Primer designing using

web-based tools for gene cloning

and real-time PCR detection

Utpal Bakshi, Ph.D

Assistant Professor,
Presidency University, Kolkata
1
 The Polymerase Chain Reaction
Advent of PCR

● In the mid-1980s, Kary Mullis and collaborators developed a method for rapidly amplifying a targeted
DNA region into millions of copies.
● The technique involved E. coli polymerase-mediated extension of DNA oligonucleotides (primers)
that were complementary to regions flanking the target.
● This method was named the polymerase chain reaction (PCR).
● Kary Mullis was awarded the 1993 Nobel Prize in Chemistry for inventing this groundbreaking
technique.

Basic Mechanism

● Standard PCR involves 30-40 cycles of the following steps:

● Denaturing a double-stranded target DNA at high temperature.
● Lowering the temperature to facilitate primer binding and polymerase extension of the primers.
● The repeated cycles lead to an exponential increase in the number of copies of the target DNA.

2
 The Polymerase Chain Reaction
● Initially, the early experiments with PCR employed a manual process using water baths and a
polymerase that was unstable at high temperatures.
● The development of thermostable polymerases derived from thermophilic bacteria and
archaea, along with computer-controlled thermocycling machines, marked a significant
advancement.
● This evolution has transformed PCR into a standard laboratory technique widely applied in
various molecular biology procedures.
● PCR is now instrumental in tasks such as measuring gene expression, amplifying targets for
sequencing and cloning, and assaying sequence variation.

3
PCR cycle: denaturation, annealing, extension

1st cycle

94-95oC

72oC

50-56oC

4
 Primer binding and extension

Key Terms:

Ds DNA, forward and reverse primers, target region and product size 5
 Primers for different types of PCR
Quantitative real-time
PCR (qPCR)

DNA +
Primers +
DNA polymerase +
Buffer reagents

Reverse Transcription
PCR (RT-PCR)
cDNA + Specific primers

RNA +
Nonspecific
primers +
Reverse
Transcriptase +
DNA polymerase +
Buffer reagents
6
https://doi.org/10.1042/BIO20200034
 Designing primers for PCR
An important aspect of PCR technique is identifying appropriate primers that:

● Match the target sequence in the correct locations

● Have compatible thermodynamic properties with the template such as denaturation
temperature (Tm)
● Don't have issues with secondary structure, self-complementarity
● Will not amplify unintended products from the DNA sample

The first three items above are addressed by a primer designing software including the
popular and free Primer3. The last item, specificity, requires searching the primers against a
database of background DNA sequences to look for unintended matches. This is a job for
BLAST.

We will use a tool that have the functionality of both the tools - Primer-BLAST
7
What is BLAST?

8
 What is BLAST?
BLAST search field (BLASTn) BLAST Output

9
 What is Primer-BLAST?
Primer-BLAST is a combination of Primer3, a popular primer designing tool, and NCBI-BLAST.

Primer-BLAST has two basic modes. It can:

1. Design primers to specifically amplify a template sequence or a set of related templates
from a background nucleic acid population (BLAST database).
2. Identify potential targets in a background nucleic acid population (BLAST Database).

10
 Accessing Primer-BLAST

There are two ways to access Primer-BLAST

● From the BLAST homepage (https://blast.ncbi.nlm.nih.gov/), follow the link to Primer-BLAST.

● From NCBI data repertoire, in the i) nucleotide sequence records or, ii) from assembly record.

11
https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?
 The Primer-BLAST interface
The Primer-BLAST input form has four main sections:
1. Sequence input (PCR Template and Primer Parameters) 2. Exon / Intron selection 3. Primer Pair Specificity
Checking Parameters (BLAST database selection and options) 4. Advanced Parameters
1. Sequence input

12
The Primer-BLAST interface
2. Why Exon/Intron selection is important?

● Here, using primers binding to

exons 7 and 9 of the human
myeloperoxidase mRNA
(NM_000250) is expected to
yield a 750 bp product.

● In contrast, amplification from

the genomic region, with an
anticipated product exceeding 5
kbp, would not generate
appreciable results under normal
PCR conditions.

13
 The Primer-BLAST interface
2. Exon/Intron selection (contd)
This is where you can set parameters that will generate primers that will be specific for transcript vs genomic DNA templates.

14
 The Primer-BLAST interface
3. Specificity Checking Parameters
● This section is where you set the BLAST database to check for unintended target matches.
● You should pick the database that best represent the background population of DNA molecules in the sample you'll be
using in the PCR experiment, examples: human genomic DNA, human mRNA.

15
 The Primer-BLAST interface
4. Advanced Parameters
No need to use until you have a very
specific question. For example,

a) If you are using a probe-based

qPCR or RT-PCR, this is where you
request an internal hybridization
oligo in addition to your primers.

In primer design, the term "internal

oligo" is used to differentiate these
primers from those that are designed to
bind to the ends (flanking regions) of
the target sequence. Internal oligos are
particularly useful when you want to
amplify a specific region within a larger ● This section also contains the BLAST parameters for the BLAST primer
gene or genomic sequence. specificity search.
● These params produce a low stringency BLAST search so that all
b) You can also request that your
possible matches are considered.
primer binding site not contain a
○ These parameters are similar to the settings triggered when you
known SNP. This only works for 16
use a short sequence in a BLAST search.
human Reference Sequences.
Primer-BLAST Results
● Primer-BLAST provides a graphical
overview that shows where the primers
bind on the template. If you use an NCBI
Reference Sequence the graphic shows
biological features on the template such
as the exon structure shown here.
● The report itself shows a report for each
of the primer pairs, 10 pairs by default,
with the predicted binding location,
product size, and selected
thermodynamic and specificity statistics.
It also shows any potentially unintended
products in the chosen database.

