cancer (KEYNOTE-042):
15 Papadopoulos KP, Johnson ML, Lockhart AC, et al. First-in-human a randomised, open-label, controlled, phase 3 trial. Lancet 2019;
study of cemiplimab alone or in combination with radiotherapy 393: 1819–30.
and/or low-dose cyclophosphamide in patients with advanced
malignancies. Clin Cancer Res 2020; 26: 1025–33.

RESEARCH
Healthy lifestyle and life expectancy free of cancer,

cardiovascular disease, and type 2 diabetes: prospective
BMJ: first published as 10.1136/bmj.l6669 on 8 January 2020. Downloaded from http://www.bmj.com/ on 13 April 2022 by guest. Protected by copyright.
cohort study
Yanping Li,1 Josje Schoufour,2,3 Dong D Wang,1 Klodian Dhana,1,4 An Pan,5 Xiaoran Liu,1
Mingyang Song,1,6,7,8 Gang Liu,1,9 Hyun Joon Shin,10 Qi Sun,1,11 Laila Al-Shaar,1 Molin Wang,6
Eric B Rimm,1,11 Ellen Hertzmark,12 Meir J Stampfer,1,6,11 Walter C Willett,1,6,11
Oscar H Franco,2,13 Frank B Hu1,6,11
For numbered affiliations see ABSTRACT CONCLUSION

end of the article. OBJECTIVE Adherence to a healthy lifestyle at mid-life is
Correspondence to: FB Hu To examine how a healthy lifestyle is related to life associated with a longer life expectancy free of major
fhu@hsph.harvard.edu
(ORCID 0000-0002-0412-2748) expectancy that is free from major chronic diseases. chronic diseases.
Additional material is published DESIGN
online only. To view please visit Prospective cohort study. Introduction
the journal online.
Cite this as: BMJ SETTING AND PARTICIPANTS The average life expectancy in the world has
2020;368:l6669 The Nurses’ Health Study (1980-2014; n=73 196) and increased substantially in the past few decades.1
http://dx.doi.org/10.1136/bmj.l6669 the Health Professionals Follow-Up Study (1986-2014; The aging of the population has led to a high
Accepted: 14 October 2019 n=38 366). prevalence of chronic diseases such as diabetes,
MAIN EXPOSURES cardiovascular disease, and cancer. Although people
Five low risk lifestyle factors: never smoking, body live longer, older individuals often live with
mass index 18.5-24.9, moderate to vigorous physical disabilities and chronic diseases.2 People with chronic
activity (≥30 minutes/day), moderate alcohol intake diseases including cancer, cardiovascular disease,
(women: 5-15 g/day; men 5-30 g/day), and a higher and diabetes have a shorter life expectancy than do
diet quality score (upper 40%). their peers without these chronic conditions.3-5
MAIN OUTCOME Estimates of the loss in life years due to these chronic
Life expectancy free of diabetes, cardiovascular conditions range from 7.5 to 20 years, depending on
diseases, and cancer. the methods used and the characteristics of the study
population.3-5
RESULTS
Modifiable lifestyle factors including smoking,
The life expectancy free of diabetes, cardiovascular
physical activity, alcohol intake, body weight, and diet
diseases, and cancer at age 50 was 23.7 years (95%
quality affect both total life expectancy and incidence
confidence interval 22.6 to 24.7) for women who
of chronic diseases.6-9 Studies have shown that
adopted no low risk lifestyle factors, in contrast to
smoking, inactivity, poor diet quality, and heavy
34.4 years (33.1 to 35.5) for women who adopted four
alcohol consumption contribute up to 60% of
or five low risk factors. At age 50, the life expectancy
premature deaths and 7.4-17.9 years’ loss in life
free of any of these chronic diseases was 23.5 (22.3
expectancy.7 10-15 Nevertheless, little research has
to 24.7) years among men who adopted no low risk
looked at how a combination of multiple lifestyle
lifestyle factors and 31.1 (29.5 to 32.5) years in men
who adopted four or five low risk lifestyle factors. factors may relate to life expectancy free from the
For current male smokers who smoked heavily (≥15 major diseases of diabetes, cardiovascular disease,
cigarettes/day) or obese men and women (body and cancer.15-19
mass index ≥30), their disease-free life expectancies Because estimates of life expectancy free of chronic
accounted for the lowest proportion (≤75%) of total diseases take into account both morbidity and
life expectancy at age 50. mortality, these estimates can be useful metrics for
health professionals and the general public, as well
as enabling policy makers to better estimate future
healthcare costs and to plan for healthcare needs. 20-22
In a previous analysis, we estimated the effect of
healthy lifestyles on the overall life expectancy. 23 In
WHAT IS ALREADY KNOWN ON THIS TOPIC this study, we examine the effect of healthy lifestyle
Modifiable lifestyle factors including smoking, physical activity, alcohol factors on life expectancy free of cancer,
use, body weight, and diet quality affect both total life expectancy and cardiovascular disease, and type 2 diabetes, using data
incidence of chronic diseases from up to 34 years of follow-up in the Nurses’ Health
Study (NHS) and 28 years of follow-up in the Health
Few studies have comprehensively examined how a combination of multiple
Professions Follow-up Study (HPFS).
lifestyle factors may relate to life expectancy free from the major diseases
such as diabetes, cardiovascular disease, and cancer
Methods
WHAT THIS STUDY ADDS Study population
A healthier lifestyle was associated with an increased total life expectancy This study was embedded in the NHS and the HPFS.
and life expectancy free of cancer, cardiovascular disease, and type 2 The NHS began in 1976, when 121 700 female nurses
the bmj | BMJ 2020;368:l6669 | doi: 1
aged
2 doi: 10.1136/bmj.l6669 | BMJ 2020;368:l6669 | the

RESEARCH
30-55 years were included and provided information on (m2). We defined a healthy
medical, lifestyle, and other health related variables. 24 body weight as a BMI in the
In 1980, 92 468 nurses also completed a validated range of 18.5-24.9.
food frequency questionnaire. The HPFS was
established in 1986, when 51 529 male US health
professionals (dentists, optometrists, osteopaths,
podiatrists, phar- macists, and veterinarians) aged 40-
75 years completed a mailed questionnaire about their
medical history and lifestyle.25 In both cohorts, self
administered questionnaires have been sent every two
years to update the information and identify newly
diagnosed cases of various diseases. For this analysis,
we used 1980 as the baseline for the NHS and 1986
for the HPFS. We excluded participants already
diagnosed as having any of the three outcomes
(cancer, cardiovascular disease, and diabetes, n=15
118), those with implausible energy intakes (women:
<500 or >3500 kcal/day; men: <800 or >4200
kcal/day), and those with missing values for body
mass index, physical activity, alcohol, or smoking at
baseline (n=17 317), leaving 111 562
participants (73 196 women and 38 366 men) for
analysis. Participants who had missing lifestyle factors
at baseline had similar baseline characteristics to
those without missing information (supplementary
table A).
The NHS and HPFS cohorts were followed across
the follow-up periods using similar questionnaires
on diet, exercise, smoking status, and other factors
(questions on the use of postmenopausal hormone
replacement therapies and reproduction related
questions were asked in the NHS only). Information
on age, ethnicity, use of multivitamins, regular use of
aspirin, postmenopausal hormone use (NHS only),
and the presence or absence of a family history of
diabetes, cancer, or myocardial infarction (in first
degree relatives) was collected via biennial
questionnaires.
Assessment of lifestyle behaviors

We derived a healthy lifestyle score based on
information on five lifestyle factors—diet, smoking,
physical activity, alcohol consumption, and body mass
index (BMI). Diet was assessed in the NHS and HPFS
by using a validated food frequency questionnaire
assessing how often, on average, a participant had
consumed a specified amount of a list of foods during
the previous year.24 Quality of diet was assessed using
the Alternate Healthy Eating Index (AHEI) score,
which is significantly associated with risk of
cardiovascular disease and other chronic diseases in
the general population.26 We defined a healthy diet as
an AHEI score in the top 40% of each cohort
distribution.7 Physical activity levels were assessed
using a validated questionnaire and updated every
two to four years.27 We estimated the number of
hours per week spent in moderate to vigorous
activities (including brisk walking) requiring the
expenditure of at least 3 metabolic equivalents of task
(METs) per hour. We classified low risk as at least 30
minutes of moderate or vigorous activity daily (3.5
h/week). Height and weight were self reported and
used to calculate BMI as weight (kg) divided by height
the bmj | BMJ 2020;368:l6669 | doi: 3
Self reported smoking status and the number of cigarettes smoked were
updated biennially. We defined never smokers as participants who reported
never smoking, current smokers as participants who reported active smoking on
the questionnaire, and ever smokers as participants who had smoked in the past
but did not report active smoking on the time varying questionnaire. On each
questionnaire, current smokers were further classified as smoking one to 14, 15
to 24, or 25 or more cigarettes per day. The food frequency questionnaire also
collected alcoholic beverage consumption, including red and white wine
separately (4 ounces, increasing to 5 ounces in 2006), beer (one glass, can, or
bottle), and liquor (one drink or shot). We multiplied the amount of alcohol in
grams per specified portion size by servings per day, determined the midpoint of
the frequency category, and summed across all beverages to estimate the
average alcohol consumption (g/day). We defined moderate alcohol
consumption as 5-15 g/day for women and 5-30 g/day for men, consistent with
the guidelines for moderate alcohol intake in the US.28
Our previous studies using objective measurements had documented the
validity of these lifestyle data. A previous validation study showed a
correlation of 0.97 between self reported weight and weight measured by a
technician.25 The correlations between physical activity reported in diaries and
that in the questionnaire was 0.62 in women and 0.58 in men.27
29
In addition, independent associations have been observed between physical
activity and several biomarkers of obesity and cardiovascular disease risk such
as high density lipoprotein cholesterol, leptin, and C peptide.30 Validation
studies of the food frequency questionnaire with dietary records indicated an
average correlation of 0.63 for all nutrients after adjustment for energy intake
and variation in the seven day dietary records.24 In addition, correlations with
nutrient biomarkers in our study population provided objective evidence for
the validity of the food frequency questionnaire. 31 32 Correlation coefficients
between the food frequency questionnaire and four single week diet records for
ethanol were 0.90 in the NHS and 0.86 in the HPFS. 33 Ethanol intake assessed
through the food frequency questionnaire was also significantly correlated with
serum high density lipoprotein cholesterol (r=0.33 for NHS; r=0.38 for HPFS).
Another validation study among 2485 women participating in the NHS reported
that smoking level was strongly associated with toenail nicotine concentration
(r=0.63).34
For each low risk lifestyle factor, the participant received a score of 1 if he or
she met the criterion for low risk, and 0 otherwise. The sum of these five scores
together gave a final low risk lifestyle score ranging from 0 to 5, with higher
scores indicating a healthier lifestyle. As the number of cases among the group
with the highest lifestyle score was small, especially mortality among
participants with prevalent diseases, we combined participants with four or five
low risk factors into one group.
4 doi: 10.1136/bmj.l6669 | BMJ 2020;368:l6669 | the

RESEARCH
Because lifestyle factors may affect mortality risk

as outcomes. The overall proportion of cases
over an extended period of time, to best represent
confirmed by medical records in the NHS and HPFS
long term lifestyle we applied time varying lifestyle
were 82.9% for cancer, 74.4% for coronary heart
information during follow-up, in which mortality risks
disease, and 64.5% for stroke.
were predicted by the repeated measurements of
Cases of type 2 diabetes were identified by self
these variables during the follow-up periods. The
report and confirmed by a validated supplementary
average response rate for the lifestyle risk factors during
questionnaire.38 39 For cases before 1998, we applied
follow- up was approximately 94% for the NHS and
the National Diabetes Data Group criteria. We used
90% for the HPFS. We calculated average levels of
the American Diabetes Association diagnostic criteria
lifestyle factors by using the latest two repeated
for confirmation from 1998 onward. The validation of
measurements for our primary analysis of diet,
self reported type 2 diabetes diagnosis in the NHS has
physical activity, and alcohol consumption.35 For non-
been documented previously.38 39
respondents to both questionnaires, we used the last
available value carried forward. For AHEI score and
Statistical analysis
alcohol consumption, we calculated the average on
the basis of four year repeated measurements. We used population based multistate life tables
Smoking status was estimated on the basis of both to calculate the differences in life expectancy and
smoking history and most recent status updated every years lived with and without major chronic diseases
two years and classified into five categories: never for each lifestyle factor and the total lifestyle factor
smoking, past smoking, and current smoking of 1-14, score. To assess the association between the number
15-24, and 25 or more cigarettes per day. To of low risk factors and life expectancy free of cancer,
minimize reverse causality, we applied the lifelong cardiovascular disease, and type 2 diabetes, we took
maximum BMI by age at risk. 36 For example, we into account three states (disease free, presence of
applied the maximum value of BMI at age 18 and BMI disease, and death), and three transitions between
in 1980 to predict mortality between 1980 and 1982 states (from non-disease to incident disease, from
and the maximum value of BMI at age 18, BMI in non-disease to mortality among participants free of
1980, and BMI in 1982 to predict mortality between major chronic disease, and from disease diagnosis to
1982 and 1984, and so forth. mortality among those with disease). Subsequently,
we built multistate life tables allowing for the
occurrence of the transitions. As shown in
Ascertainment of deaths and non-fatal chronic
supplementary figure A, all participants started from
diseases
state 0 at baseline; both the period between state 0
In the NHS and HPFS, most of the deaths were
and state 1 (before disease diagnosis) and the period
identified through family members or the postal
between state 0 and state 2 (without disease)
system in response to the follow-up questionnaires.
contributed to the estimated life expectancy free of
We searched the National Death Index to identify
cancer, cardiovascular disease, or type 2 diabetes;
deaths among all study participants, with a high
whereas only the patients with cancer, cardiovascular
sensitivity (97.7%) and specificity (100%).37
disease, or type 2 diabetes after diagnosis (from state
Self reported diagnoses of cancer, myocardial
1 to state 2) contributed to the estimated life
infarction, and stroke were collected on biennial
expectancy in the presence of the major chronic
questionnaires, and participants who reported a
disease.
new diagnosis were asked for permission to acquire
We built a total of four multistate life tables—one
their medical records and pathologic reports. Study
for a combination of cancer, cardiovascular disease,
physicians, blinded to exposure information, reviewed
and type 2 diabetes and three for individual diseases.
medical records to confirm the diagnosis. We included
For each multistate life table, we first derived overall
all cancers as outcomes except non-melanoma skin
transition rates by a single year of age in the NHS and
cancer. Non-fatal cardiovascular disease outcomes
HPFS, separately, irrespective of the lifestyle factors,
comprised non-fatal myocardial infarction and non-
for three transitions4: mortality among participants
fatal stroke. We classified non-fatal myocardial
free of the diseases, incident diseases, and mortality
infarctions as confirmed if the criteria of the World
among those with the diseases. We considered only
Health Organization were met specifically on the
the first entry into a state and no subsequent disease
basis of symptoms and either electrocardiographic
event, and no reversal of state was allowed.
changes or elevated cardiac enzyme concentrations.
Secondly, we calculated hazard ratios to assess the
We classified stroke cases according to the criteria of
relation between the number of low risk factors and the
the National Survey of Stroke, which required
three transitions by using Cox proportional hazards
evidence of a neurologic deficit with a sudden or rapid
analyses. We used separate time varying Cox
onset that persisted for more than 24 hours.
proportional hazards models to assess the risk of
Pathologically confirmed cerebrovascular conditions
mortality without disease, risk of incident disease, and
that were caused by an infection, trauma, or
risk of mortality among participants with cancer,
malignancy were not counted as outcomes. Cancer,
cardiovascular disease, and type 2 diabetes. Thirdly,
coronary heart disease, and stroke events for which
we calculated proportions of low risk factors
confirmatory information was obtained by interview
among the sub-study population for each transition.
or letter but without access to medical records were
Lastly, we used the hazard ratios combined with the
also included
the bmj | BMJ 2020;368:l6669 | doi: 5
overall transition rates and low
6 doi: 10.1136/bmj.l6669 | BMJ 2020;368:l6669 | the

RESEARCH
risk factor proportions in the multistate life table to expectancy free of

calculate total life expectancy and life expectancy with
and without diseases for each group of low risk
factors. The multistate life tables started at age 50
years and closed at age 105 years. Models were
adjusted for age, ethnicity, current multivitamin use,
current aspirin use, status with regard to a family
history of diabetes, myocardial infarction, or cancer,
and, for women, menopausal status and hormone use.
Considering potential bias resulting from changes
in diet after the diagnosis of certain diseases, we did
a sensitivity analysis in which we stopped updating
lifestyle factors at the beginning of the interval in
which the participant was diagnosed as having
cancer, cardiovascular disease, or diabetes. In another
sensitivity analysis, we further classified the past
smokers according to the years since smoking
cessation. We used SAS version 9.3 to analyze the
data. Statistical significance was set at a two tailed P
value of less than 0.05. We used Monte Carlo
simulation (parametric bootstrapping) with 10 000
runs to calculate the confidence intervals of the life
expectancy
estimation with @RISK 7.5.
Patient and public involvement

No patients were involved in setting the research
question or the outcome measures, nor were they
involved in the design and implementation of the
study. We plan to disseminate these findings to
participants in our annual newsletter and to the
general public in a press release.
Results
Participants with a higher number of low risk life-
style factors were more likely to use multivitamin
supplements and aspirin (table 1). During 2 270 411
person years of follow-up of women and 930 201
person years of follow-up of men, 34 383 deaths were
recorded (21 344 women and 13 039 men).
Life expectancies free of cancer, cardiovascular

disease, and diabetes in combination
Total life expectancy at age 50 increased with
increasing number of low risk lifestyle factors: from
31.7 years to 41.1 years in women and from 31.3
years to 39.4 years in men (fig 1). Regardless of the
number of low risk lifestyle factors, the vast majority
of life expectancy after 50 was free of cancer,
cardiovascular disease, or diabetes (fig 1). At age 50,
life expectancy free of cancer, cardiovascular disease,
and diabetes was 23.7 (95% confidence interval 22.6
to 24.7), 26.4 (25.2 to 27.4), 29.1 (28.0 to 30.0), 31.8
(30.8 to 32.8), and 34.4 (33.1 to 35.5) years among
women who adopted zero, one, two, three, and four or
five low risk lifestyle factors, respectively. Life
expectancy free of cancer, cardiovascular disease, and
diabetes at age 50 was 23.5 (22.3 to 24.7), 24.8 (23.5
to 26.0), 26.7 (25.3 to 27.9), 28.4 (26.9 to 29.7), and
31.1 (29.5 to 32.5) years among men who adopted
zero, one, two, three, and four or five low risk lifestyle
factors, respectively (table 2). The percentage of life
the bmj | BMJ 2020;368:l6669 | doi: 7

cancer, cardiovascular disease, and diabetes from total life expectancies was
74.8%, 77.6%, 80.1%,
82.2%, and 83.6% among women (75.3%, 75.8%,
76.8%, 77.9%, and 79.0% among men) who adopted zero, one, two, three, and
four or five low risk lifestyle factors, respectively.
The increasing trend of life expectancy free of cancer, cardiovascular disease,
and type 2 diabetes associated with increasing number of low risk lifestyle
factors was observed across the lifespan after age 50 (supplementary figure B).
In the sensitivity analysis in which we stopped updating lifestyle factors after
the diagnosis of cancer, cardiovascular disease, or diabetes, women and men
with four or five low risk lifestyle factors gained 10.0 (9.3 to 10.3) and 7.2 (6.4 to
7.9) years in their life expectancy free of the major chronic diseases, respectively,
compared with those with zero low risk lifestyle factors.
Life expectancies free of cancer, cardiovascular disease, or diabetes

separately
Women with four or five low risk lifestyle factors had
10.6 (10.0 to 11.3) years’ longer life expectancy free of the major chronic
diseases than did women with zero low risk lifestyle factors. When we examined
the diseases independently, among women, four to five low risk lifestyle factors
were associated with 8.3 (7.8 to 8.9) years’ longer life expectancy without
cancer,
10.0 (9.3 to 10.6) more years without cardiovascular disease, and 12.3 (11.4 to
13.4) more years without diabetes (table 2). Among men, compared with those
with zero low risk lifestyle factors, participants with four to five low risk lifestyle
factors gained 7.6 (6.8 to 8.4) years’ longer life expectancy free of major chronic
diseases: 6.0 (5.4 to 6.7) more years without cancer,
8.6 (7.9 to 9.4) more years without cardiovascular disease, and 10.3 (9.6 to 11.1)
more years without diabetes (table 2).
Life expectancies in presence of cancer, cardiovascular disease,

and diabetes
Life expectancy in the presence of cancer, cardiovascular disease, and diabetes
was not appreciably different across the groups with different numbers of low
risk lifestyle factors (fig 1; supplementary figure B), which was due to a smaller
number of patients in the low risk group together with a longer survival time
after diagnosis of diseases. Compared with the group with zero low risk lifestyle
factors, the hazard ratios for those with four or five low risk lifestyle factors and
incident cancer, cardiovascular disease, or type 2 diabetes were
0.5 for women and 0.6 for men (supplementary table B), which means a much
lower proportion of incident cancer, cardiovascular disease, or type 2 diabetes
among participants with four or five low risk lifestyle factors. After diagnosis of
these diseases, half of patients with cancer who adopted four or five low risk
lifestyle factors survived up to 22.9 years, whereas half of patients with cancer
who adopted zero low risk lifestyle factors survived only up to 11.0 years
(supplementary figure C, left); we observed a similar differential
8 doi: 10.1136/bmj.l6669 | BMJ 2020;368:l6669 | the

RESEARCH
Table 1 | Participants’ characteristics in middle of follow-up period according number of low risk lifestyle factors in
Nurses’ Health Study (women) and Health Professionals Follow-up Study (men). Values are numbers
(percentages) unless stated otherwise*
No of low risk lifestyle factors†
Zero One Two Three Four or five
Nurses’ Health Study (1998) (n=11 749) (n=25 048) (n=19 837) (n=9079) (n=2984
Mean (SD) age, years 63.3 (7.1) 63.6 (7.2) 63.7 (7.2) 63.8 (7.1) 63.6 (6.9)
Mean (SD) body mass index 31.0 (5.3) 29.2 (5.5) 26.6 (5.0) 24.4 (3.5) 23.1 (2.1)
Mean (SD) Alternate Healthy Eating Index score 43.0 (6.8) 46.6 (9.2) 51.4 (9.8) 55.3 (9.3) 58.3 (8.1)
Mean (SD) physical activity, h/week 0.5 (1.0) 0.9 (1.8) 1.9 (3.0) 3.5 (3.8) 5.5 (4.3)
Mean (SD) alcohol consumption, g/day 5.0 (10.8) 4.5 (9.1) 5.1 (8.1) 6.1 (7.4) 7.3 (5.5)
Past smoking 9086 (77.5) 11 314 (45.2) 6822 (34.4) 2658 (29.3) 558 (18.6)
Current smoking 2663 (22.5) 3249 (13.0) 1654 (8.4) 409 (4.5) 50 (1.7)
White 11 524(98.1) 24 496 (97.8) 19 289 (97.2) 8839 (97.4) 2921 (97.9)
Multivitamin use 5412 (46.1) 12 437 (49.6) 10 480 (52.8) 5220 (57.5) 1765 (59.1)
Regular aspirin use 5212 (44.5) 11 457 (45.7) 9145 (46.1) 4358 (47.9) 1535 (51.6)
Family history of diabetes 3583 (30.5) 7394 (29.5) 5296 (26.7) 2170 (23.9) 690 (23.1)
Family history of cancer 1549 (13.3) 3438 (13.7) 2721 (13.7) 1236 (13.6) 419 (14.1)
Family history of myocardial infarction 3153 (26.8) 6273 (25.1) 4787 (24.1) 2069 (22.8) 705 (23.6)
Health Professionals’ Follow-up Study (1998) (n=4052) (n=10 043) (n=10 706) (n=7252) (n=3710)
Mean (SD) age, years 64.3 (9.1) 64.0 (9.2) 63.7 (9.1) 63.7 (9.1) 63.5 (8.9)
Mean (SD) body mass index 29.2 (3.8) 28.2 (3.7) 26.9 (3.5) 25.7 (3.1) 24.2 (2.2)
Mean (SD) Alternate Healthy Eating Index score 42.5 (7.1) 45.6 (9.0) 50.1 (10.1) 54.4 (10.0) 58.9 (8.9)
Mean (SD) physical activity, h/week 0.8 (1.2) 1.9 (3.8) 3.7 (5.6) 5.9 (6.6) 8.0 (7.2)
Mean (SD) alcohol consumption, g/day 13.1 (21.2) 10.6 (15.4) 10.4 (12.4) 10.8 (10.5) 11.3 (8.2)
Past smoking 3465 (85.4) 6256 (62.2) 5258 (49.2) 2711 (37.4) 624 (16.9)
Current smoking 587 (14.6) 848 (8.5) 491 (4.6) 172 (2.4) 21 (0.6)
White 3814 (94.1) 9441 (94.0) 10 117 (94.5) 6818 (94.0) 3526 (95.0)
Multivitamin use 1520 (37.3) 4247 (42.3) 5092 (47.6) 3804 (52.5) 2135 (57.6)
Regular aspirin use 2020 (49.7) 5349 (53.3) 6014 (56.2) 4250 (58.6) 2264 (61.0)
Family history of diabetes 861 (21.2) 2090 (20.8) 2159 (20.2) 1510 (20.8) 709 (19.2)
Family history of cancer 1291 (31.7) 3445 (34.3) 3824 (35.7) 2641 (36.4) 1422 (38.5)
Family history of myocardial infarction 1300 (32.0) 3143 (31.3) 3412 (31.9) 2336 (32.2) 1248 (33.8)
*Values other than age are standardized to age distribution of study population.
†Included cigarette smoking (never smoking), physical activity (≥3.5 h/week moderate to vigorous intensity activity), high diet quality (upper 40% of
Alternate Healthy Eating Index), moderate alcohol intake of 5-15 g/day (women) or 5-30 g/day (men), and normal weight (body mass index 18.5-24.9).
survival probability for people with cardiovascular

disease (supplementary figure C, middle) and diabetes of chronic diseases compared with never smokers;
(supplementary figure C, right). The percentage of life for men, this was 1.9 and 2.6 years among those
expectancy with presence of cancer, cardiovascular with more than 10 and less than 10 years smoking
disease, or diabetes out of total life expectancy was cessation, respectively (supplementary figure D).
25.2%, 22.4%, 19.9%, 17.8%, and 16.4% among When we included only four lifestyle factors without
alcohol, women who adhered to all four low risk
women (24.7%, 24.2%, 23.2%, 22.1%, and 21.0%
lifestyle factors had 9.5 years’ (men: 8.8 years) longer
among men) who adopted zero, one, two, three, and
life expectancy free of the major chronic diseases than
four or five low risk lifestyle factors, respectively.
did those with none of these factors (supplementary
figure E, left). After further inclusion of moderate
Life expectancies associated with individual
alcohol consumption, women who adhered to all five
lifestyle factors
low risk factors had 12.5 years’ (men: 9.6 years)
We also estimated the life expectancy related to each
longer life expectancy free of the major chronic
lifestyle factor separately. A healthy dietary pattern,
diseases than did those with none of these factors
high levels of physical activity, no smoking, moderate
(supplementary figure E, right).
alcohol consumption, and an optimal BMI were all
associated with longer life expectancy free of cancer,
Discussion
cardiovascular disease, and diabetes (fig 2). The
lowest proportions of years of life expectancy free of Using data from two large cohort studies, we observed
cancer, cardiovascular disease, or diabetes as a that adherence to a low risk lifestyle was associated
percentage of total life expectancies were observed with a longer life expectancy at age 50 free of major
among men who smoked heavily (≥15 cigarettes/day) chronic diseases of approximately 7.6 years in men
and obese men and women (BMI≥30), for whom 75% and 10 years in women compared with participants
or less of life expectancy at age 50 years was lived free with no low risk lifestyle factors.
of these chronic diseases (fig 2).
In the sensitivity analysis, women who quit Comparison with other studies
smoking for more than 10 years and less than 10 Our results are consistent with previous studies
years lost that estimated the individual or clustering effect of
1.7 and 6.0 years, respectively, of life expectancy free lifestyle related risk factors on life expectancy with
the bmj | BMJ 2020;368:l6669 | doi: 9

RESEARCH
and without chronic diseases.15-19 Ferrucci et al life expectancy at age 50 years and that most of these
found that participants aged 65 years who had never extra life years were free of chronic diseases. 15 Our
smoked and had higher levels of physical activity study extends previous findings by comprehensively
had life expectancies without disability (self reported assessing five lifestyle risk factors and three major
need for help or inability to perform basic activities of chronic diseases in combination and by providing
daily living) of 6.7 years (men) and 7.3 years (women) broader estimates of longevity and the number of
higher than their peers who had ever smoked and had years lived with and without disease in relation to
low levels of physical activity.16 The Framingham lifestyle factors individually and in combination.
Heart Study showed that achieving high levels of We observed a relatively longer gain in life
physical activity, having a normal weight, and never expectancy free of diabetes associated with a low
smoking was associated with lower risk of risk lifestyle than the gained life expectancy free of
cardiovascular disease, higher total life expectancy, cancer or cardiovascular disease; this was consistent
and greater number of years lived free of with the result of different preventable attribution
cardiovascular disease.17 A large study in Europe fractions for lifestyle related to specific diseases:
found that people with no behavior related risk in our cohorts, 90% of diabetes, 80% of coronary
factors lived six years longer without chronic diseases heart disease, 70% of cardiovascular mortality, and
(cardiovascular disease, cancer, respiratory disease, 50% of cancer mortality were attributable to not
and diabetes) than did participants with at least two following a low risk lifestyle. 9 23 38 We did not observe
behavior related risk factors (including smoking, a significant difference in life expectancy with cancer,
physical inactivity, and obesity).18 The CHANCES study cardiovascular disease, and type 2 diabetes across
found that a healthy lifestyle was associated with a the number of low risk lifestyle factors. However, this
7.4-15.7 years longer does not necessarily imply that a healthy lifestyle has
no effect on patients with these conditions. At the
population level, the overall life expectancy living
with diseases was determined by both the proportion
LE with cancer, CVD, or type 2 diabetes of the population having the diseases and how long
Women
50 LE without cancer, CVD, or type 2 diabetes they survived after diagnosis. Compared with those
with zero low risk lifestyle factors, men and women
40 with four or five low risk factors had a lower rate of
Life expectancy (LE) at age 50
incident cancer, cardiovascular disease, and type 2

30 diabetes, and they also lived longer after diagnosis
of these diseases. This resulted in a paradoxical non-
20 differential life expectancy in the presence of cancer,
cardiovascular disease, and type 2 diabetes across
10 groups with different numbers of healthy lifestyle
factors. A healthy lifestyle not only decreased the
0 risk of incident cancer, cardiovascular disease, and
Men type 2 diabetes but also improved the survival after
50
diagnosis of those diseases.4 15 17 Thus, the proportion
40
of years of life living with chronic diseases was higher
among participants who adhered to an unhealthy

30 lifestyle.
Compared with men, women gained a longer life
20 expectancy free of major chronic diseases through
adherence to a low risk lifestyle, resulting from the
10 relatively stronger association between low risk
lifestyle and incident cancer, cardiovascular disease,
0 diabetes, and mortality among women than men, as
None One Two Three Four or five
observed in our study. Sex differences in the
No of low risk factors association between lifestyles and healthy life
expectancy were
Fig 1 | Estimated life expectancy at age 50 years with and without cancer, also observed in previous studies, but the reasons
cardiovascular disease (CVD), and/or type 2 diabetes among participants of Nurses’ for this disparity are not clear.15-19 We observed a
Health Study (women) and Health Professionals Follow-up Study (men) according to relatively small difference in life expectancies across
number of low risk lifestyle factors. Low risk lifestyle factors included cigarette smoking
different levels of alcohol consumption compared
(never smoking), physical activity (≥3.5 hours/week moderate to vigorous intensity
activity), high diet quality (upper 40% of Alternate Healthy Eating Index), moderate with other individual lifestyle factors. The
alcohol intake of 5-15 g/day (women) or 5-30 g/day (men), and normal weight (body cardiovascular benefits of moderate alcohol
mass index <25). Estimates of multivariate adjusted hazard ratios (sex specific) for consumption have been consistently observed in large
morbidity and mortality associated with low risk lifestyles compared with people with cohort studies,40 but alcohol consumption and risk of
zero low risk lifestyle factors adjusted for age, ethnicity, current multivitamin use, cancer showed a dose- response relation.41 42 Thus,
current aspirin use, family history of diabetes, myocardial infarction, or cancer, and current guidelines do not encourage a non-alcohol
menopausal status and hormone use (women only) drinker to start drinking just for the benefit of
1 doi: 10.1136/bmj.l6669 | BMJ 2020;368:l6669 | the

preventing cardiovascular disease.
the bmj | BMJ 2020;368:l6669 | doi: 1

RESEARCH
Table 2 | Life expectancy (in years) at age 50 years in absence of chronic diseases according to number of low risk lifestyle factors in Nurses’ Health
Study (women) and Health Professionals Follow-up Study (men) separately
No of low risk lifestyle
factors*
Zero One Two Three Four or five
Women
Free of cancer, CVD, or type 2 diabetes:
Life expectancy 23.7 (22.6 to 24.7) 26.4 (25.2 to 27.4) 29.1 (28.0 to 30.0) 31.8 (30.8 to 32.8) 34.4 (33.1 to 35.5)
Difference Reference 2.6 (2.3 to 2.9) 5.3 (5.0 to 5.6) 8.1 (7.7 to 8.5) 10.6 (10.0 to 11.3)
Free of cancer:
Free of CVD:
Free of type 2 diabetes:
Men
Free of any of cancer, CVD, or type 2 diabetes
Free of cancer:
Free of CVD:
Free of type 2 diabetes:
CVD=cardiovascular diseases.
*Included cigarette smoking (never smoking), physical activity (≥3.5 h/week moderate to vigorous intensity activity), high diet quality (upper 40% of Alternate Healthy Eating Index), moderate
alcohol intake of 5-15 g/day (women) or 5-30 g/day (men), and normal weight (body mass index 18.5-24.9). Multivariate adjusted hazard ratios (sex specific) for mortality and incident diseases
associated with lifestyles factors adjusted for age, ethnicity, current multivitamin use, current aspirin use, family history of diabetes, myocardial infarction, or cancer, and menopausal status and
hormone use (women only).
Strengths and limitations of study

diseases, which could have affected life expectancies.
Major strengths of this study are the long term follow-up
Fourthly, people may have changed their lifestyle
of two large cohorts with low rates of loss to follow-up
after diagnosis of diseases. Nevertheless, our
and the detailed and repeated measurements of
sensitivity analysis taking into account this potential
lifestyle factors that enabled us to take the dynamic
bias showed similar results. Lastly, because our study
changes in lifestyle factors over time into account.
populations consist of mostly white health
Nevertheless, we also acknowledge several
professionals who have adopted relatively healthy
limitations. Firstly, this study was limited by its
behaviors, the results may not be generalizable to
reliance on self reported lifestyle factors; measurement
other populations. Therefore, further studies are
errors are inevitable. The use of prospectively
warranted to replicate our findings in other ethnic
collected, cumulatively averaged values based on
and racial groups and people with other professional
repeated assessments would reduce the effect of
backgrounds. However, the biologic effects of
random measurement errors. Secondly, residual and
unhealthy behaviors are likely to apply to other
unmeasured confounding might also exist even
populations, and the relative homogeneity of the
though we controlled for a wide range of potential
study populations in educational attainment, health
confounders. However, only a very strong
awareness, and socioeconomic status reduces residual
unmeasured risk factor for mortality together with
confounding and enhances the internal validity.
a very large prevalence imbalance among exposure
groups could explain such strong findings.43 44
Conclusion and public health implications
Thirdly, we included only cancer, cardiovascular
disease, and type 2 diabetes because these are highly We observed that a healthier lifestyle was associated
prevalent diseases, accounting for most chronic with a lower risk of cancer, cardiovascular disease,
diseases, and their associations with lifestyle factors and diabetes as well as mortality, with an increased
are well documented. The calculated “disease-free” total life expectancy and number of years lived
life expectancy would change if we included other free of these diseases. Our findings suggest that
diseases, such as respiratory disease or kidney promotion of a healthy lifestyle would help to reduce
disease; however, the relative differences in disease- the healthcare burdens through lowering the risk
free life expectancy across different lifestyle groups of developing multiple chronic diseases, including
should not materially change. Similarly, we did not cancer, cardiovascular disease, and diabetes, and
take into account the severity and clinical extending disease-free life expectancy. Public policies
complications of the for improving food and the physical environment
1 doi: 10.1136/bmj.l6669 | BMJ 2020;368:l6669 | the

RESEARCH
LE with cancer, CVD, or type 2 diabetes

Women LE without cancer, CVD, or type 2 diabetes
40
30
20
10
Men
40
30
20
10
%LE free of CVD, cancer, and diabetes/total LE

Women 78.1 79.0 78.5 78.9 79.5 79.5 78.7 80.4 77.9 77.0 77.5 78.1 79.7 79.9 81.0 78.1 78.6 80.0 79.6 77.8 86.3 84.0 82.9 79.4 73.6 72.2
Men 76.3 77.2 76.5 76.9 78.2 77.1 76.9 78.4 74.2 75.0 76.4 76.7 76.6 78.0 76.5 77.4 76.6 77.1 76.6 77.0 74.3 79.8 78.8 75.9 70.3 68.0
Fig 2 | Estimated life expectancy at age 50 years with and without cancer, cardiovascular disease (CVD), and/or type 2 diabetes among participants
of Nurses’ Health Study (women) and Health Professionals Follow-up Study (men) according to levels of individual lifestyle risk factors. Estimates of
multivariate adjusted hazard ratios (sex specific) for morbidity and mortality associated with low risk lifestyles compared with people with zero low
risk lifestyle factors adjusted for age, ethnicity, current multivitamin use, current aspirin use, family history of diabetes, myocardial infarction, or
cancer, and menopausal status and hormone use (women only). AHEI=Alternate Healthy Eating Index; BMI=body mass index; F=fifth. *Cigarettes/
day. †Hours/week. ‡Grams/day
conducive to adopting a healthy diet and lifestyle, as 7

Clinical and Translational Epidemiology Unit, Massachusetts
well as relevant policies and regulations (for example, General Hospital and Harvard Medical School, Boston, MA, USA
smoking ban in public places or trans-fat restrictions), 8
Division of Gastroenterology, Massachusetts General Hospital,
are critical to improving life expectancy, especially life Boston, MA, USA
expectancy free of major chronic diseases. 9
Department of Nutrition and Food Hygiene, Hubei Key Laboratory
of Food Nutrition and Safety, Ministry of Education Key Lab of
AUTHOR AFFILIATIONS Environment and Health, School of Public Health, Tongji Medical
1
Department of Nutrition, Harvard T.H. Chan School of Public College, Huazhong University of Science and Technology, Wuhan,
Health, Boston, MA, USA China
10
2
Department of Epidemiology, Erasmus Medical Center, Rotterdam, Division of General Internal Medicine, Division of Global Health
Netherlands Equity, Department of Medicine, Brigham and Women’s Hospital,
3 Department of Global Health and Social Medicine, Harvard Medical
Faculty of Sports and Nutrition, ACHIEVE - Centre of Applied
School, Boston, MA, USA
Research, Faculty of Health, Amsterdam University of Applied
11
Sciences, Amsterdam, Netherlands Channing Division of Network Medicine, Department of Medicine,
4 Brigham and Women’s Hospital, Harvard Medical School, Boston,
Department of Internal Medicine, Rush University Medical Center,
MA, USA
Chicago, IL, USA
12
5 Department of Global Health and Population, Harvard T.H. Chan
Department of Epidemiology and Biostatistics, Ministry of
School of Public Health, Boston, MA, USA
Education Key Laboratory of Environment and Health, School of
13
Public Health, Tongji Medical College, Huazhong University of Institute of Social and Preventive Medicine (ISPM), University of
Science and Technology, Wuhan, China Bern, Bern, Switzerland
6
Department of Epidemiology, Harvard T.H. Chan School of Public We thank the participants and staff of the Nurses’ Health Study and
Health, Boston, MA, USA the Health Professionals Study who contributed data for their valuable
contributions, as well as the following state cancer registries for
the bmj | BMJ 2020;368:l6669 | doi: 1

RESEARCH
their help: AL, AZ, AR, CA, CO, CT, DE, FL, GA, ID, IL, IN, IA, KY, LA, ME,
MD, MA, MI, NE, NH, NJ, NY, NC, ND, OH, OK, OR, PA, RI, SC, TN, TX, 9 Stampfer MJ, Hu FB, Manson JE, Rimm EB, Willett WC. Primary
prevention of coronary heart disease in women through diet
VA, WA, WY. The authors assume full responsibility for analyses and
and lifestyle. N Engl J Med 2000;343:16-22. doi:10.1056/
interpretation of these data.
NEJM200007063430103
Contributors: YL and JS contributed equally to the paper. YL, JS, OHF, 10 Mokdad AH, Forouzanfar MH, Daoud F, et al. Global burden of
and FBH had the idea for the study. YL did the data analysis. DDW, KD, diseases, injuries, and risk factors for young people’s health during
MS, ML, EH, MS, WCW, OHF, and FBH provided statistical expertise. 1990-2013: a systematic analysis for the Global Burden of Disease
YL wrote the first draft of the paper. MS, WCW, and FBH obtained Study 2013. Lancet 2016;387:2383-401. doi:10.1016/S0140-
funding. All authors contributed to the interpretation of the results and 6736(16)00648-6
critical revision of the manuscript for important intellectual content 11 Tamakoshi A, Tamakoshi K, Lin Y, Yagyu K, Kikuchi S, JACC Study
and approved the final version of the manuscript. The corresponding Group. Healthy lifestyle and preventable death: findings from the
author attests that all listed authors meet authorship criteria and that Japan Collaborative Cohort (JACC) Study. Prev Med 2009;48:486-92.
doi:10.1016/j.ypmed.2009.02.017
no others meeting the criteria have been omitted. YZ and FBH are the
12 Khaw KT, Wareham N, Bingham S, Welch A, Luben R, Day N.
guarantors.
Combined impact of health behaviours and mortality in men
Funding: The cohorts were supported by grants of UM1 CA186107, and women: the EPIC-Norfolk prospective population study. PLoS
R01 HL034594, R01 HL060712, R01 HL088521, P01 CA87969, Med 2008;5:e12. doi:10.1371/journal.pmed.0050012
UM1 CA167552, and R01 HL35464 from the National Institutes 13 Manuel DG, Perez R, Sanmartin C, et al. Measuring Burden of
of Health. The funding sources did not participate in the design Unhealthy Behaviours Using a Multivariable Predictive Approach: Life
or conduct of the study; collection, management, analysis or Expectancy Lost in Canada Attributable to Smoking, Alcohol, Physical
interpretation of the data; or preparation, review, or approval of the Inactivity, and Diet. PLoS Med 2016;13:e1002082. doi:10.1371/
manuscript. journal.pmed.1002082
14 Li K, Hüsing A, Kaaks R. Lifestyle risk factors and
Competing interests: All authors have completed the ICMJE uniform residual life expectancy at age 40: a German cohort
disclosure form at www.icmje.org/coi_disclosure.pdf (available on study. BMC Med 2014;12:59. doi:10.1186/1741-
request from the corresponding author) and declare: support from 7015-12-59
the National Institutes of Health; YL has receiving research support 15 O’Doherty MG, Cairns K, O’Neill V, et al. Effect of major lifestyle risk
from the California Walnut Commission; AP has received research factors, independent and jointly, on life expectancy with and without
support from BY-HEALTH outside of the submitted work; FBH has cardiovascular disease: results from the Consortium on Health
received research support from the California Walnut Commission, and Ageing Network of Cohorts in Europe and the United States
and honorariums for lectures from Metagenics and Standard (CHANCES). Eur J Epidemiol 2016;31:455-68.
Process, and honorariums from Diet Quality Photo Navigation, outside doi:10.1007/s10654- 015-0112-8
the submitted work; no other relationships or activities that could 16 Ferrucci L, Izmirlian G, Leveille S, et al. Smoking, physical activity,
appear to have influenced the submitted work. and active life expectancy. Am J Epidemiol 1999;149:645-53.
doi:10.1093/oxfordjournals.aje.a009865
Ethical approval: The Nurses’ Health Study and the Health 17 Nusselder WJ, Franco OH, Peeters A, Mackenbach JP. Living healthier
Professionals Follow-up Study were approved by the institutional for longer: comparative effects of three heart-healthy behaviors on
review boards at Brigham and Women’s Hospital and Harvard T.H. life expectancy with and without cardiovascular disease. BMC
Chan School of Public Health. Public Health 2009;9:487. doi:10.1186/1471-2458-9-487
Data sharing: No additional data available. 18 Stenholm S, Head J, Kivimäki M, et al. Smoking, physical inactivity
and obesity as predictors of healthy and disease-free life
Transparency statement: The lead author (YL) affirms that the expectancy between ages 50 and 75: a multicohort study. Int J
manuscript is an honest, accurate, and transparent account of the Epidemiol 2016;45:1260-70. doi:10.1093/ije/dyw126
study being reported; that no important aspects of the study have 19 Nyberg ST, Batty GD, Pentti J, et al. Obesity and loss of disease-free
been omitted; and that any discrepancies from the study as years owing to major non-communicable diseases: a multicohort
planned (and, if relevant, registered) have been explained. study. Lancet Public Health 2018;3:e490-7. doi:10.1016/S2468-
This is an Open Access article distributed in accordance with the 2667(18)30139-7
Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, 20 Wood R, Sutton M, Clark D, McKeon A, Bain M. Measuring
inequalities in health: the case for healthy life expectancy. J Epidemiol
which permits others to distribute, remix, adapt, build upon this work
Community Health 2006;60:1089-92.
non-commercially, and license their derivative works on different doi:10.1136/jech.2005.044941
terms, provided the original work is properly cited and the use is non- 21 Epstein D, Jiménez-Rubio D, Smith PC, Suhrcke M. Social
commercial. See: http://creativecommons.org/licenses/by-nc/4.0/. determinants of health: an economic perspective. Health
Econ 2009;18:495-502. doi:10.1002/hec.1490
1 GBD 2016 Mortality Collaborators. Global, regional, and national 22 Leal J, Gray AM, Clarke PM. Development of life-expectancy tables
under-5 mortality, adult mortality, age-specific mortality, and life for people with type 2 diabetes. Eur Heart J 2009;30:834-9.
expectancy, 1970-2016: a systematic analysis for the Global Burden doi:10.1093/eurheartj/ehn567
of Disease Study 2016. Lancet 2017;390:1084-150. doi:10.1016/ 23 Li Y, Pan A, Wang DD, et al. Impact of Healthy Lifestyle Factors on Life
S0140-6736(17)31833-0 Expectancies in the US Population. Circulation 2018;138:345-55.
2 GBD 2015 DALYs and HALE Collaborators. Global, regional, and doi:10.1161/CIRCULATIONAHA.117.032047
national disability-adjusted life-years (DALYs) for 315 diseases 24 Willett WC, Sampson L, Stampfer MJ, et al. Reproducibility and
and injuries and healthy life expectancy (HALE), 1990-2015: a validity of a semiquantitative food frequency questionnaire. Am
systematic analysis for the Global Burden of Disease Study 2015. J Epidemiol 1985;122:51-65. doi:10.1093/oxfordjournals.aje.
Lancet 2016;388:1603-58. doi:10.1016/S0140-6736(16)31460-X a114086
3 Capocaccia R, Gatta G, Dal Maso L. Life expectancy of colon, breast, 25 Rimm EB, Stampfer MJ, Colditz GA, Chute CG, Litin LB, Willett WC.
and testicular cancer patients: an analysis of US-SEER population-based Validity of self-reported waist and hip circumferences in men and
data. Ann Oncol 2015;26:1263-8. doi:10.1093/annonc/mdv131 women. Epidemiology 1990;1:466-73. doi:10.1097/00001648-
4 Franco OH, Steyerberg EW, Hu FB, Mackenbach J, Nusselder W. 199011000-00009
Associations of diabetes mellitus with total life expectancy and 26 Chiuve SE, Fung TT, Rimm EB, et al. Alternative dietary indices both
life expectancy with and without cardiovascular disease. Arch strongly predict risk of chronic disease. J Nutr 2012;142:1009-18.
Intern Med 2007;167:1145-51. doi:10.3945/jn.111.157222
doi:10.1001/archinte.167.11.1145 27 Wolf AM, Hunter DJ, Colditz GA, et al. Reproducibility and validity
5 Lee HY, Hwang JS, Jeng JS, Wang JD. Quality-adjusted life expectancy of a self-administered physical activity questionnaire. Int J
(QALE) and loss of QALE for patients with ischemic stroke and Epidemiol 1994;23:991-9. doi:10.1093/ije/23.5.991
intracerebral hemorrhage: a 13-year follow-up. Stroke 2010;41:739- 28 U.S. Department of Health and Human Services and U.S.
44. doi:10.1161/STROKEAHA.109.573543 Department of Agriculture. 2015 – 2020 Dietary Guidelines for
6 Loef M, Walach H. The combined effects of healthy lifestyle behaviors Americans. 8th ed. 2015.
on all cause mortality: a systematic review and meta-analysis. Prev https://health.gov/dietaryguidelines/2015/guidelines/.
Med 2012;55:163-70. doi:10.1016/j.ypmed.2012.06.017 29 Chasan-Taber S, Rimm EB, Stampfer MJ, et al. Reproducibility
7 Li Y, Pan A, Wang DD, et al. Impact of Healthy Lifestyle Factors on Life and validity of a self-administered physical activity questionnaire
Expectancies in the US Population. Circulation 2018;138:345-55. for male health professionals. Epidemiology 1996;7:81-6.
doi:10.1161/CIRCULATIONAHA.117.032047 doi:10.1097/00001648-199601000-00014
8 Chiuve SE, Rexrode KM, Spiegelman D, Logroscino G, 30 Fung TT, Hu FB, Yu J, et al. Leisure-time physical activity,
Manson JE, Rimm EB. Primary prevention of stroke by television watching, and plasma biomarkers of obesity and
healthy lifestyle. Circulation 2008;118:947-54. doi:10.1161/ cardiovascular disease risk. Am J Epidemiol 2000;152:1171-8.
CIRCULATIONAHA.108.781062 doi:10.1093/ aje/152.12.1171
31 Hunter DJ, Rimm EB, Sacks FM, et al. Comparison of measures
1 doi: 10.1136/bmj.l6669 | BMJ 2020;368:l6669 | the

of fatty acid intake by subcutaneous fat aspirate, food frequency
the bmj | BMJ 2020;368:l6669 | doi: 1

