18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022].

See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Received: 7 June 2022 Revised: 19 July 2022 Accepted: 4 August 2022

DOI: 10.1111/tbed.14681

ORIGINAL ARTICLE

Isolation, identification and pathogenic characteristics of

tick-derived parainfluenza virus 5 in northeast China

Mingfa Yang1 Yunyun Ma1 Qian Jiang1 Mingxin Song2 Hongtao Kang1
Jiasen Liu1 Liandong Qu1

1
Division of Zoonosis of Natural Foci, State
Key Laboratory of Veterinary Biotechnology, Abstract
Harbin Veterinary Research Institute, Chinese
The number of parainfluenza virus 5 (PIV5) infection cases has increased worldwide
Academy of Agricultural Sciences, Harbin,
China over the past six decades; however, factors underlying this increase remain unclear.
2
College of Veterinary Medicine, Northeast PIV5 has been emerging or re-emerging in humans and animal species. To date, no
Agricultural University, Harbin, China
information is yet available regarding PIV5 infection in arthropod ticks. Here, we suc-
Correspondence cessfully isolated tick-derived PIV5 from the Ixodes persulcatus species designated as
Liandong Qu, Division of Zoonosis of Natural HLJ/Tick/2019 in Heilongjiang, China. Phylogenetic analysis revealed that the tick-
Foci, State Key Laboratory of Veterinary
Biotechnology, Harbin Veterinary Research derived PIV5 is closely related to subclade 2.2.6, which has become the dominant
Institute, Chinese Academy of Agricultural subtype prevalent in dogs, pigs and wildlife across China. Further experiments to
Sciences, 678 Haping Street, Xiangfang
District, Harbin 150036, Heilongjiang understand the importance of this virus as an infectious vector revealed that a ferret
Province, China. animal model experimentally infected with Tick/HLJ/2019 via the oronasal and ocular
Email: quliandong@caas.cn
inoculation routes developed moderate respiratory distress with pneumonia and neu-
Funding information rologic tissue damage from inflammation for the first time. Further surveillance of PIV5
General Administration of Customs, P.R. China,
Grant/Award Number: 2019HK125; National
in vectors of viral transmission is necessary to enhance our knowledge of its ecology in
Key R&D Program of China, Grant/Award reservoirs and facilitate the control of re-emerging diseases.
Numbers: 2017YFD0501801,
2017YFD0502303, 2019YFC1200400
KEYWORDS
parainfluenza virus 5, pathogenicity, tick

1 INTRODUCTION (Hsiung, 1972), subsequent studies were unable to confirm PIV5 as

Simian virus 5 (SV5), which was first isolated almost six decades ago
from rhesus and cynomolgus monkey kidney cells (Hull et al., 1956),
was renamed in 2016 as mammalian orthorubulavirus 5 (Adams et al.,
2017). Thus, most researchers believed that monkeys were its natu-
ral host. However, wild monkeys do not have antibodies against SV5
and appear to be infected in captivity after contact with humans, who
can be infected naturally (Atoynatan & Hsiung, 1969). SV5 was later
renamed to PIV5 and prefixed according to the isolated species. A pre-
vious research study has shown that this virus is associated with human
diseases, including Creutzfeldt–Jakob disease (CJD), multiple sclerosis
(MS), sclerosing panencephalitis (SSPE), atherosclerosis, hepatitis and
the common cold (Goswami et al., 1987). Although the positive rate
of neutralizing antibodies against PIV5 is 20% in the United Kingdom
the etiological agent of these diseases; thus, its association with human
disease remains controversial (Vandvik & Norrby, 1989). Recent stud-
ies have revealed that PIV5 efficiently infects human ciliated airway
epithelial cells and might impact human respiratory diseases (Zhang
et al., 2011). Parainfluenza virus 5 is a non-segmented negative-strand
RNA virus with a genome of 15,246 nucleotides and belongs to the
genus Rubulavirus of the family Paramyxoviridae (Henrickson, 2003).
The PIV5 genome encodes eight proteins from seven genes (N, V/P, M,
F, SH, HN and L) flanked by a 3-leader region and a 5-trailer region.
PIV5 is one of the common pathogens of kennel cough, a respiratory
disease in dogs worldwide. Dogs can develop severe clinical signs if co-
infected with other respiratory viruses or bacteria (McCandlish et al.,
1978). In Europe, the PIV5 SER strain was isolated from a case of con-
current infection with porcine reproductive and respiratory syndrome

Transbound Emerg Dis. 2022;1–17. wileyonlinelibrary.com/journal/tbed © 2022 Wiley-VCH GmbH. 1


2 YANG ET AL .
virus in Germany (Lee et al., 2013). A study in Switzerland noted that
PIV5 infection may also cause neurological disease and encephalitis in
Bos taurus (Hierweger et al., 2020). Currently, PIV5 has a global pres-
ence and is prevalent in several Asian countries. Four novel PIV5 strains
(KNU-1, Carina, M293 and Rigel) were identified in the lungs of pigs
with respiratory illness in Korea between 2013 and 2017 (Lee et al.,
2013; Lee & Lee 2013). Three dog-derived PIV5 strains (CU-D133,
CU-D151 and CU-D20804) were identified in the nasal swab sam-
ples from cases with respiratory symptoms, including sneezing, nasal
discharge, cough and dyspnoea, in Thailand between 2015 and 2018
(Charoenkul et al., 2021). PIV5 origins and natural vectors are of defi-
nite interest, given that pigs, dogs and monkeys are not likely to be the
reservoir host species (Rima et al., 2014) and that many aspects regard-
ing the transmission vectorielle and pathogenesis of this virus are still
unknown. In China, PIV5 associated with infectious respiratory disease
has been prevalent in weaning calves since 2012 in Jilin province (Liu
et al., 2015). Variants were isolated from dead wildlife with respiratory
diseases in Guangdong province, southern China (Zhai et al., 2017).
To date, PIV5 infections have been found in humans, monkeys, dogs,
hamsters, guinea, cats, pigs, cattle, rodents, lesser pandas, Panthera
tigris altaica, pangolins and horses (Chatziandreou et al., 2004). Increas-
ing evidence indicates the potential for cross-species transmission of
PIV5, which may ultimately lead to animal respiratory and neurological
diseases. Nevertheless, it is not clear whether the vectors act as inter-
mediate hosts that transfer the virus from its original host to humans
and animals. In this study, we isolated tick-derived PIV5 from the Ixodes
persulcatus species HLJ/Tick/2019 in Heilongjiang province, northeast
China, and then determined its ability to cause pneumonia and neuro-
logical tissue damage from inflammation in a ferret for the first time.
This systematic investigation of PIV5, including epidemiological analy-
sis, pathogen isolation and pathogenicity, lays a foundation to further
understand the probable potential association risks and highlights its
zoonotic potential in China.
2 MATERIALS AND METHODS
2.1 Cell, antibodies and animals
Madin–Daby bovine kidney (MDBK) cells, Madin–Daby canine kidney
(MDCK) cells, Swine testicle (ST) cells and African green monkey kid-
ney (Vero) E6 cells (ATCC® CRL-1586™, Manassas, VA, USA) were
maintained in Dulbecco’s modified minimum essential medium (Gibco,
Grand Island, NY, USA) containing 10% foetal bovine serum (Gibco),
100 U/ml penicillin and 100 µg/ml streptomycin at 37◦ C in a 5% CO2
atmosphere. Ferret and pig anti-PIV5 positive serum was prepared in
our lab. Anti-PIV5 V and NP gene mouse monoclonal antibody was
obtained from USBiological (USA). Goat anti-pig IgG HRP and goat anti-
mouse IgG FITC were obtained from Abcam (UK). Young adult ferrets
(6- to 10-month-old) were obtained from the experimental animal cen-
tre of Harbin Veterinary Research Institute (HVRI). All animals were
housed in the animal facility at HVRI under standard conditions in
accordance with institutional guidelines.
18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2.2 Sample collection and identification
During the breeding season from March to May in 2019, we collected
5476 free questing un-engorged ticks (mainly larva and nymph) by
dragging a standard 1-m2 flannel flag over natural vegetation or along
the cattle pathway in an aspen birch forest at 22 different collection
sites in six regions in the Heilongjiang Province, northeast China. The
relative density of questing ticks varies from 50 to 200 ticks per km
across the sampling area. Our study did not include endangered or pro-
tected species. The detailed species, numbers, latitude and longitude of
each collection sites were recorded. The obtained ticks were identified
using morphological keys (Chen et al., 2010) with light microscopy and
based on their molecular characteristics by using the 16S rRNA gene
sequence as described previously (Black & Piesman, 1994). Identifica-
tion and classification ticks were separated into six groups according to
regions including the Greater Khingan Mount, HeiHe, YiChun, HeGang,
JiaMuSi and ShuangYaShan in Heilongjiang northeast of China. Then,
the six groups were divided into 22 subgroups based on their morpho-
logical identification species. With each subgroup consisting of various
amount ticks were detected singular for PIV5 by using a nested PCR
assay specific to the NP gene. The primers used in this study are listed
in Table 1. To confirm PIV5, 5 µl of PCR product was run on a 1% agarose
gel. The expected size of the positive PIV5 product was 213 bp. Each
subgroup was homogenized using a handheld tissue tearor (KONTES,
China) in 500 µl of SM buffer (50 mmol/L Tris, 10 mmol/L MgSO4 ,
0.1 mol/L NaCl, pH 7.5), centrifuged (12,000 × g, 10 min, 4◦ C) and the
supernatants filtered through 0.45-µm Millex filters (Millipore, Biller-
ica, MA, USA) and stored at −80◦ C until analysis. Extracted RNAs from
supernatants were reverse transcribed for next-generation sequenc-
ing (NGS) analysis, whereas the remaining samples were used for virus
isolation.
2.3 NGS strategies
Each supernatant batch was mixed with adequate amounts of DNase
I (TaKaRa, Dalian, China) and RNase A (TaKaRa) incubated at 37◦ C
for 1 h to eliminate host genomic DNA and other free nucleic acids.
Viral nucleic acid was extracted using the AxyPrepTM Viral RNA Mini
Kit (Axygen, China) following manufacturer’s protocol. Total RNA was
eluted in 50 µl of RNase-free H2 O (TaKaRa) and stored at –80◦ C until
use. Viral RNA was reverse transcribed into cDNA using M-MLV RTase
(TaKaRa) according to manufacturer’s protocol. The generated ampli-
cons were purified using a QIAquick Polymerase Chain Reaction (PCR)
Purification Kit (Qiagen, Hilden, Germany) and dissolved in 50 µl of
TE buffer (100 mM Tris-HCl, 10 mM EDTA, pH 8.0). The tagged and
purified PCR products were subjected to Illumina HiSeq sequencing
platform at BGI Genomics Co., Ltd for sequencing and data analysis.
The resulting sequence data were aligned against the non-redundant
and viral reference NCBI GenBank databases (National Institutes of
Health, Manassas, VA, USA) using BLASTx and BLASTn (http://www.
ncbi.nlm.nih.gov/BLAST/). An E-value cut-off of ≤1 × 10−5 was used
to identify homologous sequences. Contigs containing bacterial or
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
YANG ET AL . 3

