Journal of Experimental Botany, Vol. 74, No. 18 pp.

5722–5735, 2023
https://doi.org/10.1093/jxb/erad303 Advance Access Publication 28 July 2023

RESEARCH PAPER

The transcription factor SPL13 mediates strigolactone

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

suppression of shoot branching by inhibiting cytokinin
synthesis in Solanum lycopersicum
Shangyu Chen1, Xuewei Song1, Qixiang Zheng1, Yuqi Liu1, Jingquan Yu1,2,3, , Yanhong Zhou1,2, and
Xiaojian Xia1,2,*,
1
Department of Horticulture, Zijingang Campus, Zhejiang University, Hangzhou 310058, PR China
2
Hainan Institute, Zhejiang University, Sanya 572025, PR China
3
Key Laboratory of Horticultural Plants Growth, Development and Quality Improvement, Ministry of Agriculture and Rural Affairs of
China, Hangzhou 310058, PR China
*
Correspondence: xiaojianxia@zju.edu.cn

Received 2 February 2023; Editorial decision 25 July 2023; Accepted 27 July 2023

Editor: Joanna Putterill, University of Auckland, New Zealand

Abstract
Plant architecture imposes a large impact on crop yield. IDEAL PLANT ARCHITECTURE 1 (IPA1), which encodes
a SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factor, is a target of molecular design for
improving grain yield. However, the roles of SPL transcription factors in regulating tomato (Solanum lycopersicum)
plant architecture are unclear. Here, we show that the expression of SPL13 is down-regulated in the lateral buds of
strigolactone (SL)-deficient ccd mutants and is induced by GR24 (a synthetic analog of SL). Knockout of SPL13 by
CRISPR/Cas9 resulted in higher levels of cytokinins (CKs) and transcripts of the CK synthesis gene ISOPENTENYL
TRANSFERASES 1 (IPT1) in the stem nodes, and more growth of lateral buds. GR24 suppresses CK synthesis and
lateral bud growth in ccd mutants, but is not effective in spl13 mutants. On the other hand, silencing of the IPT1 gene
inhibited bud growth of spl13 mutants. Interestingly, SL levels in root extracts and exudates are significantly increased
in spl13 mutants. Molecular studies indicated that SPL13 directly represses the transcription of IPT1 and the SL
synthesis genes CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7) and MORE AXILLARY GROWTH 1 (MAX1). The
results demonstrate that SPL13 acts downstream of SL to suppress lateral bud growth by inhibiting CK synthesis in
tomato. Tuning the expression of SPL13 is a potential approach for decreasing the number of lateral shoots in tomato.

Keywords: Cytokinin, plant architecture, shoot branch, SPL13, strigolactone.

Introduction
Plant architecture has large impacts on crop yield as in the case
of the ‘Green Revolution’ in which a moderate decrease in
plant height and increase in tiller number significantly increased
grain yields in wheat and rice. Genetic studies on model plants
including Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa),
and tomato (Solanum lycopersicum) identified mutants defective
in shoot branching, angle of the shoot branch or leaves, and
inflorescence branching (Wang and Li, 2008). Characterization

