Electrochimica Acta 182 (2015) 516–523

Contents lists available at ScienceDirect

Electrochimica Acta
journal homepage: www.elsevier.com/locate/electacta

Signaling-Probe Displacement Electrochemical Aptamer-based Sensor

(SD-EAB) for Detection of Nanomolar Kanamycin A
Ran Liua , Zihua Yanga , Qian Guoa , Juncai Zhaoa , Jie Maa , Qian Kanga , Yunfei Tangb ,
Ying Xuec , Xinhui Loua,* , Miao Heb,*
a
Department of Chemistry, Capital Normal University, Xisanhuan North Road 105, Beijing 100048, China
b
School of Environment, Tsinghua University, Beijing 100084, China
c
Beijing Municipal Center for Disease Prevention and Control, Beijing, China

A R T I C L E I N F O A B S T R A C T

Article history: The signal transduction of most target induced strand displacement-based assays relies on the
Received 14 July 2015 conformational changes of aptamers, significantly limiting the general applications of these sensors. We
Received in revised form 23 September 2015 report on a very simple and general sensor named signaling-probe displacement electrochemical
Accepted 24 September 2015
aptamer-based sensor (SD-EAB), in which signal transduction is induced only by the affinity binding
Available online 28 September 2015
between an aptamer and its target and completely independent of the conformational state of the
aptamer. A typical SD-EAB is comprised of a gold electrode immobilized with DNA duplexes formed
Keywords:
between a thiolated capture probe (aptamer or its short complementary strand) and a redox tagged
Aptamer
kanamycin A
signaling probe (short complementary strand or aptamer). In the presence of target, the signaling probe is
strand displacement displaced and released from the electrode surface, leading to the decrease of current proportional to the
electrochemical sensors logarithm of target concentrations. SD-EAB achieved the reagentless detection of kanamycin A with 7
electrochemical impedance spectroscopy orders of magnitude dynamic ranges (1 nM–10 mM). Amazingly, SD-EAB clearly differentiated
kanamycin A from its structural analogues kanamycin B by showing opposite current change. In
contrast, its counterpart, the label-free electrochemical impedance spectroscopy (EIS)-based sensor, was
one thousand times less sensitive than SD-EAB and had a narrow dynamic range (1–100 mM) due to its
limited tolerance of nonspecific adsorption of kanamycin A.
ã 2015 Elsevier Ltd. All rights reserved.

1. Introduction potential to affect anyone, of any age, in any country” in “WHO’s

Antibiotics revolutionized medicine in the 20th century due to
their effectiveness and easy access. There are thousands of
synthetic or natural antibiotics that have been synthesized or
isolated as far. However, the abuse of them results in the serious
environmental pollution due to the discharge of excrement and
urine by human being and poultry, and the emergence of
resistance of bacteria. In 2014, the World Health Organization
classified the resistance of bacteria as “a serious threat that is
happening right now in every region of the world and has the
Abbreviations: ELISA, Enzyme-Linked Immunosorbent Assay; EAB, Electro-
chemical Aptamer-Based sensors; TREAS, Target-Responsive Electrochemical
Aptamer Switch; EIS, Electrochemical Impedance Spectroscopy; EIS-AB, EIS-
Aptamer-Based sensor; SD-EAB, Signaling-probe Displacement Electrochemical
Aptamer-Based sensor.
* Corresponding authors. Fax: +86 10 68902320.
E-mail addresses: xinhuilou@cnu.edu.cn (X. Lou), hemiao@mail.tsinghua.edu.cn
(M. He).
first global report on antibiotic resistance”. The serious situation
has prompted the issue of regulations in many countries and the
development of methods for the detection of antibiotic residues in
environment.
Antibiotics are commonly classified based on their mechanism
of action, chemical structure, or spectrum of activity. Kanamycin A,
one of the most widely used aminoglycoside antibiotics, is used to
treat a wide variety of infections by inducing mistranslation and
blocks translocation by interacting with proteins [1]. The
chromatography-based methods [2–5] and immunoassays, typi-
cally, Enzyme-Linked Immunosorbent Assays (ELISAs) [6,7] and
colloidal gold test strips [8], are the most widely used methods for
the quantitative detection and screening of kanamycin A. However,
the chromatography-based methods require sophisticated instru-
ments, well-trained personnel, and long time, not suitable for on-
site applications. The immunoassays are advantageous to the
instrument-based methods because of its operational conve-
nience, high sensitivity, specificity, and rapid turnaround time.
Nanomolar kanamycin A was able to be detected with these

http://dx.doi.org/10.1016/j.electacta.2015.09.140
0013-4686/ ã 2015 Elsevier Ltd. All rights reserved.
 R. Liu et al. / Electrochimica Acta 182 (2015) 516–523
Table 1
Comparison of some recently reported aptamer-based sensors and immunoassays for detection of kanamycin A with SD-EAB.
Sensor types Limit of detection(M)
electrochemical [19] 9.4
109
electrochemical [21] 5.8
109
electrochemical [45] 1.0
108
colorimetric [15] 1.0
108
luminescent [18] 1.4
107
FRET [17] 9
1012
Rapid-ELISA [8] 1.7
109 (IC50)
Colloidal gold immunoassay [8] 1.0
108
SD-EAB 1.0
109
IC50: 50% inhibition value.
methods. However, the immunoassays need expensive antibodies
and enzymes, which is not cost effective. Therefore, the develop-
ment of fast, cheap, and easy detection systems is particularly
important and urgently desired, especially in underdeveloped
areas.
Aptamers are peptides or oligonucleotides that specifically
recognize and bind to a wide range of targets ranging from small
molecules to large proteins and even cells [9,10]. Aptamers have
becoming attractive functional molecules for a variety of important
applications including biosensors, imaging, drug delivery, and
bioengineering [11,12]. Aptamers are particularly useful as
biosensing elements as they are chemically stable, readily
available, with high purity, and ease of modification in biosensor
design [13,14].
