Metabolism:

The Chemical Uncoupler 2,4-Dinitrophenol

(DNP) Protects against Diet-induced
Obesity and Improves Energy Homeostasis
in Mice at Thermoneutrality

Margalit Goldgof, Cuiying Xiao, Tatyana

Chanturiya, William Jou, Oksana Gavrilova

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

and Marc L. Reitman
J. Biol. Chem. 2014, 289:19341-19350.
doi: 10.1074/jbc.M114.568204 originally published online May 28, 2014

Access the most updated version of this article at doi: 10.1074/jbc.M114.568204

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.

Alerts:
• When this article is cited
• When a correction for this article is posted

Click here to choose from all of JBC's e-mail alerts

This article cites 43 references, 14 of which can be accessed free at

http://www.jbc.org/content/289/28/19341.full.html#ref-list-1
 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 28, pp. 19341–19350, July 11, 2014
© 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

The Chemical Uncoupler 2,4-Dinitrophenol (DNP) Protects

against Diet-induced Obesity and Improves Energy
Homeostasis in Mice at Thermoneutrality*
Received for publication, March 24, 2014, and in revised form, May 19, 2014 Published, JBC Papers in Press, May 28, 2014, DOI 10.1074/jbc.M114.568204
Margalit Goldgof‡1, Cuiying Xiao‡1, Tatyana Chanturiya§, William Jou§, Oksana Gavrilova§, and Marc L. Reitman‡2
From the ‡Diabetes, Endocrinology, and Obesity Branch and the §Mouse Metabolism Core, NIDDK, National Institutes of Health,
Bethesda, Maryland 20892
Background: The chemical uncoupler 2,4-dinitrophenol was widely used as a treatment for obesity in the past.
Results: In mice, 2,4-dinitrophenol generates heat and turns off brown fat heat production. It reduces weight gain at thermo-
neutrality but not at cooler ambient temperatures.
Conclusion: Environmental temperature should be considered when assessing anti-obesity drugs in mice.
Significance: Chemical uncouplers deserve further investigation for the treatment of obesity.

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

The chemical uncoupler 2,4-dinitrophenol (DNP) was an
effective and widely used weight loss drug in the early 1930s.
However, the physiology of DNP has not been studied in detail
because toxicity, including hyperthermia and death, reduced
interest in the clinical use of chemical uncouplers. To investi-
gate DNP action, mice fed a high fat diet and housed at 30 °C (to
minimize facultative thermogenesis) were treated with 800
mg/liter DNP in drinking water. DNP treatment increased
energy expenditure by ⬃17%, but did not change food intake.
DNP-treated mice weighed 26% less than controls after 2
months of treatment due to decreased fat mass, without a
change in lean mass. DNP improved glucose tolerance and
reduced hepatic steatosis without observed toxicity. DNP treat-
ment also reduced circulating T3 and T4 levels, Ucp1 expres-
sion, and brown adipose tissue activity, demonstrating that
DNP-mediated heat generation substituted for brown adipose
tissue thermogenesis. At 22 °C, a typical vivarium temperature
that is below thermoneutrality, DNP treatment had no effect on
body weight, adiposity, or glucose homeostasis. Thus, environ-
mental temperature should be considered when assessing an
anti-obesity drug in mice, particularly agents acting on energy
expenditure. Furthermore, the beneficial effects of DNP suggest
that chemical uncouplers deserve further investigation for the
treatment of obesity and its comorbidities.
Obesity prevalence is ⬃35% in the United States and ⬃20%
in Europe and is increasing worldwide (1, 2). Obesity contrib-
utes to serious comorbidities, including type 2 diabetes and
cardiovascular disease. Despite the epidemic’s magnitude, few
effective therapeutic options exist. Current treatments with
diet, exercise, and behavior modification work well in the short
term but have a low long term success rate (3). Bariatric surgery
* This work was supported, in whole or in part, by National Institutes of
Health, NIDDK, Intramural Research Program Grants DK075062 and
DK075063.
1
Both authors contributed equally to this work.
2
To whom correspondence should be addressed: Bldg. 10-CRC, Rm. 5-5940,
10 Center Dr., Bethesda, MD 20892-1453. Tel.: 301-496-6442; E-mail:
marc.reitman@nih.gov.
is effective, but it is invasive and supported by limited long term
(decades) safety and efficacy data. Pharmacotherapies for obe-
sity are also meager. One modestly effective drug, orlistat, was
approved by the United States Food and Drug Administration
in 1999, and two others (lorcaserin and phentermine/topira-
mate) were approved in 2012.
The effect of 2,4-dinitrophenol (DNP)3 to increase metabolic
rate has been known since the late 1800s and was studied during
World War I (4). In the early 1930s, DNP was widely used as a
weight loss drug (5); however, enthusiasm for DNP therapy
waned due to its low therapeutic index and serious toxicities,
including hyperthermia, skin reactions, cataracts, and death (6,
7). In 1948, its mechanism of action was discovered, revealing
that DNP is a protonophore, able to move protons through lipid
bilayers and thus to chemically uncouple substrate oxidation
from ATP production (8). Mammals naturally use an uncou-
pling protein in brown adipose tissue (BAT) and beige/brite
adipose tissue to generate heat to maintain core body temper-
ature (Tb). Thus, BAT and beige/brite adipose tissue activation
is of interest as a component of drug therapy for obesity (9, 10).
Facultative thermogenesis persists in Ucp1 null mice, which
lack BAT function, suggesting a role for other tissues, such as
muscle (11–13). However, although facultative thermogenesis
is extremely important in small mammals, both thermogenic
need and capacity in adult humans are much lower than in
mice. Therefore, using a chemical uncoupler that is presumably
active in all tissues might be a complementary approach to obe-
sity pharmacotherapy, avoiding the constraint that there is lim-
ited facultative thermogenesis in adult humans.
Mice are a useful model system to study human obesity phys-
iology and treatment due to the conserved biology, plethora of
genetic tools, and modest resources (compounds, housing)
required. However, the profound differences in thermal biology
(14) have not typically been considered when studying obesity
3
The abbreviations used are: DNP, 2,4-dinitrophenol; BAT, brown adipose
tissue; HFD, high fat diet; RER, respiratory exchange ratio; Ta, environmen-
tal temperature; Tb, core body temperature; TEE, total energy expenditure;
WAT, white adipose tissue; HOMA-IR, homeostasis model assessment-es-
timated insulin resistance.