© The Author(s) 2023. Published by Oxford University Press on behalf of the Society for Experimental Biology.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which
permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.
 SPL13 mediates strigolactone suppression of shoot branching | 5723
of the corresponding genes shed light on the molecular basis
for designing the ideal plant architecture. In wild-type (WT)
tomato that grows indeterminately, an excessive number of lat-
eral shoots is not favorable for flower and fruit development.To
ensure fruit production, the lateral shoots are removed manu-
ally, which is labor costly and time consuming. Understanding
the mechanisms that control the formation of lateral shoots
is necessary for reducing the number of lateral shoots and for
increasing the efficiency of tomato production.
The development of lateral shoots involves several stages in-
cluding the initiation of the axillary meristem in the leaf axils,
the formation of lateral buds, the activation of lateral buds, and
sustained growth of buds into lateral shoots (Wang et al., 2018).
Bud formation is mainly determined by transcription factors
such as LATERAL SUPPRESSOR (tomato and Arabidopsis)
and MONOCULM1 (rice) in the GRAS family (Schumacher
et al., 1999; Greb et al., 2003; Li et al., 2003), and BLIND (to-
mato) and REGULATOR OF AXILLARY MERISTEMS
(Arabidopsis) in the MYB family (Schmitz et al., 2002; Müller
et al., 2006). The growth of lateral buds is usually inhibited by
apical dominance, which has long been thought to be regu-
lated by auxin. However, recent studies showed that sugar
availability is the primary determinant of the activation or dor-
mancy of lateral buds (Mason et al., 2014). Sucrose activates
bud growth by increasing the expression of FLOWERING
LOCUS T (FT) through the sugar signal trehalose 6-phosphate
or by suppressing the expression of BRANCHED 1 (BRC1)
(Barbier et al., 2019; Fichtner et al., 2021). BRC1 encodes a
growth-inhibiting transcription factor that is expressed in dor-
mant buds (Aguilar-Martínez et al., 2007; González-Grandío
et al., 2017).The transcriptional regulation of BRC1 by sucrose
is shown to be mediated by plant hormones. Sucrose induces
the synthesis of cytokinins (CKs) that inhibit the expression
of BRC1 (Salam et al., 2021), but suppresses the signaling of
strigolactones (SLs) that promote the expression of BRC1
(Barbier et al., 2015; Patil et al., 2022). In addition, SLs and
CKs show antagonistic interaction in the control of lateral bud
growth (Dun et al., 2012), although the underlying mechanism
is unclear.
SLs are derived from carotenoids and are plant hormones
that inhibit shoot branching (Gomez-Roldan et al., 2008;
Umehara et al., 2008). DWARF 27 (D27), CAROTENOID
CLEAVAGE DIOXYGENASE 7 (CCD7), CCD8, and MORE
AXILLARY GROWTH 1 (MAX1) catalyze the sequential
steps in SL synthesis from carotenoids to carlactononic acid
(CLA), while cytochrome P450 CYP722s convert CLA to the
orobanchol-type SLs (Mashiguchi et al., 2021). SLs are synthe-
sized in roots and translocated to shoots via the ATP-binding
cassette transporters (Kretzschmar et al., 2012). Interestingly, a
grafting experiment indicated that de novo synthesis of SLs in
shoots is functional in tomato plants (Visentin et al., 2016).
However, SLs are barely detected in shoots, possibly due to the
low transcript abundance of SL synthesis genes, and the unique
mode of SL perception in which binding of SL by its receptor
results in the hydrolysis of SL (Yao et al., 2016). In addition,
the expression of SL synthesis genes is negatively feedback
regulated by SL signaling (Mashiguchi et al., 2009). SL induces
the MORE AXILLARY GROWTH 2 (MAX2)-dependent
degradation of DWARF 53 (D53) or D53-like proteins, the
repressors of SL signaling (Jiang et al., 2013; Zhou et al., 2013;
Wang et al., 2015). D53-like proteins suppress the transcrip-
Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023
tion activity of members of the SQUAMOSA PROMOTER
BINDING PROTEIN-LIKE (SPL) family transcription fac-
tors, which inhibit tillering and shoot branching in rice and
Arabidopsis, respectively (Song et al., 2017; Xie et al., 2020).
D53 also directly suppresses the expression of CYTOKININ
OXIDASE 9 (CKX9) in rice, leading to significant increases in
the CK level and tiller number (Duan et al., 2019).
Transcripts of a subset of SPLs are targeted for cleavage
and/or translational repression by miRNA156s (miR156s).
The miR156/SPL module is a central hub in regulating the
juvenile-to-adult phase transition, plant architecture, flow-
ering, and organ morphology (Wang and Wang, 2015). The al-
lele of the maize TEOSINTE GLUME ARCHITECTURE1
gene which encodes an SPL protein is a key domestication
locus (Dong et al., 2019). Another SPL gene in rice, IDEAL
PLANT ARCHITECTURE 1 (IPA1), is a master regulator
of plant architecture, and has been considered as a new ‘Green
Revolution’ gene (Song et al., 2022). Recently, SPL13 was
found to regulate flowering by directly activating the SINGLE
FLOWER TRUSS gene, an ortholog of FT, in tomato (Cui
et al., 2020). However, the role of SPLs in shoot branching
in tomato is still unclear. Here, we found that SPL13 acted
downstream of SLs to suppress shoot branching. SPL13 inhib-
ited lateral bud growth by regulating the CK synthesis gene.
In addition, SPL13 participated in feedback regulation of SL
synthesis.
Materials and methods
Plant materials and growth conditions
The WT tomato (Solanum lycopersicum cv. Condine Red) was obtained
from the Tomato Genetics Resource Center, UC Davis, CA, USA
(https://tgrc.ucdavis.edu) and used to construct the knockout mutants.
Seeds were soaked in hot water (50 °C) for 15 min, and then placed in
a shaker that was set at a speed of 200 rpm and a temperature of 28 °C
to promote germination. When the length of the radicle was 0.5–1 cm,
the seeds were sown in the growth substrate composed of peat and ver-
miculite (3:1 v/v). The seedlings were grown in the plant factory with a
controlled environment (light intensity, 200 μmol m−2 s−1; photoperiod,
12 h/12 h; day/night temperature, 23/20 °C; relative humidity, 70–80%).
When the second true leaf fully expanded, the seedlings were transferred
to pots containing the same substrate as above, and irrigated 1–2 times a
week using Hoagland nutrient solution.
Construction of the knockout mutants
CRISPR/Cas9 [clustered regularly interspaced palindromic repeats
(CRISPR)/CRISPR-associated protein 9] was used to generate ccd7,
ccd8, and spl13 mutants. The single guide RNA (sgRNA) sequences
5724 | Chen et al.
were designed by the CRISPR-P program (crispr.hzau.edu.cn/
CRISPR2/) as follows: CCD7, TCCTCCAAAACTCTTGCCAC;
CCD8, CTTCCTGACATGTTTGATCA; SPL13,
TCGCCGGCATAAAGTTTGTG.
The gene diagram of SPL13, CCD7, and CCD8 showing locations of
CRISPR edits is provided in Supplementary Fig. S1.
The synthesized sgRNA sequence was annealed and introduced into
the BbsI site of an AtU6–sgRNA–AtUBQ–Cas9 vector. The resulting
plasmid was digested by HindIII and KpnI, and then inserted into the
pCAMBIA1301 binary vector digested by the same restriction enzymes.
After confirmation by sequencing, the vector containing sgRNA and
Cas9 was transformed into Agrobacterium tumefaciens strain GV3101.
Mutants with defects in the target gene were generated through plant
transformation as described previously (Li et al., 2016). T3 homozygous
lines were used for experiments. Primers used for genotyping are listed
in Supplementary Table S1.
Virus-induced gene silencing
Tobacco rattle virus (TRV)-based vector was used for virus-induced gene
silencing (VIGS). To construct the vector, cDNA fragments of target
genes were amplified using primers listed in Supplementary Table S1.
The VIGS tool of the Sol Genomics Network (https://solgenomics.net/)
was used to design the primers. The target site of IPT1, IPT2, or IPT4
gene silencing and the location of quantitative PCR (qPCR) primer are
shown in Supplementary Fig. S1. Purified PCR products were cloned
into the TRV2 vector. After confirmation by sequencing, the plasmids
were transformed into A. tumefaciens strain GV3101. When the cotyle-
dons fully expanded, the seedlings were infiltrated with a mixture of the
A. tumefaciens strain carrying a TRV2 derivative and the strain carrying the
helper vector TRV1. Plants infiltrated with the empty TRV2 and TRV1
vectors served as controls. The infiltrated plants were kept in the dark
for 2 d and then placed in the growth chamber. qPCR was performed
to check the gene silencing efficiency. The plants with transcripts of the
target gene <40% of the control were used for experiments.
Chemical treatments and measurement of lateral bud length
Treatment with rac-GR24 was performed when plants had four fully
expanded leaves. The stock solution of 10 mM rac-GR24 was prepared
by dissolving 25 mg of rac-GR24 (Coolaber, Beijing, China) in 8.38 ml
of acetone. For treatment, the stock solution was diluted 1000-fold to
make a 10 μM solution. The rac-GR24 solution in a volume of 10 μl was
applied directly to the lateral buds every day. The length of lateral buds
was measured 14 d after rac-GR24 treatment using a numeric caliper,
perpendicular to the stem.
In situ hybridization
Tomato lateral buds (~2 mm) were fixed with 4% paraformaldehyde at 4
°C overnight. The samples were washed with phosphate buffer (0.1 M,
pH 7.0) three times (5 min each), dehydrated through an ethanol series
(30, 50, 70, 80, 90, 95, and 100%) for 30 min at each step, and then treated
with 100% ethanol for 1 h. After that, samples were treated through a
graded series of xylene in ethanol (25, 50, 75, and 100%), washed with
50% paraffin in xylene at 65 °C for 1 h, incubated with 100% paraffin at
65 °C overnight, embedded in paraffin in molds (MEIKO EC 360), and
allowed to solidify at room temperature. Paraffin blocks were cut into 8
μm sections using a Manual Rotary Microtome (Thermo Scientific HM
325) and collected on adhesion microscope slides (MeVid). After dewax-
ing, in situ hybridization was performed using the RNAscope 2.5 HD
Detection Kit [Advanced Cell Diagnostics (ACD)] following the manu-