TA B L E 1 The primer oligonucleotides used in this study

Primers Nucleotide positions Sequence, 5′→3′ Product length/bp

Forward F1 1–20 ACCAAGGGGAAAATGAAGTG 1415
Reverse R1 1396–1415 CAGTGACAGATGAGAACGGG
Forward F2 1107–1127 CACATTTGATGGATTTTGCTG 1486
Reverse R2 2571–2592 GAGACTGAGATGAGAGAATGCG
Forward F3 2372–2390 TACTCAATCGGATGGGTGG 1519
Reverse R3 3871–3890 ACTGCCATTCTTGTTTCCTG
Forward F4 3649–3673 CGACATTTCTGTCAGTGACTTACTG 1417
Reverse R4 5042–5065 GCTGGACTTACCACACTGTTTATG
Forward F5 4700–4720 CGACTCGCAGATTAGTGGATG 1499
Reverse R5 6174–6198 ATGGATGACTGTCTTATCTTGTTCC
Forward F6 5967–5991 GCTACGACTACAAGTGTATTATCCA 1513
Reverse R6 7458–7479 CCTAAATAATATACCCCGCTTC
Forward F7 7282–7302 GGGGGGTTGTATGATGTACTG 1509
Reverse R7 8766–8790 GCATTGATTACTGAACATGATTCTT
Forward F8 8524–8547 CATTGATGATTTAGGTCCATTACA 1446
Reverse R8 9948–9969 AGAAAGTTTAGCAATAGCCGTC
Forward F9 9690–9709 ATGCTTCAAAGGGTCTCACG 1510
Reverse R9 11,179–11,199 CGTGATACCAGGTGTGGATTA
Forward F10 10,932–10,951 GGAGGATTCTAACGCAAGCC 1430
Reverse R10 12,337–12,361 ATGAGTGAAACTTGAAAAGGTGTAA
Forward F11 12,136–12,155 AGTTCTTAGACTGGCGGGAG 1390
Reverse R11 13,501–13,525 ATAATATGAGGTGACTGCTACTTGA
Forward F12 13,294–13,316 ACCAAAGATTAAGGGTTTCTCTC 1365
Reverse R12 14,639–14,658 ATGAAAGTTGCGACTGGCTC
Forward F13 14,422–14,441 AACAGGAATGGCGATGACTT 825
Reverse R13 15,227–15,246 ACCAAGGGGAAAACCAAGAT
PIV5-Nested-F22 1–22 ACCAAGGGGAAAATGAAGTGGT 213
PIV5-Nested-F64 64–86 AACTTATGGCCTTCGTGACCGAC
PIV5-Nested-R276 255–276 GAGGTTAGTATAAATACCCTG
PIV5-qPCR-F 280–303 GTAGAGATCGATGGCTTTGAGGA 97
PIV5-qPCR-R 355–376 CTCCACGGCTCATACCTGAAC
GAPDH-F 31–52 AAGGCAGTAGGCAAGGTCATCC 112
GAPDH-R 121–142 CTTTCTCCAGGTGGCAGGTCAG
GP-F 29–48 ACAAAGGTATTGTAATAAGG 118
GP-R 125–146 ATTTATATAATTGTTTCTTCAC
XP-F 33–56 ACTATACAAAGGTATTGTAATAAG 288
XP-R 300–320 TTACGCTGTTATCCCTAGAGTA
YP-F 1–24 CTGCTCAATGATTTTTTAAATTGC 382
YP-R 362–382 TCCAACATCGAGGTCGCAATC

Note: The primers of GP-F and GP-R were detected as Dermacentor silvarum, Dermacentor nuttalli and Haemaphysalis longicornis. The primer of XP-F and XP-R
was detected as Haemaphysalis concinna. The primer of YP-F and YP-R was detected as Ixodes persulcatus.

