Cesa News 150

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/322008558
On the moths of Mutki district (Bitlis Province, East Turkey) (Lepidoptera)
Article · December 2017
CITATIONS READS
0 295
2 authors:
Muhabbet Kemal Ahmet Ömer Koçak

Yuzuncu Yil University Centre for Entomological Studies Ankara (CESA)
362 PUBLICATIONS 1,311 CITATIONS 385 PUBLICATIONS 1,406 CITATIONS
SEE PROFILE SEE PROFILE
All content following this page was uploaded by Ahmet Ömer Koçak on 22 December 2017.
The user has requested enhancement of the downloaded file.

Centre for
Vxát axãá Entomological
Studies
Ankara established in 1966
Information about the scientific activities of the Cesa Announcements- General News – Expeditions-
Publications –Visitors – Workshops - Seminars -
Free irregular online issues of the Cesa News are regularly archived in the &c
recognized “Internet Archive”, in accordance with the Rules of the ICZN
Nr.150 22 December 2017
The noun “Youthquake”, The Oxford Dictionaries Word of the Year 2017, is defined as
‘a significant cultural, political, or social change arising from the actions or influence of young people’
Announcement
We established a collaboration in order to contribute from a molecular point of view to our
ongoing researches on the fauna, ecology, bionomy, distribution, mapping, taxonomy,
nomenclature, bibliography, and database of the Lepidoptera of the Old World. The responsibilities
will be shared as follows:
Field studies, curating the collected material, morphological preparations, and examinations,
identification, etc. based on the morphology will be carried out by Muhabbet Kemal and Ahmet
Ömer Koçak.
The molecular analyses will be carried out by İsmail Yıldız and Sibel Kızıldağ, by using the
following methods: The full length lepidopteran DNA barcode sequence is a 658 base pair long
segment of the 5’ terminus of the mitochondrial COI gene (cytochrome c oxidase 1). DNA samples
(dried leg) will be prepared according to the accepted standards. The mitochondrial DNA will be
extracted with a RED Extract-N-Amp Tissue PCR Kit (Sigma, St. Louis, MO, USA).
LepF1:ATTCAACCAATCATAAAGATATTGG and LepR1:TAAACTTCTGGATGTCCAAAAAATCA primers
(Fisher and Smith 2008) will be used for the PCR amplification of mt DNA COI gene and sent to
Macrogen (Netherlands) for alignment of sequences. Obtained the sequences will be aligned by
CodonCode Aligner Programs. Other sequences used in the present analyses will be obtained from
the GenBank database by MEGA 7. The mt DNA COI gene sequences were aligned using Clustal W
implemented in MEGA7 with default parameters (Hall 1999). The ends of regions will be trimmed
manually and unambiguously aligned sequences and gaps removed by Gblocks. FASTA formed
sequences will be used for transformed nexus and ML files in ALTER online programs. Maximum-
likelihood bootstrapping analyses will be carried out with 1000 replicates using RAxML with the
setting as described in Stamatakis et al (2008). ML analyses will be conducted online on the
CIPRES Portal v.3.3 (http://www.phylo.org/). A Bayesian inference (BI) analysis will be performed
with MrBayes 3.2.6 (Ronquist ve Huelsenbeck, 2003) using the Markov chain Monte Carlo
algorithm. The program JModeltest v.2.1.7 (Posada 2008) will be selected the most suitable
evolutionary model according to the AIC criterion for Bayesian inference.
The results of this research program will be published preferably in the serials of the Cesa. The
material used will be deposited in Biorepository: Cesa Collection http://grbio.org/cool/eaaz-xyfc
Participants: Dr. Muhabbet Kemal, Dr. İsmail Yıldız, Dr. Sibel Kızıldağ, Dr. Ahmet Ömer Koçak.
Nr. 150 CesaNews 22 December 2017
Centre for Entomological Studies Ankara
Research Article
http://zoobank.org/urn:lsid:zoobank.org:pub:5EDC9E8B-4F7A-4135-B4C6-4D6B7FFF7BF8
On the moths of Mutki district (Bitlis Province, East Turkey)

(Lepidoptera) 1
Muhabbet Kemal 2 Ahmet Ömer Koçak
Abstract: On the moths of Mutki district (Bitlis Province, East Turkey (Lepidoptera). Cesa News 150: 2-46, 93
figs.
In this paper, 333 species of 21 families of Lepidoptera are listed from Mutki district (Bitlis Province, East
Turkey). Faunistically, 38 species are reported here as new to Mutki district. Similarly, 43 species are recorded
here new for the fauna of Bitlis province. A nomenclatural remark is given to Polyocha transversariella
(Zeller,1848). Morphological, faunistical comments or evaluations are mentioned for some species. Field
observations are supported by the images taken in nature. Illustrations of the adults with their genitalia,
tympanal organs, and head are given, if necessary.
Keywords: Lepidoptera, fauna, Mutki, Bitlis, Turkey.
Within the several research programs announced in the past3, the Lepidoptera of Turkey has been
studying by the authors for several decades. The moth fauna of the Süphan Volcano in the district Adilcevaz
of Bitlis Province was recently published by the authors (Kemal & Koçak, 2017a). In that paper, the authors
mentioned 50 species as new to the fauna of Bitlis Province. Few weeks ago, the first author completed and
submitted the final report of a Project, supported by Van Yüzüncü Yıl University on the Süphan diurnal
Lepidoptera (Bitlis Province) (Kemal, 2017). The present study is currently supported by Van Yüzüncü Yıl
University as a project, and important faunistical results are obtained from this year’s excursions to the
vicinities of Aydemir and Çaygeçit villages in the district Mutki (Bitlis Province). As a result of this, more
than 125 moth species were collected and evaluated here.
The first results on the moth fauna of Mutki are listed below, together with the previously known
species. Thus, the total species number of the Lepidoptera of Mutki recorded from the district rose to 437
(104 species butterflies (Kemal & Akın,2012), and 333 species moths of 21 families). Among them, 38 species
are reported here as new to Mutki only, while 43 species new to the fauna of Bitlis Province. As a result of
this, the species number of the Lepidoptera fauna of Bitlis Province rose to 1059 (202 butterflies, 857 moths)
(cf. Kemal & Koçak, 2007).
During the Van earthquake in 2011 (Anonym, 2011), some material collected by K. Akın from Mutki
were destroyed during their faunistical evaluations. Therefore, the species declared in the following list with
the sequence numbers 7, 8, 20, 23, 24, 26, 28, 33, 35, 37, 40, 43, 62, 103 just remain as recorded from Mutki.
The images are given here under the following subheadings; observational images from the nature
(Figs. 1-42), and the images of the specimens in the collection and their genitalia, etc. (Figs. 43-93).
Briefly, pictorial observations of 42 species from Mutki are mentioned here for the first time. Male genitalia
of 19 species, female genitalia of 3 species, tympanal organs of 4 species, and 3 head images of 2 species are
prepared and illustrated here for the first time.
The present material examined are partly preserved in the collections of the CESA4 and YYUIRC5.
1 This paper is a part of the Project, submitted by AVAM (Anatolian and Eurasian Research and Application Center), numbered 2015-
MRK-B345, entitled “Bitlis’in Mutki ilçesindeki tarihsel ve doğal çevre üzerine araştırmalar”, supported by Van Yüzüncü Yıl University,
Bilimsel Araştırma Projeleri Başkanlığı, Van, Turkey. This project has two main aspects. Namely, the natural environment (here the
Lepidoptera fauna), and the historical structures of Mutki.
2 Asst. Prof. Dr. Muhabbet Kemal, Van Yüzüncü Yıl University, Faculty of Science, Dept. of Biology, Campus, Van / Turkey.
e-mail: muhabbet_kemal@yahoo.com.tr - co-author: Prof. em. Dr. Ahmet Ömer Koçak, c/o Van Yüzüncü Yıl University, Faculty of
Science, Dept. of Biology, Campus, Van / Turkey. e-mail: cesa_tr@yahoo.com.tr
3 Latest announcement on 22 August 2009: http://www.cesa-tr.org/Cesaprojects.htm Separately, several programs were also
announced in the ResearchGate site: Diversity of the Lepidoptera in the World (DLW) Bibliography of the Lepidoptera (BL)
Entomofauna of Turkey (ET) Researches on the animal- plant interaction Foodplants of the Lepidoptera (FL) Entomofauna of the World
(EW) Tympanal morphology of the family Geometridae (Lepidoptera) (TMG) Tympanal Morphology of the Pyralidae (Lepidoptera)
(TMP) Mapping of the Lepidoptera of Old World (MLO) Lepidoptera of Turkey (LTR) Lepidoptera fauna of Zap Valley (Hakkari
Province, SE Turkey) (LZV) Lepidoptera fauna of Erek Mountain (Van Province, East Turkey) (LEM)
4 http://grbio.org/cool/eaaz-xyfc
5 http://grbio.org/cool/390t-itxm
2
List of the species
Alucitidae
1.Alucita aff. cancellata (Meyrick,1908) (Fig. 43)

Material examined: 1♀, GP2808♀. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M.
Kemal & A.Koçak leg. (Cesa).
Pyramid-shaped signum on bursa copulatrix may be a diagnostic character for Alucita cancellata,
which was described by Meyrick (1908), based on two specimens from “Alma Dagh”, in Hatay
Province, currently known as Amanos Mountains. We used the female genitalia illustrated by
Scholz & Jackh (1994) for the identification. More materials, especially males are needed for the
precise identification of the species.
First record for the fauna of Bitlis Province.
Arctiidae
2.Arctia(Epicallia) villica (Linnaeus,1758)

Kemal & Koçak, 2016a.
3.Eilema (Manulea) palliatella (Scopoli,1763) (Figs. 44, 46)

Material examined: 2♂ (GP2798). Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M.
4.Eilema (Manulea) pseudocomplana (Daniel,1939) (Fig.1)

Material examined: 1♀. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M. Kemal &
A.Koçak leg. (Cesa).
The female specimen looks like to complana very much, but easily distinguishable by the absence
of the dark band on costal margin of the underside of hindwing (Daniel,1939: 48).
5.Eilema (Muscula) brevifurca (Wiltshire,1957) (Figs. 45, 47)

Material examined: 2♂. Bitlis Pr., Mutki, Çaygeçit 1290m, nocturnal, on 26 7 2017, M. Kemal &
The lithosiids mentioned above were classified by Dubatolov & Zolotuhin (2011). We follow this
arrangement partly. The name Muscula was established by Koçak (1991) as a section of the genus
Eilema Hbn. Dubatolov & Zolotuhin considered it as a valid genus for the species muscula Stgr.
and brevifurca Wiltsh. The male genitalia of the specimen from Çaygeçit (Mutki) with considerably
shorter furca as brevifurca, described from northern Iraq (Shaqlawa), and depicted by Wiltshire
(1957). The species muscula Stgr. is widely distributed in the southern parts of Turkey.
6.Euplagia splendidior (Tams,1922) (Fig. 2)

This species was also found by day from Süphan Mt (Kızdağı at 2580m) in the Adilcevaz district
(Kemal, 2017). First record for the fauna of Mutki district.
7.Phragmatobia placida (Frivaldsky,1835)

8.Utetheisa(s.str.) pulchella (Linnaeus,1758)

Kemal & Koçak,2014.
3
Choreutidae
9.Choreutis muhabbet Koçak,2008

Kemal & Akın, 2011 [early stages]; Kemal & Koçak, 2016a.
Coleophoridae
Several nocturnal specimens of more than three species were collected by the authors during their
last trips to the district. They belong to the genus Coleophora Hbn. Their specific identities will be
separately studied.
10.Coleophora sp. (Fig.3)
Cosmopterygidae
11.Eteobalea dohrnii (Zeller,1847) (Fig.4)

Material examined: 2♂♀. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M. Kemal &
Drepanidae
12.Cilix asiatica A.Bang-Haas,1907

Material examined: 1♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M. Kemal &
13.Watsonalla binaria (Hufnagel,1767) (Fig.5)