17
 Key Points in Primer-BLAST Results
1. Primer Length: Optimal PCR primer length is
18-22 bp, balancing specificity and ease of
binding to the template.
2. Primer Melting Temperature (Tm): Tm, - the
temperature at which one half of the DNA duplex
will dissociate to become single stranded and
indicating duplex stability, should ideally be
52-58 °C; high Tm may lead to secondary
annealing. GC content provides insight into Tm.
3. Primer Annealing Temperature (Ta): Proper
Ta, derived from Tm, is crucial for effective
primer-template hybridization. Too high Ta
results in low product yield, while too low Ta may
lead to nonspecific products.
4. GC Content: Primer GC content should be
40-60%.
5. GC Clamp: A GC clamp (G or C bases near the 3'
end) enhances specific binding, but more than 3
G's or C's in the last 5 bases should be avoided.
6. Primer Secondary Structures: Avoid
intermolecular or intramolecular primer secondary
structures (e.g., hairpins, self dimers, cross
dimers) that hinder primer-template annealing.
7. Repeats: Avoid di-nucleotide repeats like
ATATATAT, with a maximum acceptable of 4
di-nucleotide repeats.
8. Runs: Minimize long runs of a single base to
prevent mispriming; the accepted maximum
number of runs is 4 bp.
9. Amplicon Length: Experimental goals dictate
amplicon length, e.g., qPCR targets around 100
bp, while standard PCR aims for approximately
500 bp. Product length calculation: (Position of
antisense primer - Position of sense primer) + 1.
18
 Primer Design Example with Primer-BLAST
Question:

The human myeloperoxidase (MPO) gene encodes the myeloperoxidase enzyme,

which plays a crucial role in the immune system, particularly within certain white
blood cells called neutrophils. It contributes to the killing of microorganisms, such as
bacteria and fungi, by generating ROS. You are interested to study the expression of
the gene in various metabolic diseases. You have the prior information that the
mRNA of MPO gene is already sequenced and present in NCBI (NM_000250.2).
Propose the three primer design constructs below to answer the related question to
your hypothesis.

19
 Primer Design Example with Primer-BLAST
a)
As your primary job is to design a primer for MPO mRNA, how do you ensure that your
designed primer will not bind with other human mRNAs. Also, how do you check whether your
designed primer has any internal probe support within the MPO mRNAs?

Input:

https://go.usa.gov/xzRS5

https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?INPUT_SEQUENCE=NM_000250.2&PICK
_HYB_PROBE=on

Output:

[JOB ID: 3dcDpoYNi6WsnxuaFvo_qGzhLppB8jWHQA]

20
 Primer Design Example with Primer-BLAST
b)
Pick the first primer of the output (a) and check whether they would amplify human genomic
DNA.

Input:

https://go.usa.gov/xebFQ

https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?PRIMER_LEFT_INPUT=ATCCCCGGGAC
TTTGTCAAC&PRIMER_RIGHT_INPUT=GGGCCCATAAGTCAACCACA&ORGANISM=Homo%20s
apiens&PRIMER_SPECIFICITY_DATABASE=PRIMERDB/genome_selected_species

Output:

[JOB ID: kZtOXxdeGvY9yADNDa0k_3e2Nc1apS7QWw]

21
 Primer Design Example with Primer-BLAST
c)
How do you identify the genomic mRNA region of the MPO gene?

Input:

https://go.usa.gov/xeben

https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?INPUT_SEQUENCE=NM_000250&ORGA
NISM=Homo%20sapiens&PRIMER_SPECIFICITY_DATABASE=refseq_mrna&SPAN_INTRON=on

Output:

[JOB ID: __UgMXledPZTyG7NY61K_xm2W800pUDQNQ]

22
Primer Design Example with Primer-BLAST

How to design primers for a

single expression unit
containing a deleterious
SNP?

23
 Reading

https://pubmed.ncbi.nlm.nih.gov/22708584/

24
 Notice
● Tomorrow, please visit Bioinfo lab
(#1008) in the following order:
○ BITG: 2.30-2.55 P.M.
○ MLMB: 3.00-3.25 P.M.
○ VRIM: 3.30-3.55 P.M.
● Each of you will receive an individual
problem related to primer design, and
you are required to solve it within a
20-minute time frame.
○ Please bring only the necessary
materials for note-taking.
○ Engaging in unfair practices or
excessive talking in the lab will
have consequences.
● For practical notebook, I expect to see
three broad sections:
○ Objectives (why you are doing this
practical)
○ Procedure (how you have done
these practicals)
○ Observation (What do you find)
● Write in your own words (use passive
voice, past tense).
○ Follow papers to get an idea on
scientific writing.
● The Last date for the practical book
signature is two weeks from the date of
practical, i.e., 12th Jan, 2024 (by 3.30
P.M.). 25