4 YANG ET AL .
eukaryotic sequences were eliminated and virus-like sequences were
subjected to further analysis. Illumina reads were then mapped to the
reference genome with Bowtie version 2 software.
2.4 Virus isolation and purification
For virus isolation, the supernatants were added to Vero
E6(ATCC®CRL-1586™, Manassas, VA, USA) monolayer cultures
in 12-well plates. After virus adsorption, the supernatant was removed
and cells were maintained in Dulbecco’s modified Eagle’s medium
(Thermo Scientific, Rockford, IL, USA) supplemented with 2% (v/v)
heat-inactivated foetal bovine serum (Sigma–Aldrich, St. Louis, MO,
USA) and 1% (v/v) penicillin/streptomycin (Solable, Beijing, China) at
37◦ C in 5% CO2 . Cells were examined daily for cytopathic effects
(CPE). Vero E6 cells infected with the PIV5/Tick/HLJ/2019 strain
were harvested by freezing and thawing three times when CPE was
observed. Aliquots were stored at –80◦ C. To purify the tick-derived
PIV5 virus, plaque assay was performed according to common general
procedure. Vero E6 cells were inoculated with diluted viruses, overlaid
with 1% agarose in DMEM containing 1% penicillin and streptomycin
and 1% FBS. After plaque development, uniform and clear plaques
were picked using sterile pipette tips, and the agarose plug was
placed into a 0.1-ml medium and reinoculated into cell monolayer to
harvest the positive clone. After three times of plaque purification,
the virus clones were successfully obtained. The six-well plates were
also fixed with 4% paraformaldehyde and stained with 1% crystal
violet for visualizing the production of CPEs (Ibrahim et al., 2022). The
viral titres are expressed as the median tissue culture infective dose
Log10 (TCID50 /ml) according to the method of Reed and Müench.
2.5 Electron microscopy and immunofluorescence
assay
Paramyxovirus-like particles were identified in infected cells using
electron microscopy (EM). Briefly, for negative staining and thin-
section examination, primary cells were seeded into six-well plates and
infected with PIV5 at a multiplicity of infection (MOI) of 0.1. At 72-
h post-infection, the cell supernatants were collected and fixed with
2.5% glutaraldehyde for negative staining. A 20-µl aliquot of the sam-
ple was applied to a carbon-coated grid that had been glow discharged.
The grid was negatively stained with 2% phosphotungstic acid. PIV5-
infected cells were washed with PBS, fixed with 2.5% glutaraldehyde
(pH 7.2) at 4◦ C overnight, post-fixed with 1% OsO4 (pH 7.4) at 4◦ C
for 2 h, dehydrated in stepwise acetone at 4◦ C and embedded in 812
Epon resin. Thin sections were stained with 1% uranyl acetate (pH 6.5)
and 1% lead citrate (pH 7.2). EM grids were screened at 80 kV on a
Hitachi H-7650 (Tokyo, Japan) electron microscope. Subsequently, we
identified PIV5 presence by indirect fluorescent antibody. Briefly, the
cells cultured in six-well plates were infected with PIV5. After 72 h, the
cells were washed three times with phosphate-buffered saline, fixed
with 4% paraformaldehyde, and incubated with 1% bovine serum albu-
18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
min for 30 min. Then, the plate was washed and stained with mouse
monoclonal anti-PIV5 V gene antibody (1:100 dilution) at 37◦ C for 1 h,
followed by incubation with the secondary antibody goat anti-mouse
IgG FITC (Solable, Beijing, China) (1:500 dilution; 37◦ C, 1 h) and visual-
ization under a fluorescence microscope (AMG EVOS f1, ThermoFisher
Scientific).
2.6 Genetic and phylogenetic analysis
We designed 13 primer pairs to amplify the complete genome of PIV5.
RT-PCR was used to amplify each viral genome segment using the
One Step RT-PCR kit (Qiagen). Amplified products were analysed via
1% agarose gel electrophoresis and purified using the High Pure PCR
Product Purification Kit (Roche, Basel, Switzerland). The PCR products
were purified and cloned into the pMD18-T vector (TaKaRa). Positive
colonies were evaluated by Sanger sequencing by Shanghai Invitrogen
Biotechnology Co. Ltd. At least three positive colonies for each ampli-
fication product were sequenced. Sequences were assembled using
Seqman (DNASTAR, Madison, WI, USA) and manually edited. The com-
plete nucleotide sequence of PIV5 has been submitted to GenBank
(MW051776). Local and web-based bio-information tools, including
DNASTAR (Madison WI, USA), Emboss and software from NCBI,
were employed for sequence analysis. Homology searches were con-
ducted using NCBI BLAST programs. Multiple alignments of nucleotide
sequences were generated using BioEdit. The nucleotide and deduced
amino acid sequences were generated using ClustalW in the Megalin
module within Lasergene 7.0 (DNASTAR Inc). Phylogenetic trees for
the deduced sequences of the whole genome were constructed using
the neighbour-joining method in MEGA version 7.0, with bootstrap
values calculated from 1000 replicates.
2.7 Pathogenicity test of tick-derived PIV5 in
ferrets
Pathogenicity of the PIV5 Tick/HLJ/2019 isolate was evaluated using a
ferret infection model. Prior to infection, young adult ferrets (≤1 year
of age) were divided into two groups (n = 6/group): those in the infected
group were placed in an isolator. Group I was inoculated with purified
virus at a dose of 0.5 ml 107.0 TCID50 /ml (0.2 ml for each nasal passage
and 0.05 ml for each eye) of PIV5 as described previously (Chen et al.,
2012; Lee et al., 2013; Yang et al., 2014). Tick/HLJ/2019 was diluted in
PBS via the intranasal and ocular routes. PBS alone was used as Group
II (control). Ferrets were monitored twice daily, with detailed record-
ing of their clinical signs, symptoms and mortality, including nature and
severity of all gross or visible changes. All ferrets underwent clinical
evaluation. Weight and temperature were monitored daily throughout
the experiment. Clinical signs scored included abnormal circulatory,
respiratory, excretory, behavioural or neurological signs over 14 days
(Table 2). During the experiment, two ferrets were randomly eutha-
nized by exsanguination at 3, 6 or 14 days post-infection (d.p.i.). Tissue
specimens, including nasal turbinate, tonsil, trachea, lung, liver, small
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
YANG ET AL . 5

TA B L E 2 Clinical scoring protocol of ferret

Score Depression Nasal discharge Abnormal respiration Cough

0 Bright, alert, responsive;
Normal appetite;
Normal behaviour (staying with
the group)
1 Reduced responsiveness;
Slightly decreased appetite;
Otherwise normal behaviour
2 Depressed;
Decreased appetite;
Separates from group;
Extended resting periods
3 Anorexia
No nasal discharge;
Clear secretion
Nasal discharge;
Intermittent watery mucus
Increased nasal discharge;
Persistent mucoid mucopurulent
discharge
Severe nasal discharge;
Persistent purulent discharge
Normal respiration rate
Slightly increased respiration rate
Increased respiration rate;
Obvious abdominal breathing
Increased respiration rate;
Severe abdominal breathing;
Mouth breathing;
Two-staged expiration
No coughing
Only cough on compression of
trachea
Frequent spontaneous cough;
Induced productive coughing
Frequent spontaneous cough at
rest;
Prolonged episode when induced;
Induced productive coughing

intestine, kidney, pancreas, spleen and brain, as well as blood sam-
ples were collected for various pathological and viral load assays. The
relative quantification of target gene mRNA in tissue specimens was
performed by real-time quantitative RT-PCR using SYBR® Premix Ex
TaqTM (TaKaRa) using primers designed with Primer 3 on a QuantStu-
dio 5 system (Applied Biosystems, Foster City, CA, USA). The relative
fold change from PIV5 virus-infected and control animals was deter-
mined using the RNA levels of immune-response genes normalized to
that of ferret GAPDH; relative mRNA quantities were evaluated using
the 2−△△Ct method. All ferrets were euthanized at 14 d.p.i.
2.8 Necropsy, histopathological evaluation and
immunohistochemical staining
The fresh tissues were fixed with 10% neutral buffered formalin, cut
into 4-µm-thick paraffin sections and stained with haematoxylin and
eosin using standard methods. Finally, histopathological changes in
the organs (e.g. the liver, spleen and brain) were observed by optical
microscopy (Nikon Eclipse E100, Tokyo, Japan). For immunohisto-
chemical (IHC) staining, the fixed tissue sections were blocked and
incubated overnight at 4◦ C. Viral antigen was detected in the lung,
spleen and brain by means of IHC staining with a polyclonal anti-
body specific to PIV5 following previously described steps (Yang et al.,
2014).
2.9 Statistical analysis
Significant differences in weight loss, temperature change, blood anal-
ysis, viral load and titre between groups and across time points were
determined using two-tailed, unpaired t-tests. All statistical tests were
conducted using GraphPad Prism 7.0 software (GraphPad, Inc., La Jolla,
CA, USA). The prevalence of ticks was calculated using PooledInfRate
version 4.0; p-values < .05 were considered statistically significant.
3 RESULTS
3.1 Sample collection and identification
During the tick breeding season from March to May in 2019, we
collected 5476 free questing un-engorged ticks (Larva and Nymph)
from 22 different sites in Heilongjiang. These include five villages
(MH, TH, HZQ, XLQ and HM) located in the Greater Khingan Mount
(GSK) bordering Russia and Mongolia in northeast China; four villages
(AH, SW, XK and WDLC) situated in the HeiHe (HH) region, includ-
ing three first-class ports that correspond with three ports in Russia;
six villages (JY, WY, Meixi [MX], XL, Jinshantun [JST] and NC) in the
YiChun (YC) region; two villages (SB and HC) in the HeGang (HG)
region; two villages (FY and YY) in the JiaMuSi (JMS) region; and two
villages (BQ and RH) in the ShuangYaShan (SYS) region (Figure 1).
Manual identification, morphological keys and statistics indicated that
the identified ticks belonged to five predominant species, includ-
ing Dermacentor silvarum (2034/5476; 37.14%; GenBank accession
numbers: MW074174), Haemaphysalis concinna (1070/5476; 19.53%;
MW074170), Dermacentor nuttalli (955/5476; 17.44%; MW073319),
Haemaphysalis longicornis (765/5476; 14%; MW074172) and Ixodes
persulcatus (652/5476; 11.9%; MW074173) in northeast China. Phy-
logenetic and BLAST nucleotide sequence analysis of the partial 16S
rRNA sequences showed that the five species belong to the family Ixo-
didae, subfamily Ixodinae, Haemaphysalinae and Rhipicephalinae with
the highest identity to the genus Ixodes (27.2%‒98.9%) followed by Der-
macentor (30.2%‒61.2%) and Haemaphysalis (26.9‒58.7%). There were
significant differences between the population of ticks and sampling
sites of PIV5-positive ticks. Analysis showed that PIV5 was detected in
I. persulcatus (17.71%; 31/175) and D. silvarum (6.48%; 21/324) in MX
(8.4%; 52/619), and then in I. persulcatus (40.3%; 27/67) and D. silvarum
(2%; 3/150) in JST (9.17%; 30/327) in the YC (3.21%; 82/2553) region
(Table 3). MX and JST are located in the central YC region in northeast
China, which has abundant natural resources with a high forest cov-
erage area; because of its unique geographical features, this area has
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
6 YANG ET AL .