As the discovery of anti-kanamycin A aptamers, several
aptamer-based kanamycin A biosensors including colorimetric
[15,16], fluorescent [17], luminescent [18], and electrochemical
sensors [19–21] have been recently reported (Table 1). However,
these sensors have some of the following problems that limit their
practical applications: narrow dynamic range [15,17–21], compli-
cated sensor preparation process [20,21], or requirement of
enzymatic reactions for signal amplification [16].
Target induced strand displacement is one of the most widely
used signal transduction strategy in aptamer-based sensors for
fluorescent [22,23], colorimetric [24,25], and electrochemical
[26,27] detection of DNAs, proteins, ions, and small molecules.
Typically, in those sensors, a short complementary DNA strand is
hybridized with a DNA aptamer. A target can specifically bind with
the aptamer and induce the displacement of the complementary
strand, causing a corresponding signal change for quantitative
detection of the target. Among these methods, electrochemical
aptamer-based sensors (EAB) have attracted extensive attention
because they possess many properties that are required for on-site
applications: operational simplicity, high sensitivity, portability,
and low cost [26–30]. For example, Xiao et al. reported the first
target induced strand displacement-based EAB sensor for signal-
on detection of thrombin, where a short methylene blue (MB)-
tagged oligonucleotide hybridized partially with an anti-thrombin
aptamer and partially with a DNA sequence linking the aptamer to
the electrode. Thrombin binds with the aptamer and induces the
release of one end of MB tagged oligonucleotide to approach the
electrode surface, producing an increase of the Faradaic current
[29]. Later on, based on the similar concept, they designed an
ultrasensitive electrochemical sensor for DNA detection [30]. Fan
et al. further simplified the sensor probe design and demonstrated
a target-responsive electrochemical aptamer switch (TREAS) for
detection of adenosine triphosphate (ATP) at nanomolar concen-
tration, in which the anti-ATP aptamer dually labeled with SH and
ferrocene (Fc) at the two terminals was self-assembled on gold
electrodes and its complementary strand then hybridized with the
aptamer to form the rigid duplex structure and limit the electron
transfer of Fc with the electrode [28]. ATP binds with its aptamer
517
Dynamics range (M) Reagent-less Assay time
(min)
5
108–9
106 Yes 30
1
108–1.5
107 No 60
1
108–1
103 Yes 30
1
108–1
107 No 60
2
107–1.5
104 No 10
1
1011–3
109 No 210
– No 40
– Yes 10
1
109–1
102 Yes 30
and liberates the complementary DNA, leading to the structural
switch from the duplex to the tertiary aptamer structure. An
increase of current is generated as the Fc moiety approaches the
electrode surface. Willner and Dong respectively reported an even
simpler strategy by using label-free signaling probe to detection of
adenosine using electrochemical impedance spectroscopy (EIS),
here referred as EIS-aptamer-based sensor (EIS-AB) [26,27].
The purpose of this work is to develop a sensitive, cheap, and
easy aptamer-based method that is able to detect the trace amount
of antibiotics in the environmental sample. Taking the detection of
kanamycin A as an example, here we report a simple and general
signaling-probe displacement electrochemical aptamer-based
sensor (SD-EAB, Fig. 1), capable of reagentless detection of
kanamycin A with high sensitivity, selectivity, extremely broad
dynamic ranges, and good tolerance of nonspecific adsorption.
Compared to the TREAS and EIS-AB, SD-EAB is also simple in
design and generalizable while it has several advantages. First, the
signal change of SD-EAB is induced only by the affinity binding
between an aptamer and its target and completely independent of
the conformational state of the aptamer before and after binding
with target. The signal change of TREAS still highly relies on the
conformational state of the aptamer binding with its target
because it determines the distance between the redox moiety and
the electrode and therefore has a strong impact on the sensitivity.
The small increase of the distance can cause orders of magnitude
decrease of the electron exchange rate and therefore seriously
confound the sensitivity of the sensor. Similarly, the impedance
change of EIS-AB is not only determined by the amount of
aptamers or the short complementary probes that are displaced,
but also strongly interfered by target itself or contaminants that
Fig. 1. Schematic illustrations of SD-EAB A (A) and B (B) for the detection of
Kanamycin A. A SD-EAB is comprised of a gold electrode immobilized with DNA
duplexes formed between (A) a thiolated aptamer capture probe and a Fc tagged
short complementary signalling probe, or (B) a thiolated short complementary
capture probe and a Fc tagged aptamer signalling probe. Kanamycin A binds with an
aptamer and induced the displacement of a short complementary (A) or an aptamer
signalling probe (B).
518 R. Liu et al. / Electrochimica Acta 182 (2015) 516–523
are adsorbed on the electrode. Second, the design of SD-EAB is
general for all aptamers regardless the length of them. Third, SD-
EAB is extremely sensitive due to the physical separation of redox
moiety from the electrode after the strand is displaced, attributing
to its much better tolerance of the nonspecific adsorption of targets
and other contaminants on the electrode. In contrast, EIS-AB
suffers from the strong interference from the nonspecific adsorp-
tion of targets and other contaminants, leading to seriously
confound sensitivity.
2. Material and methods
2.1. Materials
Oligonucleotides were synthesized and purified via HPLC by
Takara Biotechnology Co. (Dalian, China). All DNA strands were
confirmed by mass spectrometry and the sequences are listed in
Table 2. All DNAs were dissolved in RNase-free water at 100 mM
and stored at 80  C. Kanamycin A, kanamycin B, ampicillin,
sulfadimethoxine, and tetracycline were all bought from National
Standard Substances Center (Beijing, China). Mercaptohexanol
(MCH), Tris-(2-carboxyethyl) phosphine hydrochloride (TCEP) and
hexaammineruthenium(III) chloride (RuHex) were purchased
from Sigma–Aldrich and used as received. All other reagents were
of analytical grade. RNase-free water was purchased from Takara
Biotechnology. All solutions were prepared with Milli-Q water
(18.2 MV cm1) from a Millipore system.
2.2. Gold electrode cleaning
The electrode was polished carefully to a mirror-like surface
with 1, 0.3, and 0.05 mm Al2O3 powder on a microcloth (Shanghai
Chenhua, China) for 5 min and sonicated in both ethanol and
ultrapure water respectively for 5 min to remove residual Al2O3.
