Biomaterials 264 (2021) 120390

Contents lists available at ScienceDirect

Biomaterials
journal homepage: www.elsevier.com/locate/biomaterials

Targeted silver nanoparticles for rheumatoid arthritis therapy via

macrophage apoptosis and Re-polarization
Yihua Yang a, b, 1, Lina Guo a, 1, Zhe Wang a, Peng Liu a, Xuanjun Liu a, Jinsong Ding a,
Wenhu Zhou a, *
a
Xiangya School of Pharmaceutical Sciences, Central South University, Changsha, Hunan, 410013, China
b
Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, School of Pharmaceutical Sciences, Xuzhou Medical University, Xuzhou, Jiangsu, 221004, China

A R T I C L E I N F O A B S T R A C T

Keywords: Infiltration of inflammatory cells, especially the M1 macrophages that secrete various types of inflammation
Silver nanoparticles cytokines, play crucial roles in the pathogenesis of rheumatoid arthritis (RA). To relief synovial inflammation,
ROS scavenge M1 macrophages must be eliminated or switched to anti-inflammatory M2 phenotype. We herein developed folic
Macrophage polarization
acid modified silver nanoparticles (FA-AgNPs) that can actively deliver into M1 macrophages to synergistically
Rheumatoid arthritis
induce M1 macrophages reduction and M2 macrophages polarization for effective RA treatment. The AgNPs was
Targeted therapy
Nanomedicine facilely prepared, PEGylated and modified with FA to realize M1 macrophages targeting delivery via folate re­
ceptor overexpressed on M1 macrophages surface. After entering cells, FA-AgNPs dissolved and released Ag+ in
response to intracellular glutathione (GSH), which is the key element to exert a series of anti-inflammatory
functions, such as M1 macrophages apoptosis and reactive oxygen species (ROS) scavenging to facilitate M2
macrophages polarization, both of which contributed to RA treatment. This nano-system could passively accu­
mulate into inflamed joints, permit potent anti-inflammatory activity, and impose strong therapeutic efficacy in
mice RA models with high biosafety. After treatment, FA-AgNPs could be gradually cleared from the body mainly
via feces without tissue accumulation, and did not show any appreciable long-term toxicity. This work declares
the first example of using bio-active nanoparticles for RA treatment without loading any drugs, and highlights
the potential of FA-AgNPs for targeted RA therapy via simultaneous M1 macrophage apoptosis and M1-to-M2
macrophages re-polarization.

1. Introduction expected [7], accompanied by serious risks such as tuberculosis reac­

Rheumatoid arthritis (RA) is a type of chronic auto-immune disorder
that affects ~1% of the adult population [1]. The disease is character­
ized by progressive inflammation and persistent synovitis, leading to
bone and cartilage destruction, functional incapability, and ultimately
disability [2,3]. Currently, RA is still an incurable disease, and there are
three classes of medications commonly used in clinic, i.e., non-steroidal
anti-inflammatory drugs (NSAIDs), glucocorticoids (GCs), and
disease-modifying anti-rheumatic drugs (DMARDs). While they can
improve the symptoms and slow arthritis progression, high dosage and
frequent administration are often required to obtain satisfactory effi­
cacy, which inevitably cause untoward side-effects [4,5]. The biological
agents are also developed to prevent joint destruction by suppressing the
cytokines’ level [6], but the therapeutic benefits are not as good as
tivation and serious infections [8]. Therefore, novel therapeutic strate­
gies for RA treatment are still urgently warranted.
Recent years have witnessed a surge in the development of nano­
medicine for combating RA, with the purpose of bypassing the defects of
the current treatments. Due to the abnormal vessels and inflammatory
cell infiltration, the vascular permeability is remarkably improved in RA
site, which allows for the passive accumulation of nanocarriers through
so-called “ELVIS” effect (extravasation through leaky vasculature and
subsequent inflammatory cell-mediated sequestration) [9], similar to
the EPR effect observed in solid tumors. Because of this, a number of
nano-drug delivery systems have been demonstrated to effectively
deliver various kinds of drugs into RA site [10–13], resulting in
enhanced drug accumulation and reduced side-effects [14,15]. More­
over, since the inflammation-associated cells pathologically overexpress

* Corresponding author.
E-mail address: zhouwenhuyaoji@163.com (W. Zhou).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.biomaterials.2020.120390
Received 22 June 2020; Received in revised form 1 September 2020; Accepted 16 September 2020
Available online 19 September 2020
0142-9612/© 2020 Elsevier Ltd. All rights reserved.
Y. Yang et al.
certain receptors on cell membrane, actively targeted drug delivery
systems were also designed via surface modifications of specific recog­
nition ligands [10,16]. While significant efforts have been made, this
field is still in its infancy and there is still deficiency of nanomedicines
for effective RA management.
In RA, the synovial tissue is infiltrated by various inflammatory cells,
especially macrophages, which play crucial roles in the pathophysio­
logical responses [17]. The activated macrophages, termed M1 macro­
phages, produce a series of inflammation cytokines, such as TNF-α,
IL-1β, and IL-6, to sustain and aggravate joint inflammation [18].
Therefore, the M1 macrophages have been considered as an vital ther­
apeutic target to relive symptoms of RA [19]. For example, different
nano-vehicles have been developed for targeted delivery of metho­
trexate (MTX) into M1 macrophages [10,20]. Beside direct damaging
M1 macrophages using MTX, alternative strategies have also been
attempted to switch M1 type macrophages into anti-inflammatory M2
type by regulating microenvironment in inflamed joints [11,21]. M2
macrophages can secrete anti-inflammatory cytokines to relief inflam­
mation, while in arthritic joints the macrophages are predominantly
polarized to M1 subtype due to the specific inflammatory environment,
such as hypoxia-inducible factor (HIF-1α) expression and the high
reactive oxygen species (ROS) level [22]. As such, several studies have
employed ROS scavenging nanoenzymes to drive M2 polarization for
combating inflammatory diseases [23,24]. Collectively, targeting M1
macrophages by direct triggering cell death and inducing M1-to-M2
phenotypic transition could be a promising strategy for RA treatment,
while successful strategies to simultaneously achieve both goals are still
lacking.
AgNPs are a type of highly commercialized nanomaterial for
biomedical applications owing to ease of synthesis, readily modification,
and broad biological activities [25–30]. While it is still under debate, the
mechanisms of AgNPs for bio-functions are considered to be ROS
regulation, inflammasome formation, and the release of silver ions to
cause cell apoptosis [31–34]. Recently, AgNPs have been used as vehi­
cles to deliver anti-inflammatory drugs for RA treatment [35,36], and
interestingly, it was indicated that AgNPs on its own showed
anti-inflammatory activity and could promote M2 polarization [37,38].
We hypothesize that AgNPs with ROS regulation, cell apoptosis, and
anti-inflammatory activities might be a potential nanomedicine for RA
therapy, but we are unaware of any published attempts on this front.
In current work, we studied the therapeutic potential of AgNPs for
RA and demonstrated that AgNPs were highly effective for alleviating
inflammation via synergistic inducing M1 macrophage apoptosis and
M2 macrophage polarization (Scheme 1). The AgNPs were PEGylated to
improve the colloidal stability, and decorated with folic acid (FA) to
achieve active targeting towards the M1 macrophages. After physico­
chemical characterizations, the modified AgNPs (termed FA-AgNPs)
were investigated for in vitro/vivo targetability as well as therapeutic
effect. To have fundamental understanding, the mechanisms of AgNPs
for anti-rheumatic activity were also explored. Finally, the therapeutic
effects and safety of AgNPs were assessed after systemic administration
using an in vivo RA mice model. This work demonstrated for the first
time that AgNPs can potentially be used for therapy of RA.
2. Materials and methods
2.1. Materials, cells and animals
2.1.1. Materials
Folic acid (FA) was from Sinopharm Chemical Reagent Co., Ltd
(Shanghai, China), and α-lipoyl-ω-amino poly (ethylene glycol) (LA-
PEG-NH2) was purchased from Hunan huateng pharmaceutical Co., Ltd.
(Changsha, China). Methylene blue (MB), Glutathione (GSH) and 2′ ,7′ -
dichlorodihydrofluorescein diacetate (DCFH-DA) probe were obtained
from Macklin Co., Ltd (Shanghai, China). LysoTracker Red was pur­
chased from Solarbio Biotech Co., Ltd (Beijing, China).
2
Biomaterials 264 (2021) 120390
Lipopolysaccharide (LPS) was from Biosharp Co., Ltd (Beijing, China).
Bovine Type II collagen was obtained from Chondrex (Washington DC,
USA). Silver nitrate, sodium borohydride (NaBH4), 3-(4,5-dimethylth­
iazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), complete Freund’s
adjuvant and incomplete Freund’s adjuvant were from Sigma-Aldrich
Co., Ltd (St. Louis, MO, USA). Chlorpromazine hydrochloride, nystatin
and colchicine were purchased from Aladdin (Shanghai, China). L-
cysteine was from Shanghai Boao biotechnology Co., Ltd (Shanghai,
China). Annexin V-FITC Apoptosis Detection Kit was provided by BD
biosciences Co., Ltd (San Jose, CA, USA). TRIzol reagent, First Strand
cDNA Synthesis Kit and qPCR Detection Kit were bought from Thermo
Fisher Scientific Co., Ltd (MA, USA). The primers of IL-1β, IL-6, TNF-α,
Arg-1, IL-10 and housekeeping gene of GAPDH were designed by Qingke
Biotech (Changsha, China). The antibodies of folate receptor beta, CD68,
iNOS and CD206 were from GeneTex (USA), Abzoom (USA), Boster
(Wuhan, China) and Protein tech (Wuhan, China), respectively. TUNEL
Apoptosis Assay Kit was purchased from Boster (Wuhan, China). Dul­
becco’s modified Eagle’s medium (DMEM), penicillin-streptomycin so­
lution, phosphate buffered saline (PBS), and fetal bovine serum (FBS)
were purchased from Gibco Life Technologies, Inc. (Grand Island, NY,
USA). Methanol (HPLC grade) was purchased from Tedia Co., Ltd (USA).
2.1.2. Cells
Murine macrophage cells (RAW264.7) were obtained from Xiangya
cell center (Changsha, China). The cells were cultured in DMEM medium
supplemented with 10% FBS, 1% penicillin (50 U/mL) and streptomycin
(50 U/mL) in a 5% CO2 atmosphere at 37 ◦ C.
2.1.3. Animals
Male DBA/1 J mice (7–8 weeks old, 20 ± 2 g) were purchased from
Cavens animal Co., Ltd. (Changzhou, China), and maintained in a sterile
environment and allowed free access to food and water. All animal ex­
periments were approved by the Experimental Animal Ethics Committee
of Central South University and were carried out in accordance with the
requirements the National Act on the Use of Experimental Animals
(People’s Republic of China).
2.2. Synthesis of LA-PEG-FA
Under magnetic stirring, FA (500 μmol, 220.5 mg), DCC (550 μmol,
113.5 mg) and NHS (550 μmol, 63.5 mg) were mixed in anhydrous
DMSO (20 mL). After 6 h reaction, the solution was added to a DMSO
solution (10 mL) containing LA-PEG3400-NH2 (100 μmol, 360 mg). After
72 h reaction, 15 mL deionized water was added, and the insoluble
precipitate was removed by filtration. The product was sequentially
dialyzed against PBS (for 72 h) and water (for 48 h) with MWCO of 3500
Da. The dialysis medium was replaced every 12 h. Then the product was
lyophilized for 24 h and stored at − 20 ◦ C for further characterizations.
2.3. Preparation and characterizations of FA-AgNPs
AgNPs was synthesized according to the previous reported procedure
[39]. Briefly, 1.2 mL trisodium citrate (100 mM) and 4 mL freshly pre­
pared NaBH4 (100 mM) were mixed with 390.8 mL water via stirring in
ice bath. Then, 4 mL AgNO3 (10 mM) was added, followed by 30 min
reaction. AgNPs was collected by centrifugation and resuspended in
water. Then, the FA-AgNPs was prepared by conjugating LA-PEG-FA
with AgNPs through Ag–S bond. Briefly, 36 mL of AgNPs (0.42 nM)
were mixed with 20 mg of LA-PEG-FA under magnetic stirring in the
dark. After 24 h reaction, the resultant nanoparticles were collected by
centrifugation at 20,000 rpm for 30 min at 4 ◦ C, and the pellets were
washed and resuspended in water, and stored at 4 ◦ C for further use. The
particle size, polydispersity index (PDI) and zeta potential were deter­
mined by using Malvern Zeta Sizer Nano series (Nano ZS, Malvern In­
struments, UK) at 25 ◦ C. The morphologies were observed by using
transmission electron microscopy (TEM) (Titan G2-F20, FEI, USA). The
 Y. Yang et al.
3