JULY 11, 2014 • VOLUME 289 • NUMBER 28 JOURNAL OF BIOLOGICAL CHEMISTRY 19341
Chemical Uncouplers in Weight Loss Therapy
physiology and treatment (15). Given the need for improved TABLE 1
obesity pharmacotherapy and the dearth of data on chemical PCR primer sequences
uncouplers, we investigated the physiological effects of chemi- Primer Sequence
cal uncoupling in mice, using DNP as a model compound. Ucp1-F ACTGCCACACCTCCAGTCATT
Ucp1-R CTTTGCCTCACTCAGGATTGG
While doing so, we also examined the effect of ambient temper- Prdm16-F CAGCACGGTGAAGCCATTC
ature (comparing 30 °C, which is approximately thermoneutral Prdm16-R GCGTGCATCCGCTTGTG
Cidea-F TGCTCTTCTGTATCGCCCAGT
for mice, with 22 °C, which is below thermoneutrality (16, 17)) Cidea-R GCCGTGTTAAGGAATCTGCTG
on drug effectiveness. Adiponectin-F GCACTGGCAAGTTCTACTGCAA
Adiponectin-R GTAGGTGAAGAGAACGGCCTTGT
Dio2-F ACACTGGAATTGGGAGCATC
EXPERIMENTAL PROCEDURES Dio2-R ATGCTGACCTCAGAAGGGCT
Animals and DNP—Female C57BL/6J mice (Jackson Labora- Pepck-F CTGGCACCTCAGTGAAGACA
Pepck-R TCGATGCCTTCCCAGTAAAC
tory, Bar Harbor, ME) were housed at 4 per cage, unless other- Cpt1␣-F ATGGCAGAGGCTCACCAAGC
wise indicated, at 22 or 30 °C with ad libitum access to water Cpt1␣-R GATGAACTTCTTCTTCCAGGAGTGC
Mcad-F CCCGTTCCCTCTCATCAAAAG
and high fat diet (D12492, 60% kcal fat, 5.24 metabolizable Mcad-R ACACCCATACGCCAACTCTTCG
kcal/g; Research Diets, New Brunswick, NJ) starting at 6 weeks Pgc1␣-F AGCCGTGACCACTGACAACGAG
Pgc1␣-R GCTGCATGGTTCTGAGTGCTAAG
of age with a 12-h/12-h dark/light cycle (lights on at 0600 h). Pgc1␤-F1 TTGTAGAGTGCCAGGTGCTG

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

Female mice can be housed together and were used due to lim- Pgc1␤-R1 GATGAGGGAAGGGACTCCTC
Fgf21-F ACCTGGAGATCAGGGAGGAT
ited capacity for thermoneutral housing. Body weight, food Fgf21-R GGCCTCAGGATCAAAGTGAG
intake, and water intake were measured twice weekly. DNP Fas-F AAGTTGCCCGAGTCAGAGAACC
Fas-R ATCCATAGAGCCCAGCCTTCCATC
(800 mg/liter; Sigma-Aldrich) treatment began when mice were F4/80-F GGAAAGCACCATGTTAGCTGC
⬃6 – 8 weeks old. DNP was neutralized with NaOH, protected F4/80-R CCTCTGGCTGCCAAGTTAATG
Tnf␣-F AAGCCTGTAGCCCACGTCGTA
from light, administered in drinking water, and changed twice Tnf␣-R AGGTACAACCCATCGGCTGG
weekly. DNP was kept moist, and skin/mucous membrane con- Il1␤-F AAAAAAGCCTCGTGCTGTCG
Il1␤-R GTCGTTGCTTGGTTCTCCTTG
tact was avoided. DNP concentrations were measured assum- CytoC-F GGAGGCAAGCATAAGACTGG
ing a molar extinction coefficient of 10,356 M⫺1 cm⫺1 at 400 nm CytoC-R TCCATCAGGGTATCCTCTCC
in 50 mM sodium phosphate, pH 7.0. Tap water adjusted to pH Cox8b-F GAACCATGAAGCCAACGACT
Cox8b-R GCGAAGTTCACAGTGGTT CC
7.0 was vehicle. Protocols were approved by the NIDDK, Cox5b-F GCTGCATCTGTGAAGAGGACAAC
National Institutes of Health, Institutional Animal Care and Cox5b-R CAGCTTGTAATGGGTTCCACAGT
Scd1-F CCTTCCCCTTCGACTACTCTG
Use Committee. Male diet-induced obese C57BL/6J mice were Scd1-R GCCATGCAGTCGATGAAGAA
also tested at 30 °C with DNP in drinking water and were mtCytB-Fa ACCAATCTCCCAAACCATCA
mtCytB-Ra TCCAGAGACTTGGGGATCTAAC
housed at 2 per cage. 18S-F AGTCCCTGCCCTTTGTACACA
Indirect Calorimetry—Indirect calorimetry was performed 18S-R CGATCCGAGGGCCTCACTA
a
with access to food and water using a 12-chamber environment For mitochondrial DNA copy analysis.

controlled CLAMS system (Columbus Instruments, Columbus,

OH). Female mice were treated with DNP or vehicle at 22 or
30 °C for 6 weeks. Treatment was continued in the chambers,
and the chamber temperature was 30 °C for all groups. To min-
imize thermal deconditioning of the 22 °C groups while provid-
ing sufficient time for familiarization to the chambers, mice
were placed into the indirect calorimetry chambers at 1700 h,
and baseline EE was measured at 0800 –1000 h the next day.
CL316243 (0.1 mg/kg intraperitoneally in saline; Sigma-Al-
drich) was dosed at 1100 h.
Testing—Body composition was measured by time domain
EchoMRI 3-in-1 (Echo Medical Systems, Houston, TX). Rectal
temperatures were measured using a digital thermometer (YSI
455, Measurement Specialties, Shrewsbury, MA). Intraperito-
neal glucose (2g/kg, after a 16-h fast, with AUC calculated from
0 mg/dl) and insulin tolerance (0.75 units/kg, ad libitum fed)
tests were performed at 0930 h. Glucose was measured with a
Glucometer Contour (Bayer, Mishawaka, IN). Liver triglyceride
was measured as glycerol after NaOH hydrolysis (Cayman
Chemical, catalog no. 10010755).
Serum Hormone and Metabolite Profiles—Mice were anes-
thetized (100 mg/kg ketamine and 10 mg/kg xylazine, intraperi-
toneally), bled retro-orbitally, and serum was frozen until
assayed using the following kits. Free fatty acids (Roche Applied
Science), triglycerides (Pointe Scientific Inc., Canton, MI), cho-
lesterol (Thermo Scientific), ␤-hydroxybutyrate (BioVision,
Milpitas, CA), acetoacetate (BioVision), and D-lactate
(BioVision) were measured by colorimetric assays. Insulin (Mil-
lipore, St. Charles, MO), adiponectin (Millipore), insulin-like
growth factor 1 (ALPCO, Salem, NH), T3 (DiaSorin Inc., Still-
water, MN), and T4 (DiaSorin) were measured by radioimmune
assay. Leptin (R&D Systems, Minneapolis, MN) and fibroblast
growth factor 21 (Millipore) were measured by ELISA.
Gene Expression Analysis by Quantitative RT-PCR—RNA
was extracted (Qiagen RNeasy Plus Mini Kit, Germantown,
MD), converted to cDNA (Roche Transcriptor High Fidelity
cDNA Synthesis Kit, Indianapolis, IN), and quantified by real-
time polymerase chain reaction (7900HT, Applied Biosystems,
Foster City, CA) using SYBR Green. Data are normalized to
18 S RNA (18 S DNA for mitochondrial DNA) in the same sam-
ple. Primer sequences are shown in Table 1.
Western Blot Analysis—Protein from BAT was prepared
using radioimmune assay precipitation buffer and quantified
(Pierce BCA Protein Assay Kit, Thermo Scientific, Rockford,
IL). Protein (10 ␮g/lane) was separated in 4 –12% SDS-poly-
acrylamide gels, transferred to PVDF membrane, and probed
with anti-UCP1 antibody (1:5000; U6382, Sigma-Aldrich) or
anti-␣-tubulin (1:5000; T6074, Sigma-Aldrich). Signals were
detected with SuperSignal West Pico Chemiluminescent Sub-