The electrode was then cleaned by electrochemical polishing with
35 successive cyclic voltammetry (CV) scans from 0.4 V to +1.2 V
(vs. Hg-Hg2SO4) in 0.5 M H2SO4 at 100 mV/s.
2.3. Fabrication of SD-EABs
For the preparation of SD-EAB A (Fig. 1A), A-SH at 1 mM was
mixed with TCEP at 100 mM in a buffer A (10 mM phosphate buffer
(pH 7.0) /1.0 M NaCl /5 mM MgCl2) for 1 h. The cleaned gold
electrode was then immersed in the above solution for 12 h,
followed by incubation in 2 mM MCH for 1 h. After that, the
electrode was rinsed thoroughly with buffer A, followed by
incubation with 0.5 mM C-Fc in buffer A for 2 h. The functionalized
electrode was stored at 4  C in buffer A prior to use. As the
preparation of SD-EAB B (Fig. 1B), the same process was used
except that A-SH and C-Fc were replaced by C-SH and A-Fc
(Table 2), respectively.
For the preparation of SD-EAB C, the following process was
utilized. One micro litter of A-SH stock solution (100 mM) and 5 mL
C-Fc stock solution (100 mM) were mixed to prepare 100 mL of
Table 2
Probes used in this study
Name Sequence (from 50 to 30 )
A-SH TGGGGGTTGAGGCTAAGCCGAGTCACTAT-(CH2)3-SH
C-Fc Fc-(CH2)6-GTGACTCGGCTT
C-SH HS-(CH2)6-TATGTGACTCGGCTT
A-Fc TGGGGGTTGAGGCTAAGCCGAGTCAC-(CH2)6-Fc
C GTGACTCGGCTT
A TGGGGGTTGAGGCTAAGCCGAGTCAC
Fc: ferrocene.
solution in buffer A. The mixture was then incubated in a 95  C
water-bath for 10 min and slowly cooled down to the room
temperature. Subsequently, to the mixture added 1 mL of TCEP
(10 mM, stock solution) and the mixture was kept for 1 h. The
cleaned gold electrode was then immersed in the above solution
for 12 h, followed by the incubation in 1 mM MCH for 1 h. Finally,
the functionalized electrode was stored at 4  C in buffer A prior to
use.
2.4. Electrochemical measurements
All electrochemical measurements including square-wave
voltammetry (SWV), chronocoulometry (CC), and electrochemical
impedance spectroscopy (EIS) were performed on a multichannel
potentiostat (VMP3, France) at room temperature, using a three-
electrode system consisting of the DNA-modified gold electrode as
the working electrode, a saturated calomel reference electrode
(SCE), and a platinum wire as counter electrode. SWV was
performed in buffer A within the potential range from 0.3 to
0.7 V under a modulation amplitude of 25 mV and a scan rate of
50 mV/s with a step potential of 1 mV for all the detections. The
sensors were immersed in 200 mL buffer A containing targets at
various concentrations for 30 min. The electrodes were then rinsed
with buffer A prior to the electrochemical measurements. CC
measurements were performed in the absence and presence of
50 mM RuHex in 10 mM Tris buffer (pH 7.4) while holding the
potential at 0.3 V vs SCE for 1 s. A negative potential was applied
to the working electrode to facilitate the reduction reaction of
RuHex.
EIS was performed in buffer A containing 5 mM Fe(CN)63/Fe
(CN)64 in the frequency range from 0.03 Hz to 200 kHz with 10 mV
as the amplitude before and after the sensors were incubated with
buffer A containing targets at various concentrations for 30 min. All
the SWV and EIS measurements were performed at 37  C, unless
otherwise specified.
3. Results and discussion
3.1. Design of SD-EAB
Conceptually, similarly to the probe designs for EIS-AB [26,27],
there are two types of probe designs for SD-EAB as shown in Fig. 1:
either thiolated aptamer (A-SH, Table 2, Fig. 1A) or its short
complementary probe (C-SH, Table 2, Fig. 1B) is served as the
capture probe permanently attached to the gold electrode through
Au-S interaction. The Fc tagged short complementary probe (C-Fc,
Table 2, Fig. 1A) or aptamer (A-Fc, Table 2, Fig. 1B) signaling probe is
then hybridized to the capture probe to form a duplex. Fc is close to
the electrode surface, thus can efficiently exchange electrons with
the underlying electrodes and generates high current. In the
presence of target, the signaling probe is displaced due to the
competitive binding of the aptamer with the target, resulting in a
measurable decrease of the current that is quantitatively related to
the concentration of the target (Fig. 1).
Description
capture probe in SD-EAB A
signaling probe in SD-EAB A
capture probe in SD-EAB B
signaling probe in SD-EAB B
signaling probe in EIS-AB A
signaling probe in EIS-AB B
 R. Liu et al. / Electrochimica Acta 182 (2015) 516–523 519

In this study, we employed an in vitro selected 21-base anti-
kanamycin A DNA aptamer [15] to fabricate the two sensors as
shown in Fig. 1: SD-EAB A and B. The position of the duplex was
arranged at the 30 end of the aptamer due to the presence of five
consecutive deoxyguanosines (G) at 50 end of the aptamer that
would cause the increased melting temperature of the duplex and
the difficulty of the target induced displacement. Considering the
high G/C percentage of the aptamer, a six bases short sequence (50 -
AGTCAC-30 ) was extended at the 30 end of the aptamer to hybridize
with the six bases of the short complimentary strand. Only six
bases of the aptamer are hybridized with the short complimentary
strand to ensure the successes of the target induced displacement.
Thus, a total of 12 bases of capture and signaling probe are
hybridized. A three more bases (TAT) were added as the spacer
between the thiol group and the capture aptamer or short
complimentary strand to avoid the possible steric hindrance
between the electrode surface and the capture strand.