facturer’s protocol. The SPL13 probe and a negative control probe for an
irrelevant bacterial gene dapB were provided by ACD. Slides were imaged
on a Zeiss Axio Scope A1 microscope (Zeiss) with a Zeiss Axiocam 503
color camera and Zeiss ZEN imaging software.
Yeast one-hybrid assay
Yeast one-hybrid (Y1H) assay was performed using the Matchmatch
Gold Yeast OneHybrid System (Clontech) according to the manufactur-
er’s instructions. The IPT1, CCD7, MAX1, BRC1, or SPL13 promoter
(2000 bp upstream of the transcriptional start site) was ligated into the
Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023
pAbAi vector and the full-length coding region of SPL13 was fused to
the pGADT7 vector. The promoter sequences and the SPL13 coding se-
quence were amplified using specific primers (Supplementary Table S1).
The linearized pAbAi constructs containing the IPT1, CCD7, MAX1,
BRC1, or SPL13 promoter were transformed into Y1HGold yeast strain.
pGADT7-SPL13 or an empty AD vector was transformed into the mod-
ified Y1HGold yeast strain.
Dual-luciferase assay
IPT1, CCD7, MAX1, BRC1, SPL13, and D27 promoters were amplified
and ligated into the pGreen II 0800-LUC vector. The full-length coding
region of SPL13 was amplified and fused to the pGreen II 0029 62-SK
vector. The primers used to amplify the promoter and SPL13 coding se-
quence are listed in Supplementary Table S1. The above constructs were
transformed into A. tumefaciens strain GV3101. To determine the activity
of the promoter as influenced by the transcription factor, a mixture of
the A. tumefaciens strain carrying the pGreen II 0800-LUC vector or the
pGreen II 0029 62-SK vector in a 1:10 ratio was infiltrated into Nicotiana
benthamiana leaves.Three days later, the promoter activity was determined
by the ratio of activity of firefly luciferase (LUC) and the internal refer-
ence Renilla luciferase (REN).The LUC and REN activities were meas-
ured using a Modulus Luminometer (Promega). The LUC/REN value
in the absence of SPL13 protein was set as one.
Electrophoretic mobility shift assay
EMSA was performed using the Light Shift Chemiluminescent EMSA
Kit (Cat. no. 20148; Thermo Fisher Scientific, USA) according to the
manufacturer’s instructions. The probes were biotin end-labeled using
the Biotin 3ʹ End DNA Labeling kit (Cat. no. 89818; Pierce, USA) and
annealed to dsDNA according to the following procedure: 95 °C for
5 min, and then the temperature was decreased from 95 °C to 55 °C
in 40 cycles (–1 °C per cycle, 1 cycle min–1), 55 °C for 30 min, and
then the temperature was decreased from 55 °C to 25 °C by 30 cycles
(–1 °C per cycle, 1 cycle min–1), and finally 4 °C for 5 min. To produce
the recombinant protein of SPL13, the full-length coding sequence
of SPL13 was amplified using the primers listed in Supplementary
Table S1. The PCR products were digested with BamHI and SacI, and
then ligated into the same sites of the pET-32a vector. The vectors
were transformed into Escherichia coli strain BL21 (DE3). Expression
of the recombinant His-tagged HIS-SPL13 proteins was induced by
isopropyl-β-d-1-thiogalactopyranoside.The recombinant proteins were
purified according to the instructions of the Novagen pET purification
system.
Measurement of cytokinins and strigolactones
For analysis of CKs, samples (0.2 g) frozen in liquid N2 were ground
to a fine powder and then ground in 1 ml of ice-cold extrac-
tion solution [15:1:4 (v/v/v) methanol:formic acid:water], which
was spiked with [2H6]N6-isopentenyladenine (D-iP), [2H6]N6-
isopentenyladenosineriboside (D-iPR), [2H5]trans-zeatin (D-tZ), and
[2H5]trans-zeatinriboside (D-tZR). The extracts were kept at –30 °C
overnight and centrifuged at 10 000 g for 15 min. The supernatants
 SPL13 mediates strigolactone suppression of shoot branching | 5725
were collected and flowed through a hydrophilic lipophilic balance
column (Oasis) which was pre-treated with 1 M formic acid. An aliquot
of 0.3 ml of extraction solution was flowed through the column. The
liquid was collected and dried under a gaseous N2 flush. Samples were
dissolved in 1 ml of 1 M formic acid and flowed through a mixed-mode
cation (MCX) column (Oasis) which was pre-treated with 1 M formic
acid.The column was washed sequentially with 1 ml of 1 M formic acid,
1 ml of methanol, 1 ml of 0.35 M ammonia solution, and 1 ml of 0.35 M
ammonia in 60% methanol. The final liquid was dried under gaseous N2
flush and dissolved in 200 μl of 1% acetic acid.The mixture was vortexed
and then analyzed by Agilent 1290 ultra-HPLC coupled to 6460 triple
quadruple mass spectrometers.
Measurement of SLs was performed according to the method of
Ruiz-Lozano et al. (2016) with modifications. Root samples (0.5 g) were
ground in a mortar filled with liquid nitrogen and then extracted with
0.5 ml of 40% acetone (v/v). The homogenates were vortexed for 2 min
and centrifuged at 8000 g for 5 min.The supernatants were discarded, and
the pellets were extracted twice with 0.5 ml of 50% acetone (v/v). The
supernatants were filtered through membrane filters (0.22 μm) and then
analyzed by Agilent 1290 ultra-HPLC coupled to 6460 triple quadruple
mass spectrometers.
Collection of root exudates
To analyze the SL content in root exudates, the original hydroponic
solution was discarded and the roots were washed with ultrapure water.
The roots of each intact plant were incubated with 50 ml of freshly pre-
pared Hoagland nutrient solution. The nutrient solution was collected
4 h after light illumination. The nutrient solution of 30 ml was flowed
through a MIX column pre-treated with methanol and purified water.
The MIX column was sequentially washed with 10, 20, 30, and 40% ac-
etone, and finally the SLs bound to the MIX column were eluted with
6 ml of acetone. The liquid was collected and dried with a gaseous N2
flush. The residues were dissolved with 50% acetone and then analyzed
by Agilent 1290 ultra-HPLC coupled to 6460 triple quadruple mass
spectrometers.
Gene expression analysis
Total RNA extraction was performed using an RNAprep pure Plant
Kit (TIANGEN) according to the operation manual. The first-strand
cDNA was synthesized using the ReverTraAce qPCR Reverse
Transcription Kit with genome DNA-removing enzyme (Toyobo).
qPCR was performed on the LightCycler480 detection system
(Roche) using SYBR Super Mix (Takara, RR420A). The conditions
included pre-denaturation at 95 °C for 30 s, followed by 40 cycles of
95 °C for 10 s, 60 °C for 30 s, and at 95 °C for 15 s; 60 °C for 60 s;
95 °C for 15 s. Primers for target genes are shown in Supplementary
Table S2. Tomato housekeeping genes ACTIN and UBI3 were used
as internal reference. Relative expression of target genes was calcu-
lated using the comparative 2−∆∆CT method according to Livak and
Schmittgen (2001). △△CT=(CTtarget gene–CTinternal reference)sample–(CTtarget
gene–CTinternal reference)control.
Phylogenetic tree construction
The protein sequences of the SPLs in tomato, rice, and Arabidopsis were
obtained from the NCBI (http://www.ncbi.nlm.nih.gov/). Multiple se-
quence alignment was performed using ClustalW, and the output data
were saved in MEGA format.The phylogenetic tree was then constructed
in MEGA6 software (Sudhir Kumar, Arizona State University,Tempe, AZ,
USA) using the Neighbor–Joining (NJ) method with 1000 bootstrap
replicates (Tamura et al., 2013).
Statistical analysis
A completely randomized experimental design was used. Data were
subjected to statistical analysis using the SPSS package (SPSS 19.0). The
significance of differences between the means was determined by the
Student’s t-test or Tukey’s test at a level of P<0.05.
Results
Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023
Strigolactones inhibit lateral bud growth by
suppressing cytokinin synthesis
Knockdown of the CCD7 or CCD8 gene in tomato has been
shown to reduce SL levels and to result in increased shoot
branching in tomato (Vogel et al., 2010; Kohlen et al., 2012).
Here, we generated knockout mutants of tomato CCD7 and
CCD8 genes using CRISPR/Cas9. Consistent with previous
studies, the ccd7 and ccd8 mutants showed significantly more
lateral buds with expanding leaves as compared with the WT
(Fig. 1A).The length of lateral buds in each node was measured
acropetally, and was found to be significantly longer than that
of the WT in ccd7 and ccd8 mutants (Fig. 1B). The total length
of lateral buds of ccd7 and ccd8 mutants increased by >5-fold
and 10-fold, respectively. Consistent with the outgrowth of lat-
eral buds, the expression of BRC1 was strongly inhibited in
lateral buds of ccd7 and ccd8 mutants (Fig. 1C).
Next, we studied whether the SL-dependent suppression
of shoot branching in tomato was associated with the regu-
lation of CK synthesis. The content of bioactive CK isopen-
tenyladenosine (iP) increased 42.1% and 30.3% and that of
iP riboside (iPR) increased 150.2% and 103.0%, respectively,
in the shoots of ccd7 and ccd8 mutants as compared with the
WT (Fig. 1D). Similarly, the contents of trans-zeatin (tZ) and
tZ riboside (tZR) were significantly increased in ccd7 and ccd8
mutants. Analysis of ISOPENTENYL TRANSFERASE (IPT)
gene transcripts encoding the rate-limiting enzyme in CK syn-
thesis indicated that IPT1, IPT2, and IPT4 were up-regulated
in shoots of ccd7 and ccd8 mutants, whereas the expression
of IPT3, IPT5, and IPT6 was not affected by SL deficiency
(Fig. 1E). When the IPT1 gene was silenced using VIGS, the
lateral bud growth was inhibited, whereas silencing of IPT2
or IPT4 did not result in apparent changes in bud growth
(Supplementary Fig. S2). Notably, the total length of lateral
buds of ccd7 was decreased by 255.8% after IPT1 gene silenc-
ing (Fig. 1F; Supplementary Fig. S3). The results indicated that
CK synthesis was involved in SL regulation of shoot branching.
Inhibition of lateral bud growth by strigolactones is
dependent on SPL13
SPLs are critical regulators of shoot branching in rice and
Arabidopsis. To study the role of SPLs in the regulation of
shoot branching in tomato, the phylogenetic tree that shows
the relationship of SPLs in tomato, rice, and Arabidopsis was
constructed (Supplementary Fig. S4), and the transcripts of
5726 | Chen et al.