RESEARCH
questionnaire, and diet records in a free-living population of US

men. Am J Epidemiol 1992;135:418-27. 38 Hu FB, Manson JE, Stampfer MJ, et al. Diet, lifestyle, and the risk of
doi:10.1093/oxfordjournals.aje. a116302 type 2 diabetes mellitus in women. N Engl J Med 2001;345:790-7.
32 Garland M, Sacks FM, Colditz GA, et al. The relation between doi:10.1056/NEJMoa010492
dietary intake and adipose tissue composition of selected fatty 39 Manson JE, Rimm EB, Stampfer MJ, et al. Physical activity and
acids in US women. Am J Clin Nutr 1998;67:25-30. doi:10.1093/ incidence of non-insulin-dependent diabetes mellitus in women.
ajcn/67.1.25 Lancet 1991;338:774-8. doi:10.1016/0140-6736(91)90664-B
33 Giovannucci E, Colditz G, Stampfer MJ, et al. The assessment of 40 Ronksley PE, Brien SE, Turner BJ, Mukamal KJ, Ghali WA.
alcohol consumption by a simple self-administered questionnaire. Association of alcohol consumption with selected cardiovascular
Am J Epidemiol 1991;133:810-7. doi:10.1093/oxfordjournals.aje. disease outcomes: a systematic review and meta-analysis.
a115960 BMJ 2011;342:d671. doi:10.1136/bmj.d671
34 Al-Delaimy WK, Willett WC. Measurement of tobacco smoke 41 Yen H, Dhana A, Okhovat JP, Qureshi A, Keum N, Cho E. Alcohol intake
exposure: comparison of toenail nicotine biomarkers and self-reports. and risk of nonmelanoma skin cancer: a systematic review and
Cancer Epidemiol Biomarkers Prev 2008;17:1255-61. dose-response meta-analysis. Br J Dermatol 2017;177:696-707.
doi:10.1158/1055- 9965.EPI-07-2695 doi:10.1111/bjd.15647
35 Hu FB, Stampfer MJ, Rimm E, et al. Dietary fat and coronary heart 42 Chen WY, Rosner B, Hankinson SE, Colditz GA, Willett WC.
disease: a comparison of approaches for adjusting for total Moderate alcohol consumption during adult life, drinking patterns,
energy intake and modeling repeated dietary measurements. and breast cancer risk. JAMA 2011;306:1884-90. doi:10.1001/
Am J Epidemiol 1999;149:531-40. jama.2011.1590
doi:10.1093/oxfordjournals.aje. a009849 43 Schneeweiss S. Sensitivity analysis and external adjustment for
36 Yu E, Ley SH, Manson JE, et al. Weight history and all-cause and unmeasured confounders in epidemiologic database studies of
cause-specific mortality in three prospective cohort studies. Ann therapeutics. Pharmacoepidemiol Drug Saf 2006;15:291-303.
Intern Med 2017;166:613-20. doi:10.7326/M16-1390 doi:10.1002/pds.1200
37 Rich-Edwards JW, Corsano KA, Stampfer MJ. Test of the National 44 Lee WC. Bounding the bias of unmeasured factors with
Death Index and Equifax Nationwide Death Search. Am J confounding and effect-modifying potentials. Stat Med
Epidemiol 1994;140:1016-9. doi:10.1093/oxfordjournals.aje. 2011;30:1007-17. doi:10.1002/sim.4151
a117191
Supplementary material
No commercial reuse: See rights and reprints http://www.bmj.com/permissions Subscribe:

Cancer Epidemiology 77 (2022) 102118
Cancer Epidemiology
journal homepage: www.elsevier.com/locate/canep
Socioeconomic status and its relation with breast cancer recurrence and
survival in young women in the Netherlands
a, b, 1,* c d e
Marissa C. van Maaren , Bernard Rachet , Gabe S. Sonke , Audrey Mauguen ,
f a, b c
Virginie Rondeau , Sabine Siesling , Aurélien Belot
a
Department of Research and Development, Netherlands Comprehensive Cancer Organisation, Utrecht, The Netherlands
b
Department of Health Technology and Services Research, Faculty of Behavioural, Management and Social Sciences, Technical Medical Centre, University of Twente,
Enschede, The Netherlands
c
Inequalities in Cancer Outcomes Network (ICON), Department of Non-Communicable Disease Epidemiology, Faculty of Epidemiology and Population Health, London
School of Hygiene and Tropical Medicine, London, United 7ingdom
d
Department of Medical Oncology, Netherlands Cancer Institute, Amsterdam, The Netherlands
e
Department of Epidemiology and Biostatistics, Memorial Sloan 7ettering Cancer Center, New York, United States
f
INSERM U1219, Biostatistics team, University of Bordeaux, Bordeaux, France
A B S T R A C T
7eywords:
Toung breast cancer patients Background: Associations between socioeconomic status (SES) and breast cancer survival are most pronounced
Socioeconomic status in young patients. We further investigated the relation between SES, subsequent recurrent events and mortality
Mortality in breast cancer patients < 40 years. Using detailed data on all recurrences that occur between date of
Recurrence diagnosis of the primary tumor and last observation, we provide a unique insight in the prognosis of young
Joint modelling breast cancer patients according to SES.
Methods: All women < 40 years diagnosed with primary operated stage I-III breast cancer in 2005 were
selected from the nationwide population-based Netherlands Cancer Registry. Data on all recurrences within 10
years from primary tumor diagnosis were collected directly from patient files. Recurrence patterns and
absolute risks of
recurrence, contralateral breast cancer (CBC) and mortality – accounting for competing risks – were analysed
according to SES. Relationships between SES, recurrence patterns and excess mortality were estimated using a
multivariable joint model, wherein the association between recurrent events and excess mortality (expected
mortality derived from the general population) was included.
Results: We included 525 patients. The 10-year recurrence risk was lowest in high SES (18.1%), highest in low
SES (29.8%). Death and CBC as first events were rare. In high, medium and low SES 13.2%, 15.3% and 19.1%
died following a recurrence. Low SES patients had shorter median time intervals between diagnosis, first
recurrence and 10-year mortality (2.6 and 2.7 years, respectively) compared to high SES (3.5 and 3.3 years,
respectively). In multivariable joint modeling, high SES was significantly related to lower recurrence rates over
10-year follow-up, compared to low SES. A strong association between the recurrent event process and excess
mortality was found.
Conclusions: High SES is associated with lower recurrence risks, less subsequent events and better prognosis after
recurrence over 10 years than low SES. Breast cancer risk factors, adjuvant treatment adherence and treatment
of recurrence may possibly play a role in this association.
1. Intгodugtion
mortality risk as compared to the general population, even years
Women diagnosed with early stage breast cancer have a higher after their initial breast cancer diagnosis [1,2]. This is mainly caused
by the occurrence of (late) recurrences (local, regional and distant),
second
* Correspondence to: Netherlands Comprehensive Cancer Organisation (IKNL), P.O. Box 19079, 3501 DB Utrecht, The Netherlands.
E-mail addresses: m.vanmaaren@iknl.nl (M.C. van Maaren), Bernard.Rachet@lshtm.ac.uk (B. Rachet), g.sonke@nki.nl (G.S. Sonke), mauguena@mskcc.org
(A. Mauguen), Virginie.Rondeau@inserm.fr (V. Rondeau), s.siesling@iknl.nl (S. Siesling), aurelien.belot@lshtm.ac.uk (A. Belot).
1
ORCID ID: 0000-0002-5708-2559
https://doi.org/10.1016/j.canep.2022.102118
Received 22 September 2021; Received in revised form 6 January 2022; Accepted 27 January 2022
Available online 5 February 2022
1877-7821/O 2022 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BT license (http://creativecommons.org/licenses/by/4.0/).
M.C. van Maaren et al. low (deciles 1,2,3), medium
primary cancers and late side effects of treatment [2]. Although

breast cancer occurs more frequently in higher socioeconomic
classes, it presents with more favorable characteristics as
compared to lower socioeconomic classes [3]. Several studies have
shown that, after correction for prognostic factors, high socioeconomic
status (SES) is associated with better breast cancer survival in
multiple continents and countries
[4–10]. However, these associations are not consistent across subgroups
[3]. A Swedish study showed that survival differences among socio-
economic classes were most pronounced in younger breast cancer pa-
tients (<40 years) [11]. A Norwegian group [12] studied stage-specific
survival in young breast cancer patients over time and showed that
survival improved for young women of high SES, but not for low SES.
Suggested reasons were lifestyle, comorbidity, access to treatment or
the opportunity or ability of patients to make informed treatment choices
[12]. However, comorbidity is unlikely to play a large role in young
women, and access to treatment is expected to be equal in these coun-
tries. To further explore these mortality differences, it is important to
take into account recurrent events. As breast cancer survival is largely
determined by distant metastases (DM) [13] (which in turn are influ-
enced by the occurrence of local (LR) or regional recurrences (RR) [14]),
the relation between SES, the entire recurrent event process (including
all subsequent events) and mortality has to be adequately assessed.
This has not been done before, as recurrence and mortality are usually
modeled on their own, rather than as a joint process.
Here, we do not aim to prove the already established association
between recurrences and excess mortality, but we aim to describe how
both processes are related and how it differs between socioeconomic
classes in breast cancer patients < 40 years. Using data on all consecu-
tive recurrences, and by using a joint modelling framework including
the correlation with excess mortality, we provide a unique insight in the
prognosis of young breast cancer patients according to SES.
2. Methods
2.1. Design and population
In this population-based historic cohort study, data was extracted

from the Netherlands Cancer Registry (NCR). Trained and dedicated
data managers prospectively register data on patient-, tumor- and
treatment-related characteristics of all newly diagnosed malignancies
following a notification of the nationwide network and registry of histo-
and cytopathology in the Netherlands (PALGA). For primary invasive
breast cancers diagnosed in 2005, an active follow-up was conducted in
which data on recurrences within 10 years from diagnosis were collected
directly from patient files. This additional data collection was performed
outside of this study, but is not part of the routine data collection in the
NCR. However, this data collection was performed by the same trained
datamanagers as who perform the routine data collection, who have
broad experience in the collection of follow-up data as it is regularly part
of additional projects that are registered in the NCR.
In this study, all women < 40 years with primary stage I-III
breast cancer diagnosed in 2005 in the Netherlands were identified
from the NCR. Included patients were treated with local surgery in a
Dutch hospital and did not have synchronous breast cancer (second
breast cancer diagnosed within 90 days of the first).
2.2. Outcomes and definitions
We investigated the relationship between SES, recurrences and

excess mortality within 10 years from diagnosis. SES was based on
scores assigned to the four numbers of the Dutch postal code, extracted
from the Netherlands Institute for Social Research. The scores arise
from a principal component analysis on mean household income,
percentage of inhabitants with a low income, percentage of low
educatedness and percentage of unemployment [15]. The scores
were decoded into deciles, which were consequently classified as
2
Cancer Epidemiology 77 (2022) 102118 population we used to estimate expected mortality, but we assumed
excess mortality estimates to be similar to overall mortality estimates,
(deciles 4,5,6,7) and high (deciles 8,9,10) SES. we additionally executed the joint modelling analyses using overall
Recurrences comprise LR, RR and DM, which were defined mortality instead of excess mortality as outcome to verify this (for
according to consensus-based event definitions [16]. In case of this we did not need a reference population).
concurrent recurrences (at the same date) we analysed the one
with the worst prognosis (DM first, then RR, then LR). However,
in multivariable analysis, we combined all recurrences because of
the low incidence of especially LR and RRs, and because we aimed
to model the entire process of subsequent recurrences.
Contralateral breast cancer (CBC) was defined as breast cancer in
≥
the opposite breast diagnosed 90 days of the primary tumor. The
excess mortality hazard is defined as the mortality hazard of the
patient population divided by the mortality hazard of the general
Dutch population (obtained from Statistics Netherlands
(https://www. cbs.nl/en-gb)), matched by age, gender, calendar
year. This excess mortality hazard can be interpreted as the
mortality (in)directly linked to the cancer under study (breast cancer
in our case). Follow-up times were defined as the time between
definite surgery of the primary tumor and any subsequent event
(any recurrence, CBC, and death), with the corresponding event
type. Patients alive after 10 years were censored at 10 years.
2.3. Statistical analysis
Patient-, tumor-, treatment-, and event-related characteristics

according to SES were summarized using descriptive statistics and
compared using the Chi-squared test. We estimated the absolute
risk of recurrence as first event within 10 years (cumulative
incidence function) using the non-parametric Aalen-Johansen
estimator (stcompet com- mand in Stata), in which death and CBC
(as first event) were considered to be competing events. The
absolute recurrence risk at time t represents the probability of
experiencing a recurrence by time t in the presence of the other
competing events [17,18]. As the occurrence of CBC is extremely
low in our study population (see results), and follow-up was
collected for the first primary breast cancer only, we decided to only
include CBC in the descriptive statistics in which we focused on the
first occurring event. In the multivariable analysis in which we
included all subsequent events, we censored patients who
experienced an invasive CBC at the date of occurrence of this event.
In situ breast cancer events were ignored (so not marked as an
event) in multivariable analysis as they do not affect recurrence or
mortality risks.
Thereafter, we used a joint modelling approach. As mortality
highly depends on the occurrence of recurrent events, it creates an
informative censoring by preventing the occurrence of subsequent
recurrences [19]. This type of informative censoring may lead to
biased estimates when analysing recurrent events [20]. Joint
modelling frameworks take this correlation into account by
including a random effect shared by the
recurrent event process and the mortality event [20–23]. We
used the model developed by Belot et al. [21], which is based on
two submodels:
a model for the recurrence hazard and a model for the excess
mortality hazard. Baseline hazards of both outcomes were
modeled using cubic B-splines with one interior knot located at the
median of the event-time distribution (3.7 years for recurrence,
5.1 years for mortality). Cumu- lative baseline hazards were
approximated using the Cavalieri-Simpson approximation [24]. The
random effect shared between the two hazards was assumed to
follow a normal distribution with mean 0 and variance θ, and we
included a scale parameter γ which multiplies the random effect
in the linear predictor of the excess mortality hazard. The full
likelihood was approximated with the adaptive Gaussian
quadrature with 15 quadrature points and the optimization was
done using a quasi-Newton algorithm, as implemented in the
SAS proc nlmixed. In the multivariable model, we considered
potential confounders based on clinical foreknowledge and
literature. As we lacked information on SES of the reference
3
M.C. van Maaren et al.
All statistical tests were two-sided. Descriptive statistics and

Tab1e 1
competing risk analyses were performed in Stata version 16.1, joint Patient, tumor and treatment-related characteristics according to
modelling analyses were performed in SAS version 9.4. socioeconomic status (n = 525).
3. Resu1ts Characteristic Low SES Medium SES High SES p-

(n = 178) (n = 203) (n = 144) value*
Median age in 36 (33–38) 36 (33–38) 36 (33–38) 0.873
The original follow-up cohort consisted of all breast cancer patients years (IQR)
with operated primary non-metastatic unilateral invasive breast cancer, n % n % n %
diagnosed in 2005. For this study, we requested data of 615 patients Lateгa1ieation
< 40 years from this cohort. We excluded four male patients, 11 Left 92 51.7% 101 49.8% 70 48.6% 0.854
patients who turned out to have a pathological in situ tumor, one Right 86 48.3% 102 50.2% 74 51.4%
patient who had macroscopic residual tumor left after surgery, seven Sub1oga1ieation
Outer quadrants 86 48.3% 102 50.2% 71 49.3% 0.876
patients treated with lumpectomy without additional radiotherapy and
Inner quadrants 26 14.6% 37 18.2% 24 16.7%
67 patients treated with neoadjuvant systemic therapy (as it was not Central parts 10 5.6% 9 4.4% 8 5.6%
administered in
many patients in 2005 and would need separate analysis), ending up Overlapping 55 30.9% 51 25.1% 37 25.7%
with a final study population of 525 patients of whom 178 (33.9%) were lesions
of low, 203 (38.7%) of medium and 144 (27.4%) of high SES. Four
Unknown 1 0.6% 4 2.0% 4 2.8%
patients did not have complete 10-year follow-up due to for example Histo1ogy
Ductal 158 88.8% 177 87.2% 122 84.7% 0.767
emigration. Lobular 4 2.2% 9 4.4% 8 5.6%
Patients of high SES were more often diagnosed with stage II breast Mixed ductal 6 3.4% 8 3.9% 7 4.9%
cancer as compared to patients of low and medium SES, who more lobular
often
Other 10 5.6% 9 4.4% 7 4.9%
had stage I. Patients of high SES more often received endocrine therapy
Diffeгentiation
(Table 1). gгade
3.1. Recurrence patterns Well 18 10.1% 20 9.9% 21 14.6% 0.305

differentiated
Moderately 47 26.4% 67 33.0% 49 34.0%
LR, RR and DM as first event were diagnosed in 5.5%, 3.4% and differentiated
14.7% of the complete study population within 10 years, respectively Poorly 101 56.7% 97 47.8% 72 50.0%
differentiated
(Fig. 1). A contralateral invasive breast cancer event was diagnosed Unknown 12 6.7% 19 9.4% 2 1.4%
Mu1tifoga1ity
in 2.7% of the patients, while a contralateral in situ event was
No 134 75.3% 162 79.8% 103 71.5% 0.185
diagnosed in 0.8% of the patients. A considerable percentage of Tes 43 24.2% 36 17.7% 36 25.0%
patients who experienced any event, developed a subsequent event. Unknown 1 0.6% 5 2.5% 5 3.5%
Of all patients who developed a LR as first event, 6.9% developed a TNM stage
I 72 40.5% 85 41.9% 36 25.0%
subsequent LR, 17.2% developed a RR and 27.6% developed a DM as
II 84 47.2% 89 43.8% 87 60.4%
second event. Of all patients diagnosed with a RR as first event, 5.6% III 22 12.4% 29 14.3% 21 14.6% 0.012
developed a LR, 5.6% a RR and 50.0% a DM as second event. Of all Subtype
patients diagnosed with DM as first event, 2.6% were diagnosed with HR+ /HER2- 80 44.9% 89 43.8% 77 53.5% 0.270
a LR, 2.9% with a RR and 79.2% with a subsequent DM as second HR+ /HER2 + 25 14.0% 31 15.3% 23 16.0%
HR-/HER2 + 16 9.0% 10 4.9% 7 4.9%
event. The maximum number of consecutive events was nine. The HR-/HER2- 43 24.2% 46 22.7% 23 16.0%
recurrence hazard was highest around two years following diagnosis, Unknown 14 7.9% 27 13.3% 14 9.7%
with the highest hazard in patients of low SES (Fig. A1). Patients of Type of suгgeгy
high SES have the least subsequent recurrences, compared to low (gombined with
RT)
and medium SES (Figs. A2–A4).
3.2. First events according to SES Lumpectomy 94 52.8% 111 54.7% 80 55.6% 0.811
with RT
Mastectomy 61 34.3% 65 32.0% 41 28.5%
Median times to first recurrence were 2.6 years (IQR:1.6–4.1 years), without RT
3.9 years (IQR:2.1–5.6 years) and 3.5 years (IQR:2.0–6.2 years) for low, Mastectomy 23 12.9% 27 13.3% 23 16.0%
medium and high SES, respectively. Table 2 shows the numbers and with RT
types of the first event (left panel) and of any events (right panel), Sentine1 node
pгogeduгe
stratified for SES. In patients with low SES recurrences occurred more between first recurrence and death were 2.7 years (IQR:0.9–6.9 years),
often than in medium or high SES (29.8%, 22.2% and 18.1%, respec- 2.1 years (IQR:1.0–4.3 years) and 3.3 years (IQR:0.9–5.2 years) for low,
tively), mostly distant metastases. CBC was rare in all groups. Overall, medium and high SES, respectively.
90 patients (17.1% of total) died within 10 years: 37 (20.8%), 34
(16.8%) and 19 (13.2%) patients died in the low, medium and high 3.3. Associations between SES, patterns of recurrences and death
socioeconomic group, respectively. Six patients died without experi-
encing any event: three (1.7%) of low, three (1.5%) of medium SES. Cumulative incidence functions of any recurrence, death and CBC as
Overall, 19.1% of the patients with low SES died following an event
within 10 years from diagnosis, compared to 15.3% and 13.2% in
patients with medium and high SES, respectively (Fig. 2). Median
times
4
No 76 42.7% 83 40.9% 63 43.8%
Tes 102 57.3% 120 59.1% 81 56.3% 0.860
Axi11aгy 1ymph
node dissegtion
No 162 91.0% 178 87.7% 127 88.2% 0.553
Tes 16 9.0% 25 12.3% 17 11.8%
Endogгine
theгapy
No 92 61.7% 100 49.3% 55 38.2%
Tes 86 48.3% 103 50.7% 89 61.8% 0.039
Chemotheгapy
No 34 19.1% 46 22.7% 22 15.3%
Taгgeted theгapy Tes 144 80.9% 157 77.3% 122 84.7% 0.229
No 149 83.7% 167 82.3% 120 83.3% 0.927

Type of hospita1 Tes 29 16.3% 36 17.7% 24 16.7%
Other 162 91.0% 191 94.1% 135 93.8% 0.458

Academic 16 9.0% 12 5.9% 9 6.3%
5
Abbreviations: SES = socioeconomic status, n = number, IQR = interquartile

range, TNM = tumor, node and metastasis classification system, RT (HR:0.30, 95%CI:0.09–1.02), although borderline significant. Note that
= radiotherapy, ER = oestrogen receptor, PR = progesterone receptor, the estimates are high and confidence intervals around the estimates
HER2 = human epidermal growth factor receptor 2. *A p-value < 0.1 was are very large due to the very low incidence of mortality. The
considered to be statistically significant and indicated in bold. The p-value was association
calculated using a Chi-squared test (categorical variables) or Mann-Whitney U between 10-year recurrence and excess mortality was positive ( =6.91
test (continuous variables) for known values only. In case of an expected fre- (95%CI:1.32–12.51), Table 4), indicating that patients with a higher
quency < 5 in a cell Fisher´s Exact test was used. recurrence risk also have a higher excess mortality risk. After correction
for confounding, the variance of the shared random effect (θ) reduced
first events are illustrated in Fig. 3. Recurrence risks were highest in from 17.57 (Tables 3) to 16.46 (Table 4). This is still very high, meaning
patients with low SES, lowest in patients with high SES (left panels). that despite adjustment on important prognostic factors, unmeasured
Death and CBC as first events were very rare (middle and right panels). heterogeneity is likely to be present. Including other factors such as
Death occurs more often as subsequent event, following one or more treatment did not alter the associations, but caused a larger uncertainty
recurrent events (Fig. 2). In a joint model (n 525, 793 around the estimates (data not shown).
=
observations) without correction for confounding, high SES was
associated with lower recurrence risk compared to low SES (Table 3.4. Sensitivity analysis using the overall mortality hasard
3). After correction for stage, grade and breast cancer subtype, this
association was still present As the expected mortality due to other causes of patients < 40 years
is very low, excess mortality estimates are assumed to be similar to
rig. 1. Patterns of recurrences in women < 40 years with primary non-metastatic breast cancer (n = 525). Abbreviations: LR = local recurrence, RR = RR, DM
= distant metastasis, CBC = CBC, IS = In situ.
Tab1e 2
Number and type of first event within 10-years according to socioeconomic status in breast cancer patients < 40 years (n = 525).
First event First or subsequent event
Low SES
(n = Medium SES High SES Low SES Medium SES High SES
178) (n = 203) (n = (n = (n = 203) (n = 144)
144) 178)
Type of event Total n n % n % n % Total n n % n % n %

Any гeguггenge 124 53 29.8% 45 22.2% 26 18.1% 124 53 29.8% 45 22.2% 26 18.1%
Local recurrence 29 14 7.9% 9 4.4% 6 4.2% 35 17 9.6% 11 5.4% 7 4.9%
Regional recurrence 18 7 3.9% 7 3.5% 4 2.8% 29 14 7.9% 11 5.4% 4 2.8%
Distant metastasis 77 32 18.0% 29 14.3% 16 11.1% 100 41 23.0% 36 17.7% 23 16.0%
Contгa1ateгa1 bгeast gangeг, invasive 14 5 2.8% 4 2.0% 5 3.5% 16 6 3.4% 4 2.0% 6 4.2%
Contгa1ateгa1 bгeast gangeг, in situ 4 1 0.6% 1 0.5% 2 1.4% 4 1 0.6% 1 0.5% 2 1.4%
Death 6 3 1.7% 3 1.5% 0 0.00% 90 37 20.8% 34 16.8% 19 13.2%
6
Abbreviations: SES = socioeconomic status, n = number. *A p-value < 0.1 was considered to be statistically significant and indicated in bold. The p-value was
calculated using a Chi-squared test or Fisher´s Exact test In case of an expected frequency < 5 in a cell. In case of 0 observations in a cell the p-value could not be
calculated.
7
4. Disgussion
In this population-based study we showed that high SES is

associated with lower risks of recurrence and less subsequent
recurrences in young breast cancer patients compared to low SES. This
association is independent of stage, breast cancer subtype, grade,
treatment and time to recurrence. There was no relationship between
SES and excess
Tab1e 3
Crude association between socioeconomic status and 10-year rate of
recurrence and excess mortality in patients < 40 years in a joint modelling
framework (n = 525, 793 observations).
Parameter Hazard ratio (95% CI) p-value
10-yeaг гeguггenge
Low socioeconomic status reference
Medium socioeconomic status 0.44 (0.15–1.24) 0.113
High socioeconomic status 0.22 (0.07–0.71) 0.016
rig. 2. Percentages of (combinations of) events according to socioeconomic 10-yeaг exgess moгta1ity
status in women < 40 years with primary non-metastatic breast can- Low socioeconomic status reference
cer (n = 525). Medium socioeconomic status 0.01 (0.00–9.19) 0.178
High socioeconomic status 0.00 (0.00–2.04) 0.072
overall
joint mortalityanalyses
modelling estimates. We overall
using additionally executed
mortality the of
instead multivariable
excess mor- Coeffigient p-va1ue
θ 17.57 < 0.001
tality as outcome to verify this. Results of this sensitivity analysis 6.00 < 0.001
were similar to the analyses presented in this paper (Supplementary
Abbreviations: CI = confidence interval, θ = variance of the random effect,
Table 1). = scale parameter for the random effect.
8
rig. 3. Cumulative incidence function of the 10-year recurrence risk (first event) according to socioeconomic status in women < 40 years with early stage breast
cancer (n = 525). Death and CBC as a first event were taken into account as competing event. Abbreviations: CIF = cumulative incidence function, CBC = CBC.
9
Tab1e 4
For confounding adjusted association between socioeconomic status and 10-year rate of recurrence and excess mortality in patients < 40 years in a joint modelling
framework.
Parameter Hazard ratio (95%CI) p-value Hazard ratio (95%CI) p-value Hazard ratio (95%CI) p-value
Including stage Including stage, subtype Including stage, subtype, grade
(n = 525, 793 observations) (n = 470, 709 observations)* (n = 446, 670 observations)* *
10-yeaг гeguггenge
Low socioeconomic status reference reference reference
Medium socioeconomic status 0.44 (0.15–1.24) 0.121 0.44 (0.15–1.31) 0.138 0.52 (0.17–1.60 0.251
High socioeconomic status 0.22 (0.07–0.71) 0.011 0.23 (0.06–0.85) 0.028 0.30 (0.09–1.02) 0.053
Stage I reference reference reference
Stage II/III 2.08 (0.82–5.30) 0.123 1.97 (0.66–5.89) 0.227 1.90 (0.67–5.34) 0.224
HR+ /HER2- subtype reference reference
HR+ /HER2 + subtype 0.37 (0.08–1.79) 0.216 0.39 (0.10–1.58) 0.186
HR-/HER2 + subtype 1.37 (0.21–8.88) 0.741 0.89 (0.12–6.54) 0.908
HR-/HER2- subtype 1.26 (0.39–4.06) 0.693 0.89 (0.23–3.39) 0.869
Grade 3 (poorly differentiated) reference 0.174
Grade II/II (well/moderately differentiated) 0.46 (0.15–1.41)
10-yeaг exgess moгta1ity
Low socioeconomic status reference reference reference
Medium socioeconomic status 0.01 (0.00–9.96) 0.187 0.01 (0.00–30.16) 0.249 0.03 (0.00–130.7) 0.400
High socioeconomic status 0.00 (0.00–1.53) 0.062 0.00 (0.00–16.96) 0.146 0.00 (0.00–43.5) 0.220
Stage I reference reference reference
4 6 5
Stage II/III 89.24 (0.14–5.8 *10 ) 0.174 192.9 (0.03–1.12 *10 ) 0.234 150.7 (0.04–6.41 *10 ) 0.239
HR+ /HER2- subtype reference reference
HR+ /HER2 + subtype 0.00 (0.00–67.30) 0.193 0.00 (0.00–42.1) 0.181
2.51 (0.00–7.29 *10 )5 0.05 (0.00–7.1 *10 )4
HR-/HER2 + 0.886 0.683
5 4
subtype HR-/HER2- 26.97 (0.01–1.19 *10 ) 0.441 2.90 (0.00–3.59 *10 ) 0.825
subtype
Grade 3 (poorly differentiated) reference
Grade II/II (well/moderately differentiated) 0.00 (0.00–16.9) 0.164
Coeffigient (95%CI) p-va1ue Coeffigient p-va1ue Coeffigient (95%CI) p-va1ue
θ 17.20 (11.79–22.62) < 0.001 16.79 (10.96–22.61) < 0.001 16.46 (10.65–22.28) < 0.001
6.02 (2.33–9.71) 0.001
6.65 (1.54–11.75) 0.011
6.91 (1.32–12.51) 0.001
Abbreviations: CI = confidence interval, HR = hormonal receptors, HER2 = human epidermal growth factor receptor 2, θ = variance of the random effect, = scale
parameter for the random effect. In the multivariable models * 55 patients and * *79 patients were excluded from the multivariable analysis due to missing values
(≈15%). Due to statistical complexities it was decided not to impute these missing values.
mortality, which is likely to be partly explained by the low mortality significantly different among the groups. Here, patients of high SES
rates in this population. However, we confirmed that there is a positive more often received endocrine
association between the entire recurrent event process (so all
subsequent events) and excess mortality, which implies that the
frequently described association between SES and mortality is
related to the
recurrence pattern. This suggests that other factors such as lifestyle –
which is frequently reported to be associated with SES [25] – are less
likely to be related to the reported mortality differences. This is
confirmed by a recent publication showing that lifestyle only
explained a small proportion of the association between SES and
mortality [26]. Notably, our study only includes patients< 40 years with
no more than 10-year follow-up. Comorbidities as a result of unhealthy
lifestyle occur frequently at older age so are unlikely to be present,
and therefore unlikely to have played an evident role. The argument
that patients of low SES often have an unhealthy lifestyle which
increases recurrence risks
[27] therefore does not hold in this study.
4.1. Potential explanations for differences in recurrence patterns

according to SES
A potential argument, which has not been investigated in this study,

that may explain the larger number of (subsequent) recurrences in pa-
tients of low SES compared to high SES is lower therapy adherence in
the first mentioned group. A previous Dutch study showed that there
are minimal socioeconomic differences in chemotherapy and
endocrine therapy guideline adherence [28], however, especially for
endocrine therapy, long-term adherence may still be lower. Other
studies showed that differences in breast cancer treatment exist
according to SES, with patients of low SES less often receiving axillary
surgery and chemotherapy than patients of high SES [29,30]. This
is contrasting to our study, in which axillary surgery (including
sentinel lymph node procedures) and chemotherapy are not
1
therapy, but this was correlated with the higher number of
hormonal receptor positive patients which was corrected for in
the analysis (subtype). Although dated, a study in the
Netherlands implied that survival differences among SES were not
related to treatment, but that stage at diagnosis largely explains
these inequalities [31]. Here, in which we
only focused on patients < 40 years – as survival differences
according to SES are most pronounced in this group [11,12] – we
indeed found significant differences in stage distribution, but
contrasting to what is
described in literature [3] patients of high SES more often
presented with stage II-III disease as compared to low and medium
SES. We could not find an explanation for this. Additionally, patients
of low SES in our cohort less often received mastectomy with
radiotherapy compared to patients of high SES, who more often
received postmastectomy radiotherapy. Differences in treatment
strategies were reported earlier [32]. However, this was not
statistically significant and adding radiotherapy to the multivariable
model did not change the results. In our multivariable joint model
we still found considerable between-patient variability
(θ 16.46), which indicate the presence of unmeasured factors. One =
hypothesis that may partly explain the observed recurrence and
survival differences is that patients of low SES have
prognostically more unfavorable recurrences as compared to
patients of high SES. In the low SES group, more patients
experienced a (distant) recurrence and subsequently died,
compared to medium and high SES. Furthermore, both the median
time to a first recurrence and the median time between recur-
rence and death was lower in patients with low SES compared to
medium and high SES. We additionally showed that in the group
of low SES more patients had HR-/HER2- disease, which is
associated with shorter time to recurrence and unfavorable
prognosis compared to the other subtypes [33]. Something not
investigated in this study but what might be important is treatment
of recurrences. Less optimal treatment in the low socioeconomic
group may possibly have led to the shorter time intervals
between recurrence and death.
1
4.2. Strengths and limitations

CRediT authoгship gontгibution statement
To the best of our knowledge, this is the first population-based study

Maгissa van Maaгen: Conceptualization, Validation, Formal anal-
in breast cancer patients < 40 years investigating the relationship be-
ysis, Investigation, Resources, Data curation, Writing – original draft,
tween SES and recurrence patterns over 10-year follow-up, rather than
Writing – review & editing, Visualization, Project administration. Beг-
mortality only. Our study mainly differs from previously executed
naгd Raghet: Conceptualization, Resources, Writing – review & editing,
studies by jointly modelling recurrence patterns and excess mortality.
Supervision, Project administration. Gabe Sonke: Writing – review &
We specifically aimed to jointly estimate both the recurrence process
editing. Audгey Mauguen: Writing – review & editing. Viгginie
and mortality, while accounting for the correlation between these two
Rondeau: Writing – review & editing, Sabine Sies1ing: Resources,
outcomes, in order to get a better understanding of the relationship
Writing – review & editing, Supervision, Project administration.
between SES, recurrence patterns and excess mortality. In a separate
Auгe1ie`n Be1ot: Conceptualization, Methodology, Software,
study, to complement our results, another approach based on mediation Validation,
analysis could be conducted, where we would aim to quantify the effect
Resources, Data curation, Writing – review & editing, Supervision,
of SES on mortality, potentially mediated by recurrences (indirect effect) Project administration.
[34,35]. The use of the nationwide NCR increases generalizability of our
results, and the active follow-up in which all subsequent recurrences
Deg1aгation of Competing Inteгest
were registered provides us with detailed information about prognosis.
We expect this active follow-up to be largely complete, as the patterns
The authors declare that they have no known competing financial
of recurrence closely resemble the patterns found in other literature.
interests or personal relationships that could have appeared to influence
However, in case a patient moves for example to another country, the
the work reported in this paper.
patient is censored at time of emigration. Any recurrence that occurred
after this date is missed. However, as only four patients who were still
Agknow1edgements
alive did not have the complete 10 years of follow-up, we potentially
only missed recurrences of four patients (spread over the three SES
We thank the Netherlands Cancer Registry for providing the data, as
groups). Therefore, we expect this potential limitation to be very minor.
well as the registration clerks for their effort in gathering the data in the
Furthermore, as everyone in the Netherlands has equal access to health
Netherlands Cancer Registry.
care and our data managers have access to almost all hospitals in the
Netherlands, we do not expect bias in the collection of recurrences ac-
cording to SES. In our study we used postal code of incidence to deter- Appendix A. Suppoгting infoгmation
mine SES, as we lacked information on education or household income.
However, postal codes have been described to be useful markers of SES Supplementary data associated with this article can be found in
[36] and have been used in many studies, which allows us to the online version at doi:10.1016/j.canep.2022.102118.
compare our results. The lack of information on ethnicity,
comorbidity, performance status, smoking status and BMI can be Refeгenges
considered a limitation, as they can all affect the outcomes. For
[1] L.M. Woods, M. Morris, B. Rachet, No ‘cure’ within 12 years of diagnosis among
example, it has been described that aromatase inhibitors in obese breast cancer patients who are diagnosed via mammographic screening: women
hormonal receptor positive breast cancer patients may not be as diagnosed in the West Midlands region of England 1989-2011, Ann. Oncol. 27 (11)
effective as in normal weight women, and in this way relates to higher (2016) 2025–2031.
[2] M.L. Janssen-Heijnen, L.N. van Steenbergen, A.C. Voogd, V.C. Tjan-Heijnen, P.
recurrence risks [37]. Importantly, as we investigated excess H. Nijhuis, P.M. Poortmans, J.W. Coebergh, D.J. van Spronsen, Small but
mortality, we largely corrected for age-related (including presence of significant excess mortality compared with the general population for long-term
comorbidities) mortality, and in this young population we do not survivors of breast cancer in the Netherlands, Ann. Oncol. 25 (1) (2014) 64–68.
[3] A.C. Klassen, K.C. Smith, The enduring and evolving relationship between social
expect much comorbidities. However, people of low SES in general
class and breast cancer burden: a review of the literature, Cancer Epidemiol. 35
have higher expected mortality than patients of high SES [38], and (3) (2011) 217–234.
the unavailability of life tables stratified by SES could have ampli- [4] A. Kumachev, M.E. Trudeau, K.K. Chan, Associations among socioeconomic status,
patterns of care and outcomes in breast cancer patients in a universal health care
fied the association between SES and the excess hazard [39]. Our pop-
≤ system: Ontario’s experience, Cancer 122 (6) (2016) 893–898.
ulation consisted of patients 40 years at diagnosis (so with a maximum [5] T.E. Byers, H.J. Wolf, K.R. Bauer, S. Bolick-Aldrich, V.W. Chen, J.L. Finch, J.
of 50 years at the end of follow-up) and the expected mortality rates P. Fulton, M.J. Schymura, T. Shen, S. Van Heest, X. Tin, G. Patterns of Care Study,
remain very low for those ages. Therefore, the results should not The impact of socioeconomic status on survival after cancer in the United States:
findings from the National Program of Cancer Registries Patterns of Care Study,
have been affected by the lack of lifetables stratified by SES, as we Cancer 113 (3) (2008) 582–591.
confirmed with our sensitivity analysis. [6] M. Morris, L.M. Woods, B. Rachet, What might explain deprivation-specific
differences in the excess hazard of breast cancer death amongst screen-detected
women? Analysis of patients diagnosed in the West Midlands region of England
4.3. Conclusions and future recommendations from 1989 to 2011, Oncotarget 7 (31) (2016) 49939–49947.
[7] B.H. Strand, A. Kunst, M. Huisman, G. Menvielle, M. Glickman, M. Bopp, C. Borell,
High SES is associated with lower recurrence rates, less subsequent J.K. Borgan, G. Costa, P. Deboosere, E. Regidor, T. Valkonen, J.P. Mackenbach,
H. EU Working Group on Socioeconomic Inequalities in, The reversed social
recurrent events, and the pattern of recurrence is largely associated with
gradient: higher breast cancer mortality in the higher educated compared to lower
the risk of mortality over 10-year follow-up. Patients of low SES have educated. A comparison of 11 European populations during the 1990s, Eur. J.
shorter time intervals between diagnosis and first recurrence, and Cancer 43 (7) (2007) 1200–1207.
[8] E. Bastiaannet, A.J. de Craen, P.J. Kuppen, M.J. Aarts, L.G. van der Geest, C.J. van
shorter time intervals between first recurrence and death. Patients of
de Velde, R.G. Westendorp, G.J. Liefers, Socioeconomic differences in survival
low SES more often have HR-/HER2- disease, suggesting that other among breast cancer patients in the Netherlands not explained by tumor size,
breast cancer risk factors play a role. Differences in treatment of re- Breast Cancer Res. Treat. 127 (3) (2011) 721–727.
currences was not assessed in this study and should be subject for [9] K.E. Lukong, T. Ogunbolude, J.P. Kamdem, Breast cancer in Africa: prevalence,
treatment options, herbal medicines, and socioeconomic determinants, Breast
further research, to further reduce socioeconomic differences. Cancer Res. Treat. 166 (2) (2017) 351–365.
[10] L.M. Woods, B. Rachet, D. O’Connell, G. Lawrence, M.P. Coleman, Impact of
runding deprivation on breast cancer survival among women eligible for mammographic
screening in the West Midlands (UK) and New South Wales (Australia): women
diagnosed 1997-2006, Int. J. Cancer 138 (10) (2016) 2396–2403.
This research did not receive any specific grant from funding [11] M. Lagerlund, R. Bellocco, P. Karlsson, G. Tejler, M. Lambe, Socio-economic factors
agencies in the public, commercial, or not-for-profit sectors. and breast cancer survival–a population-based cohort study (Sweden), Cancer
Causes Control. 16 (4) (2005) 419–430.
1
[12] C.B. Trewin, A.L.V. Johansson, K.V. Hjerkind, B.H. Strand, C.E. Kiserud, G. Ursin,
Stage-specific survival has improved for young breast cancer patients since 2000: socioeconomic inequalities in health: a systematic review, Prev. Med. 113 (2018)
but not equally, Breast Cancer Res. Treat. 182 (2) (2020) 477–489. 15–31.
[13] E. Tanis, C.J. van de Velde, H. Bartelink, M.J. van de Vijver, H. Putter, J.A. van der [26] T.B. Zhang, C. Chen, X.F. Pan, J. Guo, T. Li, O.H. Franco, G. Liu, A. Pan,
Hage, Locoregional recurrence after breast-conserving therapy remains an Associations of healthy lifestyle and socioeconomic status with mortality and
independent prognostic factor even after an event free interval of 10 years in early incident cardiovascular disease: two prospective cohort studies, BMJ 373 (2021)
n604.
stage breast cancer, Eur. J. Cancer 48 (12) (2012) 1751–1756.
[27] J. Hamer, E. Warner, Lifestyle modifications for patients with breast cancer to
[14] J.S. Lee, S.I. Kim, H.S. Park, J.S. Lee, S. Park, B.W. Park, The impact of local and
improve prognosis and optimize overall health, CMAJ 189 (7) (2017) E268–E274.
regional recurrence on distant metastasis and survival in patients treated with
[28] A. Kuijer, J. Verloop, O. Visser, G. Sonke, A. Jager, C.H. van Gils, T. van Dalen, S.
breast conservation therapy, J. Breast Cancer 14 (3) (2011) 191–197.
G. Elias, The influence of socioeconomic status and ethnicity on adjuvant systemic
[15] Netherlands Institute for Social Research. Socioeconomic status based on area of
treatment guideline adherence for early-stage breast cancer in the Netherlands,
postal code. 2019. https://bronnen.zorggegevens.nl/Bron?naam Sociaal-Econ
〈 = Ann. Oncol. 28 (8) (2017) 1970–1978.
omische-Status-per-postcodegebied .
〉 [29] M.J. Aarts, V.C. Hamelinck, E. Bastiaannet, J.W. Coebergh, G.J. Liefers, A.
[16] M. Moossdorff, L.M. van Roozendaal, L.J. Strobbe, S. Aebi, D.A. Cameron, J.
C. Voogd, M. van der Sangen, W.J. Louwman, Small but significant socioeconomic
M. Dixon, A.E. Giuliano, B.G. Haffty, B.E. Hickey, C.A. Hudis, V.S. Klimberg,
inequalities in axillary staging and treatment of breast cancer in the Netherlands,
B. Koczwara, T. Kühn, M.E. Lippman, A. Lucci, M. Piccart, B.D. Smith, V.C. Tjan-
Br. J. Cancer 107 (1) (2012) 12–17.
Heijnen, C.J. van de Velde, K.J. Van Zee, J.B. Vermorken, G. Viale, A.C. Voogd, I.
[30] M.S. Dreyer, A.B. Nattinger, E.L. McGinley, L.E. Pezzin, Socioeconomic status and
L. Wapnir, J.R. White, M.L. Smidt, Maastricht Delphi consensus on event
definitions for classification of recurrence in breast cancer research, J. Natl. Cancer breast cancer treatment, Breast Cancer Res. Treat. 167 (1) (2018) 1–8.
Inst. 106 (12) (2014). [31] C.T. Schrijvers, J.W. Coebergh, L.H. van der Heijden, J.P. Mackenbach,
[17] R.B. Geskus, Data analysis with competing risks and intermediate states, Socioeconomic status and breast cancer survival in the southeastern Netherlands,
Biometrics 71 (4) (2015) 1197–1198. 1980-1989, Eur. J Cancer 31A (10) (1995) 1660–1664.
[18] H. Putter, M. Fiocco, R.B. Geskus, Tutorial in biostatistics: competing risks and [32] M.D. Filipe, S. Siesling, M.R. Vriens, P. van Diest, A.J. Witkamp, The association of
socioeconomic status on treatment strategy in patients with stage I and II breast
multi-state models, Stat. Med. 26 (11) (2007) 2389–2430.
[19] R.J. Cook, J.F. Lawless, Analysis of repeated events, Stat. Methods Med. Res. 11 cancer in the Netherlands, Breast Cancer Res. Treat. 189 (2) (2021) 541–550.
(2) [33] M.C. van Maaren, L. de Munck, L.J.A. Strobbe, G.S. Sonke, P.J. Westenend, M.
(2002) 141–166. L. Smidt, P. Poortmans, S. Siesling, Ten-year recurrence rates for breast cancer
[20] L. Liu, R.A. Wolfe, X. Huang, Shared frailty models for recurrent events and a subtypes in the Netherlands: a large population-based study, Int. J. Cancer 144
terminal event, Biometrics 60 (3) (2004) 747–756. (2) (2019) 263–272.
[21] A. Belot, V. Rondeau, L. Remontet, R. Giorgi, CENSUR working survival group, [34] S. Vansteelandt, R.M. Daniel, Interventional effects for mediation analysis with
A joint frailty model to estimate the recurrence process and the disease-specific multiple mediators, Epidemiology 28 (2) (2017) 258–265.
mortality process without needing the cause of death, Stat. Med. 33 (18) (2014) [35] L. Liu, C. Zheng, J. Kang, Exploring causality mechanism in the joint analysis
3147–3166. of longitudinal data and survival data, Stat. Med. 37 (26) (2018) 3733–3744.
[22] A. Mauguen, B. Rachet, S. Mathoulin-Pélissier, G.M. Lawrence, S. Siesling, [36] J. Danesh, S. Gault, J. Semmence, P. Appleby, R. Peto, Postcodes as useful markers
G. MacGrogan, A. Laurent, V. Rondeau, Validation of death prediction after breast of social class: population based study in 26 000 British households, BMJ
cancer relapses using joint models, BMC Med. Res. Methodol. 15 (2015) 27. 318 (7187) (1999) 843–844.
[23] A. Mauguen, B. Rachet, S. Mathoulin-Pelissier, G. MacGrogan, A. Laurent, [37] M. Azrad, W. Demark-Wahnefried, The association between adiposity and breast
V. Rondeau, Dynamic prediction of risk of death using history of cancer cancer recurrence and survival: a review of the recent literature, Curr. Nutr. Rep. 3
recurrences in joint frailty models, Stat. Med. 32 (30) (2013) 5366–5380. (1) (2014) 9–15.
[24] L. Remontet, N. Bossard, A. Belot, J. Esteve, French network of cancer registries F. [38] J.P. Mackenbach, I. Stirbu, A.J. Roskam, M.M. Schaap, G. Menvielle, M. Leinsalu,
An overall strategy based on regression models to estimate relative survival and A.E. Kunst, H. European Union Working Group on Socioeconomic Inequalities
model the effects of prognostic factors in cancer survival studies, Stat. Med. 26 in, Socioeconomic inequalities in health in 22 European countries, New Engl. J.
(10) (2007) 2214–2228. Med. 358 (23) (2008) 2468–2481.
[25] D. Petrovic, C. de Mestral, M. Bochud, M. Bartley, M. Kivima¨ki, P. Vineis, [39] H. Bower, T.M. Andersson, M.J. Crowther, P.W. Dickman, M. Lambe, P.C. Lambert,
J. Mackenbach, S. Stringhini, The contribution of health behaviors to Adjusting expected mortality rates using information from a control population: an
example using socioeconomic status, Am. J. Epidemiol. 187 (4) (2018) 828–836.
1
RESEARCH
Pregnancy duration and endometrial cancer risk: nationwide

cohort study
BMJ: first published as 10.1136/bmj.l4693 on 14 August 2019. Downloaded from http://www.bmj.com/ on 13 April 2022 by guest. Protected by copyright.
Anders Husby,1,2 Jan Wohlfahrt,1 Mads Melbye1,3,4
1
Department of Epidemiology
Research, Statens Serum ABSTRACT Introduction
Institut, Artillerivej 5, DK-2300 OBJECTIVE Endometrial cancer is the most common
Copenhagen, Denmark To explore the association between pregnancy gynaecological cancer in developed countries, with an
2
Department of Biomedical duration and risk of endometrial cancer. increasing incidence in North America and Europe. 1 2
Data Science, Stanford
University School of Medicine, DESIGN A woman’s risk of endometrial cancer has been
Stanford, CA USA Nationwide register based cohort study. strongly associated with number of full term
pregnancies, with a noticeable protection associated
3
Department of Clinical
Medicine, University of SETTING
with the first full term pregnancy and additional
Copenhagen, Copenhagen, Denmark.
PARTICIPANTS protection associated with subsequent full term
pregnancies.3-12 To date studies have focused
Denmark little on the effect of the duration of pregnancy, and in
4
Department of Medicine, All Danish women born from 1935 to 2002.
particular shorter pregnancies (eg, induced abortions
Stanford University School of MAIN OUTCOME MEASURES
Medicine, Stanford, CA, USA and preterm childbirths), in analysis of this protective
Relative risk (incidence rate ratio) of endometrial factor.5 It is therefore unknown whether the
Correspondence to: A Husby
andh@ssi.dk cancer by pregnancy number, type, and duration, protective association is driven by the ability to
(or @a_husby on Twitter; estimated using log-linear Poisson regression. conceive (a woman’s fecundity), the cumulative
ORCID 0000-0002-7634-8455)
RESULTS number of months pregnant, or a process that occurs
Additional material is
published online only. To view
Among 2 311 332 Danish women with 3 947 650 at a specific time during pregnancy.
please visit the journal online. pregnancies, 6743 women developed endometrial We combined data from the nationwide Danish
Cite this as: BMJ cancer during 57 347 622 person years of follow-up. National Registry of Induced Abortions, the Medical
2019;366:l4693 After adjustment for age, period, and socioeconomic Birth Registry, and the Danish Cancer Registry to
http://dx.doi.org/10.1136/bmj.l4693 factors, a first pregnancy was associated with a investigate the association between pregnancy
Accepted: 4 July 2019 noticeably reduced risk of endometrial cancer, duration and risk of endometrial cancer. The
whether it ended in induced abortion (adjusted nationwide cohort comprised 2.3 million women
relative risk 0.53 (95% confidence interval 0.45 followed from January 1978 to December 2014 who
to 0.64) or childbirth (0.66, 0.61 to 0.72). Each had more than 670 000 induced abortions and 3.2
subsequent pregnancy was associated with an million births.
additional reduction in risk, whether it ended in
induced abortion (0.81, 0.77 to 0.86) or childbirth
Methods
(0.86, 0.84 to 0.89). Duration of pregnancy, age at
Population cohort
pregnancy, spontaneous abortions, obesity, maternal
Since 1 April 1968 the Danish Civil Registration
birth cohort, fecundity, and socioeconomic factors
System has assigned a unique identification number
did not modify the results.
to all Danish residents who were alive on that date or
CONCLUSIONS born thereafter. In addition, the register contains
The risk of endometrial cancer is reduced regardless
detailed personal information on all Danish residents,
of whether a pregnancy ends shortly after conception
including linkage of women to their children’s dates of
or at 40 weeks of gestation. This reduction in risk
birth. Using the unique identification numbers, we
could be explained by a biological process occurring
created a population based cohort of all Danish
within the first weeks of pregnancy, as pregnancies
women and their pregnancies by linking data from the
ending in induced abortions were associated with
Civil Registration System with data from the National
similar reductions in risk as pregnancies ending in
Registry of Induced Abortions and the Medical Birth
childbirth.
Registry.
Study variables
Since 1939 it has been mandatory in Denmark to
report information on induced abortions to the
WHAT IS ALREADY KNOWN ON THIS TOPIC National Registry of Induced Abortions, including
The lifetime number of births is associated with a reduction in risk of the date of the procedure and the week of gestation.
endometrial cancer
Induced abortions were only permitted for medical or
other specified reasons until 1973. Thereafter,
The number of menstrual cycles suppressed by pregnancy has been suggested
induced abortion until the end of the 12th week of
to be protective
gestation became legalised. Childbirths in Denmark,
WHAT THIS STUDY ADDS including dates of birth, have been registered since
1973 in the Medical Birth Registry, and gestational
This study found that the risk of endometrial cancer is reduced regardless of
week at time of birth has been recorded from 1978.
whether a woman’s pregnancy ends shortly after conception or at 40 weeks
From Statistics Denmark we acquired time varying,
This finding strongly suggests that factors early in gestation are responsible
the the| BMJ
forbmj 2019;366:l4693
reduction in risk | doi: 1
individual level
socioeconomic data to
address factors
2 doi: 10.1136/bmj.l4693 | BMJ 2019;366:l4693 | the