19342 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 28 • JULY 11, 2014
 Chemical Uncouplers in Weight Loss Therapy
strate (Thermo Scientific), using exposure times appropriate to
signal intensity.
Histology—Tissues were fixed in 10% formalin, blocked in
paraffin wax, and sectioned. Sections were stained with hema-
toxylin and eosin and examined by light microscopy.
Data Analysis—Data were analyzed using unpaired Student’s
t tests or analysis of variance with Tukey’s honestly significant
difference post-hoc testing using Sigmaplot version 12.5 (Systat
Software Inc.). Statistical significance was defined as p ⬍ 0.05.

RESULTS
Preliminary dose-ranging experiments at thermoneutrality
demonstrated that a dose of 800 mg/liter DNP in drinking
water (⬃89 mg/kg/day) reduced body weight without affecting
food or water intake or causing noticeable changes in behavior.
This dose was used for all experiments because higher DNP

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

doses reduced water and food intake, possibly an aversive effect,
whereas lower doses did not affect body weight (Fig. 1).
DNP Treatment Reduces Weight Gain and Improves Glucose
Homeostasis—We treated female C57BL/6J mice with DNP for
8 weeks at 30 °C on a high fat diet. DNP-treated mice weighed
18% (p ⬍ 0.05) less than vehicle-treated mice, with no effect on
food intake (Fig. 2, A and B). DNP treatment reduced fat mass
with no change in lean mass (Fig. 2C). Free-living total energy
expenditure (TEE), calculated by energy balance, from the
caloric intake, change in body weight, and change in body com-
position (18), was increased by 13% (p ⬍ 0.05) (Fig. 2D). DNP
treatment lowered fed and fasting glucose levels and HOMA-IR
and improved glucose tolerance, with no obvious effect on insu-
lin tolerance (Fig. 2, E–K). Treatment with DNP in male diet-
induced obese mice showed similar effects on body weight and
composition, food intake, and TEE over 2 weeks (Fig. 3).
DNP-treated Mice Weigh Less at 30 °C but Not at 22 °C—We
next examined the interaction between environmental temper-
ature (Ta) and DNP treatment, comparing thermoneutrality FIGURE 1. DNP dose response. A, body weight; B, food intake; C, water intake.
(30 °C) with a typical vivarium Ta (22 °C). Vehicle-treated mice 6-Week-old female mice housed 4 per cage on a high fat diet were acclima-
gained more weight at 30 °C than at 22 °C (Fig. 4A), consistent tized to 30 °C for 7 days and then treated with the indicated dose of DNP in the
drinking water for 1 week. Body weight change data are mean ⫾ S.E. (error
with prior reports (19 –21). At 30 °C, DNP-treated mice bars); n ⫽ 8/group. *, p ⬍ 0.05 as compared with 0 mg/ml DNP dose. Intake
weighed 23% less than vehicle-treated controls, due to reduced data are mean of two cages. Data are combined from two independent exper-
fat mass with little change in lean mass (Fig. 4, C and D). In iments. Initial body weight was 24.7 ⫾ 0.6 g in the first experiment (0 – 400
mg/liter) and 26.4 ⫾ 0.8 g in the second experiment (0 –2000 mg/liter).
contrast, at 22 °C DNP had no effect on body weight or fat mass.
Mice at 22 °C ate 23% more than mice housed at 30 °C, with no
DNP effect on food (Fig. 4B) or water intake (not shown). 2). In the 30 °C groups, the DNP-mediated metabolic rate
DNP Treatment Increases Metabolic Rate at Thermo- increase, compared with vehicle-treated controls, was 6% per
neutrality—We used the energy balance technique to measure mouse (0.209/0.196, p ⫽ not significant), 37% per g of body
free living TEE (18). Over 5 weeks of treatment, the free living weight (8.82/9.46, p ⫽ 0.009), 28% per (g of body weight)0.75
TEE of the vehicle groups at 22 °C was 32% greater than at (19.4/15.1, p ⫽ 0.02), or 11–13% using a statistical model. Com-
30 °C. At 30 °C, DNP treatment increased TEE by 16%, whereas paring the 22 °C groups (where the DNP-treated and vehicle
at 22 °C, DNP treatment had no effect on free living TEE (Fig. groups have the same body weight), the mean DNP-mediated
4E). increase was 17% (0.237/0.202, p ⫽ 0.05) above the light phase
Next, we used indirect calorimetry to measure the effect of thermoneutral metabolic rate. There were no differences in
DNP on metabolic rate and thermogenic capacity. These exper- RER (respiratory exchange ratio, the ratio of CO2 produced to
iments were performed at thermoneutrality to remove the con- O2 consumed, which indicates metabolic fuel type) or physical
tribution of facultative thermogenesis. To minimize thermal activity.
deconditioning of the 22 °C groups while providing sufficient CL316243, a selective ␤3-adrenoreceptor agonist, was used
acclimatization time, mice were placed in the metabolic cham- in thermoneutral conditions to maximally stimulate BAT ther-
bers 13 h before baseline measurements. DNP treatment mogenesis and WAT lipolysis, assaying the capacity for facul-
increased baseline TEE measured at thermoneutrality (Table tative thermogenesis (22–25) (Fig. 5 and Table 2). In all groups,

JULY 11, 2014 • VOLUME 289 • NUMBER 28 JOURNAL OF BIOLOGICAL CHEMISTRY 19343
Chemical Uncouplers in Weight Loss Therapy

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

FIGURE 2. Effect of DNP treatment at thermoneutrality in C57BL/6J mice. A, body weight; B, food intake; C, body composition at 3 weeks; D, energy
expenditure over the first 3 weeks of treatment. E–H, glucose tolerance test, area under the glucose excursion curve (AUC), plasma insulin before and 15 min
after glucose administration, and HOMA-IR levels after 5 weeks. I, insulin tolerance test after 6 weeks. J and K, 4-h fasted serum glucose and insulin levels at
euthanasia after 11 weeks of treatment. 8-Week-old female mice on a HFD were acclimatized to housing at 4 per cage at 30 °C for 2.5 weeks and then treated
with vehicle or DNP (800 mg/liter in the drinking water). *, p ⬍ 0.05.