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

Fig. 1. Cytokinin (CK) is involved in strigolactone (SL) regulation of shoot branching. (A) Bud outgrowth phenotypes of ccd7 and ccd8 mutants. (B)
Lateral bud length of ccd7 and ccd8 mutants. (C) qPCR analysis of the relative transcript of BRC1 in lateral buds. (D) CK content in nodal stems of WT,
ccd7, and ccd8 plants. (E) Expression analysis of IPT1–IPT6 in shoots of the WT, and ccd7 and ccd8 mutants. (F) Effects of silencing of IPT1 on the total
lateral bud length of WT and ccd7 plants. Plants in the six-leaf stage were used in the experiment. Values are means of 3–5 biological replicates ±SD.
The different letters indicate a significant difference according to Tukey’s test (P<0.05), and the asterisks indicate a significant difference according to
Student’s t-test (P<0.05).

SPL family genes in the lateral buds were compared between
the WT and ccd7 mutant (Supplementary Fig. S5). The results
showed that defects in SL synthesis resulted in a 22.1–72.2%
decrease in transcript levels of the SPL family genes, among
which SPL13 showed the strongest down-regulation. The pat-
tern of SPL13 expression showed that the transcript level of
SPL13 was high in lateral buds, moderate in apical buds and
stems, and low in mature leaves and roots (Fig. 2A). In situ hy-
bridization was carried out to further study the expression pat-
tern of SPL13. The mRNA of SPL13 was detected in the leaf
primordia of the lateral buds, and the transcript level of SPL13
in the ccd7 mutant was lower than that of the WT (Fig. 2B). In
addition, rac-GR24 (a synthetic analog of SLs) promoted the
expression of SPL13 in the lateral buds and shoots of the WT,
and reversed the inhibition of SPL13 expression in the ccd7
mutant (Fig. 2C, D).
To study whether SPL13 is involved in the SL regulation
of shoot branching in tomato, we constructed the knockout
mutants of SPL13 using CRISPR/Cas9 and obtained two
lines (spl13#3 and spl13#5). Similar to ccd mutants, the spl13
mutants showed obvious elongated lateral buds at each node,
with the total lateral bud length increasing by 3.74- and 5.75-
fold in spl13#3 and spl13#5, respectively, compared with the
WT (Fig. 3A, B). Consistent with the lateral bud growth, the
transcript levels of BRC1 decreased by 44.8% and 45.5% in
the two lines, respectively (Fig. 3C). Interestingly, the expres-
sion of SPL13 in lateral buds was strongly inhibited in the
spl13 mutants (Fig. 3D), probably because the transcription of
SPL13 was activated by SPL13 itself (Supplementary Fig. S6).
When the plants were treated with rac-GR24, the total length
of lateral buds in the WT or ccd7 mutant was significantly in-
hibited, whereas the lateral bud growth in the spl13 mutant was
not affected (Fig. 3E; Supplementary Fig. S7). All the results in-
dicated that SPL13 acted downstream of SLs to suppress lateral
bud growth in tomato.
SPL13 is involved in strigolactone suppression of
cytokinin synthesis
Next, we studied whether SPL13 participated in the regula-
tion of CK synthesis by SLs. Measurement of the CK con-
tents in shoots indicated that the iP, iPR, tZ, and tZR contents
were increased by 12.0, 66.7, 207.8, and 393.5%, respectively, in
spl13 mutants compared with the WT (Fig. 4A). The transcript
levels of IPT1 and IPT2 in shoots of spl13 mutants were much
higher than those of the WT (Fig. 4B; Supplementary Fig. S8),
whereas the expression of other members of the IPT gene
family in spl13 mutants shows only slight increases compared
with the WT. Furthermore, rac-GR24 inhibited the expression
of IPT1 in the WT, but was not able to inhibit the expression
 SPL13 mediates strigolactone suppression of shoot branching | 5727

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

Fig. 2. Expression of SPL13 is regulated by SL. (A) The expression of SPL13 in tomato apical buds, mature leaves, stems, lateral buds, and roots. (B) In
situ hybridization of mRNA of SPL13 in lateral buds. (C and D) Effects of application of rac-GR24 on the expression of SPL13 in lateral buds and stems
of the WT and ccd7 mutant. Plants in the six-leaf stage were used in the experiment. Values are means of three biological replicates ±SD. The different
letters indicate a significant difference according to Tukey’s test (P<0.05), and the asterisks indicate a significant difference according to Student’s t-test
(P<0.05).

of IPT1 in spl13 mutants (Fig. 4C). The iP nucleotides can
be trans-hydroxylated by CYP735A to produce tZ nucleo-
tides, and the CK nucleotides are activated by LONELY GUY
(LOG) to produce the bioactive CKs (Werner and Schmulling,
2009). qPCR showed that LOG3, LOG4, LOG6, CYP735A1,
and CYP735A2 were up-regulated in spl13 mutants
(Supplementary Fig. S9). In addition, SPL13 regulated the ex-
pression of CKXs. The transcript levels of CKX2 and CKX6
were lower in spl13 mutants than in the WT (Supplementary
Fig. S10). rac-GR24 decreased the iP, iPR, tZ, and tZR content
in the shoots of the WT and ccd7 mutant (Fig. 4D). However,
the CK levels in spl13 mutants were not affected by rac-GR24.
SPL13 inhibits shoot branching by regulating cytokinin
synthesis
To further study the role of SPL13 in the regulation of CK
synthesis during shoot branching, the CK synthesis gene
IPT1, whose expression was highest among the IPT family
genes in spl13 mutants, was silenced by VIGS in the spl13-
3# line. The growth of lateral buds was strongly inhibited
by silencing of IPT1 in the WT and spl13 mutants (Fig.
5A, B). Accordingly, the transcript levels of BRC1 in lat-
eral buds were significantly increased in the IPT1-silenced
WT and spl13 mutant (Fig. 5C). The transcript of BRC1 was
increased by rac-GR24, whereas the expression of BRC1 was
not further enhanced by rac-GR24 in IPT1-silenced plants
(Supplementary Fig. S11). This suggest that IPT1 is required
for SL regulation of BRC1. Meanwhile, rac-GR24 was not
able to promote the expression of BRC1 in spl13 mutants
(Supplementary Fig. S12C). Consistent with previous find-
ings, the dual-luciferase assay, Y1H assay, and EMSA indi-
cated that SPL13 was able to bind to the promoter of BRC1
(Supplementary Fig. S13).
Motif analysis of the IPT1 gene promoter (PIPT1; sequence
2000 bp upstream of the transcriptional start site) identified five
GTAC motifs, the putative SPL-binding sites (Supplementary
Fig. S14A). The activity of PIPT1 decreased by 51% after infil-
tration of SPL13 protein as shown by the dual-luciferase assay
(Fig. 5D).Y1H assay showed that the yeast cells containing the
PIPT1-bait vector and the pGADT7-SPL13 vector grew on the
selection medium (Fig. 5E). Furthermore, EMSA confirmed
5728 | Chen et al.