Biomaterials 264 (2021) 120390

Scheme 1. Schematic illustration of the therapeutic mechanism of FA-AgNPs against RA. FA-AgNPs dissolve and release Ag+ in response to intracellular GSH, which synergistically induces M1 macrophages apoptosis
and scavenge ROS to cause the polarization of M1 macrophages to M2 phenotype in inflamed synovial joints.
Y. Yang et al.
stability studies were conducted by adding various concentrations of
NaCl, and the UV–vis spectra of the nanoparticles were measured by UV
Spectrophotometer. To prepare FITC-labelled NPs, the LA-PEG-FITC
instead of LA-PEG-FA was used and performed as described above.
2.4. Ag+ release study
The Ag+ release was assessed by membrane-free dissolution method.
The release media was 10 mM phosphate buffer solutions (pH 7.4, 5.5)
without or with 10 mM GSH. Typically, FA-AgNPs were dissolved by
different media under mechanical shaking (100 rpm) at 37 ◦ C. At pre­
determined intervals, sample was withdrawn and centrifuged, the su­
pernatant of Ag+ content was detected by an inductively coupled plasma
mass spectrometer (ICP-MS).
2.5. ROS scavenging activity assay
2.5.1. Catalase-like activity
The catalase-like activity of AgNPs and AgNO3 was studied by
measuring the oxygen generation using portable dissolved oxygen meter
(JPBJ-609L, INESA Scientific Instrument Co., Ltd., China). Briefly,
AgNPs (42 nM) or AgNO3 (10 mM) was added to an equal volume of
H2O2 (100 mM), and the oxygen generation was monitored every 10 s
for 160 s.
2.5.2. Hydroxyl radical scavenging activity
The hydroxyl radical (⋅OH) was generated via Mn2+-mediated
fenton-like reaction according to our previous reported procedure [40].
Meanwhile, AgNPs (8.4 nM) or AgNO3 (2 mM) and MB (10 μg/mL) was
added. After incubating at 37 ◦ C for 30 min, the UV–vis spectra within
400–800 nm was measured using microplate reader (Infinite M200 PRO,
TECAN, Austria).
2.6. Cellular uptake study
The RAW264.7 cells were seeded onto 24-well plates at density of 4
× 104 cells per well, and cultured for 48 h in the absence or presence of
lipopolysaccharide (LPS, 10 μg/mL). Then, the cells were treated with
FITC-labelled NPs for 2 h, followed by washing three times with PBS (pH
7.4). The cells were fixed with 4% paraformaldehyde for 20 min, and
stained with DAPI for 10 min. Internalization was observed by using
fluorescent microscopy. To quantify the internalization, the cells were
seeded onto 6-well plates at density of 2 × 105 cells per well, and the
same treatments were performed as described above. After washing in
triplet with PBS (pH 7.4), the cells were collected and the fluorescence
intensity was assessed by flow cytometry (FACSVerse, BD, USA). To
examine the uptake mechanism, the cells were pretreated with 1 mM
free folic acid (FA) for 1 h before incubating with FITC-labelled NPs.
To study the uptake mechanism, the activated macrophages were
treated with chlorpromazine (10 μg/mL), nystatin (15 μg/mL) or
colchicine (5 μg/mL) for 1 h under cell culture conditions. After this
pretreatment, the medium was replaced by serum-free medium con­
taining FITC-labelled FA-AgNPs and incubated for 4 h followed by
washing three times with PBS. Subsequently, the cells were harvested,
washed with PBS for several times and resuspended in PBS. The fluo­
rescence intensity was analyzed by flow cytometry (FACSVerse, BD,
USA) with 10,000 events collected.
To examine the subcellular localization, the cells were seeded in 35
mm confocal dishes at density of 2 × 105 cells per dish, incubated
overnight and activated with LPS (10 μg/mL) for 48 h. Then, the me­
dium was removed and FITC-labelled FA-AgNPs were added. After in­
cubation for 2 h, 4 h or 12 h, the cells were washed three times with PBS
and incubated with pre-warmed Lysotracker Red (1:20,000) for 1 h at
37 ◦ C. Then the cells were fixed with 4% paraformaldehyde for 15 min
and the nuclei were stained with DAPI (1 μg/mL), followed by observing
using confocal laser scanning microscope (CLSM).
4
Biomaterials 264 (2021) 120390
2.7. In vitro cytotoxicity study
RAW264.7 cells were seeded into 96-well plates at density of 5 × 103
per well and activated by LPS (10 μg/mL) for 48 h. After removing the
medium and washing twice with PBS, the cells were incubated with
different formulations (diluted by cell culture medium) for 48 h. Then,
20 μL of MTT solution (5 mg/mL) was added. After 4 h, 100 μL of DMSO
was added, and the absorbance was detected at 490 nm using microplate
reader (Infinite M200 PRO, TECAN, Austria).
2.8. Cellular apoptosis assay
RAW264.7 cells were seeded onto 6-well plates at density of 2 × 105
cells per well and activated by LPS (10 μg/mL) for 48 h. Subsequently,
0.9 nM of FA-AgNPs were added for 4, 12, 48 h incubation, respectively.
The cells were collected and suspended with 500 μL PBS. Then, 5 μL
FITC-Annexin and 5 μL PI were added. The apoptosis rate was deter­
mined by flow cytometry (FACSVerse, BD, USA).
2.9. Imaging of reactive oxygen species
The RAW264.7 cells were seeded onto 24-well plates at density of 4
× 104 cells per well, and stimulated by LPS (10 μg/mL). After 48 h, the
cells were treated with 0.8 nM of AgNPs, FA-AgNPs, or 10.3 μM AgNO3
for 24 h. Then, 10 μM of DCFH-DA was added and incubated for 30 min.
The cells were then imaged by fluorescent microscopy. To quantify the
ROS level, the cells were seeded onto 6-well plates at density of 2 × 105
cells per well, and the same treatments were performed as described
above. The cells were harvested and the fluorescence intensity was
measured by flow cytometry (FACSVerse, BD, USA).
2.10. Macrophage phenotype transition study
For immunofluorescence staining, RAW 264.7 cells were seeded in a
24-well plate with coverslips and activated with LPS (10 μg/mL) for 48
h. The cells were then incubated with FA-AgNPs (0.8 nM) for 48 h,
followed by fixing with 4% paraformaldehyde. Then, the cells were
incubated with primary antibodies against CD68 (1:100), iNOS (1:50) or
CD206 (1:50) at 4 ◦ C overnight and then incubated with respective
fluorescent-labelled secondary antibodies for 30 min. The nuclei were
stained with DAPI and the cells were mounted. The samples were
observed with a fluorescent microscope. For RT-PCR quantification,
RAW264.7 cells were seeded onto 6-well plates at density of 2 × 105
cells per well and activated by LPS (10 μg/mL) for 48 h. Then, 0.8 nM of
FA-AgNPs were added. After 48 h, the cells were harvested and total
RNA was extracted using TRIzol reagent. The levels of mRNAs
(including IL-1β, IL-6, TNF-α, Arg-1 and IL-10) were determined by RT-
PCR (CFX-Connect, BIO-RAD, USA). Primer sequences were designed by
soft of primer 5.0 (Table 1).
2.11. Mice model of collagen-induced arthritis
The collagen-induced arthritis (CIA) mice model was established
according to a previous report [41]. First, two emulsions were prepared
by mixing 2 mg/mL bovine type II collagen with an equal volume of
Table 1
Primer sequences used for real-time PCR.
Gene Forward Primer (5′ to 3′ ) Reverse Primer (5′ to 3′ )
IL-1β ATGAAGGGCTGCTTCCAAAC TCTCCACAGCCACAATGAGT
IL-6 GGAGCCCACCAAGAACGATA ACCAGCATCAGTCCCAAGAA
TNF-α CTCATGCACCACCATCAAGG ACCTGACCACTCTCCCTTTG
Arg-1 TGGCTTGCGAGACGTAGAC GCTCAGGTGAATCGGCCTTT
IL-10 CTGGACAACATACTGCTAACCG GGGCATCACTTCTACCAGGTAA
GAPDH GGGTCCCAGCTTAGGTTCAT CCAATACGGCCAAATCCGTT
Y. Yang et al.
Complete Freund’s Adjuvant (for emulsion A) or Incomplete Freund’s
Adjuvant (for emulsion B) for overnight stirring in ice bath. On day 0,
the mice were administrated with 0.1 mL emulsion A via tail intravenous
injection. On day 21, a booster injection was given with emulsion B.
Mice were monitored daily for arthritis progression.
2.12. In vivo biodistribution of the nanoparticles
The CIA or healthy mice were injected intravenously with FITC
labelled FA-AgNPs, and the hind paws of mice were isolated and visu­
alized by in vivo imaging system (Caliper, Hopkington, MA, USA) 10 h
after administration. To quantify the Ag content, the hind paws were
grinded with liquid nitrogen, and placed in a mixed acid matrix of aqua
regia with heating overnight at 90 ◦ C, followed by an additional heating
at 140 ◦ C for 6 h to completely digest any organic compounds, and the
solution was analyzed by ICP-MS (Agilent 7500C).
2.13. Pharmacokinetic and excretion studies
The healthy mice were injected intravenously with FA-AgNPs, and
the venous blood, urine, and feces samples were collected at pre-
designated timepoints. The samples were mineralized in a high-
pressure microwave oven, followed by digestion using aqua regia as
described above. The Ag content was quantified by ICP-MS (Agilent
7500C).
2.14. Therapeutic efficacy in vivo
The CIA mice were divided into 4 groups (n = 6) for administration
of saline, MTX (5 mg/kg BW), MTX-AgNPs (0.652 nmol/kg BW) or FA-
AgNPs (0.652 nmol/kg BW). In parallel, the normal healthy mice
without any treatment were used as control. The treatment was started
at day 30 after the first immunization, and the mice were injected
intravenously with different formulations every other day for overall 10
times. The hind paw thickness and arthritis score were recorded every
other day. The arthritis scores of four paws were evaluated from 0 to 4
according to the following scale: 0 = no evidence of erythema or
swelling, 1 = erythema and mild swelling, 2 = erythema and mild
swelling extending from the ankle to the tarsals, 3 = erythema and
moderate swelling extending from the ankle to metatarsal joints, and 4
= erythema and severe swelling encompassing the ankle, foot, and digits
or ankylosis of the limb [41]. The maximum arthritis score of every
mouse was 16. On day 50 after first immunization, joint tissues were
sampled, and the total RNA was extracted by TRIzol reagent. The mRNA
levels of the pro-inflammatory cytokines were quantitated using
RT-PCR.
2.15. Histological analysis
After treatments, the mice were sacrificed, and ankle joints, spleen
and thymus were collected and fixed in 4% paraformaldehyde over­