RESEARCH
potentially associated with reproductive choices and

between time and the three socioeconomic variables
cancer risk: educational attainment, marital status,
(see supplementary appendix).
and urbanicity (see supplementary appendix).
Pregnancy history was modelled as described
From the Danish National Patient Registry we
previously,17 with the effect of each pregnancy
acquired information on hospital diagnostic codes
estimated as the effect of the pregnancy compared
for obesity and non-malignant endometrial and
with one pregnancy less (ie, relative risk of
ovarian diseases. We also obtained information on
endometrial cancer for one pregnancy compared with
hysterectomies and bilateral oophorectomies, as
0, two compared with one, three compared with
registered by the Danish Classification of Surgical
two, and so on), where a pregnancy could result in
Procedures and Therapies from 1977 to 1995 and by
either an induced abortion or birth. This
the Nordic Medico-Statistical Committee Classification
parameterisation allows for a focus on the effect of
of Surgical Procedures from 1996 (see supplementary
each additional pregnancy. In additional analyses, we
appendix). The Danish National Patient Registry
assumed relative risks to be the same for all
also holds information on spontaneous abortions
pregnancies after the first pregnancy. To investigate
that resulted in clinical contact13 from 1977, but
whether the effect of induced abortions and
the registry does not hold detailed information on
childbirths varied by pregnancy duration (≤5 weeks,
gestational week for these pregnancies.
6-7 weeks, 8-9 weeks, 10-11 weeks, ≥12 weeks for
Information on endometrial cancer and other
induced abortions, and <37 weeks, ≥37 weeks for
cancer diagnoses was collected from the Danish
childbirths), age at pregnancy (<30 years, ≥30 years),
Cancer Registry, which contains details on cancers
time since pregnancy (<10 years, ≥10 years), and
diagnosed in Denmark since 1943 and is considered
attained age (<50 years, ≥50 years), we allowed the
close to complete.14 Endometrial cancer was defined
relative risks to vary by these factors.
by ICD-10 (international classification of diseases,
In sensitivity analyses we also considered potential
10th revision) codes C54-55 in combination with an
confounding effects of obesity and oral contraceptives
endometrial cancer histological subtype by relevant
use. For this we investigated the effects of pregnancy
ICD-O-3 (international classification of diseases for
on risk of endometrial cancer in subcohorts by clinical
oncology, third edition) code (see supplementary
diagnosis of obesity and birth cohort, respectively.
appendix). Information on cancer stage (grouped
Additionally, to investigate whether the effects of
using FIGO (International Federation of Gynecology
induced abortions and births were modified by previous
and Obstetrics) classification15) and cancer subtype
induced abortions and births, we analysed the relative
(by previously used grouping of subtype histology 16)
risk of endometrial cancer among parous women
was also retrieved from the Danish Cancer Registry.
stratified by the number of induced abortions (0, 1, or
≥2) and births (1, 2, 3, or ≥4). Uniparous women with
Participants
no induced abortions were used as reference.
We established a cohort of all Danish women
Finally, to explore potential effects of fecundity, we
born between 1 January 1935 and 31 December
estimated the relative risk of endometrial cancer after
2002. Using the Danish Civil Registration System
a pregnancy (including both induced abortions and
identification number, we linked information on
births) compared with one pregnancy less by age at
each woman’s pregnancies with the corresponding
and time since any pregnancy. In these analyses, age
pregnancy type (ie, gestational week of every
at pregnancy was stratified by less than 25 years, 25-
induced abortion) and duration (gestational week of
29 years, 30-34 years, and 35 or more years, whereas
delivery for every birth), and information on whether
time since pregnancy was stratified by less than 10
she developed endometrial cancer. Women were
years, 10-19 years, 20-29 years, and 30 or more years.
followed from 1 January 1978, or from their 12th
In addition, we created a high fecundity subcohort,
birthday, whichever came later, until endometrial
which was defined as women with three or more
cancer, death, emigration, or 31 December 2014,
pregnancies and a maximum of five years between
whichever came first. We censored on cancer before
their first and third pregnancy.
start of follow-up, first diagnosis of any other cancer
All tests were likelihood ratio tests. Analyses were
(excluding non-melanoma skin cancer), time of
performed using SAS procedure GENMOD.
hysterectomy (including hystero-oophorectomy), and
time of bilateral oophorectomy.
Patient and public involvement
No patients were involved in setting the research
Statistical analyses
question, outcome measures, the study design, or
We used log-linear Poisson regression to estimate
the conduct of the study. The results of the study will
incidence rate ratios (relative risks) of endometrial
be disseminated to the public, patients, and health
cancer by pregnancy type. Analyses were adjusted for
professionals by various media sources: press
effects of attained age and time in five year categories,
releases written using layman’s terms, social media
in addition to interaction between age and time.
postings, and scientific conferences.
Analyses, except when otherwise stated, were
adjusted for pregnancy history, educational
Results
attainment, marital status, and urbanicity, in addition
The cohort included 2 311 332 Danish women who
to interaction
were followed for 57 347 622 person years (average
the bmj | BMJ 2019;366:l4693 | doi: 3

RESEARCH
of 24.8 years of follow-up per woman). The women

(P=0.69), when stratifying by time since pregnancy
had 3 947 650 pregnancies, of which 671 560 were
(table 3), no effect modification was found on the
induced abortions and 3 276 090 were births. The
association between pregnancy type and endometrial
median gestational weeks of pregnancies that ended
cancer (P=0.94), and when stratifying by attained
in induced abortion was 8 (interquartile range 7-9
age (table 3), no effect modification was found on the
weeks), whereas the median gestational weeks of
association between pregnancy type and endometrial
pregnancies that ended in birth was 40 (39-41
cancer (P=0.13). In addition, we performed analyses
weeks). During follow-up, 6743 women developed
of the effect of pregnancy type on risk of endometrial
endometrial cancer. Supplementary table S1 shows
cancer by cancer stage and subtype (table 4), by
the number of endometrial cancer events and person
adjustment for non-malignant endometrial and
years according to number of induced abortions,
ovarian disease (see supplementary table S3), and
number of births, age at first pregnancy, age at latest
by degree of adjustment for socioeconomic factors
pregnancy, duration of latest pregnancy, time since
(see supplementary table S4), and a similar pattern
latest pregnancy, birth cohort, and socioeconomic
of no difference was observed in the association of
factors.
induced abortions and births with risk of endometrial
Table 1 shows the relative risk of endometrial
cancer. Nevertheless, for type II endometrial cancers
cancer after any pregnancy compared with one
no statistically significant reduction in risk was found
pregnancy less by type of pregnancy. We found that
by each additional pregnancy. This finding could be
both induced abortions and births were associated
attributable to the limited number of cases of this
with a reduced risk of endometrial cancer, with a
cancer subtype.
particularly strong risk reduction after the first
We carried out an analysis limited to only parous
pregnancy (relative risk reduction around 40%). For
women (≥1 birth), with uniparous women with no
the first pregnancy, an induced abortion was
induced abortions as reference, to investigate the
associated with a slightly larger risk reduction than a
effect of number of childbirths stratified by number
birth, but for subsequent pregnancies the association
of induced abortions (fig 1). The results also indicate
did not differ (P=0.25). However, for pregnancies
a protective effect on risk of endometrial cancer by
taking place in the same period (from 1973 when
both each additional childbirth and each additional
induced abortion was legalised in Denmark), induced
induced abortion, in a dose-response manner.
abortions and births were associated with the same
Obesity is a strong risk factor for endometrial
risk reduction in endometrial cancer for both the first
cancer. In a subcohort of 110 567 women who had
(P=0.50) and any subsequent pregnancy (P=0.41) (see
been characterised as clinically obese in hospital
supplementary table S2). The pattern was the same
registers (see supplementary table S5), no difference
when stratifying further by duration of pregnancy
was found in the association between pregnancy type
(table 2).
and risk of endometrial cancer (P=0.90), with
When stratifying by age at pregnancy (table 3),
estimates similar to those in the complete cohort. To
no effect modification was found on the association
explore a
between pregnancy type and endometrial cancer
Table 1 | Relative risk of endometrial cancer after a pregnancy compared with having one pregnancy less by pregnancy
number and type
Relative risk (95% CI)
Pregnancy No and type Adjusted for age and period* Adjusted for age, period, and socioeconomic factors*†
First pregnancy
Induced abortion 0.52 (0.44 to 0.62) 0.53 (0.45 to 0.64)
Childbirth 0.66 (0.61 to 0.71) 0.66 (0.61 to 0.72)
Any subsequent
Childbirth 0.88 (0.85 to 0.90) 0.86 (0.84 to 0.89)
Second pregnancy:
Childbirth 0.85 (0.79 to 0.91) 0.83 (0.77 to 0.89)
Third pregnancy:
Childbirth 0.86 (0.80 to 0.92) 0.84 (0.78 to 0.90)
Fourth pregnancy:
Childbirth 0.92 (0.81 to 1.04) 0.91 (0.80 to 1.03)
Fifth pregnancy:
Childbirth 0.92 (0.72 to 1.16) 0.91 (0.72 to 1.16)
*Adjusted for age, period, pregnancy history, and interaction between age and period.
†Additionally adjusted for educational attainment, marital status, urbanicity, and interaction between period and educational attainment, marital status,
and urbanicity, respectively. P value for difference between induced abortion and childbirth for risk of endometrial cancer, adjusted for age, period,
and socioeconomic factors, are 0.07 (relative risk 0.53 v 0.66) and 0.25 (0.81 v 0.86), respectively, for first and any subsequent pregnancy. Test for
difference between model with different effect of each pregnancy compared with model with same effect for all pregnancies after the first pregnancy gave
P=0.99. Sensitivity analysis with start of follow-up from 20 years of age presented in supplementary table S9 gave identical results.
4 doi: 10.1136/bmj.l4693 | BMJ 2019;366:l4693 | the

RESEARCH
Table 2 | Relative risk of endometrial cancer after a pregnancy compared with having supplementary table S6). No difference was found in
one pregnancy less by pregnancy number and type, stratified by weeks of gestation the association by birth cohort. Furthermore, when
Pregnancy No, type, and duration Adjusted relative risk (95% CI)* information on spontaneous abortions available from
First pregnancy† 1977 was included (see supplementary table S7), the
Induced abortion (weeks): association between induced abortions and births and
5 0.66 (0.30 to 1.48)
risk of endometrial cancer was not modified (P=0.08).
6-7 0.56 (0.43 to 0.73)
8-9 0.54 (0.41 to 0.70)
Lastly, to explore the potential effects of fecundity,
10-11 0.46 (0.29 to 0.71) we investigated the association between any
12 0.59 (0.24 to 1.41) pregnancy (including both induced abortions and
Childbirth (weeks): childbirths) and risk of endometrial cancer. The
36 0.61 (0.44 to 0.85) protective association between pregnancy and risk of
37 0.49 (0.43 to 0.55)
endometrial cancer was more pronounced for
Any subsequent†
Induced abortion (weeks): pregnancies at an older age (see supplementary fig
5 0.71 (0.49 to 1.02) S1A) and shorter time since pregnancy (see
6-7 0.75 (0.68 to 0.83) supplementary fig S1B), with any subsequent
8-9 0.84 (0.76 to 0.92) pregnancy associated with an 11% (95% confidence
10-11 0.93 (0.80 to 1.08)
interval 6% to 15%) risk reduction before age 25
12 0.81 (0.51 to 1.28)
Childbirth (weeks): compared with 25% (20% to 30%) after age 35, and
36 0.87 (0.70 to 1.10) with a 52% (43% to 60%) risk reduction within the
37 0.73 (0.69 to 0.78) first 10 years after pregnancy compared with a
*Adjusted for age, period, educational attainment, marital status, urbanicity, and interaction between period and 10% (7% to 13%) risk reduction after 30 or more years.
age, educational attainment, marital status, and urbanicity, respectively.
†Test for difference in fit when stratifying by gestational duration of pregnancy as in table 2, compared with In a high fecundity subcohort consisting of women
stratification only by pregnancy type as in table 1, P=0.98. with three or more pregnancies who had less than
five years between their first and third pregnancy (see
supplementary table S8), an additional pregnancy had
potential confounding effect of oral contraceptive
a similar effect to that in other women also with three
use, the association between pregnancy type and
pregnancies.
risk of endometrial cancer was investigated among
women from several birth cohorts, with different
Discussion
possible lifetime use of oral contraceptive use (see
In a nationwide cohort study of pregnancy duration
and risk of endometrial cancer, using information
from 2.3 million women with more than 670 000
Table 3 | Relative risk of endometrial cancer after a pregnancy compared with having induced abortions and 3.2 million childbirths, a
one pregnancy less by pregnancy number and type, stratified by age at pregnancy,
strong protective association was found between
time since pregnancy, and attained age at diagnosis
first pregnancy and risk of endometrial cancer, with
Pregnancy No and type Adjusted relative risk (95% CI)*
additional protection from each subsequent
Age at pregnancy† <30 years ≥30 years
First pregnancy: pregnancy. The protective association was equivalent
Induced abortion 0.59 (0.48 to 0.72) 0.42 (0.30 to 0.61) for induced abortions and childbirths.
Childbirth 0.67 (0.62 to 0.73) 0.61 (0.55 to 0.69)
Any subsequent: Possible explanation for findings
Childbirth 0.89 (0.86 to 0.92) 0.79 (0.75 to 0.83)
Our findings contrast with the current understanding
Time since pregnancy‡ 10 years 10 years of the cause of endometrial cancer, which is centred
First pregnancy: around the unopposed oestrogens hypothesis,
Induced abortion 0.36 (0.13 to 0.97) 0.56 (0.47 to 0.67) whereby the risk of endometrial cancer increases
Childbirth 0.33 (0.23 to 0.50) 0.68 (0.62 to 0.73) with number of menstrual years (from menarche to
Any subsequent:
menopause) and decreases with years of pregnancy
Childbirth 0.45 (0.36 to 0.56) 0.87 (0.84 to 0.90) and oral contraceptive use.7 10 18 19 20 However, a study
Attained age§ 50 years 50 years found that each additional year of pregnancy was
First pregnancy: associated with a 22% risk reduction in risk of
Induced abortion 0.40 (0.28 to 0.56) 0.61 (0.49 to 0.75) endometrial cancer, whereas both each additional
Childbirth 0.42 (0.35 to 0.51) 0.73 (0.67 to 0.80)
year of oral contraceptive use and each year of
Any subsequent:
delayed menarche or advanced menopause were
Childbirth 0.73 (0.67 to 0.81) 0.88 (0.85 to 0.91) associated with only around an 8% risk reduction,5
*Adjusted for age, period, educational attainment, marital status, urbanicity, and interaction between period and indicating that a pregnancy affects a woman’s risk of
age, educational attainment, marital status, and urbanicity, respectively. Test for difference in fit when stratifying endometrial cancer through a different mechanism
by age at pregnancy, time since pregnancy, and attained age, respectively, compared with analysis in table 1,
P=0.69, P=0.94, and P=0.13, respectively. than number of menstrual years.
†5215 events and 32 745 464 person years among women with a pregnancy before age 30 years, and 2462 Two underlying mechanisms could explain our
events and 15 465 953 person years among women with a pregnancy at or after age 30 years.
‡123 events and 16 813 543 person years among women with less than 10 years since pregnancy, and 5681 finding. Foremost, the association could be due to a
events and 26 026 430 person years among women with less than 10 years since pregnancy. fecundity effect, whereby the number of pregnancies
§929 events and 46 156 519 person years among women aged less than 50 years, and 5814 events and
11 191 103 person years among women aged 50 or more years. is a proxy for a woman’s ability to become pregnant,
and thereby a healthy endometrium and endocrine
system. Several observations argue against this idea
the bmj | BMJ 2019;366:l4693 | doi: 5

however.
6 doi: 10.1136/bmj.l4693 | BMJ 2019;366:l4693 | the

RESEARCH
Table 4 | Relative risk of endometrial cancer after a pregnancy compared with having one pregnancy less by pregnancy
number and type, by cancer stage and cancer subtype*
Adjusted relative risk (95% CI)†
Cancer stage‡ Cancer subtype§
Pregnancy No and type Stage I Stage II-IV Type I Type II
No of events 2968 1021 6203 485
First pregnancy:
Induced abortion 0.51 (0.40 to 0.64) 0.73 (0.53 to 1.02) 0.53 (0.44 to 0.63) 0.70 (0.38 to 1.31)
Childbirth 0.70 (0.62 to 0.79) 0.63 (0.52 to 0.76) 0.67 (0.61 to 0.72) 0.62 (0.45 to 0.87)
Any subsequent:
Induced abortion 0.86 (0.80 to 0.93) 0.80 (0.70 to 0.91) 0.81 (0.76 to 0.86) 0.84 (0.68 to 1.03)
Childbirth 0.89 (0.85 to 0.93) 0.91 (0.84 to 0.97) 0.84 (0.82 to 0.87) 1.09 (0.98 to 1.21)
*Analyses by competing risks between stage/subtype groups and other cancers.
†Adjusted for age, period, educational attainment, marital status, urbanicity, and interaction between period and age, educational attainment, marital
status, and urbanicity, respectively.
‡Analysis of cancer stage included 19 721 829 person years and was based on follow-up time from 2004. Missing stage and low stage were grouped
together. Sensitivity analysis on cancer stage based events only after implementation of the 2009 FIGO revision of stage is presented in supplementary
table S10.
§Analysis of cancer subtype included 57 348 802 person years and was based on follow-up time from 1978. The few endometrial cancers not grouped in
type I and type II was included in the analysis as a separate outcome (see supplementary methods for definitions of endometrial cancer subtypes).
Firstly, we found no difference in the effect of a an additional pregnancy and risk of endometrial
woman’s second to fifth pregnancy, with each cancer was similar to that among other women with
pregnancy having a similar protective effect, rather the same number of pregnancies. Finally, a large
than a trend whereby each additional pregnancy was collaborative study from the Endometrial Cancer
associated with a lower risk reduction for endometrial Consortium EC2C found a strong protective effect of
cancer. Secondly, when we examined the effect of an parity even after adjusting for self reported
additional pregnancy in our high fecundity subcohort, infertility,11 which also argues against fecundity
the association between explaining the association between number of
pregnancies and risk of endometrial cancer. Taken
No of induced abortions together, these findings point to an early gestational
0 1 ≥2 effect, present in the first weeks after conception, to
1.00 be the most likely underlying mechanism responsible
Relative
for the protective effect of pregnancy on risk of

0.75 endometrial cancer.
A plausible explanation for an early gestational
0.50 effect is the rapid increase of the progesterone to
oestrogen ratio in the first weeks after conception, when
progesterone levels increase more than threefold and
oestrogen levels increase only modestly. 21 In support
of this hypothesis, the Norwegian Women and Cancer
0.25
(NOWAC) prospective cohort study of 104 318 women
1 2 3 ≥4 recently found that the risk of endometrial cancer in
No of childbirths ever users of progesterone intrauterine devices (LNG-
0 induced abortions IUS) was only 22% (95% confidence interval 13% to
Events 40%) compared with never users in a multivariable
1001 2505 1006 332
Person years (000s) analysis adjusted for oral contraceptive use, parity,
6681 13 266 5012 1464 body mass index, and other potential confounders.22
In addition, multiple studies have found a favourable
1 induced abortion effect of progesterone treatment for both endometrial
Events
hyperplasia—a precursor for endometrial cancer—
121 336 162 51 and low stage endometrial cancer.23 24
Person years (000s)
1388 2847 1208 361
Strengths and limitations of this study
≥2 induced abortions
Events We used a Danish nationwide cohort design with
follow-up spanning four decades. Furthermore,
39 63 39 10
Person years (000s) given our access to prospectively registered clinical
528 956 459 160 information on both induced abortions and births
(including duration of pregnancy), we avoid recall
Fig 1 | Relative risk of endometrial cancer among parous women (≥1 birth) by number bias, which is known to introduce biases when
of induced abortions and births, with uniparous women with no induced abortions
investigating the effects of induced abortion.25
as reference. Estimates are adjusted for age, period, educational attainment, marital
status, urbanicity, and interaction between period and age, educational attainment, We also investigated the effect of potential
marital status, and urbanicity, respectively. Events and person years (in 1000s) are important confounders such as obesity, birth cohort,
given for each number of induced abortion and birth. Test for interaction between marital status, educational attainment, and urbanicity,
induced abortions and births, P=0.92 and found no indications of confounding on the
association
the bmj | BMJ 2019;366:l4693 | doi: 7
RESEARCH
between pregnancy duration and risk of endometrial

the data analysis, and the finished article. The corresponding author
cancer. However, we did not have information on attests that all listed authors meet authorship criteria and that no
lifetime use of oral contraceptives, which has been others meeting the criteria have been omitted.
associated with a decreased risk of endometrial Funding: This study was supported by Helsefonden (grant No 16-B-
cancer 26 and potentially could explain the association 0257 to AH), Anita og Tage Therkildsens Fond (grant No 100039 to
AH), and the Danish Cancer Society (grant No R167-A10791 to AH
between induced abortions and reduced risk of and MM). Neither funder played any role in the design or conduct
endometrial cancer. Nevertheless, two findings argue of the study. All researchers acted independently from the study
against this assumption. Firstly, we found no sponsors in all aspects of the study.
difference in the effect of induced abortion and Competing interests: All authors have completed the ICMJE uniform
disclosure form at www.icmje.org/coi_disclosure.pdf and declare:
childbirth on risk of endometrial cancer in different support from Helsefonden, Anita og Tage Therkildsens Fond, and
birth cohorts (see supplementary table S6), despite the Danish Cancer Society; no financial relationships with any
different possible lifetime use of oral contraceptives, organisations that might have an interest in the submitted work in the
previous three years; no other relationships or activities that could
which were available in Denmark from 1966 (see appear to have influenced the submitted work.
supplementary fig S2). Secondly, most of the previous Ethical approval: As the study was based on deidentified information
studies on endometrial cancer that adjusted for oral form the Danish national registers and as study participants are never
contraceptive use found indications of a risk reducing contacted, consent from the Danish research bioethics committees
effect of induced abortions on risk of endometrial are not required. The study’s use of register data was covered by the
approval from the Danish Data Protection Agency for register based
cancer.4 6 7 9 10 Furthermore, our estimates of the studies conducted by Statens Serum Institut (approval No 2015-57-
pregnancy effect on risk of endometrial cancer were 0102).
more similar when we focused on pregnancies in the Data sharing: The data used in the study can be obtained by
same period (see supplementary table S2). This submitting a research protocol to the Danish Data Protection Agency
(Datatilsynet) and, if permission is granted, by applying to the Ministry
observation suggests that the marginally smaller risk of Health’s Research Service (Forskerservice) and Statistics Denmark
reduction by births compared with induced abortions (Danmarks Statistik) for access to the data. The data therefore do not
(table 1) likely is explained by confounding from oral belong to the authors and they are not permitted to share data, except
in aggregate form.
contraceptive use, as a proportion of the births
The guarantor (AH) affirms that the manuscript is an honest,
occurred before the introduction of oral accurate, and transparent account of the study being reported; that
contraceptives. no important aspects of the study have been omitted; and that any
Spontaneous abortions were associated with less discrepancies from the study as planned (and, if relevant, registered)
have been explained.
reduction in risk of endometrial cancer than induced
This is an Open Access article distributed in accordance with the
abortions and births. However, spontaneous Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license,
abortions represent a heterogeneous group of which permits others to distribute, remix, adapt, build upon this work
unhealthy pregnancies in contrast with induced non-commercially, and license their derivative works on different
terms, provided the original work is properly cited and the use is non-
abortions and births, which primarily are healthy
commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.
pregnancies. In addition, studies report that
pregnancies resulting in spontaneous abortion have 1 Fitzmaurice C, Dicker D, Pain A, et al, Global Burden of Disease
Cancer Collaboration. The Global Burden of Cancer 2013.
low levels of gestational hormones (including JAMA Oncol 2015;1:505-27.
progesterone),27 28 which could explain the weaker doi:10.1001/jamaoncol.2015.0735
association between spontaneous abortions and risk 2 Morice P, Leary A, Creutzberg C, Abu-Rustum N, Darai E. Endometrial
cancer. Lancet 2016;387:1094-108. doi:10.1016/S0140-
of endometrial cancer. 6736(15)00130-0
3 Albrektsen G, Heuch I, Tretli S, Kvåle G. Is the risk of cancer of the
corpus uteri reduced by a recent pregnancy? A prospective
Conclusions and implications study of 765,756 Norwegian women. Int J Cancer 1995;61:485-
Our study shows that the protective association between 90. doi:10.1002/ijc.2910610410
pregnancy and endometrial cancer is equivalent for 4 Brinton LA, Berman ML, Mortel R, et al. Reproductive, menstrual,
and medical risk factors for endometrial cancer: results from a
pregnancies resulting in induced abortion and birth, case-control study. Am J Obstet Gynecol 1992;167:1317-25.
and thus suggests that the association is attributable doi:10.1016/S0002-9378(11)91709-8
5 Dossus L, Allen N, Kaaks R, et al. Reproductive risk factors and
to a woman’s underlying fecundity or a biological endometrial cancer: the European Prospective Investigation into
process occurring early in gestation. The findings Cancer and Nutrition. Int J Cancer 2010;127:442-51. doi:10.1002/
from our study and others support an early ijc.25050
6 Kalandidi A, Tzonou A, Lipworth L, Gamatsi I, Filippa D,
gestational process, as each additional pregnancy was Trichopoulos D. A case-control study of endometrial cancer in
associated with a reduction in risk of endometrial relation to reproductive, somatometric, and life-style variables.
Oncology 1996;53:354-9. doi:10.1159/000227587
cancer, and because adjustment for infertility did not 7 McPherson CP, Sellers TA, Potter JD, Bostick RM, Folsom AR.
explain the effect of parity on risk. Future research is Reproductive factors and risk of endometrial cancer. The Iowa
of great importance as it could lead to insights into Women’s Health Study. Am J Epidemiol 1996;143:1195-202.
doi:10.1093/oxfordjournals.aje.a008707
early gestational factors that potentially could 8 Parazzini F, Negri E, La Vecchia C, et al. Role of reproductive factors
facilitate the prevention of endometrial cancer. on the risk of endometrial cancer. Int J Cancer 1998;76:784-6.
doi:10.1002/(SICI)1097-0215(19980610)76:6<784::AID-
IJC2>3.0.CO;2-U
Contributors: AH conceived the study, contributed to the study 9 Parslov M, Lidegaard O, Klintorp S, et al. Risk factors among
design, classified register data, and performed statistical analysis, young women with endometrial cancer: a Danish case-control
interpreted the study results, drafted the manuscript, and is the study.
guarantor of the study. JW contributed to the study design, planned Am J Obstet Gynecol 2000;182:23-9.
statistical analysis, oversaw the conduct of the statistical analysis, doi:10.1016/S0002- 9378(00)70486-8
interpreted the study results, and revised the manuscript. MM take full responsibility for the integrity
contributed to the study design, interpreted the study results, and of the data, the accuracy of
revised the manuscript. All authors had access to all of the data and
8 doi: 10.1136/bmj.l4693 | BMJ 2019;366:l4693 | the

10 Pocobelli G, Doherty JA, Voigt LF, et al. Pregnancy history and risk of
endometrial cancer. Epidemiology 2011;22:638-45. doi:10.1097/ EDE.0b013e3182263018
11 Yang HP, Cook LS, Weiderpass E, et al. Infertility and incident endometrial cancer risk: a pooled
analysis from the epidemiology of
the bmj | BMJ 2019;366:l4693 | doi: 9

RESEARCH
endometrial cancer consortium (E2C2). Br J Cancer 2015;112:925-

33. doi:10.1038/bjc.2015.24 22 Jareid M, Thalabard J-C, Aarflot M, Bøvelstad HM, Lund E, Braaten T.
12 Setiawan VW, Pike MC, Karageorgi S, et al. Australian National Levonorgestrel-releasing intrauterine system use is associated with a
Endometrial Cancer Study Group. Age at last birth in relation to decreased risk of ovarian and endometrial cancer, without increased
risk of endometrial cancer: pooled analysis in the epidemiology risk of breast cancer. Results from the NOWAC Study. Gynecol
of Oncol 2018;149:127-32. doi:10.1016/j.ygyno.2018.02.006
endometrial cancer consortium. Am J Epidemiol 2012;176:269-78. 23 Gunderson CC, Fader AN, Carson KA, Bristow RE. Oncologic and
doi:10.1093/aje/kws129 reproductive outcomes with progestin therapy in women with
13 Lohse SR, Farkas DK, Lohse N, et al. Validation of spontaneous endometrial hyperplasia and grade 1 adenocarcinoma: a systematic
abortion diagnoses in the Danish National Registry of Patients. review. Gynecol Oncol 2012;125:477-82. doi:10.1016/j.
Clin Epidemiol 2010;2:247-50. doi:10.2147/CLEP.S13815 ygyno.2012.01.003
14 Storm HH, Michelsen EV, Clemmensen IH, Pihl J. The 24 Ørbo A, Vereide A, Arnes M, Pettersen I, Straume B. Levonorgestrel-
Danish Cancer Registry--history, content, quality and use. impregnated intrauterine device as treatment for endometrial
Dan Med Bull 1997;44:535-9. hyperplasia: a national multicentre randomised trial.
15 Pecorelli S. Revised FIGO staging for carcinoma of the vulva, BJOG 2014;121:477-86. doi:10.1111/1471-0528.12499
cervix, and endometrium. Int J Gynaecol Obstet 2009;105:103- 25 Lindefors-Harris B-M, Eklund G, Adami H-O, Meirik O. Response
4. doi:10.1016/j.ijgo.2009.02.012 bias in a case-control study: analysis utilizing comparative data
16 Mørch LS, Kjaer SK, Keiding N, Løkkegaard E, Lidegaard Ø. The concerning legal abortions from two independent Swedish studies.
influence of hormone therapies on type I and II endometrial Am J Epidemiol 1991;134:1003-8. doi:10.1093/oxfordjournals.aje.
cancer: A nationwide cohort study. Int J Cancer 2016;138:1506- a116173
15. doi:10.1002/ijc.29878 26 Collaborative Group on Epidemiological Studies on Endometrial
17 Wohlfahrt J, Melbye M. Age at any birth is associated with breast Cancer. Endometrial cancer and oral contraceptives: an individual
cancer risk. Epidemiology 2001;12:68-73. doi:10.1097/00001648- participant meta-analysis of 27 276 women with endometrial
200101000-00012 cancer from 36 epidemiological studies. Lancet Oncol
18 Key TJ, Pike MC. The dose-effect relationship between ‘unopposed’ 2015;16:1061-70. doi:10.1016/S1470-2045(15)00212-0
oestrogens and endometrial mitotic rate: its central role in explaining 27 Johnson MR, Riddle AF, Sharma V, Collins WP, Nicolaides KH,
and predicting endometrial cancer risk. Br J Cancer 1988;57:205-12. Grudzinskas JG. Placental and ovarian hormones in anembryonic
doi:10.1038/bjc.1988.44 pregnancy. Hum Reprod 1993;8:112-5. doi:10.1093/oxfordjournals.
19 Weiderpass E, Adami H-O, Baron JA, et al. Risk of endometrial cancer humrep.a137857
following estrogen replacement with and without progestins. J Natl 28 Whittaker PG, Schreiber CA, Sammel MD. Gestational hormone
Cancer Inst 1999;91:1131-7. doi:10.1093/jnci/91.13.1131 trajectories and early pregnancy failure: a reassessment. Reprod Biol
20 Gavrilyuk O, Braaten T, Weiderpass E, Licaj I, Lund E. Lifetime Endocrinol 2018;16:95. doi:10.1186/s12958-018-0415-1
number of years of menstruation as a risk index for postmenopausal
endometrial cancer in the Norwegian Women and Cancer Study.
Acta
Obstet Gynecol Scand 2018;97:1168-77. doi:10.1111/aogs.13381 Supplementary information: additional information
21 Liu J. Endocrinology of Pregnancy. In: Creasy RK, Resnik R, Iams on methods and materials, demographic information,
JD, Lockwood CJ, Moore TR, Greene MF, eds. Creasy and Resnik’s
Maternal-Fetal Medicine: Principles and Practice. 7th ed. Saunders, in addition to sensitivity analyses
2014: 100-11.
1 doi: 10.1136/bmj.l4693 | BMJ 2019;366:l4693 | the

No commercial reuse: See rights and reprints http://www.bmj.com/permissions Subscribe:
The Breast 63 (2022) 168–176
The Breast
journal homepage: www.journals.elsevier.com/the-
“Alas … my sickness becomes my family’s burden”: A nested qualitative

study on the experience of advanced breast cancer patients across the
disease trajectory in Indonesia
a, b b c c
Tayi Suryo Prabandari , Wika Hartanti , Syafriani , Mentari Widiastuti ,
d e f, *
Riani Witaningrum , Susanna Hilda Hutajulu , Matthew John Allsop
a
Department of Health Behavior, Environment and Social Medicine, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Indonesia
b
Center of Bioethics and Medical Humanities, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Indonesia
c
Center of Health Behavior and Promotion, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada, Indonesia
d
Division of Hematology and Medical Oncology, Department of Internal Medicine, Dr. Sardjito General Hospital, Yogyakarta, Indonesia
e
Division of Hematology and Medical Oncology, Department of Internal Medicine, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada/Dr. Sardjito
General Hospital, Yogyakarta, Indonesia
f
Academic Unit of Palliative Care, Leeds Institute of Health Sciences, University of Leeds, U7
A B S T R A C T
7eywords:
Breast cancer Introduction: Limited research exists exploring the experience of living with advanced breast cancer in
Qualitative Indonesia. We sought to explore the narratives of women with breast cancer across the illness trajectory to
Indonesia understand their experiences from diagnosis to accessing and undergoing cancer treatments to inform the
Chemotherapy development of cancer care.
Illness trajectory Methods: A nested, exploratory study adopting a qualitative approach. We conducted in-depth face-to-face in-
terviews with women living with advanced breast cancer in Togyakarta, Indonesia. We purposively
sampled participants by age, education and marital status. All interviews were transcribed verbatim with
thematic analysis used to identify, analyse and report patterns and themes within the data.
Findings: Four main themes were derived: 1) Early experiences, prior to accessing health care; 2) Navigating
the system to access treatment; 3) Enduring chemotherapy and advancing disease, with crucial family support;
4) Seeking normalcy and belief in treatment. From initial symptoms through to undergoing treatments, the
experience of participants was punctuated by barriers and challenges.
Discussion: Presentation delays were driven by dismissing initial symptoms, seeking alternative medicines, and
fear of surgery. Access to healthcare required participants to contend with long-distance travel to facilities,
tiered and convoluted referral processes, and adverse effects and financial impact of treatments. Individual
determination, belief in God, and the role of families were critical throughout the disease trajectory. Adopting
a focus across the disease trajectory facilitated the identification of enduring and persistent challenges to care
delivery that can inform targeted development and optimisation of care delivery for women with breast cancer.
1. Intгodugtion
age-standardized incidence and mortality rates of breast cancer are 44
In 2020, there were an estimated 10 million cancer deaths and 15.3 per 100,000 population, respectively [4]. In the country, breast
globally, with 58.3% occurring in Asia [1]. Female breast cancer is cancer is mostly diagnosed at later stages [5,6] with low survival rates
the most commonly diagnosed cancer globally [1] with some of the [7]. From limited research, patient and service-level factors are being
highest breast cancer incidence and mortality rates occurring in Asian identified that may influence the timing of interaction with health ser-
countries including Indonesia [2,3]. In the context of Indonesia, vices and the common late presentation among breast cancer patients in
the Indonesia. For patients, delays in help-seeking are associated with the
* Corresponding author. ; @matthewallsop

E-mail addresses: yayisuryo@ugm.ac.id (T.S. Prabandari), wika.hartanti@mail.ugm.ac.id (W. Hartanti), syafriani.ny@gmail.com (Syafriani), mentari.widiastuti@
mail.ugm.ac.id (M. Widiastuti), rwitaningrum@gmail.com (R. Witaningrum), susanna.hutajulu@ugm.ac.id (S.H. Hutajulu), m.j.allsop@leeds.ac.uk (M.J. Allsop).
https://doi.org/10.1016/j.breast.2022.04.001
Received 17 December 2021; Received in revised form 17 March 2022; Accepted 1 April 2022
Available online 4 April 2022
0960-9776/O 2022 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BT license (http://creativecommons.org/licenses/by/4.0/).
Y.S. Prabandari et al. an interview, which was subsequently discussed with the wider research
team. Key points were described and compiled to support monitoring of
use of traditional or alternative treatments to alleviate breast cancer interview data during the data collection period. Although the extent of
symptoms [8,9]. The economic status of patients is also associated with new information being identified reduced
the timing of presentation to healthcare [10,11]. For example, whilst
cancer management is available and can be supported through the na-
tional universal insurance program, additional out-of-pocket
expenses can be incurred (such as transport, accommodation, and
logistics) which can inhibit patient presentation to health facilities
[10,11]. At the health service level, delays can be influenced by both
health professionals and the intricate, tiered referral pathways from
diagnosis to treatment [11]. The concept of an illness trajectory has
been explored previously for people living with chronic illnesses, such
as advanced cancer patients [12]. A trajectory can provide a
framework for exploring different phases of a disease as they are
experienced by people, from the initial identification of symptoms
through to the advanced stages and dying. From existing research,
there is emerging evidence to suggest that Indonesian patients with
breast cancer encounter difficulties throughout the trajectory of their
disease, from initial symptom identification to help-seeking and
undergoing treatment. When breast cancer patients initially
experience symptoms, they often first seek opinions from relatives
and peers, and mostly present at health care facilities when their
conditions have worsened [11]. Following diagnosis, breast cancer
treatment processes have also been reported to be complex and
inter- twined within the sociocultural context [10]. However,
Indonesian
women’s experience of accessing and receiving care for breast cancer
remains understudied, with research to date focusing on discrete frag-
ments of their illness. Studies across countries signify the need for a
holistic portrayal of breast cancer patients’ journey over the course
of diagnosis and treatment to understand the broader implications of
being
diagnosed with breast cancer [6]. This research aims to address this gap
in the literature for Indonesia, exploring the narratives of patients
with breast cancer to understand their experiences from diagnosis to
accessing and undergoing cancer treatments.
2. Mateгia1 and methods
2.1. Setting
This exploratory study adopted a qualitative approach with

women living with advanced breast cancer in Togyakarta, Indonesia.
This nested study was undertaken as part of a larger cohort study
on chemotherapy services at Dr. Sardjito Hospital, Togyakarta,
Indonesia. The
parent study was “Analyses of chemotherapy toxicities in breast cancer
patients, predicting risk factors and the influence on patients’ survival
and quality of life”. All participants in this study received first
line chemotherapy.
2.2. Sampling
Purposive sampling was adopted to recruit patient participants from

the parent study. Participants were eligible if they had metastatic breast
cancer, were not deemed too ill by the medical team to participate
and had been recruited to the parent study within 12 months prior to
data collection. A purposive sampling frame identified potential
participants with variation according to age, education level and
marital status. We sought to recruit up to 20 participants to provide
a diverse range of perspectives and experiences across the breast
cancer disease trajectory from our target population. The intended
sample size was informed by the concept of data saturation given
the purposive sampling approach adopted in this study [13]. Data
saturation involved monitoring incoming data from interviews to
determine a point at which little or no new information relevant to the
study objectives was emerging. This was achieved through the
interviewer summarising key aspects raised by a participant following
The Breast 63 (2022) 168–176 often experienced as a painless lump in the breast (quote 1). With the
growth of a lump sometimes accompanied by changing breast shape,
after the first ten interviews, we continued to the target sample to participants would typically explore self-care using herbal or
ensure maximum diversity across characteristics of the sampling traditional medicine approaches (quote 2). Most participants decided
frame. to seek medical care when symptoms worsened, including lumps
becoming
2.3. Data collection
Data collection started from June to November 2019 using

semi- structured face-to-face interviews. Project-specific consent
procedures were developed for this study, including detailed
information sheets relating to the planned interviews and an
additional consent form. Participants were approached through
screening of parent study participants. Those meeting the
eligibility criteria were approached by a member of the research
team to introduce this study. Potential participants were provided
with an information sheet detailing involvement in a nested
qualitative component of the parent study. Those who agreed to
participate completed a consent form prior to participation. All
participants were interviewed once and alone in a private room in
the cancer clinic at Dr. Sardjito Hospital, Togyakarta. Topic
guides developed by
the research team were used to guide exploration of participants’ ex-
periences of first symptoms, initial contact with health care
providers and other sources of support, factors influencing the
decision to seek support, and experiences of undergoing
treatments. All interviews were audio-recorded. Following an
interview, researchers made notes which were discussed as part of
research team meetings to inform the analysis process and monitor
data saturation. All interviews were later transcribed for
analysis supported by OpenCode software version 4.03.
2.4. Data analysis
We adopted thematic analysis to identify, analyse and report

patterns and themes within the data. We outline the process
adopted during analysis including the development of themes in Fig.
1. We followed the six stages of thematic analysis as outlined by
Braun and Clarke [14]. This included generating initial codes from
participant transcripts, grouping codes with similar semantic
meaning, from which codes were grouped together to form
themes. Themes were formed using explicit or surface meaning of
transcript content rather than through interpretation by the research
team. Themes were discussed and refined by the research team
until consensus was reached. We then adopted a thematic
network approach [15] to develop a schematic depicting how
principal themes and patterns aligned with the original questions.
The schematic was developed iteratively through discussion by
the research team. The study is reported in accordance with the
Consolidated criteria for reporting qualitative research (COREQ)
checklist [16].
3. Resu1ts
In total, 20 participants with metastatic breast cancer

participated with a description of participant characteristics
presented in Table 1. Interviews lasted a median of 31.41 min.
Four main themes were derived through analysis: 1) Early
experiences, prior to accessing health care; 2) Navigating the
system to access treatment; 3) Enduring chemotherapy and
advancing disease, with crucial family support; 4) Seeking
normalcy and belief in treatment. We have included quotations to
illustrate findings across the derived themes in Table 2. A
schematic depicting how principal themes and patterns aligned
with the original questions and with each other is shown in Fig.
2.
3.1. Early experiences, prior to accessing health care
All participants initially dismissed their earliest symptoms,