Material examined: 2♂1♀. Bitlis Pr., Mutki, Çaygeçit 1290m, on 26 7 2017, M. Kemal & A.Koçak
leg. (Cesa).
First record for the fauna of Mutki district.
Ethmiidae
14.Ethmia similis Sattler,1967

Material examined: 13♂♀. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017; 19♂♀ from
Çaygeçit 1290m, on 26 7 2017, M. Kemal & A.Koçak leg. (Cesa, Yyuirc).
Gelechiidae
15.Aristotelia aff. subdecurtella (Stainton,1859)-complex

Material examined: 1♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017; 7♂♀ from
Çaygeçit 1290m, on 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
Only the specific affinity of the collected material are temporarily mentioned here. Therefore, the
species isnot evaluated here faunistically.
16.Aroga aristotelis (Millière,[1876]) (Figs.48, 49)

Material examined: 3♂ (GP2802♂, GP2803♂). Bitlis Pr., Mutki, Çaygeçit 1290m, nocturnal, on 26
7 2017, M. Kemal & A.Koçak leg. (Cesa).
For the identity of this species cf. Huemer & Karsholt (1999).
4
17.Metzneria sp.
Material examined: 2 ex. Bitlis Pr., Mutki, Çaygeçit 1290m, on 26 7 2017, M. Kemal & A.Koçak leg.
(Cesa).
18.Syncopacma polychromella (Rebel,1902)

Material examined: 2 ex. Bitlis Pr., Mutki, Çaygeçit 1290m, nocturnal, on 26 7 2017, M. Kemal &
This species was recently discovered by the first author from Adilcevaz (Süphan) (Kemal,2017). It
is here reported as new for the fauna of Mutki district.
Geometridae
19.Aplasta ononaria (Fuessly,1783)

Material examined: 1♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017; 1♂ from
Çaygeçit 1290m, nocturnal, on 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
20.Apochima diaphanaria (Püngeler,1904)
21.Camptogramma bilineatum (Linnaeus,1758) (Fig.6)

Kemal & Koçak, 2014, 2016a.
Observed around Aydemir.
22.Cataclysme riguata (Hübner,[1813]) (Figs.7, 50, 51)

Stadie et al. (2014), proposed subtilisparsata Whli. as a distinct species from riguata Hbn. Wehrli
(1932) proposed subtilisparsata as a geographic variation of riguata Hbn. But this name is
currently used as valid of a distinct species. However, it is still not easy to distinguish these two
species, by using the external features, and also the genitalic structures. In the male genitalia, only
the shape of pseudojuxta – round in riguata, elongate sub-rectangular in subtilisparsata – has
been pointed out by Stadie et al. (2014).
In the male genitalia, illustrated here, has a round-shaped pseudojuxta; therefore, it is considered
riguata Hbn., as in the case of Bahçesaray (Paşaköy) specimen (GP2475♂) (Kemal & Koçak,
2016b). As to their distributions in south-eastern Turkey, riguata Hbn. occurs in southern
mountainous area of Van Lake Basin (Mutki, Bahçesaray), but subtilisparsata Whli., inhabits in
the more southern region (Maraş, Şirvan, Uludere, Hakkari, Güzeldere Pass).
First record for the fauna of Bitlis province.
23.Catarhoe cuculata (Hufnagel,1767)
24.Catarhoe permixtaria (Guenée,[1858])

25.Cyclophora punctaria (Linnaeus,1758) (Figs.52-54)

Material examined: 1♂ (GP2788). Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017; 1♀
from Çaygeçit 1290m, on 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
The specimens belong to the second generation of ssp. fritzae, described by Hausmann from
Caucasus. It is characterized especially strongly curved fibula of the male genitalia (Hausmann,
2004: 423).
26.Docirava mundulata (Guenée,[1858])

Koçak & Kemal,2015a.
5
27.Eilicrinia cordiaria (Hübner,1790) (Fig.8)

Material examined: 3♂♀. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, 5♂♀. From Çaygeçit 1290m,
26 7 2017, all M. Kemal & A.Koçak leg. (Cesa).
28.Ematurga atomaria (Linnaeus,1758)

Kemal &Koçak,2015a.
29.Ennomos (Deuteronomos) fraxineti Wiltshire,1947 (Fig.9)

30.Eupithecia sp.1
The species observed around Aydemir. Nocturnal. It is somewhat similar to silenicolata-venosata
species group. However, genitalic comparison is necessary for its precise identification.
31.Eupithecia sp.2
The species observed around Aydemir. Nocturnal. It is somewhat similar to Eupithecia gemellata
H.-S., in the graphata-group, currently known from Bursa and Maraş in Turkey. However,
genitalic comparison is necessary for its precise identification.
32.Gnopharmia colchidaria (Lederer,1870) (Figs. 55-58)

The species is widely distributed in Iran, Azerbaidjan, and Turkey. Rajaei (2010), described its
early stages, larval food-plants from Iran, together with some taxonomical information.
Material examined: 3♂♀, GP2794♂. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, nocturnal, M.
33.Hypomecis punctinalis (Scopoli,1763)
34.Idaeasp.
Observed around Aydemir on 25 7 2017. Nocturnal.
35.Idaeatrigeminata (Haworth,[1809])
36.Neognopharmia stevenaria (Boisduval,1840)

Material examined: 1♀. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M. Kemal &
37.Proteuchloris neriaria (Herrich-Schäffer,[1852])
38.Rhodostrophia cuprinaria (Christoph,1876) (Fig.10)

This species was also found by the authors from Süphan Mt (Kızdağı, around 2500m) in the
Adilcevaz district (unpublished information). Therefore, both records are new for the fauna of
Bitlis Province.
39.Scopula decorata ([Denis & Schiffermüller],1775) (Fig.11)

40.Scopula immistaria (Herrich-Schäffer,[1852])
6
41.Scopula submutata (Treitschke,1828)

Observed around Aydemir on 25 7 2017.
42.Scopula ornata (Scopoli,1763)

Material examined: 1♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017; 2♂ from
Çaygeçit 1290m, on 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
43.Siona lineata (Scopoli,1763)

This species was known from various localities in Van Lake Basin (Koruklu, Nemrut (Tatvan),
Mutki; Gevaş and Bahçesaray (Van Pr.)) (Kemal & Koçak, 2016b).
44.Stegania dilectaria (Hübner,1790)

45.Thetidia persica Hausmann,1996 (Figs.59, 60)

Material examined: 1♂, GP2801♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M.
If the structural differences of the male genitalia between the populations of Iran and the Anatolia,
mentioned by Hausmann (1996) are taken into consideration, the specimen from Mutki is similar
to iranian persica Hausm. However, different appearances emerged especially between the shape
of valva of the specimen from Mutki and Hausmann’s draft drawing of persica, due to the
longitudinal foldings.
Lasiocampidae
46.Chondrostega sp.
Kemal et al, 2010: fig. 42 [young caterpillar from Mutki, Dereyolu]
47.Lasiocampa eversmanni (Kindermann,1843)

Kemal et al, 2010: fig. 43 [young caterpillar from Mutki, Dereyolu]; Kemal & Koçak, 2014, 2016a.
48.Lasiocampa grandis (Rogenhofer,1891) (Fig.12)

49.Malacosoma castrensis (Linnaeus,1758)

50.Malacosoma neustrium (Linnaeus,1758)

Kemal et al, 2010: figs. 40-41 [young caterpillars]
51.Pachypasa otus (Drury,[1773]) (Fig.13)

7
Lecithoceridae
52.Eurodachtha nigralba Gozmany,1978

Material examined: 12♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, 1♂ from
Çaygeçit 1290m, 26 7 2017, M. Kemal & A.Koçak leg. (Cesa, Yyuirc).
53.Odites (Gozmaniola) kollarella (Costa,[1836])

Çaygeçit 1290m, 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
Lymantriidae
54.Euproctis chrysorrhoea (Linnaeus,1758)

Kemal et al, 2010: fig.39 [caterpillar]; Kemal &Koçak,2015a.
55.Euproctis melania (Staudinger,1892)

Akın & Kayci, 2014 [Alatoprak]; Kemal & Koçak, 2016a.
56.Lymantria dispar (Linnaeus,1758) (Fig.14)

57.Parocneria detrita (Esper,[1785])

Material examined: 1♂ [defected]. Bitlis Pr., Mutki, Çaygeçit 1290m, nocturnal, on 26 7 2017, M.
Noctuidae
58.Agrotis ipsilon (Hufnagel,1766)

59.Agrotis segetum ([Denis & Schiffermüller],1775)

60.Amphipyra micans Lederer,1857

61.Apamea sp.
Material examined: 1♂1♀. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, M. Kemal &
62.Athetmia ambusta (Fabricius,1787)

(=#ambusta [Denis & Schiffermüller],1775; proposed without description, therefore unavailable)
8
63.Autophila sp. (Fig.61)

Material examined: 1♀. Bitlis Pr., Mutki, Çaygeçit 1290m, nocturnal, on 26 7 2017, GP2790♀, M.
Externally somewhat similar to Autophila anaphanes Brsn.; however, for the precise identification,
more material, especially males are needed.
64.Catocala (s.str.) lupina Herrich-Schäffer,[1851]

65.Chersotis (s.str.) fimbriola (Esper,[1798])

66.Clytie(s.str.) terrulenta (Christoph,1893)

Koçak & Akın, 2011 [cited as haifae].
67.Cosmia trapezina (Linnaeus,1758) (Fig.15)

68.Cryphia (Bryophila) occidentalis (Osthelder,1933) (Fig.16)

69.Cryphia sp.1 (Fig.17)
70.Cryphia sp.2 (Fig.18)

Both species were observed around Çaygeçit. For their identification, genitalic comparison is
necessary.
71.Dichagyris (Yigoga) nigrescens (Hofner,1888)

72.Dichagyris (s.str.) melanura (Kollar,1846)

73.Drasteria cailino (Lefèbvre,1827)

Material examined: 5♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, 1♂1♀ from
74.Dysgonia algira (Linnaeus,1767)

Material examined: 2♂. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, M. Kemal & A.Koçak leg.
(Cesa).
9
75.Eremobia asiatica Draudt,1936

76.Earias clorana (Linnaeus,1761) (Fig.62)

Material examined: 4♂, GP2789♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, 6♂
from Çaygeçit 1290m, 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
77.Eublemma (albida-gr.) gratissimum (Staudinger,1892)

78.Eublemma (candidana-gr.) minutatum (Fabricius,1794)

79.Eublemma (pallidula-gr.) pallidulum (Herrich-Schäffer,[1856]) (Fig.19)

80.Eublemma (rosina-gr.) panonicum (Freyer,1840) (Fig.20)

81.Hadena (s.str.) compta ([Denis & Schiffermüller],1775)

82.Hecatera bicolorata (Hufnagel,1766)

Material examined: 2♂. Bitlis Pr., Mutki, Çaygeçit 1290m, nocturnal, 26 7 2017; 1♂. Bitlis Pr.,
Tatvan, Tosunlu 1.8km NW 1790m (13Gi), nocturnal, 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
83.Hoplodrina blanda ([Denis & Schiffermüller],1775) (Figs. 63, 64)

This species may easily be confused with octogenaria Gz., but it is usually distinguished by the
shape of juxta, and number of the first group of cornuti in the basal diverticulum on the vesica of
the male genitalia. The male, collected from Mutki is dissected and the last abdominal segment
also illustrated here. The number of cornuti group is between 15-20, therefore the specimen is
attributed to the species Hoplodrina blanda Den.- Schiff. (according to various authors).
84.Hypena munitalis Mann,1861 (Fig.21)

Material examined: 6♂♀. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, on 25 7 2017, 3♂♀ from
Çaygeçit 1290m, 26 7 2017, M. Kemal & A.Koçak leg. (Cesa, Yyuirc).
85.Hypena obsitalis (Hübner,[1813])

10
86.Idia calvaria ([Denis & Schiffermüller],1775) (Fig.22)

(Cesa).
87.Lygephila (s.str.) amasina (Staudinger,1879)