3.2. Detection of kanamycin A using SD-EAB
The detection of kanamycin A was conducted using SD-EAB A
and B, respectively. We found that the signal reached level-off after
30 min’s incubation with the sample at 37  C and therefore all the
data at different target concentrations were collected under these
conditions. As shown in Fig. 2, the overall performance of SD-EAB A
in sensitivity and signal linearity as the function of the logarithm of
target concentration was much better than that of SD-EAB B. For
both sensors, the peak current near 0.2 V corresponding to the
oxidation peak of Fc, measured by SWV, gradually decreased as the
increase of the concentration of kanamycin A. For SD-EAB A, a nice
linear relationship between the relative current changes and the
logarithm of the concentration of kanamycin A with the correlation
coefficient of 0.996 was observed in the concentration from 1 nM
to 100 mM (Fig. 2A, 2D). Surprisingly, the detection limit of SD-EAB
B was only 0.5 mM, 500 times higher than that of SD-EAB A (Fig. 2B,
2D). The relationship between the relative current changes and the
logarithm of the concentration of kanamycin A from 0.5 mM to
10 mM was not linear any more.
By using SD-EAB A, kanamycin A as low as 1 nM was statistically
detected, which was 5–10 times more sensitive than other
reported electrochemical kanamycin sensors and comparable to
the immunoassays [6–8] and chromatography-based standard
methods [2–5] (Table 1). Importantly, the dynamic ranges of SD-
EAB A ranged from 1 nM to 10 mM, 2–5 orders of magnitudes
wilder than other reported kanamycin A sensors (Table 1). The high
sensitivity and extraordinary broad dynamic range of SD-EAB A
should be contributed to the physical separation of the redox
moiety from the electrode which produces the high absolute
current changes [31] and the exceptionally high sensitivity of
electrochemical current measurement techniques such as SWV
and DPV. Our previous studies have demonstrated that the linear
dynamic range of an electrochemical Hg2+ sensor (10 pM–100 mM)
[31] was 4 orders of magnitude wilder than its fluorescent
counterpart (10 nM–10 mM) [32]. The semi-log dependence of the
calibration curves is quite common in electrochemical current
measurements that are conducted on electrode surface [30,31,33–
35]. We believe that the surface effect plays a significant role here.
It is possibly due to the fact that the concentration decrease of the
free probes attached to the electrode is much greater than that of
its counterparts in the homogeneous solution when the probes are
challenged with targets. The wide dynamic range enables the
application of SD-EAB in wide concentration range and therefore
avoids the tedious dilution or pre-concentration step. SD-EAB is a
reagentless sensor, enabling the detection of kanamycin A in a very
simple way, while the additional reagents are still required for
most reported recently methods during the detection process
(Table 1). In addition, the similar trend at room temperature was
observed: the current decrease was also proportional to the
concentration of kanamycin at room temperature. However, the
sensitivity of SD-EAB at 37  C was about 100 times lower than that
at room temperature (Fig. 2C, 2D), probably contributed to the
lower binding affinity between the capture and signaling probe at
the higher temperature. The wide temperature operation window
of SD-EAB adds additional value for on-site applications.
In order to understand the reasons that cause the huge
difference in sensor performance, we respectively characterized

Fig. 2. A direct comparison between SD-EAB A and B for the detection of kanamycin A as shown in SWV curves (A, B, and C) and the calibration curves (D). (A) and (C) were the
SWV curves of SD-EAB A collected at 37  C and room temperature, respectively. (B) was the SWV curves of SD-EAB B collected at 37  C. The calibration curves (a), (b), and (c)
shown in (D) were corresponding to Fig. (A), (B), and (C), respectively. The data reported are averages of three individual experiments. The percent signal decrease on the
ordinate of the calibration curves was calculated by the equation: signal % = (I0-I)/I0
100%. Here I denotes the peak current at the presence of target and I0 denotes the blank
current (0 nM target).
520 R. Liu et al. / Electrochimica Acta 182 (2015) 516–523
Table 3
The surface characterization of SD-EAB A and B.
SD-EAB Capture probe density (probes/cm2)a Capture Probe spacing (nm)b Hybridization efficiency (%)c Signaling probe density (probes/cm2) Aptamer density
A 1.6  0.1
1012 7.9  0.3
B 4.4  0.4
1012 4.8  0.2
a
measured and calculated from the four repeated standard chronocoulometry measurements (Fig. S-1, -2, SI). [31,36].
b
calculated according to the probe density. We assume that all the probes were uniformly immobilized on the electrode with a square footprint. Each probe’s footprint is
equal to the reciprocal of the capture probe density, and the probe spacing is equal to the square root of the footprint.
c
calculated according to the probe density before and after hybridization (Fig. S-1, -2, SI) [31,36].
the densities of the capture probes, signaling probes, and aptamers
on the electrodes for SD-EAB A and B, respectively, using the
standard chronocoulometry (CC) methods (Table 3) [31,36]. The
detailed procedure and equations were well described in the
reference [31,36]. Specifically, the capture probe (A-SH in SD-EAB A
or C-SH in SD-EAB B) density was 1.6  0.1
1012 and
4.4  0.4
1012 probes/cm2 (Fig. S-1, -2, Supporting Information
(SI)), respectively, corresponding well to the literature reported
data [31,37]. The shorter probes usually have the higher density
under the same immobilization conditions. The measured
hybridization efficiency for A-SH in SD-EAB A or C-SH in SD-EAB
B was 92.0  6.4 and 33.1  0.2 % (Fig. S-1, -2, SI), respectively. The
much lower hybridization efficiency of C-SH in SD-EAB B should be
mainly due to their high density [38]. Eventually, the signaling
probes with the same density (1.5  0.1
1012 probes/cm2) were
formed in SD-EAB A and B (Table 3). The densities of the aptamers
in SD-EAB A and B were also very similar: 1.6  0.1
1012 and
1.5  0.1
1012 probes/cm2, respectively. However, the probe spac-
ing between the two close-by capture probes of SD-EAB B
(4.8  0.2 nm) was much smaller than that of SD-EAB A
(7.9  0.3 nm), which may interfere the efficient binding of
aptamers with their targets and the release of the aptamer-target
complexes due to steric hindrance. In addition, kanamycin A is an
aminoglycoside antibiotic that has four amine groups per molecule
and is positively charged in the detection buffer A. Thus, the
nonspecific adsorption of kanamycin A on the negatively charged
DNA probes should exist. The stronger nonspecific adsorption is
expected on the electrode surface of SD-EAB B with the higher DNA
probe density, which may interfere with the sensitivity of the
sensor.