F I G U R E 1 Map of HLJ, northeast of China, showing the study regions where samples were collected for tick in 2019. Red coordinates
represent the 22 tick collection sites. The pentagram represents PIV5-positive sites. The names of the collection sites are abbreviated as follows:
Mohe (MH), Huma (HM), Xilinqu (XLQ), Huzhongqu (HZQ) and Tahe (TH) located in the Greater Khingan Mountains; Aihui (AH), Sunwu (SW),
Xunke (XK) and Wudalianchi (WDLC) situated in the HeiHe region; Jiayin (JY), Wuying (WY), Meixi (MX), Xilin (XL), Jinshantun (JST) and Nancha
(NC) located in the YiChun region; Luobei (LB) and Suibin (SB) located in the HeGang region; Huachuan (HC) and Fuyuan (FY) located in JiaMuSi;
Youyi (YY), Baoqing (BQ) and Raohe (RH) located in ShuangYaShan

become a popular tourist destination, which factors increase potential
the risk of human infection PIV5. In the GSK (2.19%, 26/1185) region,
PIV5 was detected in I. persulcatus (34.38%, 11/32) and D. silvarum
(9.09%, 15/165) in only Mohe (34.38% 26/341), which borders Russia
and Mongolia where investigations have previously been conducted on
emerging diseases (Jia et al., 2020). Ticks from the remaining regions
tested negative for PIV5. As a result, such PIV5 presence in tick have
exposure increased risk for human and animals infection in YiChun and
Greater Khingan Mount regions.
3.2 Targeted NGS of PIV5 identified in tick
virome
For PIV5 identification, a total of 390,455,830 of raw reads were
obtained from ticks through the paired-end (2 × 150 bp) sequenc-
ing using the Illumina HiSeq sequencing platform. Following the
removal of tick sequences based on comparison against tick refer-
ence genome available from the NCBI databases, then adaptor and
quality trimmed them with the Fastp program and Cutadapt, result-
ing in a total of 389,708,900 clean reads. These reads were de novo
assembled using Trinity with default parameters. The Cutadapt soft-
ware removed sequence pieces that were lower than 50 bp and
trimmed the sequence part with pHRED score lower than 20 (–Q20).
Gene prediction using MetaGeneMark revealed that 746,930 reads
showed identity to annotated microbial ORFs, with 37,346 (4.9%,
37,346/746,930) reads showing identity to viral open reading frames
based on functional annotations. Then, the most significant BLASTn
similarities were used against the nucleotide database downloaded
from GenBank. The viral sequences were classified into 15 virus fam-
ilies based on the most significant BLASTn similarities, including Bun-
yaviridae, Phenuiviridae, Nairoviridae, Peribunyaviridae, Paramyxoviridae,
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
YANG ET AL . 7

TA B L E 3 PIV5 detection in free questing un-engorged tick at the different sampling regions in Heilongjiang
No. Tick species found
Village (longitude & un-engorged No. PIV5-positive
Region latitude) ticks ticks/no. tested ticks I. persulcatus D. nuttalli H. longicornis H. concinna D. silvarum
Greater MH (N52.97 E122.46) 341 26/341 32 40 29 75 165
Khingan
TH (N52.34 E124.69) 331 0/331 55 8 101 77 90
Mountains
HZQ (N52.03 E123.57) 138 0/138 46 2 41 29 20
XLQ (N49.98 E127.47) 106 0/106 8 8 NA NA 90
HM (N51.71 E126.65) 269 0/269 NA NA 100 109 60
HeiHe AH (N49.98 E127.47) 200 0/200 NA 80 NA NA 120
SW (N49.3 E127.32) 401 0/401 55 40 60 60 186
WDLC (N48.51 E126.19) 456 0/456 65 13 73 40 265
XK (N49.56 E128.47) 211 0/211 NA 40 NA 150 21
YiChun JY (N48.87 E130.40) 237 0/237 NA 77 NA 50 110
WY (N48.13 E129.16) 180 0/180 4 103 NA 12 61
MX (N47.62 E129.14) 619 52/619 175 NA 64 56 324
XL (N47.28 E129.18) 658 0/658 46 233 63 190 126
JST (N47.20 E129.36) 327 30/327 67 NA NA 110 150
NC (N47.14 E129.25) 532 0/532 2 253 90 45 142
HeGang LB (N47.57 E130.82) 110 0/110 36 5 20 3 46
SB (N47.28 E131.85) 86 0/86 18 7 54 NA 7
JiaMuSi HC (N47.02 E130.71) 61 0/61 31 NA NA 26 4
FY (N48.36 E134.30) 48 0/48 NA 15 6 20 7
ShuangYaShan YY (N46.76 E131.80) 70 0/48 7 14 13 0 36
BQ (N46.32 E132.19) 78 0/78 5 10 45 18 NA
RH (N46.79 E134.01) 17 0/17 NA 7 6 NA 4

Abbreviations: NA, no ticks collected.

Rhabdoviridae, Chuviridae, Artoviridae, Tetraviridae, Flaviviridae, Reoviri-
dae, Totiviridae, Herpesviridae, Panoravirus and Retroviridae. Heatmap for
the relative abundances was produced using Heml 1.0. Colour in the
heat maps reflects the logarithm of the relative reads abundance with
red being higher and blue lower than the mean abundance value per
reads. Of the tick virome profiling, the relative abundance of Bunyamw-
era orthobunyavirus and Oxbow orthohantavirus shows a high level of
abundances than other viruses. In addition, it is noteworthy that the
lassa mammarenavirus (the aetiological agent of Lassa Fever) was the
first time the presence in virome of tick with very low in abundance.
However, transmission occurs when humans come into close contact
with the mouse specifically through ingestion or inhalation of mouse
urine, faeces or blood. Arbovirus baku virus abundances higher than
Sindbis virus were considered significance (Figure 2). We identified
contigs annotated as the nucleocapsid protein (N), phosphoprotein (P),
haemagglutinin-neuraminidase (HN), matrix protein (M), polymerase
(L) and fusion protein (F) segments of PIV5 (family Paramyxoviridae,
genus Rubulavirus). To confirm the assembled viral contigs, we mapped
reads back to the full-length genome of the PIV5 strain 1168-1 (Gen-
Bank accession no. KC237064.1, corresponding to the N, L, P, HN, M
and F gene segments). After removing repetitive reads, we mapped
2274 reads to the N gene segment (depth 279), 4746 reads to the L
gene segment (depth: 1125), 1897 reads to the P gene segment (depth
252), 1172 reads to the HN gene segment (depth 210), 2395 reads to
the M gene segment (depth 241) and 3926 reads to the F gene seg-
ment (depth 382). The virus genome obtained comprised N segment
1724 bp, P segment 1298 bp, M segment 1371 bp, F segment 1873 bp,
HN segment 1789 bp and L segment 6804 bp. Our analysis revealed
that ticks are reservoirs for a wide range of viruses and suggests that
discovery and characterization of tickborne viruses will have implica-
tions for viral taxonomy and may provide insight into tick-transmitted
diseases.
3.3 Isolation and purification
The homogenized tick supernatants were divided equally for RNA
extraction and virus isolation. If no CPE was detected in Vero E6 cells,
cultures were continuously blind passaged for three generations to
ensure that no CPE developed. After blind passaged for three gen-
erations, CPE appeared within 4–6 days, and only the I. persulcatus
subgroup from Meixi showed CPE; these features included cell clump-
ing, granulating, shrinking, rounding, seining and arrangement of nuclei
in a classical pattern before detachment (Figure 3a). Non-inoculated
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
8 YANG ET AL .