88.Lygephila (s.str.) craccae (Fabricius,1787)

(Cesa).
89.Mormo maura (Linnaeus,1758)

Eaten badly by a predator, and a single forewing remained. Found around Aydemir on 25 7 2017.
90.Nycteola siculana (Fuchs,1899)

Material examined: 1♀. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017 M. Kemal & A.Koçak leg.
(Cesa).
This species is new to the fauna of Bitlis province.
91.Orthosia rubricosa (Esper,[1786])

Akın, 2011.
92.Recophora beata (Staudinger,1892)

Material examined: 1♀. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, M. Kemal & A.Koçak leg.
(Cesa).
93.Shargacucullia (Verbascullia) verbasci (Linnaeus,1758)

Kemal et al, 2010: fig. 44 [young caterpillar from Mutki, Çaygeçit]; Kemal &Koçak,2015a.
94.Sideridis (Aneda) rivularis (Fabricius,1775)

Material examined: 2♀. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, 3♂ from Çaygeçit 1290m, 26 7
2017, all M. Kemal & A.Koçak leg. (Cesa).
95.Trichoplusia ni (Hübner,[1803])
(Cesa).
96.Victrix (Rasihia) tabora (Staudinger,1892) (Figs.23, 65)

For the identity of this species, cf. Varga,Z. & L.Ronkay (1991).
97.Xanthia icteritia (Hufnagel,1766)

Kemal et al, 2010: figs. 50-54
11
98.Xestia c-nigrum (Linnaeus,1758)

(Cesa).
99.Xylena exsoleta (Linnaeus,1758)

Kemal et al, 2010: figs. 56-57
100.Zekelita antiqualis (Hübner,[1809])

(Cesa). First record for the fauna of Bitlis province.
Notodontidae
101.Clostera curtula (Linnaeus,1758)

(Cesa). First record for the fauna of Mutki district.
102.Harpyia milhauseri (Fabricius,1775)

(Cesa).
103.Neoharpyia pulcherrima (Brandt,1938)

Koçak & Kemal,2015.
104.Phalera bucephaloides (Ochsenheimer,1810)

Koçak & Kemal,2015.
105.Pheosia tremula (Linnaeus,1761) (Fig.24)

(Cesa).
106.Pterostoma palpinum (Linnaeus,1761)

Kemal & Koçak, 2014, 2016; Koçak & Kemal,2015a.
(Cesa).
107.Spataliaargentina ([Denis & Schiffermüller],1775)

Oecophoridae
Oecophorinae
108.Epicallima icterinella (Mann,1867)

Material examined: 2ex. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, M. Kemal & A.Koçak leg.
(Cesa).
Depressariinae
109.Agonopterix cnicella (Treitschke,1832) (Figs.25, 66-70)

Material examined: 2♀ (GP2785♀, GP2787♀) (det. Buchner), 1♂ (GP2797♂). Bitlis Pr., Mutki,
Aydemir 1710m, nocturnal, on 25 7 2017, M. Kemal & A.Koçak leg. (Cesa).
12
First record for the fauna of Bitlis province. Recently reported also from Adana, Elazığ, Erzincan,
Malatya (Buchner,2017).
110.Depressaria zelleri Staudinger,1879 (Figs. 26, 71-74)

Material examined: 1♂ (GP2786♂) (det. Buchner). Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, M.
This species was described by Staudinger (1879) from Amasya, later recorded also from
Kahramanmaraş (Caradja, 1920).
Pleurotinae
111.Pleurota (s.str.) eximia Lederer,1861 (Fig.27)

112.Pleurota sp.1 (Fig.28)
113.Pleurota sp.2
Pterophoridae
114.Cnaemidophorus rhododactylus (Fabricius,1787)

(=#rhododactylus [Denis & Schiffermüller],1775; proposed without description, therefore unavailable)
115.Procapperia linariae (Chrétien,1922) (Figs.29, 75, 76)

Material examined: 18♂ (GP2799♂). Bitlis Pr., Mutki, Aydemir 1710m, on 25 7 2017; 7♂. Çaygeçit
1290m, 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
Crepuscular-Nocturnal. First record for the fauna of Bitlis Province.
116.Stenoptilia sp. (Fig.30)

Observed around Çaygeçit. Nocturnal.
Pyralidae
117.Acritonia comeella Amsel,1954 (Figs.30, 77, 78)

Akın, 2014 [Çaygeçit; male genitalia]
Material examined: 1♂, GP2812♂. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, M. Kemal & A.Koçak
leg. (Cesa).
This species was first reported from Turkey by Akın, based upon a single male (2014). Later, the
authors recorded it from Şırnak Pr. (Beytüşşebap, Dule) (Kemal & Koçak, 2015b), and from Süphan
Mt. (Bitlis Pr.) (Kemal & Koçak, 2017a). In Mutki, around Aydemir, a single nocturnal male of this
species was found by the authors. It is apparently rare in the district.
118.Acrobasis consociella (Hübner,[1813])

Akın, 2014 [Mutki, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Gümüşkanat, Çatalsöğüt, Yeniköy; male
genitalia]
13
119.Acrobasis dulcella (Zeller,1848)

Akın, 2014 [Alatoprak, Gümüşkanat; male genitalia]
120.Acrobasis glaucella Staudinger,1859 / fallouella Ragonot,1871

Akın, 2014 [Tolgalı; male genitalia]
The validity of fallouella Rag is currently under discussion.
121.Acrobasis legatea (Haworth,[1811])

Akın, 2014 [Mutki, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Gümüşkanat, Çatalsöğüt, Yeniköy; male
genitalia]
122.Acrobasis obliqua (Zeller,1847)

Akın, 2014 [Alatoprak, Tolgalı, Gümüşkanat; male genitalia]
123.Acrobasis ottomana Caradja,1916

Akın, 2014 [Kavakbaşı-Koyunlu; male genitalia]
124.Acrobasis tumidana ([Denis & Schiffermüller],1775)

Akın, 2014 [Mutki, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Gümüşkanat, Çatalsöğüt, Dağarcık;
male genitalia]
125.Agriphila bleszynskiella Amsel,1961

Akın, 2014 [Çaygeçit, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı; male genitalia]
126.Agriphila tolli (Bleszynski,1952)

Akın, 2014 [Çaygeçit, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Üstyayla, Gümüşkanat; male
genitalia]
127.Agriphila tristella ([Denis & Schiffermüller],1775)

Akın, 2014 [Mutki, Geyikpınar, Boğazönü; male genitalia]
128.Anania verbascata (Fabricius,1787)

129.Anarpiaincertalis (Duponchel,1832)
Akın, 2014 [Mutki, Geyikpınar, Alatoprak, Boğazönü, Çatalsöğüt, Tolgalı, Gümüşkanat,
Gümüşkanat şelalesi; male genitalia]
130.Ancylodes pallens Ragonot,1887

Akın, 2014 [Alatoprak; female genitalia]
131.Ancylolomia tentaculella (Hübner,1796)

132.Ancylosis cinnamomella (Duponchel,1836)

Akın, 2014 [Alatoprak, Tolgalı, Yeniköy; male genitalia]
133.Ancylosis convexella (Lederer,1855)

Akın, 2014 [Alatoprak, Kavakbaşı-Koyunlu; male genitalia]
134.Ancylosis dumetella (Ragonot,1887)

Akın, 2014 [Mutki, Alatoprak, Tolgalı, Kaşak, İkizler, Çiğdemalan; male genitalia]
135.Ancylosis hellenica (Staudinger,1870)

Akın, 2014 [Alatoprak; male genitalia]
14
136.Ancylosis morbosella Staudinger,1879

Akın, 2014 [Çatalsöğüt; female genitalia]
137.Ancylosis oblitella (Zeller,1848)

Akın, 2014 [Boğazönü; female genitalia]
138.Anthophilopsis moeschleri (Christoph,1862)

139.Antigastra catalaunalis (Duponchel,1833)

Akın, 2014 [Tolgalı; female genitalia]
140.Aporodes floralis (Hübner,[1809])

Akın, 2014 [Alatoprak, Tolgalı; female genitalia]
141.Arsissa divaricella (Ragonot,1887)

Akın, 2014 [Alatoprak, Tolgalı, Yeniköy; male genitalia]
The identity of this species is doubtful, as the description and drawn genitalia of Arsissa divaricella
by Roesler are inadequate.
142.Arsissa ramosella (Herrich-Schäffer,[1855]) (Fig.31)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Yeniköy, Kaşak, Çatalsöğüt,
Dağarcık, Gümüşkanat; male genitalia]
Material examined: 8♂♀. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, M. Kemal & A.Koçak leg.
(Cesa, Yyuirc).
143.Asalebria(Exophora) exasperata (Staudinger,1879)

Akın, 2014 [Kavakbaşı-Koyunlu, Yeniköy, Kaşak, Çatalsöğüt, Gümüşkanat, Geyikpınar,
Yumrumeşe-Ocaklı; male genitalia]
144.Asalebria (s.str.) geminella (Eversmann,1844)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Gümüşkanat, Tolgalı; male genitalia]
145.Asalebria (s.str.) pseudoflorella (Schmidt,1934)

146.Bostra obsoletalis (Mann,1864)

147.Bradyrrhoa (s.str.) gilveolella (Treitschke,1833) (Fig.32)

Akın, 2014 [Mutki, Çaygeçit, Yeniköy, Tolgalı, Kaşak, Gümüşkanat, Yumrumeşe-Ocaklı; male
genitalia]
Material examined: 2♂♀. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, 5♂3♀ from Çaygeçit 1290m,
26 7 2017, all M. Kemal & A.Koçak leg. (Cesa).
148.Cadra calidella (Guenée,1845)

149.Cadra figulilella (Gregson,1871)

Akın, 2014 [Mutki, Alatoprak, Çiğdemalan, Geyikpınar, Tolgalı, Gümüşkanat; male genitalia]
150.Cadra furcatella (Herrich-Schäffer,[1849]) (Figs. 79-82)

Akın, 2014 [Mutki, Yeniköy, Kaşak; male genitalia]
Material examined: 1♂, GP2811♂. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, M. Kemal & A.Koçak
leg. (Cesa).
This species is easily distinguishable by its male genitalia. It is also recorded by the authors from
Van Pr. (Bahçesaray Krapet Pass, GP2490♂, and Saklıvadi, GP2613♂) [unpublished information].
15
151.Catoptria falsella ([Denis & Schiffermüller],1775)

Akın, 2014 [Mutki, Boğazönü; female genitalia]
152.Catoptria mytilella (Hübner,[1805])

Akın, 2014 [Mutki, Kavakbaşı-Koyunlu, Geyikpınar, Çaygeçit, Alatoprak, Tolgalı, Gümüşkanat;
male genitalia]
153.Catoptria pinella (Linnaeus,1758)

Akın, 2014 [Mutki, Çaygeçit, Kavakbaşı-Koyunlu, Tolgalı, Yeniköy; male genitalia]
154.Chrysocrambus linetellus (Fabricius,1781)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Yumrumeşe-Ocaklı, Gümüşkanat, Kavakbaşı-Koyunlu,
Tolgalı, Yeniköy, Dağarcık, Kaşak, İkizler, Geyikpınar; male genitalia]
155.Coenochroa ablutella (Zeller,1839)

Akın, 2014 [Çiğdemalan, Yeniköy; male genitalia]
156.Crambus scoticus Westwood,1845

Akın, 2014 [Mutkialı, Geyikpınar; male genitalia]
157.Cynaeda (Noctuelia) superba (Freyer,[1844])

Akın, 2014 [Gümüşkanat; male genitalia]
158.Cynaeda (s.str.) gigantea (Staudinger,1879)

Akın, 2014 [Mutki, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Kaşak, Geyikpınar; male genitalia]
(Cesa).
159.Denticera divisella (Duponchel,1842)

Akın, 2014 [Alatoprak, Çiğdemalan, Gümüşkanat; male genitalia]
160.Dolicharthria bruguieralis (Duponchel,1833)

161.Dolicharthria intervacatalis (Christoph,1877)