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

Fig. 3. SPL13 suppresses shoot branching. (A) Bud outgrowth phenotypes of the spl13 mutant. (B) Lateral bud length of the spl13 mutant. (C) qPCR
analysis of the relative transcript of BRC1 in lateral buds. (D) qPCR analysis of the relative transcript of SPL13 in lateral buds of the spl13 mutant. (E)
Effects of application of rac-GR24 on the total lateral bud length of ccd7 and spl13 mutants. Plants in the six-leaf stage were used in the experiment.
Values are means of 3–5 biological replicates ±SD. ns indicates a non-significant difference according to Student’s test (P<0.05). The asterisks indicate a
significant difference according to Student’s t-test (P<0.05).

the in vitro binding of SPL13 protein to the DNA fragment of
PIPT1 that contained the GTAC motif (Fig. 5F). These results
indicated that SPL13 inhibited shoot branching by suppressing
the expression of the CK synthesis gene in tomato.
SPL13 inhibits strigolactone synthesis in tomato
To further study the relationship between SLs and SPL13, the
SL synthesis in spl13 mutants was analyzed. Compared with
the WT, the transcript levels of CCD7 and MAX1 in the roots
and shoots of spl13 mutants increased by 38.1–200.7% (Fig.
6A, B). However, no significant difference in the expression
of CCD8 was found between the WT and spl13 mutants. The
transcript levels of CCD7 and MAX1 decreased by 51.1%
and 36.8 %, respectively, in the WT after rac-GR24 treatment,
whereas rac-GR24-induced inhibition of CCD7 and MAX1
expression was not obvious in spl13 mutants (Supplementary
Fig. S12A, B). CYP722C, CYP712G1, and D27 also func-
tion in SL synthesis. qPCR results showed that the expression
of CYP722C and CYP712G1 did not change significantly,
whereas the expression of D27 was significantly increased in
roots of spl13 mutants. Dual-luciferase assay showed that SPL13
can suppress the promoter activity of D27 (Supplementary
Fig. S15). Orobanchol, didehydro-orobanchol, and solanacol
were detected in the root extracts and exudates. The relative
levels of orobanchol and solanacol in root extracts of spl13
mutants were higher than those of the WT, whereas the rela-
tive level of all three types of SLs increased in the root exudates
of spl13 mutants as compared with the WT (Fig. 6C, D). The
ccd7 shoot branching phenotype was reversed when ccd7 scions
were grafted on the spl13 rootstocks (Supplementary Fig. S16),
further indicating sufficient amounts of SLs in the roots of the
spl13 mutant.
Dual-luciferase assay showed that the activity of the CCD7
and MAX1 promoters, which contained two and four GTAC
motifs, respectively (Supplementary Fig. S14B, C), was inhib-
ited by 55.9% and 47.2%, as a result of SPL13 infiltration (Fig.
7A, D).The Y1H assay also showed interaction between SPL13
and the promoters of CCD7 or MAX1 (Fig. 7B, E). In addi-
tion, EMSA confirmed the binding of SPL13 protein to the
GTAC motif in the promoters of CCD7 and MAX1 (Fig. 7C,
F). All the results suggested that SPL13 was a transcriptional re-
pressor of CCD7 and MAX1, and was involved in the feedback
regulation of SLs synthesis.
 SPL13 mediates strigolactone suppression of shoot branching | 5729

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

Fig. 4. SL suppresses CK synthesis through SPL13. (A) CK content in nodal stems of WT and spl13 plants. (B) Expression analysis of IPT1 in shoots of
the WT and spl13 mutant. (C) Effects of application of rac-GR24 on the expression of IPT1 in the nodal stems of the WT and spl13 mutant. (D) Effects of
application of rac-GR24 on the CK contents of the WT, and ccd7 and spl13 mutants. Plants in the six-leaf stage were used in the experiment. Values are
means of 3–5 biological replicates ±SD. ns indicates a non-significant difference according to Student’s test (P<0.05). The asterisks indicate a significant
difference according to Student’s t-test (P<0.05).

Discussion in the suppression of shoot branching by SLs in tomato was

SPL13 mediates strigolactone to regulate shoot
branching in tomato
Molecular genetic studies in model plants have established the
pathways of SL synthesis (Mashiguchi et al., 2021). Previous
studies have shown the inverse relationship between SL levels
and the number of lateral shoots in CCD7- or CCD8-silenced
tomato plants and demonstrated that CCD7 and CCD8 are
essential for SL synthesis in tomato (Vogel et al., 2010; Kohlen
et al., 2012). However, the mechanism by which SLs regulate
shoot branching in tomato is unclear. In Arabidopsis or rice,
D53 or D53-like protein which is targeted for protein deg-
radation in SL signaling suppress the function of SPL tran-
scription factors which suppress shoot branching or tillering
(Song et al., 2017; Xie et al., 2020). The miR156–SPL14
module was also shown to inhibit tillering independently of
SLs in rice (Luo et al., 2012). A previous study showed that
the tomato miR156a-targeted SPL13 regulates inflorescence
development (Cui et al., 2020). However, the role of SPL13
unclear. By analyzing the transcript levels of SPL family genes
in SL-deficient ccd7 mutants, the expression of SPL13 was
found to be the most inhibited (Supplementary Fig. S5). The
transcripts of SPL13 were most abundant in lateral buds (Fig.
2A), and knockout of SPL13 promoted the outgrowth of lat-
eral buds as compared with the WT (Fig. 3A, B), indicating
that SPL13 is an important regulator of lateral bud growth.
Importantly, the lateral bud growth of ccd7 was inhibited when
the SL deficiency was complemented by exogenous rac-GR24,
whereas the growth of lateral buds in spl13 mutants was insen-
sitive to rac-GR24. In addition, the spl13 mutants contained
higher levels of SLs in root extracts and exudates, which was at-
tributable to an increase in the expression of SL synthesis genes
(Fig. 6). The results provide evidence supporting that SPL13
is involved in SL regulation of shoot branching, and partic-
ipates in the feedback regulation of SL synthesis in tomato.
Interestingly, the ccd7 shoot branching phenotype was reversed
when ccd7 scions were grafted on the WT or spl13 rootstocks
(Supplementary Fig. S16). Long-distance SL transport from
5730 | Chen et al.

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

Fig. 5. CK synthesis is involved in SPL13 regulation of shoot branching. (A) Bud outgrowth phenotypes of WT and spl13 plants after silencing of IPT1.
(B) Effects of IPT1 silencing on the total lateral bud length of WT and spl13 plants. (C) qPCR analysis of the relative transcript of BRC1 in lateral buds.
(D) Dual-luciferase assay for the regulatory effect of SPL13 on the expression of IPT1. (E) Y1H analysis of SPL13 binding to the PIPT1. (F) EMSA analysis
of SPL13 binding to the IPT1. Plants in the six-leaf stage were used in the experiment. Values are means of 3–5 biological replicates ±SD. The different
letters indicate a significant difference according to Tukey’s test (P<0.05), and the asterisks indicate a significant difference according to Student’s t-test
(P<0.05).