1
Y.S. Prabandari et al.
The Breast 63 (2022) 168–176
Tab1e 1
Tab1e 2
Characteristics of participants.
Illustrative quotes for the themes and sub-
themes.
Participant informants (total n = 20) n %
Sub Themes Illustrative quote
Age 40–49 10 50
Theme 1: Eaг1y expeгienges, pгioг to aggessing hea1th gaгe
50–59 6 30 Eaг1y signs and se1f-gaгe 1 “When I found the lump, I did not do
60–69 4 20 adopted duгing initia1 bгeast anything. I thought it was not that
gangeг symptoms serious. I did not feel pain. Even
Highest level of education Primary/junior high school 14 70 when I perform daily activities, I do
Senior high school/university 6 30 not feel pain or fatigue, no.”
Marital status Single 1 5 (Participant 13, 56 years old)
Widowed 1 5 2 “(initially) I wasn’t too concerned
Married 18 90 about the disease, as I’ve
consulted
Number of children 0 1 5 with the herbalist, and asked if the
1 3 15 disease could be managed in the
2 12 60 herbal clinic and whether we needed
3 or more 4 20 to get treated at the hospital. (The
Status of employment Housewife 10 50 herbalist said) ‘with God’s will, we
can treat the disease here, no need
to
Employed/self-employed outside the 9 45 go to the hospital.’ So, I (felt assured
home and) had no concern. (Participant 10,
No job 1 5 46 years old)”
3 “I ignored it for about 2 years. Then
Time since diagnosis (per 0 year 6 30 the lump got bigger and bigger to the
2019) 1 year 12 60 point that I started feeling pain. The
2 years 0 0 pain spread to this and this part. I
3 years 2 10 was terrified, (only) then I went to
Metastasis status Oligo metastasis 15 75 Hospital B.” (Participant 15, 54
Multiple metastases 5 25 years old)
4 “… I don’t feel it, ma’am … then …
Stage at initial diagnosis Stage III (locally advanced) 3 15
here … my heart is like being
Stage IV (metastatic disease) 17 85
squeezed, you know … it feels
congested … I think it’s because of
my stomach acid … The first time I
fatigued whilst undergoing treatment (quote 18). Some participants knew that … kept going to the
experienced severe pain during chemotherapy which affected district hospital once, twice, three
mobility and elevated blood pressure and required morphine for its times … but still didn’t get better.
Then I asked for a referral to a
management (quote 19). Participants also highlighted the high levels provisional general
of distress caused when considering possible outcomes from treatment hospital. Then you know … I was on
(quote 20), alongside being emotionally sensitive and dispirited, with the X-ray … it turned out that my
lungs were full of fluid … the
a few feeling
doctor said the fluid was coming
“like dying” when expressing their suffering (quote 21). out of my breast … which … had
Supportive and protective factors were reported by participants hit the
which facilitated coping with treatment. At an individual level, partic- motorcycle handlebar in the past”.
ipants coped with their illness through finding joy and spirituality, (Participant 18, 47 years old)
along 5 “I took alternative medicine … there
with incorporating alternative treatments alongside the medical was no improvement, Ma’am. The
approach. Some participants sought to divert negative thoughts through practitioner guaranteed this, this,
leisure activities such as listening to music and activities that made them this, but there was no improvement.
One of them sold the medicine for one
happy (quote 22). Participants also relied on their spirituality by million [rupiah] per package … but
praying and surrendering to God, holding the belief that cancer is a it’s pricey.” (Participant 08, 56 years
form of trial to be endured which strengthened hopes for recovery old)
(quote 23). Par- ticipants also reported combining alternative Inneг gonfligts aгound feaг of 6 “I was asked to do surgery, but I said, I
treatments to speed up postoperative wound healing (quote 24). suгgeгy and gompeting don’t want to, I was afraid. I just
pгioгities ignored it and kept taking herbal
Participants illustrated the critical roles of others. Participants’ medicine for 3 years” (Participant 03,
families often encouraged compliance and adherence to treatment 64 years old)
courses. Family members maintained optimism to motivate participants 7 “(At that time) my children were still
very young and at school age. I
to complete treatment programs, alongside physically accompanying
thought children’s school had to be
them to hospital visits (quote 25). Family members would take care
prioritized more, and maybe I could
of deal with my conditions later (after
participants’ needs during and between treatment sessions, including they finished school)”. (Participant
keeping participants motivated and entertained throughout
treatment.
Participants explained that family roles extend into financial support, as such as actively initiating
communication and listening to rami1y and wideг sogia1 8
families would collect funds to cover expenses, mostly non-medical,
participants’ feelings and suppoгting гo1es in engouгaging and
throughout the treatment program (quote 26). Whilst providing a fagi1itating gontagt with hea1thgaгe
crucial supporting role, participants were often conflicted with the level complaints, encouraged seгviges
participants to continue
of strain this could place on family members (quote 27). Supporting that treatment
this conflicted with a sense of placing a burden on them. Supportive
others included health professionals, who through friendly gestures,
1
10, 46 years old) consultation and examination, and comply. I agree and follow her (lead),
“(I thought) it was only a lump, not a big deal. But after two months my blood if the doctor said to get breast as what’s important is that I can be
pressure was low, so my daughter told me to just go to the hospital, get medical surgery, she told me I had to healed”. (Participant 12, 56 years old)
(quote 28, 29). Wider society-based initiatives and community-based 9 “My children always encourage me to
undergo treatment, although I said I
charities were also reported to support participants through free lod-
felt better, I should not go, I make my
ging, amenities, and volunteers’ assistance during participant stays (continued on next page)
for treatment (quote 30) and forms of psychological support such as
sending
1
The Breast 63 (2022) 168–176
Tab1e 2 (continued )
children so busy to take care of me
…. for example, I felt pain on my medication.” (Participants 10, 46
years old)
shoulder, then my children ask me to Hea1th pгofessiona1 16“Before the current doctor, we had
go to the hospital because they worry gommunigation encountered a doctor who said harsh
that the pain was related to my things to us. That doctor said this
breast” (Participant 07, 58 years old) disease couldn’t be cured anymore, it
10 “In the past, my face was very pale. was already at stage 4, the terminal
When I met my neighbour, she was stage, incurable, and told us to just
worried about my health. At that go home. Sometimes we encountered
time, I said, I was just a little dizzy, doctors who were unfriendly, this
had a headache and had a fever. doctor even said bad discouraging
After that my neighbour visited me words to a patient who was severely
and persuaded me to go to the ill.” (Participant 01, 61 years old)
Puskesmas [Primary Health Care] for 17 “Previously, I was referred to XX
treatment. I was not mentally ready Hospital. The service was not good.
for treatment, I was afraid. Next One doctor served several patients. I
time, the Puskesmas staff visited me am an impatient person. Imagine, at
and explained various that time, I had just finished surgery,
things. Thus, I agreed to go to the then I had to travel to XX Hospital at
Puskesmas“. (Participant 10, 43 years 3
old) a.m. by car with my weak
Theme 2: Navigating the system to aggess tгeatment condition. When I got there and met
the doctor, I
Convo1uted hea1th gaгe гefeггa1 11 “… When I felt pain, I told my was only given painkillers and got the
systems husband to take me to Puskesmas that wound bandage changed. If it was
night. Then he took me to Puskesmas only for changing the bandage, I
and I got referred to a district-level could do it myself at home. I said to
hospital. Then, I got referred to a the doctor that I was going to this
provincial-level hospital.” hospital for chemotherapy. But the
(Participant 02, 53 years old) doctor
12 “The physician at Puskesmas said, scolded me and said “Enough! I don’t
‘Ma’am, you have to … you need to need your argument”. At that time,
go to the hospital. I will make a fortunately, I got advice from another
referral. Where do you want to be doctor to change the referral to this
referred to?’ The doctor asked me to current hospital “. (Participant 18, 47
choose between several hospitals in years old)
Jogja. I chose one hospital (Hospital Theme 3: Enduгing ghemotheгapy and advanging disease, with gгugia1 fami1y
P). But suppoгt
the doctor (internist) at Hospital P accompany my visit to the Enduгing expeгienge of side effegts
said the lump needed to be removed hospital 2–3 times a week, expeгienged when undeгgoing ghemotheгapy
with surgery. It cannot be treated for chemotherapy, routine
with medication alone. Medication will check-ups, and picking up
not be suitable. Just undergo surgery the
as
soon as possible (the internist referred
the participant to a surgeon)”
Impagt of tгave1 due to distange (Participant 03, 64 years old)
of hea1th fagi1ities 13 “I had experienced bad physical
conditions during my trips to the
hospital. My haemoglobin level was
only 5,8. During the trip, I vomited
blood … I came from Klaten [a
neighbouring city about 45 min
from Togyakarta] which is quite far.
(Participant 06, 41 years old)
14 “The transport [travel to the hospital]
was far. It costs three hundred
thousand rupiahs [equivalent to 30
US dollars] for one trip, and six
hundred thousand rupiahs
[equivalent to 60 US dollars] for
round-trips … for every treatment
visit, I had to stay here for 2–3 days,
and initially, I spent two hundred
thousand rupiahs [approximately 20
US dollars] per night [for the
accommodation]. Luckily I had a
nephew here who now provided me
with room to stay for free with every
hospital visit.” (Participant 07,
Caгegiveг 1ost ingome due to 58 years old)
extent of suppoгt гequiгed 15 “My husband was so supportive of
my treatment that he had to leave his
job. He used to work at the airport,
but because of taking care of me, he
quit his job and is now working non-
permanent jobs … as he’d need to
1
18 “After chemo, I felt nauseous, doctor even prescribed me be diagnosed Will I be here during the fasting
I didn’t that orange morphine.” with cancer. ‘Oh month next year? It’s so scary. Oh
want to eat, then my (Participant 05, 55 years Allah, will I be God, please extend my lifespan. I
nails turned black and old) able to go to the am not ready to die. I am full of sin.
my skin was scaly like 20 “When I first went to mosque during And I still want to take care of my
fish Sardjito Hospital, I cried the fasting month grandchildren.” (Participant 05, 55
skin.” (Participant 09, 63 when I looked at the next year?’ At the years old)
years old) patients here. It was time, I cried so 21 “I was desperate during the second
19 “After the first terrifying. Some patients’ hard until chemo. I didn’t think I could
chemo, I felt major skin seems to have everyone in the continue. I felt tortured, thought I’d
pain, that I couldn’t darkened, and I cried. ‘Oh, do I mosque came to rather die than suffer like that. (I
walk normally have me. They tried to didn’t expect) the cure to my illness
like I used to prior to to die so soon? I am not comfort me, would feel
chemo, (after the first ready to leave my ‘Ma’am, you torturous.” (Participant 03, 64 years
chemo) I had to walk grandchildren.’ For a need to keep old)
very slowly month I kept crying. Well, believing that 22
and carefully. The Ma’am, it’s stressful … to you will recover.’
(continued on next page)
1
The Breast 63 (2022) 168–176
Sub Themes Illustrative quote Sub Themes Illustrative quote
Coping thгough spiгitua1ity and

joy, a1ongside a1teгnative “Now, I no longer think about how have the money to commute.”
theгapy long I live. I just want to do the (Participant 04, 50 years old)
things that make me happy. I sing, I 31 “My religious (Quran recital) group of
listen to Wayang (traditional java friends send encouragement and
performance) in order to sleep well”. motivations. I am no longer able to
(Participant 05, 55 years old) join their group activities, because
23 “I just want to be healed, that’s it. I’m focusing on my treatments, but
Every night I read zikr [Islamic they often visit me and pray for me.”
utterance/prayer] in order to ask (Participant 09, 63 years old)
Allah for recovery. Allah does not test Theme 4: Seeking noгma1gy and be1ief in tгeatment
humans beyond our ability, Mam. I Sense of impгoving physiga1 32 “I am in good condition after chemo.
believe it.” (Participant 06, 41 symptoms Although I feel weak after chemo, my
years old) And гesuming dai1y agtivities appetite is getting better. My friends
24 “I got a massage after having said, my body is not as thin as
surgery. I also used special oil from before. I also feel that my face skin
Surabaya. It felt hot when I used it. gets brighter and my nails are no
The oil is clear like eucalyptus oil. My longer black”. (Participant 03, 64
husband’s friend used the oil and her years old)
breast’ wound dried up quickly. I 33 “… I feel better after chemo. Before,
observed mine is getting smaller” I had to change wound bandages
(Participant 08, 56 years old) twice a day due to a lot of pus, now
rami1y suppoгt, engouгagement 25 “I did the whole treatment process it’s once a day and this pus fluid has
and gompany patiently. Sometimes, I feel sorry for reduced.
my children who accompany me for Before I had a lot of breast pain,
treatment. I often say I want to quit discomfort in various positions, and
the treatment so they won’t be sleep disturbance. After the second
troubled. But my children encouraged chemo cycle, the pain diminished,
me to continue treatment”. and I could sleep better.” (Participant
(Participant 09, 63 years old) 05, 55 years old).
26 “I am a housewife. My living 34 “After several rays and chemo, I feel
expenses including meals are fully better and healthier and able to walk
provided by my children. They [at the beginning of the treatment I
cover medical expenses that are not was still using a wheelchair]. Thank
covered by BPJS. Alhamdulillah, God (I feel) a lot of improvement. I
they are very caring, taking care of was unable to walk, now I walk fine.
me I felt pain then, now no more pain.
wholeheartedly” (Participant 05, 55 I feel a lot healthier, unlike the past
years old) times when many things hurt, but
27 “I felt like complaining to God, and now I can even ride my motorcycle
sort of asking God to end this (life) by myself. In the past, I couldn’t even
once and for all, because I pity my Confidenge in se1f-management get up from bed nor eat without
help.” (Participant 13, 56 years old)
kids for going through troubles taking of gondition
care of me. Alas. my sickness, 35 “Even now, sometimes I take care of
becomes my family’s burden. (In it myself, the hospital staff explains
terms of) many aspects like financial, how to treat the wound myself. I
efforts, and time. But my children bought
insisted that I needed to stay strong, wound treatment at the pharmacy.
have more patience. (Children said) Morning and evening, I change the
Wi11ingness to peгseveгe with bandage and put on the underpad.
this is just how it’s supposed to be,
like I used to take care of them as tгeatment Now the wound is getting smaller”
children, and now it’s their turn to (Participant 10, 46 years old).
take care of me their mother. Those 36 “I used to be very afraid to go to the
kids collectively motivated, supported hospital because I heard bad
and entertained me.” (Participant 03, experiences from my neighbours and
65 years old) my friends. However, after I went
Positive and motivationa1
gommunigation with hea1th 28 “The doctor (here in this hospital) through [chemotherapy] it turned out
to be easy. After being referred here
pгofessiona1s asked about my health condition,
listened to my complaints, then the [Sardjito Hospital] my illness was
doctor explained the chemo immediately treated. There are many
schedule” doctors here who are ready to help,
(Participant 01, 61 years old). medicines are also available. If I
29 “Thank God, the service at this cannot see a certain doctor, there are
hospital is very good. I have been other medical officers who may
admitted and hospitalised here many substitute. Now I am no longer afraid.
times, so I know the nurses well. I am happy, I want to be treated
They are friendly and playful”. quickly because I want to get well
(Participant 04, 50 years old) soon. The important thing is to keep
up the spirit and not think negatively.
Suppoгt fгom wideг oгganisations 30 “My nephew introduced me to I stayed at the
Sedekah Rombongan (community- SR
based charity foundation). It provided free of
I didn
me with free lodging, and volunteers
who took me to and from the Pгefeгenges foг hea1th pгofessiona1
hospital. It’s already been a year and gommunigation гegaгding theiг management
more that I’ve been assisted by SR.
During the early treatment, it was
very difficult, I couldn’t commute, so
1
After knowing this disease, I went through all the doctor’s advice. I’m
not discouraged” (Participant 10, 46 years old).
37 “So, I just want to follow (doctor’s suggestion) because I really want to
be healed … (doctor said) it’s important to get immediate treatment
… (if I have to) get chemo then so be it
… as long as I can get help (for my
(continued on next page)
1
The Breast 63 (2022) 168–176
improved mobility including returning to walking unaided (quote 34).
Sub Themes Illustrative quote Participants also reported developing confidence and competence with
disease)” (Participant 18, 47 years self-management approaches, including treating their wounds at home
old) without support from nurses (quote 35). Most participants reported
38 “… I said this to the doctor ‘I am becoming increasingly positive and motivated to persevere with medical
afraid of this disease [cancer]. So,
doctor … if there is anything related treatments, as they felt more able to manage treatment courses that
to my illness, please just offered an opportunity for healing (quote 36). As treatment continued,
communicate it to my child … ‘. ‘Oh, clear communication of their disease and treatment by healthcare pro-
alright’, said the doctor.” (Participant fessionals facilitated retention of hope for some participants (quote 37).
16, 64 years old).
Other participants preferred doctors to communicate with their family
Outgome deteгmined by God 39 “Well … I just surrendered … on their behalf, particularly when too ill or in physical discomfort
A1mighty because Allah gave me the disease. which could affect their comprehension of details being provided
So … I am ready for what will
happen … the important thing is I
(quote 38). All participants expressed a determination to persist with
pray. I am not afraid … nor sad … and explore options for treatment as a route to improving their
just surrender … to Allah. I will condition. Most participants believed that it was important to persevere
follow whatever the doctor decides to with treatments and that the outcomes would be determined by God
do … the important thing is that I
Almighty (quote 39).
am cured” (Participant 19, 47 years
old).
4. Disgussion
prayers (quote 31).
Our in-depth exploration of the experience of women with advanced
3.4. Seeking normalcy and belief in treatment breast cancer provides a novel depiction across the disease trajectory
from initial symptoms, to presentation, and undergoing chemotherapy
Participants reported that they and their families perceived a sense treatments. We highlight common delays in the presentation to health
of healing that could be achieved through regaining a sense of normalcy providers when initially experiencing symptoms that were later deter-
in their daily lives. After completing chemotherapy, most participants mined to be indicative of breast cancer. Waiting for symptoms to worsen
in our study felt improvement in physical symptoms, such as a dried and resorting to alternative medicines were often driven by psycholog-
wound, regaining appetite and body weight, as well as experiencing ical and economic factors. Once accessing health facilities for treatment
improved sleep quality (quote 32, 33). Some participants also reported of breast cancer, participants commonly had to contend with long-
rig. 2. Thematic network schematic to represent key findings from the analysis.
1
Y.S. Prabandari et al. campaigns. Primary care is a key requirement of universal health
distance travel to facilities, tiered and convoluted referral processes, and

multiple adverse effects and financial burden from undergoing treat-
ment. Critical throughout these stages of the disease trajectory was the
role of individual strength and determination, belief in God, and the role
of families who were crucial advocates and sources of support. While
living with advanced disease, access to treatment provided a sense
of healing when participants felt they were regaining the ability to
undertake aspects of daily activities as they sought to return a
sense of normalcy to their lives.
Our findings provide the first report on the experiences of women
with metastatic breast cancer that explores experiences across the dis-
ease trajectory in the context of a low- and middle-income country
setting. Existing phases of a breast cancer pathway have been
derived through a recent systematic review and meta-synthesis of
qualitative evidence [17]. However, the pathway was derived from
studies commonly focusing on a limited timepoint in the disease
trajectory (e.g. receiving an early diagnosis of breast cancer, or
having undergone breast cancer surgery) alongside highlighting the
need for more research exploring the experiences of women from
developing countries [17]. The concept of trajectory introduced by
Strauss incorporates not just the
‘physiological unfolding of a patient’s disease but the total organization
of work done over the course of illness and the impact on those involved
with that work and its organization’ [18]. The broader temporal
focus presented in this study enables exploration and identification
of both
factors that are limited to specific phases, and those that are enduring
and persistent. Reported experiences of women in this study align with
the key phases of a breast cancer pathway whilst contributing novel
elements; the integral role of family, and the persistent challenges
experienced relating to convoluted and complex referral processes
across services and settings.
At a regional level, our findings correspond with existing literature
from the South East Asia region whilst providing novel contributions
for the context of Indonesia. Poor recognition of breast cancer
symptoms is a cause of delayed presentation in Malaysia [19].
Furthermore, a low perception of disease severity upon discovering
initial symptoms and tended to see symptoms as normal pain or signs
of psychological distress aligns with experiences of Iranian women
with breast cancer [20]. The response could be indicative of low health
literacy among participants (i.
e. the ability to understand and use information to make decisions about
their health); the most common barrier to cancer diagnosis in LMICs
[21]. For those receiving a confirmed diagnosis of cancer, feelings of
fear, shame, denial and financial concerns were common among par-
ticipants, aligned with previous work in Indonesia [22]. Surrounding
participants from initial symptoms through to undergoing treatments
were family. Family caregivers and members influenced decision
making to engage with and seek support from health services. This
included prioritisation of the need of their children over their own
health, alongside the role of families in persuading participants to
seek care. This aligns with Indonesian society; a country with strong
social cohe- sion and regarded as one of the least individualistic
societies globally [23,24].
Cancer control efforts span risk factor modification and prevention,
early diagnosis, treatment, and palliation [21]. There is limited devel-
opment across all stages in Indonesia. For prevention, programs are
often implemented under Puskesmas (Primary Health Care), including an
existing breast cancer awareness program initiated by the Indonesian
Health Ministry; the BCearly detection program. BCearly targets primary
prevention of breast and cervical cancers [25]. Government-led initia-
tives often occur alongside those led by non-governmental organisations
(e.g. the Indonesian Cancer Foundation and oncology societies), chari-
ties, cancer support groups, and survivor societies. Campaigns generally
seek to deliver public education by cancer experts and survivors, often
targeting high-risk individuals (e.g. family members of cancer patients).
Participants’ dismissing of symptoms and fears around accessing care
evidence a need for further development and evaluation of current
1
The Breast 63 (2022) 168–176 chemotherapy hence the results may not resemble the experiences of
patients in other centres in the country and women experiencing other
coverage [26] but there is known inequity in service provision treatment modalities. Furthermore, ethical approval obtained for the
across Indonesia [27]. With the development and refinement of study required all interviews to take place in the hospital setting and
campaigns, there needs to be structural investment in primary not in the home of participants. Subsequently,
healthcare to accommodate increased demand from women with
breast cancer, irrespective of location. Following presentation to
cancer care services, the experience of commencing and undergoing
treatments was complex for participants. Unmet support needs
were evident across three domains aligned with breast cancer
treatment [28]; i) health system and information, ii) physical,
and iii) psychological. All were prominent in this study, with
adverse physical and psychological effects aligned with existing
reports of trauma caused by intense pain, fear of death, and
stress when undergoing breast cancer treatments in Indonesia
[29]. There is, however, a lack of holistic care for people with
advanced breast cancer in Indonesia, despite the need [30].
Critical areas of clinical importance that include physical
symptom control, psychosocial support, physical activity,
nutrition support, and advance care planning, could be supported
through provision of palliative care. Whilst the Ministry of Health
developed a palliative care policy in 2007, progress with
implementation has been slow with very limited, disparate provi-
sion across the country.
We outline findings that can inform multiple routes to
improving care for women with breast cancer in Indonesia.
Firstly, health professionals reflecting empathy and good
communication can improve the experience of care for patients;
sincere motivational words can be perceived positively by
patients with cancer in Indonesia [29]. Sec- ondly, families need
to be considered as key stakeholders in the development of future
approaches that seek to improve the delivery of care for women
with breast cancer. Family caregivers and members greatly
influence decision making to engage with and seek support from
health services, including participants reporting prioritisation of
the need of their children over their own health, with family
members continuing to play a key supportive role throughout
treatment. Thirdly, once undergoing treatments participants
reported a determination to endure and complete treatments.
Exploring ways of providing support during treatment such as
leveraging digital health approaches to support self-management
[31,32] or adaptation of remote monitoring of adverse events [33]
may provide valuable tools to augment the delivery and quality
of care. Lastly, palliative care development to better meet the
needs of women undergoing treatments and living with
advanced disease should be prioritized through, for example,
building capacity and increasing the palliative care workforce,
creating care models that provide services in the community, and
exploring integration across oncology care and other disease
groups. There is also scope to use our findings to guide provision
of both country- or region-specific care pathways, drawing on
crossover in experiences of women with breast cancer in this
study and those in other countries in Southeast Asia, such as
Singapore, where similar factors (e.g. fear and a lack of information)
have been identified as affecting initial presentation [34].
Devising tailored care pathways could guide Indonesia and
countries in the region towards universal health coverage [35];
where achieved it is independently associated with decreasing
breast cancer mortality [36]. Beyond Southeast Asia, this study
highlights the value of exploring experiences across the disease
trajectory to augment the evidence base for breast cancer care in
low- and middle-income countries, providing an approach to
understand both phase-specific and enduring factors to inform
prioritisation for service development.
The study was conducted by a team of experienced researchers
in the field of oncology, psychology, medical science, public
health, and bioethics. We recruited participants that reflected
diversity in age, education, marital status, occupation, time
since diagnosis and stage at diagnosis. However, the study took
place in one cancer centre in Indonesia and undergoing
1
The Breast 63 (2022) 168–176
the research team was not able to follow up with participants in the Dharmais cancer centre Jakarta and University Malaya medical centre, Kuala
community to seek further input from participants on the study findings Lumpur. Asian Pac J Cancer Prev 2011;12(11):2943–6.
to verify their accuracy in the portrayal of their experiences. [7] Sinaga ES, Ahmad RA, Shivalli S, Hutajulu SH. Age at diagnosis predicted survival
outcome of female patients with breast cancer at a tertiary hospital in Togyakarta,
Indonesia. Pan Afr Med J 2018 Jul 11;(163):31 [cited 2021 Jul 15].
5. Cong1usions [8] Solikhah S, Matahari R, Utami FP, Handayani L, Marwati TA. Breast cancer stigma
among Indonesian women: a case study of breast cancer patients. BMC Wom
Health 2020 Jun 3;20(1):116.
Delays in presentation to health providers when initially experi- [9] Sunarsih IM, Prabandari TS, Aryandono T, Sastrowijoto S. Exploring possible
encing symptoms indicative of breast cancer were common across par- causes for delays seeking medical treatment among Indonesian women with
ticipants. From initial symptoms through to undergoing treatments, the breast cancer. Asian J Pharmaceut Clin Res 2018 Jun 7:284–8.
[10] Iskandarsyah A, de Klerk C, Suardi DR, Soemitro MP, Sadarjoen SS, Passchier J.
experience of participants was continually punctuated by barriers
Psychosocial and cultural reasons for delay in seeking help and nonadherence to
and challenges. However, family members were a constant source of treatment in Indonesian women with breast cancer: a qualitative study. Health
support and influence across the illness trajectory. Family caregivers Psychol 2014 Mar;33(3):214–21.
should be considered key stakeholders in the development of [11] Pahria T. Indonesian women diagnosed with breast cancer: a hermeneutic process
[phd]. Queensland University of Technology; 2017 [cited 2021 Jul 15].
approaches to improve the delivery of breast cancer care across the Available from: https://eprints.qut.edu.au/110738/.
stages of risk factor modification and prevention, early diagnosis, [12] Hackett J, Godfrey M, Bennett MI. Patient and caregiver perspectives on managing
treatment, or palliation. While interventions are being developed pain in advanced cancer: a qualitative longitudinal study. Palliat Med 2016 Sep 1;
30(8):711–9.
across each of these four elements of cancer control in Indonesia, [13] Guest G, Bunce A, Johnson L. How Many interviews are enough?: an experiment
there is a dearth of evidence to indicate their acceptability and with data saturation and variability. Field Methods 2006 Feb 1;18(1):59–82.
effectiveness. Future research spanning the disease trajectory could [14] Braun V, Clarke V. Using thematic analysis in psychology. Qual Res Psychol 2006
Jan 1;3(2):77–101.
facilitate the identification of enduring and persistent challenges to
[15] Attride-Stirling J. Thematic networks: an analytic tool for qualitative research.
care delivery that can be targeted to guide the development and Qual Res 2001 Dec 1;1(3):385–405.
optimisation of support for women with breast cancer. [16] Tong A, Sainsbury P, Craig J. Consolidated criteria for reporting qualitative
research (COREQ): a 32-item checklist for interviews and focus groups. Int J Qual
Health Care 2007 Dec 1;19(6):349–57.
Authoг gontгibutions [17] Smit A, Coetzee BJ, Roomaney R, Bradshaw M, Swartz L. Women’s stories of living
with breast cancer: a systematic review and meta-synthesis of qualitative evidence.
TSP, SSH and MJA conceived the idea. Data collection was per- Soc Sci Med 2019;222:231–45.
[18] Strauss AL. Chronic illness and the quality of life. second ed. St Louis: Mosby; 1984.
formed by SS, WH, TSP. Data analysis and interpretation, as well as [19] Taib NA, Tip CH, Low WT. A grounded explanation of why women present with
manuscript writing and finalisation were performed by all authors. advanced breast cancer. World J Surg 2014 Jul;38(7):1676–84.
[20] Khakbazan Z, Taghipour A, Roudsari RL, Mohammadi E, Omranipour R. Delayed
presentation of self-discovered breast cancer symptoms in Iranian women: a
runding qualitative study. Asian Pac J Cancer Prev 2014;15(21):9427–32.
[21] Brand NR, Qu LG, Chao A, Ilbawi AM. Delays and barriers to cancer care in low-
and middle-income countries: a systematic review. Oncol 2019 Dec;24(12):
This work was supported by the Faculty of Medicine, Public
e1371–80.
Health and Nursing, Universitas Gadjah Mada (2019) [22] Deliana M, Suza DE, Tarigan R. Advanced stage cancer patients experience in
multidisciplinary research scheme grant, received by TSP. SHH seeking treatment in medan, Indonesia. Open Access Maced J Med Sci 2019 Jul
received funding from Kementrian Riset, Teknologi dan Pendidikan 14; 7(13):2194–203.
[23] Triandis HC, Bontempo R, Betancourt H, Bond M, Leung K, Brenes A, et al. The
Tinggi Republik Indonesia (ID) (2018) to undertake the project. MJA measurement of the etic aspects of individualism and collectivism across cultures.
received funding from Research England Quality-related Research Aust J Psychol 1986 Dec 1;38(3):257–67.
GCRF from the University of Leeds (2019). [24] Goodwin R, Giles S. Social support provision and cultural values in Indonesia and
Britain. J Cross Cult Psychol 2003 Mar 1;34(2):240–5.
[25] Minister of Health. Minister of Health Regulation No 29/2017 concerning
Ethiga1 appгova1 Amendment of Minister of Health Regulation No 34/2015 on Breast Cancer and
Cervical Cancer Management [Internet]. 2017. Available from: https://peraturan.
bpk.go.id/Home/Details/112083/permenkes-no-29-tahun-2017.
This study has been approved by the Medicine and Health Research [26] van Weel C, Kidd MR. Why strengthening primary health care is essential
Ethics Committee of the Faculty of Medicine, Public Health and Nursing, to achieving universal health coverage. CMAJ (Can Med Assoc J)
Universitas Gadjah Mada and Dr. Sardjito Hospital, Togyakarta, 2018;190(15): E463–6. https://doi.org/10.1503/cmaj.170784.
[27] Pratiwi AB, Setiyaningsih H, Kok MO, Hoekstra T, Mukti AG, Pisani E. Is Indonesia
Indonesia (reference number KE/FK/0417/EC/2018). A study permit achieving universal health coverage? Secondary analysis of national data on
was also granted by the Dr. Sardjito Hospital director. insurance coverage. health spending and service availability BMJ Open 2021;11:
e050565. https://doi.org/10.1136/bmjopen-2021-050565.
[28] Wabula I, Tunitasari E, Wahyudi AS. Supportive care needs of women with breast
Deg1aгation of gompeting inteгest cancer: a systematic review. J Ners 2020 Jul 7;15(1Sp):142–8.
[29] Wahyuni D, Huda N, Utami GT. Studi Fenomenologi: Pengalaman Pasien Kanker
stadium Lanjut yang. Menjalani Kemoterapi 2015;2(2).
The authors declare no conflict of interest. [30] Nuraini T, Andrijono A, Irawaty D, Umar J, Gayatri D. Spirituality-focused
palliative care to improve Indonesian breast cancer patient comfort. Indian J
Refeгenges Palliat Care 2018;24(2):196–201.
[31] Gudi N, Tadav UN, John O, Webster R. Challenges and opportunities in employing
digital health to address self-management needs of people with NCDs in India.
[1] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global BMJ Innov 2021 Sep 12. https://doi.org/10.1136/bmjinnov-2020-000620.
cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide [32] Tadav SK, Tadav N. Continuity of cancer care in the era of COVID-19
for 36 cancers in 185 countries. CA Cancer J Clin 2021;71(3):209–49. pandemic: role of social media in low- and middle-income countries. World J Clin
[2] Ghoncheh M, Momenimovahed Z, Salehiniya H. Epidemiology, incidence and Cases 2021 Jan 16;9(2):291–5.
mortality of breast cancer in Asia. Asian Pac J Cancer Prev 2016;17(S3):47–52. [33] McGregor BA, Vidal GA, Shah SA, Mitchell JD, Hendifar AE. Remote oncology care:
[3] GLOBOCAN. Breast [Internet]. GLOBOCAN; 2020 [cited 2021 Jul 27]. Available review of current technology and future directions. Cureus 2020;12(8):e10156.
from: https://gco.iarc.fr/today/data/factsheets/cancers/20-Breast-fact-sheet.pdf. [34] Ng CWQ, Lim JNW, Liu J, Hartman M. Presentation of breast cancer, help seeking
[4] GLOBOCAN. Indonesia - Globocan 2020 [Internet]. GLOBOCAN; 2021 [cited 2021 behaviour and experience of patients in their cancer journey in Singapore: a
Jul 15]. Available from: https://gco.iarc.fr/today/data/factsheets/populations/ qualitative study. BMC Cancer 2020;20:1080.
360-indonesia-fact-sheets.pdf. [35] Heer E. Addressing breast cancer mortality in low-income and middle-income
[5] Anwar SL, Raharjo CA, Herviastuti R, Dwianingsih EK, Setyoheriyanto D, countries: if you can’t measure it, it doesn’t exist. Lancet Oncol 2021;22(11):
Avanti WS, et al. Pathological profiles and clinical management challenges of 1493–4.
breast cancer emerging in young women in Indonesia: a hospital-based study. [36] Duggan C, Trapani D, Ilbawi AM, Fidarova E, Laversanne M, Curigliano G, et al.
BMC Wom Health 2019 Feb 6;19(1):28. National health system characteristics, breast cancer stage at diagnosis, and
[6] Ng CH, Pathy NB, Taib NA, Teh TC, Mun KS, Amiruddin A, et al. Comparison breast cancer mortality: a population-based analysis. Lancet Oncol
of breast cancer in Indonesia and Malaysia–a clinico-pathological study between 2021;22(11):1632–42.
1
Olsson Möller et al. BMC Health Services Research (2020) 20:252
https://doi.org/10.1186/s12913-020-05107-7
RESEARCH ARTICLEOpen Access
Barriers and facilitators for individualized

rehabilitation during breast cancer treatment –
a focus group study exploring health care
professionals’ experiences
Ulrika Olsson Möller1, Ing-Marie Olsson2,3, Katarina Sjövall4, Ingela Beck1,4,5, Lisa Rydén6 and
Marlene Malmström2,3,5*
Abstract
Background: Breast cancer (BC) and related treatment are associated with the risk of developing a wide range of persistent disabling impairm
Methods: A total of 19 HCPs were included, representing various professions in BC care/rehabilitation within surgical, oncological and speci
Results: Three categories were captured: (1) varying attitudes towards rehabilitation; (2) incongruence in how to identify and meet rehabilitat
(Continued on next page)
* Correspondence: marlene.malmstrom@med.lu.se
2
Department of Health Sciences, Lund University, Box 157, 221 00 Lund, Sweden
3
Skåne University Hospital, Lund, Sweden
Full list of author information is available at the end of the article
© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which
permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the
original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other
third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the
material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory
regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this
licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a
credit line to the data.
Olsson Möller et al. BMC Health Services Research (2020) 20:252 Page 2 of 9
(Continued from previous page)

Conclusion: This study suggests that the cancer trajectory is medically and treatment-driven and that rehabilitation plays a marginal role in to
Keywords: Breast cancer, Health care professionals, Individualization, Qualitative, Rehabilitation, Barriers and facilitators
Background systematic review showed that one symptom or problem

Despite a favourable prognosis and extensive evidence of could be treated with a wide range of interventions and
the positive effects of cancer rehabilitation, patients with that the efficacy depend on the diverse array of
breast cancer (BC) still suffer from unmet rehabilitation aetiological causes underlying the problem, and patients’
needs [1]. This may increase the risk of prolonged or diverse preferences [19]. Altogether this indicate that
inhibited recovery, emphasizing the need for extended individualization is essential for optimized recovery.
knowledge about barriers and facilitators for individual- For cancer rehabilitation to be successful, teamwork is
ized rehabilitation. needed to prevent and reduce the physical, psycho-
BC is the most common cancer in women worldwide logical, social and existential consequences of cancer and
and is responsible for about 28% of all cancer diagnoses its treatment [12]. In Sweden, national guidelines for
[2]. Diagnostic and treatment related advances have re- cancer rehabilitation [20] include recommendations on
sulted in decreased mortality [3] and prolonged survival assessment: care processes, care structure and
[4, 5]. Despite favourable survival outcomes, BC and as- teamwork: treatments: self-care: physical, psychological,
sociated treatment unfortunately comes with the risk of social and existential aspects: follow-up and quality
developing a wide range of persistent disabling compli- indicators. However, implemetention and clinical
cations. Studies show that 34–43% of patients with effects of the national cancer rehabilitation guidelines
newly diagnosed BC report high distress [6, 7] and has not yet been investgated.
therefore are at risk of developing chronic distress [7] Despite extensive research related to BC rehabilitation,
and more than 60% report at least one adverse treatment the reasons behind patients’ unmet rehabilitation needs
effect 6-year after diagnosis [8]. Distress is defined as a are still unclear. Therefore, interviewing HCPs about
multi-factorial, unpleasant emotional experience of a barriers and facilitators for individualized rehabilitation
psychological, social and/or spiritual nature that may is needed to gain a deeper understanding of reasons for
interfere with the ability to cope effectively with cancer patients’ lack of access to rehabilitation.
and its physical symptoms and treatments [9]. As BC
also tends to be diagnosed at younger ages compared Methods
with other common cancer types [4] the long-term The aim of this study was to explore HCPs’ experiences of
impact also affects work ability, with approximately 30– current rehabilitation practice and describe current bar-
60% remaining on sickness absence 1 year after treatment riers and facilitators for individualized rehabilitation for
[10, 11]. patients following BC treatment. This explorative qualita-
This means that rehabilitation is essential for patients’ tive focus group study is a part of the ReScreen complex
suffering from BC as cancer rehabilitation aims to pre- intervention study (Clinicaltrials.gov NCT03434717) fo-
vent and reduce the physical, psychological, social and cusing on screening-based individualized rehabilitation
existential consequences of cancer [12]. Studies have re- following BC treatment. The overall project is developed
peatedly shown that exercise and physical activity have according to the Medical Research Councils (MRC)
positive effects on several consequences of BC treatment framework for complex interventions [21]. The present
such as reduced fatigue, depression, anxiety, and lym- study is a part of the first phase of the complex interven-
phoedema as well as increased shoulder mobility and tion framework “Development” focusing on identifying
Quality of Life (QoL) [13–16]. However, studies have the evidence base. These results combined with the results
also reported that BC patients have unmet rehabilitation of a systematic review of reviews [19] will be used as a
needs in relation to fear of cancer recurrence, psycho- fundament in the development of an intervention for
logical concerns, having someone to talk to [17], patient- evidence-based rehabilitation which is evaluated in the
education and psychological, financial and occupational third phase of the project. The manuscript is reported
counselling [1]. Unmet needs are strongely associated according to the Consolidated criteria for reporting quali-
with decreased QoL [18]. Parallel to this a recent tative research (COREQ) guidelines.
Context
hospital. A semi-structured interview guide was used
This study was conducted at the Departments of Surgery
(see Additional file 1), focusing on HCPs’ experiences of
and Oncology of a university hospital in southern
current rehabilitation practice and barriers and facilita-
Sweden where approximately 670 patients are diagnosed
tors for individualized rehabilitation. The interviews
with BC annually. In Sweden, rehabilitation in this con-
started with an open-ended question: “Could you please
text, is performed at different levels depending on avail-
describe your role in the rehabilitation of patients fol-
able competence and resources. Patients with BC are
lowing BC treatment?” which was followed by probing
depending on initial treatment regime treated and
questions to get a deeper understanding and illuminate
followed-up at the surgical or at the oncological out-
various perspectives. The last author (M.M) moderated
patient unit. These outpatient units represent the basic
the interviews aiming to support the participants in
rehabilitation level. At the basic rehabilitation level con-
focusing on the study aim while one assistant inter-
tact nurses working specifically with BC patients are the
viewer (I.B, U.OM, or K.S) kept notes and asked probing
patients primary care contact and are available during
questions [22]. To validate the interpretation of the in-
the pre and post treatment phase. These units also in-
terviews an assistant interviewer summarized the con-
clude rehabilitation resources such as physiotherapists,
tent of the interviews at the end of each interview,
occupational therapists and social workers. Some re-
thereby allowing for immediate member checking [23].
habilitation follow-ups are structured, for example all
When conducting the fifth interview no new information
patients with axillary lymph node dissection, by default
emerged why data collection was closed.
see a physiotherapist before and after surgery focusing
on lymphedema prevention, while rehabilitation in gen- Data analysis
eral is based on patients’ initiatives. Patients that, at the The digitally recorded and transcribed interviews were
basic rehabilitation level, are identified as having com- analyzed using conventional qualitative content analysis
plex needs can be referred to a specialized cancer re- [24]. This inductive approach allows categories to flow
habilitation unit (hereafter referred to as the advanced from the data. The first and last authors (U.OM, M.M)
rehabilitation level). The unit for advanced rehabilitation had the main responsibility for the analysis while the
is organized under the Department of Oncology and in- other authors focused on ensuring the link between the
clude a multi professional team with e.g. physicians, data and the analysis. All researchers have extended
psychologist, social workers, physiotherapists and occu- experiences of qualitative research and focus group in-
pational therapists that exclusively focus on rehabilita- terviews. Initially, all transcripts were read and/or lis-
tion of patients with cancer. tened to repeatedly by the authors independently to
achieve an overall understanding and a sense of the
Recruitment and participants
whole. Thereafter, words and meaning units in the text
Different HCPs working within BC care or specific can-
that highlighted key concepts were identified independ-
cer rehabilitation, at the Departments of Surgery and
ently, and notes were made about the initial analysis. An
Oncology and in various parts of the cancer trajectory,
initial coding scheme was developed by defining and
were considered eligible for inclusion. Participants were
labelling patterns, sub-categories and categories. Similar-
purposefully included through key persons, by mail or
ities and differences in the interpretation of data were
face-to face, at each unit to achieve maximum variation
discussed throughout the analysis until consensus was
regarding type of profession, workplace, and years of
reached by all authors.
working with BC/in cancer rehabilitation. A total of 19
HCPs from the Departments of Surgery (n = 11) and
Results
Oncology (n = 8) were included representing nurses
The participants’ experiences were captured in three cat-
(n = 7), nurse assistants (n = 1), physicians (n = 1), psy-
egories and eight sub-categories (Table 1) describing
chologists (n = 1), physiotherapists (n = 5), social
current rehabilitation practice as well as barriers and fa-
workers (n = 3) and occupational therapists (n = 1). Four
cilitators for individualized rehabilitation. Extensive pro-
of the participants had worked in the field for 1–5 years,
fessional competence, related to experiences of working
three for 6–10 years, five for 11–20 years, three for 21–
with patients with BC/rehabilitation, was described as a
30 years and four for 30 years or more.
facilitator for individualized rehabilitation as it enabled
experience-based identification of patients’ needs. Bar-
Focus group interviews
riers for individualized rehabilitation, on the other hand,
Five focus group interviews [22] with three to five partic-
were identified in terms of lack of structure, collabor-
ipants in each group were conducted in November 2016
ation and knowledge in relation to individualized re-
– March 2017. The interviews lasted between 71 and 89
habilitation in an often medically and treatment-driven
min and were conducted in a conference room at the
health care system.
Table 1 Schematic overview of categories and sub-categories

