Food Microbiology Laboratory For The Food Science Student: Cangliang Shen Yifan Zhang

Cangliang Shen
Yifan Zhang
Food Microbiology
Laboratory
for the Food
Science Student
A Practical Approach
Second Edition
Food Microbiology Laboratory for the
Food Science Student
Cangliang Shen • Yifan Zhang
Food Microbiology
Laboratory for the Food
Science Student
A Practical Approach
Second Edition
Cangliang Shen Yifan Zhang
Division of Animal and Nutritional Department of Nutrition and Food
Sciences Science
West Virginia University Wayne State University
Morgantown, WV, USA Detroit, MI, USA
ISBN 978-3-031-26196-1 ISBN 978-3-031-26197-8 (eBook)

https://doi.org/10.1007/978-3-031-26197-8
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature
Switzerland AG 2017, 2023
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher,
whether the whole or part of the material is concerned, specifically the rights of translation,
reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any
other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are
exempt from the relevant protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in
this book are believed to be true and accurate at the date of publication. Neither the publisher nor
the authors or the editors give a warranty, expressed or implied, with respect to the material
contained herein or for any errors or omissions that may have been made. The publisher remains
neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Switzerland AG
The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland
Preface to the Second Edition
After publishing the 1st edition for 5 years, we realize that it is better to revise
and update for a 2nd edition of this food microbiology laboratory textbook.
We add five new chapters including “Chapter 10—Thermal Inactivation of
Escherichia coli O157:H7 in Mechanically Tenderized Beef Steaks and Color
Measurements”, “Chapter 11—Evaluate Antimicrobial Activity of Chlorine
Water on Apples and Measurement of Free Chlorine Concentrations”,
“Chapter 12–Evaluate Cross-contamination of Salmonella on Tomatoes in
Wash Water Using Most Probable Number (MPN) Technique”, “Chapter
15—DNA Extraction and Purity Determination of Foodborne Pathogens”,
and “Chapter 16—Practice of Multiplex PCR to Identify Bacteria in Bacterial
Solutions”. We also include new lab work flowcharts for Gram-staining and
endospore-staining technology in Chapter 1, pour plating and spread plating
in Chapter 3, Enterotube II in Chapter 9, and Kirby-Bauer test procedure in
Chapter 20. We include a new sample of syllabus with the hybrid teaching of
both lecture and lab sections in one course, which will assist junior faculty/
instructors to develop similar lecture and lab courses.
Division of Animal and Nutritional Sciences Cangliang Shen

West Virginia University
Morgantown, WV, USA
v
Preface to the First Edition
In order to help food science students to understand the relationship between

microorganism and food products, it is important to develop a food microbi-
ology laboratory textbook. Currently, a very limited amount of food microbi-
ology laboratory manual is commercially available, which makes it difficult
for students to have a useful food microbiology laboratory manual with them.
The aim of this book is to supply food microbiology lab course instructor
with a useful lab manual to teach this course and food science students and
food microbiologists who will be working in food industry with a readable
easily understanding and following laboratory manual. This book is designed
to give students an understanding of the role of microorganisms in food pro-
cessing and preservation; relation of microorganisms to food contamination,
foodborne illness, and intoxication; general food processing and quality con-
trol; role of microorganisms in health promotion; and federal food processing
regulations. The listed laboratory exercises are aimed to provide a hands-on-
opportunity for the student to practice and observe the principles of food
microbiology especially enumeration, isolation and identification of microor-
ganism in foods. Students will familiarize themselves with the techniques
used to research, regulate, prevent and control the microorganisms in food
and understand the function of beneficial microorganism during food manu-
facturing process. This book includes almost all pictures of each step of lab
work, and all the pictures are coming from real lab practice and lab results.
This lab manual is typically fit for small land-grant Institutions to teach food
microbiology lab class, and for non-land grant universities who plan to
develop food science course curriculum.