roots to shoots was shown to be mediated by a short-distance
transporter (Kretzschmar et al., 2012; Shiratake et al., 2019),
instead of the xylem sap flow. The grafting experiment further
excludes the possibility that the shoot branching phenotypes of
spl13 mutants is related to SL transport.
At present, the mechanism by which SPL13 is controlled by
the upstream regulator of SL signaling is unclear in tomato.We
found that the SPL13 gene was transcriptionally self-regulated.
The promoter activity of SPL13 (PSPL13) increased after infil-
tration of SPL13 protein, as shown by the dual-luciferase assay
(Supplementary Fig. S6A). The Y1H assay showed that the
yeast cells containing the PSPL13-bait vector and the pGADT7-
SPL13 vector grew on the selection medium (Supplementary
Fig. S6B). SPL13 protein is necessary for the transcriptional
induction of SPL13 by SLs (Fig. 3E). Recently, a D53-like
gene was identified in Pisum sativum and was found to act
downstream of SLs to regulate lateral bud growth (Kerr et al.,
2021). If SLs regulate shoot branching in tomato through the
conserved signaling pathway, the putative D53-like protein is
the most likely regulator of SPL13. The upstream SL signaling
will release the suppression of SPL13 by the D53-like protein,
leading to the activation of SPL13 transcription. This explains
why the SPL13 gene was regulated by SLs at the transcrip-
tional level (Fig. 2).
Cytokinin synthesis participates in the strigolactone
inhibition of shoot branching
SLs and CKs have antagonistic effects on lateral bud growth
(Dun et al, 2012). However, the role of CKs in the SL reg-
ulation of lateral bud growth remains ambiguous. CK levels
in the xylem sap were reduced in the SL synthesis or signal-
ing mutants, possibly due to a feedback mechanism (Foo et al.,
2007). However, IPT1, the key gene involved in local CK syn-
thesis during release of apical dominance (Tanaka et al., 2006),
was up-regulated in the SL-related mutants in pea (P. sativum)
(Dun et al., 2012). CK levels were also found to increase in
shoots of the SL synthesis mutant in pea (Young et al., 2014).
In addition, GR24 down-regulated the expression of IPT3 in
chrysanthemum (Chen et al., 2013). In this study, the tomato
ccd mutants showed a significantly higher level of CKs in shoots
compared with the WT. The increase in CK content was re-
lated to the up-regulation of the IPT1 gene, whereas silenc-
ing of IPT1 strongly inhibited the outgrowth of lateral buds
 SPL13 mediates strigolactone suppression of shoot branching | 5731

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

Fig. 6. SPL13 inhibits SL synthesis. (A, B) qPCR analysis of relative transcripts of CCD7, CCD8, and MAX1 in nodal stems and roots. (C, D) Relative
content of orobanchol, didehydro-orobanchol, and solanacol in root extracts and root exudates. Plants in the six-leaf stage were used in the experiment.
Values are means of three biological replicates ±SD. ns indicates a non-significant difference according to Student’s test (P<0.05). The asterisks indicate
a significant difference according to Student’s t-test (P<0.05).

in ccd7 mutants (Fig. 1E). Local CK synthesis is required for
the initial activation of lateral buds (Tanaka et al., 2006; Dun
et al, 2012). Additionally, CKs promote vascular development
(Fu et al., 2021) which is likely to be involved in the polar
auxin transport and sugar transport during the activation of
lateral buds (Waldie and Leyser, 2018; Barbier et al., 2019). CK
also regulates SL signaling through enhancing the expression
of D53-like genes, which probably regulate the expression of
downstream genes directly or by suppressing the transcrip-
tional activity of multiple SPLs (Kerr et al., 2021). Combining
the results of this study, it is clear that suppressing CK synthesis
is involved in the SL inhibition of bud growth.
The function of SPL13 is intimately linked to cytokinin
synthesis
SLs suppress CK levels by promoting the expression of a CK
degradation gene in a D53-dependent manner in rice (Duan
et al., 2019). Here, we propose a model whereby SPL13 medi-
ated SLs to suppress local CK synthesis by inhibiting the ex-
pression of IPT1 (Fig. 8). Exogenous SL inhibited local CK
synthesis in the WT, but failed to regulate CK synthesis in the
spl13 mutants. Mutation of the SL-regulated SPL13 resulted in
an increase in IPT1 transcripts and elevated CK levels in shoots
(Fig. 4A, B). Furthermore, SPL13 directly bound to the pro-
moter of the IPT1 gene, whereas silencing of IPT1 suppressed
lateral bud growth in spl13 mutants (Fig. 5). The evidence
strongly supports that SLs inhibit CK synthesis through SPL13.
Silencing of IPT1 reversed the inhibition of BRC1 expres-
sion in the spl13 mutant (Fig. 5C). In addition, GR24 increased
the expression of BRC1 in the TRV control, but did not fur-
ther enhance the expression of BRC1 in IPT1-silenced plants
(Supplementary Fig. S11). The results suggest that SL and
SPL13 are regulating BRC1 expression indirectly through CKs.
However, dual-luciferase and Y1H assays indicated that SPL13
can bind to the promoter of BRC1, consistent with previous
5732 | Chen et al.

Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023

Fig. 7. SPL13 inhibits the transcription of SL synthesis genes. (A, D) Dual-luciferase assay for the regulatory effect of SPL13 on the expression of CCD7
and MAX1. (B, E) Y1H analysis of SPL13 binding to the PCCD7 and PMAX1. (C, F) EMSA analysis of SPL13 binding to CCD7 and MAX1. Values are means
of four biological replicates ±SD. The asterisks indicate a significant difference according to Student’s t-test (P<0.05).