Akın, 2013; Akın, 2014 [Tolgalı, Alatoprak, Gümüşkanat; male genitalia]
162.Ecbatania holopyrrhella (Ragonot,1888)

163.Ecpyrrhorrhoe diffusalis (Guenée,1854)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Çatalsöğüt, Çiğdemalan, Tolgalı, Gümüşkanat, Kaşak; male
genitalia]
164.Elegia fallax (Staudinger,1881) (Fig.33)

Akın, 2014 [Alatoprak, Çaygeçit, Çatalsöğüt, Tolgalı, Gümüşkanat; male genitalia]
Material examined: 2♂. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, M. Kemal & A.Koçak leg.
(Cesa).
165.Ematheudes punctellus (Treitschke,1833)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Yumrumeşe-Ocaklı, Kavakbaşı-Koyunlu, Çatalsöğüt,
Tolgalı, Gümüşkanat, Geyikpınar, Çitliyol, Kaşak, Çiğdemalan, Yeniköy, İkizler; male genitalia]
166.Endotricha flammealis ([Denis & Schiffermüller],1775) (Fig.34)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Çatalsöğüt, Yumrumeşe-Ocaklı, Tolgalı, Gümüşkanat,
Boğazönü, Kavakbaşı-Koyunlu; male genitalia]
16
Material examined: 2♂. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, 1♂ from Çaygeçit 1290m, 26 7
2017, M. Kemal & A.Koçak leg. (Cesa).
167.Epactoctena octogenalis (Lederer,1863) (Fig.35)

Akın, 2014 [Mutki, Alatoprak, Çatalsöğüt, Tolgalı, Gümüşkanat; male genitalia]
(Cesa).
168.Epascestria pustulalis (Hübner,[1823])

169.Ephelis cruentalis (Geyer,[1832])

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Yumrumeşe-Ocaklı, Gümüşkanat, Kavakbaşı-Koyunlu,
Tolgalı, Yeniköy, Geyikpınar; male genitalia]
170.Ephestia (Anagasta) welseriella (Zeller,1848)

171.Ephestia (s.str.) mistralella (Millière,1874)

Akın, 2014 [Mutki, Alatoprak, Gümüşkanat; male genitalia]
The genus Ephestia is represented by 5-6 species in Turkey (Roesler,1973). The male specimen
collected from Çaygeçit (GP2800♂) looks like more to mistralella externally, but there are serious
differences in the male genitalia. Therefore, it couldnot be identified at the specific level. Akın
(2014) proposed this species as new for the fauna of Turkey. However, more material is needed for
the clarifying of its status in the region (Figs.83-85)
172.Ephestia (s.str.) unicolorella Staudinger,1881

Akın, 2014 [Gümüşkanat; female genitalia]
173.Epiepischnia pseudolydella Amsel,1954

Akın, 2014 [Koyunlu, Tolgalı, Gümüşkanat, Yeniköy; male genitalia]
Material examined: 1♂. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017 M. Kemal & A.Koçak leg.
(Cesa).
174.Epischnia albunculella (Staudinger,1879)

175.Epischnia christophori Ragonot,1887

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Çatalsöğüt, Tolgalı, Gümüşkanat, Geyikpınar, Kaşak,
Koyunlu, Kavakbaşı-Koyunlu, Dağarcık, Yeniköy; male genitalia]
176.Epischnia prodromella (Hübner,[1799])

Akın, 2014 [Alatoprak, Çaygeçit, Tolgalı, Gümüşkanat; male genitalia]
Material examined: 1♂. Bitlis Pr., Çaygeçit 1290m, 26 7 2017, M. Kemal & A.Koçak leg. (Cesa).
177.Episcythrastis tabidella (Mann,1864)

Akın, 2014 [Çatalsöğüt, Kavakbaşı-Koyunlu; female genitalia]
178.Etiellazinckenella (Treitschke,1832)
Akın, 2014 [Tolgalı, Kavakbaşı-Koyunlu; male genitalia]
179.Euchromius bellus (Hübner,1796)

Akın, 2014 [Tolgalı, Geyikpınar; female genitalia]
17
180.Euchromius ocelleus (Haworth,[1811])

Akın, 2014 [Çaygeçit, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Çiğdemalan; male genitalia]
181.Euchromius pulverosus (Christoph,1887) (Fig.36)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Gümüşkanat, Kavakbaşı-Koyunlu, Tolgalı, Boğazönü,
Geyikpınar; male genitalia]
182.Euchromius superbellus (Zeller,1849)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Gümüşkanat, Kavakbaşı-Koyunlu, Tolgalı; male genitalia]
183.Eudonia mercurella (Linnaeus,1758)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Gümüşkanat, Çatalsöğüt, Boğazönü, Tolgalı, Kavakbaşı-
Koyunlu; male genitalia]
184.Eurhodope (s.str.) monogrammos (Zeller,1867)

Akın, 2014 [Tolgalı, Yeniköy; male genitalia]
185.Euzophera (s.str.) bigella (Zeller,1848)

Akın, 2014 [Gümüşkanat, Çatalsöğüt, Tolgalı; male genitalia]
186.Euzophera (s.str.) cinerosella (Zeller,1839)

Akın, 2014 [Gümüşkanat, Tolgalı; male genitalia]
187.Euzophera (s.str.) flagella (Lederer,1869)

188.Euzophera (s.str.) imperfectella Ragonot,1895

Akın, 2014 [Gümüşkanat, Çiğdemalan, Tolgalı, Kavakbaşı-Koyunlu, Yeniköy; male genitalia]
189.Euzophera (s.str.) pinguis (Haworth,[1811])

Akın, 2014 [Gümüşkanat, Alatoprak; male genitalia]
190.Euzopherodes charlottae (Rebel,1914)

Akın, 2014 [Çatalsöğüt; female genitalia]
191.Euzopherodes lutisignella (Mann,1869)

Akın, 2014 [Çatalsöğüt, Alatoprak; male genitalia]
192.Evergestis aenealis ([Denis & Schiffermüller],1775)

Akın, 2014 [Gümüşkanat, Kavakbaşı-Koyunlu, Yeniköy; male genitalia]
193.Evergestis caesialis (Herrich-Schäffer,[1849])

(Cesa).
New to the fauna of Bitlis province.
194.Evergestis infirmalis (Staudinger,1870)

Akın, 2014 [Çaygeçit, Alatoprak, Gümüşkanat, Kavakbaşı-Koyunlu, Tolgalı, Dağarcık, Çiğdemalan;
male genitalia]
195.Evergestis mundalis (Guenée,1854)

Akın, 2014 [Yeniköy; male genitalia]
196.Faveria sordida (Staudinger,1879)

18
197.Galleria mellonella (Linnaeus,1758)

Akın, 2014 [Alatoprak, Boğazönü; male genitalia]
198.Glaucocharis euchromiella (Ragonot,1895)

Akın, 2014 [Çatalsöğüt, Gümüşkanat, Kavakbaşı-Koyunlu, Alatoprak, Çiğdemalan; male genitalia]
199.Gymnancyla canella ([Denis & Schiffermüller],1775)

200.Hellula undalis (Fabricius,1781)

Akın, 2014 [Çaygeçit, Alatoprak, Çiğdemalan, Üstyayla, Kavakbaşı-Koyunlu, Tolgalı; male
genitalia]
201.Homoeosoma inustellum Ragonot,1884

Akın, 2014 [Yeniköy; male genitalia]
202.Homoeosoma sinuellum (Fabricius,1794)

Akın, 2014 [Çaygeçit, Yeniköy; male genitalia]
203.Hyperlais dulcinalis (Treitschke,1835)

Akın, 2014 [Çaygeçit, Alatoprak; male genitalia]
204.Hypochalcia ahenella ([Denis & Schiffermüller],1775)

Akın, 2014 [Mutki, Yeniköy, Tolgalı, Gümüşkanat, Alatoprak; male genitalia]
205.Hypsopygia costalis (Fabricius,1775)

Akın, 2014 [Alatoprak, Çatalsöğüt, Tolgalı, Gümüşkanat, Geyikpınar, Kavakbaşı-Koyunlu; male
genitalia]
206.Hypsopygia rubidalis ([Denis & Schiffermüller],1775)

207.Hypsotropa limbella Zeller,1848

Akın, 2014 [Geyikpınar, Çatalsöğüt, Tolgalı, Gümüşkanat, Alatoprak; male genitalia]
208.Insalebria serraticornella (Zeller,1839)

Akın, 2014 [Kaşak; male genitalia]
209.Isauria dilucidella (Duponchel,1836)

Akın, 2014 [Çaygeçit, Kavakbaşı-Koyunlu, Geyikpınar, Tolgalı, Çiğdemalan, Gümüşkanat,
Alatoprak; male genitalia]
210.Keradere lepidella (Ragonot,1887)

Akın, 2014 [Alatoprak, Gümüşkanat, Tolgalı; male genitalia]
211.Khorassania hartigi Amsel,1951

Akın, 2014 [Alatoprak, Çatalsöğüt, Yeniköy; male genitalia]
212.Lambaesia straminella (Zerny,1914)

Akın, 2014 [Mutki, Yeniköy, Çaygeçit, Kavakbaşı-Koyunlu, Çatalsöğüt, Alatoprak, Kaşak, Tolgalı;
male genitalia]
213.Lamoria sp.
Akın, 2014 [2♀♀ ex Gümüşkanat]
19
214.Laristania taftanella (Amsel,1954)

Akın, 2014 [Tolgalı, Kaşak, Çatalsöğüt; male genitalia]
215.Loxostege sticticalis (Linnaeus,1761)

216.Mecyna marcidalis (Fuchs,1879)

Akın, 2014 [Alatoprak, Çaygeçit, Çatalsöğüt, Tolgalı, Gümüşkanat; male genitalia, cited as
biternalis] This species was also recorded by the authors from Beytüşşebap, Dule valley (Şırnak
Pr.) (GP2529♂), new for the fauna of this province. We used the genitalic images published by
Slamka (2013) for the specific identification.
217.Mecyna biternalis (Mann,1862)

Akın, 2014 [Mutki, Kavakbaşı-Koyunlu, Yeniköy; male genitalia, cited as marcidalis]
218.Mecyna subsequalis (Herrich-Schäffer,1855)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Tolgalı, Gümüşkanat, Yeniköy; male genitalia]
219.Mecyna trinalis ([Denis & Schiffermüller],1775) (Figs. 86,87)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Çatalsöğüt, Kaşak, Yeniköy; male genitalia]
220.Megasis (s.str.) kocaki Akın,2016

Akın, 2014 [Yeniköy]; Akın, 2016.
221.Merulempista brucella (Staudinger,1879)

Akın, 2014 [Çaygeçit, Gümüşkanat, Alatoprak; male genitalia]
222.Mesocrambus candidellus (Herrich-Schäffer,[1848])

Akın, 2014 [Kavakbaşı-Koyunlu, Yeniköy; male genitalia]
223.Metacrambus carectellus (Zeller,1847)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Yumrumeşe-Ocaklı, Kavakbaşı-Koyunlu, Tolgalı, Yeniköy;
male genitalia]
224.Metasia carnealis (Treitschke,1829)

Akın, 2014 [Gümüşkanat; female genitalia]
225.Metasia subtilialis Caradja,1916

Akın, 2014 [Mutki, Tolgalı; male genitalia]
226.Metasia virginalis Ragonot,1894

Akın, 2014 [Alatoprak, Çaygeçit, Çiğdemalan, Tolgalı; male genitalia]
227.Metasia sp.1
Akın, 2014 [Çaygeçit 1♀, cited as Metasia sp.1]
228.Metasia sp.2
Akın, 2014 [Mutki 1♀, cited as Metasia sp.2]
20
229.Moitrelia obductella (Zeller,1839)

Akın, 2014 [Kavakbaşı-Koyunlu, Tolgalı, Yeniköy; male genitalia]
230.Moitrelia placidella (Zerny,1929)