night. Ankle joints were decalcified with 10% EDTA solution for 40 days.
Samples were embedded in paraffin and sliced into 4 μm-thick sections.
The tissue sections were stained with H&E. The images of sections were
obtained with a light microscope (Model IX71 Olympus, Tokyo, Japan).
The histological changes with synovial inflammation and cartilage
erosion of ankle joints were evaluated by HSS (histopathological scores
of synovium) [42,43].
2.16. Immunofluorescence staining
After deparaffinization, rehydration and antigen retrieval, the sec­
tions of ankle joints were incubated with primary antibodies against
iNOS (1:50) and CD206 (1:100) at 4 ◦ C overnight, and then incubated
with fluorescent-labelled secondary antibodies for 30 min. After being
counterstained with DAPI, the sections were imaged using a fluorescent
5
Biomaterials 264 (2021) 120390
microscope.
2.17. Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP Nick
End Labeling (TUNEL) staining
After deparaffinization, rehydration and permeation with proteinase
K and 0.1% Triton X100, the sections of ankle joints were blocked by 3%
H2O2-methanol solution. After that, TUNEL staining was conducted at
37 ◦ C for 60 min. Then, the sections were stained with DAPI. The images
were recorded with a fluorescent microscope.
2.18. Safety evaluation in vivo
To evaluate the safety of each formulation, the serum of mice was
collected after treatment, and the levels of aspartate aminotransferase
(AST), alanine aminotransferase (ALT), blood urea nitrogen (BUN) and
creatinine (Cre) were measured by using the standard kits according to
the manufacturer’s instructions.
2.19. Long-term toxicity test
The healthy mice were injected with FA-AgNPs (0.652 nmol/kg)
every other day for overall 10 times. After the final injection, the body
weights were monitored, and the mice were sacrificed at day 28 to
measure the hematological and clinical biochemistry indexes. The main
organs were collected for histological analysis. To study the tissue
accumulation, the healthy mice were treated with FA-AgNPs as
described above. The mice were sacrificed at day 1, 7, or 28 after the
final injection, and the main organs were collected to measure the Ag
content.
2.20. Statistical analysis
All quantitative data were expressed as mean ± SD from at least
triplicate measurements. Differences between two comparative groups
were assessed using the Student’s t-test, and the significance among
multiple groups was examined by the one-way analysis of variance
(ANOVA). Significance was measured at the following thresholds: *P <
0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
3. Results and discussions
3.1. Preparation and characterizations of FA-AgNPs
The heterofunctional α-lipoyl-ω-folic poly (ethylene glycol) (abbre­
viated as LA-PEG-FA) was synthesized by conjugating FA with α-lipoyl-
ω-amino poly (ethylene glycol) (LA-PEG-NH2, MW = 3600) through
DCC/NHS coupling chemistry, and the conjugation was confirmed by
UV–vis, FT-IR and 1H- NMR characterizations (Figure S1). The conju­
gation efficiency was quantified by HPLC measurement, and ~45% of
LA-PEG was modified with FA (Figure S2), indicating high conjugation
ratio. Citrate capped silver nanoparticles (AgNPs) were synthesized
using NaBH4 as reductant according to the procedure reported previ­
ously [39]. From transmission electron microscopy (TEM), the particles
were roughly spherical with uniformed size (Fig. 1A). The LA-PEG-FA
was anchored on the surface of AgNPs via Ag-sulfide bond (Scheme
1), resulting in surface FA-modified AgNPs (termed as FA-AgNPs), which
were purified by centrifugation to remove unreacted LA-PEG-FA. The
FA-AgNPs can be easily dispersed in aqueous solution, and the spherical
morphology of FA-AgNPs was retained (Fig. 1B). After surface
LA-PEG-FA modification, the zeta potential of AgNPs changed from
− 16.6 mV to − 4.2 mV, due to the surface displacement of negatively
charged citrate by LA-PEG-FA.
Both AgNPs and FA-AgNPs showed strong UV absorption peak at
~400 nm, indicating no aggregation during the LA-PEG-FA conjugation
(Fig. 1C) [39]. We then studied the colloidal stability of the
Y. Yang et al.
Fig. 1. TEM micrographs of (A) AgNPs and (B) FA-AgNPs. (C) UV–vis spectra of AgNPs and FA-AgNPs. Colloidal stability of (D) AgNPs and (E) FA-AgNPs as a
function of NaCl concentration indicated by UV–vis spectra. Inset: The photographs of these samples. Storage stability of (F) AgNPs and (G) FA-AgNPs at 4 ◦ C and
25 ◦ C. Size was measured at predetermined time within 60 d. Data were presented as mean ± SD (n = 3). (H) In vitro Ag+ release from FA-AgNPs under various
conditions. The pHs were buffered by phosphate buffer solution, and the GSH concentration was 10 mM.
nanoparticles. With increasing NaCl concentration, the brown color of
AgNPs gradually faded, concomitant with the decrease of UV absorption
(Fig. 1D). Therefore, AgNPs alone are prone to aggregation at high salt
concentration, probably due to the charge screen effect of the salt to
attenuate the negative repulsion between each AgNPs. After LA-PEG-FA
modification, in contrast, the stability of FA-AgNPs was markedly
enhanced to tolerate 200 mM NaCl without obvious color and UV ab­
sorption changes (Fig. 1E). In addition, the LA-PEG-FA conjugation
could stabilize AgNPs for at least 60 d (Fig. 1F and G). This improved
stability can be attributable to the steric hindrance effect provided by
PEG.
AgNPs are known to undergo gradual dissolution to release Ag+ in
aqueous solution, leading to non-specific toxic effects on various or­
ganisms during in vivo circulation [44,45]. To predict the biological fate
of the FA-AgNPs, the release of Ag+ was studied at different conditions.
We first dissolved the nanoparticles into phosphate buffer solution (pH
7.4) to mimic physiological environment. After 48 h, no Ag+ was
detected by ICP-MS (Fig. 1H, black trace). The pH was then decreased to
5.5, but again Ag+ barely released (Fig. 1H, red trace). Finally, we
simulated the cytoplasm condition by adding 10 mM GSH, and in this
case a time-dependent Ag+ release was observed, with a cumulative
release ~80% after 48 h (Fig. 1H, blue trace). This GSH-responsive Ag+
release would be ascribed to the thiophilic nature of Ag+ to strongly bind
GSH, thus facilitating the dissolution of Ag+ from AgNPs surface. Note
that the GSH level is ~2–10 mM in living cells while only 2–20 μM in
extracellular fluids [46]. Therefore, the FA-AgNPs could remain stable
under physiological conditions, but rapidly release Ag+ to exert bio­
logical functions after delivering into the target cells, thus minimizing
the undesirable side-effects.
3.2. In vitro cellular uptake
We next explored cellular uptake of the FA-AgNPs by using RAW
264.7 cells (a macrophage cell line) as model. The cells were activated
by lipopolysaccharide (LPS) to stimulate the inflammation statement for
M1 polarization according to a previous report [47], and the successful
activation was validated by significant increases of cytokines including
TNF-α, IL-1β and IL-6 (Figure S3). To track the FA-AgNPs inside cells, the
particles were labelled with FITC fluorophore, and the location of the
cells were visualized by staining the cell nuclei with DAPI.
6
Biomaterials 264 (2021) 120390
After 2 h incubation, the activated macrophages displayed strong
green fluorescence throughout the cells, indicating substantial cellular
uptake (Fig. 2A). For the normal macrophages (without LPS stimula­
tion), in contrast, only weak green fluorescence was seen in part of the
cells. We reason that this difference can be ascribed to the over­
expression of folate receptor beta (FR-β) on the membrane of the acti­
vated macrophages, which facilitates the cellular uptake of FA-AgNPs
through the specific interaction between FA and FR [48,49]. To confirm
this, we assessed the FR-β on cell surface by immunofluorescence
staining, which confirmed the significant up-expression of FR-β after LPS
activation (Figure S4). To further declare the contribution of FR-β for
FA-AgNPs internalization, we pre-treated the cells with free FA to
abolish the FR-β pathway, and in this case, we can hardly observe green
fluorescence inside cells. For comparison, we also prepared PEGylated
AgNPs with methotrexate (MTX) modification (MTX-AgNPs). MTX is a
FA analogue, while its binding affinity toward folate receptor is >
100-fold lower than that of FA [50]. In addition, after conjugation with
PEG polymer, the bioactivity of MTX was strongly passivated
(Figure S5). Therefore, MTX-AgNPs is an excellent control to study the
targetability of FA-AgNPs. As expected, MTX-AgNPs also showed mini­
mal internalization. All these results confirmed that the FR-mediated
uptake pathway plays a major role for intracellular delivery of
FA-AgNPs into the activated macrophages.
To have a quantitative characterization, the flow cytometry experi­
ments were performed (Fig. 2B), and the fluorescent intensities were
quantified (Fig. 2C). For FA-AgNPs, the activated macrophages dis­
played ~5-fold higher fluorescence than normal macrophages, demon­
strating the targeting ability. However, the intensity of MTX-AgNPs was
rather low in both activated macrophages and normal macrophages.
Free FA pre-treatment, on the other hand, strongly decreased the in­
tensity of FA-AgNPs in the activated macrophages. Overall, the flow
cytometry results were highly in accordance with the above fluorescent
microscopy studies. It should be noted that the normal macrophages
showed only minimal uptake for both MTX-AgNPs and FA-AgNPs, which
can be attributable to the hydrophilic layer of PEG on particle surface
[51]. Therefore, the surface PEG modification would protect the nano­
particles from non-specific mononuclear phagocyte system (MPS)
clearance, which is important for prolonged circulation half-life and
better targeting delivery toward RA site through “ELVIS” effect [14,52].
In general, the nanoparticles are internalized by the cytomembrane
Y. Yang et al. Biomaterials 264 (2021) 120390