Varying attitudes towards rehabilitation Incongruence in how to identify and meet
Suboptimal collaboration during cancer
rehabilitation needs
treatment
Rehabilitation based on medical indicators Identifying signs of vulnerability Interprofessional team collaboration
Lack of consensus about approach towards
rehabilitation Screening for rehabilitation needs Interdisciplinary collaboration
Setting goals for rehabilitation Actions triggered by signs of vulnerability
Varying attitudes towards rehabilitation

make sure that they know where to go…
The participants’ attitudes towards rehabilitation could
(Participant at basic rehabilitation level, Interview 1)
be a barrier to patients’ access to rehabilitation. This was
apparent when rehabilitation and follow-up were based
Lack of consensus about approach towards rehabilitation The
on medical indicators, such as side effects of various
approach towards rehabilitation varied depending on
treatments, rather than on patients’ individual needs and
the participants’ individual knowledge about and
when consensus about the goal of rehabilitation was
interest in rehabilitation, and on what rehabilitation level
lacking.
the HCP worked. It was evident that patients could be
given different advice and support depending on which
Rehabilitation based on medical indicators
HCP they see. This indicate that lack of knowledge and
Rehabilitation, in the context of follow-up, were on the
consensus about timing and strategies for rehabilitation
basic level predominately described as organized based
is a barrier. The HCPs expressed diverse views on the
on medical indicators such as risk of developing lym-
best time to initiate a rehabilitation plan. Some partici-
phoedema or risk of side effects associated with specific
pants felt it was insulting to discuss rehabilitation when
treatments. However, the participants stressed that the
the patient is facing a life-threatening illness and
assessments of patients’ rehabilitation needs should be
stressed that patients should take it easy and slowly ad-
based on a combination of personal characteristics, such
just to the new situation with as little interference from
as the patient’s social network, personality and life situ-
the HCPs as possible.
ation. Therefore, the importance of exploring the pa-
tient’s life situation and resources at an early stage was
And the most important thing is not that
repeatedly emphasized. At the advanced cancer rehabili-
[rehabilitation]; the important thing is to get them
tation level, a more comprehensive approach to rehabili-
to understand the diagnosis and support them
tation was adopted, allowing for screening for both
during the treatment. Then, if you feel during these
needs and resources as a base for a rehabilitation plan.
meetings that ‘there seems to be a problem here’
I use it [screening tool] not just to identify problems then of course you can document it /…/ but it is
but also to capture resources. What support does not primary, that we need to identify their
this person have in her life to cope with her current rehabilitation needs. (Participant at basic
life situation, and how can we contribute? rehabilitation level, Interview 3)
(Participant at advanced rehabilitation level,
On the other hand, it was also emphasized that a pro-
Interview 5).
active approach promoting rehabilitation at an early
The participants emphasized the importance of pre- stage was fundamental to recovery. At the same time
paring patients for potential problems by giving them HCPs repeatedly described rehabilitation as driven by
information in advance e.g. about risk of developing fa- patients’ initiatives indicating an inactive rather than
tigue. They also stressed the importance of empowering proactive rehabilitation. Altogether, this indicated a lack
patients to call the contact nurse if needed. However, of consensus regarding the meaning of and approach to-
participants also described the risk of patients not know- wards rehabilitation.
ing when to call as they might be unaware of symptoms
Setting goals for rehabilitation
and problems that might prompt a contact.
Participants sometimes described specific goals, both
…the health care service has a great responsibility for rehabilitation in general and for establishing goals
to at least make sure of it [that patients know when for each patient. However, at the basic rehabilitation
to call], because it is very much based on the fact level goal setting was often not described as a part of
that they should contact us. Therefore, we have to clinical routines and were rarely discussed at a team
level. Spe- cific patient-related goals were highlighted
as important,
such as being able to touch the breast or to get back to I think teamwork is everything in this, because you
work but were rarely developed in conjunction with the [the nurses] see it [the needs], you are the ones who
patient. It was also stressed that there was a need for an meet the patient first. And then the rest of us come
integrated individual rehabilitation plan in which the pain. (Participant at basic rehabilitation level,
tient’s goals were clearly documented, and which Interview 3)
followed the patient throughout the cancer trajectory to
optimize rehabilitation. The participants highlighted that patients’ needs vary
greatly and that HCPs need to be aware of and respon-
It [the rehabilitation] starts there in the screening sive to patients’ needs throughout the cancer trajectory,
moment /…/ but above all … The approach is which was described as a complex task.
always that ‘You are going back [to recover]’,
and how do we best achieve this? (Participant at Screening for rehabilitation needs
basic rehabilitation level, Interview 3) Even if the participants at the basic level mainly
described similar potential signs of vulnerability there
Incongruence in how to identify and meet rehabilitation needs were no consensus about or structure for how or when
The importance of identifying patients’ needs these potential signs should be identified. Various
throughout opinions were expressed about the importance of adopting
the cancer trajectory was stressed. Still, a lack of structure a more structured way of screening. Some participants
for continuous screening for rehabilitation needs was re- expressed that the most important issue was the
peatedly described as a barrier and consensus about the relational aspects of support; they said that a more
need for systematic needs assessments was lacking. Ra- structured approach towards rehabilitation (e.g. through
ther, HCPs identified signs of vulnerability as indicators screening) could compromise the patient–HCP
for rehabilitation needs based on clinical experience. relationship, as the approach became instrumental and
objective.
Identifying signs of vulnerability
Some HCPs like to have a sheet and be able to
Based on experience, the HCPs were attentive to signs of
count and measure, while other colleagues believe
vulnerability by looking beyond the merely obvious and
that /… / it should come naturally and that
medical aspects. These signs varied and could include
establishing a relationship is needed for concerns to
specific patient groups such as younger women with
emerge. (Participant at advanced rehabilitation level,
children, women that were alone in their situation or did
Interview 5)
not seem to understand the situation:
Others stated that there was a great need for an im-
It comes naturally; I can see if a patient has small
proved and reliable way of identifying patients’ needs.
children or not … or if a patient has a chaotic
These participants argued that a structured screening
relationship or if her husband has just left her …//
procedure would make it possible to identify and act
It just something you catch in the moment …
upon each patient’s needs and would provide better pre-
(Participant at basic rehabilitation level, Interview 2)
requisites for individualized rehabilitation. On the other
hand, participants at the advanced level stressed that pa-
By identifying signs of vulnerability, the participants tients often were referred too late indicating the need of
extended the understanding of patients’ needs. For ex- earlier identification of patients’ needs.
ample, if a patient had a history of burn-out the HCPs
would ask how this might influence her rehabilitation or, We have tried to convey this [earlier needs
in women with children, to explore the plans for telling assessment] //, that this should be done before they
their children about the cancer. However, the partici- [the patients] come to us. // They come, as I see it,
pants also described the risk of potential signs being too late. (Participant at advanced rehabilitation level,
neglected if they were considered “sensitive” (such as re- Interview 5)
lational, sexual or existential issues) or if the HCP was
unaware of specific signs. Actions triggered by signs of vulnerability
The participants described that the contact nurses at The participants described that when signs of vulnerabil-
the basic levels were best positioned to identify signs of ity were identified and a patient was considered to be in
vulnerability. The other HCPs corroborated this, saying need of extended rehabilitation, this triggered various
they had faith in the contact nurses’ ability to identify actions. If the needs were practical (e.g. economic is-
and refer patients in need of their interventions. sues), psychological (e.g. anxiety) or physical (e.g. swol-
len arm) there was usually a clear routine for referral to
a social worker or physiotherapist at the basic return to your normal everyday life. (Participant at
rehabilitation level. By contrast, if the trigger was advanced level, Interview 4)
based on personal characteristics or health behaviours
(e.g. inactivity, substance abuse), a structure for One example of the lack of collaboration between dis-
initiating supportive interventions or referring patients ciplines was that despite extensive available competence
for extended support was often lacking. at the advanced rehabilitation level many participants at
the basic level was either unaware of the unit’s
Suboptimal collaboration during cancer treatment
existence or of how or when to refer patients. The
It was evident that barriers for rehabilitation existed at an participants also expressed that they were working in a
organizational level, in terms of lack of interprofessional
quickly changing health care system within an area
(between HCPs at the same department) and interdiscip- where new evidence rapidly emerged, which made it
linary (between the departments) collaboration. This was
difficult to keep up to date with both evidence and
described as hindering a comprehensive rehabilitation available rehabilitation resources. Therefore, they
process in which a team-based rehabilitation plan follows expressed that there was a need for a support tool that
the patient throughout the cancer trajectory. included information about which interventions might
be effective for different problems and information
Interprofessional team collaboration
about locally available rehabilitation resources.
“Interprofessional collaboration” was often referred to
as gathered professional competences within a specific There is not much to offer … who should we refer
unit, meaning that the team collaboration was related to them to? (Participant at basic rehabilitation level,
one part of the cancer trajectory. It was stressed that Interview 3)
interprofessional discussions about patient cases were
important to keep updated, to enhance knowledge and Therefore, implementation of evidence-based guide-
to ensure that rehabilitation recommendations were lines that are adopted throughout the cancer trajectory
valid, and evidence based. Still, at the basic was expressed as having potential to bridge the gap be-
rehabilitation level, the structure for team collaboration tween different disciplines.
was limited. To enhance such collaboration, geographic
and resource aspects were highlighted as important. For Discussion
example, working geo- graphically close made it easier to Despite national guidelines and initiatives to integrate
discuss individual patients and to share experiences in rehabilitation throughout the cancer trajectory, this
an informal way while the HCPs working in several study shows that rehabilitation plays a marginal role in
units often described their role as consultative. today’s BC care in Sweden. The results demonstrate a
prominent lack of consensus regarding HCPs approach
There is probably no one, I believe, who thinks that it
towards rehabilitation. It also demonstrates that the
[team-based evaluations] would be impossible, but
responsibility for identifying patients with extended re-
there could be purely practical conditions, obstacles,
habilitation needs is on the basic level where structures
organizational barriers for it to happen spontaneously.
for systematic needs assessments and evidence-based
//. But right now, there is no structure for it … //
guidelines often are lacking. This imbalance is likely to
You make the best out of what you have.
be a barrier for individualized rehabilitation. Altogether,
(Participant at basic rehabilitation level, Interview
these results clearly show that there is a gap between
1)
rehabilitation research and clinical practice leaving pa-
tients with sub-optimal rehabilitation and emphasizing
Interdisciplinary collaboration
the need for implementation of guidelines for individual-
Interdisciplinary collaboration was often described as
ized rehabilitation.
unsatisfactory. The ineffective collaboration was de- This study shows that rehabilitation often is organized
scribed as a process where the next instance “started based on medical or treatment-related indicators mean-
over instead of taking over”, leading to a potential risk of ing that patients with more advanced or specific treat-
prolonged waiting times, inefficient communication, and ments are more actively monitored. This way of
sub-optimal rehabilitation. To enable optimal rehabilita- organizing rehabilitation and survivorship care has also
tion, it was stressed that the recovery period should be been demonstrated in a Danish study [25] where cancer
(but often was not) seen from a comprehensive continu- patients’ initial care often was described as based on the
ous perspective. novelty and severity of the diagnoses, with focus on
treatment, side effects and care, which drew attention
Rehabilitation should really run through it all. From
and focus away from survivorship care. These results
day one when you get your diagnosis, until you
are
in line with previous research showing that medical was unclear who had the overall responsibility for the re-
indicators, such as type of tumour, are likely to be habilitation process, and an overall plan and structure
modest indicators for distress and that poor QoL, for when and how patients should be referred within the
disability, or unmet needs are more powerful system was lacking. Studies stress the importance of a
predictors of distress multidisciplinary approach to meet the wide range of re-
[26] indicating an extended rehabilitation need. HCPs in habilitation needs of patients with BC [31, 32] which
the present study stress that patients’ individual prefer- also was emphasised in the present study. Despite this,
ences and signs of vulnerability are important indicators interprofessional collaboration was described as insuffi-
for patient’s rehabilitation needs, which is in line with cient in terms of “the next instance is starting over in-
former research [25, 26] indicating a medical driven re- stead of taking over”. The lack of collaboration resulted
habilitation system. in limited knowledge about resources between disci-
Earlier studies have shown that HCPs avoid structured plines and can be seen as a sign of a fragmented cancer
assessments because of insufficient implementation of a care trajectory.
needs assessment form, uncertainty [27], or because they This study shows that despite an extensive amount of
question the added value of screening tools [28, 29]. In research within the field structures for individualized re-
contrast, studies also show perceived benefits of assess- habilitation is lacking. It is also well known that research
ment of needs including detecting needs, enhancing hol- often fail to translate into meaningful patient care out-
istic care, improving clinician–patient relationship and comes. Key domains that are fundamental to consider to
enhanced potential to address problems [27]. These dual successfully implement research findings into clinical
perspectives relating to the value of structured evalua- practice include understanding barriers and facilitators
tions was also seen in the present study where some related to the characteristics of the intervention and the
HCPs expressed that the experienced based and “infor- involved individuals, the inner and outer setting and the
mal” identification of needs was a facilitator for individu- process of implementation [33]. This emphasize the
alized rehabilitation while others described it as a barrier need for a deeper understanding of barriers for imple-
since it came with a risk of HCPs addressing different menting individualised rehabilitation to provide a solid
problems. This indicates that even if patients are identi- evidence ground for further development within this
fied they might get varying advice depending on whom field. In the present study barriers related to individuals’
they see and where they are in the cancer trajectory. A attitudes towards rehabilitation, planning and organizing
screening test is, however, usually not enough for facili- rehabilitation and lack of inter disciplinary collaboration
tating change in patient outcomes. Rather it could be were revealed. These different perspectives need to be
seen as the first step in a process where further compre- considered in the further development towards individu-
hensive assessments and timely provision of evidence- alized rehabilitation for patients suffering from BC.
based intervention are needed [26]. As stated by Stout
et al. [30], describing the Prospective Surveillance Model Strengths and limitations
(PMS), patient’s self-identification of rehabilitation needs This qualitative focus group study is, to our knowledge,
is insufficient, which is also the base for the present the first of its kind exploring HCPs’ experiences of
study. However, instead of focusing primarily on phys- current practice and barriers and facilitators for individ-
ical and functional limitations, as in the PSM, the ualized rehabilitation for patients treated for BC. Includ-
present study adds knowledge of barriers and facilitators ing HCPs who represent various professions and
from the perspective of different HCPs and for early disciplines allowed for variation in perspectives, which
identification of physical, psychological, existential and/ can be considered a strength of this study. The design
or social needs that would trigger automatic referral. also enabled a deeper understanding of the mechanisms
The results from the present study shows that HCPs’ behind the current routines. However, this also means
stressed the need for an evidence-based decision support that narratives from different parts of the trajectory were
tool where the latest evidence is combined with locally included which might be related to conditions that are
available rehabilitation resources as a basis for ensuring unique to that specific specialty and this should be con-
evidence-based individualized rehabilitation. sidered when interpreting the results. When participant
Identifying women with extensive rehabilitation needs have intense or lengthy experience within the topic
is a complex but fundamental task when aiming to en-
smaller focus groups are often recommended [22]. In
sure optimized BC rehabilitation. In this study, specialist
this study we therefore aimed for smaller focus groups
and profession-specific competence were highlighted as
to enhance the opportunity to share insights and obser-
important for enabling individualized rehabilitation. It
vations which is considered a strength of the study. The
was clearly stated that the responsibility for identifying
focus group interviews were rich and dynamic reflecting
women with extended needs was dependent on the con-
that the participants felt comfortable in talking about
tact nurses on the basic rehabilitation level. However, it
this topic. No further information emerged during the

Supplementary information
fifth interview why data collection was closed. The in- Supplementary information accompanies this paper at https://doi.org/10.
cluded participants reflect the current composition of 1186/s12913-020-05107-7.
HCPs working within cancer rehabilitation. The fact
Additional file 1. Interview guide.
that only one physician and one psychologist were
included reflects this composition but might be
Abbreviations
considered as a limitation of the study. A further
BC: Breast cancer; HCP: Health care professional; QoL: Quality of Life
consideration is that the study exclusively includes
representatives from hospital- based cancer Acknowledgements
rehabilitation which might be a potential limitation We would like to thank the participant in the focus group for sharing their
knowledge so generously.
since the primary health care (community based)
perspective is lacking. Further studies focusing on Authors’ contributions
cancer rehabilitation in the transition between hospital- M.M and L.R designed the study. U.OM and M.M developed the interview guide.
U.OM, M.M, I.B and K.S conducted the focus group interviews. U.OM, IM.O and
based and primary health care is therefore needed. M.M conducted the initial analysis and wrote the initial draft of the manuscript and
To increase the trustworthiness of the study [34] the I.B, IM.O, K.S and L.R made substantial contributions to the interpretation of data
HCPs were encouraged to share their experiences and to the revision of the manuscript. All authors have approved the submitted
version.
without any pressure to reach consensus. Each interview
was moderated and conducted by researchers with Funding
experience in conducting qualitative focus group This focus group study is a part of the Re-Screen research project focusing on
individualized rehabilitation for women treated for BC that is supported by
interviews and member checking was used to ensure Governmental funding of clinical research within the National Health Service
that the interviews captured the HCPs’ experiences. (NHS), The Swedish Breast Cancer Association, the Percy Falk foundation and the
The last author had a distant professional relationship Cancer and Allergy Foundation. The funding bodies had no influence on the
design, data collection, data analysis or in writing the manuscript. Open access
with some of the participants while the others had no funding provided by Lund University.
previous relationship. To increase trustworthiness a
second researcher without relationship with the Availability of data and materials
This study has in accordance with the national ethical regulations (2003:460)
participants were present at the interviews.
received ethical approval from the Regional Ethical Review board in Lund, Sweden.
Transferability of qualitative studies is related to the de- In the approved application (reference number 2015/505) we stated that only the
gree of similarity between the study context and the members of the research group that are involved in the study will have access to
data. This means that we are not allowed to share the raw data from this study.
clinical setting. Authors may make suggestions about
transferability but due to contextual differences it is always Ethics approval and consent to participate
the readers’ responsibility to determine however or not it The study was approved by the Regional ethical review board in Lund, Sweden
is transferable [34]. This study has limitations related to (reference number 2015/505). All participants approved participation and signed
informed consent.
being performed at a single center and being performed
within the Sweden health care system only. However, Consent for publication
since a qualitative study do not aim to generalize rather to Not applicable
describe variations, we suggest that these results are likely Competing interests
to mirror the role of cancer rehabilitation in similar cancer The authors declare that they have no competing interests.
settings where evidence-based rehabilitation guidelines
Author details
may not yet have been implemented. 1
Department of Nursing and Integrated Health Sciences, Faculty of Health Sciences,
Kristianstad University, Kristianstad, Sweden. 2Department of Health Sciences, Lund
Conclusion University, Box 157, 221 00 Lund, Sweden. 3Skåne University Hospital, Lund,
Despite the participants’ extensive individual knowledge Sweden. 4Department of Clinical Sciences in Lund, Oncology and Pathology, Lund
University, Lund, Sweden. 5The Institute for Palliative Care, Lund University and
in the field, this study clearly shows that the cancer Region Skåne, Lund, Sweden. 6Lund University, Skåne University Hospital,
trajectory is medically and treatment-driven and that Department of Clinical Sciences Lund, Surgery, Lund, Sweden.
rehabilitation plays a marginal role in the earlier parts of
Received: 22 November 2019 Accepted: 12 March 2020
the trajectory. It also demonstrates a prominent
imbalance in the role and structure of rehabilitation as
the responsibility for identifying patients with extended References
1. von Heymann-Horan AB, Dalton SO, Dziekanska A, Christensen J, Andersen I,
rehabilitation needs is at the basic level where Mertz BG, et al. Unmet needs of women with breast cancer during and after
rehabilitation is often not an integral part. Structures for primary treatment: a prospective study in Denmark. Acta Oncol. 2013; 52(2):382–
systematic screening for needs, evidence- based 90.
2. Ferlay J, Colombet M, Soerjomataram I, Dyba T, Randi G, Bettio M, et al.
guidelines for individualized rehabilitation interventions Cancer incidence and mortality patterns in Europe: estimates for 40 countries
and structures for referring patients for advanced and 25 major cancers in 2018. Eur J Cancer. 2018;103:356–87.
rehabilitation are often lacking. To enable optimal and
individualized recovery for BC patients’, rehabilitation
needs to be an integrated part of the cancer trajectory
and run in parallel with diagnostics and treatment.
3. Carioli G, Malvezzi M, Rodriguez T, Bertuccio P, Negri E, La Vecchia C. Trends and

27. Biddle L, Paramasivan S, Harris S, Campbell R, Brennan J, Hollingworth W.
predictions to 2020 in breast cancer mortality in Europe. Breast. 2017; 36:89–95.
Patients’ and clinicians’ experiences of holistic needs assessment using a cancer
4. Miller KD, Siegel RL, Lin CC, Mariotto AB, Kramer JL, Rowland JH, et al. Cancer
distress thermometer and problem list: a qualitative study. Eur J Oncol Nurs.
treatment and survivorship statistics, 2016. CA Cancer J Clin. 2016; 66(4):271–89.
2016;23:59–65.
5. National Board of Health and Welfare. Cancer in numbers 2018 (in Swedish). 2018.
28. Handberg C, Jensen CM, Maribo T. Lack of needs assessment in cancer survivorship
https://static-files.cancerfonden.se/Cancer%20i%20siffror%202018_ laddaner.pdf.
care and rehabilitation in hospitals and primary care settings. J Clin Med Res.
Accessed 21 Feb 2020.
2017;9(10):864–71.
6. Bidstrup PE, Mertz BG, Dalton SO, Deltour I, Kroman N, Kehlet H, et al.
29. Fillion L, Cook S, Blais M-C, Veillette A-M, Aubin M, de Serres M, et al.
Accuracy of the Danish version of the ‘distress thermometer’. Implementation of screening for distress with professional cancer
Psychooncology. 2012;21(4):436–43. navigators. Oncologie. 2011;13(6):277–89.
7. Ploos van Amstel FK, Tol J, Sessink KH, van der Graaf WTA, Prins JB, 30. Stout NL, Binkley JM, Schmitz KH, Andrews K, Hayes SC, Campbell KL, et al. A
Ottevanger PB. A specific distress cutoff score shortly after breast cancer prospective surveillance model for rehabilitation for women with breast cancer.
diagnosis. Cancer Nurs. 2017;40(3):e35–40. Cancer. 2012;118(8):2191–200.
8. Schmitz KH, Speck RM, Rye SA, DiSipio T, Hayes SC. Prevalence of breast cancer 31. D’Egidio V, Sestili C, Mancino M, Sciarra I, Cocchiara R, Backhaus I, et al.
treatment sequelae over 6 years of follow-up: the pulling through study. Counseling interventions delivered in women with breast cancer to improve
Cancer. 2012;18(8):2217–25. health-related quality of life: a systematic review. Qual Life Res.
9. Holland JC, Andersen B, Breitbart WS, Buchmann LO, Compas B, Deshields 2017;26(10):2573–92.
TL, et al. Distress management. J Natl Compr Cancer Netw. 2013;11(2):190– 32. Leensen MCJ, Groeneveld IF, Heide IVd, Rejda T, van Veldhoven PLJ, Berkel SV,
209.
Snoek A, Harten WV, Frings-Dresen MHW, de Boer AGEM. Return to work of
10. Sjovall K, Attner B, Englund M, Lithman T, Noreen D, Gunnars B, et al. cancer patients after a multidisciplinary intervention including occupational
Sickness absence among cancer patients in the pre-diagnostic and the post- counselling and physical exercise in cancer patients: a prospective study in the
diagnostic phases of five common forms of cancer. Support Care Cancer.
Netherlands. BMJ Open. 2017;7(6):e014746.
2012;20(4):741–7.
33. Damschroder LJ, Aron DC, Keith RE, Kirsh SR, Alexander JA, Lowery JC. Fostering
11. Sun Y, Shigaki CL, Armer JM. Return to work among breast cancer survivors: a implementation of health services research findings into practice: a consolidated
literature review. Support Care Cancer. 2017;25(3):709–18. framework for advancing implementation science. Implement Sci.
12. Nordic Cancer Union. From needs to offers. Rehabilitation of cancer patients. 2009;7(4):50.
2004. http://www.ncu.nu/Default.aspx?ID=21. Accessed 21 Feb 2020. 34. Graneheim UH, Lundman B. Qualitative content analysis in nursing research: concepts,
13. Zeng Y, Huang M, Cheng AS, Zhou Y, So WK. Meta-analysis of the effects of procedures and measures to achieve trustworthiness. Nurse Educ Today.
exercise intervention on quality of life in breast cancer survivors. Breast Cancer. 2004;24(2):105–12.
2014;21(3):262–74.
14. Loh SY, Musa AN. Methods to improve rehabilitation of patients following breast
cancer surgery: a review of systematic reviews. Breast Cancer. 2015;7: 81–98. Publisher’s Note
15. Meneses-Echavez JF, Gonzalez-Jimenez E, Ramirez-Velez R. Effects of supervised Springer Nature remains neutral with regard to jurisdictional claims in
exercise on cancer-related fatigue in breast cancer survivors: a systematic review published maps and institutional affiliations.
and meta-analysis. BMC Cancer. 2015;15:77.
16. Zhu G, Zhang X, Wang Y, Xiong H, Zhao Y, Sun F. Effects of exercise
intervention in breast cancer survivors: a meta-analysis of 33 randomized
controlled trails. Onco Targets Ther. 2016;9:2153–68.
17. Akechi T, Okuyama T, Endo C, Sagawa R, Uchida M, Nakaguchi T, et al. Patient’s
perceived need and psychological distress and/or quality of life in ambulatory
breast cancer patients in Japan. Psychooncology. 2011;20(5): 497–505.
18. Hansen DG, Larsen PV, Holm LV, Rottmann N, Bergholdt SH, Søndergaard J.
Association between unmet needs and quality of life of cancer patients: a
population-based study. Acta Oncol. 2013;52(2):391–9.
19. Olsson Moller U, Beck I, Ryden L, Malmstrom M. A comprehensive approach to
rehabilitation interventions following breast cancer treatment - a systematic
review of systematic reviews. BMC Cancer. 2019;19(1):472.
20. Regional Cancer Centres in Sweden (RCC). Swedish national guidelines for cancer
rehabilitation (in Swedish). 2019. https://www.cancercentrum.se/
samverkan/vara-uppdrag/cancerrehabilitering/vardprogram/. Accessed 21 Feb 2020.
21. Medical Research Council (MRC). Developing and evaluating complex
interventions: new guidance. 2008. https://mrc.ukri.org/documents/pdf/
complex-interventions-guidance/. Accessed 21 Feb 2020.
22. Krueger RA, Casey MA. Focus groups: a practical guide for applied research. 5th ed.
Thousand Oaks: Sage Publications; 2015.
23. Kidd PS, Parshall MB. Getting the focus and the group: enhancing analytical rigor
in focus group research. Qual Health Res. 2000;10(3):293–308.
24. Hsieh HF, Shannon SE. Three approaches to qualitative content analysis. Qual
Health Res. 2005;15(9):1277–88.
25. Handberg C, Jensen CM, Maribo T. When a policy decision meets practice
realities: the case of cancer survivorship care and rehabilitation needs
assessment. Eur J Oncol Nurs. 2018;33:70–7.
26. Carlson LE, Waller A, Mitchell AJ. Screening for distress and unmet needs in
patients with cancer: review and recommendations. J Clin Oncol Off J Am Soc
Clin Oncol. 2012;30(11):1160–77.
BioMed Central publishes under the Creative Commons Attribution License (CCAL). Under
the CCAL, authors retain copyright to the article but users are allowed to download, reprint,
distribute and /or copy articles in BioMed Central journals, as long as the original work is
properly cited.
Copyright B 2012 Wolters Kluwer Health | Lippincott Williams & Wilkins
Ahmad Nasiri, MSN Fariba

Taleghani, PhD Alireza
Irajpour, PhD
Men’s Sexual Issues After Breast Cancer

in Their Wives
A Qualitative Study
K E Y W O R D S Background: Husbands of women with breast cancer may experience problems

Breast cancer in their sexual relationships with their wives. Adjustment to sexual issues can be affected
Iran by cultural norms and beliefs. Understanding men’s perceptions and responses to their new
Men sexual status after diagnosis of their wife’s disease and during its treatment may help
Muslims clinicians to better support the couple. Objective: The objective of this study was to
Qualitative study explore the sexual issues of Iranian men after breast cancer in their wives. Methods: A
Religious beliefs qualitative research method based on the grounded theory approach was used. In-depth
Sexual adjustment interviews were conducted with a purposive sampling of Iranian men experiencing breast
Sexual issues cancer in their wives. Data analysis was based on the constant comparative method.
Results: Eighteen men were interviewed. Five main themes emerged: sexual relationship
changes, sexual avoidance, sexual abstinence, sexual restraint, and efforts to normalize the
relationship. Conclusions: The participants experienced problems in their sex lives.
Because cultural and religious beliefs were important factors affecting the men’s sexual
adjustment, health system providers should encourage husbands to tolerate and adjust to
their sexual issues in the context of their culture and religion. Implications for Practice:
The findings of this study could help nurses and other healthcare professionals recognize
sexual issues in the husbands of women with
breast cancer and promote the couples’ healthy sexual life.
reast cancer is the most common cancer in the world
B
death from cancer in American women. 2 Although the prev-
among women.1 The worldwide incidence of breast can- alence of the disease in Eastern countries is low, its incidence
cer differs by country. It is the second leading cause of in most Asian countries is increasing. In Iran, breast cancer is
Author Affiliations: Faculty of Nursing and Midwifery (Mr Nasiri) and Correspondence: Fariba Taleghani, PhD, Nursing and Midwifery Care Re-
Nursing and Midwifery Care Research Center, Faculty of Nursing and search Center, Faculty of Nursing and Midwifery, Isfahan University of
Midwifery (Drs Irajpour and Taleghani), Isfahan University of Medical Sci- Medical Sciences, PO Box 81746-73461, Isfahan, Iran
ences, Iran. (taleghani@nm.mui.ac.ir).
The authors have no funding or conflicts of interest to disclose. Accepted for publication July 9, 2011.
DOI: 10.1097/NCC.0b013e31822d48e5
236 n Cancer NursingTM, Vol. 35, No. 3, 2012 Nasiri et

Copyright @ 2012 Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
the most common malignancy among women, accounting activity. In Iran, some cultural behaviors such as men’s
for 24.4% of all neoplasms.3 Advances in screening and commitment to marriage
treatment of breast cancer have led to improved survival
rates.4 Women who have timely and appropriate treatment
have 5- and 10-year survival rates of 74% and 62%,
respectively.5
Breast cancer can have physical and emotional impact on
women and contribute to problems during treatment. 6 One of
the complications of breast cancer treatment can be sexual.
A mastectomy can change women’s self-concept and body
image and decrease their sexual sensibility because of loss of
breast and nipple sensation. The mastectomy can evoke a strong
emotional stress7 and threaten the perceptions of women’s fe-
mininity.6 In addition, women can experience chemotherapy-
induced early menopause.6,8 Sexual desire in patients with breast
cancer during chemotherapy is often inhibited because of fa-
tigue, nausea, vomiting, and alopecia. In addition, fatigue dur-
ing radiotherapy and painful dermatitis can affect intimacy desire
in these women.9 Walsh and colleagues10 indicated that sexual
interests of patients with breast cancer decrease secondary to
the physical pain and sensitivity changes related to the adverse
effects of the treatment. Couples’ sexual relationships can thus
be affected by women’s experience during treatment for breast
cancer. According to Moreira and coinvestigators,11 breast
cancer has affected couples’ sexual relationships.
Approximately 61.1% of women reported that sexual
relationships with their husbands worsened. The frequency of
the couples’ sexual activity decreased.12 Some women
reported that breast cancer and its treatment caused an
emotional separation between them and their husband and
elicited their husbands’ fear of sexual intercourse. Many
studies have also reported changes in men’s sexual behavior
after breast cancer diagnosis and treatment in their
wives.9,13Y16 Negative responses such as criticism or with-
drawal by a spouse can adversely affect the well-being of
women with breast cancer; in contrast, good marital
relationships can predict better adaptation to breast cancer.17
Men who experienced less sexual disruption and greater
relationship satisfaction were more supportive to their wives
with breast cancer than those who had less satisfied
relationship.17 In a different study, husbands’ initiation of sex
contributed to well-being, psychosexual adjustment, and
marital satisfaction in patients with breast cancer; the men’s
negative reaction to the scar of mastectomy incision decreased
marital satisfaction and increased distress in the sexual
experiences of their wives.18 Rowley-Green19 reported that the
lack of adjustment to sexual difficulties in the husbands of
women with breast cancer may cause stress, negative mood,
and disturbance in relationship with their wives.
Men’s adjustment to sexual issues in various societies can
be affected by their cultural norms and beliefs. Several studies
have reported cultural differences in sexual relationships by
nations of origin,12,20Y22 specifically between Eastern and West-
ern countries23 and even among various states of a country.22
According to Beutel and colleagues,22 men’ sexual intensity
and frequency of sexual desire in the western states of Germany
compared with the eastern states are low; moreover, rural
men have less sexual activity than their urban counterparts.
Traditional- restrictive attitudes can negatively affect sexual
Sexual Issues After Breast Cancer NursingTM, Vol. 35, No. 3, 2012 n 237
and avoiding of remarriage (because of its cultural various characteristics in terms of age, job, socioeconomic
consequences) and unwillingness to discuss sexual issues can status, duration of time elapsed from mastectomy in their
affect men’s sexual behaviors when they experience sexual wives, and their wives’ current treatment. Five of the
frustration with their wives. Religious beliefs also influence participants were employed,
individuals’ reactions to sexual issues. Howsepian and
Merluzzi24 suggested that persons who espouse strong
religious beliefs have less feelings of guilt with their sexuality
than those who report no religious faith. In Eastern
countries, especially in Muslim populations, sexual be-
haviors are accepted only in certain conditions that are different
from those in followers of other divine religions in Westerns
countries. In Islam, such sexual behaviors as out-of-marriage
sex, masturbation, ogle, and lechery are forbidden; instead,
other practices such as fasting and praying are recommended
to pre-
vent ethical deviation.
Spouses may not frequently discuss their sexual issues and
thus may not have agreement and may experience problems in
their life.19 Iranian people usually feel ashamed of talking
about their sexual issues and prefer not to discuss sexual
problems especially with strangers, even with their
physician or nurse. As a consequence, their sexual issues
may not be recognized. Careful exploring of their sexual
issues can guide clinicians in helping the husbands of women
with breast cancer to cope with their sexual problems.
Although a great number of studies have reported sexual
problems in patients with breast cancer,4,9Y12,14,16,25,26 only a
few studies have addressed the sexual problems in the
husbands of patients with breast cancer. In addition,
cultural and religious aspects of sexual issues, which are 2
important factors influencing sexual behaviors, have not
been clearly discussed in such studies. Moreover, no
research has explained sexual issues in the husbands of women
with breast cancer in Iran. Therefore, this study is an
attempt to reveal Iranian men’s sexual concerns after breast
cancer in their wives.
Study Purpose
The purpose of this study was to explore the sexual
concerns of Iranian men experiencing breast cancer in
their wives.
Design
A qualitative research method was used, with in-depth
interviews conducted with a sample of Iranian men in
2010. A grounded theory approach was used with the
interview data for this study, which is a part of a larger
qualitative study about adjustment processes in men who
experience breast cancer in their wives.
Participants
The participants were 18 Iranian men who were purposively
selected from among the husbands of women with breast can-
cer who were referred to specialized cancer treatment centers
or outpatient cancer clinics in Iran. Eligible participants
completed written informed consent. Participants had

8 were unemployed, and 5 were retired. None of them had 2 participants were interviewed again in order to confirm some
previous history of mental disorders (Table 1). Four men who of the emerging concepts. Data collection was discontinued
met eligibility criteria declined to participate; reasons for after 20 interviews, as no new information was forthcoming, and
refusal included being busy and having no time for an the saturation point had been reached.
interview. The characteristics of these 4 men were similar to
those of the men who participated in the study. All wives of
the participants had undergone unilateral modified radical Ethical Considerations
mastectomy. None of the wives had metastasis as documented The medical ethics committee of the university approved the
in their medical records. All participants and their wives were study. Eligible participants were informed about the purpose
Iranian Shiite Muslims. All men reported being committed to of the study, the method of data collecting, and tape recording
their religious beliefs. The sample size was determined by of the interviews both orally and in writing. They were also
data saturation. assured of confidentiality and anonymity. Furthermore, we
informed them that their cooperation was completely
Data Collection voluntarily and that they could end participation at any
moment. All signed a written informed consent document
The data were collected and tape recorded through in-depth prior to participation.
face-to-face interviews with the participants. Open-ended ques-
tions were used at the beginning of the interview, such as
‘‘Tell me about your relationship with your wife after the Data Analysis
diagnosis of the disease?’’ and ‘‘How is your sexual Constant comparative method, derived from the grounded
relationship with your wife after the disease?’’ Subsequent theory methodology,27 was used to analyze the data. The initial
questions included ‘‘Explain more about the changes in your step involved examining the data line-by-line and identifying
sexual relationship with your wife after the disease,’’ ‘‘What the keywords and sentences of the texts. Then a label was given
was your reaction about the changes in your wife’s sexual to each keyword or sentence in the process termed ‘‘open cod-
behavior?’’ and ‘‘How did you satisfy your sexual needs when ing.’’27 The codes were reviewed and renamed in an ongoing
you could not have sex with your wife?’’ Duration of each fluid manner by constantly comparing the newly generated
interview session varied from 30 to 80 minutes. An active labels with the previous data. Similar codes were then
listening attitude was maintained to conduct in-depth grouped under higher-order headings known as concepts.27
interviews, and the spontaneous narrative of the participants Next, concepts were grouped into categories, from which 5
was not interrupted, allowing the participants to think about major themes were induced. During the data analysis, 2 more
their sexual issues and then speak of them. As Iranian men researchers were involved to enhance the validity of data
are usually unwilling to discuss sexual issues with a female interpretation. They read the transcripts to confirm the
researcher, a male researcher of the research team did the coding and categories and to check the primary researcher’s
interviews. Bias related to the sex of the researcher is possible; the interpretations. Some of the participants were contacted after
male research team member wrote his own ideas and thoughts the data analysis and given a full transcript of their coded
about male sexual issues at the beginning of the study and tried interviews to determine whether they were accurate according
to bracket those during the interviews. During the data analysis, to their experiences. In addition,
Table 1 • Participants’ Demographic Information
Time Elapsed From Wife’s Current
ID Code Age, y Occupation No. of Children Mastectomy Treatment
P1 51 Employed 2 4y Follow-up
P2 38 Unemployed 1 8 mo Follow-up
P3 58 Unemployed 4 25 d Chemotherapy
P4 50 Retired 2 6y Follow-up
P5 62 Retired 3 6y Follow-up
P6 33 Unemployed 2 6 mo Radiotherapy
P7 43 Employed 1 3 mo Radiotherapy
P8 49 Employed 4 4 mo Radiotherapy
P9 47 Unemployed 3 4 mo Radiotherapy
P10 70 Retired 1 2 mo Chemotherapy
P11 42 Employed 1 5 mo Chemotherapy
P12 51 Employed 3 40 d Chemotherapy
P13 69 Unemployed 5 2.5 y Follow-up
P14 55 Retired 2 6 mo Radiotherapy
P15 55 Retired 1 1 mo Radiotherapy
P18 49 Unemployed 2 6 mo Chemotherapy
credibility and confirmability of the data were enhanced FREQUENCY OF COUPLE’S SEX
through peer checking, validation of the emerging codes and
categories in the subsequent interviews, and debriefing with 2 Although most participants expressed that breast cancer and
supervisors. the related treatments have reduced both their sexual desire
and frequency of sex, some of them believed that the fre-
quency of their intercourses has varied over the time:
n Findings We had no intercourse during 1 week or at least

3 to 4 days after her chemotherapy because of her bad
The results of 20 face-to-face interviews with the general condition due to nausea and the like. Of
course, she also had no desire herself for sex too, and
participants using constant comparative analysis method
I should have taken care of her, and whenever (she) gets
emerged the following 5 major themes: sexual relationship better, then we will have sex. [P4]
changes, sexual avoidance, sexual abstinence, sexual restraint,
and effort to normalize relationship (Table 2).
Sexual Avoidance
Sexual Relationship Changes Sexual avoidance was one of the men’s mental reactions to their
One of the major themes in this study was sexual sexual changes. Most men avoided thinking of sex with their
relationship changes. The participant’s sexual desire and wives after diagnosis of the breast cancer. Some factors includ-
frequency of sex were both decreased. In addition, the more in- ing annoying emotions and restrictive beliefs about sex con-
depth repeated interview with the participants showed that tributed to this.
their sexual desire and frequency of sex were varying because of
ANNOYING EMOTIONS
different conditions of the patients over time.
The majority of the men, when describing their wives’ physical
SEXUAL DESIRE appearance before the disease, experienced emotions such as
The patients’ uncomfortable conditions after diagnosis of breast anxiety and taking pity to her. They avoided intimacy with
cancer and during the treatment caused change in their hus- their wives, which negatively influenced their sexual
bands’ sexual desire. One of the participants said: relationship. One participant said:
At the moment, that she is ill, I never think of it (sexual I(Surgeons) have taken her breast out, and she has a
relationship) at all. I will try to heal my wife, then I will (postmastectomy) scar; it may cause an unpleasant sense.
have sex with her. Of course, at least I can hug and kiss her Of course, it is natural; this sense can be due to kindness
during the treatment, but we will continue to our normal or affection. When I see (the scar), I take pity on her, when
lives when the treatment is finished. [P7] I see her mastectomy scar after she takes bath, I say to
myself I wish this would not have happenedI [P11]
In addition, changes in patients’ body appearance such as
lack of breast or alopecia influenced the sexual desire of some The other said:
men. They believed that removal of their wife’s breast caused When a man sees that his wife has lost her breast,
decrease in their sexual desire. he becomes sad and feels distaste, then he does not
feel enough pleasure. [P2]
In addition, when facing with their wives the uncomfort-
Table 2 • Themes and Subthemes able status due to pain in mastectomy, incision, or such che-
Themes and Subthemes motherapy complications as nausea, vomiting, and weakness,
the men felt annoying emotions:
Sexual relationship changes Sexual desire
Frequency of couple’s sex Sexual avoidance When a man comes home and sees that his wife is sick,
Annoying emotions Restrictive beliefs lying on the bed with no sense of freshnessI or feeling
Sexual abstinence headacheI or any other discomfort, then the lust gets
Wife’s unpleasant physical conditions Wife’s psychological problems away from him, spontaneously. [P9]
Sexual restraint Religious beliefs Loyalty to wife
Effort to normalize relationship
Effort to continue sexual relationship Effort to increase intimacy

RESTRICTIVE BELIEFS
Some participants avoided thinking of sex because they be-

lieved that sex with their wives who suffered from illness
was inhumane, immoral, and unconscionable. One of the
men expressed his opinion as follows:
Despite her illness, if I wanted to have sex, then this
would not mean a human behavior; sorry, it would
be a kind of bestiality. [P7]
Another man said: ‘‘Why? Does my problem still exist?’’ Her morale has
been weakened again; we cannot think of coition until
When a man sees that his wife is sick, his conscience
her morale returns into normal. [P9]
does not allow him to have sex with her. Although man
is willing to have sex, but because his wife is sick and
receives chemotherapyI then he prefers to postpone
it for after her recovery. [P8] Sexual Restraint
The men in the present study tried to tolerate sexual frustration
and avoid obliquity by sexual restraint. Some motivations for
Sexual Abstinence sexual restraint included religious beliefs and loyalty to wife,
The other major theme in this study was sexual abstinence. which are affected by sociocultural and religious background.
Some men, despite a willingness and intention to have sex, pre-
sented a self-control to their sexual desire. Therefore, they were RELIGIOUS BELIEFS
deprived of sexual pleasure, leaving them always in an unpleas-
ant condition. Some factors such as the wife’s physical condition The participants who were tolerating sexual frustration believed
and psychological problems could cause sexual frustration and a that they were being examined by God:
sense of sexual abstinence in men. I say to myself that this is the will of God to examine me;
he tested me as his servant in order to compare my present
WIFE’S UNPLEASANT PHYSICAL CONDITIONS condition with my past when my wife was healthy. [P15]
The patients’ unpleasant physical conditions such as pain in the Some participants also believed that toleration of sexual frus-
surgical scar, nausea and vomiting, and feeling discomfort tration was God’s help for them:
during intercourse because of genital tract changes may
Ionly God could help (me) to avoid obliquity Ionly
convince a man to avoid having sex with her despite his desire God must help a man and give him the power to
to do so. One of the participants said: tolerate sexual frustration for the specific period of time
If I have intercourse with her, she will suffer and (during his wife’s disease)I. [P1]
become sad; I won’t do it because she will become sulky The other participant explained about the situation in which
and physically damaged. [P8] he was near to fall to obliquity, but an invisible hand (God’s)
Another participant said: helped him not to do illicit sex despite opportunity. He believed
that his strong belief in God helped him in that time. None of
This is a difficult abstinence; Isometimes a man the men had used masturbation, as Muslims; they believe that it
becomes very close to it (sex), but at the last moment,
is forbidden and considered a sin in Islam.
he says to himself, ‘‘I won’t do it.’’ A man must have a
strange devotion and self-sacrifice! This is hard; this is
very hard. [P1] LOYALTY TO WIFE
WIFE’S PSYCHOLOGICAL PROBLEMS

Avoiding ogle, lechery, and illicit sex, or even remarriage, were
examples of loyalty to one’s wife by which many men who had
Reluctance, moodiness, and weakened morale were some of the sexual frustration remained faithful to their wives:
psychological problems of women with breast cancer during the
II say to myself that I should not do sex with strange
disease and treatment, which were expressed by men as the
woman because her (my wife’s) illness will aggravate;
main reasons for their suffering about not having sex with their
I should have self-devotion. I think that my relationship
wives. One of them said: with another woman will cause many bad consequences
I felt that she was reluctant. When I asked her (to in our life. I stop myself because of its consequent
have sex), she said that her condition to have sex was problems, which I think may happen in the future.’’
not appropriate, then I accepted it. [P5] [P15]
Another man said about his wife’s moodiness related to sex: Most men believed that some religious practices could pre-
vent them from ethical deviations. One participant believed
She was often very moody to do it (sex), so I also that ‘‘fasting’’ was a way to avoid obliquity.
considered this issue and did not do it. [P16] Another example of loyalty to wife was commitment to pre-
Another problem that worried most participants was de- serving marriage and avoiding divorce:
creased morale in the patients, which not only reduced their When a couple put their hands together (while they marry),
happiness and excitement but also disturbed their relation- then they should stay together and be loyal to each other
ships especially their sexual relationship: until the end. Although some men may marry again
while they are married, but I am not like them, and my
While chemotherapy has not yet been finished, wife is also sure that I will not marry again. [P17]
(physicians) said that she should receive radiotherapy;
now my wife becomes worried again, and she says, Few participants tended to remarry, as they preferred not to
do it because their wives were unwilling.