CL316243 caused a drop in RER to ⬃0.71, indicating that fatty
acids were the predominant energy source. In vehicle-treated
mice, TEE stabilized after CL316243 treatment at increases of
79 ⫾ 7 and 109 ⫾ 10% over baseline in the mice that were
chronically maintained at 30 and 22 °C, respectively (p ⫽ 0.03,
30 °C versus 22 °C). The smaller TEE increase with chronic
30 °C exposure is probably due to the reduced capacity for BAT
activation. Surprisingly, in DNP-treated mice, acute CL316243
treatment had a qualitatively different effect, a large acute
increase in TEE (due to fat oxidation because the RER is ⬃0.71),
which then diminished gradually. By ⬃5 h after drug dosing, the
30 °C DNP TEE was lower than the 30 °C vehicle controls.
DNP treatment increases metabolic rate measured at ther-
moneutrality in both the 22 and 30 °C Ta groups. Our interpre-
tation is that at 22 °C, the DNP-mediated increase in metabolic
rate is quantitatively offset by a reduction in facultative thermo-
genesis, so there is no net change in TEE. With an unchanged
TEE and food intake, there was no effect on body weight. In
contrast, upon chronic adaptation to 30 °C, there is little ongo-
ing BAT thermogenesis to suppress, so the DNP-mediated
increase in metabolic rate increases the TEE. At 30 °C, the TEE
increase caused by DNP was not compensated for by increased
food intake; thus, weight loss ensued.
DNP Reduces BAT Activation—The BAT phenotype was
investigated to see if it supports the above interpretations. In
vehicle-treated mice, BAT had larger lipid droplets at 30 °C,
consistent with the greater adiposity of the mice (Fig. 6A). BAT
at 22 °C had higher Ucp1 mRNA and protein levels compared
with the 30 °C vehicle group, indicating greater activation (Fig.
6, B and C). However, other mRNA markers of BAT activation
(Prdm16, Cidea, Dio2, and Fgf21) or mitochondrial function/
mass (CytoC and Cox8b mRNAs; mitochondrial DNA) were
not significantly increased, consistent with a relatively modest
activation of BAT (Fig. 6, C and D).

19344 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 28 • JULY 11, 2014
 Chemical Uncouplers in Weight Loss Therapy

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

FIGURE 3. Effects of DNP treatment in male C57BL/6J mice. A, body weight; B and C, body composition; D, food intake; E, TEE over 2 weeks of treatment.
11-Week-old male mice on a HFD were acclimatized to housing at 2 per cage at 30 °C for 4 days and then treated with DNP at 800 mg/liter. Weight, fat mass,
and composition are mean ⫾ S.E. (error bars); n ⫽ 8/group. *, p ⬍ 0.05. Food intake and energy expenditure data are based on 4 cages/group, expressed per
mouse. iWAT, inguinal white adipose tissue; eWAT, epididymal white adipose tissue.

FIGURE 4. Effect of environmental temperature on response to treatment with DNP in C57BL/6J mice. A, body weight; B, food intake; C, fat mass; D, body
composition; E, energy expenditure. 8-Week-old female mice on a HFD were acclimatized to housing at 4 per cage at 22 or 30 °C for 2.5 weeks and then treated
with DNP (800 mg/liter in the drinking water). Fat mass was measured at euthanasia after 9 weeks of treatment. Body composition was measured after 5 weeks,
and energy expenditure is the average over the first 5 weeks of treatment. Weight, fat mass, and composition are mean ⫾ S.E. (error bars); n ⫽ 8/group. *, p ⬍
0.05. Food intake and energy expenditure data are based on 2 cages/group, expressed per mouse. iWAT, inguinal white adipose tissue; gWAT, gonadal white
adipose tissue.

DNP treatment at 30 °C reduced Ucp1, Prdm16, Cidea, Dio2, icantly (CytoC mRNA and mitochondrial DNA). At 22 °C, DNP
and Fgf21 mRNA levels. Other mitochondrial markers were tended to reduce BAT activation markers but not to the level
also reduced, either significantly (Cox8b mRNA) or non-signif- seen at 30 °C (Fig. 6, A–D). No consistent changes in BAT mito-

JULY 11, 2014 • VOLUME 289 • NUMBER 28 JOURNAL OF BIOLOGICAL CHEMISTRY 19345
Chemical Uncouplers in Weight Loss Therapy
TABLE 2
Effect of CL316243 in DNP-treated mice
“Baseline (pre-CL316243)” is the 2-h time period ending 1 h before CL316243 injection. “After CL316243” indicates measurement ⬃5 h after CL316243 injection. All
measurements were performed at thermoneutrality; see “Experimental Procedures” for details. The last three columns show significance from two-way analysis of variance;
no value indicates p ⬎ 0.05. T ⫻ D is temperature-drug interaction. The individual baseline TEE points were also analyzed with a statistical model incorporating
temperature, drug, T ⫻ D, activity, and body weight (nested within drug and temperature) constructed using JMP (SAS). Drug (p ⬍ 0.0001), activity (p ⬍ 0.0001), and body
weight (p ⫽ 0.02) contributed significantly, whereas temperature and T ⫻ D did not (p ⬎ 0.05). The model has an adjusted r2 ⫽ 0.60. As examples, TEE for a “mean” mouse
(body weight of 27.43 g; activity of 198 beam breaks/13 min) and “median” mouse (body weight of 27.03 g; activity of 55 beam breaks/13 min) are included.
30 °C 30 °C 22 °C 22 °C
vehicle DNP vehicle DNP Temperature Drug TⴛD
Body weight (g) 30.9 ⫾ 1.6 23.8 ⫾ 0.9 27.5 ⫾ 1.2 27.4 ⫾ 1.5 0.01 0.01
Baseline (pre-CL316243)
TEE (kcal/h/mouse) 0.196 ⫾ 0.006 0.209 ⫾ 0.014 0.202 ⫾ 0.010 0.237 ⫾ 0.013 0.047
TEE (kcal/h/body weight) 6.46 ⫾ 0.36 8.82 ⫾ 0.69 7.42 ⫾ 0.44 8.86 ⫾ 0.75 0.003
TEE (kcal/h/body weight0.75) 15.1 ⫾ 0.7 19.4 ⫾ 1.4 16.9 ⫾ 0.9 20.1 ⫾ 1.5 0.004
RER 0.764 ⫾ 0.012 0.756 ⫾ 0.006 0.758 ⫾ 0.005 0.754 ⫾ 0.006
Activity (beam breaks/13 min) 174 ⫾ 29 204 ⫾ 37 191 ⫾ 34 225 ⫾ 23
TEE (kcal/h/mean mouse) 0.226 0.251 0.230 0.268 ⬍0.0001
TEE (kcal/h/median mouse) 0.185 0.208 0.189 0.228 ⬍0.0001
After CL316243
TEE (kcal/h/mouse) 0.350 ⫾ 0.009 0.286 ⫾ 0.017 0.419 ⫾ 0.018 0.433 ⫾ 0.015 ⬍0.001 0.02