Fig. 2. (A) Fluorescent images of RAW 264.7 cells and activated RAW 264.7 cells (by LPS) treating with FITC-labelled FA-AgNPs or MTX-AgNPs for 2 h. The FR-
mediated uptake of FA-AgNPs were explored by pretreating the cells with 1 mM free FA. Scale bar = 100 μm. (B) Flow cytometry images of RAW 264.7 cells and
activated RAW 264.7 cells after incubating with FITC-labelled FA-AgNPs (in absence or presence of 1 mM free FA) or MTX-AgNPs for 2 h. (C) Quantified fluorescence
intensity from (B). For B and C, the control means the cells without any treatment. (D) Relative cellular internalization of FA-AgNPs without or with pretreatment of
various endocytosis inhibitors. (E) CLSM images of activated RAW264.7 cells incubated with FITC-labelled FA-AgNPs for various time periods. Scale bar = 25 μm.

to form endosomes through different endocytosis pathways. To study
the detailed uptake mechanism, the cells were pre-treated with several
inhibitors, including nystatin, chlorpromazine (CPZ) and colchicine,
which prevents caveolin-, clathrin- and macropinocytosis-mediated
endocytosis, respectively [53,54]. All types of inhibitors were able to
decrease FA-AgNPs uptake to some extent, and among them CPZ was the
most effective one (Fig. 2D). Therefore, FA-AgNPs was predominately
internalized by clathrin-mediated endocytosis, which is in agreement
with other FA-modified nanoparticles reported previously [55]. To
further track the intracellular fate of FA-AgNPs, time-dependent cellular
uptake was studied. After 2 h incubation, the fluorescence of FA-AgNPs
showed good co-localization with endo- and lysosomes stained red by
Lysotracker, confirming the endocytotic internalization (Fig. 2E). The
green fluorescence was intensified with longer incubation time because

7
Y. Yang et al. Biomaterials 264 (2021) 120390

of more FA-AgNPs assimilation, and the fluorescence was mostly local­ AgNPs, likely due to the higher cellular uptake induced by FA decora­
ized in the cytoplasm with minimal distribution in cell nuclei. tion. For normal macrophages, on the contrary, the trend was reversed
that AgNPs was much more toxic than FA-AgNPs (~3-fold higher). This
can be explained by surface PEG modification that impedes FA-AgNPs
3.3. In vitro cytotoxicity
uptake by normal macrophages. These results suggest a selective
toxicity of FA-AgNPs towards the inflammatory cells against the normal
Having demonstrated targeting capability of FA-AgNPs, we then
macrophages (the IC50 value was 2-fold lower). Therefore, the FA-AgNPs
surveyed cellular cytotoxicity by using MTT test, and the unmodified
could specifically suppress inflammation cells with much less influence
AgNPs were used as control. After 48 h treatment, the viability of both
on the essential functions of immunity system.
normal macrophages (Fig. 3A) and activated macrophages (Fig. 3B)
The cytotoxicity of AgNPs has been reported in several cancer cells,
decreased in a dose-dependent manner. Notably, the activities of these
which proposed that the release of Ag+ in the cytosol plays a critical role
two nanoparticles were variant dependent on the cell lines. To quantify
[32]. From the above experiments, we have demonstrated that
these differences, the IC50 values were measured (Fig. 3C). For activated
FA-AgNPs could release Ag+ with the aid of GSH. To explore effect of
macrophages, the FA-AgNPs showed ~3-fold higher activity than

Fig. 3. In vitro viability test of (A) RAW 264.7 cells and (B) activated RAW 264.7 cells in presence of different concentrations of AgNPs and FA-AgNPs after 48 h
incubation. (C) IC50 values calculated from (A) and (B). (D) Viability of the activated RAW 264.7 cells in presence of 0.5 mM Cys as a function of FA-AgNPs
concentration after 48 h incubation. (E) The apoptosis of the activated RAW 264.7 cells after treatment of 0.9 nM FA-AgNPs with variant time periods.