Akın, 2014 [Çiğdemalan, Gümüşkanat, Alatoprak, Tolgalı; male genitalia]
231.Myelois (Gnathogutta) circumdatella Lederer,1858

Akın, 2014 [Çaygeçit, Alatoprak, İkizler, Yeniköy; male genitalia]
232.Myelois (Gnathogutta) ossicolor Ragonot,1893 (Fig.37)

Akın, 2014 [Çaygeçit, Alatoprak; as Myelois sp.]
(Cesa).
This species was previously reported by Akın (2014), without identification.
233.Myelois (Gnathogutta) pluripunctella (Ragonot,1887)

Akın, 2014 [Kaşak, Alatoprak; male genitalia]
234.Myelois (Gnathogutta) pumicosa Lederer,1855

Akın, 2014 [Mutki, Yeniköy, İkizler, Gümüşkanat; male genitalia]
235.Myelois (s.str.) circumvoluta (Fourcroy,1785)

Akın, 2014 [Çiğdemalan, Alatoprak; male genitalia]
(Cesa).
236.Myrlaea albistrigata (Staudinger,1881) (Fig.38)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Kavakbaşı-Koyunlu, Tolgalı, Yeniköy, Gümüşkanat, Kaşak;
male genitalia]
(Cesa).
237.Myrlaea nigrosquamalis (Amsel,1950)

Akın, 2014 [Mutki, Alatoprak, Tolgalı, Gümüşkanat, Çatalsöğüt; male genitalia]
2017, all M. Kemal & A.Koçak leg. (Cesa).
238.Nephopterix angustella (Hübner,1796)

Akın, 2014 [Çaygeçit, Gümüşkanat; male genitalia]
239.Nephopterix minimella Amsel,1954

240.Nomophila noctuella ([Denis & Schiffermüller],1775)

Akın, 2014 [Çaygeçit, Alatoprak, Tolgalı, Geyikpınar, Yumrumeşe-Ocaklı, Kavakbaşı-Koyunlu,
Dağarcık, Kaşak, Boğazönü, Çiğdemalan; male genitalia]
(Cesa).
241.Nyctegretis lineana (Scopoli,1786)

Akın, 2014 [Tolgalı, Boğazönü; male genitalia]
242.Oncocera amoenella (Zeller,1848) (Fig.39)

Akın, 2014 [Çaygeçit, Gümüşkanat, Tolgalı; male genitalia]
21
243.Oncocera semirubella (Scopoli,1763)

Akın, 2014 [Çaygeçit, Alatoprak, Tolgalı, Yeniköy, Gümüşkanat, Boğazönü, Çiğdemalan; male
genitalia]
244.Ostrinia nubilalis (Hübner,1796)

Akın, 2014 [Tolgalı, Gümüşkanat; male genitalia]
245.Paracorsia repandalis ([Denis & Schiffermüller],1775)

246.Parapoynx stratiotatum (Linnaeus,1758)

Akın, 2014 [Kavakbaşı-Koyunlu]
247.Paratalanta hyalinalis (Hübner,1796)

248.Patania ruralis (Scopoli,1763)

Akın, 2014 [Alatoprak, Tolgalı; male genitalia]
249.Pediasia contaminella (Hübner,1796)

Akın, 2014 [Dağarcık, Boğazönü; male genitalia]
250.Pediasia matricella (Treitschke,1832)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Üstyayla, Gümüşkanat, Kavakbaşı-Koyunlu, Koyunlu,
Tolgalı; male genitalia]
251.Pempeliella sororiella (Zeller,1839)

Akın, 2014 [Alatoprak, Gümüşkanat, Tolgalı, Yeniköy; male genitalia]
252.Peoria sp.
Akın, 2014 [Alatoprak, Tolgalı; cited as Peoria sp.]
253.Phlyctaenomorpha sinuosalis (Le Cerf,[1910])

(Cesa).
New to the fauna of Bitlis province.
254.Phycita spissicella (Fabricius,1777)

Akın, 2014 [Mutki, Çaygeçit, Çatalsöğüt, Yumrumeşe-Ocaklı; male genitalia]
255.Phycita teheranella Amsel,1954

256.Phycita sp.1
Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Gümüşkanat; cited as Phycita sp.1]
257.Phycita sp.2
Akın, 2014 [Mutki, cited as Phycita sp.2]
258.Phycitodes albatella (Ragonot,1887)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Tolgalı, Çiğdemalan, Gümüşkanat; male genitalia]
259.Phycitodes binaevella (Hübner,[1813])

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Tolgalı, Çiğdemalan, Gümüşkanat, Çatalsöğüt, Kavakbaşı-
22
260.Phycitodes lacteella (Rothschild,1915)

Akın, 2014 [Alatoprak, Gümüşkanat, Kavakbaşı-Koyunlu; male genitalia]
261.Phycitodes nigrilimbella (Ragonot,1887)

Akın, 2014 [Alatoprak, Tolgalı, Çiğdemalan, Kavakbaşı-Koyunlu; male genitalia]
262.Phycitodes saxicola (Vaugham,1870)

Akın, 2014 [Mutki, Çaygeçit, Alatoprak, Tolgalı, Gümüşkanat, Çatalsöğüt; male genitalia]
263.Phycitodes sp.
Akın, 2014 [Çaygeçit, Alatoprak, Tolgalı, Gümüşkanat; cited as Phycitodes sp.]
264.Polyocha transversariella (Zeller,1848)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Tolgalı, Gümüşkanat, Kaşak, Çiğdemalan; male genitalia;
as Epidauria strigosa Stgr.]
Nomenclatural remark: The validity of the name transversariella Zeller,1848 is not accepted by
various authors. This name was described by Zeller in 1848 as binominal, and at a specific level. It
is an available name under the current ICZN rules; therefore it can be used as a valid name of a
taxon according to the priority rules. Leraut’s (2014) misleading statement about the validity of
transversariella Zeller is giving the wrong idea or impression to the readers.
265.Polyochodes farsella (Amsel,1951) (Figs.88-90)

Material examined: 1♂, GP2804♂. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, M. Kemal &
This species was reported by the authors from Süphan Mt as new to the fauna of Turkey (Kemal &
Koçak,2017a). This time, it is recorded from Mutki for the first time.
266.Psammotis pulveralis (Hübner,1796)

Akın, 2014 [Mutki, Alatoprak; male genitalia]
267.Pseudosyria ambustiella (Ragonot,1887)

Akın, 2014 [Mutki, Yeniköy; male genitalia]
268.Psorosa dahliella (Treitschke,1832)

Akın, 2014 [Alatoprak, Çatalsöğüt, Tolgalı, Gümüşkanat, Kavakbaşı-Koyunlu, Yeniköy; male
genitalia]
269.Psorosa maraschella Caradja,1910

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Çatalsöğüt, Tolgalı, Gümüşkanat, Kaşak, Kavakbaşı-
Koyunlu, Yeniköy; male genitalia]
270.Psorosa tochalella Amsel,1954

Akın, 2014 [Mutki, Alatoprak, Çatalsöğüt, Tolgalı, Gümüşkanat, Kaşak, Kavakbaşı-Koyunlu,
Yeniköy; male genitalia]
271.Pterothrixidia rufella (Duponchel,1836)

Akın, 2014 [Mutki, Alatoprak, Çiğdemalan, Tolgalı, Gümüşkanat, Kaşak, Yeniköy; male genitalia]
272.Pyralis kacheticalis (Christoph,1893) (Fig.40)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Çatalsöğüt, Tolgalı, Gümüşkanat, Boğazönü, Kavakbaşı-
(Cesa).
273.Pyralis perversalis (Herrich-Schäffer,[1849])

23
(Cesa).
274.Pyrasia gutturalis (Staudinger,1879)

Akın, 2014 [Alatoprak, Tolgalı, Gümüşkanat şelalesi, Gümüşkanat; male genitalia]
275.Pyrausta aerealis (Hübner,1793)

Akın, 2014 [Mutki, Yeniköy, Kavakbaşı-Koyunlu, Gümüşkanat; male genitalia]
276.Pyrausta aurata (Scopoli,1763) (Fig.41)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Tolgalı, Kavakbaşı-Koyunlu, Geyikpınar, Açıkalan-
Hacıvan, Üstyayla, Yumrumeşe-Ocaklı, Boğazönü, Dağarcık, Gümüşkanat şelalesi, Gümüşkanat;
male genitalia]
Material examined: 4♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, 25 7 2017, 2♂ from Çaygeçit
277.Pyrausta castalis Treitschke,1829

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Dağarcık, Yeniköy; male genitalia]
278.Pyrausta despicata (Scopoli,1763)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Tolgalı, Yeniköy, Kavakbaşı-Koyunlu, Geyikpınar, Çitliyol,
Çiğdemalan, Üstyayla, Yumrumeşe-Ocaklı, İkizler, Boğazönü, Gümüşkanat şelalesi, Gümüşkanat;
male genitalia]
Material examined: 1♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, 25 7 2017, M. Kemal &
279.Pyrausta ferrealis (Hampson,1900)

Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Tolgalı, Gümüşkanat; male genitalia]
280.Pyrausta pauperalis (Staudinger,1879)

Akın, 2014 [Alatoprak, Çaygeçit, Tolgalı, Gümüşkanat; male genitalia]
281.Pyrausta purpuralis (Linnaeus,1758)

Akın, 2014 [Çaygeçit, Tolgalı, Kavakbaşı-Koyunlu, Boğazönü, Çiğdemalan, Yeniköy; male genitalia]
282.Pyrausta sanguinalis (Linnaeus,1767)

Akın, 2014 [Mutki, Çaygeçit, Tolgalı, Çiğdemalan, Kavakbaşı-Koyunlu, Gümüşkanat; male
genitalia]
283.Pyrausta virginalis Duponchel,1832

Akın, 2014 [Mutki, Alatoprak, Geyikpınar, Çaygeçit, Çiğdemalan, Gümüşkanat; male genitalia]
284.Pyraustimorpha inexpectata Koçak & Seven,1995

285.Sciota insignella (Mann,1862)

286.Sciota rhenella (Zincken,1818)

287.Sclerobiodes persica Amsel,1951

24
288.Scoparia absconditalis Christoph,1887

289.Sefidiaclasperella Asselbergs,1994
Akın, 2014 [Mutki, Alatoprak, Çaygeçit, Çatalsöğüt, Tolgalı, Gümüşkanat, Yeniköy; male genitalia]
290.Selagia argyrella ([Denis & Schiffermüller],1775)

Akın, 2014 [Üstyayla; male genitalia]
291.Sitochroa straminealis (Hampson,1900

Akın, 2014 [Kaşak; female genitalia]
292.Stemmatophora brunnealis (Treitschke,1829)

293.Stemmatophora honestalis (Treitschke,1829)

Akın, 2014 [Mutki; male genitalia]
Material examined: 6♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, 25 7 2017, 1♂ from Çaygeçit
294.Synaphe antennalis (Fabricius,1794)

Akın, 2014 [Mutki, Yumrumeşe-Ocaklı; male genitalia]
295.Synaphe berytalis (Ragonot,1888)

Akın, 2014 [Tolgalı, Kavakbaşı-Koyunlu; male genitalia]
296.Syrianarpia mendicalis (Staudinger,1879)

Akın, 2014 [Mutki, Alatoprak, Tolgalı, Gümüşkanat; male genitalia]
297.Taftania serratella (Ragonot,1893)

298.Tegostoma perlepidalis (Guenée,1854) (Fig.42)

Akın, 2014 [Mutki, Tolgalı, Yeniköy; male genitalia]
299.Teliphasa (Sultania) lophotalis (Hampson,1900)

Akın, 2014 [Alatoprak, Tolgalı; male genitalia]
300.Tephris romanoffella (Ragonot,1887)

Akın, 2014 [Mutki, Tolgalı, Alatoprak, Gümüşkanat; male genitalia]
301.Tephris verruculella (Ragonot,1887)

302.Tretopteryx pertusalis (Geyer,[1832])