SPL13 has dual functions in directly regulating BRC1 expres-

Fig. 8. The model depicts the mechanism of action of SPL13 in
suppressing shoot branching in tomato plants.
studies showing that IPA1/SPLs directly regulate BRC1 ex-
pression (Lu et al., 2013; Xie et al., 2020). We propose that
sion and CK synthesis, while both mechanisms are involved
in SL regulation of bud outgrowth. Recently, D53-like genes,
the suppressors of SL signaling, were found to be induced by
CK signaling (Kerr et al., 2021). It is likely that CK participates
in the SPL13 regulation of BRC1 expression through impacts
on SL signaling. In the absence of sufficient CKs, low levels of
D53-like allow transcriptional activation of the BRC1 gene by
multiple SPL factors. Alternatively, CK signaling may directly
regulate the expression of BRC1.
We also found that tomato SPL13 is not homologous to IPA1/
SPL14 in rice and SPL9/15 in Arabidopsis (Supplementary Fig.
S4). Combined with the roles of SPL13 in BRC1 transcription
and CK synthesis, our results suggest that the mode of action
of SPL13 is distinct from those of the classic SPLs. Recently,
the SPL transcription factor LIGULELESS1 was shown to
regulate leaf angle in maize by activating the transcription
of RAVL1, which encodes a B3-domain transcription factor
acting upstream of brassinosteroids (Tian et al., 2019). SPL8
was also found to promote lamina joint development by regu-
lating auxin signaling and brassinosteroid biosynthesis in wheat
 SPL13 mediates strigolactone suppression of shoot branching | 5733
(Liu et al., 2019). These results indicate the functional diversity
of SPL factors, and emphasize that SPL-dependent regulation
of hormone synthesis and/or signaling underlies the shaping of
plant architecture in different crops.
The pattern of SPL13 expression showed that the SPL13
transcripts were abundant in lateral buds (Fig. 2A), suggest-
ing that SPL13 may directly control the genes related to
leaf differentiation and growth of the buds. A previous study
showed that the lateral buds of mutants with defects in CK
synthesis still showed a response to a decrease in apical domi-
nance (Müller et al., 2015). SLs regulate lateral bud dormancy
downstream of auxin (Brewer et al., 2009). It is likely that
SLs also regulate shoot branching through a pathway inde-
pendent of CKs. Indeed, the length of lateral buds in ccd7
mutants was still longer than that of the WT after silencing of
the IPT1 gene (Fig. 1F; Supplementary Fig. S3). It is likely that
SPL13-dependent transcription of growth-inhibiting genes in
buds plays a role in SL-mediated bud dormancy. However,
the detailed mechanism needs in-depth studies in the future.
Importantly, the allele of the SPL13 gene that results in com-
pact shoot architectures suitable for growing at high density
should be identified in tomatoes. Additionally, the advance in
gene editing technology is expected to aid in fine regulation
of SPL13 expression in tomato plants, leading to the optimi-
zation of vegetative and reproductive growth, and ultimately a
boost in fruit yields.
Supplementary data
The following supplementary data are available at JXB online.
Fig. S1. Gene diagram.
Fig. S2. IPT1 is important for the regulation of lateral bud
growth.
Fig. S3. Bud outgrowth phenotypes of the WT and ccd7 mu-
tant after silencing of the CK synthesis gene IPT1.
Fig. S4. Phylogenetic tree that shows the relationship of SPLs
in tomato, rice, and Arabidopsis.
Fig. S5. Expression analysis of SPL family genes in the lateral
buds of the WT and ccd7 mutants.
Fig. S6. The expression of SPL13 undergoes self-regulation.
Fig. S7. Bud outgrowth phenotypes of the ccd7 and spl13
mutants after application of rac-GR24.
Fig. S8. Expression analysis of IPT2–IPT6 in shoots of the
WT and spl13 mutants.
Fig. S9. Expression analysis of LOG1–LOG8, CYP735A1,
and CYP735A2 in shoots of the WT and spl13 mutants.
Fig. S10. Expression analysis of CKX1–CKX7 in shoots of
the WT and spl13 mutants.
Fig. S11. qPCR analysis of the relative transcript of BRC1
in lateral buds.
Fig. S12. Effects of application of rac-GR24 on the expres-
sion of CCD7 and MAX1 in shoots and BRC1 in lateral buds
of the WT and spl13 mutant.
Fig. S13. SPL13 promotes the transcription of BRC1.
Fig. S14. Identification of the SPL-binding motif in the pro-
moters of IPT1, CCD7, MAX1, BRC1, CCD8, and D27.
Fig. S15. Expression analysis of CYP722C, CYP712G1, and
D27 in roots of the WT and spl13 mutants.
Fig. S16. Effects of grafting on the lateral bud outgrowth.
Table. S1. Primers used for vector construction.
Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023
Table. S2. Primers used for qPCR analysis.
Acknowledgements
We are grateful to Ms Q. Sun for co-constructing the tomato ccd7 and
ccd8 mutants, and to Dr X.D. Wu for help in strigolactone and cytokinin
analysis.
Author contributions
XX, JY, and YZ: design; SC, XS, QZ, and YL: executing the experimental
measurements; SC and XS: interpreting the results; SC and QZ: data
analysis; XX and SC: writing and revision; all authors read and approved
the final manuscript.
Conflict of interest
The authors declare no conflict of interest.
Funding
This study was supported by the National Natural Science Foundation
of China (32272694), Natural Science Foundation of Zhejiang
Province (LR23C150002), the Fundamental Research Funds for the
Central Universities (2021FZZX001-30), and the Starry Night Science
Fund of Zhejiang University Shanghai Institute for Advanced Study
(SNZJU-SIAS-0011).
Data availability
All data supporting the findings of this study are available within the
paper and within its supplementary data published online.
References
Aguilar-Martínez JA, Poza-Carrión C, Cubas P. 2007. Arabidopsis
BRANCHED1 acts as an integrator of branching signals within axillary buds.
The Plant Cell 19, 458–472.
Barbier FF, Dun EA, Kerr SC, Chabikwa TG, Beveridge CA. 2019. An
update on the signals controlling shoot branching. Trends in Plant Science
24, 220–236.
Barbier F, Péron T, Lecerf M, et al. 2015. Sucrose is an early modulator
of the key hormonal mechanisms controlling bud outgrowth in Rosa hyb-
rida. Journal of Experimental Botany 66, 2569–2582.
Brewer PB, Dun EA, Ferguson BJ, Rameau C, Beveridge CA. 2009.
Strigolactone acts downstream of auxin to regulate bud outgrowth in pea
and Arabidopsis. Plant Physiology 150, 482–493.
5734 | Chen et al.
Chen X, Zhou X, Xi L, Li J, Zhao R, Ma N, Zhao L. 2013. Roles of
DgBRC1 in regulation of lateral branching in chrysanthemum (Dendranthema
× grandiflora cv. Jinba). PLoS One 8, e61717.
Cui L, Zheng F, Wang J, Zhang C, Xiao F, Ye J, Li C, Ye Z, Zhang J.
2020. miR156a-targeted SBP-Box transcription factor SlSPL13 regulates
inflorescence morphogenesis by directly activating SFT in tomato. Plant
Biotechnology Journal 18, 1670–1682.
Dong Z, Xiao Y, Govindarajulu R, Feil R, Siddoway ML, Nielsen T,
Lunn JE, Hawkins J, Whipple C, Chuck G. 2019. The regulatory land-
scape of a core maize domestication module controlling bud dormancy and
growth repression. Nature Communications 10, 3810.
Duan J, Yu H, Yuan K, Liao Z, Meng X, Jing Y, Liu G, Chu J, Li J. 2019.
Strigolactone promotes cytokinin degradation through transcriptional acti-
vation of CYTOKININ OXIDASE/DEHYDROGENASE 9 in rice. Proceedings
of the National Academy of Sciences, USA 116, 14319–14324.
Dun EA, de Saint Germain A, Rameau C, Beveridge CA. 2012.
Antagonistic action of strigolactone and cytokinin in bud outgrowth control.
Plant Physiology 158, 487–498.
Fichtner F, Barbier FF, Annunziata MG, Feil R, Olas JJ, Mueller-
Roeber B, Stitt M, Beveridge CA, Lunn JE. 2021. Regulation of shoot
branching in Arabidopsis by trehalose 6-phosphate. New Phytologist 229,
2135–2151.
Foo E, Morris SE, Parmenter K, Young N, Wang H, Jones A, Rameau
C, Turnbull CG, Beveridge CA. 2007. Feedback regulation of xylem cy-
tokinin content is conserved in pea and Arabidopsis. Plant Physiology 143,
1418–1428.