To confirm if the steric hindrance is one of the critical factors
attributed to the low sensitivity of SD-EAB B, we used the one-step
immobilization of pre-hybridized duplexes to fabricate a SD-EAB C
that has the same probe design as that of SD-EAB B, but has the
much lower capture probe spacing than that of SD-EAB B [39].
Specifically, C-SH and A-Fc (Table 2) was mixed at the molar ratio of
1 to 5 in the hybridization buffer to ensure the formation of duplex.
The measured duplex density was 1.4  0.1
1012 probes/cm2
(Fig. S-3, SI), which was much lower than the density of C-SH in
SD-EAB B (4.4  0.4
1012 probes/cm2, Table 3). The density of both
signaling probes and aptamers on the electrode for SD-EAB C was
very close to the values for SD-EAB B (1.5  0.1
1012 probes/cm2,
Table 3). The calculated probe spacing between the two close-by
duplexes of SD-EAB C was 8.6  0.2 nm, even slightly greater than
that of SD-EAB A (7.9  0.3 nm). However, the detection limit of SD-
EAB C was still 0.5 mM (Fig. S-4), as same as that of SD-EAB B. The
data suggested that the steric hindrance and the nonspecific
adsorption of kanamycin A should not be the major reasons that
caused the low sensitivity of SD-EAB B. We suspect that the release
of the aptamer-kanamycin A complexes from the electrode surface
might be much more difficult than that of the short complemen-
tary probes due to their bigger sizes and the binding affinity
between positively charged kanamycin A and the negatively
charged probes. The stable attachment of aptamer on sensor
(probes/cm2)
92.0  6.4 1.5  0.1
1012 1.6  0.1
1012
33.1  0.2 1.5  0.1
1012 1.5  0.1
1012
surface (as the capture probe) may also facilitate its conformation
change upon binding to the analyte and the strand displacement.
3.3. Selectivity tests of SD-EAB A
We challenged our SD-EAB A sensor with several common used
antibiotics that have either very similar or completely different
chemical structures with kanamycin A.
SD-EAB A possessed excellent selectivity against kanamycin B,
the structural analogues of kanamycin A, and other types of
antibiotics including ampicillin, sulfadimethoxine, and tetracy-
cline, even at high concentrations. Specifically, as shown in Fig. 3,
when SD-EAB A was respectively challenged with these targets at
100 mM, 51.2% current decrease was observed in the presence of
kanamycin A. In sharp contrast, only 0  9.4 and 2.2  6.8% of
current decreases were detected in the presence of sulfadime-
thoxine and tetracycline, respectively. Interestingly, 9.8  1.0 and
6.6  1.6% of current increases were detected in the presence of
kanamycin B and ampicillin, respectively. The sensor still possesses
high selectivity at very high target concentrations (1 mM). It is
quite amazing that SD-EAB can easily differentiate kanamycin A
from kanamycin B by showing the totally opposite signal changes,
which has never been achieved by any reported kanamycin
sensors.
We reasoned that such an unprecedented selectivity was due to
the following two factors. First, the pre-blocking of the binding
sites of kanamycin aptamer by a short complementary strand
favors the improvement of the selectivity of the sensor similar to
the strategies used for the improved single mismatch detections
[40,41]. The 21-base anti-kanamycin A aptamer used in this study
possesses a higher affinity for kanamycin A (reported dissociation
constant, Kd = 78.8 nM) than for its structural analogue kanamycin
B (Kd = 84.5 nM) [15]. The small affinity differences among them
can be enlarged by lowering the free energy of the aptamer via
hybridizing with a short complimentary strand [42,43]. In another
word, kanamycin B couldn't effectively bind with anti-kanamycin
apatmer and induce the displacement of the signaling probe in SD-
EAB while kanamycin A did. Therefore, no current decrease was
Fig. 3. The selectivity tests of SD-EAB A against its structural analogue kanamycin B
(Kan B), and other types of antibiotics including ampicillin (Amp), sulfadimethoxine
(Sul), and tetracycline (Tet). The data reported are averages of three individual
experiments.
 R. Liu et al. / Electrochimica Acta 182 (2015) 516–523
observed in the presence of kanamycin B. Second, the nonspecifi-
cally adsorbed aminoglycoside antibiotics can accelerate electron
transfer rate and cause the current increases due to the electro-
activity of them [19,44]. On the basis of these two unique
properties, the current was increased in the presence of kanamycin
B. Thus, SD-EAB A owns the outstanding selectivity to enable the
easy differentiation of kanamycin A from kanamycin B by showing
opposite current changes.
3.4. Comparison of SD-EAB with EIS-AB
The EIS-ABs first reported by Willner and Dong are quite
attractive label-free techniques due to their simple probe designs
[26,27]. For direct comparison with our SD-EABs, we fabricated
EIS-AB A and B under the same conditions as used for SD-EAB A
and B except that the label-free signaling probes (short
complementary probe C and anti-kanamycin aptamer A, Table 2)
were used to replace the Fc tagged ones. Either the two-step
immobilization process as shown in Fig. 1 or the one-step
immobilization of the preformed duplexes was used for the
fabrication of EIS-AB A and B. EIS measurements were then
conducted after the sensors were incubated with kanamycin A or
other antibiotics at various concentrations. Theoretically, the
impedance of the sensors should all decrease as the increase of
the target concentration.
However, in sharp contrast to SD-EAB A, the two EIS-AB A
sensors prepared under the two different immobilization con-
ditions all failed the detection of kanamycin A, showing the
random increase of the impedance as the increase of the target
concentration (Fig. 4A and 4B). While the two EIS-AB B sensors
prepared under the two different immobilization conditions were
all able to specifically response to the presence of kanamycin A. The
impedance of the sensors all decreased in the presence of
kanamycin A (Fig. 4C and 4D). However, only the EIS-AB B
prepared via the one-step immobilization of the preformed
duplexes achieved the quantitative and selective detection of
kanamycin A with a detection limit (S/N = 3) of 1 mM and a narrow
dynamic range from 1 to 100 mM (Fig. 4D). The EIS-AB B prepared
via the two-step immobilization process did showed impedance
decrease in the presence of kanamycin A at varied concentrations;
Fig. 4. Nyquist plots of EIS-AB A (A, B) and B (C, D) for the detection of kanamycin A. EIS measurements were conducted before (blank) and after incubation with kanamycin A
at continuously increased concentrations, respectively. EIS-AB A and B are the counterparts of SD-EAB A and B, being prepared via either a two-step immobilization process as
shown in Fig. 1 (A and C) or a one-step immobilization of preformed duplexes (B and D). The data reported are averages of three individual experiments.