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

TEE, ratio to baseline 1.79 ⫾ 0.07 1.45 ⫾ 0.19 2.09 ⫾ 0.10 1.85 ⫾ 0.08 0.006 0.02
RER 0.707 ⫾ 0.007 0.716 ⫾ 0.005 0.702 ⫾ 0.003 0.717 ⫾ 0.010

Igf-1 levels were higher at 22 °C versus 30 °C (p ⫽ 0.001), with

FIGURE 5. Effect of chronic DNP and acute CL316243 treatment on TEE (A)
and RER (B). Mice were studied after 6 weeks of DNP/vehicle treatment at the
indicated Ta. CL316243 was injected intraperitoneally at time 0, and the met-
abolic rate was measured at 30 °C for all groups; see “Experimental Proce-
dures” for details. There is a handling effect during the first half hour, with an
increase in TEE, RER, and physical activity. Data are mean ⫾ S.E. (error bars);
n ⫽ 8/group.
chondrial appearance were seen with electron microscopy
(data not shown).
WAT and Endocrine Effects—Leptin mRNA in WAT and
serum levels reflected the underlying adiposity, being reduced
by DNP versus vehicle at 30 °C and were proportional to each
other and body weight/fat mass (Fig. 7) (data not shown). No
changes in WAT mRNA markers of browning were detected.
Adiponectin levels did not differ between the groups (Fig. 7).
no effect of DNP treatment. Fgf21 concentrations were variable
but appeared to be reduced by DNP. DNP treatment decreased
serum T3 and T4 levels at both temperatures (p ⬍ 0.005) (Fig.
7).
Effect of DNP on Liver and Lipid Metabolism—At 30 °C, DNP
treatment reduced liver weight by 13% (p ⫽ 0.058), due to
reduced hepatic steatosis, with a 49% reduction in triglyceride
amount (p ⫽ 0.02) (Fig. 8, A–C). DNP-treated livers showed no
histological evidence of injury. Indeed, at 30 °C, DNP treatment
actually reduced alanine aminotransferase levels by 32% (p ⫽
0.002; Fig. 8D).
Although DNP treatment might be predicted to induce mito-
chondrial function to compensate for less efficient ATP pro-
duction, we observed that DNP had no effect on liver mRNA
levels of Pgc1␣ or Pgc1␤, transcription factors that stimulate
mitochondrial biogenesis, Cox5b (Fig. 8E), or mitochondrial
DNA levels (data not shown). Liver mRNA levels of metabolic
proteins were similar among the four treatment groups; only
Fgf21 and Mcad mRNA levels were higher at 22 °C versus 30 °C
in vehicle-treated mice. DNP treatment reduced Scd1 mRNA at
both temperatures.
Serum ␤-hydroxybutyrate, acetoacetate, and triglyceride lev-
els were increased in DNP-treated mice maintained at 30 °C,
whereas no change was observed in free fatty acid, lactate, or
cholesterol levels (Fig. 8, F and G). Additionally, there was no
change in the ␤-hydroxybutyrate/acetoacetate ratio, suggesting
that the liver mitochondrial redox state was not significantly
altered by DNP treatment.
Thermal Biology—No difference in rectal body temperature
(Tb) was observed in mice fed a HFD at 22 °C. At 30 °C, results
were inconsistent, with DNP treatment sometimes increasing
Tb, possibly more so during handling. Rectal Tb was more sys-
tematically monitored in singly housed, chow-fed male
C57BL/6J mice at 30 °C treated with DNP or vehicle (n ⫽
8/group). Light phase Tb was measured on 12 of 21 days, and
the global mean Tb was 0.22 °C higher in the DNP-treated mice
(36.53 ⫾ 0.06 °C versus 36.31 ⫾ 0.06 °C; p ⫽ 0.006). These

19346 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 28 • JULY 11, 2014
 Chemical Uncouplers in Weight Loss Therapy

Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014

FIGURE 6. DNP effect in BAT. A, histology; B, Ucp1 protein; C, mRNA levels; D, mitochondrial DNA content (mtDNA). Scale bar, 100 ␮m. mRNA and DNA levels
are normalized to 30 °C vehicle. Mice were studied after 9 weeks of DNP/vehicle treatment at the indicated Ta. Data are mean ⫾ S.E. (error bars); n ⫽ 8/group.
*, p ⬍ 0.05.

FIGURE 7. Effect of DNP on hormone levels. A–G, the indicated hormone levels were measured in samples obtained from ad lib fed mice at euthanasia after
9 weeks of DNP/vehicle treatment at the indicated Ta. Data are mean ⫾ S.E. (error bars); n ⫽ 8/group. *, p ⬍ 0.05 for vehicle-DNP comparison, within Ta.

results suggest that DNP treatment can slightly increase Tb at
30 °C.
DISCUSSION
We studied the effect of chronic DNP treatment in mice
housed below (22 °C) and at (30 °C) thermoneutrality. Below
thermoneutrality, a DNP dose that increased thermoneutral
metabolic rate by ⬃17% had no effect on TEE, body weight, or
adiposity. Our results suggest that in mice maintained below
thermoneutrality, the increase in energy expenditure generated
by DNP-mediated uncoupling can be compensated for by
reducing BAT thermogenesis. At thermoneutrality, this com-
pensatory mechanism is absent due to the fact that BAT and
other sources of facultative thermogenesis are virtually inactive
in thermoneutral conditions. Therefore, at thermoneutrality,
DNP treatment increases TEE, leading to reduced body weight,
adiposity, and hepatic steatosis and improved glucose toler-
ance. No attenuation in efficacy or clear toxic effects of DNP
treatment were observed. Recently, a DNP prodrug that is acti-
vated in the liver was reported, which also improved hepatic