Fu X, Su H, Liu S, Du X, Xu C, Luo K. 2021. Cytokinin signaling local-
ized in phloem noncell-autonomously regulates cambial activity during sec-
ondary growth of Populus stems. New Phytologist 230, 1476–1488.
Gomez-Roldan V, Fermas S, Brewer PB, et al. 2008. Strigolactone inhi-
bition of shoot branching. Nature 455, 189–194.
González-Grandío E, Pajoro A, Franco-Zorrilla JM, Tarancón C,
Immink RG, Cubas P. 2017. Abscisic acid signaling is controlled by a
BRANCHED1/HD-ZIP I cascade in Arabidopsis axillary buds. Proceedings
of the National Academy of Sciences, USA 114, E245–E254.
Greb T, Clarenz O, Schafer E, Muller D, Herrero R, Schmitz G, Theres
K. 2003. Molecular analysis of the LATERAL SUPPRESSOR gene in
Arabidopsis reveals a conserved control mechanism for axillary meristem
formation. Genes & Development 17, 1175–1187.
Jiang L, Liu X, Xiong G, et al. 2013. DWARF 53 acts as a repressor of
strigolactone signalling in rice. Nature 504, 401–405.
Kerr SC, Patil SB, de Saint Germain A, et al. 2021. Integration of the
SMXL/D53 strigolactone signalling repressors in the model of shoot branch-
ing regulation in Pisum sativum. The Plant Journal 107, 1756–1770.
Kohlen W, Charnikhova T, Lammers M, et al. 2012. The tomato
CAROTENOID CLEAVAGE DIOXYGENASE8 (SlCCD8) regulates rhizo-
sphere signaling, plant architecture and affects reproductive development
through strigolactone biosynthesis. New Phytologist 196, 535–547.
Kretzschmar T, Kohlen W, Sasse J, Borghi L, Schlegel M, Bachelier
JB, Reinhardt D, Bours R, Bouwmeester HJ, Martinoia E. 2012. A
petunia ABC protein controls strigolactone-dependent symbiotic signalling
and branching. Nature 483, 341–344.
Li X, Qian Q, Fu Z, et al. 2003. Control of tillering in rice. Nature 422,
618–621.
Li XJ, Chen XJ, Guo X, et al. 2016. DWARF overexpression induces alter-
ation in phytohormone homeostasis, development, architecture and carote-
noid accumulation in tomato. Plant Biotechnology Journal 14, 1021–1033.
Liu KY, Cao J, Yu KH, et al. 2019. Wheat TaSPL8 modulates leaf angle
through auxin and brassinosteroid signaling. Plant Physiology 181, 179–194.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 25,
402–408.
Lu ZF, Yu H, Xiong GS, et al. 2013. Genome-wide binding analysis of the
transcription activator IDEAL PLANT ARCHITECTURE1 reveals a complex
network regulating rice plant architecture. The Plant Cell 25, 3743–3759.
Luo L, Li W, Miura K, Ashikari M, Kyozuka J. 2012. Control of tiller
growth of rice by OsSPL14 and strigolactones, which work in two inde-
pendent pathways. Plant & Cell Physiology 53, 1793–1801.
Mashiguchi K, Sasaki E, Shimada Y, Nagae M, Ueno K, Nakano T,
Yoneyama K, Suzuki Y, Asami T. 2009. Feedback-regulation of strigolac-
tone biosynthetic genes and strigolactone-regulated genes in Arabidopsis.
Bioscience, Biotechnology, and Biochemistry 73, 2460–2465.
Mashiguchi K, Seto Y, Yamaguchi S. 2021. Strigolactone biosynthesis,
transport and perception. The Plant Journal 105, 335–350.
Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023
Mason MG, Ross JJ, Babst BA, Wienclaw BN, Beveridge CA.
2014. Sugar demand, not auxin, is the initial regulator of apical dom-
inance. Proceedings of the National Academy of Sciences, USA 111,
6092–6097.
Müller D, Schmitz G, Theres K. 2006. Blind homologous R2R3 Myb
genes control the pattern of lateral meristem initiation in Arabidopsis. The
Plant Cell 18, 586–597.
Müller D, Waldie T, Miyawaki K, To JP, Melnyk CW, Kieber JJ,
Kakimoto T, Leyser O. 2015. Cytokinin is required for escape but not
release from auxin mediated apical dominance. The Plant Journal 82,
874–886.
Patil SB, Barbier FF, Zhao J, et al. 2022. Sucrose promotes D53 accu-
mulation and tillering in rice. New Phytologist 234, 122–136.
Ruiz-Lozano JM, Aroca R, Zamarreño AM, Molina S, Andreo-
Jiménez B, Porcel R, García-Mina JM, Ruyter-Spira C, López-Ráez
JA. 2016. Arbuscular mycorrhizal symbiosis induces strigolactone biosyn-
thesis under drought and improves drought tolerance in lettuce and tomato.
Plant Cell & Environment 39, 441–452.
Salam BB, Barbier F, Danieli R, et al. 2021. Sucrose promotes stem
branching through cytokinin. Plant Physiology 185, 1708–1721.
Schmitz G, Tillmann E, Carriero F, Fiore C, Cellini F, Theres K. 2002.
The tomato Blind gene encodes a MYB transcription factor that controls
the formation of lateral meristems. Proceedings of the National Academy of
Sciences, USA 99, 1064–1069.
Schumacher K, Schmitt T, Rossberg M, Schmitz G, Theres K. 1999.
The Lateral suppressor (Ls) gene of tomato encodes a new member of
the VHIID protein family. Proceedings of the National Academy of Sciences,
USA 96, 290–295.
Shiratake K, Notaguchi M, Makino H, Sawai Y, Borghi L. 2019. Petunia
PLEIOTROPIC DRUG RESISTANCE 1 is a strigolactone short-distance
transporter with long-distance outcomes. Plant & Cell Physiology 60,
1722–1733.
Song X, Lu Z, Yu H, et al. 2017. IPA1 functions as a downstream tran-
scription factor repressed by D53 in strigolactone signaling in rice. Cell
Research 27, 1128–1141.
Song X, Meng X, Guo H, et al. 2022. Targeting a gene regulatory element
enhances rice grain yield by decoupling panicle number and size. Nature
Biotechnology 40, 1403–1411.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6:
Molecular evolutionary genetics analysis version 6.0. Molecular Biology and
Evolution 30, 2725–2729.
Tanaka M, Takei K, Kojima M, Sakakibara H, Mori H. 2006. Auxin con-
trols local cytokinin biosynthesis in the nodal stem in apical dominance. The
Plant Journal 45, 1028–1036.
Tian J, Wang C, Xia J, et al. 2019. Teosinte ligule allele narrows plant
architecture and enhances high-density maize yields. Science 365,
658–664.
Umehara M, Hanada A, Yoshida S, et al. 2008. Inhibition of shoot
branching by new terpenoid plant hormones. Nature 455, 195–200.
Visentin I, Vitali M, Ferrero M, Zhang Y, Ruyter-Spira C, Novák O,
Strnad M, Lovisolo C, Schubert A, Cardinale F. 2016. Low levels of
strigolactones in roots as a component of the systemic signal of drought
stress in tomato. New Phytologist 212, 954–963.
Vogel JT, Walter MH, Giavalisco P, et al. 2010. SlCCD7 controls strigo-
lactone biosynthesis, shoot branching and mycorrhiza-induced apocarot-
enoid formation in tomato. The Plant Journal 61, 300–311.
 SPL13 mediates strigolactone suppression of shoot branching | 5735
Waldie T, Leyser O. 2018. Cytokinin targets auxin transport to promote
shoot branching. Plant Physiology 177, 803–818.
Wang B, Smith SM, Li J. 2018. Genetic regulation of shoot architecture.
Annual Review of Plant Biology 69, 437–468.
Wang H, Wang H. 2015. The miR156/SPL module, a regulatory hub and
versatile toolbox, gears up crops for enhanced agronomic traits. Molecular
Plant 8, 677–688.
Wang L, Wang B, Jiang L, Liu X, Li X, Lu Z, Meng X, Wang Y, Smith
SM, Li J. 2015. Strigolactone signaling in Arabidopsis regulates shoot de-
velopment by targeting D53-Like SMXL repressor proteins for ubiquitination
and degradation. The Plant Cell 27, 3128–3142.
Wang Y, Li J. 2008. Molecular basis of plant architecture. Annual Review of
Plant Biology 59, 253–279.
Werner T, Schmulling T. 2009. Cytokinin action in plant development.
Current Opinion in Plant Biology 12, 527–538.
Xie Y, Liu Y, Ma M, Zhou Q, Zhao Y, Zhao B, Wang B, Wei H, Wang H.
2020. Arabidopsis FHY3 and FAR1 integrate light and strigolactone signal-
ing to regulate branching. Nature Communications 11, 1955.
Yao R, Ming Z, Yan L, et al. 2016. DWARF14 is a non-canonical hormone
receptor for strigolactone. Nature 536, 469–473.
Young NF, Ferguson BJ, Antoniadi I, Bennett MH, Beveridge
CA, Turnbull CG. 2014. Conditional auxin response and differential
Downloaded from https://academic.oup.com/jxb/article/74/18/5722/7233038 by University of Tokyo Library user on 13 November 2023
cytokinin profiles in shoot branching mutants. Plant Physiology 165,
1723–1736.
Zhou F, Lin Q, Zhu L, et al. 2013. D14-SCFD3-dependent degradation of
D53 regulates strigolactone signalling. Nature 504, 406–410.