Akın, 2014 [Çaygeçit, Yumrumeşe-Ocaklı, Gümüşkanat, Yeniköy; male genitalia]
303.Udea confinalis (Lederer,1858)

Akın, 2014 [Mutki, Alatoprak, Geyikpınar, Çaygeçit, Kaşak, Tolgalı, Yeniköy, Üstyayla,
Gümüşkanat şelalesi, Koyunlu, Kavakbaşı-Koyunlu; male genitalia]
25
304.Udea dispunctalis (Guenée,1854)

Akın, 2014 [Kaşak; male genitalia]
305.Udea ferrugalis (Hübner,1796)

Akın, 2014 [Mutki, Geyikpınar, Çaygeçit, Tolgalı, Çiğdemalan, Gümüşkanat, Gümüşkanat şelalesi,
Yumrumeşe-Ocaklı, Kavakbaşı-Koyunlu; male genitalia]
306.Udea fulvalis (Hübner,[1809])

Akın, 2014 [Koyunlu; female genitalia]
307.Udea praepetalis (Lederer,1869)

Akın, 2014 [Mutki, Alatoprak, Koyunlu; male genitalia]
308.Udea sp.
Akın, 2014 [Mutki, Geyikpınar, Çaygeçit, Açıkalan-Hacıvan; cited as Udea sp.]
309.Udea prunalis ([Denis & Schiffermüller],1775)

Akın, 2014 [Mutki, Kavakbaşı-Koyunlu; male genitalia]
310.Uresiphita gilvata (Fabricius,1794)

Akın, 2014 [Mutki, Tolgalı, Çiğdemalan, Gümüşkanat, Yeniköy; male genitalia]
311.Xanthocrambus saxonellus (Zincken,1821)

Akın, 2014 [Mutki, Alatoprak, Gümüşkanat, Tolgalı; female genitalia]
312.Zitha subustalis (Lederer,1855)

Akın, 2014 [Alatoprak, Çaygeçit, Çatalsöğüt, Gümüşkanat, Kavakbaşı-Koyunlu; male genitalia]
Sphingidae
313.Agrius convolvuli (Linnaeus,1758)

Akın,2012 [Mutki].
314.Deilephila suellus Staudinger,1878

Akın,2012 [Tolgalı].
315.Dolbina elegans A.Bang-Haas,[1913]

Akın,2012 [Alatoprak, Çaygeçit, Tolgalı]; Kemal & Koçak, 2016a.
316.Hemaris (Cochrania) croatica (Esper,[1779])

Akın,2012 [Çaygeçit]; Kemal & Koçak, 2016a.
317.Hyles euphorbiae (Linnaeus,1758)

Akın,2012 [Çaygeçit, Boğazönü, Yeniköy]; Kemal & Koçak, 2016a.
318.Hyles livornica (Esper,[1780])

Akın,2012 [Dağarcık].
319.Laothoe populeti (Bienert,[1870])

Akın,2012 [Mutki, Çaygeçit]; Kemal & Koçak, 2016a.
26
320.Macroglossum stellatarum (Linnaeus,1758)

Kemal et al, 2010: fig. 58 [caterpillar from Mutki, Çaygeçit]; Akın,2012 [Çaygeçit]; Kemal & Koçak,
2016a.
321.Marumba quercus ([Denis & Schiffermüller],1775)

Akın,2012 [Çaygeçit, Alatoprak, Gümüşkanat şelalesi]; Kemal & Koçak, 2016a.
322.Proserpinus proserpinus (Pallas,1772)

Akın,2012 [Alatoprak]; Kemal & Koçak, 2016a.
323.Rethera komarovi (Christoph,1885)

Akın,2012 [Yeniköy]; Kemal & Koçak, 2016a.
324.Sphingonaepiopsis gorgoniades (Hübner,[1819])

Akın,2012 [Tolgalı]; Kemal & Koçak, 2016a.
325.Theretra alecto (Linnaeus,1758)

Akın,2012 [Tolgalı].
Thyatiridae
326.Tethea ocularis (Linnaeus,1767)

Material examined: 1♂. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017 M. Kemal & A.Koçak leg.
(Cesa).
This species is new to the fauna of Mutki district.
Tortricidae
327.Cydia pomonella (Linnaeus,1758)

This species is new to the fauna of Bitlis Province.
328.Cydia pyrivora (Danilevsky,1947)

Material examined: 1 ex. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, 25 7 2017, M. Kemal &
329.Diceratura ostrinana (Guenée,1845) (Figs. 91, 92)

The external features and colouration are similar to those of Diceratura rhodograpta, but the male
genitalia makes it clear that the specimen belongs to Diceratura ostrinana Gn. (Razowski, 1970,
2002, 2009). The genitalic drawings of this species, like many others, in the three Razowski’s
books are the same. Only in the first one, the differences of the valva of ostrinana from Beirut and
Saida (Lebanon) are shown. He stated (2009:99): “The specimen from Beyrut may represent a
distinct taxon”. Therefore, the southern populations of Turkey of this group will be separately
studied.
Material examined: 1♂, GP2813♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, 25 7 2017, M.
330.Epinotia dalmatana (Rebel,1891)

Material examined: 2♂. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017 M. Kemal & A.Koçak leg.
(Cesa).
27
331.Kenneliola fagiglandana (Zeller,1841) (Fig. 93)

Material examined: 1♂. Bitlis Pr., Mutki, Aydemir 1710m, nocturnal, 25 7 2017; 1♂ from Çaygeçit
1290m, 26 7 2017 M. Kemal & A.Koçak leg. (Cesa).
This species was recently reported by the authors from Bahçesaray (Van Pr.) (Kemal & Koçak,
2017b). It is new to the fauna of Bitlis Province.
332.Pammene amygdalana (Duponchel,1843)

Yponomeutidae
333.Yponomeuta malinella (Zeller,1838)