JULY 11, 2014 • VOLUME 289 • NUMBER 28 JOURNAL OF BIOLOGICAL CHEMISTRY 19347
Chemical Uncouplers in Weight Loss Therapy
FIGURE 8. DNP effects in liver. A, histology; B, mass; C, triglyceride levels; D, alanine aminotransferase (ALT) activity; E, mRNA levels; F and G, serum analytes. FFA,
free fatty acid. Scale bar, 50 ␮m. Mice were studied after 9 weeks of DNP/vehicle treatment at the indicated Ta. Data are mean ⫾ S.E. (error bars); n ⫽ 8/group.
*, p ⬍ 0.05.
steatosis and glucose homeostasis and did so with an improved
therapeutic index (26). Its effects at thermoneutrality were not
investigated.
Chronic DNP treatment reduced circulating thyroid hor-
mone levels, the principal regulator of basal metabolic rate (27).
The lower thyroid tone reduces BAT activation (28), probably
via reduced action in the hypothalamus (29). Lower leptin levels
are probably not a major cause of the reduced thyroid tone (30)
by DNP because reduced thyroid hormone levels occurred in
the 22 °C DNP group in which neither adiposity nor leptin lev-
els were affected.
Because DNP increased TEE while reducing BAT activity,
fuel oxidation in non-BAT tissues must be increasing. The
observed increase in ␤-hydroxybutyrate levels suggests that
there is a contribution from fatty acid oxidation by liver. The
greater increase in TEE immediately after ␤3-agonist adminis-
tration in DNP-treated mice suggests that there is increased
capacity for fatty acid oxidation, notably seen in the 22 °C
groups that are matched for body weight and adiposity and thus
triglyceride supply. Substrate flux studies will be required to
quantify the individual contributions of specific tissues to the
increased oxidation.
DNP treatment improved glucose homeostasis, as evidenced
by improved glucose tolerance, decreased fasting and fed blood
glucose levels, and lower insulin levels in response to glucose
challenge. Because there was no clear improvement in insulin
tolerance, the lower fed serum insulin levels and HOMA-IR
19348 JOURNAL OF BIOLOGICAL CHEMISTRY
Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014
suggest a modest improvement in insulin sensitivity and/or an
increase in non-insulin-regulated (e.g. DNP-stimulated) glu-
cose disposal. The current studies are not sufficiently quantita-
tive to determine whether the beneficial effects of DNP on glu-
cose are at the expected level for the degree of weight reduction.
It is not known if BAT inactivation is deleterious to glucose or
lipid metabolism. Because BAT clears triglyceride-rich lipopro-
teins (31), DNP-induced BAT inactivation may contribute to
the observed increase in circulating triglyceride levels.
In DNP-treated mice at thermoneutrality, why did caloric
intake not increase sufficiently to prevent weight reduction?
This is not due to physical limitations on ingestion, because the
amount of food required is less than what was eaten at 22 °C.
The biology may be analogous to exercise’s effect on food intake
and body weight: in the sedentary human or rat, low levels of
exercise slightly reduce body weight and food intake, whereas
with further increases in exercise level, food intake rises and the
weight remains stable (32, 33). In mice at thermoneutrality,
increasing cold exposure may produce a similar response (ini-
tial weight loss and then increasing food intake to maintain
body weight) (19 –21, 34). If the analogy to exercise and BAT
activation holds, the DNP dose used was probably too low to
increase food intake. An alternate explanation is that increased
thermogenesis and increased food intake are intrinsically cou-
pled in the coordinated response to a cold environment, and
DNP treatment bypasses this homeostatic regulation.
VOLUME 289 • NUMBER 28 • JULY 11, 2014