521
however, the impedance changes were not proportional to the
concentration of target (Fig. 4C).
The performances of these EIS-AB sensors rely on the following
two opposite effects. First, the release of the signaling probes
causes the decrease of impedance of the electrode. Second,
kanamycin A is positively charged under the detection condition
and can nonspecifically adsorb on the electrode surface. The
nonspecific adsorption of kanamycin A causes the increase of
impedance. In addition, the conformational changes of aptamers
upon their binding with kanamycin A may also cause the block of
the electrode surface and cause the increase of the impedance. In
EIS-AB B, the signaling probe (aptamer) was much longer than the
one (short complimentary strand) in EIS-AB A, causing a greater
decrease of impedance of the electrode at the same concentration
of kanamycin A. In EIS-AB A, the displacement of the short
complimentary strand caused the smaller decrease of the
impedance of the electrode compared to EIS-AB B. Thus the
nonspecific adsorption of kanamycin A had a stronger effect on
the performance of EIS-AB A, leading to the failure of the sensor.
Therefore, the performance of EIS-AB B was in general better than
that of EIS-AB A. Kanamycin A is positively charged under the
detection condition, which caused its stronger nonspecific
adsorption on the electrode surface with higher DNA probe
density as shown in Fig. 4A and 4B. The measured impedance of
EIS-AB B prepared via the two-step immobilization process
(5627 V, Fig. 4C) was much higher than that of EIS-AB B prepared
via the one-step immobilization process (3600 V, Fig. 4D),
implying the higher amount of DNA was immobilized on the
electrode of EIS-AB B prepared via the two-step immobilization
process. Therefore, the strong nonspecific adsorption of kanna-
mycin A is expected on the electrode of EIS-AB B prepared via the
two-step immobilization process, resulting in the worse perfor-
mance of sensor compared to EIS-AB B prepared via the one-step
immobilization process. The strong nonspecific adsorption of
kanamycin A at the high concentration range resulted in the
narrow dynamic range of EIS-AB B.
We also measured the selectivity of EIS-AB B prepared via the
one-step immobilization process. The 23% and 6.3% of the
impedance decrease were observed in the presence of kanamycin
A and B at 100 mM, respectively. The same signal changes were also
522 R. Liu et al. / Electrochimica Acta 182 (2015) 516–523
Fig. 5. The SWV curves (A) and the calibration curve (B, &) for the detection of kanamycin A in lake water using SD-EAB A. The calibration curve obtained in DI water was also
shown in B (*) for comparison. The data reported are averages of three individual experiments.
observed in the presence of kanamycin A and B at 1 mM,
respectively. The data suggested that EIS-AB had the lower
selectivity compared to SD-EAB.
From the direct comparison between SD-EAB and EIS-AB, it is
clear that SD-EAB possesses the much better sensitivity, selectivity,
and the much better tolerance to the interference from the
nonspecific adsorption than its counterpart sensor EIS-AB.
3.5. Detection kanamycin in lake water by SD-EAB
We chose the lake water (from The Summer’s Palace, Beijing) to
examine the practical applicability of our SD-EAB A in environ-
mental monitoring. A linear relationship between the logarithm of
concentration of kanamycin A and the signal decrease percentage
with a high correlation efficiency (R2 = 0.994) was obtained in the
range from 1 nM to 10 mM (Fig. 5). The signal decrease percentage
at each concentration of kanamycin A in lake water was all slightly
smaller than that in DI water. The slopes of the two calibration
curves measured in DI water and in lake water were very similar
(Fig. 5B). The results clearly demonstrated the potential applica-
tions of SD-EAB A in real environmental water.
4. Conclusions
In summary, we report here a novel member of EAB family, SD-
EAB, with the purpose to provide a simple, generalizable, and
probe design-free strategy for highly sensitive and selective
detection of trace amount of small molecule environmental
pollutants. SD-EAB possesses many unique properties compared
to other EABs: (1) The signal change of SD-EAB is induced only by
the affinity binding between an aptamer and its target and
essentially independent of the conformational state of the aptamer
before and after binding with target. Thus, the sensitivity of SD-
EAB mainly relies on the affinity of the aptamer, providing one of
the simplest and reliable platforms for affinity-based sensing,
similar to antibody-antigen interactions. (2) SD-EAB generates
much higher absolute current changes due to the physical
separation of the redox moiety from the electrode, rendering its
high sensitivity and extraordinary broad dynamic ranges. (3) SD-
EAB has the much better tolerance to the interference from the
nonspecific adsorption than its analogue sensor EIS-AB. SD-EAB is
a signal-off sensor that may cause false positive results sometimes.
However, on the basis of its high selectivity, sensitivity, and broad
dynamic ranges, such a false positive results should be easily ruled
out by series titrations. In fact, many signal-off sensors have been
routinely used in practical applications such as the enzymatic
reaction inhibition-based pesticide tests and competitive immu-
noassays (ELISA and colloidal gold test trips, Table 1). In addition,
we found that a SD-EAB using short complementary strands as the
signaling probes was 500-fold more sensitive that the one using
aptamers as the signaling probes. The remaining of the aptamer-
target complex on the electrode may add the difficulty in sensor
regeneration. However, just like the widely used glucose test strips,
many types of single-use electrode have been developed recently.
We believe that SD-EAB is a valuable addition to EAB family and
will find its practical applications due to its advantages described
above.