F I G U R E 2 The viral species names identified by taxonomic annotation using BLASTx are sorted by viral family in the heatmap. The sampling
locations are marked above the heat map. Classification of viral reads obtained from cDNA library preparation for NGS in un-engorged ticks. A
heatmap of the relative abundances was drawn using Heml 1.0. The colours in the heat map reflect the logarithm of the relative read abundance,
with red being higher and blue being lower than the mean abundance value per read.

Vero E6 cells exhibited no CPE (Figure 3b). Then isolates of the result-
ing viruses were grown to different cell lines, including MDCK cells,
ST cells and Vero E6 cells (Figure 3c). Finally, the suspected virus cell
supernatant was detected using nested PCR targeting the N gene of
PIV5 (Figure 3d) and the purified virus formed clear plaques with
approximately 0.5–1 mm in diameter (Figure 3e). Non-inoculated Vero
E6 cells exhibited no plaque (Figure 3f).
3.4 EM, immunofluorescence and the whole
genome sequencing
Paramyxovirus-like particles were identified in infected cells using EM.
Ultra-thin sections of infected Vero E6 cells displayed typical electron
dense virus particles organized in a paracrystalline pattern within the
cytoplasm (Figure 4a). These results confirmed that the isolate virus
belonged to the family Paramyxoviridae. The virus showed an irregu-
lar, spherical, long filamentous form, approximately 200 nm in length.
Enveloped particles ranged from 50 to 200 nm in diameter. Virus parti-
cles were further confirmed by negative staining EM, revealing typical
helical symmetry and enveloped capsids of approximately 150 nm
in diameter, characteristic of Paramyxoviridae (Figure 4b). The PIV5
Tick/HLJ/2019 was also characterized by immunofluorescence assay
(IFA) using anti-PIV5 V monoclonal antibody PIV5 specific. Green flu-
orescent signals were observed at 72 h post-infection in cells infected
with the Tick/HLJ/2019, but not in the negative control (Figure 4c). RT-
PCR results obtained using an additional 13 pairs of primers designed
across the whole sequence indicated that the virus corresponded to
PIV5. The isolated strain was named Tick/HLJ/2019 and sequence
information was deposited in GenBank under the accession number
MV051776. Sequencing revealed a genome of 15,246 bp encoding
seven viral genes arranged in the order 3-leader-N-V/P-M-F-SH-HN-
L-trailer-5, similar to that of other Paramyxoviruses (Figure 4d). These
data confirmed that the Tick/HLJ/2019 strain belongs to PIV5.
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
YANG ET AL . 9

F I G U R E 3 (a) Cytopathic effects appeared within 4–6 days in MDBK cells. (b) Mock-infected MDBK cells. (c) Viral growth kinetics of PIV5 in
different cells. (d) PCR detection of PIV5 in the supernatant and different cells. (M, DNA Marker DL2000; 1, Positive control plasmid; 2, Ixodes
persulcatus supernatant; 3, Vero E6 cell; 4, ST cell; 5, MDCK cell; NC, Negative control). (e) Production of plaques of the PIV5 isolate in Vero
E6 cells. (f) Uninfected Vero E6

3.5 Phylogenetic analysis 96.71%‒99.70%, 96.21%‒100%, 85.38%‒100%, 97.06%‒99.94% and

To trace the evolution of the Tick/HLJ/2019 strain, the whole genomes
of the selected PIV5 reference strains from various hosts were
retrieved from the NCBI nucleotide database. The evolutionary tree
showed that all PIV5 strains were divided into two groups (Groups I
and II). HLJ/Tick/2019 belonged to group II, as it was 96.94%‒99.85%
identical to group II strains, but only 97.44%‒97.97% identical to
group I strains. Tick/HLJ/2019 is closely (98.86%‒99.85%) related to
strains HMZ and SR (Panthera tigris tigris), ZJQ-221(lesser panda) and
GD18 and CAN (pangolin), forming the single subclade 2.2.6. Sub-
clade 2.2.6 has become the dominant subtype prevalent in dogs, pigs
and wildlife across China, implying that these viruses may originate
from the common ancestor. By contrast, strain HLJ/Tick/2019 differed
genetically from strain BC-14 (clade 2.2.3) and was prevalent in wean-
ing calves of the Jilin province near HLJ in China (Figure 5). Moreover,
sequence comparison of the F gene among the new strains revealed
96.32%‒99.88% nucleotide identity. Genes encoding the N, V/P(V), M,
SH, HN and L proteins of Tick/HLJ/2019 exhibited 96.86%‒99.87%,
98.08%‒99.91% nucleotide sequence identity, respectively, to those of
the prototype PIV5 reference strains from various hosts.
3.6 Clinical signs, viral distribution and
replication post infection in ferrets
To evaluate the pathogenicity of strain Tick/HLJ/2019, we utilized a
ferret infection model. The survival rate was 100% in the infection and
control groups throughout the experiment (Figure 6a). Daily observa-
tion revealed major clinical signs, including depression, anorexia, nasal
discharge, huddling, dyspnoea, lower activity levels and coughing in
the infection group, yielding significantly higher average clinical scores
than those in the control group (p < .01), which showed no clinical signs
(Figure 6b). Infected ferrets also developed persistently high fever
(≥39◦ C) at 4 d.p.i., lasting for 8 days, with the highest mean body tem-
perature observed at 6 d.p.i. (Figure 6c). Additionally, infected ferrets
lost significantly more body weight than the controls (Figure 6d). The
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
10 YANG ET AL .

F I G U R E 4 Electron micrographs. (a) Ultra-thin sections of infected cells displayed typical contrast-rich virus particles (black arrows). Scale bar,
500 nm. (b) Via negative staining of the cell culture supernatant, enveloped Paramyxovirus-like particles with a double-layered capsid structure
were observed. The membrane of the viral vesicles showed a spike (black arrows), enlarged viral nucleocapsid (black arrows) and irregularly
shaped cores (diameter = approximately 150 nm). Scale bar, 200 nm. (c) Indirect immunofluorescence detection of PIV5 in Vero E6 cells infected
with strain Tick/HLJ/2019. Bright field; nuclei were detected by DAPI staining (DAPI); immunofluorescence showed positive green fluorescence
signals in Tick/HLJ/2019-infected cells where PIV5 V gene mouse monoclonal antibody was used. Non-infected Vero E6 cells showed no
fluorescent signal (magnification: 100× as shown). (d) Amplification 13 segments of the full-length genome of the PIV5 strain Tick/HLJ/2019 strain
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
YANG ET AL . 11

F I G U R E 5 Phylogenetic tree based on the full-length genomic sequences of PIV5. Nucleotide sequences of the Tick/HLJ/2019 strain; the font
marked in red represented by a triangle and 29 other PIV5 prototype strains were compared using MegAlign software. The phylogenetic tree was
generated using MEGA 7.0 software and the neighbour-joining method with 1000 bootstrap replicates.
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
12 YANG ET AL .

F I G U R E 6 Clinical evaluation of ferrets following inoculation with PIV5. Six ferrets in each group were subcutaneously inoculated with 107.0
TCID50 of virus. (a) Survival, (b) clinical scores, (c) temperature and (d) body weight were assessed and are shown as the standard error of the
mean. Body temperatures >39◦ C were defined as fever. Data are presented as mean ± SEM. The two-tailed Mantel–Cox method or the two-tailed,
unpaired t-test was used to assess p-values. *p < .05, **p < .01, and ***p < .001. (e, f, g) Load viral RNA copies in tissues of PIV5-infected ferrets. On
3, 6, and 14 dpi. Each organ was collected and homogenized for viral RNA detection by qPCR. The dashed black lines in these panels indicate the
limit of detection. (h, i, g) Virus titration in tissues of PIV5-infected ferrets. On 3, 6, and 14 dpi. Each organ was collected and homogenized for virus
titration in Vero E6 cells.