DNP treatment did not affect Tb at 22 °C but slightly
increased Tb at 30 °C. The small degree of hyperthermia with
DNP treatment in mice is consistent with the intrinsically high
rate of heat loss in small mammals, which is protective against
hyperthermia. In humans, death caused by DNP is typically
attributed to hyperthermia. However, if hyperthermia is the
principal toxicity, DNP should have increased toxicity in small
mammals housed at thermoneutrality, which is not the case
(35). It is plausible that the proximate cause of death is actually
energy depletion, with the hyperthermia being secondary to the
increased metabolism in the attempt to maintain ATP levels.
A previous long term mouse DNP study used a 1 mg/liter
dose and reported increased longevity and reduced body
weight, presumably at ambient temperatures (36). We found
that an 800-fold larger dose caused mild weight reduction over
1–2 weeks at thermoneutrality, whereas lower doses did not.
The 800 mg/liter mouse dose is, after scaling, comparable with
the human dose (the clinical dose, 1.2– 4.3 mg/kg/day (37),
scales to 15–54 mg/kg/day in mice (38)). This dose is also con-
sistent with the reported narrow therapeutic index; in young
mice, 25% mortality was observed with DNP at ⬃325 mg/kg/
day in the diet for 1 week (37). Single doses of DNP are more
toxic (LD50 of 35 to 72 mg/kg) (35, 39), probably due to higher
peak exposures. Compared with gavage or parenteral dosing,
dosing in drinking water or food is expected to produce lower
peak concentrations and more even coverage over the day. A
DNP prodrug (26) may also achieve some of its improved ther-
apeutic index by reducing the peak concentration of the active
species.
Thermal biology is fundamentally different between small
and large mammals due to the different surface area/volume
ratios (14, 40, 41). Large mammals have developed physiologic
mechanisms for heat dissipation, whereas thermal physiology
in small mammals is oriented to heat generation, with a major
contribution from BAT (9). Large mammals defend Tb and let
body shell and surface temperature drop, thereby increasing
insulation, whereas mice have little insulation and adapt by reg-
ulated changes in Tb (42). In humans, the broad thermoneutral
zone and low level of facultative thermogenesis (increases of
only a few percent (43– 45)) need to be considered. Because
BAT function in adult humans is modest and reduces with age,
drugs that increase energy expenditure by BAT-independent
mechanisms deserve further investigation.
The theoretical implications of the mouse/human differ-
ences in thermal biology for drug development have been noted
(46 – 48), but we are unaware of pharmacotherapy studies actu-
ally evaluating this theory. We chose DNP treatment to inves-
tigate the role of Ta because DNP selectively increases energy
expenditure. Obesity therapies that target food intake reduc-
tion might be less sensitive to Ta. The finding that DNP-medi-
ated thermogenesis at 22 °C substitutes for BAT thermogenesis
with no weight loss contrasts with the significant DNP-induced
weight reduction observed at 30 °C. This is an experimental
confirmation that Ta can affect the measured efficacy of a
potential anti-obesity drug and thus suggests that drugs
increasing the metabolic rate might have greater human effi-
cacy than would be predicted from the typical preclinical stud-
ies in mice below thermoneutrality. It is also notable that obese
JULY 11, 2014 • VOLUME 289 • NUMBER 28
Chemical Uncouplers in Weight Loss Therapy
people, the pharmacotherapy target population, have less BAT
activity than lean people (49), further strengthening the ratio-
nale for studying anti-obesity drugs in mice at thermoneutrality.
Although DNP itself has an unacceptable benefit/risk ratio
for the treatment of obesity (7), our data support further inves-
tigation into uncoupling as an approach to obesity therapy.
Improved properties of a chemical uncoupler include a better
therapeutic index, which might be achieved by a wider dynamic
range (50), saturation absorption pharmacokinetics, or reduc-
ing exposure to the most sensitive organs, such as the eye
(which can develop cataracts (51)). Recently, a DNP prodrug
that is activated in the liver showed remarkable properties,
including improved hepatic steatosis and glucose homeostasis,
with an improved therapeutic index (26). Combination therapy
with a low dose of an uncoupler and another obesity drug (par-
ticularly one that reduces food intake) could also be investi-
Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014
gated. Our study aimed to further explore the physiology of
DNP in order to inform further consideration of chemical
uncouplers in weight loss therapy. Given the demonstrated
therapeutic benefits, it is worth considering whether a suffi-
ciently safe chemical uncoupler can be developed for the treat-
ment of obesity.
Acknowledgments—We thank Simeon Taylor, Lee Weinstein, and
Paul Lee for helpful comments and Ruifeng Teng for technical
assistance.
REFERENCES
1. Ogden, C. L., Carroll, M. D., Kit, B. K., and Flegal, K. M. (2013) Prevalence
of Obesity among Adults: United States, 2011–2012. NCHS Data Brief, pp.
1– 8, Centers for Disease Control and Prevention, Atlanta, GA
2. Directorate General for Health and Consumers (2010) Strategy for Europe
on Nutrition, Overweight and Obesity Related Health Issues, Implementa-
tion Progress Report, European Commission, Brussels
3. Kraschnewski, J. L., Boan, J., Esposito, J., Sherwood, N. E., Lehman, E. B.,
Kephart, D. K., and Sciamanna, C. N. (2010) Long-term weight loss main-
tenance in the United States. Int. J. Obes. (Lond.) 34, 1644 –1654
4. Perkins, R. G. (1919) A study of the munitions intoxications in France.
Pub. Health Rep. 34, 2335–2374
5. Tainter, M. L., Stockton, A. B., and Cutting, W. C. (1935) Dinitrophenol in
the treatment of obesity. JAMA 105, 332–336
6. Colman, E. (2007) Dinitrophenol and obesity: an early twentieth-century
regulatory dilemma. Regul. Toxicol. Pharmacol. 48, 115–117
7. Grundlingh, J., Dargan, P. I., El-Zanfaly, M., and Wood, D. M. (2011)
2,4-Dinitrophenol (DNP): a weight loss agent with significant acute tox-
icity and risk of death. J. Med. Toxicol. 7, 205–212
8. Loomis, W. F., and Lipmann, F. (1948) Reversible inhibition of the cou-
pling between phosphorylation and oxidation. J. Biol. Chem. 173, 807
9. Nedergaard, J., and Cannon, B. (2010) The changed metabolic world with
human brown adipose tissue: therapeutic visions. Cell Metab. 11,
268 –272
10. Tseng, Y. H., Cypess, A. M., and Kahn, C. R. (2010) Cellular bioenergetics
as a target for obesity therapy. Nat. Rev. Drug Discov. 9, 465– 482
11. Enerback, S., Jacobsson, A., Simpson, E. M., Guerra, C., Yamashita, H.,
Harper, M. E., and Kozak, L. P. (1997) Mice lacking mitochondrial uncou-
pling protein are cold-sensitive but not obese. Nature 387, 90 –94
12. Ukropec, J., Anunciado, R. P., Ravussin, Y., Hulver, M. W., and Kozak, L. P.
(2006) UCP1-independent thermogenesis in white adipose tissue of cold-
acclimated Ucp1⫺/⫺ mice. J. Biol. Chem. 281, 31894 –31908
13. Bal, N. C., Maurya, S. K., Sopariwala, D. H., Sahoo, S. K., Gupta, S. C.,
Shaikh, S. A., Pant, M., Rowland, L. A., Bombardier, E., Goonasekera, S. A.,
Tupling, A. R., Molkentin, J. D., and Periasamy, M. (2012) Sarcolipin is a
JOURNAL OF BIOLOGICAL CHEMISTRY 19349
Chemical Uncouplers in Weight Loss Therapy
newly identified regulator of muscle-based thermogenesis in mammals.
Nat. Med. 18, 1575–1579
14. Gordon, C. J. (2012) Thermal physiology of laboratory mice: defining ther-
moneutrality. J. Thermal Biol. 37, 654 – 685
15. Overton, J. M. (2010) Phenotyping small animals as models for the human
metabolic syndrome: thermoneutrality matters. Int. J. Obes. (Lond.) 34,