Acknowledgements
We are grateful for financial support from the National Natural
Science Foundation (21305093, 20975108), National key scientific
instrument and equipment development plan (2012YQ030111),
Beijing City Talent Training Aid Program (2012D005016000004),
Program for the Young Talents of Higher Learning Institutions in
Beijing (CIT&TCD201304145) and Special Fund of State Key Joint
Laboratory of Environment Simulation and Pollution Control
(13K03ESPCT).
Appendix A. Supplementary data
Supplementary data associated with this article can
be found, in the online version, at http://dx.doi.org/10.1016/j.
electacta.2015.09.140.
References
[1] J. Wirmer, E. Westhof, Molecular contacts between antibiotics and the 30S
ribosomal particle, Methods Enzymol. 415 (2006) 180–202.
[2] R. Oertel, V. Neumeister, W. Kirch, Hydrophilic interaction chromatography
combined with tandem-mass spectrometry to determine six aminoglycosides
in serum, J. Chromatogr. A 1058 (2004) 197–201.
[3] Y. Tao, D. Chen, H. Yu, L. Huang, Z. Liu, X. Cao, C. Yan, Y. Pan, Z. Liu, Z. Yuan,
Simultaneous determination of 15 aminoglycoside(s) residues in animal
derived foods by automated solid-phase extraction and liquid
chromatography-tandem mass spectrometry, Food Chem. 135 (2012)
676–683.
[4] Y.H. Long, A. Hernandez, E. Kaale, A. Van Schepdael, E. Roets, F. Borrull, M.
Calull, J. Hoogmartens, Determination of kanamycin in serum by solid-phase
extraction, pre-capillary derivatization and capillary electrophoresis, J.
Chromatogr. B 784 (2003) 255–264.
[5] E. Kaale, A.V. Schepdael, E. Roets, J. Hoogmartens, Determination of kanamycin
by electrophoretically mediated microanalysis with in-capillary derivatization
and UV detection, Electrophoresis 24 (2003) 1119–1125.
[6] H. Watanabe, A. Satake, Y. Kido, A. Tsuji, Production of monoclonal antibody
and development of enzyme-linked immunosorbent assay for kanamycin in
biological matrices, Analyst 124 (1999) 1611–1615.
[7] E. Loomans, J. Van Wiltenburg, M. Koets, A. Van Amerongen, Neamin as an
immunogen for the development of a generic ELISA detecting gentamicin,
kanamycin, and neomycin in milk, J. Agric. Food Chem. 51 (2003) 587–593.
[8] Y. Chen, Z. Wang, Z. Wang, S. Tang, Y. Zhu, X. Xiao, Rapid Enzyme-Linked
Immunosorbent Assay and Colloidal Gold Immunoassay for Kanamycin and
Tobramycin in Swine Tissues, J. Agric. Food Chem. 56 (2008) 2944–2952.
[9] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Selection of Single-
Stranded-DNA Molecules That Bind and Inhibit Human Thrombin, Nature 355
(1992) 564–566.
[10] A.D. Ellington, J.W. Szostak, Invitro Selection of Rna Molecules That Bind
Specific Ligands, Nature 346 (1990) 818–822.
[11] M. Famulok, G. Mayer, M. Blind, Nucleic Acid AptamersFrom Selection in Vitro
to Applications in Vivo, Acc. Chem. Res. 33 (2000) 591–599.
 R. Liu et al. / Electrochimica Acta 182 (2015) 516–523
[12] J.H. Lee, M.V. Yigit, D. Mazumdar, Y. Lu, Molecular diagnostic and drug delivery
agents based on aptamer-nanomaterial conjugates, Adv. Drug Del. Rev. 62
(2010) 592–605.
[13] D. Li, S. Song, C. Fan, Target-Responsive Structural Switching for Nucleic Acid-
Based Sensors, Acc. Chem. Res. 43 (2010) 631–641.
[14] J. Liu, Z. Cao, Y. Lu, Functional Nucleic Acid Sensors, Chem. Rev. 109 (2009)
1948–1998.
[15] K.-M. Song, M. Cho, H. Jo, K. Min, S.H. Jeon, T. Kim, M.S. Han, J.K. Ku, C. Ban, Gold
nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer,
Anal. Biochem. 415 (2011) 175–181.
[16] X. Liu, Y. Jiang, M. Li, H. Wang, Y. Liu, L. Lu, Y. Sun, H. Lei, Development of
Enzyme-linked Aptamer Assay for Detection of Kanamycin A, Chinese J. Anal.
Chem. 7 (2013) 1428–1433.
[17] H. Li, D.E. Sun, Y.J. Liu, Z.H. Liu, An ultrasensitive homogeneous aptasensor for
kanamycin based on upconversion fluorescence resonance energy transfer,
Biosens. Bioelectron. 55 (2014) 149–156.
[18] K.-H. Leung, H.-Z. He, D.S.-H. Chan, W.-C. Fu, C.-H. Leung, D.-L. Ma, An
oligonucleotide-based switch-on luminescent probe for the detection of
kanamycin in aqueous solution, Sens. Actuators, B 177 (2013)
487–492.
[19] Y. Zhu, P. Chandra, K.-M. Song, C. Ban, Y.-B. Shim, Label-free detection of
kanamycin based on the aptamer-functionalized conducting polymer/gold
nanocomposite, Biosens. Bioelectron. 36 (2012) 29–34.
[20] F.L. Li, Y.M. Guo, X. Sun, X.Y. Wang, Aptasensor based on thionine, graphene-
polyaniline composite film, and gold nanoparticles for kanamycin detection,
Eur. Food Res. Technol. 239 (2014) 227–236.
[21] X. Sun, F.L. Li, G.H. Shen, J.D. Huang, X.Y. Wang, Aptasensor based on the
synergistic contributions of chitosan-gold nanoparticles, graphene-gold
nanoparticles and multi-walled carbon nanotubes-cobalt phthalocyanine
nanocomposites for kanamycin detection, Analyst 139 (2014)
299–308.
[22] Z.W. Tang, P. Mallikaratchy, R.H. Yang, Y.M. Kim, Z. Zhu, H. Wang, W.H. Tan,
Aptamer switch probe based on intramolecular displacement, J. Am. Chem.
Soc. 130 (2008) 11268–11269.