YANG ET AL .
nasal turbinate, tonsil, trachea, lung, liver, small intestine, kidney, pan-
creas, spleen and brain from each ferret were collected for viral RNA
quantification by RT-qPCR and virus titration in Vero E6 cells at 3, 6 and
14 d.p.i. As PIV5 reportedly mainly damages the respiratory and ner-
vous systems of animals, thus, to investigate whether Tick/HLJ/2019
replicates in the upper respiratory tract and brain of ferrets, we evalu-
ated viral RNA in the tissues and organs of two ferrets. Higher levels of
viral RNA were detected in the nasal turbinate, tonsils and trachea at 3
d.p.i. (Figure 6e). To investigate whether the observed fever and loss of
appetite in two ferrets were caused by the virus, the animals were euth-
anized at 6 d.p.i. (Figure 6f). Viral RNA was relatively low in the nasal
turbinate, tonsils and trachea, but was significantly elevated in the lung
and spleen. In contrast, viral RNA was not detected in the tissues or
organs of either infected ferret euthanized at 14 d.p.i., except for small
amounts in the brain and spleen and a higher level (103.3 copies/g) in
the lungs, similar to the viral load observed at 6 d.p.i., suggesting that
the lung is the most susceptible organ (Figure 6f). We investigated the
replication dynamics of Tick/HLJ/2019 in ferrets. Infectious virus titre
was detected in the viral RNA-positive nasal turbinate, trachea, ton-
sils, lung, spleen, brain and small intestine, as determined using the
TCID50 , but not in other organs tested. Viral titres markedly decreased
between 3 and 6 d.p.i. in the nasal turbinate, trachea and tonsils. No
viable virus was detected in either ferret at 14 d.p.i. Viral titres in the
lung tissue of one animal were 1.5 log10 above the cut-off level at 3
d.p.i., increasing to 3.9 and 3.0 log10 for both animals at 6 d.p.i. Unlike
the viral RNA-positive brain and small intestine, viral titres in the lungs
decreased only slightly at 14 d.p.i. (Figure 6h–j). These results indicate
that Tick/HLJ/2019 replicated in the upper respiratory tract and brain
of ferrets for up to 14 days without causing severe disease or death as
confirmed by the viral load in the respiratory and nervous systems.
3.7 Necropsy, histopathological evaluation and
IHC staining
At necropsy, the infected ferrets exhibited severe gross lesions with
enlargement and haemorrhage. Severe interstitial oedema and dif-
fuse haemorrhage were observed on the lung surface, and the lung
parenchymas were firmer and heavier than those of the control
group (Figure 7a). Hyperaemia and enlargement of the brains along
with severely swollen, friable, haemorrhagic and necrotic spleens
were observed (Figure 7b,c). No macroscopic lesions were recorded
in control group tissues (Figure 7d–f). Histopathological examina-
tion showed pneumonic lesions characterized by extensive congestion
with haemosiderin deposition, alveolar epithelial cell proliferation and
inflammatory cell infiltration, leading to widening of the lung alveolar
diaphragm (Figure 7g). Degeneration and necrosis of neurons as well
as glial cell proliferation and perivascular infiltration were observed
around small blood vessels in the brain tissue (Figure 7h). Red pulp
in the spleen contained a small amount of haemosiderin deposition
and infantile erythrocytosis (Figure 7i). Control animals exhibited no
gross lesions (Figure 7j-l). In IHC staining, PIV5 antigen was primar-
18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
13
ily detected in the lung, brain and spleen. The presence of the PIV5
NP antigen was confirmed in lung bronchial epithelial cells (Figure 7m).
Neurons and astrocytes were severely infected with PIV5 in the brain
(Figure 7n). Compared with the lung and brain, the spleen PIV5 anti-
genic signals were not apparent through IHC staining (Figure 7o). No
PIV5 antigens were recorded in control group tissues (Figure 7p–f).
This result indicates that tick-derived exhibits PIV5 in lung, brain and
spleen infection.
4 DISCUSSION
In the last decade, climate change has become complex, the geographic
range of tick vectors transmitting tick-borne diseases has expanded
and knowledge on pathogenic agents has become limited (Nuttall &
Labuda, 2003). Therefore, despite the low prevalence of tick-borne
PIV5 in this study, emerging and re-emerging tick-borne infectious dis-
eases constitute a threat to human health. They may also negatively
affect animal health and production with a potentially serious impact
on the global stock farming industry (Fuente et al., 2016). Ticks are key
sentinel hosts that expose humans and animals to tick-borne diseases.
Among the tick vectors, ixodid ticks are important haematophagous
ectoparasites. The most common cause of these infectious diseases is
tick-borne encephalitis virus (TBEV), which is a flavivirus in the Fla-
viviridae family (Kunze, 2016). Furthermore, Crimean–Congo haem-
orrhagic fever virus (CCHFV), belonging to the family Nairoviridae,
is the tick-borne etiological agent of Crimean–Congo haemorrhagic
fever in humans (Yadav et al., 2013). Severe fever with thrombocy-
topenia syndrome (SFTS) is an emerging tick-borne infectious disease
caused by SFTS virus belonging to the family Phenuiviridae of the
order Bunyavirales (Yu et al., 2011). In previous studies, PIV5 infections
have been found in humans, livestock, companion animals and wildlife
and Paramyxoviridae infection is increasingly being reported in animal
species. Hitherto, whether members of the Paramyxoviridae family are
present in ticks has been unclear. Yet, for the first time, the tick was
detected as a novel transboundary vector of PIV5 in the HLJ province,
northeast China. Increasing evidence has indicated the potential cross-
species transmission of PIV5 that can lead to animal pathogenicity.
However, the vectors that act as intermediate hosts to transfer the
virus from its original host to humans and animals remain unknown.
The results of the current study indicate a possible novel mechanism
of PIV5 transmission in tick: that is, via tick bites. However, this may
not be the case if the association is specific to PIV5 infection cases.
These assumptions require validation through more experimental data
and greater support from clinical data. We collected 5476 un-engorged
tick specimens from 22 representative sampling sites in HLJ including a
large forest area, custom ports, border areas and tourist sites. The ticks
were collected over a large area to increase the probability of detecting
PIV5. High-throughput NGS enables rapid identification of pathogens
in clinical samples (Zhang et al., 2019). It has successfully been used
to discover many tick-borne viruses in China, such as Alongshan virus
(Wang et al., 2019), Tamdy virus (Zhou et al., 2018), Jingmen tick virus
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
14 YANG ET AL .

F I G U R E 7 Gross lesions in experimentally infected ferrets with PIV5. The lesions of the lung, brain and spleen of the ferrets that were
inoculated with 107.0 TCID50 of the virus are shown here. (a) Severe interstitial oedema and diffuse haemorrhage of the lung; (b) hyperaemia and
brain enlargement. (c) Severe haemorrhage and necrosis of the spleen were found. (d–f) The surface of lung, brain and spleen in the control group is
also shown. Histopathological changes in experimentally infected ferrets with PIV5. (g) Extensive congestion with haemosiderin deposition (black
arrows), alveolar epithelial cell proliferation and inflammatory cell infiltration (black arrows) leading to widening of the alveolar diaphragm of the
lungs. (h) Glial cell proliferation and perivascular infiltration of glial cells can be seen around small blood vessels in brain tissue. (i) Red pulp contains
a small amount of haemosiderin deposition, infantile erythrocytosis in the spleen. (j, k, l) Negative control (histology changes in the healthy ferret).
Haematoxylin and eosin staining, bar = 100 µm. Immunohistochemistry of tissues from ferrets infected with PIV5. The presence of the PIV5 NP
antigen was confirmed in (m) lung (Bronchial epithelial cells, bar = 100 µm), (n) brain (Astrocytes, bar = 100 µm) and (o) spleen (lymphoblasts, bar =
50 µm) by black arrows. (p, q, r) Negative viral antigens were detected in the lung, brain and spleen in the control animal.