8
Y. Yang et al.
Ag+ release, we first incubated the activated macrophages with different
concentrations of AgNO3, and the IC50 value was calculated to be 11.9
μM (Figure S6), corresponding to 0.05 nM FA-AgNPs with the same mass
amount of Ag atom. Therefore, free Ag+ was much more toxic than
FA-AgNPs (the IC50 value of FA-AgNPs was 0.92 nM). We then incubated
the cells with FA-AgNPs in presence of 0.5 mM cysteine (Cys), a strong
Ag+ chelator that can abolish the biological functions of Ag+ inside cells.
Cys itself was non-toxic to cells (Figure S7), but it can strongly alleviate
the toxic effect of FA-AgNPs (Fig. 3D). Therefore, the released Ag+ from
FA-AgNPs should play a vital role for cell cytotoxicity.
To further study the cellular inhibitory effect of FA-AgNPs, the
Annexin V/PI assay was carried out to evaluate the mode and extent of
cell death. With 0.9 nM FA-AgNPs treatment, the percentage of
apoptotic cells gradually increased over time, reaching 50% after 48 h
incubation (Fig. 3E). This result was highly consistent with the IC50
value measured by MTT assay. Therefore, the FA-AgNPs damage cells
mainly through apoptotic cell death.
Fig. 4. (A) Fluorescent images and (B) flow cytometry of the cells with different treatments and then stained with ROS fluorescent probe DCFH-DA. Scale bar = 100
μm. (C) Quantified fluorescence intensity from (B). (D) The kinetics of O2 generation monitored by portable dissolved oxygen meter. (E) Hydroxyl radical scavenging
activity of AgNPs and Ag+ probed by MB.
9
Biomaterials 264 (2021) 120390
3.4. ROS scavenging capability
Oxidative stress refers to the production of reactive oxygen species
(ROS) to cause intracellular anti-oxidant imbalance, leading to a series
of cellular dysfunctions. Previous studies have shown that ROS are
implicated in the pathophysiology of RA, and strategies for regulating
ROS have been employed for the treatment of RA [24,56]. There are
different types of ROS in the activated macrophages, including
non-radical species (H2O2, singlet oxygen 1O2, etc.) and radical species
(superoxide anion O⋅-2 , hydroxyl radical ⋅OH, etc.). To study the ROS
scavenging activity of FA-AgNPs in activated macrophages, the
2′ -7′ -dichlorodihydrofluorescein diacetate (DCFH-DA) was used as a
probe to fluorescently monitor the total intracellular ROS level. After
diffusion into cells, the DCFH-DA probe is deacetylated to DCFH by
cellular esterase, and further oxidized by ROS to yield green fluorescent
DCF for ROS monitoring. Before LPS stimulation, no apparent fluores­
cence was detected inside cells, indicating low ROS level (Fig. 4A). The
LPS treatment significantly improved the ROS level as evidenced by the
Y. Yang et al.
bright fluorescence emission, leading to severe oxidative stress. We then
treated the activated macrophages with AgNPs or FA-AgNPs for 24 h,
and as expected, the ROS level markedly decreased (Fig. 4A), confirming
strong ROS scavenging activity.
It is interesting to note that several studies have shown the ROS
regulation capability of AgNPs [31,57], and AgNPs is known to kill
cancer cells by producing ROS to damage intracellular constituents and
cause cell apoptosis [31]. In our case, however, AgNPs act as ROS
scavenger to down-regulate the ROS level. These discrepancy results
may be due to the different intracellular environment, as the activated
macrophage is pathologically featured with high oxidative pressure.
Such environment-dependent properties of nano-materials have been
noticed previously. For example, iron oxide nanoparticles could switch
peroxidase-like activity for free radical production to catalase-like ac­
tivity for ROS scavenging with pH increase [58]. We reason that the ROS
regulation activity of AgNPs is partially controlled by intracellular ROS
level.
Since FA-AgNPs could rapidly release Ag+ in response to intracel­
lular GSH, we next test whether such released Ag+ has any effect on ROS
scavenging. To do this, the cells were treated with free Ag+, and inter­
estingly, the ROS level was significantly decreased. The relative fluo­
rescence intensity of each group was measured by flow cytometry
(Fig. 4B), which allowed for quantitative comparison (Fig. 4C). The LPS
stimulation increased the fluorescence by ~40-fold, indicating the
activation of the macrophage. The fluorescence intensity for AgNPs, FA-
AgNPs and Ag+-treated groups decreased by 14, 21, and 36-fold
respectively, compared with the non-treated control after 24 h incuba­
tion. The ROS scavenging activity was in order of Ag+ > FA-AgNPs >
AgNPs. Collectively, these findings revealed that FA-AgNPs could
effectively decrease intracellular ROS level to alleviate inflammation,
which is partly achieved by releasing Ag+. To further explore the
mechanism, we also studied the ROS scavenging activity in test tube by
using hydrogen peroxide (H2O2) and hydroxyl radical (⋅OH) as example
(Fig. 4D and E), since they are two major types of ROS in RA site.
Interestingly, the AgNPs could catalyze H2O2 decomposition while Ag+
could effectively scavenge ⋅OH, confirming their ROS scavenging
activity.
Fig. 5. (A) Immunofluorescence staining of CD68 (green), iNOS and CD206 (red), and nuclei (blue) on macrophages without or with treatment of FA-AgNPs. Scale
bar = 100 μm. The mRNA levels of (B) M1 macrophage markers (IL-1β, IL-6 and TNF-α), and (C) M2 macrophage markers (Arg-1 and IL-10) in activated macrophages
without and with treatment of FA-AgNPs. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)
10
Biomaterials 264 (2021) 120390
3.5. In vitro M1 to M2 phenotypic transition of macrophages
Macrophage can exist in two different phenotypes, i.e. pro-
inflammatory (M1) and anti-inflammatory (M2) phenotypes. In RA
joints, the macrophages are primarily of the M1 phenotype that pro­
motes RA progression by secreting various inflammatory cytokines [59].
Therefore, switching macrophage from M1 to M2 phenotype is a po­
tential method for the treatment of RA [24]. To examine capability of
FA-AgNPs for reprogramming macrophage, the phenotypes of the cells
were analyzed by immunofluorescence staining of CD68 (the
pan-macrophage marker), iNOS (M1 marker), and CD206 (M2 marker).
After FA-AgNPs treatment, the iNOS signal decreased while the immu­
nity of CD206 becomes more pronounced (Fig. 5A), suggesting effective
repolarization of macrophages from M1 to M2 type. To confirm this
result, the mRNA expression of macrophage markers, including IL-1β,
IL-6, TNF-α, Arg-1 and IL-10, were measured by using RT-PCR.
Compared to the non-treated cells, FA-AgNPs could significantly
decrease the expression of M1 markers (Fig. 5B), while increase the M2
markers (Fig. 5C). Therefore, FA-AgNPs can exert anti-inflammatory
activity by modulating macrophage polarization, and subsequent regu­
lating inflammation cytokines expression.
3.6. In vivo pharmacokinetics, excretion, and targetability
Having confirmed the therapeutic activity of FA-AgNPs in cell level,
we next studied the in vivo performances of the FA-AgNPs. The phar­
macokinetics and excretion of FA-AgNPs were first investigated in
healthy mice after a single intravenous injection by measuring the Ag
content using ICP-MS. The FA-AgNPs displayed a typical long-
circulation profile, with half-life of ~104 h (Fig. 6A), likely attribut­
able to its surface PEG modification. Notably, over 80% of the Ag con­
tent was cleared after 16 d, indicating biodegradability of the
nanoparticles. From Fig. 6B, it was clear seen that Ag was predominantly
excreted via feces, which is consistent with previous report [60]. The
cumulative excretion reached ~50% at day 8, in line with the above t1/2
data, and ~80% of total body burden was excreted at day 16, indicating
minimal body accumulation of Ag.
We then studied the in vivo behavior in collagen-induced arthritis
Y. Yang et al.
Fig. 6. (A) Kinetics of blood Ag concentration in mice following a single intravenous injection of FA-AgNPs. (B) Accumulated Ag content excreted in feces and urine
(inset). (C) Fluorescent image of FITC-labelled FA-AgNPs in joints of CIA mouse and normal mouse 10 h after injection of FA-AgNPs. (D) Quantified intensity from
(C). (E) The amount of Ag accumulated in the paws of CIA mouse and normal mouse 10 h after intravenous injection.
(CIA) model mice. The mice were injected with collagen to build the CIA
model according to a previous reported protocol [41], and the arthritis
symptoms were fully developed 30 days after immunization, charac­
terized by severe swelling around the ankle, foot and digits. To evaluate
the in vivo targeting efficiency, the FITC-labelled FA-AgNPs were intra­
venously administrated, and the fluorescence was detected using an
optical imaging system. Strong emission was observed in the inflamed
joints of CIA mouse, while the signal in the noninflamed paws of normal
mouse was much weaker (Fig. 6C), demonstrating the in vivo targeting
ability of the nanoparticles to selectively accumulate into the inflamed
joint. Such passively accumulation of nanoparticles into inflamed joints
has been demonstrated previously, which can be ascribed to the “ELVIS”
effect [11,61,62]. We then quantified the fluorescent intensity, and
~3-fold stronger intensity was obtained in inflamed paw (Fig. 6D). To
accurately identify the accumulation of FA-AgNPs in the inflamed joints,
we measured the mass of Ag in the paws using ICP-MS, and the result
was quite consistent with the fluorescent observation (Fig. 6E).
3.7. In vivo therapeutic efficacy on CIA mice
The therapeutic efficacy was measured by treating the CIA mice with
FA-AgNPs every other day for 20 days, and MTX was chosen as clinical
standard treatment. To confirm the targeted therapy of FA-AgNPs in
vivo, MTX-AgNPs were also tested for comparison. Compared with the
saline-treated mice, the mice subjected with each formulation showed
obvious improvement in the degree of swelling as well as much less
redness (Fig. 7A). While MTX and MTX-AgNPs displayed comparable
therapeutic effect (Fig. 7B and C), the FA-AgNPs achieved significantly
decreased clinical score and better end outcome, demonstrating the
superiority of targeted FA-AgNPs. Swelling ratios were quantified by the
examination of joint thickness, the results in each group agreed with the
clinical scores (Fig. 7D and E). We then measured the levels of pro-
inflammatory cytokines as another index to evaluate the therapeutic
efficacy. For the saline-treated mice, the cytokines including TNF-α, IL-
1β and IL-6 remained at high levels (Fig. 7F), while FA-AgNPs could
11
Biomaterials 264 (2021) 120390
reduce the cytokines almost to normal level, demonstrating a good anti-
inflammation activity. The cytokines levels also significantly decreased
after MTX-AgNPs and MTX treatment, while the efficacy was much
lower. Furthermore, the phenotypic alteration of synovial macrophages
in RA joints were evaluated by immunofluorescent staining of M1 (iNOS,
red) and M2 (CD206, green) markers (Fig. 7G). Compared with that of
normal mice, level of M1 macrophage-specific biomarker in inflamed
joints significantly increased, whereas the injection of each formulation
could reduce its level to different extent, accompanied by the increase of
M2 macrophage-specific biomarker. As expected, the FA-AgNPs dis­
played the most obvious for M1-to-M2 phenotypic transition, which
contributed to the best anti-inflammatory efficacy.
We then evaluate the final outcomes by histological examination
(Fig. 7H). The mice with saline treatment showed significant inflam­
mation, involving synovial hyperplasia, pannus formation and bone
destruction in the joints. The MTX-AgNPs and MTX-treated group
showed an obvious improvement of the symptoms, with less synovial
cell lining and milder bone destruction. Among them, the mice treated
with FA-AgNPs displayed the mildest inflammation with smooth artic­
ulation of the cartilage surface. We quantified the histological changes
with synovial inflammation and cartilage erosion of ankle joint by HSS,
and the scores were in order of FA-AgNPs < MTX-AgNPs < MTX < Saline
(Fig. 7I). In addition, based on TUNEL staining, the macrophage
apoptosis was observed after various treatment, and the overall trend
was consistent with the above therapeutic efficacy (Fig. 7J). Collec­
tively, all these in vivo results suggest good therapeutic effect of FA-
AgNPs, which is significantly better than that of the commercial drug
of MTX.
3.8. Safety evaluation of FA-AgNPs in vivo
For the safety concerns, the hepatotoxicity was evaluated by
measuring the serum levels of liver enzymes alanine transaminase (ALT)
and aspartate aminotransferase (AST) after treatment (Fig. 8A), and the
nephrotoxicity was tested by measuring blood urea nitrogen (BUN) and
Y. Yang et al. Biomaterials 264 (2021) 120390