[23] R. Nutiu, Y.F. Li, Structure-switching signaling aptamers, J. Am. Chem. Soc. 125
(2003) 4771–4778.
[24] J.W. Liu, D. Mazumdar, Y. Lu, A simple and sensitive dipstick test in serum
based on lateral flow separation of aptamer-linked nanostructures, Angew.
Chem. Int. Edit. 45 (2006) 7955–7959.
[25] Z. Zhu, C.C. Wu, H.P. Liu, Y. Zou, X.L. Zhang, H.Z. Kang, C.J. Yang, W.H. Tan, An
Aptamer Cross-Linked Hydrogel as a Colorimetric Platform for Visual
Detection, Angew. Chem. Int. Edit. 49 (2010) 1052–1056.
[26] M. Zayats, Y. Huang, R. Gill, C.-a. Ma, I. Willner, Label-free and reagentless
aptamer-based sensors for small molecules, J. Am. Chem. Soc. 128 (2006)
13666–13667.
[27] B.L. Li, Y. Du, H. Wei, S.J. Dong, Reusable, label-free electrochemical aptasensor
for sensitive detection of small molecules, Chem. Commun. (Camb) 36 (2007)
3780–3782.
[28] X. Zuo, S. Song, J. Zhang, D. Pan, L. Wang, C. Fan, A target-responsive
electrochemical aptamer switch (TREAS) for reagentless detection of
nanomolar ATP, J. Am. Chem. Soc. 129 (2007) 1042–1043.
523
[29] Y. Xiao, B.D. Piorek, K.W. Plaxco, A.J. Heeger, A reagentless signal-on
architecture for electronic, aptamer-based sensors via target-induced strand
displacement, J. Am. Chem. Soc. 127 (2005) 17990–17991.
[30] Y. Xiao, A.A. Lubin, B.R. Baker, K.W. Plaxco, A.J. Heeger, Single-step electronic
detection of femtomolar DNA by target-induced strand displacement in an
electrode-bound duplex, Proc. Natl. Acad. Sci. USA 103 (2006) 16677–16680.
[31] X. Lou, T. Zhao, R. Liu, J. Ma, Y. Xiao, Self-Assembled DNA Monolayer Buffered
Dynamic Ranges of Mercuric Electrochemical Sensor, Anal. Chem. 85 (2013)
7574–7580.
[32] J. Du, M. Liu, X. Lou, T. Zhao, Z. Wang, Y. Xue, J. Zhao, Y. Xu, Highly Sensitive and
Selective Chip-Based Fluorescent Sensor for Mercuric Ion: Development and
Comparison of Turn-On and Turn-Off Systems, Anal. Chem. 84 (2012) 8060–
8066.
[33] T. Zhao, R. Liu, X. Ding, J. Zhao, H. Yu, L. Wang, Q. Xu, X. Wang, X. Lou, M. He, Y.
Xiao, Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich
Assay for Ultrasensitive Detection of Small Molecules, Anal. Chem. 87 (2015)
7712–7719.
[34] Z. Zhu, Y. Su, J. Li, D. Li, J. Zhang, S. Song, Y. Zhao, G. Li, C. Fan, Highly Sensitive
Electrochemical Sensor for Mercury(II) Ions by Using a Mercury-Specific
Oligonucleotide Probe and Gold Nanoparticle-Based Amplification, Anal.
Chem. 81 (2009) 7660–7666.
[35] D. Wu, Q. Zhang, X. Chu, H. Wang, G. Shen, R. Yu, Ultrasensitive electrochemical
sensor for mercury (II) based on target-induced structure-switching DNA,
Biosens. Bioelectron. 25 (2010) 1025–1031.
[36] A.B. Steel, T.M. Herne, M.J. Tarlov, Electrochemical quantitation of DNA
immobilized on gold, Anal. Chem. 70 (1998) 4670–4677.
[37] T.M. Herne, M.J. Tarlov, Characterization of DNA probes immobilized on gold
surfaces, J. Am. Chem. Soc. 119 (1997) 8916–8920.
[38] A.W. Peterson, R.J. Heaton, R.M. Georgiadis, The effect of surface probe density
on DNA hybridization, Nucleic Acids Res 29 (2001) 5163–5168.
[39] Z. Li, T. Niu, Z. Zhang, G. Feng, S. Bi, Effect of monovalent cations (Li+, Na+, K+,
Cs+) on self-assembly of thiol-modified double-stranded and single-stranded
DNA on gold electrode, Analyst 137 (2012) 1680–1691.
[40] Y. Xiao, X. Qu, K.W. Plaxco, A.J. Heeger, Label-free electrochemical detection of
DNA in blood serum via target-induced resolution of an electrode-bound DNA
pseudoknot, J. Am. Chem. Soc. 129 (2007) 11896–11897.
[41] Y. Xiao, X. Lou, T. Uzawa, K.J.I. Plakos, K.W. Plaxco, H.T. Soh, An Electrochemical
Sensor for Single Nucleotide Polymorphism Detection in Serum Based on a
Triple-Stem DNA Probe, J. Am. Chem. Soc. 131 (2009) 15311–15316.
[42] Y. Xiao, K.J.I. Plakos, X. Lou, R.J. White, J. Qian, K.W. Plaxco, H.T. Soh,
Fluorescence Detection of Single-Nucleotide Polymorphisms with a Single,
Self-Complementary, Triple-Stem DNA Probe, Angew. Chem. Int. Edit. 48
(2009) 4354–4358.
[43] D.M. Kolpashchikov, Triple-Stem DNA Probe: A New Conformationally
Constrained Probe for SNP Typing, Chembiochem 10 (2009) 1443–1445.
[44] Y. Zhu, P. Chandra, C. Ban, Y.-B. Shim, Electrochemical Evaluation of Binding
Affinity for Aptamer Selection Using the Microarray Chip, Electroanalysis 24
(2012) 1057–1064.
[45] J. Dapra, L.H. Lauridsen, A.T. Nielsen, N. Rozlosnik, Comparative study on
aptamers as recognition elements for antibiotics in a label-free all-polymer
biosensor, Biosens. Bioelectron. 43 (2013) 315–320.