YANG ET AL .
(Qin et al., 2014) and SFTS virus (Liu et al., 2014). In our research, using
NGS, we successfully isolated PIV5 from the taiga tick I. persulcatus
in Vero E6 cells. Although the NGS revealed only 2.63%–3.2% cover-
age to viral open reading frames of the total reads, it still proved to
be effective in virus isolation. Further analysis using nested PCR, IFA,
EM and different cell cultures confirmed the presence of PIV5. Notably,
PIV5, which has been isolated from several isolates, including the AGS
original W3A strain (Young et al., 2007), can persist in Vero cells with
no CPE. In contrast, we observed CPE in different cell lines, includ-
ing Vero E6, ST and MDCK. Subsequently, analysis of the full-length
15,246 bp sequence showed that the Tick/HLJ/2019 genome was
98.74% identical to that of the prototype W3A strain at the nucleotide
level. Therefore, we excluded the possibility of cellular endogenous
contamination. The phylogenetic analysis showed that the 30 PIV5
strains formed two groups (Groups I [2/30] and II [28/30]). At present,
clade 2.1 contains two isolates: XJ033 and AGS. It has been reported
that the equine PIV5 XJ033 strain obtained by Illumina sequencing
platform showed a 99.9% homology with the human PIV5 strain AGS.
However, previous attempts to isolate the equine PIV5 using Vero cells
failed (Xie et al., 2020). Nevertheless, the possibility of inter-species
transmission from humans rather than animals cannot be excluded. The
phylogenetic tree showed that the isolated Tick/HLJ/2019 strain was
closely related to PIV5 strains 2.2.6 from various wildlife and domes-
tic animals in China and South Korea. Based on the NCBI sequence
information, all PIV5 isolates were obtained from the lung tissue of ani-
mals. These data indicated that PIV5 exhibits a common phenomenon
and tissue tropism in respiratory diseases in animals. However, further
studies involving animal experiments are required to investigate poten-
tial differences in the pathogenicity of tick-derived PIV5. We carried
out in vivo experiments on ferrets as commonly used animal models
for respiratory viruses and cross-species transmission. The ferret has
been used infection as a representative model for Human Influenza
virus (Yang et al., 2016) and Coronavirus diseases (Shi et al., 2020).
We evaluated the clinical disease, immune response and viral load
of the Tick/HLJ/2019 isolate in experimentally infected animals. We
found that the Tick/HLJ/2019 virus replicates systemically in ferrets.
Infected ferrets showed early disease signs at 3–6 d.p.i., with adult
ferrets presenting mild clinical symptoms, including fever, nasal dis-
charge, huddling and dyspnoea but no mortality. Notably, some carriers
were asymptomatic. The symptoms gradually increased over time and
infected ferrets lost significantly more body weight than the controls,
indicating that PIV5 causes disease in ferrets. The main histopatholog-
ical parameters included the presence of mononuclear inflammatory
infiltrate (lymphocytic/monocytic) surrounding the ventricles in the
brain and focal interstitial pneumonitis with distension of the alveo-
lar sacs in the lungs. Moreover, the lungs, spleen and brain exhibited a
significantly higher RNA viral load. These changes are similar to those
caused by other animal PIV5 strains (Liu et al., 2015, 2017). It is also
clear that the true genetic diversity of PIV5 may be greater than that
first realized (Feehan et al., 2019), meaning that low-level PIV5 cir-
culation in ticks remains a potential risk of infection transmission to
humans.
18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
15
5 CONCLUSION
In summary, our study describes the isolation, identification and
pathogenicity of the first recorded Chinese PIV5 strain HLJ/Tick/2019.
The detailed results presented in this study are important for under-
standing the act of ticks as vectors for potential risks of PIV5 trans-
mission to animals exposed to the pathogen. Further surveillance of
PIV5 in different vectors is necessary to better understand both the
epidemiology and pathogenicity of the viral transmission of disease.
AUTHOR CONTRIBUTIONS
Mingfa Yang prepared the original manuscript. Yunyun Ma supervised
the work and participated in the conception of the study. Liandong Qu
reviewed the manuscript. All authors participated in the interpreta-
tion of data and provided important intellectual contributions to the
manuscript.
ACKNOWLEDGEMENTS
We thank Professor Song for participating in tick collection and identi-
fication. This study was supported by the Project supported by General
Administration of Customs, P.R. China (grant no. 2019HK125) and
National Key R&D Program of China (grant no. 2017YFD0501801,
2017YFD0502303, 2019YFC1200400).
CONFLICT OF INTEREST
The authors declare no conflict of interest.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the
corresponding author upon reasonable request.
ETHICS STATEMENT
Animal experiments were performed in animal biosafety level 3 (P3+)
containment facilities approved by the Committee on the Ethics of
Animal Experiments of HVRI of the Chinese Academy of Agricultural
Sciences. This study was performed in strict accordance with Chi-
nese Regulations for Laboratory Research and animal protocols were
approved by the HVRI Committee on the Ethics of Animal Experiments
(HSY–IACUC-2019-219).
ORCID
Mingfa Yang https://orcid.org/0000-0002-1396-5763
REFERENCES
Adams, M. J., Lefkowitz, E. J., King, A. M. Q., Harrach, B., Harrison, R. L.,
Knowles, N. J., Kropinski, A. M., Krupovic, M., Kuhn, J. H., Mushegian, A.
R., Nibert, M., Sabanadzovic, S., Sanfaçon, H., Siddell, S. G., Simmonds,
P., Varsani, A., Zerbini, F. M., Gorbalenya, A. E., & Davison, A. J. (2017).
Changes to taxonomy and the International Code of Virus Classification
and Nomenclature ratified by the International Committee on Taxonomy
of Viruses 2017. Archives of Virology, 162(8), 2505–2538.
Atoynatan, T., & Hsiung, G. D. (1969). Epidemiologic studies of latent virus
infections in captive monkeys and baboons. II. Serologic evidence of