(caption on next page)

12
Y. Yang et al. Biomaterials 264 (2021) 120390

Fig. 7. (A) Photographs of inflamed joints before and after different treatments. (B) The clinical scores calculated for the inflamed joints with different treatments as
a function of time. (C) The clinical score after 20 days of different treatments. (D) The paw thickness of the inflamed joints for different treatments as a function of
time. (E) The paw thickness after 20 days of different treatments. (F) The mRNA levels of TNF-α, IL-1β and IL-6 in joints of CIA mice after different treatments.
Healthy, un-treated animals served as control (normal). (G) Immunofluorescence analysis of M1 (iNOS, red) and M2 (CD206) macrophage markers in the joint after
treatment. Scale bars = 50 μm. (H) Hematoxylin-eosin (H&E) and (J) TUNEL staining of ankle joints from mice treated with different formulations. Arrows indicate
finger-like pannus formation and the asterisk stands for bone destruction. Scale bar = 100 μm. (I) Histopathology evaluations of joint synovium by HSS determined
from (H). (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 8. Evaluation of the (A) hepatotoxicity and (B) nephrotoxicity of each treatment by measuring the serum levels of ALT, AST, BUN and Cre. (C) Histopathological
analysis of spleen and thymus after treatments by staining with hematoxylin and eosin (H&E). Scale bar = 100 μm.

creatinine (Cre) (Fig. 8B). All these parameters were not changed after
FA-AgNPs and MTX-AgNPs treatment compared to normal animals,
suggesting minimal acute toxicity to liver and kidney. For MTX-treated
group, by contrast, considerable increase of AST and Cre levels were
noticed, which may be a sign of liver and renal damage after long-term
MTX administration. Indeed, the severe side-effects of MTX are major
limitations for its clinical RA therapy applications. Therefore, the FA-
AgNPs seems to be a better choice due to the higher efficacy and bio-
safety.
As FA-AgNPs function as an immunomodulator for RA therapy, we
then explored whether the nanoparticles had any effect on immune or­
gans by histopathological analysis (Fig. 8C). No obvious change was
observed from the hematoxylin and eosin (H&E) stained organs of
spleen and thymus. Collectively, all these results implied that FA-AgNPs
present a highly safe and effective platform for RA therapy.
3.9. Long-term toxicology evaluation of FA-AgNPs in vivo
As FA-AgNPs could be retained in mice body for a long period of time
after multiple injection, a systematic study was performed to evaluate
the in vivo long-term toxicity. Body weight usually reflects the health
condition of the treated mice. In general, the average body weights
gradually increased during the observation period of 28 days after FA-
AgNPs treatment (Fig. 9A), suggesting a well tolerance of the mice to­
ward FA-AgNPs at the therapeutically efficacious dose. We also
measured the tissue Ag content in main organs at day 1, 7, and 28 after
the final injection. The FA-AgNPs were mainly distributed in spleen,
liver and lungs (Fig. 9B), while low level of Ag accumulation in kidney
was observed, further suggesting that the FA-AgNPs was not primarily
excreted by urine. The Ag content gradually decreased overtime, and
most of the nanoparticles were removed from each organ after 28 days,
which is consistent with the above excretion results.
After 28 days treatment, the serum biochemical and hematological
parameters were measured to quantitatively evaluate the potential
toxicity of FA-AgNPs. Overall, while some parameters showed relatively
large standard deviations due to inter-animal variation, none of them
showed any significant changes compared to those of the mice without
any treatment. For routine blood examination, all parameters, such as
red blood cells, white blood cells, and platelets, were at a normal level
(Fig. 9C), indicating no significant risk associated with FA-AgNPs
treatment. In serum biochemical analysis, various parameters were
measured with particular attention paid to liver (e.g., ALP, ALT, AST)
and kidney (e.g., Cre, BUN) (Fig. 9D). Likewise, all indicators were
within normal ranges, suggesting no obvious injury to these organs.
Based on these results, the tissue damage was further evaluated by H&E
staining for the major organs (Fig. 9E), and no apparent histopatho­
logical abnormalities or lesions were observed in each organ. Collec­
tively, all these data indicate no significant long-term toxicity of FA-
AgNPs up to 28 days.
4. Conclusions
In summary, we developed FA-AgNPs that can alleviate inflamma­
tion by synergistic M1 macrophages reduction and M2 macrophages
induction for effective RA treatment. Mechanistic studies indicated that
the intracellular released Ag+ plays critical roles for this synergistic ef­
fect, which caused M1 macrophages apoptosis and ROS clearance to
allow M1-to-M2 re-polarization. FA-AgNPs were PEGylated to improve
colloidal stability and reduce non-specific opsonization, which enabled
passive accumulation into RA site through “ELVIS” effect. Surface FA