Effort to Normalize Relationship of couples’ intercourse after breast cancer diagnosis and mas-
tectomy.9,10,12,14,26 Helene26 states that the frequency of in-
In the present study, the men tried to adjust themselves with tercourse and degree of sexual satisfaction may be a part of the
the ongoing situation by continuing sexual relationship with ‘‘malignant’’ process of men’s sexual withdrawal. The
their wives and increasing their intimacy. findings of Fobair and Spiegel16 also indicated that the
frequency of couples’ sexual activity was decreased after breast
EFFORT TO CONTINUE SEXUAL RELATIONSHIP cancer treatment. They suggested that women being
treated by chemotherapy have experienced less sexual
Most men believed that continuity of a sexual relationship was
activity with their spouses because of early menopause and
a sign of returning to normal life and could help their wives
vaginal dryness.
to increase their morale and self-confidence. They believed that
According to the findings of the present study, sexual
if they could not maintain a sexual relationship with their
avoidance was one of the men’s mental reactions by which
wives, other forms of relationships (eg, even having a dinner
they avoid thinking of sex with their wives. Most participants
or lunch together) would also have been stopped. They tried
emphasized that they preferred not to think about sexual
to ignore their wives’ disease and the related problems while
relations with their wives, because this could be a source of
they were attempting to have sex:
irritation in the relationship. One of the reasons for sexual
I pretended that I was willing to have sex with her so avoidance was annoying emotions. Watching their wives’
that she did not imagine that I had become reluctant to naked body with mastectomy scar or hairless head during
her. Then our sexual relationship became even warmer their marital relationships, they experienced unpleasant
than before her illness. As a result, she forgot her illness emotions such as stress and anxiety as well as feeling pity for
gradually, and then our sexual relationship became even their wives. As a result, they preferred not to think of looking
warmer than before. [P1] at their wives’ naked body or have a sexual relationship with
them. In addition, the men preferred not to think of sex with
EFFORT TO INCREASE INTIMACY their wives and avoided it because of some restrictive beliefs.
The present study also represents the impact of social and
The participants tried to increase intimacy and improve close cultural factors in the participants’ avoidance. Most men who
relations with their ill wives. Most men expressed that their had restrictive beliefs were from rural areas and had lower
speech tone with their wives had become more respectful and education levels. Fobair and Spiegel,16 explaining the sexual
romantic than before and that their wives’ illness has concerns of women with breast cancer and their spouses,
encouraged them to value their wives and family members reported that some men withdraw from their wives because of
even more than before. One of them said: the disease’s influence on their relationships. Other report that
I believe that if a couple loved each other by 50% men, after their wives’ breast cancer, may withdraw affection
already, now they should love each other by 100%. and avoid sexual relationships with them for self-protection.26
[P3] Husbands of women with breast cancer have expressed that
their wives’ mastectomy scar view has caused a fear in them and
affected their sexual relationship.25 The findings of Schain13
also supported that men’s sexual relationship is affected by
n Discussion their feeling about the appearance changes in their wives after
breast cancer. Based on their results, 25% of men had not
The results of the present study revealed changes in the men’s seen their wives naked after the mastectomy. But the results
sexual life after breast cancer diagnosis and removal of their of 2 other studies indicated that women’s breast loss did not
wives’ breasts. The couples’ sexual desire and frequency of sex affect intimate relations between the couple.2,25 Breast cancer
were affected by breast cancer and its treatment. Most partic- patients react to their spouse’s response to their appearance
ipants expressed that the frequency of their sex has decreased. changes; if the spouse’s response is positive, the process toward
In addition, there was a variation in both the rate of sexual couples’ physical intimacy is initiated. In contrast, if the
desire and the frequency of sex after breast cancer diagnosis spouse’s response is negative, the woman feels rejected and
in their wives and during the treatment. Men’s sexual desire thus with draws physically and emotionally from her
was varied based on the severity of the treatment husband.14 Being sensitive to the behavior of her spouse and
complications or the patient’s various unpleasant conditions the feeling that he is losing interest in her are also major
during the treatment. For example, in the first days after the barriers to a woman’s coping with her breast cancer
mastectomy or during chemotherapy, the couples’ sexual disease.28
relationship has been stopped, but resumed in some cases In a study by Holmberg and colleagues,29 the men unani-
after the wives’ recovery from uncomfortable symptoms. mously believed that sex with their wives would be frivolous
Moreover, both the quality and quantity of the couples’ sexual in comparison to the potential loss of them in the critical phases
relationship in the past had a great impact on their sexual of breast cancer diagnosis and treatment. However, some
relationship after the disease. Sim- ilar studies confirm the factors such as the desire for reproducing, promoting
association between sexual problems before and after the intimacy in relationship, relieving sexual tension, preventing
breast cancer.12,14 Several studies have also reported decreasing relationship conflict, and impressing one’s peers are reasons
sexual pleasure and decreasing frequency for interest in sex. Instead, avoidance motives can be sexual
frustration, loss of couples’ relationship interest, and
relationship conflicts. The

avoidance has unpleasant outcomes, such as anxiety and successful marriage depends on successful sexual relation-
tension in the person who is doing the avoiding.30
Another major theme in the present study was sexual ab-
stinence. Some participants, despite having interest in
coition, had no sexual intercourse with their wives or did not
enjoy coition. Both the unpleasant physical conditions and
psychological problems of women with breast cancer caused
feelings of suffering in their husbands and resulted in sexual
abstinence. Despite the men’s desire to have sex with their
wives, they felt annoyance during the sexual intercourse
because of some difficulties in their wives such as pain in
their surgical scar, nausea, vomiting, fatigue, or feeling of
discomfort during the coition. So repeating this experience
led gradually to some sexual frustration. The women’s
unpleasant emotions including reluctance, moodiness,
depression, and anxiety also led to sexual frustration in their
husbands. It has also been reported in many other studies that
physical problems following the treatment of breast cancer in
women have caused sexual behavior disorders in their
husbands.9,10,12Y14,26 Helene26 found that most men had no sex
with their wives for fear of harming them during the
treatment period. Several studies also suggested that lack of
interest in having sex of patients with breast cancer with their
husbands was one of the reasons for the couples’ sexual
relationship disruption that could lead to men’s withdrawal
from their sexual desire and energy as a kind of self-protective
reaction to their wives’ depression and anxiety.12,13,26 In
addition, men’s sexual desire has been affected by decreased
marital relationships, loss of sexual satisfaction, increased
distress during sex,
anger, anxiety, resentment of their wives, and loss of
romantic 9,22,31Y33
thoughts.
Most participants in the present study accepted their wives’
disease and helped them to treat and improve their mental
condition and tried to adjust to their own unpleasant sexual
problems. They tolerated sexual restraint and tried to have nor-
malized intimate relations with their wives. The participants and
their wives were Muslims (Shiite). Most participants believed
that frustration with sex and their wives was a kind of exam-
ination by God, that is, God wanting to see if they would endure
these difficulties or they would deviate. The men believed that if
they had no immoral behavior, God would help them to tolerate
sexual abstinence. Because the Holy Quran, in Chapter Talaq,
verse 4, says: ‘‘Whoever is careful of (his duty to) Allah
(God), He will make easy for him his affairs.’’ In addition, the
participants tried to avoid ogle and lechery. According to
Islam, men and women who are strangers to each other are not
allowed to be alone with each other in a closed area.34 The
Holy Quran, in Chapter Noor verse 30, advises men: ‘‘Say to
the believing men that they should lower their gaze and guard
their modesty that will make for greater purity for them, and
Allah (God) is well acquainted with all that they do’’.
Therefore, the participants following their religion believed
that they should refrain from ogle and lechery. Also in Islam,
sex out of marriage and masturbation are strongly
condemned and considered as sin. Therefore, the men
participating in the present study said that they never
committed such behaviors. Conversely, sexual relationship
within the marriage is highly respected. Muslims believe that
ship.35 The participants believed that such religious obliquity and to remain faithful to their ill wives by sexual
practices as fasting and praying could protect them from restraint. It seems necessary that Iranian health system pro-
obliquities and suppress their escalating sexual desire. viders pay more attention to these men in order to address
However, Shiite Muslims have the tradition of temporary
marriage, and a man is allowed to marry more than 1 wife
especially when his wife is sick, but because of cultural
barriers, remarriage is unusual in Iranian society. In
addition, Iranian women also strongly oppose their
husband’s remarriage. Some participants in the present
study, despite having a desire to remarry, did not because
of their wives’ opposition and the possibility of
psychological trauma to them. Commitment to preserve
marriage in the participants was another finding of the
study. None of the participants reported thinking of
divorcing or leaving their wives. Although Islam allows
men to divorce under special conditions, staying together
with their spouses is more recommended than separation
from each other. Similarly, according to Huey, 36 strong
religious beliefs and attending church were strong
protectors against having out-of-marriage sex. Generally,
the stronger the couples’ religious beliefs, the less likely their
extramarital sex.37,38 Walsh et al10 reported that only a few
women (about 3%) separated from their husbands, and
about 12% terminated the relationship with their spouses
after having received the diagnosis of breast cancer.
These authors attributed lack of a husband’s emotional
support from the patients has stopped the couples’
relationship.
Effort to normalize the relationship was another major
theme in the present study. Most participants, trying to
continue their sexual relationship with their wives, believed
that the continuity of a sexual relationship was the main
reason for the continuation of their marital relationship and
the mental strengths in themselves and their wives. The
participants forget their problems and strengthen their
partner’s self-confidence through their motivations to have
a sexual relationship with their wives. Although the men in
the present study were suffering from limitations of sexual
satisfaction during their wives’ disease, they believed that
this issue could not cause them to abuse their ill wives or
leave them. Fobair and Spiegel16 suggested that physicians
‘‘advise your patient to create and maintain open
communication with her partner, Iand remain sexually
active as much as possible, as engaging in sexual activity
actually helps maintain sexual desire.’’
n Conclusions
Iranian men experiencing breast cancer in their wives
suffered from some sexual issues. These men may have been
forgotten and are not considered as individuals requiring
support by the health system. There is no specialized
center in Iran for the men who have wives with breast
cancer to consult about their sexual issues. So they are not
informed of what to anticipate, and they are not
supported in their efforts to cope with their sexual
problems. However, although the participants in this
study suffered from sexual frustration, they tried to avoid
their sexual problems. They should find solutions and im- 2. Rabin E, Heldt E, Hirakata V, Bittelbrunn A, Chachamovich E, Fleck M.
plement projects, based on the culture and religion of the Depression and perceptions of quality of life of breast cancer survivors and
husbands of women with breast cancer, to increase their sex- their male partners. Oncol Nurs Forum. 2009;36(3):E153.
3. Harirchi I, Kolahdoozan S, Karbakhsh M, et al. Twenty years of breast
ual satisfaction. cancer in Iran: downstaging without a formal screening program. Ann
Oncol. 2010;22(1):93.
4. Emilee G, Ussher JM, Perz J. Sexuality after breast cancer: a review.
Maturitas. 2010;66(4):397Y407.
n Study Limitations 5. Deapen D. Breast implants and breast cancer: a review of incidence, de-
tection, mortality, and survival. Plast Reconstr Surg. 2007;120(7):S70.
6. Jun E-Y, Kim S, Chang S-B, Oh K, Kang HS, Kang SS. The effect of a
The results of the present study can be extended only for other
sexual life reframing program on marital intimacy, body image, and
populations with similar demographic, cultural, and religious sexual function among breast cancer survivors [published online ahead of
characteristics. Although the present study explains men’s print]. Cancer Nurs. 2011;34(2):142.
sexual issues and suggests practical solutions for sexual prob- 7. Hoga LP, Mello DR, Dias AR. Psychosocial perspectives of the partners
lems in the husbands of patients with breast cancer, it does of breast cancer patients treated with a mastectomy: an analysis of
not determine the effectiveness of these strategies. Therefore, personal narratives. Cancer Nurs. 2008;31(4):318.
8. Cido´ n EU. Sexual problems after breast cancer: the underreported
more studies are needed to assess the impact of such solutions
symptoms. Gynecol Oncol. 2010;116(1):147.
on the sexual well-being of these couples. 9. Carole H, Teresita R, Ruth M. Sexuality and intimacy issues facing
women with breast cancer. Oncol Nurs Forum. 2006;33(6):1163.
10. Walsh SR, Manuel JC, Avis NE. The impact of breast cancer on younger
women’s relationships with their partner and children. Fam Syst Health.
n Implications for Practice 2005;23(1):80Y93.
11. Moreira H, Crespo C, Pereira M, Canavarro M. Marital quality among
women with breast cancer: the role of marital intimacy and quality of
This study suggests that healthcare providers in Iran or other life. Psicooncolog´ıa. 2010;7(1):61.
Muslim countries, even countries where Muslims are in the 12. Bre´dart A, Dolbeault S, Savignoni A, et al. Prevalence and associated
minority, should be more sensitive to the consequences of factors of sexual problems after early-stage breast cancer treatment: results of
breast cancer in women for their Muslim husbands’ sexual a French exploratory survey. Psychooncology. 2011;20(8):841.
issues. One of the practical applications of these study results 13. Schain WS. The sexual and intimate consequences of breast cancer treatment.
CA Cancer J Clin. 1988;38(3):154Y161.
is that sexual counseling units, in which male counselors help 14. Northouse LL, Cracchiolo-Caraway A, Appel CP. Psychologic
the husbands of women with breast cancer with their sexual consequences of breast cancer on partner and family. Semin Oncol Nurs.
issues to address and promote satisfactory sexual lives for them, 1991;7(3):216Y223.
need to be available in these countries’ health system. In 15. Speer JJ, Hillenberg B, Sugrue DP, et al. Study of sexual functioning
addition, healthcare professionals such as nurses need to determinants in breast cancer survivors. Breast J. 2005;11(6):440Y447.
16. Fobair P, Spiegel D. Concerns about sexuality after breast cancer. Cancer J.
develop an understanding of the importance of sexual issues in
2009;15(1):19.
Muslim men experiencing breast cancer in their wives. We 17. Wimberly S. Partner Support and Psychosexual Adjustment to Breast Cancer
suggest supplementary education and training of the nurses [PhD thesis]. Miami, FL: University of Miami; 2007.
and other healthcare professionals who are in contact with 18. Wimberly SR, Carver CS, Laurenceau J-P, Harris SD, Antoni MH.
Muslim men living with wives with breast cancer. They could Perceived partner reactions to diagnosis and treatment of breast cancer:
impact on psychosocial and psychosexual adjustment. J Consult Clin Psychol.
provide much-needed educational materials such as pamphlets,
2005;73(2):300Y311.
compact disks, videotapes, and the like to correct the sexual 19. Rowley-Green G. Sexual Intimacy and Fear of Recurrence From the Per-
behaviors of these couples based on their culture and religion spective of Partners of Breast Cancer Patients [MA thesis]. Los Angeles, CA:
and also to recommend to them to pay attention to each University of Southern California; 2003.
other’s sexual demands in order to increase their sexual 20. Daly J, Davidson P, Chang E, Hancock K, Rees D, Thompson DR.
satisfaction. Cultural aspects of adjustment to coronary heart disease in Chinese-
Australians: a review of the literature. J Adv Nurs. 2002;39(4):391Y399.
21. Thune´-Boyle IC, Stygall JA, Keshtgar MR, Newman SP. Do religious/
ACKNOWLEDGMENTS spiritual coping strategies affect illness adjustment in patients with cancer?
A systematic review of the literature. Soc Sci Med.
The authors thank all participants and staff at the units in- 2006;63(1):151Y164.
volved in this study for their kind cooperation and support: 22. Beutel ME, Sto¨bel-Richter Y, Bra¨hler E. Sexual desire and sexual
Sayed-al-Shohada Breast Cancer Research Center, Sayed-al- activity of men and women across their lifespans: results from a
representative German community survey. BJU Int.
Shohada radiotherapy clinic, and Imam Reza chemotherapy
2008;101(1):76Y82.
clinic. They acknowledge Isfahan University of Medical Sciences 23. Sandhya S. The social context of marital happiness in urban indian couples:
for its funding contribution. interplay of intimacy and conflict. J Marital Fam Ther.
2009;35(1):74Y96.
24. Howsepian BA, Merluzzi TV. Religious beliefs, social support, self-
efficacy and adjustment to cancer. Psychooncology.
References 2009;18(10):1069Y1079.
1. Baquet C, Mishra S, Commiskey P, Ellison G, DeShields M. Breast 25. Hilton BA. Issues, problems, and challenges for families coping with breast
cancer epidemiology in blacks and whites: disparities in incidence, cancer. Semin Oncol Nurs. 1993;9(2):88Y100.
mortality, survival rates and histology. J Natl Med Assoc. 26. Helene KH. Breast cancer and sexuality. Sex Disabil. 2002;20(4):261.
2008;100(5):480. 27. Strauss A, Corbin J. Basics of Qualitative Research. London, UK: Sage: 1998.
28. Taleghani F, Yekta ZP, Nasrabadi AN, Käppeli S. Adjustment process in
Iranian women with breast cancer. Cancer Nurs. 2008;31(3):E32.
29. Holmberg SKRNP, Scott LLMS, Alexy WP, Fife BLRNP. Relationship
issues of women with breast cancer. Cancer Nurs. 2001;24(1):53Y60.

30. Impett EA, Peplau LA, Gable SL. Approach and avoidance sexual 35. Abu-Ali A. Ethnic Identity and Religiosity as Predictors of Sexual Attitudes
motives: implications for personal and interpersonal well-being. Pers Among Muslim Adolescent Girls. San Francisco, CA: Alliant International
Relation. 2005; 12(4):465Y482. University; 2003.
31. Meuleman EJ, Van Lankveld JJ. Hypoactive sexual desire disorder: an 36. Huey KM. Who Is Screwing Around Here? The Relationship Between
underestimated condition in men. BJU Int. 2005;95(3):291Y296. Religiosity, Pornography, and Extramarital Sex. Indiana, IN: Purdue Uni-
32. Carvalho J, Nobre P. Sexual desire and related factors. Sexologies. 2008; versity; 2002.
17(1):S117. 37. Allen E, Atkins D, Baucom D, Snyder D, Gordon K, Glass S. Intraper-
33. Graziottin A. How breast cancer can affect sexual function and intimacy. sonal, interpersonal, and contextual factors in engaging in and
Sexologies. 2008;17(1):S22. responding to extramarital involvement. Clin Psychol Sci Pract.
34. Amar A. Understanding the veil: non-stranger sexual assault of a 2005;12(2):101Y130.
muslim woman. J Forensic Nurs. 2007;3(3/4):134. 38. Hill Z, Cleland J, Ali M. Religious affiliation and extramarital sex among
men in Brazil. Int Fam Plan Perspect. 2004;30(1):20Y26.
Online - 2455-3891
Vol 11, Issue 6, 2018 Print - 0974-2441
Research Article
EXPLORING POSSIBLE CAUSES FOR DELAYS SEEKING MEDICAL TREATMENT AMONG

INDONESIAN WOMEN WITH BREAST CANCER
IRENE MARCELLINA SUNARSIH1*, YAYI SURYO PRABANDARI2, TEGUH ARYANDONO3, SOENARTO

SASTROWIJOTO4
1
Indonesian Cancer Foundation Yogyakarta Special Region Branch, Indonesia. 2Department of Health Behavior, Social Medicine and
Environment Health, Faculty of Medicine Universitas Gadjah Mada, Indonesia. 3Department of Surgery, Faculty of Medicine, Universitas
Gadjah Mada, Indonesia. 4Center for Bioethics and Medical Humanities, Faculty of Medicine, Universitas Gadjah Mada, Indonesia.
Email: yayisuryo@ugm.ac.id
Received: 08 February 2018, Revised and Accepted: 13 March 2018
ABSTRACT
Introduction: The duration of time delay of breast cancer patients can be significantly long, depending on the affecting situation and environment.
A study on the profile of cancer patient time delay of breast cancer cases undertaken at the Oncology Hospital in Surabaya Indonesia showed that
patient delay was highest with 36,18%,while referal delay was 25% and treatment delay was 13,16%.
Objective: This study aimed to explore the underlying causes for the delays seeking medical treatment experienced by Indonesian women with breast
cancer and what kinds of non-medical treatment were pursued instead.
Methods: This study used qualitative methods with in-depth interviews among 20 participants to reveal the causes of delaying medical treatment by
patients with breast cancer. Subjects were chosen from women diagnosed with breast cancer who had delayed their medical treatment for various
reasons and were currently undergoing medical treatment at a hospital.
Results: The underlying causes for the delay of medical treatment were varied, including psychological reasons (fear of surgery, being worried about
adverse effects of the medicine, making troubles to the other people, afraid of losing breast, or losing husband); lack of knowledge about cancer
(unfamiliar with the symptoms of cancer, possible cancer cure by nutritious food, more trust in alternative medicine, myth, participant’s husband did
not approve her surgery, only rely on prayer, forgot if she was sick); factors deriving from health service system (limited facilities, a false diagnosis,
queue rooms/radiotherapy/for hospitalization, the radiotherapy equipment was out of service, patient unable to walk, high out-of-pocket cost, and
doctors were not communicative). During time delay, some patients have also sought non-medical treatment with herbal medicines, non-herbal
medicines, and non-conventional treatment (laser, reiki, acupuncture, and vest treatments).
Conclusion: Many factors affect the delay of medical care among patients with breast cancer. Often, these delays influence the patients to seek
alternative treatments.
Keyword: Breast cancer patient, Delay of medical treatment, Non-medical treatment.
© 2018 The Authors. Published by Innovare Academic Sciences Pvt Ltd. This is an open access article under the CC BY license
(http://creativecommons. org/licenses/by/4. 0/) DOI: http://dx.doi.org/10.22159/ajpcr.2018.v11i6.25211
INTRODUCTION
namely, appraisal delay, illness delay, scheduling delay, and treatment
Cancer is a disease with significant social, economic, psychological, delay [5]. The duration of time delay can be significantly long,
and spiritual impact. In 2012, the estimation of cancer morbidity depending on the affecting situation and environment. A study on the
and mortality ranked breast cancer among Indonesian women as the profile of cancer patient time delay of breast cancer cases undertaken at
highest [1]. Results of the Basic Health Research (Riskesdas) in 2013 the Oncology Hospital in Surabaya showed that patient delay was
showed that cancer prevalence in the Special Region of Yogyakarta highest with 36.18%, while referral delay was 25%, and treatment delay
was 4.1% of the population. This prevalence was the highest rate in
was 13.16%. One significant factor relating to patient delay in breast
Indonesia and even exceeds the national annual prevalence of 1.4% [2].
cancer cases in this study was tumor size. Direct and indirect patient’s
Registration of tumors at Dr. Sardjito General Hospital in 2015 showed
that among the ten most prevalent cancers according to organ or arrival had no significant influence on patient delay. Alternative
location in men and women, breast cancer ranked number one. medicine had significant influence on medical treatment delay [6]. These
Similarly, among the ten most prevalent cancers according to organ or delays bring the patient to be in stages of denial, anger, bargaining,
location in women, breast cancer also ranked the highest. Distribution depression, and then finally reaching some acceptance [7]. These
of breast cancer based on age showed the highest annual prevalence is processes may cause patients to look for other options before seeking
between the ages of 45–54-year-old [3]. Many people in the Indonesian medical treatment. Myths about cancer and alternative medicine
society have no proper knowledge about cancer. This fact may be the contribute to not optimal cancer management, due to the patients
cause for patients delaying to seek treatment and presenting late to receiving misinformation and as a result, delaying seeking professional
hospitals with an advanced stage of cancer [4]. medical treatment.
There is an illustrated model of research which calculates total delay

This study aimed to explore the underlying causes of delays for seeking
for all variations of physical disease. There are several levels of delay,
medical treatment by Indonesian patients with breast cancer and what
kind of non-medical treatment the patients have sought instead.

Sunarsih et al.
Asian J Pharm Clin Res, Vol 11, Issue 6, 2018, 284-288
METHODS
medical treatment. To attempt the alternative vest treatment, three
This study used qualitative methods with in-depth interviews to reveal participants purchased the vests. But in the end, only one participant
the reasons for delaying medical treatment by patients with breast actually wore the vest.
cancer in Indonesia. The researcher is a master of public health and
first vice chair of the Indonesian Cancer Foundation Yogyakarta Special According to evidence-based medical research, there are several
Region Branch. This research was conducted because many patients levels of delay, namely, appraisal delay, illness delay, scheduling
with breast cancer present at hospitals in advanced stages of the delay, and treatment delay. The duration of time for delay can be
disease in Indonesia. long, depending on the affecting situation and environment. Total
time of delay for all cases (n=20) was between 1 month to 10 years:
Subjects were selected from patients diagnosed with breast cancer Categorically, eight persons waited between 1 and 6 months, 1 person
and undergoing medical treatment at Dr. Sardjito General Hospital, waited 6–12 months, 10 persons delayed 1–5 years, and 1 person
Yogyakarta, Indonesia, who had a history of delayed medical delayed more than 5 years.
treatment for various reasons. The sample population was 20 patients
who were differentiated into the following categories: Those living DISCUSSION
in Yogyakarta, Indonesia, and its surroundings and those living in
areas at least 2 h away from city center via public transportation; Causes of delay
those younger than 50 years old and those older than 50 years old; One or multiple adverse effects of cytotoxic drugs are experienced by
and those with education up to high school and those with education all cancer patients who are undergoing chemotherapy [8]. The stories
higher than high school. Subjects were interviewed using interview of the suffering caused by the adverse effects of chemotherapy have
guides. Data was transcribed verbatim. Analysis start from code, been heard by new patients and considered as a frightening experience.
catagory and theme. The data was arranged in narrative sentences, This perception may hinder the patient’s intention to immediately
interpretation, summarized and evaluated. seek any medical treatments. Moreover, one study showed that breast
cancer also left psychosocial impacts, which involve patients’ worries,
The study protocol was approved by the Medical and Health Research sexuality, and body image. Breast cancer management was often
Ethics Committee Faculty of Medicine Universitas Gadjah Mada (KE/ delayed because of the several reasons [9]. Essentially, they needed
FK/226/EC/2016) in March 2016. Informed and written consent form time and help to accept the reality of their condition and finally seek
was obtained from each participant before the interview. professional and conventional medical treatment. Examining the
sociodemographic factors and reasons associated with delays in breast
RESULTS cancer presentation, a study of Nigerian women found the delay of
treatment was often due to ignorance of the illness and fear of removal
Causes of delay of their breasts [10].
There were a number of underlying causes for the delay of medical
treatment, which included causes related to psychological factors, Lack of knowledge about cancer symptoms will contribute significantly
lack of knowledge about cancer, and the limitation of the existing to delays in medical treatment [11]. One study showed that women who
health service system. There were 18 causes for the delay of medical delay treatment up to 60 days after the diagnosis of advanced cancer
treatment. The causes are presented in Table 1. significantly bear the risk of death [12].
Seeking of non-medical treatment Another study examined the power of suggestion in traditional Javanese
While delaying seeking professional medical treatment, patients sought healing treatment, showing that suggestions arise from both the patient
out a variety of non-medical treatments such as herbal medicine, non-
and the healer. Even though patients often feel uncomfortable because
herbal medicine, and non-conventional treatments, which are presented
of their illness, they still have a hope of recovery [13]. The patients
in Table 2.
sometimes will improve nutritious food intake in an effort to cure their
cancer without seeking the available conventional medical treatment,
Alternative medicines provided by traditional healers could be in the
even though some participants have doctoral level of education as seen
form of herbal medicine or non-herbal medicines. One of the traditional
in this study’s findings.
healers gave fermented solution from herbal medicine, containing
fermented herbal material and yeast.
The factors causing errors in patients’ perceptions include inaccurate or
insufficient information, and this was a major factor in misinterpreting
There was one religious leader (imam) who as a healer not only
the possibility of an alternative cure [14]. Many patients believe
provided spiritual motivations but also provided herbal capsules and
in alternative medicine because the information often comes up
stew, cotton swabbing of lumps, prayed on water, and according to
repeatedly in an intimate setting, while in more clinical settings such as
local folklore, was known for transferring the diseases of four people
hospitals, the medical information given reflects heavily on the doctor’s
to eggs. There was a naturopathic doctor who also offered alternative
medicines using white turmeric capsules. The doctor has a history as business and busy schedule.
a stage IV breast, ovary, and lung cancer patient. Instead of seeking
In Javanese and Asian culture, the husband is the head of the household,
medical treatment, her grandma gave her white turmeric as a raw
vegetable and she felt better. so the necessary decisions must involve the husband including
medical treatment decisions. This arrangement is not beneficial for
Other medication (non-conventional treatment) most patients because the cancer will quickly develop. As one expert
Aside from medical treatment, some participants prefer other forms of explained Javanese society in general still holds the view that the
intervention including laser, reiki, acupuncture, and vest treatments. position of a wife is dependent on the husband. This dependency
Involving laser treatment, a participant stated that she had already pattern implies that women are considered not independent and are
undergo four laser therapies by a doctor with no significant effect, and unable to determine their life direction and make decisions related to
then the doctor recommended surgery. Concerning reiki treatments, personal health and family issues [15].
this practice requires practitioners to handrub the back of the patients
along with making prayers and prescribing a fruit juice recipe with a For a successful intervention, it is necessary to develop better dialogue
variety of fruits every week. Acupuncture was done by puncturing a between health-care workers and patients about the treatment process.
needle into patients’ skin and applying heat or electrical stimulation An expert from the American Board of Internal Medicine describes the
at acupuncture spots. One participant who underwent this method professional elements of medical practice as altruism, the essence
felt that the lump in her breast got bigger. She then switched over to of being professional, best attention to the patient, and respect for
others including patients, families, other doctors, and other health-
2
Sunarsih et al.
Table 1: The causes of medical treatment delay

There is an opportunity to do radiotherapy in other cities which also
serve health insurance patients with faster waiting time, but many
Factors Contributing causes
patients do not use the opportunity because it increases their out-of-
Psychological factors Fear of surgery pocket cost for transportation and lodging. According to a recent press
Afraid of the adverse effects of the release about the Indonesian National Health Insurance (NHI) [19]
medicine and the explanation of the hospital director, there was a surge in NHI
Being troublesome to other people
program participants. This increase resulted in long queues because
Losing her breast or her husband
the hospital facilities have not been upgraded to accommodate this
Lack of knowledge of Unfamiliar with the symptoms of change in policy. This fact resulted in patients who came from outside
cancer cancer the city to have increased costs for lodging and/or transportation.
Cure cancer by nutritious food
Belief in alternative medicine Because of the increased number of patients and the added burden
Belief in myth on the radiotherapy equipment, it was reasonable to have delays if
Participant’s husband did not
the device needs to be repaired. Based on the management of the
approve her surgery
infrastructure of radiology and radiotherapy equipment, the quality
Only rely on prayer
of radiology services is not only determined by the quality of the
Forgot if she was sick
Health services Limited facilities human resources of the service providers but also depends on the
A false diagnosis quality of facilities, infrastructure, and equipment used [20]. Therefore,
Queue rooms/radiotherapy/for the ability of the radiographer to manage increased patient load, in
hospitalization particular, maintaining radiology infrastructure within the limits of
The radiotherapy equipment was out his or her authority, greatly determines the quality of the results of the
of service services provided. If the radiographer declares that the device is unfit
Patient unable to walk for use, it must be repaired first to maintain the quality of patient care,
Cannot afford the cost and this shutdown of equipment leads to further delayed treatment for
Doctors were not communicative the patient.
One participant signed up six times to consult with a doctor at the

Table 2: Non-medical treatment hospital and was unsuccessful because the number of patients for
doctor consultation was limited. This delay happened because the
Alternatives Kinds of alternatives doctors also have other activities such as visiting the inpatients,
coordination meetings, teaching, seminars, symposia, and other
Alternative herbal medicines Herbal medicine to be boiled,
reasons, so they were forced to limit the daily number of patients
as capsule, solution, or scrub
served. Under these present circumstances, the hospital expects
and fermented solution
Alternative non-herbal Transferring disease to goat the patients to be willing to wait to receive services by the existing
medicines or eggs specialists.
Sucking it with leech
Pulling out the disease Patients unable to walk cannot perform laboratory tests and that
Taking disease out with cotton handicap results in not getting the medicine covered by health
and with spoon insurance, despite the advice that the treatment should not be
Puncturing and rubbing feet interrupted. This situation has indicated the need for home services
Flapping hands on the floor that can perform health and sampling laboratory examination.
Wiping back with tissues Concerning palliative care policy, in response to the increase of diseases
Stomping wood with feet such as cancer, degenerative diseases, stroke, HIV/AIDS, especially for
Other Laser, reiki, acupuncture, and the advanced stages of illness, palliative care is needed in addition to
medication (non-conventional vest treatments currently available services to facilitate promotive, preventive, curative,
treatment) and rehabilitative efforts [21]. It is necessary to improve the quality
of life of patients and their families. Ideally, palliative care can be
adequately done in a patient’s home (home care). Certainly, at this time,
care workers [16]. Due to the traditional paternalistic hierarchy, the the homecare services are not covered by health insurance.
professionalism of doctors needs to be improved, and sometimes it is
necessary for someone to advocate or mediate between the doctor and Essential drugs are sometimes unavailable, and this situation often
the patient. happens in community health services in Indonesia. This dilemma is
not in accordance with regulations on the standard of pharmaceutical
According to research about the influential factors on delays in seeking service in hospitals which state that the organization of pharmaceutical
medical services, other influential factors are age, education level, services in the hospital shall ensure the availability of pharmaceutical
family income, and availability of health insurance [17]. As a result, preparations, medical devices, and consumables that are safe,
doctors need to clearly explain the importance of taking medication beneficial, useful, and affordable [22]. According to the rational use
and making consultation with their doctor regularly. Not knowing the of medicines protocols, drug planning in medical facilities including
importance of early diagnosis of cancer and treatment, patients often pharmacies, hospitals, and health centers should be done properly to
delay seeing a doctor on the grounds that doctors will not find the prevent any occasion of running out of stock or inability to meet the
disease and it will be a waste of time and money [18]. potential demand.
Class A hospitals as cancer referral centers which also serve patients Health insurance can be an important factor for meeting the patients’
from outside of the Special Region of Yogyakarta cannot serve a large needs and utilization of health services. Today, there are new
number of patients immediately. According to the person in charge of regulations of the NHI in Indonesia concerning access to health services
the Radiotherapy Department, the hospital only has two radiotherapy [23]. Sindo, in a press release about a study conducted on ASEAN costs
equipment to serve 80 patients each day, with each session running in oncology departments [24], published the results that showed cancer
about 15–20 min. Radiotherapy service can require between 25 and treatment costs brought major impact on the ASEAN society and is a
30 visits, causing patients’ waiting time to backlog to more than a year. major cause of poverty throughout Asia.
2
Sunarsih et al.
Due to limited facilities, this difficult situation has demanded from the
cancer patients which found that the healthy behavior of patients with
patients additional money and strong motivation to continue seeking
breast cancer is affected by both external factors, including their family
conventional services. Furthermore, to prevent further delay in medical
and environment and internal factors, such as patient perceptions of
treatment, family support is needed.
their condition and sense of self-efficacy [32].
In this study, some participants only rely on prayer without receiving
Other medication (non-conventional treatment)
proper treatment. This faith-based belief is in line with another research
Laser radiation has specific attributes: monochromaticity, high
which stated that there exists an excessive faith in religion, and trust in
coherence, and polarization. These properties result in the extensive
spirituality, which ends up in delaying seeking medical treatment [25].
use of lasers in medicine. Laser devices can be assigned into three basic
One expert inferred that psychotherapy which is aimed to cure mental
groups by means of their level of energy: High, medium, and low energy.
illness needs to not only rely on medical devices and best practices but
All of these types of radiation are used in modern medical practices [33].
also on combining religious aspects as well to be successful in such
situations [26].
Reiki is traditionally considered to be effective for the relief of pain,
dyspnea, and anxiety. Patients who request reiki usually feel increased
According to a researcher concerning the factors for delay among
calm, peace, and well-being. Reiki is received by the gentle touch of
patients with breast cancers in screening at medical facilities, there
hands and can be used in most conditions because it is noninvasive and
are some factors that correlate significantly with delayed treatment,
the patient is fully clothed [34]. One healer who gave reiki treatment
and these concerns include education, cost affordability, information
also gave a fruit juice recipe with a variety of fruits every week. Fruit
exposure, spouse/family supports, and screening behavior (e.g. never
is a food with high nutritional value and antioxidant content known to
conducting breast self-examination) [27]. Contrarily, in an analysis of
have antitumor and anticancer properties, which can make the body
factors affecting delays in treatment of breast cancer, one study found
feel fresh and better.
no correlation between related factors such as knowledge, occupation,
fear, family support, health insurance, transportation cost, with seeking
Acupuncture is the stimulation by subcutaneous puncture of specific
treatment except hospital behavior, family history, and education,
points on the body. The method can vary, but the most well-known type
which were weakly correlated with delays in breast cancer treatment.
in the United States is the insertion of thin metal needles through the
They also found no other significant factors affecting treatment
skin into nerve ganglia based on a traditional oriental practice [35].
delays in patients with breast cancer [28]. These results are in direct
The efficacy of this practice continues to attract current attention and
contradiction with the multifactorial findings of this study.
debate.
Non-medical treatment
Out of 20 participants, as many as 19 (95%) people sought alternative A cancer vest is a device recently created for breast cancer treatment.
medicine. Most participants were of average to higher education According to the inventor, the device is an electrical capacitance volume
level. This finding is suggesting that educational background did not tomography that works as a low electrical power current which is
necessarily affect medical or non-medical treatment-seeking behavior. focused to a certain nerve spot on cancer. Doctors and oncologists are
The Basic Health Research (Riskesdas) in 2013 stated that in Indonesia, very cautious in addressing the findings that claim it can cure breast
as much as 30.4% of households seek out alternative medicine. A higher cancer without any clear empirical evidence. Starting in January 2016,
number was found in Yogyakarta, and the highest was in South Borneo the Indonesian Ministry of Health forbad vest practice until enough
at 61.3%. evidence was given to support its availability. The vest itself does not
have any marketing authorization and based on a regulation about
The local religious network Ulama not only provides spiritual marketing authorization of medical devices and household supply
motivation, and alternative healers, but also grants prayer services every medical device and/or household medical supply imported,
and provides herbal medicines, capsules, stew, and cotton swabbing used and/or distributed in Indonesia territory must have prior
for lumps, while some spiritual leaders are known to pray over water marketing authorization [36]. All of the participants that underwent
and recent folklore records one man (imam) transferring the disease the above alternative treatments (laser, reiki, acupuncture, and vest)
of four people to eggs. Another naturopathic doctor is known to offer were not getting any improvement and ultimately switched to medical
alternative medicines using white turmeric capsules, for example, but treatments.
the doctor continues keeping anamnesis and taking account of medical
examinations by another doctor. A study on perceptions about breast self-examination among women
with risk of cancer found that there was a positive correlation between
Many studies have been done to investigate the properties of plants as perceived benefits to perform breast self-examination, perceived
potential anti-cancer drugs against breast cancer. The active ingredients barriers of women with cancer risk to perform breast self-examination,
of the plants include phenolic compounds such as tannins, flavonoids, and their behavior in performing breast self-examination. However,
and phenolic acids, which possess anticancer properties [29]. The after further analysis, those variables did not strongly correlate with
existence of crude herbal powder in capsules produced by herbalists actual breast self-examination behavior. The strongest correlated
or naturopathic doctors is in violation of quality requirements of variables were respondents’ knowledge, respondents’ education, and
traditional medicines, which state that drugs in the form of capsule can accuracy of information about breast self-examination [37].
only consist of the extract of active ingredients [30].
CONCLUSION
A recent research stated that some of the reasons patients seek
Factors causing patients with breast cancer to delay seeking medical
alternative medicine are family and friends’ recommendation, family
treatment included the following: Psychological factors, lack of
sanctions, felt compatibility and benefits, and faith in a healer. These
knowledge, and limited access to health services. In response, the
factors together strongly influence Malaysian and Asian culture [31].
patients sought non-medical treatment such as herbal medicines to be
This issue is a common occurrence in developing countries with
boiled and prepared traditionally, turmeric capsules, salves or scrubs,
limited health facilities and a health system different from modern
and fermented solutions. They also used non-herbal treatments,
Western medical practices. Some participants stated that they seek
such as faith healing with some alternatives involving transferring
alternative medicines because of family and friends’ recommendations,
their disease to goats or eggs, sucking it out with leeches, pulling
commercial advertisements, compatibility with the medication, and
out the disease by pinching, taking disease out with cotton swabs or
faith in healers. These patient testimonies are in line with a study on the
with spoons, puncturing and scraping feet, flapping hands on the
correlation of self-efficacy with treatment-seeking behavior in breast
floor, wiping back with tissues, and stomping on wood with bare
2
Sunarsih et al.
feet. Some participants prefer other non-conventional alternative

news/delaying-treatment-increases-risks-for-advanced-breast-cancer-
medicine practices recently made popular with commercial Internet patients. [Last accessed on 2015 Jul 17].
advertisements (laser, reiki, acupuncture, and vest treatments). Based 13. Triratnawati A, Wulandari A, Marthias T. The power of suggestion in
on the widespread availability of these various alternatives, this study’s traditional Javanese healing treatment. J Komun 2014;2:280-93.
findings reveal the importance of appropriate community education 14. Sunaryo. Psychology and Nursing. Jakarta: EGC; 2004.
about cancer treatment and prevention and the recommendation that 15. Atik CB. Self-actualization of women in the cultural system of Java. J
increased availability of modern, evidence-based health services must Sosiol Dilema 2012;29:13-22.
be achieved with national promotional programs. 16. Shrank WH, Reed VA, Jernstedt GC. Perspective fostering
professionalism in medical education. A call for improved assessment
and meaningful incentives. J Gen Intern Med 2004;19:887-92.
ACKNOWLEDGMENT
17. Budiman A, Khambri D, Bachtiar H. Factors that affect the treatment
This study would have not been completed without the excellent compliance on tamoxifen-treated patients after breast cancer surgery.
cooperation of the breast cancer patients as participants. Special thanks J Kesehatan Andalas 2013;2:20-4.
18. Kills KD. Report on the Problems of Diagnosing Cancer Early and Why
and sincere appreciation goes to the Dean of Faculty of Medicine,
we Need to Solve Them. A Cancer Research UK and Tesco; 2012.
Public Health and Nursing, Universitas Gadjah Mada, the staff of the 19. Kesehatan BP. There was a Surge of JKN Program Participants on May
Indonesian Cancer Foundation and the head of Dr. Sardjito Hospital for 1, 2017; Press release on 3 May 2017.
supporting this research. 20. Decree of the Minister of Health No. 375 / Menkes / SK / III / 2007 on
Standards of Radiographers; 2017.
AUTHOR’S CONTRIBUTIONS 21. Decree of the Minister of Health No. 812/Menkes/SK/VII/2007 on
All authors contributed equally to the writing and revising of this article. Palliative Care Policy; 2007.
22. Regulation of the Minister of Health of the Republic of Indonesia No.
CONFLICT OF INTEREST 72/2016 on the Standard of Pharmaceutical Services in Hospitals; 2006.
23. Presidential Regulation of the Republic of Indonesia number 12 of 2013
The authors state that there is no conflict of interest in this study. on national health insurance; 2017
24. Sindo. Result of a Study on the Socioeconomic Burden of Cancer in
REFERENCES South East Asian Countries; Press Release on August, 25; 2015.
25. Gullatte MM, Brawle O, Kinney, Power B, Mooney K. Religiosity,
1. Globocan. Estimate Cancer Incidence, Mortality and Prevalence in spirituality, and cancer fatalism beliefs on delay in breast cancer
2012 in Indonesia; 2012. diagnosis in African American woman. J Relig Health 2010;49:62-72.
2. Indonesian Ministry of Health. Riset Kesehatan Dasar 2013 (Basic 26. Ariyanto D. Psychotherapy and prayer. Suuhf 2006;18:3-26.
Health Research 2013). Jakarta: Ministryof Health; 2013. 27. Gusti AR, Ni LP. Factors of delay in cancer patients breast in
3. Ghozali A. Tumor Registry Database Pathology Laboratory. performing preliminary examination to the health service. Kemas
Yogyakarta: Installation of Anatomical Pathology Dr Sardjito Hospital; 2016;11(2):276-284.
2015. 28. Arlyana H, Fauziah HN. Analysis of factors affecting treatment
4. Division of Hematology Oncology Department of Internal Medicine. delays in women with breast cancer patients. Proceedings of National
UGM Faculty of Medicine/Dr. Sardjito. Breast Cancer Patients Resume and International Seminar of Research and Community Service of
Data in 2007- 2011: Yogyakarta: Division of Hematology Oncology Muhammadiyah University Semarang; 2014.
Department of Internal Medicine; 2017. 29. Elgadir MA, Salama M, Adam A. Anti-breast cancer fromvarious
5. Andersen BL, Cacioppo JT. Delay in seeking a cancer diagnosis: Delay natural sources, review. Int J Pharm Pharm Sci 2015;7:44-7.
stages and psychophysiologica comparison processes. Br J Soc Psychol 30. Regulation of the Head of the Food and Drug Supervisory Agency
1995;34:33-52. of the Republic of Indonesia Number 12 Year 2014 on the Quality
6. Djatmiko A, Octovianus J, Fortunata N. Profile of cancer delay in cases Requirements of Traditional Medicines; 2014.
of breast cancer in Surabaya Oncology Hospital. Indonesia J Cancer 31. Muhamad M, Merriam S, Suhami N. Why breast cancer patients seek
2013;7:47-52. traditional healers. Int J Breast Cancer 2012;2012. Article ID 689168, 9.
7. Kübler-Ross E. On Grief and Grieving: Finding the Meaning of Grief 32. Julike F, Endang S. The relationship of self efficacy with behavior
Through the Five Stages of Loss. New York: Simon & Schuster Ltd.; seeking treatment in breast cancer patients in RSU Ibnu Sina Gresik. J
2005. Psikologi Klinis dan Kesehatan Mental 2012;1(3):140-6.
8. Kirthi C, Azra A, Mounika R, Syed AA, Aparna Y, Sanjeen S. A study 33. Rola P, Doroszko A, Derkacz A. The use of low-level energy
on the adverse effects of anticancer drugs in an oncology center of a laser radiation in basic and clinical research. Adv Clin Exp Med
tertiary care hospital. Int J Pharm Pharm Sci 2014;6:580-3. 2014;23:835- 42.
9. Kattlove H, Winn RJ. Ongoing care of patients after primary treatment 34. Bullock M. Reiki. A complementary therapy for life. Am J Hosp Palliat
for their cancer. CA Cancer J Clin 2003;53:172-96. Care 1997;14:31-3.
10. Ibrahim NA, Oludara MA. Socio-demographic factors and reasons 35. Wellness Council America. Understanding Acupuncture. WELCOA
associated with delay in breast cancer presentation: A study in Nigerian Online Bulletins. Available from: https://www.co.westmoreland.pa.us/
women. NLM Abbrev Support Care Cancer 2010;18:255-63. Archive/ViewFile/Item/647. [Last accessed on 2017 Jan 17].
11. Simon AE, Waller J, Robb K, Wardle J. Patient delay in presentation of 36. Health. Cancer Clinic Dr. Warsito Utomo Completely Closed after
possible cancer symptoms: The contribution of knowledge and attitudes January 27, 2016. Available from: http://www.Liputan6.com. [Last
in a population sample from the United Kingdom. Cancer Epidemiol accessed on 2016 Jan 27].
Biomarkers Prev 2010;19:2272-7. 37. Desanti OI, Sunarsih IM, Supriyati. The perception of women at risk
12. Simon S. Delaying Treatment Increases Risks for Advanced Breast of breast cancer about breast self-examination in the city of Semarang,
Cancer Patients. 2012. Available from: http://www.cancer.org/cancer/ Java Central. Berita Kedokteran Masyarakat 2010;26(3):152-61.
2
PRACTICAL GUIDE ON
EVIDENCE BASED MEDICINE (EBM)
BLOCK I.9
Clinical Epidemiology and Biostatistics Unit (CE&BU)
Coordinator
Prof. dr. Jarir At Thobari, PhD, D.Pharm

dr. Lukman Ade Chandra, M.Med., M. Phil

YOGYAKARTA
2023
Skills Lab Material Book Block I.9 | 321

PRACTICAL SESSION
LITERATURE SEARCHING
INTRODUCTION
Evidence-Based Medicine is the conscientious, explicit, and judicious use of current best
evidencein making decisions about the care of individual patients. The practice of evidence- based
medicine means integrating individual clinical expertise with the best available clinical evidence from
systematicresearch.
EBM start with generating question related to patient problem. Questions often spring to mind ina
form that makes finding answers in the medical literature a challenge. Dissecting the question intoits
component parts and restructuring it so that it is easy to find the answers is an essential first step
inEBM. Most questions can be divided into four parts:
1. The population or participants (P) : Who are the relevant patients?

2. The intervention or indicator (I) : What is the management strategy, diagnostic test or
exposure that you are interested in (such as a drug,food, surgical procedure, diagnostic test or
exposure to a chemical)?
3. The comparator or control (C) : What is the control or alternative management strategy, test
or exposure that you will be comparing the one you are interested in with?
4. The outcome (O) : What is the patient-relevant consequences of the
exposure in which we are interested?
All clinical or research questions can be divided into these four components, which we call
“PICO”. It is important to use all four parts of the question, if possible.
Different types of questions

By far the most common type of clinical question is about how to treat a disease or condition.In
EBM, treatments and therapies are called “interventions” and such questions are questions of
INTERVENTION. However, not all research questions are about interventions. Other types of
questionsthat may arise are as follows:
1. What causes the problem? AETIOLOGY AND RISK FACTORS

2. What is the frequency of the problem? FREQUENCY
3. Does this person have the problem? DIAGNOSIS
4. Who will get the problem? PROGNOSIS AND PREDICTION
In each case the P I C O method can be used to formulate the question. The same approach canbe
used to research qualitative questions about health issues of a more general nature (PHENOMENA).In
this case, the question will consist of ‘P’ and ‘O’ only. The studies that you will need to search for
aredifferent for the different types of questions and we will discuss this further in the next section
322 | Faculty of Medicine, Public, Health and Nursing

Interventions
Interventions cover a wide range of activities from drug treatments and other clinical therapies,
tolifestyle changes (for example, diet or exercise) and social activities (such as an education program).
Interventions can include individual patient care or population health activities (for example,
screeningfor diseases such as cervical or prostate cancer).
Example:
"A 28-year-old male presents with recurrent furunculosis for past 8 months; these episodes have
been treated with drainage and several courses of antibiotics but keep recurring. He asks if
recurrences can be prevented”
To convert this to an answerable question, use the P I C O method as
follows:
 Population/patient = patients with recurrent furunculosis
 Intervention/indicator = prophylactic antibiotics
 Comparator/control = no treatment
 Outcome = reduction in recurrence rate of furunculosis
Question: ‘In patients with recurrent furunculosis, do prophylactic antibiotics, compared to no treatment,reduce
the recurrence rate?’
Etiology and risk factors

Questions of etiology and risk factors are about what causes a disease or health condition. They
are the reverse of intervention questions because they deal with the harmful outcomes of an activity or
exposure. Such questions commonly arise in relation to public health issues, such as whether eating
certain foods increases the risk of heart disease or being exposed to an environmental
chemicalincreases the risk of cancer, and so on.
Example
“Jeff has come in to your surgery to discuss the possibility of getting a vasectomy. He says he
hasheard something about vasectomy causing an increase in testicular cancer later in life. You
knowthat the risk of this is low but want to give him a more precise answer”
To convert this to an answerable question, use the P I C O method as follows:
 Population/patient = adult males
 Intervention/indicator = vasectomy
 Comparator/control = no vasectomy
 Outcome = testicular cancer
Question: ‘In men, does having a vasectomy (compared to not having one) increase the risk of gettingtesticular
cancer in the future?’
Frequency or rate
Questions of frequency (prevalence) are about how many people in the population have a
diseaseor health problem, such as what the frequency of hearing problems in infants or in the
prevalence of Alzheimer’s disease is the over 70s. If the question also includes a time period, such as
for cases of influenza in winter versus summer, it becomes a question of rate (incidence).
Example
“Susan is a 6-week-old baby at her routine follow-up. She was born prematurely at 35 weeks.
Youwant to tell the parents about her chances of developing hearing problems”

 Population/patient = infants
 Intervention/indicator = premature
 Comparator/control = full-term
 Outcome = sensorial deafness
Question: ‘In infants born prematurely, compared to those born at full term, what will the
prevalence of sensorial deafness be?’
Diagnosis
Diagnosis questions are concerned with how accurate a diagnostic test is in various patient groups
and in comparison, to other available tests. Measures of test accuracy include its sensitivity
andspecificity.
Example
“Julie is pregnant for the second time. She had her first baby when she was 33 and had
amniocentesisto find out if the baby had Down syndrome. The test was negative, but it was not a good
experienceas she did not get the result until she was 18 weeks pregnant. She is now 35, one month
pregnantand asks if she can have a test that would give her an earlier result. The local hospital
offers serumbiochemistry plus nuchal translucency ultrasound screening as a first trimester test for
Down syndrome. You wonder if this combination of tests is as reliable as conventional
amniocentesis”
 Population/patient = pregnant women
 Intervention/indicator = nuchal translucency ultrasound screening plus serum
biochemistry (first trimester)
 Comparator/control = conventional amniocentesis
 Outcome = accurate diagnosis (measured by sensitivity and specificity) of Down
syndrome (trisomy 21)
Question: ‘For pregnant women, is nuchal translucency ultrasound screening plus serum biochemistry
testing in the first trimester as accurate (i.e. with equal or better sensitivity and specificity) as
conventionalamniocentesis for diagnosing Down syndrome?’
Prediction (prognosis)
Prediction or prognosis questions are concerned with how likely an outcome is for a population
with certain characteristics (risk factors), such as the likelihood that a man who is experiencing
atypicalchest pains will suffer further heart failure or sudden death within the next few days, or the
predicted morbidity and mortality for a person diagnosed with colon cancer.
Example
“Childhood seizures are common and frightening for the parents and the decision to initiate
prophylactic treatment after a first seizure is a difficult one. To help parents make their decision,
you need to explain the risk of further occurrences following a single seizure of unknown cause”
 Population/patient = children
 Intervention/indicator = one seizure of unknown cause
 Comparator/control = no seizures
 Outcome = further seizures

Question: ‘In children who have had one seizure of unknown cause, compared with children who
havehad no seizures, what is the increased risk of further seizures?’