16
myxovirus infections with special reference to SV5. American Journal of
Epidemiology, 89, 472–479.
Black, W. C. I., & Piesman, J. (1994). Phylogeny of hard and soft-tick
taxa (Acari: Ixodidae) based on mitochondrial 16S rDNA sequences.
Proceedings National Academy of Science USA, 91, 10034–10038.
Charoenkul, K., Nasamran, C., Janetanakit, T., Chaiyawong, S., Bunpapong,
N., Boonyapisitsopa, S., Tangwangvivat, R., & Amonsin, A. (2021). Molec-
ular detection and whole genome characterization of Canine Parain-
fluenza type 5 in Thailand. Science Reports, 11, 3866.
Chatziandreou, N., Stock, N., Young, D., Andrejeva, J., Hagmaier, K.,
Mcgeoch, D. J., & Randall, R. E. (2004). Relationships and host range
of human, canine, simian and porcine isolates of simian virus 5 (parain-
fluenza virus 5). Journal of General Virology, 85, 3007–3016.
Chen, Z., Yang, X., Bu, F., Yang, X., Yang, X., & Liu, J. (2010). Ticks (acari:
ixodoidea: argasidae, ixodidae) of China. Experimental & Applied Acarol-
ogy, 51, 393–404.
Chen, Z., Xu, P., Salyards, G. W., Harvey, S. B., Rada, B., Fu, Z. F., & He,
B. (2012). Evaluating a parainfluenza virus 5-based vaccine in a host
with pre-existing immunity against parainfluenza virus 5. PLoS ONE, 7,
e50144.
de la Fuente, J., Waterhouse, R. M., Sonenshine, D. E., Roe, R. M., Ribeiro,
J. M., Sattelle, D. B., & Hill, C. A. (2016). Tick genome assembled: New
opportunities for research on tick-host-pathogen interactions. Frontiers
in Cellular and Infection Microbiology, 6, 103.
Feehan, B. J., Penin, A. A., Mukhin, A. N., Kumar, D., Moskvina, A. S.,
Khametova, K. M., Yuzhakov, A. G., Musienko, M. I., Zaberezhny, A. D.,
Aliper, T. I., Marthaler, D., & Alekseev, K. P. (2019). Novel mammalian
orthorubulavirus 5 discovered as accidental cell culture contaminant.
Viruses, 11, 777.
Goswami, K. K., Randall, R. E., Lange, L. S., & Russell, W. C. (1987). Antibod-
ies against the paramyxovirus SV5 in the cerebrospinal fluids of some
multiple sclerosis patients. Nature, 327, 244–247.
Hull, R. N., Minner, J. R., & Smith, J. W. (1956). New viral agents recovered
from tissue cultures of monkey kidney cells. I. Origin and properties of
cytopathogenic agents S.V.1, S.V.2, S.V.4, S.V.5, S.V.6, S.V.11, S.V.12 and
S.V.15. American Journal of Epidemiology, 63, 204–215.
Hsiung, G. D. (1972). Parainfluenza–5 virus. Infection of man and animal.
Progress in Medical Virology, 14, 241–74.
Hierweger, M. M., Werder, S., & Seuberlich, T. (2020). Parainfluenza virus 5
infection in neurological disease and encephalitis of cattle. International
Journal of Molecular Sciences, 21, 498.
Henrickson, K. J. (2003). Parainfluenza viruses. Clinical Microbiology Reviews,
16, 242–264.
Ibrahim, Y. M., Zhang, W. L., Werid, G. M., Zhang, H., Pan, Y., Zhang, L.,
Xu, Y. F., Li, C. W., Chen, H. Y., & Wang, Y. (2022). Characterization of
parainfluenza virus 5 from diarrheic piglet highlights its zoonotic poten-
tial. Transboundary and Emerging Diseases. https://doi.org/10.1111/tbed.
14482
Jia, N., Wang, J., Shi, W., Du, L., Sun, Y., Zhan, W., Jiang, J.-F., Wang, Q., Zhang,
B., Ji, P., Bell-Sakyi, L., Cui, X.-M., Yuan, T.-T., Jiang, B.-G., Yang, W.-F.,
Lam, T. T.-Y., Chang, Q.-C., Ding, S.-J., Wang, X.-J., . . . Cao, W.-C. (2020).
Large-scale comparative analyses of tick genomes elucidate their genetic
diversity and vector capacities. Cell, 182, 1328.e13–1340.e13.
Kunze, U. (2016). The International Scientific Working Group on tick-borne
encephalitis (ISW TBE): Review of 17 years of activity and commitment.
Ticks and Tick-borne Diseases, 7, 399–404.
Lee, Y. N., Park, C. K., Shin, J. H., & Lee, C. (2013). Characterization in vitro
and in vivo of a novel porcine parainfluenza virus 5 isolate in Korea. Virus
Research, 178, 423–429.
Lee, Y. N., & Lee, C. (2013). Complete genome sequence of a novel
porcine parainfluenza virus 5 isolate in Korea. Archives of Virology, 158,
1765–1772.
Liu, Y., Li, N., Zhang, S., Zhang, F., Lian, H., & Hu, R. (2015). Parainfluenza
virus 5 as possible cause of severe respiratory disease in calves, China.
Emerging Infectious Diseases, 21, 2242–2244.
18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
YANG ET AL .
Liu, Q., He, B., & Huang, S. Y. (2014). Severe fever with thrombocytope-
nia syndrome, an emerging tick-borne zoonosis. The Lancet Infectious
Diseases, 14, 763–772.
Liu, C., Li, X., Zhang, J., Yang, L., Li, F., Deng, J., Tan, F., Sun, M., Liu, Y., & Tian, K.
(2017). Isolation and genomic characterization of a canine parainfluenza
virus type 5 strain in China. Archives of Virology, 162, 2337–2344.
McCandlish, I. A., Thompson, H., Cornwell, H. J., & Wright, N. G. (1978). A
study of dogs with kennel cough. The Veterinary Record, 102, 293–301.
Nuttall, P. A., & Labuda, M. (2003). Dynamics of infection in tick vectors and
at the tick host interface. Advances in Virus Research, 60, 233–272.
Qin, X.-C., Shi, M., Tian, J.-H., Lin, X.-D., Gao, D.-Y., He, J.-R., Wang, J.-B., Li, C.-
X., Kang, Y.-J., Yu, B., Zhou, D.-J., Xu, J., Plyusnin, A., Holmes, E. C., & Zhang,
Y.-Z. (2014). A tickborne segmented RNA virus contains genome seg-
ments derived from unsegmented viral ancestors. Proceedings National
Academy of Science USA, 111, 6744–6749.
Rima, B. K, Gatherer, D., Young, D. F, Norsted, H., Randall, R. E., & Davison, A.
J. (2014). Stability of the Parainfluenza Virus 5 genome revealed by deep
sequencing of strains isolated from different hosts and following passage
in cell culture. Journal of Virology, 88, 3826–3836.
Shi, J., Wen, Z., Zhong, G., Yang, H., Wang, C., Huang, B., Liu, R., He, X., Shuai,
L., Sun, Z., Zhao, Y., Liu, P., Liang, L., Cui, P., Wang, J., Zhang, X., Guan, Y.,
Tan, W., Wu, G., . . . Bu, Z. (2020). Susceptibility of ferrets, cats, dogs, and
other domesticated animals to SARS-coronavirus 2. Science, 368, 1016–
1020.
Vandvik, B., & Norrby, E. (1989). Paramyxovirus SV5 and multiple sclerosis.
Nature, 338, 769–771.
Wang, Z.-D., Wang, B., Wei, F., Han, S.-Z., Zhang, L., Yang, Z.-T., Yan, Y., Lv,
X.-L., Li, L., Wang, S.-C., Song, M.-X., Zhang, H.-J., Huang, S.-J., Chen, J.,
Huang, F.-Q., Li, S., Liu, H.-H., Hong, J., Jin, Y.-L., . . . Liu, Q. (2019). A
new segmented virus associated with human febrile illness in China. New
England Journal of Medicine, 380, 2116–2125.
Xie, J., Tong, P., Zhang, A., Zhang, L., Song, X., & Kuang, L. (2020). Identi-
fication and characterization of the first equine Parainfluenza virus 5.
Virologica Sinica, 35, 245–247.
Yang, D. K., Nah, J. J., Kim, H. H., Choi, S. S., Bae, Y. C., Park, J. W., & Song, J. Y.
(2014). Isolation of novel bovine parainfluenza virus type 5 (bPIV5) and
its incidence in Korean cattle. Korean Journal of Veterinary Research, 54,
107–112.
Yadav, P. D, Cherian, S. S., Zawar, D., Kokate, P., Gunjikar, R., Jadhav, S.,
Mishra, A. C., & Mourya, D. T. (2013). Genetic characterization and
molecular clock analyses of the Crimean-Congo hemorrhagic fever
virus from human and ticks in India, 2010–2011. Infection, Genetics and
Evolution, 14, 223–231.
Yu, X.-J., Liang, M.-F., Zhang, S.-Y., Liu, Y., Li, J.-D., Sun, Y.-L., Zhang, L., Zhang,
Q.-F., Popov, V. L., Li, C., Qu, J., Li, Q., Zhang, Y.-P., Hai, R., Wu, W., Wang,
Q., Zhan, F.-X., Wang, X.-J., Kan, B., . . . Li, D.-X. (2011). Fever with throm-
bocytopenia associated with a novel Bunyavirus in China. New England
Journal of Medicine, 364, 1523–1532.
Young, D. F., Carlos, T. S., Hagmaier, K., Fan, L., & Randall, R. E. (2007). AGS
and other tissue culture cells can unknowingly be persistently infected
with PIV5; a virus that blocks interferon signalling by degrading STAT1.
Virology, 365, 238–240.
Yang, H., Chen, Y., Qiao, C., He, X., Zhou, H., Sun, Y., Yin, H., Meng, S., Liu, L.,
Zhang, Q., Kong, H., Gu, C., Li, C., Bu, Z., Kawaoka, Y., & Chen, H. (2016).
Prevalence, genetics, and transmissibility in ferrets of Eurasian avian-like
H1N1 swine influenza viruses. Proceedings National Academy of Science
USA, 113, 392–397.
Zhai, J.-Q., Zhai, S.-L., Lin, T., Liu, J.-K., Wang, H.-X., Li, B., Zhang, H., Zou, S.-Z.,
Zhou, X., Wu, M.-F., Chen, W., & Luo, M.-L. (2017). First complete genome
sequence of parainfluenza virus 5 isolated from lesser panda. Archives of
Virology, 162, 1413–1418.
Zhang, L., Collins, P. L., Lamb, R. A., & Pickles, R. J. (2011). Comparison of
differing cytopathic effects in human airway epithelium of parainfluenza
virus 5 (W3A), parainfluenza virus type 3, and respiratory syncytial virus.
Virology, 421, 67–77.
 18651682, 0, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/tbed.14681 by Zhejiang University, Wiley Online Library on [04/12/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
YANG ET AL . 17

Zhang, M., Hill, J. E., Fernando, C., Alexander, T. W., Timsit, E., Meer, F.,
& Huang, Y. (2019). Respiratory viruses identified in western Cana- How to cite this article: Yang, M., Ma, Y., Jiang, Q., Song, M.,
dian beef cattle by metagenomic sequencing and their association with Kang, H., Liu, J., & Qu, L. (2022). Isolation, identification and
bovine respiratory disease. Transboundary and Emerging Diseases, 66,
pathogenic characteristics of tick-derived parainfluenza virus
1379–1386.
Zhou, H., Ma, Z., Hu, T., Bi, Y., Mamuti, A., Yu, R., Carr, M. J., Shi, M., 5 in northeast China. Transboundary and Emerging Diseases,
Li, J., Sharshov, K., Gao, G. F., & Shi, W. (2018). Tamdy virus in Ixodid 1–17. https://doi.org/10.1111/tbed.14681
ticks infesting Bactrian camels, Xinjiang, China, 2018. Emerging Infectious
Diseases, 25, 2136–2138.