13
Y. Yang et al. Biomaterials 264 (2021) 120390

Fig. 9. (A) Body weight of the mice treated with multiple injections of FA-AgNPs for 28 days. (B) Distribution of Ag in main organs following multiple injection of
FA-AgNPs at different timepoints. (C) Hematological and (D) Serum biochemical parameters following multiple intravenous exposure to FA-AgNPs at day 28. (E)
Hematoxylin and eosin stained images of major organs from mice with multiple injection of FA-AgNPs at 28 days post-injection.

modification further mediated active delivery of the nano-system into
M1 macrophages to attenuate the joints inflammation in RA mice, which
showed much better efficacy than the current standard treatment of
MTX with higher biosafety. Besides, the FA-AgNPs could be excreted
from mice body and did not cause any obvious long-term toxicity in vivo.
Given the high commercialization of AgNPs for medical applications, we
can envisage that FA-AgNPs would be a promising clinical therapeutic
modality for RA therapy.
Data availability statement
The raw data and processed data required to reproduce these find­
ings are available from the corresponding author upon request.
CrediT author statement
Yihua Yang: Methodology, Conceptualization, performed the ex­
periments, Writing - original draft, read and approved the final manu­
script. Lina Guo: Methodology, Conceptualization, performed the
experiments, Writing - original draft, read and approved the final
manuscript. Zhe Wang: performed the experiments, read and approved
the final manuscript. Peng Liu: performed the experiments, read and
approved the final manuscript. Xuanjun Liu: performed the experi­
ments, read and approved the final manuscript. Jinsong Ding: Formal
analysis, Validation, read and approved the final manuscript. Wenhu
Zhou: Methodology, Conceptualization, Writing - original draft, read
and approved the final manuscript.