This species is new to the fauna of Mutki district.
Acknowledgements
We thank to “Bilimsel Araştırma Projeleri Koordinatörlüğü” of the Van Yüzüncü Yıl University, for
supporting our Project, numbered 2015-MRK-B345.
We are grateful to Mr. Peter Buchner for his kind comments and help for identification of
Depressaria spp., and to Asst. Prof. Dr. Kesran Akın (Bitlis Eren University) for his kind
collaboration.
References
Akın,K., 2011, On the distribution and biology of Orthosia rubricosa (Esper,[1786]) in Turkey
(Lepidoptera, Noctuidae). Cesa News 70: 3-5, 2 figs. 1 map.
Akın, K., 2012. Mutki (Bitlis) Lepidoptera Faunasına Katkılar I. Sphingidae. BEÜ Fen Bilimleri Dergisi 1
(1): 45-49.
Akın,K., 2013, Dolicharthria intervacatalis (Chr.), new to the fauna of Turkey (Pyralidae,
Lepidoptera). Cesa News 92: 2-3, 1 fig.
Akın,K., 2014, Mutki İlçesi (Bitlis) Pyralidae (Lepidoptera) Faunası ve Ekolojisi Üzerine Araştırmalar.
341s. Yüzüncü Yıl Üniversitesi, Fen Bilimleri Enstitüsü, Biyoloji Anabilimdalı. Doktora tezi, no 367477
https://tez.yok.gov.tr/UlusalTezMerkezi/tezSorguSonucYeni.jsp [last access: 5 12 2017].
Akın, K., 2015, New Species and Genera for The Fauna of Turkey (Lepidoptera, Pyralidae, Phycitinae). Ent.
News 125 (1): 38-42.
Akın, K., 2016. A new species of the genus Megasis Guenée, 1845 from Turkey (Lepidoptera, Pyralidae).
Zoology in the Middle East 62 (1): 61-63.
Akın, K. & L. Kayci, 2014, Euproctis melania (Staudinger, 1892) Türünün Biyolojisi ve Yayılışına Katkılar
(Lepidoptera, Lymantriidae). 22. Ulusal Biyoloji Kongresi. 23-27 Haziran, Eskişehir. 1023.
Anonym, 2011, Editorial. Cesa News 65: 1.
Buchner,P., 2017, Faunistic records of Depressariidae (Lepidoptera, Gelechioidea) from Turkey – a result
of studies for „Microlepidoptera of Europe: Depressariinae“. Cesa News 134: 1-34, figs.
Caradja,A., 1920, Beitrag zur Kenntnis der geographischen Verbreitung der Mikrolepidopteren des
palaearktischen Faunengebietes nebst Beschreibung neuer Formen. Dt. Ent. Z., Iris 34: 75-179.
Daniel,F., 1939, Beiträge zur Kenntnis der Gattung Lithosia F. (Lep., Arct.) I. Mitt. Münch. ent. Ges. 29: 44-
54, 5 figs.
Dubatolov,V.V. & V.V..Zolotuhin, 2011, Does Eilema Hübner,[1819] (Lepidoptera, Arctiidae,
Lithosiinae) present one or several genera? Euroasian ent. J. 10 (3): 367-379, figs.
Hausmann,A., 1996, The morphology of the geometrid moths of the Levant and neighbouring countries.
Nota lepid. 19 (1/2): 3-90, figs.
Hausmann,A., 2004, The geometrid moths of Europe. Volume 2 Sterrhinae. Apollo Books, Stenstrup.
28
Huemer,P. & O.Karsholt, 1999, Gelechiidae I [in] Huemer,P., Karsholt,O. & L.Lyneborg (eds),
Microlepidoptera of Europe volume 3. Apollo Books, Stenstrup.
Kemal,M., 2017, Determination of the diurnal Lepidoptera fauna of Süphan Mountain and its
environment. Proje no: 2014-FEN-B165. Yüzüncü Yıl Üniversitesi Bilimsel Araştırma Projeleri
Koordinasyon Birimi, Van [unpublished].
Kemal,M. & A.Ö.Koçak, 2007, Synonymical and distributional List of the species of Bitlis Province (East
Turkey) (Lepidoptera). Cent. Ent. Stud., Misc. Pap. 111/112: 1-12.
Kemal, M. & A.Ö.Koçak, 2014, Illustrated and annotated list on the Entomofauna of Gören Mount (Van
Province, East Turkey), with ecological remarks I – Period of April-June 2014. Priamus (Suppl.) 33: 5-
206, 273 figs. 1 Table.
Kemal, M. & A.Ö.Koçak, 2015a, Preliminary annotated list of the Lepidoptera of Sivas Province (East
Turkey). Cesa News 113: 1-101, 23 maps.
Kemal,M. & A.Ö.Koçak, 2015b, Acritonia Ams. in East Turkey (Lepidoptera, Pyralidae). Cesa
News 119: 9-10, 2 figs.
Kemal,M. & A.Ö.Koçak, 2016a, Annotated and pictorial list of the Çatak Lepidoptera. Priamus (Suppl.)
41: 1-118, 95 figs.
Kemal,M. & A.Ö.Koçak, 2016b, On the Geometridae fauna of Bahçesaray district, together with some
morphological and eco-faunistical notes (Van Province, East Turkey) (Lepidoptera). Priamus 14 (2): 76-
119, 69 figs. 32 maps.
Kemal,M. & A.Ö.Koçak, 2017a, Annotated list of the moths of Süphan Volcano (Bitlis Province, East
Turkey) (Lepidoptera). Priamus 15 (2): 82-123, 72 figs.
Kemal,M. & A.Ö.Koçak, 2017b, On the Microlepidoptera of Bahçesaray district (Van Province, East
Turkey). Priamus 15 (3): 125-164, 105 figs.
Kemal,M. & K.Akın, 2011, Choreutis muhabbet Koçak: New provincial record in Turkey and its early
stages (Lepidoptera, Choreutidae) [in Turkish].Cesa News 62: 6-12, 12 şekil.
Kemal, M. & K. Akın, 2012, Mutki (Bitlis) İlçesi Papilionoidea ve Hesperioidea (Lepidoptera) Faunasına
Katkılar. 21. Ulusal Biyoloji Kongresi. 3-7 Eylül, İzmir. 934.
Kemal,M., Koçak,A.Ö., Akın,K., Yalçın,M., Bakan,B. & D.Çelikkaya, 2010, Spring aspect of the
pterygot insect fauna of Mutki (Bitlis Province, South East Turkey). Cesa News 58: 1-78, 150 figures, 1
graph.
Koçak,A.Ö., 1991, On the Arctiidae of Turkey in the collection of CES with some taxonomical and ecological
notes (Lepidoptera). Priamus 5 (4): 122-149, 7 figs.
Koçak,A.Ö. & K.Akın, 2011, Clytie haifae (Habisch), new to the fauna of Turkey (Lepidoptera,
Noctuidae). Cesa News 63: 6-7, 1 fig.
Koçak,A.Ö. & M.Kemal, 2015, Annotated list of the Lepidoptera of Hakkari Province (SE Turkey). Cesa
News 116: 1-146, 69 figs., 18 maps.
Leraut,P., 2014, Moths of Europe. Volume 4 Pyralids 2. 441 pp. N.A.P. Editions, Verrières-le-Buisson.
Meyrick,E., 1908, Notes and descriptions of Pterophoridae and Orneodidae. Trans. Ent. Soc. London 1907
(4): 471-511.
Rajaei, H., 2010, Life-history of Gnopharmia kasrunensis Wehrli, 1939 and G. colchidaria Lederer, 1870
(Geometridae, Ennominae) and their distribution in Iran, with first host-plant records for the genus.
Bonn. Zool. Bull. 57 (1): 65–73., figs.
Razowski,J., 1970, Cochylidae, [in] Amsel,H.E. et al., Microlepidoptera Palaearctica 3: xiv + 529 pp.,
161 Taf., Wien.
Razowski,J., 2002, Tortricidae (Lepidoptera) of Europe Volume 1 Tortricinae and Chlidanotinae. 247
pp., 16 Pls. Bratislava.
Razowski,J., 2009, Tortricidae of the Palaearctic Region volume 2 Cochylini. 195 pp. 57 pls. Krakow-
Bratislawa.
Roesler,R.-U., 1973, Trifine Acrobasiina (1. Teilband der Phycitinae). [in] Amsel,H.G. et al.,
Microlepidoptera Palaearctica vol.4. Textband, xvi + 752 S., 145 Abb.; Tafelband 137 S., 37 Abb., 38
Farbtaf., 121 SW-Taf., 11 Verbreitungstab. Verlag G. Fromme Co. Wien.
Scholz,A. & E.Jackh, 1994, Taxonomie und Verbreitung der westpaläarktischen Alucita-Arten
(Lepidoptera, Alucitidae [Orneodidae]). Alexanor 18 (4) (1993) (Suppl.): [3]-[63], figs.
Slamka,F., 2013, Pyraloidea of Europe (Lepidoptera). Volume 3. Pyraustinae & Spilomelinae. 357S.
Bratislava.
Stadie,D., Hausmann,A. & H.Rajaei, 2014, Cataclysme subtilisparsata Wehrli,1932 (Lepidoptera,
Geometridae, Larentiinae) recognized as bona species - an integrative approach. Nota lepid. 37 (2): 141-
150, figs.
Staudinger, O., 1879, Lepidopteren-Fauna Kleinasien’s. Horae Soc. ent. Ross. 15: 159-435.
Varga,Z. & L.Ronkay,1991, Taxonomical notes on the genus Victrix Staudinger,1879 (Lepidoptera,
Noctuidae). II. The subgenus Rasihia Koçak,1989. Nota lepid. 14 (2): 144-170, figs.
Wiltshire, E.P., 1957, The Lepidoptera of Iraq. Nicolas Kaye Limited.
29
Images
Observational images from the nature
Figs. 1, 2 – Eilema pseudocomplana, at rest. Bitlis Pr., Mutki, Aydemir 1710m, on 25 7 2017 (left); Euplagia
splendidior, at rest from same place and date, at 05:21 a.m. (right), M. Kemal (Cesa)
Figs. 3, 4 – Coleophora sp. at rest. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, at 5:57 a.m. (left); Eteobalea dohrnii, at
rest. Mutki, Aydemir 1710m, 25 7 2017, at 06: 14 a.m., M. Kemal (Cesa)
Figs. 5, 6 - Watsonalla binaria at rest. Bitlis Pr. Mutki, Çaygeçit 1290m. 26 7 2017 (left); Camptogramma bilineatum,
at rest. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, at 6:07 p.m. (right); M. Kemal (Cesa).
30
Figs. 7, 8 – Cataclysme riguata at rest. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, at 6:51 a.m. (left); Eilicrinia
cordiaria at rest. Mutki, Çaygeçit 1290m, 26 7 2017, at 5: 40 a.m. (right), M. Kemal (Cesa)
Figs. 9, 10 – Ennomos fraxineti, at rest. Bitlis Pr. Mutki, Çaygeçit 1290m, 26 7 2 017, at 6:34 a.m. (left); Rhodostrophia
cuprinaria, at rest. Mutki, Aydemir 1710m, 25 7 2017, at 5:21 a.m. (right), M. Kemal (Cesa)
Figs. 11, 12 – Scopula decorata, at rest. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, at 5:24 a.m. (left); Lasiocampa
grandis at rest. From same place and date, at 7: 13 a.m. (right), M. Kemal (Cesa)
31
Figs. 13, 14 – Pachypasa otus, at rest. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, at 5:50 a.m. (left); Lymantria
dispar, at rest. From same place and date, at 5:51 a.m. (right), M. Kemal (Cesa)
Figs. 15, 16 – Cosmia trapezina, at rest. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, at 6:54 a.m. (left); Cryphia
occidentalis, at rest. From the same place and date, at 7:10 am (right), M. Kemal (Cesa)
Figs. 17, 18 – Cryphia spp., at rest. Both from Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, M. Kemal (Cesa)
32
Figs. 19, 20 – Eublemma pallidulum, at rest. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, at 6:25 a.m. (left); Eublemma
panonicum, at rest. Mutki, Aydemir 1710m, 25 7 2017, at 5:52 a.m. (right), M. Kemal (Cesa)
Figs. 21, 22 – Hypena munitalis, at rest. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, at 6:01 a.m. (left); Idia calvaria,
at rest. Mutki Çaygeçit 1290m 26 7 2017, at 5:38 a.m. (right), M. Kemal (Cesa)
Figs. 23, 24 - Victrix (Rasihia) tabora, a male at rest. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, at 5:12 a.m. (left);
Pheosia tremula, a male at rest from same place and date, at 6:03 a.m. (right), M. Kemal (Cesa)
33
Figs. 25, 26 - Agonopterix cnicella at rest. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, at 5:29 a.m. (left); Depressaria
zelleri, a male at rest. From Mutki, Çaygeçit 1290m, on 26 7 2017, at 5:47 a.m. (right), M. Kemal (Cesa)
Figs. 27, 28 - Pleurota eximia male at rest. Bitlis Pr., Mutki, Aydemir 1710m on 25 7 2017, at 6:33 a.m. (left/above);
Pleurota sp. at rest from same place and date, at 6:26 a.m. (right), M. Kemal (Cesa)
Figs. 29, 30 - Procapperia linariae male at rest. Bitlis Pr., Mutki, Aydemir 1710m on 25 7 2017, at 6:33 a.m. (left);
Stenoptilia sp. at rest from Mutki, Çaygeçit 1290m, on 26 7 2017, at same place and date, at 5:45 a.m. (right), M. Kemal
(Cesa)
34
Figs. 31, 32 - Arsissa ramosella at rest. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, at 6:11 a.m. (left); Bradyrrhoa
gilveolella, a resting female. Mutki, Çaygeçit 1290m, 26 7 2017, at 6:09 a.m. (right), M. Kemal (Cesa)
Figs. 33, 34 - Elegia fallax at rest. Bitlis Pr., Mutki, Aydemir 1710m 25 7 2017, at 5:51 a.m. (left); Endotricha
flammealis from Mutki, Çaygeçit 1290m, 26 7 2017, at 5:31 a.m. (right), M. Kemal (Cesa)
Figs. 35, 36 - Epactoctena octogenalis at rest. Bitlis Pr., Mutki, Aydemir 1710m, at 5:32 a.m. (left); Euchromius
pulverosus at rest from same place and date, at 5:54 a.m. (right), M. Kemal (Cesa)
35
Figs. 37, 38 - Myelois ossicolor at rest. Bitlis Pr., Mutki, Aydemir 1710m, at 5:41 a.m. (left); Myrlaea albistrigata at rest
from same place and date, at 6:37 a.m. (right), M. Kemal (Cesa)
Figs. 39, 40 - Oncocera amoenella at rest. Bitlis Pr., Mutki, Çaygeçit 1290m, 26 7 2017, at 6:06 a.m. (left); Pyralis
kacheticalis at rest . Mutki, Aydemir 1710m, on 25 7 2017, at 6:35 a.m. (right), M. Kemal (Cesa)
Figs. 41, 42 - Pyrausta aurata during feeding in the evening. Bitlis Pr., Mutki, Aydemir 1710m, 24 7 2017, at 5:22 p.m.
(left); Tegostoma perlepidalis at rest from same place, on 25 7 2017, at 5:48 a.m. (right), M. Kemal (Cesa)
36
Images of the specimens in the collection and their genitalia
Fig. 43 – Alucita aff. cancellata. Female genitalia. GP2808♀. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, M. Kemal
(Cesa)
Figs. 44, 45 – Uppersides of males of Eilema (Manulea) palliatella (left), and Eilema (Muscula) brevifurca (right). The
former from Aydemir 1710m, 25 7 2017, the latter from Çaygeçit 1290m on 26 7 2017, both from Mutki (Bitlis Pr.), M.
Kemal (Cesa). For their genitalia, see below.
Figs. 46, 47 – Male genitalia of Eilema (Manulea) palliatella. GP2798 (left), male genitalia of Eilema (Muscula)
brevifurca. GP2795 (right), M. Kemal (Cesa). See above.
37
Figs. 48, 49 – Aroga aristotelis. Upperside of male (left). Male genitalia, GP2803♂, aedeagus removed and last
abdominal tergite and sternite (right). Bitlis Pr. Mutki, Çaygeçit 1290m, 26 7 2017, M. Kemal (Cesa)
Figs. 50, 51 - Cataclysme riguata. Upperside of male (wingspan 23mm) (left). Male genitalia, GP2810♂. Bitlis Pr.,
Mutki, Aydemir 1710m, 25 7 2017, M. Kemal (Cesa)
38
Figs. 52-54 – Cyclophora punctaria ssp. fritzae Hausm. (GP2788♂).Upperside of male, with characteristic bipectinated
antenna up to 2/3 (below left), male genitalia, with curved fibula (top), tympanal organs (before and after preparation)
(below right). Bitlis Pr. Mutki, Aydemir, M. Kemal (Cesa)
Figs. 55, 56 – Male of Gnopharmia colchidaria. Upperside (left), underside (right). GP2794. Bitlis Pr., Mutki, Aydemir
1710m, 25 7 2017, M. Kemal (Cesa). For its male genitalia see below.
39
Figs. 57, 58 - Male genitalia of Gnopharmia colchidaria. Upperside (left), underside (right). GP2794, Aedeagus and
abdominal sternite removed. M. Kemal (Cesa). See also above.
Figs. 59, 60 - Tethidia persica. Male genitalia (left), and tympanal organs (before and after preparation) (right).
GP2801♂. Bitlis Pr. Mutki, Aydemir 1710m, 25 7 2017, M. Kemal (Cesa)
Fig. 61 – Female genitalia of Autophila sp. GP2790♀. Part of bursa copulatrix with 5 signa separately enlarged. Bitlis
Pr. Mutki, Çaygeçit 1290m, 26 7 2017, M. Kemal (Cesa)
40
Fig. 62 – Male genitalia of Earias clorana, GP2789♂. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, M. Kemal (Cesa)
Figs. 63, 64 - Hoplodrina blanda. Male genitalia, GP2809♂. Total view (left), removed aedeagus with the groups of
cornuti on the diverticulum of the vesica; first group of cornuti in the basal diverticulum enlarged (top left); last
abdominal segment (bottom right), Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, M. Kemal (Cesa)
41
Fig. 65 – Victrix (Rasihia) tabora. Male genitalia, aedeagus removed. GP2806♂. Bitlis Pr., Mutki, Aydemir 1710m, 25 7
2017, M. Kemal (Cesa)
Figs. 66-68 – Agonopterix cnicella (det. P. Buchner). Upperside of female (top left), Lateral view of female head (top
right). Female genitalia, with enlarged signum GP2787♀ (bottom), Bitlis Pr., Mutki, Aydemir, M. Kemal (Cesa)
42
Figs. 69, 70 – Upperside of male of Agonopterix cnicella (left), and its genitalia, GP2797 (right), Bitlis Pr., Mutki,
Aydemir 1710m, M. Kemal (Cesa)
Figs. 71-74 - Depressaria zelleri (det. P. Buchner). Upperside of male (left), and its genitalia GP2786♂ (top right). Head
of the same specimen (bottom): Lateral view (left), ventral view (right). Bitlis Pr., Mutki, Çaygeçit, M. Kemal (Cesa)
43
Figs. 75, 76 – Procapperia linariae. Upperside of male (left), and its genitalia, aedeagus removed, GP2799 (right). Bitlis
Pr., Mutki, Aydemir 1710m, 25 7 2017, M. Kemal (Cesa)
Figs. 77, 78 - Acritonia comeella. Upperside of male (wingspan 24mm) (above), and its genitalia. GP2812♂. Bitlis Pr.,
44
Figs. 79, 80 - Cadra furcatella. Upperside of male (wingspan 24mm) (left), and tympanal organs (before and after
preparation). GP2811♂. Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017, M. Kemal (Cesa)
Figs. 81, 82 - Cadra furcatella. Male genitalia GP2811♂ (left), with removed aedeagus and coremata (right). Bitlis Pr.,
Figs. 83-85 – Ephestia sp. Upperside of male, its genitalia and coremata GP2800♂. Bitlis Pr., Mutki, Çaygeçit 1290m,
26 7 2017, M. Kemal (Cesa)
45
Figs. 86, 87- Mecyna trinalis. Male genitalia with removed aedeagus. GP2800♂ (left), and tympanal organs (before
and after preparation) (right). Bitlis Pr. Mutki, Aydemir 1710m, 25 7 2017, M. Kemal (Cesa)
Figs. 88-90 - Polyochodes farsella. Upperside of male (above). Male genitalia with removed aedeagus, and abdominal
last segment (right), GP2804♂. Bitlis Pr. Mutki, Aydemir 1710m 25 7 2017, M. Kemal (Cesa)
Figs. 91-93 - Diceratura ostrinana. Upperside of male (wingspan 13mm) (left), its genitalia with removed aedeagus.
GP2813♂ (middle) from Bitlis Pr., Mutki, Aydemir 1710m, 25 7 2017; Kenneliola fagiglandana. Upperside of male
(wingspan 16mm) (right) from Mutki, Çaygeçit 1290m, 26 7 2017, M. Kemal (Cesa)
46
Cesa News
Cesa News is a peer reviewed online serial of the Centre for Entomological Studies Ankara (Cesa), established in 2008. It
appears at irregular intervals as PDF format and includes original articles of the research workers of the Centre,
regarding on various subjects on Entomology. The publication language is English or Turkish. Cesa News is archived
online at “Internet Archive” since 2011, in accordance with the publication rules of the ICZN.
Cesa News is an open-access serial, distributed under the terms of the “Creative Commons Attribution License”, which
permits free use, and distribution in any medium, provided the original author(s) and source are credited.