Phenomena
Questions about phenomena can relate to any aspect of clinical practice, such as physical
examination, taking a health history or barriers to successful participation in health care. Such
questions usually involve a population (P) and an outcome (O) but not an intervention or comparator.
Example
“Mary is a mother who is concerned about her child of 3 years old. He has a fever. After you have
examined him you conclude that he probably has a viral infection. Mary asks, ‘But what if he has
afever again during the night doctor?’ You want to understand her principle underlying concerns
sothat you can reassure her”
 Population/patient = mothers of children with fever
 Outcome = principle concerns
Question: For mothers of children with a fever, what are the principle concerns?
Types of studies
Th e types of studies that give the best evidence are different for the different types of questions. In every
case, however, the best evidence comes from studies where the methods used maximize the chance of
eliminating bias. The study designs that best suit the different question types outlined are asfollows:
Question Best study designs Description

INTERVENTION Randomized controlled trial Subjects are randomly allocated to treatment or
control groups and outcomes assessed.
AETIOLOGY Randomized controlled trial As etiology questions are like intervention
AND questions, the ideal study type is an RCT.
RISK FACTORS However, it is usually not ethical or practical to
conduct such a trial to assess harmful outcomes.
Cohort study Outcomes are compared for matched groups with
and without exposure or risk factor (prospective
study).
Case-control study Subjects with and without outcome of interest are
compared for previous exposure or risk factor
(retrospective study).
FREQUENCY Cohort study As above
AND RATE Cross-sectional study Measurement of condition in a representative
(preferably random) sample of people.
DIAGNOSIS Cross-sectional study with Preferably an independent, blind, comparison
random or consecutive with ‘gold standard’ test.
sample
PROGNOSIS Cohort/survival study Long-term follow-up of a representative cohort.
AND
PREDICTION
PHENOMENA Qualitative Narrative analysis or focus group; designed to
assess the range of issues (rather than their
quantification).
In each case, a systematic review of all the available studies is better than an individual study.

Searching methods and Boolean logic
To effectively locate the resources for your literature review, you need to develop a search strategy
tocarefully plan how you will look for these resources. A search strategy helps you to:
 Articulate your research topic & research question
 Remain consistent in your search from one search tool to the next
 Find a large amount of relevant information
 Save time and energy in the long run
During your literature search, especially when you search for articles in databases, you will rely very
much on keyword searching. To conduct a keyword search, you need to formulate a search statement.
Below are the basic steps to develop a search statement.
1. Identify the keywords or the main concepts of your research topic.
2. Think of similar terms (synonyms) or phrases that might also be used to describe these
concepts,to ensure that you do not miss out any relevant information. You can use a thesaurus to
help youfind synonyms.
3. Make use of truncation, wildcards, parentheses and phrase searching for more productive
searching.
4. Combine your search terms in a way that a database can understand. To do this, you need to
usethe words AND, OR, NOT (Boolean operators).
Boolean logics
Boolean logic refers to the logical relationships among search terms. Most databases recognize the use
of Boolean Operators, and it is usually recommended that you capitalize AND, OR and NOT for
thedatabase to recognize these terms as Boolean Operators.
AND
Narrows your search. Finds citations that include ALL the terms. Use
AND to combine together separate topics.
Example: Mediterranean Diet AND heart attack finds articles that
include both these terms.
OR
Broadens your search. Finds citations that include ANY of the terms. Use
OR to combine together synonyms or related ideas.
Example: heart attack OR myocardial infarction finds articles that
contain either of these terms.
NOT Narrows your search. Removed citations that contain a term.

Use with caution! You will lose out on citations that contain an off-hand
mention of a term.
Example: Mice NOT rabbit finds articles that only refer to mice. If an article
happened to mention rabbit, this article would not be included from the
search results.
()
Narrows your search. Used to combine groups of terms and allows you to
create a more complex search.
Example: (heart attack OR myocardial infarction) AND Mediterranean Diet
finds articles on that refer to Mediterranean Diets and either heart attacks or
myocardial infarction.

PRACTICAL WORK
The aim of the practical work
1. Students can formulate the clinical question or research question using the PICO methods to
framethe answerable question
2. Students can understand how to find relevant articles journal to answer the
clinical/researchquestion
Relation to the SKDI (Indonesia Medical Doctor Competencies)

1. This practical work is to develop skills of the student in area on access and assess the
informationand knowledge related to health technology
2. This practical work is to develop the skill of the student in area of self-conscious and
personaldevelopment on health technology
Instruments and data

1. Personal computer and internet connection
2. Internet website of literature searching
2.1. PubMed http://www.ncbi.nlm.nih.gov/PubMed
PubMed is an Internet interface for MEDLINE. It is a project developed by the National Centerfor
Biotechnology Information (NCBI) at the National Library of Medicine (NLM). It has been
developed in conjunction with publishers of biomedical literature as a search tool for
accessingliterature citations and linking to full-text journals at Web sites of participating
publishers and PubMed provides links to that site. In addition, PubMed provides bibliographic
information suchas journal, volume, issue, page number, and year. Using the ‘Clinical Queries’
feature in PubMed, you can restrict retrieval to articles that are mostlikely to answer your clinical
question. This specialized search is intended for clinicians and has built-in search “filters”. Four
study categories--therapy, diagnosis, etiology, prognosis--are provided, and you may indicate
whether you wish your search to be more sensitive (i.e., includemost relevant articles but probably
including some less relevant ones) or more specific (i.e., including mostly relevant articles but
probably omit a few). PubMed is updated continuously asinformation is received from the
publishers.
2.2. The Cochrane Library http://www.cochranelibrary.com/

The Cochrane Library is an electronic publication designed to supply high-quality biomedical
evidence to inform people providing and receiving care, and for those responsible for
research,teaching, funding, and administration at all levels. It includes:
a. Cochrane Database of Systematic Reviews.
b. Database of Abstracts of Reviews of Effectiveness
c. The Cochrane Controlled Trials Register - Bibliographic information on controlled trials.
d. The Cochrane Methodology Register - Empirical studies of methods used in reviews
andmethodological studies that are directly relevant to doing a review.
e. The NHS Economic Evaluation Database - Register of published economic
evaluations ofhealth care interventions.
f. Health Technology Assessment Database - Information on medical, social, ethical,
andeconomic implications of development, diffusion, and the use of health technology.

STUDENT ACTIVITIES
Asynchronous learning
 Students should log in to Gamel and learn the materials of EBM and Critical Appraisal
Practical sessions
 Watching a video on Gamel “Advanced Literature Searching: dr. Ajeng Viska Icanervilia,
MPH”
Synchronous learning
 Attend the scheduled meeting with your instructor
 Do the pre-test of literature searching (link provided in Gamel)
 Formulate the PICO related to therapy
 The problem (P) could be one of these diseases such as
o acute respiratory infection,
o pneumonia,
o urinary tract infection,
o hypertension,
o diabetic mellitus,
o tuberculosis,
o malaria,
o acute gastroenteritis or diarrhea,
o typhoid fever,
o asthma bronchial,
o scabies,
o rheumatoidarthritis,
o gastritis,
o etc.
 Intervention (I) could be found from National Formulary 2020 or any relevant sources
 Determine the type of the treatment outcome (O) which should be categorical and
preferable dichotomous outcome such as cure, death, etc.
 Do a literature searching using PubMed and find one article with Randomized Controlled Trial
(RCT) study
 Discuss the decision of choosing article with the instructor
 Complete the student worksheet and ask the signature of the instructors
 Submit the article and the student worksheet into the Gamel within a week after the practical
session

STUDENT WORKSHEET
Write the PICO
 Population/patient :
 Intervention/indicator :
 Comparator/control :
 Outcome :
Research question
List your keywords for literature searching based on PICO
 Population/patient :
 Intervention/indicator :
 Comparator/control :
 Outcome :
Combination of keywords (using Boolean logic) of each PICO with the number of
articles
i.e:
 tumor OR cancer OR carcinoma = 5234 articles
 analgesic OR painkillers =12355 articles
 etc.
Combination of all keywords (using Boolean logic) with the number of articles
Please screenshot your PubMed History and Search Details
What filters or limits do you used for your searching?

i.e study design (RCT), years (2011-2022), language, etc
Which article do you choose to answer your research question (PICO)?
Please mention the reasons why you choose the article
Date, ………………………
Signature of supervisor (…. )

References
1. Paul Glasziou, Chris Del Mar and Janet Salisbury. 2003. Evidence-based Medicine
Workbook Finding and applying the best research evidence to improve health care, BMJ
Publishing book, London.
2. Erika D. Ecker and Andrea C. Skelly. 2010. Conducting a winning literature search, Evid Based
Spine Care J.
Student’s Book Block I.9 | 331

PRACTICAL SESSION
CRITICAL APPRAISAL
INTRODUCTION
All of us would like to enjoy the best possible health we can. To achieve this goal we need reliable
information about what might harm or help us when we make healthcare decisions. Research involves
gathering data, then collating and analysing it to produce meaningful information. However, not all
research is good quality and many studies are biased and their results untrue. This can lead us to
drawfalse conclusions. It is therefore important to understand what evidence-based medicine (EBM) is.
To practice EBM, clinicians need to apply the findings of scientific research to the circumstances of
individual patients as part of their clinical decision- making process. Clinicians, therefore, must be able
to select and appraise scientific literature that is relevant to their field, understand the implicationsof
research findings for individual patients, elicit patients’ own preferences and develop an
appropriatemanagement plan based on the combination of this information. Each of these tasks presents
its own challenges, but the sheer volume of medical literature means that the first step (that of selecting
and appraising scientific evidence) can be daunting.
The number of new medical research articles published each year continually increases, and
morethan 12,000 new articles, including papers on in excess of 300 randomized controlled trials (RCTs),
are added to the MEDLINE database each week. 1,2 One practical way that clinicians can manage this
‘information overload’2 is to develop efficient skills in critical appraisal, which enable them focus on
only the highest-quality studies that will guide their clinical practice and to extrapolate information
whennecessary from studies of less rigorous design if high-quality trials are unavailable.
If healthcare professionals and patients are going to make the best decisions, they need to be able to:
1. Answer the question on whether their decision is supported by current best evidence
2. Decide whether studies have been undertaken in a way that makes their findings reliable
3. Make sense of the results
4. Know what these results mean in the context of the decision they are making
Without critically appraising the information they received, clinicians are relatively helpless in deciding
what new information to incorporate into their practice. They may choose to believe the most
authoritative expert or the trusted colleague, but such reliance forfeits independent judgement.
What is critical appraisal
Critical appraisal is one step in the process of evidence-based clinical practice. Evidence-

based clinical practice is ‘an approach to decision making in which the clinician uses the best evidence
available, in consultation with the patient, to decide the option which suits the patient best8. To determine
whatis the ‘best’ evidence, we need critical appraisal skills that will help us to understand the methods
and results of research and to assess the quality of the research. Most research is not perfect, and
critical appraisal is not an exact science – it will not give us the ‘right’ answer. But it can help us to
decide whether we think a reported piece of research is good enough to be used in decision-making.
There are many factors that come into play when making healthcare decisions – research evidence is
just one ofthem. If research has flaws, it is up to readers to use their critical appraisal skills to decide
whether thisaffects the usefulness of the paper in influencing their decision.
The rationale for critical appraisal
Getting the “right” answer more often. The inputs used to inform decisions in health care come
frommany different sources. For instance, medical decision making involves an amalgam of
information arising from the history, examination and investigation of patients, basic clinical sciences
(anatomy, biochemistry, physiology, pathology and social sciences), clinical experience (the
practitioner’s own and that of colleagues), information from textbooks and lastly empirical research
findings9. As far as externalinformation, not specific to a given patient with a given problem, is
concerned, there has long been a concern that empirical research (careful observation of what has
actually happened to groups of patients, communicated in published reports) has been underused and
overlooked. Although long suggested it is only recently that the ramifications of failure to
systematically incorporate the findings of empirical research into practice have emerged clearly. The
best publicised example is the delay in widespread implementation of the use of thrombolysis in acute
myocardial infarction10. One key rationale for criticalappraisal has thus been to increase the use of
existing empirical research to improve the accuracy of health care decisions11. However, just as the
literature shows that the term “critical appraisal” has different meanings, so it makes clear that the
rationale for critical appraisal (and implicitly the outcomesmost greatly valued) are also very varied.
Depending particularly on the person or group undertaking or supporting critical appraisal teaching,
they vary as follows:
1. Making epidemiology and statistics valued. In response to apparent lack of interest in these
subjectsby medical undergraduates, critical appraisal in relation to actual research articles has
sometimesbeen introduced specifically as a means to improve the effectiveness with which
epidemiology andstatistics are taught12.
2. Contributing to more effective and efficient means of keeping up-to-date. This is
particularly emphasised by EBM to help overcome the problems, already alluded to, that many
sources of information relied on by clinicians, theories from basic sciences, advice from
colleagues and textbooks are out-of-date 9. Critical appraisal is one skill allowing continuing self-
directed learning throughout a career in health care.

3. Changing the hierarchical nature of medical practice. Enabling individuals, often “juniors”,
to moreindependently identify the “best” course of action, will inevitably destabilise any system
based on patronage12. Thus, the important objectives of teaching critical appraisal to non-clinicians
(especiallyhealth care managers and patients) may include empowering and challenging orthodoxy,
even if they are not explicitly stated.
4. Raising awareness of the importance of critical appraisal. An important rationale may not be
to turn all participants into skilled appraisers of research, but to increase the appreciation of the
importance and need for high levels of such skills in those “professionals” directly involved in
making health care decisions13.
PRACTICAL WORK
The aim of the practical work
1. Students are able to understand the principle and procedures of critical appraisal
2. Students recognize how to critically appraise a research paper
3. Students practice the steps to critically appraise journals on diagnostic and therapy
Relation to the SKDI (Indonesia Medical Doctor Competencies)
1. This practical work is to develop skills of the student in area on understanding the
principle of evidence-based medicine
2. This practical work is to develop the skills of the student in utilizing evidence-based
medicine in clinical reasoning
Instruments and data

1. Personal computer and internet connection
2. Journal articles on diagnostic test and therapeutic study
3. Critical appraisal tools from Oxford University (https://www.cebm.ox.ac.uk/resources/ebm-
tools/critical-appraisal-tools), specific to:
 Diagnostics Critical Appraisal Sheet
 Randomised Controlled Trials (RCT) Critical Appraisal Sheet

STUDENT ACTIVITIES: CRITICAL APPRAISAL ON DIAGNOSTIS
Practical sessions
 Watching a video on Gamel “Critical appraisal on diagnosis: dr. Andaru Dahesihdewi,
Sp.PK(K)”
 Download and read the materials of critical appraisal (CA) on diagnosis, including:
o Example of critical appraisal on diagnosis “The Validity of the Rapidly Diagnostic
Tests for Early Detection of Urinary Tract Infection” (file 1)
o Diagnostic Study Appraisal Worksheet (file 2)
o List of journals (11 articles) in diagnostic study (folder)
Synchronous learning (online)
 Attend a scheduled meeting with your instructor
 Do the pre-test of critical appraisal on diagnosis (provided in Gamel)
 Appraise the article (D1-D11) using Diagnostic Study Appraisal Worksheet provided in Gamel
 Please ask your instructors for any difficulties during the practical session
 Each student should only appraise one article that will be assigned based on the student list
number. Please see the list of articles on diagnosis.
 The completed Diagnostic Study Appraisal Worksheet should be submitted to Gamel.
List of articles on diagnosis

No Code Title
Evaluation of a novel antigen-based rapid detection test for the diagnosis of SARS-
1 D1
CoV-2 in respiratory samples
Accuracy, Sensitivity and Specificity of Fine Needle Aspiration Biopsy for
2 D2
Salivary Gland Tumors: A Retrospective Study from 2006 to 2011
Comparison of the Performance of the TPTest, Tubex, Typhidot and Widal
Immunodiagnostic Assays and Blood Cultures in Detecting Patients with Typhoid
3 D3
Fever in Bangladesh, Including Using a Bayesian Latent Class
Modeling Approach
Developing clinical rules to predict urinary tract infection in primary care settings:
4 D4 sensitivity and specificity of near patient tests (dipsticks) and clinical scores
Comparison of Immunochromatography Method and Immunocytochemistry

5 D5
Method in Rapid Detection of NS-1 Antigen in Dengue Infection
Sensitivity and specificity of an index for the diagnosis of TB meningitis in
6 D6
patients in an urban teaching hospital in Malawi
Sputum-smear negative pulmonary tuberculosis: sensitivity and specificity of
7 D7
diagnosis algorithm
Testing the sensitivity and specificity of the fluorescence microscope
8 D8
(Cyscope®) for malaria diagnosis
The sensitivity, specificity, predictive values, and likelihood ratios of fecal occult
9 D9
blood test for the detection of colorectal cancer in hospital settings
The specificity and sensitivity of ultrasonography in the diagnosis of acute right
10 D10
lower quadrant pain in women of child bearing age
The Auxiliary Diagnostic Value of a Novel Wearable Electrocardiogram-
11 D11
Recording System for Arrhythmia Detection- Diagnostic Trial

STUDENT ACTIVITIES: CRITICAL APPRAISAL ON THERAPY
Practical sessions
 Watching a video on Gamel “Critical appraisal on therapy: dr. Jarir At Thobari, Ph.D”
 Download and read the materials of critical appraisal (CA) on therapy, including:
o Example of critical appraisal on diagnosis “Three-day versus five-day treatment with
amoxicillin for non-severe pneumonia in young children: a multicentre randomized-
controlled trial” (file 1)
o Therapeutic Study Appraisal Worksheet (file 2)
o List of journals (11 articles) in therapeutic study (folder)
Synchronous learning (online)
 Attend a scheduled meeting with your instructor
 Do the pre-test of critical appraisal on diagnosis (provided in Gamel)
 Appraise the article (T1-T11) using Therapeutic Study Appraisal Worksheet provided in Gamel
 Please ask your instructors for any difficulties during the practical session
 Each student should only appraise one article that will be assigned based on the student list
number. Please see the list of articles on therapy.
 The completed Therapeutic Study Appraisal Worksheet should be submitted to Gamel.
List of articles on therapy
No Code Title
Does single application of topical chloramphenicol to high risk sutured
1 T1
wounds reduce incidence of wound infection after minor surgery
Effects of low dose ramipril on cardiovascular and renal outcomes in patients with
2 T2
type 2 diabetes and raised excretion of urinary albumin
A double-blinded randomized controlled trial of silymarin for the prevention of
3 T3
antituberculosis drug-induced liver injury
Effectiveness of early switch from intravenous to oral antibiotics in severe
4 T4
community acquired pneumonia: multicentre randomised trial
Effectiveness of quinine versus artemether-lumefantrine for treating uncomplicated
5 T5
falciparum malaria in Ugandan children: randomised trial
Randomised placebo controlled multicentre trial to assess short term
6 T6 clarithromycin for patients with stable coronary heart disease: CLARICOR
trial
Twice weekly fluticasone propionate added to emollient maintenance treatment
7 T7 to reduce risk of elapse in atopic dermatitis: randomized double blind parallel
group study
Use of probiotic Lactobacillus preparation to prevent diarrhoea associated with
8 T8
antibiotics: randomised double-blind placebo-controlled trial
9 T9 Use of ramipril in preventing stroke: double-blind randomised trial
Vascular events in healthy older women receiving calcium supplementation:

10 T10
randomised controlled trial
Evaluation of Ivermectin as a Potential Treatment for Mild to Moderate COVID-
11 T11 19: A Double-Blind Randomized Placebo Controlled Trial in Eastern
India

REFERENCE
1. Belsey J. What is evidence-based medicine? London: Hayward Medical Communications,

2009.
2. Juni P, Altman DG, Egger M. Systematic reviews in health care: Assessing the quality of
controlledclinical trials. BMJ 2001; 323: 42–46.
3. The CONSORT Statement. www.consortstatement. org/?o=1011 (last accessed 2
February 2009)
4. Hemingway P, Brereton N. What is a systematic review? London: Hayward Medical
Communications,2009.
5. A Little Poison Can Be Good For You: The received wisdom about toxins and radiation
may be all wet. http://money.cnn.com/magazines/fortune/fortune_archi
ve/2003/06/09/343948/index.htm (last accessed 22 January 2009)
6. Critical Appraisal Skills Programme checklists. www.phru.nhs.uk/Pages/PHD/ resources.htm
(lastaccessed 22 January 2009)
7. Moore A, McQuay H. Clinical trials. In: Bandolier’s little book of making sense of the
medicalevidence. Oxford: Oxford University Press, 2006.
8. Moore A. What is an NNT? London: Hayward Medical Communications, 2009.
9. Sackett DL, Richardson WS, Rosenberg W, Haynes RB. Evidence-based medicine. How to
practiceand teach EBM. Edinburgh: Churchill Livingstone, 2000.
10. Antman EM, Lau J, Kupelnick B et al. A comparison of results of meta-analyses of randomized
control trials and recommendations of clinical experts. Treatments for myocardial infarction.
JAMA1992;268:240-248.
11. Fowkes FGR, Gehlbach SH, Farrow SC et al. Epidemiology for medical students: a course
relevantto clinical practice. International Journal of Epidemiology 1984;13:538-41.
12. James NT. Scientific method and raw data should also be considered (letter). BMJ 1996;313:169-
70.
13. Milne R, Donald A, Chambers L. Piloting short workshops on the critical appraisal of reviews.
Health Trends 1995;27:120-3

BLOCK I.9
PRACTICAL SESSION
Qualitative Data Collection Methods
CONTRIBUTOR:
Dr. Dra. Retna Siwi Padmawati, MA.
dr. Bagas Suryo Bintoro, Ph.D.
Department of Health Behavior, Environmental and Social

Medicine Faculty of Medicine, Public Health, and Nursing
Yogyakarta
2023

Description:
Data collection methods are varied in qualitative research. The most common used methods to
gather qualitative data are observation (participant or non-participant); individual depth
interviews; and focus group discussion (FGD). Other data collection method that can be used
is studying documents (minutes meeting; regulation, operating procedures, flyers, leaflet,
posters, or audio and video documents, etc.).
This practical session focuses on “in-depth interviews” which will allow the researchers to
collect large information about the perceptions, attitudes and behaviors of the interviewees or
the research participants on many subject matters. The method can offer a rich insight of the
participants’ experience and preferences from many different subjects/sample and eventually,
facilitate intervention. Selecting informants or appropriate participants as well as improving
trustworthiness will also be discussed in this practical session.
Learning objectives:
1. To describe various sampling strategy and data collection methods in qualitative research
2. Understand the strategies to improve trustworthiness of qualitative data
Content:
1. Methods in qualitative data collection: aims, types, characteristics

2. Ways to collect data in a qualitative research (that includes elaboration of
questionnaire, in depth interview and focus group discussion)
3. Sampling strategies in qualitative method
4. The main technique in data collection methods: in-depth interview skill
5. Strategies to improve trustworthiness in qualitative research
Activities in class:
1. 30 presentation by the tutor

2. 15 discussion by students (in pairs)
3. 30 minutes practices and observations
4. 25 minutes discussions
Practice in class:
1. Read the interview guideline in pairs (two students)
2. Form a group of 4 students (6 other students will observe)
3. One will perform as interviewer, one as interviewee, and two as observers (15
minutes)
4. Interviewer will practice to conduct the interview using an interview guideline; and
the interviewee will answer the questions
5. Observers will give comments and insights on their interviewing techniques/
practices (15 minutes)
6. Other audiences will also give comments and insights (25 minutes) Individual
practices (to be submitted in GAMEL one week after the block ends):
1. Select the available interview guidelines or create the guideline based on your owned
interest subject matter

2. Use the interview guideline to conduct an in-depth interview to a real participant (15
minutes max)
3. Please record the interview
4. Transcript verbatim the interview using 12 font times new roman

BLOCK I.9
PRACTICAL SESSION
DRUG INFORMATION
CONTRIBUTOR:
dr. Lukman Ade Chandra, M.Med., M.Phil.
Dr. drh. Pamungkas Bagus Satriyo, M.Sc., Ph.D
Department of Pharmacology & Terapy

Yogyakarta
2023

PRACTICAL WORK PHARMACOLOGY & TERAPY
DRUG INFORMATION
INTRODUCTION
Physicians must be up-to-date with relevant drug-related literature in order to provide the
most current druginformation. The drug information may include information on essential
drug list, pharmacology profile of the drug, indication, recommended dosage and some drug
administrations, contraindication, side effect, possible drug interaction, adverse drug
reaction and including how to report the adverse-drug- reaction. The physicians must have
advanced literature search and assessment skills to searching the information related to
medicines.
Today, the internet provides a plethora of drug information for both health care
professionals and their patients. Many practitioners probably use the internet when seeking
answers to questions. However, there is no quality control for these types of information
sources on the internet, and practitioners may be jeopardizing their own credibility when
using these resources. Therefore, with so many websites retrievinginformation from drug
information references, the medical students should know which information shouldbe able
to use to support their knowledge on drug information.
PRACTICAL WORK
A. The aim of the practical work

1) To develop skill in identification and retrieval of drug information related to the
drug contents (substance active/generic name), pharmacokinetic of drugs (half-
life, t-max, etc.) indication/ contraindication, mechanism action according to
drug classes, potential drug-drug interaction, pregnancy safety use (teratogenic
effect), and costs
2) To develop skill in making reporting the adverse drug event and causality
assessment of adversedrug event
B. Relation to the SKDI (Indonesia Medical Doctor Competencies)

1) This practical work is to develop skills of the student in area of
information management inparticularly on access and assess the
knowledge technology especially on drugs.
2) This practical work is to use the scenario in patients with hypertension,
hyper-cholesterolemia,myocardial infarction and dysmenorrhea which have
competence level 4
3) This practical work is to develop skills on identify the potential drug
interaction and reportingadverse drug events whereby include in the
competency area of management health problem

C. Instruments and data
1) Personal computer and internet
2) Pre-viewing video:
a) Introduction of Drug Information:
https://drive.google.com/file/d/1zzKKMJw4H
0Tu90ctoQNnAfsu- pwWoXnj/view?
usp=share_link
b) Seeking for Drug information using web-
based resources:
https://www.youtube.com/watch?v=Uh
gwD-vSmf4&t=4s
3) Internet website of drug information
a) MIMS: https://www.mims.com/
b) E-catalogue: https://e-katalog.lkpp.go.id/
c) WHO Anatomical Therapeutically Chemical (ATC) Code & Defined
Daily Dose (DDD):https://www.whocc.no/atc_ddd_index/
d) Drug information and Drug interaction: https://www.drugs.com/
e) WHO essential drugs list
https://www.who.int/medicines/publications/ess
entialmedicines/en/
f) Indonesia Essential
Drugs List Daftar
Obat Esensial
Nasional 2021:
https://e-fornas.kemkes.go.id/files/pdf/DOEN%202021.pdf
g) Indonesia (National) Drug Formulary:
Daftar Obat Formularium Nasional 2021
https://e-fornas.kemkes.go.id/files/pdf/KMK%20No.%20HK.01.07-
MENKES-6485- 2021%20tentang%20Formularium_Nasional.pdf
Adendum Formularium Nasional 2022
https://e-fornas.kemkes.go.id/files/pdf/KMK%20No.%20HK.01.07-
MENKES-1970-
2022%20tentang%20Perubahan%20atas%20Formularium%20Nasion al.pdf
E-Fornas Kementerian Kesehatan RI https://e-
fornas.kemkes.go.id/daftar obat.php
4) Form of monograph of drug information
5) Form of potential drug-drug Interaction
6) Form of reporting of the adverse drug event

D. Procedure
1) Students finished watching the pre-viewing videos before the practical
session
2) Students attend the scheduled practical session
3) Students do the pre-test
4) The instructor will explain the study objectives and give working paper
(forms) to the students
5) Student will get following prescribing scenarios and complete forms:
(i) Form of monograph of drug information
(ii) Form of potential drug-drug Interaction
(iii) Form of monitoring efek samping obat (MESO)
6) Two students will work together to complete the forms based on scenarios
provided
7) Discuss the results with instructors
E. Online drug information resources

The students will use the following resource to seek the information
1) www.mims.com. This website contains information on drugs marketed in
Indonesia. The student could only use the website to know the active compound
(generic name) of a particular branded drug, indication, pregnancy safety
use/teratogenic effect and costs. The other information maystill not up date. For
the pharmaceutical product which avaliable in Indonesia formulary, the drug
prices information could be seen in this website: https://e-katalog.lkpp.go.id/.
The studentcould compare the retail drug price with e-catalog from BPJS.
2) http://www.whocc.no/atc_ddd_index. This website contains information about

structure drug classes of pharmaceutical product available in the market around
the world. The classification system is based on The Anatomical Therapeutic
Chemical (ATC) from WHO standard classification. This website contains also
the Defined Daily Dose (DDD) which is a measuring unit of standardized
dosage of each product and it is the gold standard for international drug
utilization research. The ATC Code contains 5 level for class system, example
for Captopril, theATC Code is C09AA01
C : first level code indicates the anatomical main group and
consists of one letter(14 main groups). Captopril is C for
cardiovascular system
C09 : second level of the code indicates the therapeutic main group and
consists oftwo digits. Captopril is C09 for Agent Acting on
RAAS
C09A : third level of the code indicates the therapeutic/pharmacological
subgroup andconsists of one letter. Captopril is C09A for ACE-
Inhibitors, plain

C09AA : fourth level of the code indicates the
chemical/therapeutic/pharmacological subgroup and
consists of one letter. Captopril is C09AA for ACE-
Inhibitors, plain
C09AA01 : fifth level of the code indicates the chemical substance and consists
of two digits. Captopril is C09A for captopril substance
3) http://www.drugs.com/ OR http://www.medscape.com/druginfo/
druginterchecker OR http://www.drugdigest.org. These websites contain
information on detailed on the pharmaceutical product, including drug
interaction. From this website, student will able to checkthe interaction of drugs
with drugs, food or disease.
Drug-drug interactions - These are the most common type of drug

interaction. The more medications are given, the greater the chance for drug
interacting with another medicine. Drug- drug interactions can decrease how
well the medications work, may increase minor or serious unexpected side
effects, or even increase the blood level and possible toxicity of a certain drug.
Drug-food/beverage interactions - This may seem odd, but certain

medications can interact with foods or beverages. For example, grapefruit juice
can lower the levels of enzymes in liver responsible for breaking down
medications. Blood levels of an interacting drug may rise, leadingto toxicity.
This interaction can occur with the commonly used statins to lower cholesterol,
like atorvastatin, lovastatin, or simvastatin. The result can be muscle pain, or
even severe muscle injury known as rhabdomyolysis.
Drug-disease interactions - Drug interactions don’t always occur with just

other drugs or foods. The existing medical condition can affect the way a drug
works, too. For example, over-the-counter oral decongestants like
pseudoephedrine or phenylephrine may increase blood pressure and can be
dangerous if you have have high blood pressure. Drug interactionscan occur in
several different ways:
• A pharmacodynamic interaction occurs when two drugs given

together act at the sameor similar receptor site and lead to a greater
(additive or synergistic) effect or a decreased(antagonist) effect. For
example, when chlorpromazine, sometimes used to help prevent nausea
and vomiting, and haloperidol, an antipsychotic medication for
schizophrenia, aregiven together there may be a greater risk for causing a
serious, possibly fatal irregular heart rhythm.

• A pharmacokinetic interaction may occur if one drug affects another
drug’s absorption, distribution, metabolism, or excretion. Examples can
help to explain these complicated mechanisms:
i. Absorption: Some drugs can alter the absorption of another drug
into your bloodstream. For example, calcium can bind with some
medications and block absorption. The HIV treatment dolutegravir
should not be taken at the same time as calcium carbonate because it
can lower the amount of dolutegravir absorbed into the bloodstream
and reduce its effectiveness in treating HIV infection. Dolutegravir
should be taken 2 hours before or 6 hours after medications that
contain calciumor other minerals to help prevent this interaction. In
the same manner, many drugs cannot be taken with milk or dairy
products because they will bind with the calcium. Drugs that affect
stomach or intestine motility, pH, or natural flora can also lead to drug
interactions.
Distribution: Protein-binding interactions can occur when two or more
highly protein-bound drugs compete for a limited number of binding sites on
plasma proteins. One example of an interaction is between fenofibric acid,
used to lower cholesterol and triglycerides in the blood, and warfarin, a
common blood thinner to help prevent clots.Fenofibric acid can increase the
effects of warfarin and cause you to bleed more easily.

ii. Metabolism: Drugs are usually eliminated from the body as either
the unchanged (parent) drug or as a metabolite that has been changed
in some way. Enzymes in the liver, usually the CYP450 enzymes, are
often responsible for breaking down drugs for elimination from the
body. However, enzyme levels may go up or down and affect how
drugs are broken down. For example, using diltiazem (a blood
pressure medication) with simvastatin (a medicine to lower
cholesterol) may elevate the bloodlevels and side effects of
simvastatin. Diltiazem can inhibit (block) the CYP450 3A4 enzymes
needed for the breakdown (metabolism) of simvastatin. High blood
levels ofsimvastatin can lead to serious liver and muscle side effects.
iii. Excretion: Some nonsteroidal antiinflammatory drugs (NSAIDs),
like indomethacin, may lower kidney function and affect the excretion
of lithium, a drug used for bipolar disorder. You may need a dose
adjustment or more frequent monitoring by your doctorto safely use
both medications together.
The classifications below are a guideline only. The relevance of a particular drug
interaction to aspecific patient is difficult to determine using this tool alone
given the large number of variablesthat may apply.
• Major: Highly clinically significant. Avoid combinations; the risk of the

interaction outweighsthe benefit;
• Moderate: Moderately clinically significant. Usually avoid
combinations; use it only underspecial circumstances.
• Minor; Minimally clinically significant. Minimize risk; assess risk and
consider an alternativedrug, take steps to circumvent the interaction risk
and/or institute a monitoring plan; or
• Unknown: No information available.
4) http://www.who.int/medicines/publications/essentia
lmedicines/en/ thiswebsite contains information on
essential drug list from WHO.
5) http://farmalkes.kemkes.go.id/2014/02/daftar-obat- esensial-
nasional-2013/ thiswebsite contains formation on Indonesia
essential drug list
6) http://farmalkes.kemkes.go.id/en/2018/02/formularium
-nasional-2017/ thiswebsite contains formation on Indonesia
drug formulary

REFERENCES
1. Konsil Kedokteran Indonesia, Standard Kompetensi Dokter Indonesia.
Indonesia Medical Consil2015.
2. Charles F Lacy, Lora L Armstrong 2017, Drug Information Handbook: A
Comprehensive Resource forAll Clinicians and Healthcare Professionals, 17th
Edition. American Association of Pharmacist.

FORM MONOGRAPH OF DRUG INFORMATION
INDICATOR DRUG INFORMATION

Branded Drug
Active substance/generic name
Indication
Pregnancy safety use
Cost
• Retail cost
• e-catalog cost
ATC Code
• Level 1
• Level 2
• Level 3
• Level 4
• Level 5
Defined daily dose (DDD)
Mechanism action
Absorption
Distribution
Clearance
The common adverse drug

effects/reaction (potential safety
issue)
Contraindication
Monograph prepared by: Date:

References:

POTENTIAL DRUG-DRUG INTERACTION
Name interacted drugs Type of Interaction Effect of interaction

1.
2.
3.
4.
5.
Prepared by: Date:
References:

LEMBAR MONITORING EFEK SAMPING OBAT
(MESO)
FORMULIR PELAPORAN EFEK SAMPING OBAT Kode Sumber Data :

PENDERITA
Nama (Singkatan) : Umur : Suku : Berat Badan Pekerjaan :
………………. ……… ………………… ……………… ……………………
Kelamin (beri tanda X) : Penyakit Utama : Kesudahan

Penyakit
Pria............................... Utama (Beri
Tanda X) :
Wanita : Hamil.................... Sembuh
Meninggal
Tidak hamil..........
Sembuh
Tidak tahu............ dengan gejala
sisa Belum
sembuh
Tidak Tahu
Penyakit / Kondisi lain yang menyertai (beri tanda X) :
Gangguan Ginjal Kondisi medis lainnya Gangguan

Hati Faktor Industri, pertanian, kimia.
Alergi Lain-lain :
EFEK SAMPING OBAT (ESO)
Bentuk / Manifestasi ESO yang Terjadi / Saat/Tang Kesudahan ESO
Keluhan Lain Termasuk Mutu : gal Mula (beri tanda X) :
Terjadi : Tanggal:…………………
…………
Sembuh
Meninggal
Sembuh
dengan gejala
sisa Belum
sembuh
Tidak tahu
Riwayat ESO yang Pernah Dialami :

OBAT
Beri Pemberiaan
Nama tanda X
(Nama Bentuk No. Bets untuk Tgl. Tgl. Indikasi
Dagang/ Sediaan obat yang Cara Dosis Mul akhi penggu
Nama dicurigai / a r n aan
Generik/Pabrik/IF Wakt
) u
1. ............... .............. ..............
................................. ............... .............. ..............
2. ............... .............. ..............
.................................
............... .............. ..............
3.
................................. ............... .............. ..............
4. ............... .............. ..............
................................. ............... .............. ..............
5. ............... .............. ..............
................................. ............... .............. ..............
6. ............... .............. ..............
.................................
7.
.................................
8.
.................................
9.
.................................
10.
................................
Keterangan Tambahan (misalnya : kecepatan timbulnya
Efek Samping Obat, reaksi setelah obat dihentikan, Data Laboratorium
(bila ada).
pengobatan yang diberikan untuk mengatasi ESO)
Tgl. Pemeriksaan :
…………..…..., tgl ..20….

Tanda Tangan Pelapor
(………………………….)

RAHASIA MONITORING EFEK SAMPING OBAT
NASIONAL
KIRIMAN BALASAN
IZIN No.04/PRKB/JAT/REGIONAL-IV/2017
No.Izin Berlaku s/d 31 Desember 2017 KIRIM
TANPA
PERA
N
GKO
KEPADA
PT.POS INDONESIA
(PERSERO) KEPALA
KANTOR POS
JAKARTA 13000
Untuk diserahkan kepada:
PUSAT FARMAKOVIGILANS/MESO
NASIONAL
Direktorat Pengawasan Distribusi
Produk Terapetik & PKRT Badan
Pengawas Obat dan Makanan RI
Jl. Percetakan Negara No. 23, Kotak Pos
No. 143 Jakarta 10560 Telp. : (021)
4244755 ext. 111, 4244691 ext
1072
Fax. : (021) 42883485
E-mail : pv-center@pom.go.id
Indonesia-MESO-
BadanPOM@hotmail.com
Subsite : http://e-
meso.pom.go.id
PENGIRI
M
Nama :
Keahlian :
Alamat :
Nomor Telepon :
PENJELASAN :
1. Monitoring Efek Samping Obat (MESO) yang dilakukan di Indonesia bekerja
sama dengan WHO- Uppsala Monitoring Center (Collaborating Center for
International Drug Monitoring) yang dimaksudkan untuk memonitor semua
efek samping obat yang dijumpai pada penggunaan obat.
2. Hasil evaluasi dari semua informasi yang terkumpul akan digunakan sebagai
bahan untuk melakukan penilaian kembali obat yang beredar serta untuk
melakukan tindakan pengamanan atau penyesuaian yang diperlukan.
3. Umpan balik akan dikirim kepada pelapor.

No Pertanyaan/ Questions Scale
. Ya/ Tidak Tidak
Yes No Diketahui/
Unknown
1 Apakah ada laporan efek samping obat yang serupa? 1 0 0
(Are there previous conclusive reports on this
reaction? )
2 Apakah efek samping obat terjadi setelah 2 -1 0

pemberian obat yang dicurigai? (Did the ADR
appear after
the suspected drug was administered?
3 Apakah efek samping obat membaik setelah obat 1 0 0
dihentikan atau obat antagonis khusus diberikan? (Did
the ADR improve when the drug was
discontinued or a specific antagonist
was administered?)
4 Apakah Efek Samping Obat terjadi berulang 2 -1 0
setelah obat diberikan kembali? (Did the ADR
recure
when the drug was readministered?)
5 Apakah ada alternative penyebab yang dapat -1 2 0
menjelaskan kemungkinan terjadinya efek samping
obat? (Are there alternative causes that could on
their own have caused the reaction?)
6 Apakah efek samping obat muncul kembali ketika -1 1 0

plasebo diberikan? (Did the ADR reappear when
a placebo was given?)
7 Apakah obat yang dicurigai terdeteksi di dalam darah 1 0 0
atau cairan tubuh lainnya dengan konsentrasi yang
toksik? (Was the drug detected in the blood (or
other fluids) in concentrations known to be
toxic?)
8 Apakah efek samping obat bertambah parah 1 0 0

ketika dosis obat ditingkatkan atau bertambah
ringan
ketika obat diturunkan dosisnya? (Was the ADR
more severe when the dose was increased or
less severe when the dose was decreased?)
9 Apakah pasien pernah mengalami efek samping obat 1 0 0
yang sama atau dengan obat yang mirip sebelumnya?
(Did the patient have a similar ADR to the same
or similar drugs in any previous
exposure?)
10 Apakah efek samping obat dapat dikonfirmasi dengan 1 0 0
bukti yang obyektif? (Was the ADR confirmed
by objective evidence? )
Total Score

NARANJO PROBABILITY SCALE:
ScoreCategory
9+Highly probable
5 - 8Probable
1 - 4Possible
0-Doubtful

BLOCK I.9
PRACTICAL SESSION
LEARN ON DRUG USE IN PRIMARY HEALTH CENTERS
CONTRIBUTOR:
Prof. Dr. Dra. Erna Kristin, Apt., M.Si. Prof.
dr. Jarir At Thobari, DPharm, Ph.D. dr.
Lukman Ade Chandra, M.Med., M.Phil. dr.
Sudi Indra Jaya, M.Biomed.
drg. Fara Silvia Yuliani, M.Sc.
Department of Pharmacology & Terapy

Yogyakarta
2023
Slills Lab Material Book Block I.9 | 359

PRACTICAL WORK PHARMACOLOGY &
THERAPYFIELD VISIT TO PRIMARY HEALTH
CENTERS LEARN ON DRUG USE
INTRODUCTION
Many studies have been conducted to document patterns of drug use, indicating that overprescribing,
multi-drugprescribing, misuse of drugs, use of unnecessary expensive drugs, and overuse of antibiotics
and injections are the most common problems of irrational drug use by both prescribers and
consumers. Improving drug use could yield significant financial and public health benefits. While
many efforts have been undertaken to improve drug use, few evaluations have been conducted in this
field.
An overview of numerous intervention studies at improving drug use in developing country have been
done. It revealsthat commonly used interventions, such as an essential drug list and standard treatment
guidelines, have rarely been systematically evaluated so far. Most intervention studies focus on
prescribers in a publichealth setting, even though irrational drug use is also widespread in the private
sector. The purpose of this field visit is to observe what the system of care is like in local health
facilities and to identify and examine possible sources of data about drug use that are available at the
facility or in the setting you are visiting. Your group will be assigned to visit two local public health
facilities: a district hospital and a health center.
PRACTICAL WORK
A. The aim of the practical work

a. Identify potential quantitative and qualitative sources of data available about drug use
in primaryhealth centers.
b. Plan the logistical aspects of the data collection process in these facilities.
B. Relation to the SKDI (Indonesia Medical Doctor Competencies)

1) This practical work aims to develop the student’ in area of information management,
particularly in accessing and assessing knowledge technology related to drugs.
2) This practical work aims to develop skills in drug use, which are include in the
competency area of health problem management.
C. Instruments and data: Worksheet, computer, presentation slides
D. Procedure
1) Visit to local primary health centers
Your group leader should introduce the group members to the facility staff and explain
the purpose of the visit. Your group should fill in the information on

Worksheet 1-7 based on yourdiscussion or observation in primary health centers. You
may wish to divide up into smaller groups and visit different areas of the facility to
identify possible sources of data about drug use to complete the worksheet. For example,
in a health center, you might all wish to visit the patient registration area, waiting area,
consultation room, medical records room (if any), and dispensary.
You are expected to identify sources of quantitative and qualitative data. In termas of
quantitative data, you should look for historical data on drug use (various types of records)
and opportunitiesfor collecting concurrent data, such as by interacting with patients after
they receive treatment. For qualitative data, you should seek out both people and
opportunities. Consider who is available at the facility that you could talk to and learn
from. What steps would you need to take to initiate a conversation with them?
Additionally, identify opportunities to observe different aspects of the health facility's
operations, which could provide insights into drug use problems.
Use the Worksheet to guide your activities. These worksheets are similar to the ones you
prepared during the “Learning About Drug Use” session. Use the Worksheet as the basis
for assembling adescription of thequantitative data available at the facility. If data is available,
briefly describe what it contains, where it is located, and how it is organized. Use the
Worksheet to record potential sources of qualitative data. Identify the types and numbers
of people available at the facility, and opportunities for learning about specific factors that
underlie certain drug use problems. There is no need to rush; you will have enough time to
carefully examine the data sources so that you can provide a clear report in the afternoon.
Take the time to talk to staff and patients without disrupting the facility’s operation. When
preparing your report, imagine that you are explaining tosomeone who has never visited the
facility how they should collect the information. At the endof your visit, please regroup and
take the time to thank the staff members for their assistance.
Student should also complete the Worksheet 8 for individual assignment
2) After attending the Field Visit, Students should make a presentation and attend
thepractical session in the Department of Pharmacology and Therapy.
3) During the practical session at the Department of Pharmacology and Therapy
a. Each group of students will give a presentation for 10 minutes, followed by 5
minutes Q&A session (total 75minutes)
b. The instructor will wrap up the session and give signature for the individual
assignment.
c. There will be a post-test at the end of the session to assess student’s
knowledge about drug use in primary health center.

WORKSHEET 1 (GROUP ASSIGNMENT)
IDENTIFICATION OF SITE
Name of site visited :
Date of visited : Date/month/year / /
Visitors :
Name of person in charge :
Address of PHC :
Phone number :
Accreditation status : No/Yes, if yes please describe (ISO accreditation or others?
Inpatient clinics : No/Yes, if yes how many rooms?
Other clinics : Geriatric/smoking cessation/drug addiction/
Number of Satellite PHC :
Community services : Number of Posyandu Number of Cadre
Sources of funding : capitation/non-capitation, please describe
Collaboration with BPJS : (referral back to PHC) No/Yes, if yes which disease?

WORSKHEET 2 (GROUP ASSIGNMENT)
DATA AVAILABILITY
DATA SOURCES
NO YES (please describe)
DRUG SUPPLY
Drug Selection
♦ How many items of drugs are available?
♦ Are the items of drugs in PHC in accordance with the
national formulary drug list?
♦ Are there additional drugs outside the national
formulary drug list?
Drug Procurement
♦ Is e-catalog used to procure the drugs?
♦ Is the procurement of medicines through the e-catalog runs
smoothly?
Facility drug supply orders and Pharmacy stock card?
♦ Is LPLO used to order the drug supply?
♦ Is the pharmacy stock card available?
DATA AVAILABILITY
DATA SOURCES
Health Problems
Community morbidity survey
♦ Was there survey on specific disease in community?
♦ When and why the study or survey were done? what was
the results?
Routine health information system with report by diagnosis
♦ What is specific mechanism on reporting the health
problems (LB1, LB2, etc)?
♦ Was there report on 10 or 20 most common disease/
problems available?
♦ Is the electronic record available?
♦ Is there specific reporting to specific events such as
tuberculosis, outbreak, maternal clinic, disease
related to periodontal, etc.?

Patient registers (with data on complaints or diagnosis)
♦ Was there the disease information (complaint, disease
name, disease code) available?
♦ Was there specific disease registration disease (i. e. t
uberculosis), specific services (mother and child
clinics) or insurance (BPJS) available?
Which diseases are included in the referral program?