14
Y. Yang et al.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgement
This work was supported by Innovation-Driven Project of Central
South University (No. 20170030010004), National Natural Science
Foundation of China (No. 21804144, 81573374), Hunan Engineering
Research Center for Optimization of Drug Formulation and Early Clin­
ical Evaluation (No. 2015TP2005).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.biomaterials.2020.120390.
References
[1] J.M.W. Hazes, J.J. Luime, The epidemiology of early inflammatory arthritis, Nat.
Rev. Rheumatol. 7 (2011) 381–390.
[2] G. Schett, E. Gravallese, Bone erosion in rheumatoid arthritis: mechanisms,
diagnosis and treatment, Nat. Rev. Rheumatol. 8 (2012) 656–664.
[3] I.B. McInnes, G. Schett, The pathogenesis of rheumatoid arthritis, N. Engl. J. Med.
365 (2011) 2205–2219.
[4] Z.A. Khan, R. Tripathi, B. Mishra, Methotrexate: a detailed review on drug delivery
and clinical aspects, Expet Opin. Drug Deliv. 9 (2012) 151–169.
[5] J.N. Hoes, J.W.G. Jacobs, F. Buttgereit, J.W.J. Bijlsma, Current view of
glucocorticoid co-therapy with DMARDs in rheumatoid arthritis, Nat. Rev.
Rheumatol. 6 (2010) 693–702.
[6] H. Lee, S.H. Bhang, J.H. Lee, H. Kim, S.K. Hahn, Tocilizumab-alendronate
conjugate for treatment of rheumatoid arthritis, Bioconjugate Chem. 28 (2017)
1084–1092.
[7] D.L. Scott, F. Wolfe, T.W.J. Huizinga, Rheumatoid arthritis, Lancet 376 (2010)
1094–1108.
[8] J.A. Singh, G.A. Wells, R. Christensen, E.T. Ghogomu, L. Maxwell, J.K. MacDonald,
et al., Adverse effects of biologics: a network meta-analysis and Cochrane
overview, Cochrane Database Syst. Rev. (2011) 60.
[9] D. Wang, S.R. Goldring, The bone, the joints and the balm of gilead, Mol. Pharm. 8
(2011) 991–993.
[10] J.M. Shin, S.H. Kim, T. Thambi, D.G. You, J. Jeon, J.O. Lee, et al., A hyaluronic
acid-methotrexate conjugate for targeted therapy of rheumatoid arthritis, Chem.
Commun. 50 (2014) 7632–7635.
[11] Q. Wang, H. Jiang, Y. Li, W.F. Chen, H.M. Li, K. Peng, et al., Targeting NF-kB
signaling with polymeric hybrid micelles that co-deliver siRNA and dexamethasone
for arthritis therapy, Biomaterials 122 (2017) 10–22.
[12] S.M. Lee, H.J. Kim, Y.J. Ha, Y.N. Park, S.K. Lee, Y.B. Park, et al., Targeted chemo-
photothermal treatments of rheumatoid arthritis using gold half-shell
multifunctional nanoparticles, ACS Nano 7 (2013) 50–57.
[13] R. Li, Y. He, Y. Zhu, L. Jiang, S. Zhang, J. Qin, et al., Route to rheumatoid arthritis
by macrophage-derived microvesicle-coated nanoparticles, Nano Lett. 19 (2019)
124–134.
[14] Q. Wang, X. Sun, Recent advances in nanomedicines for the treatment of
rheumatoid arthritis, Biomater Sci 5 (2017) 1407–1420.
[15] M.D. Yang, X.R. Feng, J.X. Ding, F. Chang, X.S. Chen, Nanotherapeutics relieve
rheumatoid arthritis, J. Contr. Release 252 (2017) 108–124.
[16] T.P. Thomas, S.N. Goonewardena, I.J. Majoros, A. Kotlyar, Z.Y. Cao, P.R. Leroueil,
et al., Folate-targeted nanoparticles show efficacy in the treatment of inflammatory
arthritis, Arthritis Rheum. 63 (2011) 2671–2680.
[17] I.A. Udalova, A. Mantovani, M. Feldmann, Macrophage heterogeneity in the
context of rheumatoid arthritis, Nat. Rev. Rheumatol. 12 (2016) 472–485.
[18] J.S. Smolen, D. Aletaha, M. Koeller, M.H. Weisman, P. Emery, New therapies for
treatment of rheumatoid arthritis, Lancet 370 (2007) 1861–1874.
[19] I.B. McInnes, G. Schett, Cytokines in the pathogenesis of rheumatoid arthritis, Nat.
Rev. Immunol. 7 (2007) 429–442.
[20] R. Heo, D.G. You, W. Um, K.Y. Choi, S. Jeon, J.S. Park, et al., Dextran sulfate
nanoparticles as a theranostic nanomedicine for rheumatoid arthritis, Biomaterials
131 (2017) 15–26.
[21] S. Jain, T.H. Tran, M. Amiji, Macrophage repolarization with targeted alginate
nanoparticles containing IL-10 plasmid DNA for the treatment of experimental
arthritis, Biomaterials 61 (2015) 162–177.
[22] U. Fearon, M. Canavan, M. Biniecka, D.J. Veale, Hypoxia, mitochondrial
dysfunction and synovial invasiveness in rheumatoid arthritis, Nat. Rev.
Rheumatol. 12 (2016) 385–397.
[23] F. Zeng, Y. Wu, X. Li, X. Ge, Q. Guo, X. Lou, et al., Custom-made ceria nanoparticles
show a neuroprotective effect by modulating phenotypic polarization of the
microglia, Angew. Chem. Int. Ed. 57 (2018) 5808–5812.
15
Biomaterials 264 (2021) 120390
[24] J. Kim, H.Y. Kim, S.Y. Song, S.H. Go, H.S. Sohn, S. Baik, et al., Synergistic oxygen
generation and reactive oxygen species scavenging by manganese ferrite/ceria Co-
decorated nanoparticles for rheumatoid arthritis treatment, ACS Nano 13 (2019)
3206–3217.
[25] E.I. Alarcon, K. Udekwu, M. Skog, N.L. Pacioni, K.G. Stamplecoskie, M. Gonzalez-
Bejar, et al., The biocompatibility and antibacterial properties of collagen-
stabilized, photochemically prepared silver nanoparticles, Biomaterials 33 (2012)
4947–4956.
[26] Z.M. Xiu, Q.B. Zhang, H.L. Puppala, V.L. Colvin, P.J.J. Alvarez, Negligible particle-
specific antibacterial activity of silver nanoparticles, Nano Lett. 12 (2012)
4271–4275.
[27] R.W.-Y. Sun, R. Chen, N.P.Y. Chung, C.-M. Ho, C.-L.S. Lin, C.-M. Che, Silver
nanoparticles fabricated in Hepes buffer exhibit cytoprotective activities toward
HIV-1 infected cells, Chem. Commun. (2005) 5059–5061.
[28] R. Bhattacharya, P. Mukherjee, Biological properties of "naked" metal
nanoparticles, Adv. Drug Deliv. Rev. 60 (2008) 1289–1306.
[29] J. Liu, Y. Zhao, Q. Guo, Z. Wang, H. Wang, Y. Yang, et al., TAT-modified nanosilver
for combating multidrug-resistant cancer, Biomaterials 33 (2012) 6155–6161.
[30] A. Panacek, M. Kolar, R. Vecerova, R. Prucek, J. Soukupova, V. Krystof, et al.,
Antifungal activity of silver nanoparticles against Candida spp, Biomaterials 30
(2009) 6333–6340.
[31] D.W. Guo, L.Y. Zhu, Z.H. Huang, H.X. Zhou, Y. Ge, W.J. Ma, et al., Anti-leukemia
activity of PVP-coated silver nanoparticles via generation of reactive oxygen
species and release of silver ions, Biomaterials 34 (2013) 7884–7894.
[32] V. De Matteis, M.A. Malvindi, A. Galeone, V. Brunetti, E. De Luca, S. Kote, et al.,
Negligible particle-specific toxicity mechanism of silver nanoparticles: the role of
Ag+ ion release in the cytosol, Nanomed. Nanotechnol. Biol. Med. 11 (2015)
731–739.
[33] E.T. Hwang, J.H. Lee, Y.J. Chae, Y.S. Kim, B.C. Kim, B.I. Sang, et al., Analysis of the
toxic mode of action of silver nanoparticles using stress-specific bioluminescent
bacteria, Small 4 (2008) 746–750.
[34] E.-J. Yang, S. Kim, J.S. Kim, I.-H. Choi, Inflammasome formation and IL-1β release
by human blood monocytes in response to silver nanoparticles, Biomaterials 33
(2012) 6858–6867.
[35] A. Mani, C. Vasanthi, V. Gopal, D. Chellathai, Role of phyto-stabilised silver
nanoparticles in suppressing adjuvant induced arthritis in rats, Int. Immunopharm.
41 (2016) 17–23.
[36] K. Rao, T. Roome, S. Aziz, A. Razzak, G. Abbas, M. Imran, et al., Bergenin loaded
gum xanthan stabilized silver nanoparticles suppress synovial inflammation
through modulation of the immune response and oxidative stress in adjuvant
induced arthritic rats, J. Mater. Chem. B 6 (2018) 4486–4501.
[37] A.N. Yilma, S.R. Singh, S. Dixit, V.A. Dennis, Anti-inflammatory effects of silver-
polyvinyl pyrrolidone (Ag-PVP) nanoparticles in mouse macrophages infected with
live Chlamydia trachomatis, Int. J. Nanomed. 8 (2013) 2421–2432.
[38] Y.M.F. Chen, M. Guan, R.Y. Ren, C.H. Gao, H. Cheng, Y. Li, et al., Improved
immunoregulation of ultra-low-dose silver nanoparticle-loaded TiO2 nanotubes via
M2 macrophage polarization by regulating GLUTI and autophagy, Int. J. Nanomed.
15 (2020) 2011–2026.
[39] X. Zhang, M.R. Servos, J. Liu, Fast pH-assisted functionalization of silver
nanoparticles with monothiolated DNA, Chem. Commun. 48 (2012) 10114–10116.
[40] Y. Nie, D. Li, Y. Peng, S. Wang, S. Hu, M. Liu, et al., Metal organic framework
coated MnO2 nanosheets delivering doxorubicin and self-activated DNAzyme for
chemo-gene combinatorial treatment of cancer, Int. J. Pharm. 585 (2020) 119513.
[41] D.D. Brand, K.A. Latham, E.F. Rosloniec, Collagen-induced arthritis, Nat. Protoc. 2
(2007) 1269–1275.
[42] H. Liu, J.X. Ding, J.C. Wang, Y.A. Wang, M.D. Yang, Y.B. Zhang, et al., Remission of
collagen-induced arthritis through combination therapy of microfracture and
transplantation of thermogel-encapsulated bone marrow mesenchymal stem cells,
PloS One 10 (2015) 18.
[43] H. Liu, J.X. Ding, C.Y. Wang, J.C. Wang, Y.N. Wang, M.D. Yang, et al., Intra-
articular transplantation of allogeneic BMMSCs rehabilitates cartilage injury of
antigen-induced arthritis, Tissue Eng. 21 (2015) 2733–2743.
[44] T.S. Peretyazhko, Q.B. Zhang, V.L. Colvin, Size-controlled dissolution of silver
nanoparticles at neutral and acidic pH conditions: kinetics and size changes,
Environ. Sci. Technol. 48 (2014) 11954–11961.
[45] S. Kittler, C. Greulich, J. Diendorf, M. Koller, M. Epple, Toxicity of silver
nanoparticles increases during storage because of slow dissolution under release of
silver ions, Chem. Mater. 22 (2010) 4548–4554.
[46] R. Cheng, F. Feng, F.H. Meng, C. Deng, J. Feijen, Z.Y. Zhong, Glutathione-
responsive nano-vehicles as a promising platform for targeted intracellular drug
and gene delivery, J. Contr. Release 152 (2011) 2–12.
[47] M.D. Yang, J.X. Ding, X.R. Feng, F. Chang, Y.N. Wang, Z.L. Gao, et al., Scavenger
receptor-mediated targeted treatment of collagen-induced arthritis by dextran
sulfate-methotrexate prodrug, Theranostics 7 (2017) 97–105.
[48] A. Rollett, T. Reiter, P. Nogueira, M. Cardinale, A. Loureiro, A. Gomes, et al., Folic
acid-functionalized human serum albumin nanocapsules for targeted drug delivery
to chronically activated macrophages, Int. J. Pharm. 427 (2012) 460–466.
[49] C. Yang, S. Gao, J. Kjems, Folic acid conjugated chitosan for targeted delivery of
siRNA to activated macrophages in vitro and in vivo, J. Mater. Chem. B 2 (2014)
8608–8615.
[50] P.T. Wong, S.K. Choi, Mechanisms and implications of dual-acting methotrexate in
folate-targeted nanotherapeutic delivery, Int. J. Mol. Sci. 16 (2015) 1772–1790.
[51] C.D. Walkey, J.B. Olsen, H.B. Guo, A. Emili, W.C.W. Chan, Nanoparticle size and
surface chemistry determine serum Protein adsorption and macrophage uptake,
J. Am. Chem. Soc. 134 (2012) 2139–2147.
Y. Yang et al.
[52] H.C. Fischer, L.C. Liu, K.S. Pang, W.C.W. Chan, Pharmacokinetics of nanoscale
quantum dots: in vivo distribution, sequestration, and clearance in the rat, Adv.
Funct. Mater. 16 (2006) 1299–1305.
[53] M. Liu, Y. Peng, Y.B. Nie, P. Liu, S. Hu, J.S. Ding, et al., Co-delivery of doxorubicin
and DNAzyme using ZnO@polydopamine core-shell nanocomposites for chemo/
gene/photothermal therapy, Acta Biomater. 110 (2020) 242–253.
[54] Y. Chen, C.J. Yang, J. Mao, H.G. Li, J.S. Ding, W.H. Zhou, Spermine modified
polymeric micelles with pH-sensitive drug release for targeted and enhanced
antitumor therapy, RSC Adv. 9 (2019) 11026–11037.
[55] H. Yang, C.C. Lou, M.M. Xu, C.H. Wu, H. Miyoshi, Y.Y. Liu, Investigation of folate-
conjugated fluorescent silica nanoparticles for targeting delivery to folate receptor-
positive tumors and their internalization mechanism, Int. J. Nanomed. 6 (2011)
2023–2032.
[56] Q. Zhang, S.Y. Lin, S.R. Shi, T. Zhang, Q.Q. Ma, T.R. Tian, et al., Anti-inflammatory
and antioxidative effects of tetrahedral DNA nanostructures via the modulation of
macrophage responses, ACS Appl. Mater. Interfaces 10 (2018) 3421–3430.
16
Biomaterials 264 (2021) 120390
[57] C. Beer, R. Foldbjerg, Y. Hayashi, D.S. Sutherland, H. Autrup, Toxicity of silver
nanoparticles—nanoparticle or silver ion? Toxicol. Lett. 208 (2012) 286–292.
[58] Z. Chen, J.-J. Yin, Y.-T. Zhou, Y. Zhang, L. Song, M. Song, et al., Dual enzyme-like
activities of iron oxide nanoparticles and their implication for diminishing
cytotoxicity, ACS Nano 6 (2012) 4001–4012.
[59] S. Bhattacharya, A. Aggarwal, M2 macrophages and their role in rheumatic
diseases, Rheumatol. Int. 39 (2019) 769–780.
[60] Y. Lee, P. Kim, J. Yoon, B. Lee, K. Choi, K.H. Kil, et al., Serum kinetics, distribution
and excretion of silver in rabbits following 28 days after a single intravenous
injection of silver nanoparticles, Nanotoxicology 7 (2013) 1120–1130.
[61] C.H. Li, H.M. Li, Q. Wang, M.L. Zhou, M. Li, T. Gong, et al., pH-sensitive polymeric
micelles for targeted delivery to inflamed joints, J. Contr. Release 246 (2017)
133–141.
[62] Y.J. Kim, S.Y. Chae, C.H. Jin, M. Sivasubramanian, S. Son, K.Y. Choi, et al., Ionic
complex systems based on hyaluronic acid and PEGylated TNF-related apoptosis-
inducing ligand for treatment of rheumatoid arthritis, Biomaterials 31 (2010)
9057–9064.