(A scientific Consortium)
(co-operation of research workers for pure-scientific, not commercial purpose)
Web Page of the Cesa: http://www.cesa-tr.org/ - Digital Library of the Cesa: https://archive.org/details/@cesa
Scientific Serials: Priamus & Priamus Supplement (print and online versions) (ISSN 1015-8243)6, Miscellaneous Papers (print and
online versions) (ISSN 1015-8235) 7, Memoirs (print and online versions) (ISSN-8227)8 DVD Films9, Iconographia Insectorum10
(online), Cesa Publications on African Lepidoptera (online)11, Cesa News (online)12, Cesa Books (online) 13
Owners / Sahipleri - Editors / Yayıncılar: Prof. em. Dr. Ahmet Ömer Koçak (c/o Yüzüncü Yıl University, Van, Turkey), Asst.
Prof. Dr. Muhabbet Kemal Koçak (c/o Yüzüncü Yıl University, Van, Turkey).
Editorial Board of all Scientific Serials of the CESA / Bütün Bilimsel Yayınların Yayın Kurulu: Insecta, taxonomy,
nomenclature, ecology, faunistics: Prof. Dr. Ahmet Ömer Koçak (Yüzüncü Yıl Üniversitesi, Turkey), Asst. Prof. Dr. Muhabbet
Kemal Koçak (Yüzüncü Yıl University, Turkey).
Chief referees of all Scientific Serials of the CESA: Prof. em. Dr. Ahmet Ömer Koçak & Asst. Prof. Dr. Muhabbet Kemal Koçak:
Insecta, taxonomy, nomenclature, fauna, ecology, catalogues, checklists of the Old World.
Expert referees according to the subject areas: Dr. Peter Huemer (Austria): Gelechiidae, and some Microlepidoptera groups in
Palaearctic (Lepidoptera). Dr. J. B. Heppner (U.S.A.): Microlepidoptera of Nearctic and Neotropical. Dr. G. Baldizzone (Italy):
Coleophoridae (Lepidoptera). Dr. V. Korneyev (Ukraine): Tephritidae, Pyrgotidae, Ulidiidae (Diptera). Prof. Dr. Y.G.Verves
(Ukraine): Sarcophagidae (Diptera). Dr. Daniel Burckhardt (Switzerland): Psyllidae (Homoptera). Prof. Dr. E. Heiss (Austria):
Hemiptera. Dr. R. Ehrmann (Germany): Mantodea. Prof. Dr. Mustafa Ünal (Bolu, Turkey): Orthoptera. Prof. Dr. Hüseyin Özdikmen
(Turkey): Coleoptera. Prof. Dr. Suat Kıyak (Turkey): Hemiptera, Hymenoptera (Cynipidae).
Plant taxonomy, flora and vegetation: Assoc. Prof. Dr. Murat Ünal, Asst. Prof. Dr. Mesut Pınar, (Yüzüncü Yıl University, Van,
Turkey).
Molecular studies: Asst. Prof. Dr. İsmail Yıldız, Dr. Sibel Kızıldağ (Yüzüncü Yıl University, Van, Turkey).
Editorial policy: The submitted manuscript is evaluated by the Chief Editor and Referee. In case of need, the manuscript is sent to
expert referees according to the subject areas.
ALL RIGHTS RESERVED
Correspondences should be addressed to: Prof. em. Dr. Ahmet Ömer Koçak, c/o Yüzüncü Yıl University, Fen Fakültesi,
Biyoloji Bölümü, Kampus, Van / Turkey. - e-mail: cesa_tr@yahoo.com.tr
All the serials of the Cesa are archived regularly by the Internet Archive
(300 Funston Ave., San Francisco, CA 94118, U.S.A.),
in accordance with the rules of the International Codes of Zoological Nomenclature (ICZN)
https://archive.org/
also recorded regularly by the Zoological Record,

Thomson Reuters, Enterprise House, Innovation Way, Heslington, York, YO10 5NQ, United Kingdom
https://clarivate.com/
6 http://www.cesa-tr.org/Priamus.htm http://www.cesa-tr.org/Pri.htm
7 http://www.cesa-tr.org/Miscell.htm
8 http://www.cesa-tr.org/Memoirs.htm
9 http://www.cesa-tr.org/CDF.htm
10 http://www.cesa-tr.org/Icon.htm
11 http://www.cesa-tr.org/CPAL.htm
12http://www.cesa-tr.org/Cesanews.htm
13 http://www.cesa-tr.org/Cesabooks.htm
47
View publication stats

Cesa News 150

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Cesa News 150

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

On the moths of Mutki district (Bitlis Province, East Turkey) (Lepidoptera)

Article · December 2017

Muhabbet Kemal Ahmet Ömer Koçak

SEE PROFILE SEE PROFILE

The user has requested enhancement of the downloaded file.

On the moths of Mutki district (Bitlis Province, East Turkey)

Muhabbet Kemal 2 Ahmet Ömer Koçak

List of the species

1.Alucita aff. cancellata (Meyrick,1908) (Fig. 43)

2.Arctia(Epicallia) villica (Linnaeus,1758)

3.Eilema (Manulea) palliatella (Scopoli,1763) (Figs. 44, 46)

4.Eilema (Manulea) pseudocomplana (Daniel,1939) (Fig.1)

5.Eilema (Muscula) brevifurca (Wiltshire,1957) (Figs. 45, 47)

6.Euplagia splendidior (Tams,1922) (Fig. 2)

7.Phragmatobia placida (Frivaldsky,1835)

8.Utetheisa(s.str.) pulchella (Linnaeus,1758)

9.Choreutis muhabbet Koçak,2008

10.Coleophora sp. (Fig.3)

11.Eteobalea dohrnii (Zeller,1847) (Fig.4)

12.Cilix asiatica A.Bang-Haas,1907

13.Watsonalla binaria (Hufnagel,1767) (Fig.5)

14.Ethmia similis Sattler,1967

15.Aristotelia aff. subdecurtella (Stainton,1859)-complex

16.Aroga aristotelis (Millière,[1876]) (Figs.48, 49)

18.Syncopacma polychromella (Rebel,1902)

19.Aplasta ononaria (Fuessly,1783)

20.Apochima diaphanaria (Püngeler,1904)

21.Camptogramma bilineatum (Linnaeus,1758) (Fig.6)

22.Cataclysme riguata (Hübner,[1813]) (Figs.7, 50, 51)

23.Catarhoe cuculata (Hufnagel,1767)

24.Catarhoe permixtaria (Guenée,[1858])

25.Cyclophora punctaria (Linnaeus,1758) (Figs.52-54)

26.Docirava mundulata (Guenée,[1858])

27.Eilicrinia cordiaria (Hübner,1790) (Fig.8)

28.Ematurga atomaria (Linnaeus,1758)

29.Ennomos (Deuteronomos) fraxineti Wiltshire,1947 (Fig.9)

32.Gnopharmia colchidaria (Lederer,1870) (Figs. 55-58)

33.Hypomecis punctinalis (Scopoli,1763)

36.Neognopharmia stevenaria (Boisduval,1840)

37.Proteuchloris neriaria (Herrich-Schäffer,[1852])

38.Rhodostrophia cuprinaria (Christoph,1876) (Fig.10)

39.Scopula decorata ([Denis & Schiffermüller],1775) (Fig.11)

40.Scopula immistaria (Herrich-Schäffer,[1852])

41.Scopula submutata (Treitschke,1828)

42.Scopula ornata (Scopoli,1763)

43.Siona lineata (Scopoli,1763)

44.Stegania dilectaria (Hübner,1790)

45.Thetidia persica Hausmann,1996 (Figs.59, 60)

47.Lasiocampa eversmanni (Kindermann,1843)

48.Lasiocampa grandis (Rogenhofer,1891) (Fig.12)

49.Malacosoma castrensis (Linnaeus,1758)

50.Malacosoma neustrium (Linnaeus,1758)

51.Pachypasa otus (Drury,[1773]) (Fig.13)

52.Eurodachtha nigralba Gozmany,1978

53.Odites (Gozmaniola) kollarella (Costa,[1836])

54.Euproctis chrysorrhoea (Linnaeus,1758)

55.Euproctis melania (Staudinger,1892)

56.Lymantria dispar (Linnaeus,1758) (Fig.14)

57.Parocneria detrita (Esper,[1785])

58.Agrotis ipsilon (Hufnagel,1766)

59.Agrotis segetum ([Denis & Schiffermüller],1775)

60.Amphipyra micans Lederer,1857