DATA AVAILABILITY
DATA SOURCES
Prescribing practice
Previous surveys of drug prescribing
♦ Are there previous surveys of drug use? If yes, what was
the result?
Patient registers with data on prescribed drugs
♦ What information are available (drugs nameee,
dooosaaageee, administration, number of drugs)?
♦ Is there registration for specific drugs (i.e. anti-
tuberculotic), drugs for mother and child or drug for
specific insurance (BPJS)
Prescription receipts/prescription
♦ Is electronically prescription?
♦ What information are available? (patients’
information, drugs name, dosage, type of
administration, number of drugs)?
Patient medical record with data on prescribed drugs
♦ Is there patients medical record (manual or
computerized)?
♦ What are the available drug’s information in medical
record (drugs name, dosage, type of administration,
number of drugs)?
DATA SOURCES HOW MANY DESCRIPTION

Health facility administrators
♦ What is the role of administrators in PHC?
Prescribers at health faciltities
♦ Who could prescribe the drugs (doctors, dentist,
midwives)?
♦ If there are any mechanism to check for prescription
given other than doctor?

Dispensing drugs
♦ Who does the drug dispensing? Is it pharmacist?
♦ Please explain the process of the drug dispensing to
the patient!
♦ Is there collaboration with outside pharmacy for
PRB (pasien rujuk balik/Referral back patients)?
Current patients
♦ How many patients visited the PHC per day?
Community members
♦ What is the rule of community health volunteers/
cadre in PHC services?
Others (decsribe)
FACTORS EFFECTING DRUG USE DESCRIPTION

Quality of the diagnostic process
♦ Does the diagnostic process always conduct by the
doctor? (in PHC or in satellite PHC)
♦ Is there laboratory to support the diagnostic
process?
♦ Is there guideline used on diagnostic process?
♦ Is there collaboration with outside laboratory?
Therapeutic Knowledge
♦ Is the patient therapy always given by the doctor? (in
PHC or in satellite PHC)
♦ Is there guideline used on diagnostic process?
Communication between patients and providers about
treatment?
♦ Does the patient be informed about their sickness?
♦ Does the patient be informed about the treatment?
(Name of drugs, type of drugs, how many times, when,
what is the side effect, when does need to re-
visit?
Patient Satisfaction
♦ Is there survey on patient satisfaction? What is the
result?

Referral Program*
DESCRIPTION
(*program rujuk balik/PRB di Puskesmas)
♦ Which diseases are included in referral program?
♦ Which drugs are included in referral program?
♦ Who prescribed these drugs?
♦ If the drugs are not available in PHC�� to where

patients could get the medicines?

WORKSHEET 8 (INDIVIDUAL ASSIGNMENT)
Student’s Name : Student’s Number :
No. Data Description

Puskesmas :
1 Top 5 disease (exclude dental problems) 1.

2.
3.
4.
5.
Source of data:
2. Please describe detail the standard treatment of a 1.

disease in PHC! 2
For example, Disease 1: 3
1. Drug A, every 12 hours for 10 days 4
2. Drug B, every 8 hours for symptomatic 5
3. etc.
Source data:
2. Please mention the top 5 drugs/medicines are used 1.

in PHC! 2.
3.
4.
5.
Source of data:
3 Please analyses the pattern of top 5 diseases with top

5medicines used in PHC, compare to standard
treatment guidelines!
4. Please describe the role of prescriber! Medical doctor:
Others: Nurse, or Midwife
6. Please describe the role of medicine dispenser

(pharmacist)!

Statistical Methods for Numerical Data
Block I.9
Copyright © 2022, Department of Biostatistics, Epidemiology, and Population Health

Universitas Gadjah Mada, Yogyakarta, Indonesia
Contents
Unit 3: Statistical Methods for Numerical Data...............................................................3
Course Objectives.............................................................................................................3
Learning Objectives..........................................................................................................3
Introduction......................................................................................................................3
Pre-Class Exercise............................................................................................................5
Class Exercise...................................................................................................................6
Exercise Step with Statistic Tools....................................................................................9
2
Statistical Methods for Numerical Data
Course Objectives
The course objectives of this unit are to choose the appropriate descriptive and
inferential statistical methods for numerical data and to interpret the results
appropriately.
Learning Objectives
1. To explain how to choose appropriate inferential procedure, whether using
point estimation, interval estimation, or hypothesis testing.
2. To calculate point estimates and interval estimates of sample statistics.
3. To perform step-by-step hypotheses testing (including specifying the null and
alternative hypothesis) for numerical data.
4. To explain the p-value and how it is used to draw conclusions.
5. To explain the relationship between hypothesis testing and confidence
intervals
6. To evaluate statistical significance vs. practical importance
Introduction
We will introduce three forms of statistical inference in this unit, each one representing
a different way of using the information obtained from the sample to draw conclusions
about the population. These forms are:
 Point Estimation: In point estimation, we estimate an unknown parameter
using a single number that is calculated from the sample data.
 Interval Estimation: In interval estimation, we estimate an unknown parameter
using an interval of values that is likely to contain the true value of that
parameter (and state how confident we are that this interval indeed captures
the true value of the parameter).
 Hypothesis Testing: In hypothesis testing, we have some claims about the
population, and we check whether or not the data obtained from the sample
provide evidence against this claim.
3
Obviously, each one of these forms of inference will not be discussed at length in this
section, but it would be useful to get at least an intuitive sense of the nature of each of
these inference forms, and the difference between them in terms of the types of
conclusions they draw about the population based on the sample results.
Recall that in the EDA unit, when we learned about summarizing the data obtained from
one variable, we distinguished between two cases; numerical data and categorical data.
We will make a similar distinction here in the inference unit. In the EDA unit, the
type of variable determined the displays and numerical measures we used to
summarize the data. In inferential statistics, the type of variable of interest (numerical
or categorical) will determine what the population parameter of interest is.
When the variable of interest is numerical, the population parameter that we infer is
the population mean (mu, µ) associated with that variable versus the sample
statistics that is the sample mean ( 𝑥¯ ). For example, if we are interested in
studying the annual salaries in the population of medical doctors in a certain province,
we’ll choose a sample from that population of medical doctors and use the collected
salary data from the sample ( 𝑥¯ ) to make an inference about µ, the mean annual
salary of all medical doctors in that province.
In order to do so, there are several statistical assumptions that you need to check to
guarantee that you are conducting an appropriate statistical test and that the result could
be interpreted correctly to the wider population. Please refer to Graph 1 for the detailed
steps to conduct statistical data inference for numerical data.
4
Graph 1. Steps to conduct statistical inference for numerical data
Statistical inference for

numerical data
Type of data: ratio vs interval
Normality Test
Using:
−Kolmogorov Smirnov Test
−Shapiro-Wilk Test
Parametric Statistic Non-Parametric Statistic
Unpaired Paired Paired

Unpaired
1 or 2 groups: t- test
Single group: Paired t-test 1 or 2 groups: Wilcoxon rank sum test 1 or 2 groups: Wilcoxon signed r
2 or more groups: One-way ANOVA test

2 or more groups: Repeated ANOVA test
2 or more groups: Kruskal Wallis test 2 or more groups: Friedman’s tes
Pre-class exercise
We want to conduct research on the relationship between baby's birth weight and the
mother’s smoking status. There are 127 pregnant mothers who will participate in this
study. The smoking status variable has 2 values (smoking vs non-smoking). Baby
birth weight is analyzed as numerical data.
Please provide your:
5
1. Research hypothesis
2. Referring to Graph 1, please state all statistical tests that you will conduct to
analyze your data
3. State your statistical hypothesis (null and alternative) for each
statistical test
You have to finish the pre-class exercise before your practical session
takes place. Please give your written answer to the tutor at the beginning of the
practical session. Failure to submit your pre-class exercise will cost you
your practical session attendance.
Class Discussion
Supposed you found that the mean baby’s birth weight of non-smoking mothers was
3762 grams with 95% CI [3591 – 3977 grams] with a p-value at 0.001.
Using layman’s terms, please explain what the numbers mean!
Class Exercise
In 2004, the state of North Carolina in the USA released a large dataset containing
information on births recorded in this state. This data set is useful to researchers
studying the relationship between the habits and practices of expectant mothers and the
birth of their children. You will work with a random sample of observations from this
dataset. We will use this dataset to answer the question in your pre-class exercise.
Your dataset has 13 variables, some categorical and some numerical. The codebook for
those variables is found below:
1. fage : father’s age in years
2. mage : mother’s age in years
3. mature : maturity status of mother
4. weeks : length of pregnancy in weeks
5. premie : whether the birth was classified as premature (premie)
or full-term
6. visits : number of hospital visits during pregnancy
6
7. marital : whether mother is married or not married at birth
8. gained : weight gained by mother during pregnancy in pounds
9. weight : weight of the baby at birth in pounds
10. Lowbirthweight : whether baby was classified as low birthweight
(low) or not (not low)
11. gender : gender of the baby, female or male
12. habit : status of the mother as a nonsmoker or a smoker
13. whitemom : whether mom is white or not white
7
Class Exercise
1. Can you define the variables in the dataset using a code book as in the pre-class
exercise? What will be your choice as a dependent variable? What are the cases
in this dataset? How many cases are there in our sample? How many samples are
eligible for your analysis (consider missing values)?
2. Make a side-by-side boxplot of habit and weight. What does the plot highlight
about the relationship between these two variables?
3. Check if the conditions necessary for statistical inference are met. In this case,
you might need to consider your sample size.
4. Write the hypotheses for testing if the average weights of babies born to
smoking and non-smoking mothers are different (you should already have this
from your pre-class exercise). Conduct your statistical test. Include the 95% CI
in your analysis and please interpret them.
5. Calculate a 95% confidence interval for the average length of all pregnancies
(weeks) and interpret it in context. Note that since you’re doing inference on a
single population parameter, you might recall that on average a normal
pregnancy will be 39 weeks.
8
Exercise Steps
1. Make a side-by-side boxplot of habit and weight. What does the plot
highlight about the relationship between these two variables?
What the
boxplot tells us?
9
2. Hypothesis testing to construct and record a confidence interval for the
difference between the weights of babies born to smoking and non- smoking
mothers.
 Normality check
1
 Homogeneity check
1
2. Calculate a 95% confidence interval for the average length of all
pregnancies (weeks) and interpret it in context.
Results of 95% CI
3. Check if length of pregnancies (weeks) are significantly different

between smoking and non-smoking mothers. Please interpret it in
context.
1
Results of Independent t-test and 95% CI
1
Paper
Smoking and lung cancer risk in Sri Lankan men: a case-control study
P U Chulasiri1, N S Gunawardana2, A de Silva3
(Index words: tobacco, smoking, ever smoker, lung cancer, odds ratio)
Abstract Introduction
Objectives Tobacco smoking is the strongest risk factor for
Non-communicable diseases (NCD) are a leading
lung cancer. As the strength of association of smoking and lung cause of death globally. Tobacco smoking is associated
cancer in Sri Lanka has not been estimated, a study was with ill-health, disability and an increased risk of death
conducted to estimate the risk of lung cancer among adult male from communicable diseases [1]. Tobacco has been
smokers in the Colombo District. named as the only 'legal drug' that kills its users when
Methods A case control study was carried out among 62 newly used exactly as intended by manufacturers [1]. Cigarettes
diagnosed male lung cancer patients from the Colombo District are the commonest form of smoked tobacco in the world
presenting to National Cancer Institute, Maharagama. Four
[1].
controls per case were randomly selected from the same Grama According to data from the National Cancer
Niladhari area matching the age of the cases within 10 years. Registry of Sri Lanka, the second commonest cancer
Absence of lung cancer was clinically confirmed in the among males was lung cancer (8.6 per 100,000
controls. Information on smoking, other potential risk factors population), it was the sixth commonest cancer among all
and confounders were obtained using an interviewer- Sri Lankans (5.4 per 100,000 population) [2].
administered questionnaire. Univariate analysis and logistic Risk factors for lung cancer are well established.
regression identified the risk factors. They include active and passive tobacco smoking,
exposure to asbestos, radon gas or wood smoke, familial
Results After adjustment for confounding variables, ever
and genetic factors and exposure to indoor and outdoor
smokers odds of having lung cancer compared to never smokers
air pollution [3-4]. Among these risk factors, cigarette
OR 10.74 (95% CI 3.54-32.59) . Lower educ ation level
smoking is the strongest determinant of lung cancer [5].
(OR=5.61, 95% CI 2.37-13.28), ever exposed to X-rays
(OR=2.81, 95% CI 1.14-6.94) and a family history of any
cancer (OR=2.83, 95% CI 1.09-7.30) were other significant risk The risk of lung cancer in Asian countries is five
factors. The population attributable risk percent (PAR%) times higher among smokers compared to non-smokers
showed that 84.04% of the male lung cancer cases are
[6,7]. The strength of the association of lung cancer and
smoking in Sri Lanka has not been assessed in the past. It
attributed to smoking.
is likely that the range of risk factors for lung cancer in
Conclusions Smoking and exposure to X-rays were risk factor Sri Lanka are different and the magnitude of risk due to
for lung cancer among adult males in the Colombo District. smoking in the Sri Lankan populations is
unknown. Establishing the strength of the association
is the first step in identifying attributable risk and
population attributable risk of tobacco smoking in lung
Ceylon Medical Journal 2017; 62: 25-28 cancer. This data is important to plan tobacco prevention
DOI: http://doi.org/10.4038/cmj.v62i1.8429 activities in the country. Thus, the present study was
undertaken to estimate the strength of the association
between tobacco smoking and lung cancer and the
population attributable risk of tobacco smoking on lung
cancer among adult males in Sri Lanka.
Ministry of Health, Sri Lanka, 2Department of Community Medicine, Faculty of Medicine, and 3Department of
1
Economics, Faculty of Arts, University of Colombo, Sri Lanka.

Correspondence: PUC, e-mail: <pubudu.chulasiri@gmail.com>. Received 30 May 2016 and revised version
accepted 25 August 2016.
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and
reproduction in any medium, provided the original author and source are credited.
Vol. 62, No. 1, March 2

Paper
Methods alcohol. Classification of drinkers into lifetime abstainer,

A case control study was carried out to identify the former regular drinker, current drinker and non-drinker
risk factors of lung cancer among adult men in the was based on CDC guidelines.
Colombo District. Male patients with primary lung Four pre-intern medical officers were trained as data
cancer, aged more than 20 years, resident in the Colombo collectors. Data entry was carried out using Epidata
district, diagnosed within the last six months and treated software (version 3.1). Statistical analyses were con-
at the National Cancer Institute, Maharagama (CIM) ducted using SPSS version 20. Variables considered as
were included in the study. Diagnosis was confirmed by potential risk factors were stratified into two levels.
an Oncologist. The controls were adult males aged >20 Initially, the risk factors for lung cancer were identified
years selected from the community using the voters list using bivariate cross tabulations and by calculating the
as the sampling frame. Lung cancer was excluded in odds ratios (OR) and 95% confidence intervals (CI).
controls by clinical history and examination. The controls Statistical significance for the association was calculated
were matched by age and area of residence. Four controls based on the chi-square test, and p<0.05 was considered
per case who were aged within 10 years of a case were as statistically significant. Multivariate logistic reg-
randomly selected from the same Grama Niladhari (GN) ression analysis was carried out to identify the adjusted
area. ORs. Independent variables used for the analyses were
variables with a p<0.2 in the bivariate analysis of OR.
The sample size was calculated using the formula Approval was obtained from the Ethics Review Com-
for multiple controls per case. The rate of smoking mittee (ERC) of Faculty of Medicine, University of
among controls was taken as 38% based on smoking Colombo. Written informed consent was obtained from
prevalence in Sri Lanka [8]. Odds ratio associated with all patients.
the exposure (smoking) was taken as 2.7 [9]. By
accounting for a possible 10% non-response rate, the
number of cases selected was 62 and based on a case to
Results
control ratio of 1:4, the number of controls included in All 62 eligible cases who were invited, participated
the study was 248. in the study. The study included 246 eligible controls
out of 248 with a response rate of 99.2%.
An interviewer-administered questionnaire was
used to assess risk factors of lung cancer. The same A majority of the cases (n=28, 45.2%) and controls
questionnaire was used in both cases and controls. The (n=110, 44.7%) were aged 60-69 years and there was
risk factors included were smoking, exposure to second no significant difference in age between cases and
hand smoking (SHS), alcohol consumption, dietary controls.
habits, occupational exposure, household indoor air Bivariate analyses showed that males with
pollution, exposure to radiation and history of cancers education less than GCE Ordinary Level had
in the family. Categorisation of smokers was based on significantly higher risk, (OR=4.0; 95% CI 2.12-7.54)
the definitions by the Centre for Disease Control (CDC), compared to those who had passed GCE Ordinary Level.
Atlanta, United States [10]. The risk of lung cancer among the males who had not
been employed during the life time was significantly
The smokers were categorised as ‘ever smokers’ lower (OR= 0.16; 95% CI-0.03-0.98). Religion, ethnicity
and ‘never smokers’. Persons who had not smoked a or employment was not associated with lung cancer.
tobacco product (cigarette, cigar, bidi, pipe) or had
None of the lung cancer patients had other cancers
smoked fewer than 100 in their lifetime were classified
while two controls had prostate cancer and thyroid
as ‘never smokers’ and those who had smoked more than
cancer. A majority of cases (n=61, 98.4%) and controls
100 tobacco products in their lifetime were classified as
(n=243, 98.8%) had no family history of lung cancer or
‘ever smokers’. Ever smokers were categorised into
any other cancer (n=49, 79% and n=209, 85.0%
‘current smokers’ and ‘former smokers’. Ever smokers
respectively).
who were currently smoking tobacco products daily or
on some days were classified as ‘current smokers’ (daily The risk of lung cancer among males who had been
or non- daily) and those who had not smoking tobacco exposed to at least one X-ray in their lifetime was
products during the last 30 days but had previously significantly higher than those who had no such exposure
(OR=3.45; 95% CI 1.83-6.51). The risk of lung cancer
smoked daily or on some days were classified as ‘former
in those who had been exposed to at least one CT scan in
smokers’ (daily or non-daily).
their lifetime was significantly higher than those who
SHS was defined as breathing tobacco smoke had not (OR=5.17; 95% CI 2.23-12.02).
emitted by someone at home, boarding house, inside a
The risk of lung cancer among ‘ever smokers’ was
vehicle or inside a closed public area (cinema hall,
significantly higher compared to ‘never smokers’
cafeteria, shop, public place) during the lifetime. (OR=10.01; 95% CI-3.88-25.52). Twenty eight (45.2%)
Beverages that contain ethyl alcohol (arrack, wine, ‘ever smokers’ among cases and 65 (26.4%) ‘ever
brandy, beer, toddy, kasippu etc) were considered as smokers’ among controls were ‘current daily smokers’.
2 Ceylon Medical
Paper
A small proportion of ‘ever smokers’ among cases (n=2, controls (n=104, 42.3%) reported exposure to SHS
3.2%) and controls (n=5, 2.0%) current ‘non-daily either at home, at restaurants or inside vehicles in their
smokers’. Other than the former non-daily smokers, other lifetime. When exposure to SHS in any location was
‘ever smoker’ categories (current daily, current non-daily considered, a majority of the cases (n=49, 79%) and
and former daily) had higher risk of lung cancer controls (n=155, 63%) had been exposed to SHS. The
compared to the ‘never smoker’ categories (current daily risk of lung cancer was (OR 2.22; 95% CI 1.10-4.47)
OR=9.9; 95% CI 3.65-26.9), current non-daily higher among males who had been exposed to SHS at
OR=9.20; 95% CI 1.42-59.59) and former daily home, restaurants or vehicles compared to those without
(OR=11.27; 95% CI 4.08-31.12) (Table 1). (Table 2).
A majority of the cases (n=50, 80.6%) and After adjusting for confounding variables, four
approximately half the controls (n=116, 52.8%) had significant risk factors were identified. ‘Ever smokers’
smoked more than 100 sticks per year in their lifetime had a significantly higher risk of lung cancer com-
and the risk of having lung cancer was (OR=4.67; 95% pared to ‘never smokers’ (OR=10.74; 95% (3.54-32.59).
CI 2.37-9.19) higher compared to those who have Education  GCE Ordinary Level (OR=5.61; 95%
smoked zero to 100 sticks per year. The risk of getting CI 2.37-13.28), ‘ever exposure to X rays’ (OR=2.81;
lung cancer among males who had smoked more than 20 95% CI 1.14-6.94) and family history of any cancer
years (OR=2.45; 95% CI 1.37-4.39) was higher (OR= 2.83; 95% CI 1.09-7.30), were significant after
compared to those who had smoked less than 20 years adjustment for confounders (Table 3).
or not smoked at all. Current smokers and those who had Population attributable risk percent (PAR%) of
quit smoking within a period of ten years showed OR=8.8 smoking for lung cancer was estimated as 84.04%.
compared to those who had quit smoking more than ten Prevalence of ‘ever smokers’ was estimated as 54.1%
years ago or had never smoked. (95% CI 51.1% - 57.0%) based on a community-based
cross sectional study while the OR of smoking and lung
Approximately half of the cases (n=33, 53.2%) and cancer was estimated as 10.74 [23].
Table 1. Association between smoking status and lung cancer

Smoking category Cases Controls Odds Ratio (95% CI)
N % N %
Ever smoker 57 91.9 131 53.3 10.01 (3.88-25.82) p<0.001

Current daily 28 45.2 65 26.4 9.9 (3.65-26.9) p=0.001
Current non-daily 2 3.2 5 2.0 9.20 (1.42-59.59) p=0.006
Former daily 25 40.3 51 20.7 11.27 (4.08- 31.12) p=0.001
Former non-daily 2 3.2 10 4.1 4.60 (0.78-16.8) p=0.06
Never smoked 5 8.1 115 46.7 1.0
Table 2. Association between exposure to second hand smoking and lung cancer
Category Cases Controls Odds Ratio (95% CI)
N % N %
Exposed to second hand smoking 33 53.2 104 42.3 2.22 (1.10-4.47)

in home/restaurants/vehicles p=0.02
Exposed to second hand 29 46.8 88 35.8 2.30 (1.13-4.72)
smoking in work place p=0.02
Exposed to second hand smoking 49 79.0 155 63.0 2.21 (1.14-4.30)
in any location p=0.02
Not exposed to any SHS 13 21.0 91 37.0 1.0
Vol. 62, No. 1, March 2

Paper
Table 3. Multivariate logistic regression for the

References
risk factors
1. World Health Organization. WHO global report on trends
Variable 95% in prevalence of tobacco smoking 2015. Geneva: World
OR Confidence
Intervals
Health Organization, 2015.
2. National Cancer Control Programme. Cancer Incidence
Smoking status 10.74 (3.54-32.59)
Data Sri Lanka 2009. National Cancer Control
Ever smoked 1.0
Programme, Sri Lanka, 2015.
Never smoked*
Highest Education Level 5.61 (2.37-13.28) 3. Edwards R. The problem of tobacco smoking. BMJ 2004;
Upto GCE (O/L)a 1.0 328: 217-9.
GCE O/L pass and
above* 4. Turner MC, Krewski D, Pope CA, 3rd, Chen Y, Gapstur
SM, Thun MJ. Long-term ambient fine particulate matter
Exposure to X-rays 2.81 (1.14-6.94)
air pollution and lung cancer in a large cohort of never-
Ever exposed 1.0
smokers. Am J Respir Crit Care Med 2011; 184: 1374-81.
Never exposed*
Family history of cancer 2.83 (1.09-7.30) 5. Alberg AJ, Nonemaker J. Who is at high risk for lung
Yes 1.0 cancer? Population-level and individual-level perspectives.
No* Semin Respir Crit Care Med 2008; 29: 223-32.
Variable(s) entered: Ever smoking status, alcohol consumption, 6. Alberg AJ, Brock MV, Ford JG, Samet JM, Spivack SD.
Highest educational qualification, Employment, Family History of Epidemiology of lung cancer: Diagnosis and management
Cancer, exposure to X Ray, Exposure to CT, History of Pneumonia of lung cancer, 3rd ed: American College of Chest
History of Tuberculosis, History of asthma, Exposure to Second hand Physicians evidence-based clinical practice guidelines.
smoking, Exposure to saw dust, Exposure to granite, Consumption of Chest 2013; 143: e1S-29S.
milk upto the age of 19 years Consumption of processed food up to 19
years, Consumption of processed food from 20-45 years. 7. Bilello KS, Murin S, Matthay RA. Epidemiology, etiology,
a
GCE O/L – General Certificate Examination of Ordinary Level and prevention of lung cancer. Clinics in Chest Medicine
2002; 23: 1-25.
8. Katulanda P, Wickramasinghe K, Mahesh JG, et al.

Discussion Prevalence and correlates of tobacco smoking in Sri Lanka.
Asia Pac J Public Health 2011; 23: 861-9.
Our study found that being an ‘ever smoker’ was a
strong risk factor for lung cancer among males. Other 9. Prasad R, Ahuja RC, Singhal S, et al. A case-control study
significant risk factors for lung cancer identified in the of bidi smoking and bronchogenic carcinoma. Ann Thorac
multivariate logistic regression were, ever exposure to Med 2010; 5: 238-41.
X-rays, educational level of GCE Ordinary Level or less 10. Schoenborn CA, Adams PF, Peregoy JA. Health behaviors
and family history of cancer. The strength of adjusted of adults: United States, 2008-2010. Vital Health Stat
risk of ‘ever smokers’ in the present study is comparable 2013; 10.
with European countries and is higher than the adjusted
11. Chulasiri PU, Gunawardena NS, Silva Ad. Prevalence and
risk for lung cancer reported in other Asian countries
associated factors of smoking among adult males in
[12-13]. One reason for this could be the high number Colombo district and cost of treatment of lung cancer
of cigarettes smoked by the ‘ever smokers’ [12-13]. attributed to smoking [unpublished MD dissertation].
Young males in Western countries initiate smoking at Colombo: University of Colombo, Sri Lanka; 2015.
very young age [14]. Early age at initiation of smoking
12. Hu J, Galeone C, Lui R, Pelucchi C, La Vecchia C, Negri
is a strong risk factor for lung cancer [15]. According to
E. Smoking and lung cancer in Harbin, northeast China.
data from the Colombo District if smoking among males Ann Oncol 2005; 16: 1605-8.
could be prevented, 84% of lung cancers could be
prevented. 13. Jee SH, Samet JM, Ohrr H, Kim JH, Kim IS. Smoking and
cancer risk in Korean men and women. Cancer Causes
Control 2004; 15: 341-8.
Funding
14. Stellman SD, Takezaki T, Wang L, et al. Smoking and lung
This study was supported by a grant from Medical cancer risk in American and Japanese men: an international
Research Institute, Colombo. case-control study. Cancer Epidemiol Biomarkers Prev
2001; 10: 1193-9.
Conflicts of interest 15. Alberg AJ, Ford JG, Samet JM. Epidemiology of lung
cancer: ACCP evidence-based clinical practice guidelines
There are no conflicts of interest. (2nd edition). Chest 2007; 132: 29s-55s.
2 Ceylon Medical
Statistical Methods for Categorical Data
Block I.9

Contents
Statistical Methods for Categorical Data.........................................................................3
Course Objectives.............................................................................................................3
Learning Objectives..........................................................................................................3
Introduction......................................................................................................................3
Pre-Class Exercise............................................................................................................4
Class Exercise...................................................................................................................5
2
Statistical Methods for Categorical Data
Course Objectives
The course objectives of this unit are to choose the appropriate descriptive and inferential
statistical methods based on the data type and to interpret the results appropriately.
Learning Objectives
1. To perform statistical inference for categorical data, including the chi-square test,
Wilcoxon test, Kruskal-Wallis test, and Exact Fisher test.
2. To interpret and conclude about the population from the sample using the results
of the statistical methods performed
Introduction
When the variable of interest is categorical, the population parameter that we will infer is the
population proportion (p) associated with that variable. For example, if we are interested
in studying opinions about adolescent premarital sex among Indonesian girls, our variable of
interest is “premarital sex (in favor/against)”. We will choose a sample of adolescent girls and
use the collected data to make an inference about p, the proportion of Indonesian girls who
support premarital sexual activity.
In the previous session, we studied the relationship between a categorical independent variable
(explanatory) with a numerical dependent variable (response). Theoretical distributions are
described by quantities called parameters, notably the mean and standard deviation.
Methods that use distributional assumptions are called parametric methods because we
estimate the parameters of the distribution assumed for the data.
Non-parametric methods are most often used to analyze data that do not meet the distributional
requirements of parametric methods. Non-parametric statistical tests are used instead of the
parametric tests we have considered thus far, when:
 The data are nominal or ordinal (rather than interval or ratio)
 The data are not normally distributed
The following are some common non-parametric tests:
3
Chi-square: x2
1. used to analyze nominal data
2. compares observed frequencies to frequencies that would be expected under the null
hypothesis
Mann-Whitney U
1. compares two independent groups on a dependent variable measure with rank- ordered
(ordinal) data
2. non-parametric equivalent to a t-test
Wilcoxon matched-pairs test
1. used to compare two correlated groups on a dependent variable measured with rank-
ordered (ordinal) data
2. non-parametric equivalent to a t-test for correlated samples
Kruskal-Wallis test
1. used to compare two or more independent groups on a dependent variable with rank-
ordered (ordinal) data
2. non-parametric alternative to one-way ANOVA
Pre-Class Exercise
There are three pre-class exercise questions that you have to answer. You have to finish the
pre-class exercise before your practical session takes place. Please give your
written answer to the tutor at the beginning of the practical session. Failure to submit your
pre-class exercise will cost you your practical session attendance.
Pre-Class Exercise 1
4
Please interpret the result from Chulasiri, Gunawardana & De Silva (2017) above!
Please interpret the result from Chulasiri, Gunawardana & De Silva (2017) above!
Equivalent Test.
Non-parametric tests are like a parallel universe to parametric tests. The table shows related
pairs between both tests.
Please fill in the correct tests in each blank provided below!
Parametric test Non parametric test
Independent Sample t-test …….
Paired samples t-test …….
One way analysis of variance (ANOVA) …….
One-way repeated measures analysis …….
of variance
Class Exercise
In this practical session, we will learn the use of the chi-square test to measure relationships
between two categorical variables.
In this exercise, we use a retrospective cohort study in the Gunung Kidul district (2015)
to determine the association between teenage pregnancy and low birth weight (LBW) in
Gunung Kidul District. In addition, the study also aims to assess the
5
effect of other variables including chronic energy malnutrition, anemia, education level,
hypertension, and antenatal visit. Data were collected from 394 pregnant women who had a
live birth; 197 of them were <20 years (exposure group) and half of them (n=197) were ≥20
years. The pregnant women in the exposure group were recruited from health centers who had
complete medical records, whereas the no- exposure group was recruited using systematic
random sampling.
Codebook of the variables:

No Variables description Codes/value Name
1 Low birth weight 1 = BWT<=2500g, Low
0 = BWT>2500g
2 Mother’s age 1= teenager Age
0= adult
3 Education level 1= low Edu
0= high
4 Chronic energy malnutrition 1= yes CEM
status 0= no
5 Anemia 1=yes Anemia
0=no
6 Hypertension 1= yes Hypertension
0= no
7 ANC visit 1= incomplete ANC
0= complete
Step 1: State the dependent variable and independent variable of the study
above.
Answer:
Step 2: State the statistical hypotheses
We need to state our statistical hypothesis before measuring the relationship between two
categorical variables, so our hypotheses are:
Ho:
Ha:
Step 3: Summarize our data (dependent and independent variables)
6
How can you get the summarized data? Please refer back to your exploratory data analysis
(EDA) session.
1. In Jamovi, we can use “Analyses” tab. Choose “Frequencies” then choose

“Independent Samples” under Contingency Tables section
7
2. Choose which variables will be in columns and which one will be in rows.
3. Open cells option in the bottom part of contingency tables setting. Check expected and
row column percentage depending on our need.
8
4. What is the proportion of low-birth-weight baby in this research? What is the proportion of
low birth weight by mother’s hypertension status?
9
Step 4: Perform bivariate analysis using the appropriate statistical method to
test our hypothesis and state the interpretation
1. In Jamovi, we can use “Analyses” tab. Choose “Frequencies” then choose

“Independent Samples” under Contingency Tables section
1
2. Choose which variables will be in column and which one will be in row.
3. Open Statistics section. Check X2 (Chi-Square) and Fisher’s exact test
1
4. Is there any association between teenage pregnancy and LBW in Gunung Kidul district? Is
there any association between anemia and LBW in Gunung Kidul district? Could you
interpret the result from both questions?
1
References
1. Altman DG, Bland JM. Parametric v non-parametric methods for data analysis.
BMJ 2009;338:a3167.
2. Chulasiri PU. Smoking and lung cancer risk in Sri Lanka men: a case-control study.
Ceylon Medical Journal 2017; 62:25-28
3. Marjuang, Edy.(2015). Hubungan kehamilan usia remaja dengan kejadian bayi berat
lahir rendah (BBLR) di kabupaten gunungkodul daerah istimewa yogyakarta tahun
2015. Thesis. Yogyakarta: Fakultas Kedokteran Universitas Gadjah Mada.
1
Block I.9

Contents
Correlation and Regression................................................................................................ 3
Course Objectives.................................................................................................. 3
Learning Objectives............................................................................................... 3
Introduction........................................................................................................................ 3
Pearson’s Correlation Coefficient......................................................................................4
Step 1: State the hypothesis...................................................................................5
Step 2: Obtain data, check conditions and summarize data..................................5
Step 3: Obtain the p-value of the test....................................................................5
Step 4: Conclusion................................................................................................. 6
Spearman’s Rank Correlation............................................................................................ 6
Step 4: Conclusion................................................................................................. 7
Simple Linear Regression.................................................................................................. 7
Linear Regression Model......................................................................................8
Step 4: Conclusion................................................................................................. 9
Pre-Class Exercise.............................................................................................................. 10
In-Class Exercise................................................................................................................ 10
2
Course Objectives
The course objectives of this unit are: to calculate correlation and perform regression
analysis and to interpret the result correctly
Objectives
1. To calculate Pearson’s correlation, Spearman’s correlation, and perform simple
linear regression to analyze medical and public health data.
2. To understand the limitation of Pearson’s correlation, Spearman’s
correlation, and simple linear regression.
3. To interpret the result of the statistical tests correctly
Introduction
In inferring a relationship, so far, we have learned inference procedures for both cases
C→Q and C→C from the role/type classification table below. The last case to be
considered in this course is case Q→Q, where both the explanatory and response
variables are numerical (continuous data).
Table 1. Classification of data analysis type

Response
Categorical Quantitative
Categorical C(C C(Q

Explanat
Quantitative Q(C Q(Q
For case Q→Q, we will learn about the following statistical tests:
1. Test for the significance of Pearson's Correlation Coefficient
2. Test for the significance of the slope in linear regression
3. Test for the significance of Spearman's Rank Correlation (non- parametric
data)
3
In the Exploratory Data Analysis (EDA) session, we examined the relationship between
two quantitative variables by looking at a scatterplot. We discussed the regression
equation but made no attempt to claim that whatever relationship was observed in the
sample necessarily held for the larger population from which the sample originated.
In this section, we will learn how to test the relationship between two quantitative data.
We will focus on simple linear relationships and will try to answer the following
questions:
1. Is the correlation coefficient different from zero in the population, or could it be that
we obtained the result in the data just by chance?
2. Is the slope different from zero in the population, or could it be that we obtained the
result in the data just by chance?
The assumptions and conditions to use the methods are:

1. Dependent and independent variables must be quantitative (continuous) data
2. Independent observation
3. Has normal distribution
4. No significant outlier
If the assumptions and conditions are met, we can estimate the slope and correlation
coefficient for our population and conduct hypothesis tests about these parameters using
Pearson’s correlation and simple linear regression. But if the assumptions and
conditions (specifically numbers 3 and 4) are not met, we can estimate the slope and
conduct a hypothesis test using Spearman’s rank.
Interestingly the tests for the slope and the correlation coefficient are equivalent; they
will always produce the same p-value and conclusion.
Pearson's Correlation Coefficient

What we know from the lecture:
1. r only measures the LINEAR association between two quantitative variables X and
Y
4
2. It ranges from -1 and 1 (-1 ≤ r ≤ 1)
3. If the relationship is linear then r = 0 implies no relationship between X and Y
(note this is our null hypothesis!!)
4. r > 0 implies a positive relationship between X and Y (as X increases, Y also
increases)
5. r < 0 implies a negative relationship between X and Y (as X increases, Y
decreases)
Step 1: State the hypotheses

Ho: There is no relationship between the two quantitative variables X and Y Ha:
There is a relationship between the two quantitative variables X and Y. Before
conducting the correlation test, we must define the population correlation coefficient.
In statistics, we use the Greek letter ρ (rho) to denote the population correlation
coefficient. Thus, if there is no relationship between the two quantitative variables X
and Y in our population, we can see that this hypothesis is equivalent to:
Ho: ρ = 0.
The alternative hypothesis will be
Ha: ρ ≠ 0 (two-sided test)
However, one-sided tests are also possible in Pearson’s correlation.
Step 2: Obtain data, check conditions, and summarize data

(i) The sample should be random with independent observations (all observations are
independent of all other observations).
(ii) The relationship should be reasonably linear which we can check using a scatterplot.
Any clearly non-linear relationship should not be analyzed using this method.
(iii) To conduct this test, both variables should be normally distributed which we can
check using histograms and QQ-plots. Remember, outliers can cause problems.
Although there is an intermediate test statistic, in effect, the value of r itself serves as
our test statistic.
5
Step 3: Find the p-value of the test by using the test statistic
We will rely on software to obtain the p-value for this test.
Step 4: Conclusion
As usual, we use the magnitude of the p-value to draw our conclusions. A small p-value
indicates that the evidence provided by the data is strong enough to reject Ho and
conclude (beyond a reasonable doubt) that the two variables are related (ρ ≠ 0). In
particular, if a significance level of 0.05 is used, we will reject Ho if the p-value is less
than 0.05.
Confidence intervals can be obtained to estimate the true population correlation
coefficient (ρ (rho)) but we will not compute these intervals in this course. You could be
asked to interpret or use a confidence interval that has been provided to you.
Spearman's Rank Correlation

We will look at one non-parametric test in case Q→Q.
Spearman's rank correlation uses the same calculations as Pearson's correlation
coefficient except that it uses the ranks instead of the original data. This test is useful
when there are outliers or when the variables do not appear to be normally distributed.
This Spearman’s rank coefficient is similar to r
1. It ranges from -1 to 1
2. A value of 0 implies no relationship
3. Positive values imply a positive relationship
4. Negative values imply a negative relationship.

In this module, we can state our null and alternative hypotheses as:
Ho: There is no relationship between the two quantitative variables X and Y. Ha:
There is a relationship between the two quantitative variables X and Y. This
hypothesis is equivalent to
6
Ho: ρs = 0.
The alternative hypothesis will be
Ha: ρs ≠ 0 (two-sided test)
However, one-sided tests are possible in Spearman’s rank test.

The sample should be random with independent observations (all observations are
independent of all other observations).
The two variables should be quantitative or ordinal.
Step 3: Find the p-value of the test by using the test statistic
We will rely on software to obtain the p-value for this test.
Step 4: Conclusion
conclude (beyond a reasonable doubt) that the two variables are related. In particular, if
a significance level of 0.05 is used, we will reject Ho if the p-value is less than 0.05.
Simple Linear Regression

In the lecture, we discussed the least squares method for estimating the regression line
and used statistical software to obtain the slope and intercept of the linear regression
equation. These estimates can be considered as the sample statistics which estimate the
true population slope and intercept.
Now we will formalize simple linear regression which will require some additional
notation.
A regression model expresses two essential pieces of information:
1. A tendency of the response variable Y to vary with the explanatory variable X in a
systematic fashion (deterministic)
2. A stochastic scattering of points around the curve of statistical relationship (random)
7
Regression is a vast subject that handles a wide variety of possible relationships. All
regression methods begin with a theoretical model which specifies the form of the
relationship and includes any needed assumptions or conditions. Now we will introduce
a more "statistical" definition of the regression model and define the parameters in the
population.
Linear Regression Model

We assume the relationship in the population is linear and can therefore be written as:
𝑦 = 𝛽0 + 𝛽1𝑥+ s
The parameter β0 is the intercept (in the population) and the average value of Y when
X is 0. The parameter β1 is the slope (in the population) and is the change in the average
Y for each 1 unit increase in X. ε is the error term and the error terms are assumed to be:
1. Normally distributed with mean zero (check with histogram and QQ-plot)
2. Constant variance (check with a scatterplot of Y vs. X)
3. Statistically independent (difficult to check, be sure to have independent
observations in the data, different methods are required for dependent observations!)
There is another interesting measure in linear regression. It is the coefficient of
determination, R2, which for simple linear regression is simply the square of the
correlation coefficient, r. The value of R 2 is interpreted as the proportion of variation in
our response variable Y, which can be explained by the linear regression model using
our explanatory variable X.
Properties of R2 are:
1. It ranges from 0 to 1
2. R2 = 0 implies the model explains none of the variation in Y.
A small R2 may or may not mean that there is no relationship between X and Y
- we must be careful as the relationship that exists may simply not be specified in our
model - currently a simple linear model.
8
Now we move into our formal test procedure for simple linear regression.

In order to test the hypothesis that
Ho: There is no relationship between the two quantitative variables X and Y Ha: There
is a relationship between the two quantitative variables X and Y assuming our model
is correct (a linear model is sufficient), we can write the above hypothesis as
Ho: β1 = 0 (the slope of our linear equation = 0 in the population). The
alternative hypothesis will be
Ha: β1 ≠ 0. (two-sided test)

1. The sample should be random with independent observations (all
observations are independent of all other observations).
2. The relationship should be linear which we can check using a scatterplot.
3. The residuals should be reasonably normally distributed with a constant
variance which we can check using the methods discussed below.
Normality Test: Using histogram and QQ-plot of the residuals.
Step 3: Find the p-value of the test by using the test statistic as follows
Under the null hypothesis, the test statistic follows a t-distribution with n-2 degrees
of freedom. We will rely on software to obtain the p-value for this test.
Step 4: Conclusion
conclude (beyond a reasonable doubt) that the slope in the population is not zero and
therefore the two variables are related. In particular, if a significance level of 0.05 is
used, we will reject Ho if the p-value is less than 0.05.
9
Confidence intervals will also be obtained in the software to estimate the true
population slope, β1.
Exercise
Pre-Class Exercise
Please finish this exercise before the laboratory session and discuss your answer with
the instructor during the laboratory session.
You have to finish the pre-class exercise before your practical session
takes place. Please give your written answer to the tutor at the beginning of the
practical session. Failure to submit your pre-class exercise will cost you
your practical session attendance.
We use the data about maternal age (in years) and parity for women who attended their
first antenatal (ANC) visits. We want to look for the relationship between maternal age
and parity using Pearson’s correlation coefficient. The result for Pearson’s correlation
coefficient is r = 0.3 and p-value = 0.03.
Questions:
1. What is the interpretation of the result? (Interpret both the r coefficient and p-
value)
2. Is Pearson’s correlation coefficient the right statistical test for this data?
3. Please state your reason for answer number 2
4. If your answer for number 2 is no, what is the right statistical test?
In-Class Exercise
Exercise 1
For the in-class exercise, we have research called “Relationship between C - reactive
protein level and blood glucose level in patients with acute myocardial infarct”. Students
will be asked questions regarding the statistical tests which will be discussed in the
laboratory with the instructor.
Question
1
1. Please state your proposed statistical test for this topic and state your reason.
2. Please state your hypothesis for this study
3. Please state your step to test the hypothesis using your chosen statistical test.
Exercise 2
This is a study in 1964 about the relationship between the amount of crying and IQ. It
has been thought that greater infant vocalization (for instance, more crying) is
associated with higher IQ. In the study, 38 newborns were made to cry after being
tapped on the foot and the number of distinct cry vocalizations within 20 seconds was
counted. The subjects were followed up at 3 years of age and their IQs were
measured. Please compute and conclude the result of the relationship between the
amount of crying and IQ through statistical analysis!
1. Please open file “3. Dataset Correlation and Regression.omv” with Jamovi
2. Check conditions and summarize data In
Jamovi:
• Analyses tab Exploration  Scatterplot
• Enter crycount to X-Axis and IQ to Y-Axis
1
1
• If you want to add linear line to help visualize the association between two
variables, check Linear on Regression Line section
• Results
Scatterplot Scatterplot with fitted linear line
3. Estimate the linear regression intercept and slope

 We can use linear regression analysis to estimate the intercept and slope
of crycount and IQ
 In the analyses choose Regression  Linear Regression
 Enter IQ to Dependent Variable box and crycount to Covariates box
 In the model coefficient section check Confidence Interval
1
4. Check the data distribution by histograms or QQ-plots To
make QQ-plot with Jamovi:
 Analyses  Descriptives Enter variables
 Go to Plots section. Check Q-Q
1
5. Conclude the result of normality test!
6. Conduct statistical test analysis (correlation test)
• In Jamovi, Choose Analyses  Regression  Correlation Matrix
• Enter all of the variables. Then choose Pearson and Spearman in the
Correlation Coefficients section. And check Flag significant
correlations in the Additional Options section
1
7. Read the result/ output in Jamovi
 Check the p-value and rho
 Please explain the result?
References
Rosner, B. 2011. Chapter 11: Regression and Correlation. Fundamental of
Biostatistics, 7th Edition. Boston: Brooks/Cole
1
Mukaka M. 2012. A guide to appropriate use of Correlation coefficient in medical
research. Malawi Medical Journal : The Journal of Medical Association of
Malawi. 24(3):69-71.

Skills Lab Book I.9 (2023)

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Skills Lab Book I.9 (2023)

Uploaded by

Copyright:

Available Formats

TABLE OF CONTENTS

Developing Personal Formulary ...........................................................................................

Dressing, Bandaging and Splinting ......................................................................................

Skills Training Material Book year II | 1

DEVELOPING PERSONAL FORMULARY

Skills Training Material Book year II | 3

1. Students must follow every practical session.

4 | Skills Training Material Book year II

DEVELOPING PERSONAL FORMULARY

Dr. dr. Woro Rukmi Pratiwi, MKes, SpPD, FINASIM

dr. Yolanda Dyah Kartika, M.Sc.

dr. Eggi Arguni M.Sc, PhD, Sp.A(K)

dr. Catharina Triwikatmini M.Kes., Sp.PD-KGEH

EDUCATIONAL DESIGN REVIEWED BY:

Skills Training Material Book year II | 5

The number of circulating drug in Indonesia is sometimes difficult for physicians to

No. Topics for Clinical Skills Training Block

Yogyakarta, November 2023

6 | Skills Training Material Book year II

I. Learning Objective of Block I.9

II. Learning Objective Of Skills Training

Time Activity Students Instructor Materials

Skills Training Material Book year II | 7

Background Fresh-graduate physicians are often difficults to understand and explore

To facilitate the selection of drugs in practice, it is necessary to

After completing this activity, students are expected to develop and

Methods Preparation lecture, role play and group discussion

Time allocation 100 minutes

8 | Skills Training Material Book year II

Pharmaceutical dosage form and picture:

Indication and Dosage:

Skills Training Material Book year II | 9

INFORMATION FOR THE PATIENT

e. Some parameters which used during follow up

10 | Skills Training Material Book year

e. Some parameters which used during follow up

For Indication 3 (etc):

j. Some parameters which used during follow up

Yogyakarta, Agustus 2021

Skills Training Material Book year II |

(WHO Guide to Good Prescribing: A Practical Manual)

12 | Skills Training Material Book year

DRESSING, BANDAGING AND SPLINTING

UNIVERSITAS GADJAH MADA

Skills Training Material Book year II |

dr. M. Rosadi Siswandhana , SpB, SpBP-RE(K)

dr. Santosa Budiharjo, MKes, PA(K)

dr. Yudha Mathan Sakti, SpOT (K)

dr. Zikrina Abyanti Lanodiyu, Sp.OT

Dr. Christantie Effendy, S.Kp, M.Kes.

Lucia Anik Purwaningsih, Skep, Ns

Educational Design Reviewed by

Skills Training Material Book year II |

No. Skills Training Topic Block

2. Aseptic Procedure 1.4

Yogyakarta, October 2023

16 | Skills Training Material Book year

Skills Training Material Book year II |

A. General Objectives of Skills Training Year 2

Accident and Emergency Level of Expected Ability

The Arm & The Leg Level of Expected Ability

Therapeutic Skills Level of Expected Ability

18 | Skills Training Material Book year