S53–S58
16. Herrington, L. P. (1940) The heat regulation of small laboratory animals at
various environmental temperatures. Am. J. Physiol. 129, 123–139
17. Mount, L. E. (1971) Metabolic rate and thermal insulation in albino and
hairless mice. J. Physiol. 217, 315–326
18. Ravussin, Y., Gutman, R., LeDuc, C. A., and Leibel, R. L. (2013) Estimating
energy expenditure in mice using an energy balance technique. Int. J. Obes.
(Lond.) 37, 399 – 403
19. Rippe, C., Berger, K., Böiers, C., Ricquier, D., and Erlanson-Albertsson, C.
(2000) Effect of high-fat diet, surrounding temperature, and enterostatin
on uncoupling protein gene expression. Am. J. Physiol. Endocrinol. Metab.
279, E293–E300
20. Nikonova, L., Koza, R. A., Mendoza, T., Chao, P. M., Curley, J. P., and
Kozak, L. P. (2008) Mesoderm-specific transcript is associated with fat
mass expansion in response to a positive energy balance. FASEB J. 22,
3925–3937
21. Castillo, M., Hall, J. A., Correa-Medina, M., Ueta, C., Kang, H. W., Cohen,
D. E., and Bianco, A. C. (2011) Disruption of thyroid hormone activation
in type 2 deiodinase knockout mice causes obesity with glucose intoler-
ance and liver steatosis only at thermoneutrality. Diabetes 60, 1082–1089
22. Susulic, V. S., Frederich, R. C., Lawitts, J., Tozzo, E., Kahn, B. B., Harper,
M. E., Himms-Hagen, J., Flier, J. S., and Lowell, B. B. (1995) Targeted
disruption of the ␤3-adrenergic receptor gene. J. Biol. Chem. 270,
29483–29492
23. Grujic, D., Susulic, V. S., Harper, M. E., Himms-Hagen, J., Cunningham,
B. A., Corkey, B. E., and Lowell, B. B. (1997) ␤3-Adrenergic receptors on
white and brown adipocytes mediate ␤3-selective agonist-induced effects
on energy expenditure, insulin secretion, and food intake. A study using
transgenic and gene knockout mice. J. Biol. Chem. 272, 17686 –17693
24. Cannon, B., and Nedergaard, J. (2004) Brown adipose tissue: function and
physiological significance. Physiol. Rev. 84, 277–359
25. Gavrilova, O., Marcus-Samuels, B., and Reitman, M. L. (2000) Lack of
responses to a ␤3-adrenergic agonist in lipoatrophic A-ZIP/F-1 mice. Di-
abetes 49, 1910 –1916
26. Perry, R. J., Kim, T., Zhang, X. M., Lee, H. Y., Pesta, D., Popov, V. B., Zhang,
D., Rahimi, Y., Jurczak, M. J., Cline, G. W., Spiegel, D. A., and Shulman,
G. I. (2013) Reversal of hypertriglyceridemia, fatty liver disease, and insulin
resistance by a liver-targeted mitochondrial uncoupler. Cell Metab. 18,
740 –748
27. Du Bois, E. F. (1924) Basal Metabolism in Health and Disease, pp.
243–252, Lea & Febiger, Philadelphia
28. Ribeiro, M. O., Carvalho, S. D., Schultz, J. J., Chiellini, G., Scanlan, T. S.,
Bianco, A. C., and Brent, G. A. (2001) Thyroid hormone: sympathetic
interaction and adaptive thermogenesis are thyroid hormone receptor
isoform-specific. J. Clin. Invest. 108, 97–105
29. López, M., Varela, L., Vázquez, M. J., Rodrı́guez-Cuenca, S., González,
C. R., Velagapudi, V. R., Morgan, D. A., Schoenmakers, E., Agassandian,
K., Lage, R., Martı́nez de Morentin, P. B., Tovar, S., Nogueiras, R., Carling,
D., Lelliott, C., Gallego, R., Oresic, M., Chatterjee, K., Saha, A. K., Rah-
mouni, K., Diéguez, C., and Vidal-Puig, A. (2010) Hypothalamic AMPK
and fatty acid metabolism mediate thyroid regulation of energy balance.
Nat. Med. 16, 1001–1008
30. Nillni, E. A. (2010) Regulation of the hypothalamic thyrotropin releasing
hormone (TRH) neuron by neuronal and peripheral inputs. Front. Neu-
roendocrinol. 31, 134 –156
31. Bartelt, A., Bruns, O. T., Reimer, R., Hohenberg, H., Ittrich, H., Peldschus,
K., Kaul, M. G., Tromsdorf, U. I., Weller, H., Waurisch, C., Eychmüller, A.,
19350 JOURNAL OF BIOLOGICAL CHEMISTRY
Gordts, P. L., Rinninger, F., Bruegelmann, K., Freund, B., Nielsen, P.,
Merkel, M., and Heeren, J. (2011) Brown adipose tissue activity controls
triglyceride clearance. Nat. Med. 17, 200 –205
32. Mayer, J., Marshall, N. B., Vitale, J. J., Christensen, J. H., Mashayekhi, M. B.,
and Stare, F. J. (1954) Exercise, food intake and body weight in normal rats
and genetically obese adult mice. Am. J. Physiol. 177, 544 –548
33. Mayer, J., Roy, P., and Mitra, K. P. (1956) Relation between caloric intake,
body weight, and physical work: studies in an industrial male population in
West Bengal. Am. J. Clin. Nutr. 4, 169 –175
34. Ravussin, Y., Xiao, C., Gavrilova, O., and Reitman, M. L. (2014) Effect of
intermittent cold exposure on brown fat activation, obesity, and energy
homeostasis in mice. PLoS One 9, e85876
35. Harvey, D. G. (1959) On the metabolism of some aromatic nitro com-
pounds by different species of animal. III. The toxicity of the dinitrophe-
nols, with a note on the effects of high environmental temperatures.
J. Pharm. Pharmacol. 11, 462– 474
36. Caldeira da Silva, C. C., Cerqueira, F. M., Barbosa, L. F., Medeiros, M. H.,
and Kowaltowski, A. J. (2008) Mild mitochondrial uncoupling in mice
affects energy metabolism, redox balance and longevity. Aging Cell 7,
Downloaded from http://www.jbc.org/ at SMAC Consortium - Bern on September 10, 2014
552–560
37. Agency for Toxic Substances and Disease Registry (ATSDR) (1995) Tox-
icological Profile for Dinitrophenols, ATSDR, Atlanta, GA
38. Food and Drug Administration (2005) Guidance for Industry: Estimating
the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics
in Adult Healthy Volunteers, United States Department of Health and
Human Services, Rockville, MD
39. Kaiser, J. A. (1964) Studies on the toxicity of disophenol (2,6-diiodo-4-
nitrophenol) to dogs and rodents plus some comparisons with 2,4-dini-
trophenol. Ther. Ggw 103, 232–244
40. Kleiber, M. (1975) Body size and metabolic rate. The Fire of Life, 2nd Ed.,
pp. 179 –222, Robert E. Krieger Publishing Co., Huntington, NY
41. Schmidt-Nielsen, K. (1984) Scaling: Why Is Animal Size So Important? pp.
75– 89, Cambridge University Press, Cambridge
42. Stanier, M. W., Mount, L. E., and Bligh, J. (1984) Energy Balance and
Thermal Regulation, pp. 38 –72, Cambridge University Press, Cambridge
43. Dauncey, M. J. (1981) Influence of mild cold on 24 h energy expenditure,
resting metabolism and diet-induced thermogenesis. Br. J. Nutr. 45,
257–267
44. Celi, F. S., Brychta, R. J., Linderman, J. D., Butler, P. W., Alberobello, A. T.,
Smith, S., Courville, A. B., Lai, E. W., Costello, R., Skarulis, M. C., Csako,
G., Remaley, A., Pacak, K., and Chen, K. Y. (2010) Minimal changes in
environmental temperature result in a significant increase in energy ex-
penditure and changes in the hormonal homeostasis in healthy adults.
Eur. J. Endocrinol. 163, 863– 872
45. Wijers, S. L., Schrauwen, P., van Baak, M. A., Saris, W. H., and van Marken
Lichtenbelt, W. D. (2011) ␤-Adrenergic receptor blockade does not in-
hibit cold-induced thermogenesis in humans: possible involvement of
brown adipose tissue. J. Clin. Endocrinol. Metab. 96, E598 –E605
46. Lodhi, I. J., and Semenkovich, C. F. (2009) Why we should put clothes on
mice. Cell Metab. 9, 111–112
47. Cannon, B., and Nedergaard, J. (2011) Nonshivering thermogenesis and
its adequate measurement in metabolic studies. J. Exp. Biol. 214, 242–253
48. Karp, C. L. (2012) Unstressing intemperate models: how cold stress un-
dermines mouse modeling. J. Exp. Med. 209, 1069 –1074
49. van Marken Lichtenbelt, W. D., Vanhommerig, J. W., Smulders, N. M.,
Drossaerts, J. M., Kemerink, G. J., Bouvy, N. D., Schrauwen, P., and Teule,
G. J. (2009) Cold-activated brown adipose tissue in healthy men. N. Engl.
J. Med. 360, 1500 –1508
50. Lou, P. H., Hansen, B. S., Olsen, P. H., Tullin, S., Murphy, M. P., and Brand,
M. D. (2007) Mitochondrial uncouplers with an extraordinary dynamic
range. Biochem. J. 407, 129 –140
51. Horner, W. D. (1942) Dinitrophenol and its relation to formation of cat-
aracts. Arch. Ophthalmol. 27, 1097–1121
VOLUME 289 • NUMBER 28 • JULY 11, 2014