Morgantown, WV, USA
vii
Acknowledgments
I appreciate my division director Dr. Robert Taylor who assigned me to

develop and teach food microbiology laboratory course when I joined West
Virginia University. I got the inspiration of writing this food microbiology
manual from my Ph.D. advisor Dr. John N. Sofos, University Distinguished
Professor of Colorado State University. He taught me “safety, quality, and
quantity” are the three basic principles to conduct any food microbiology
research almost 10 years ago when I was an amateur of food microbiology. I
will pass this information to my future students and readers of this lab man-
ual. I would love to greatly appreciate Ms. Lindsey Williams, communication
manager at Davis College, West Virginia University, who has helped to take
all pictures of all lab works and results in each chapter. I want to thank my
graduate students, Mr. Corey Coe, Mr. KaWang Li, Ms. Rebecca Stearns, and
Ms. Lacey Lemonakis, and my undergraduate teaching assistants, Ms. Carly
Long, Payton Southall, Jordan Garry, and Jessica Clegg, for their generous
help during writing of this lab manual. The written of Chapter 14 obtained
strong support from Mr. Mark Carlson at Western Kentucky University. This
2nd edition book was supported by the United States Department of
Agriculture, the National Institute of Food and Agriculture-Research and
Extension Experiences for Undergraduates (REEU) program (Award
#2020-68018-30657). Finally, I would love to thank my wife Dr. Yi Xu for
her love and support. This book is also dedicated to my 6-year-old son Alex
Shen.

Morgantown, WV, USA
ix
Contents
1 Food Microbiology Laboratory Safety

and Notebook Record�� 1
Three Principles of Conducting Food Microbiology Lab Work�� 1
Introduction of Biosafety Level (BSL)�� 1
Lab Safety Rules�� 1
Lab Notebook Requirement�� 2
2
Staining Technology and Bright-Field Microscope Use�� 9
Major Experimental Materials �� 9
Gram Stain Procedure�� 10
Endospore Stain Procedure�� 10
Bright-Field Microscope Use�� 11
3
Enumeration of Bacteria in Broth Suspension
by Spread and Pour Plating�� 19
Dilution Procedure �� 20
Numeration�� 21
Review Questions�� 21
4 Isolation of Foodborne Pathogens on Selective,
Differential, and Enrichment Medium by Streak-Plating �� 25
Introduction of Selective and Differential Medium �� 25
Introduction of Medium for Isolating Foodborne Pathogens�� 25
Practice of Streak-Plating�� 26
Figure of Streak-Plating�� 26
Question for Review�� 27
5 Enumeration of Aerobic Plate Counts, Coliforms,
and Escherichia coli of Organic Fruit Juice on Petrifilm �� 31
Introduction�� 31
Procedure of Plating Upon Petrifilm�� 32
6 Enumeration and Identification of Staphylococcus aureus
in Chicken Salads�� 39
Enumeration of S. aureus in Chicken Salads �� 39
Procedure �� 40
xi
xii Contents
Review Question�� 40

Lab Work Flowchart�� 41
Part of Result Figures (Work from Previous Students)�� 42
7 Enumeration
and Identification of Listeria monocytogenes
on Ready-to-Eat (RTE) Frankfurters�� 45
Lab Work Procedure�� 46
Enumeration of L. monocytogenes or L. monocytogenes
on Frankfurters�� 46
Procedure �� 46
Lab Work Flochart �� 47
Part of Result Figures (Work from Previous Students)�� 48
8 Isolation
and Identification of Salmonella
and Campylobacter spp. on Broiler Carcasses �� 53
Major Medium Used for Salmonella Isolation�� 54
Major Medium Used for Campylobacter Isolation�� 54
Figure of API-20 E Results Sheet�� 56
API 20 E Test Results Table of Color Change �� 56
Positive Salmonella spp. Result �� 57
Lab Work Flowchart (Salmonella)�� 58
Lab Work Flowchart (Campylobacter)�� 59
Part of Results Figures (Work from Previous Students)�� 60
9 T
hermal Inactivation of Escherichia coli O157:H7
in Non-intact Reconstructed Beef Patties�� 63
Major Experimental Material�� 63
Identification of E. coli O157:H7�� 65
Procedure �� 66
USDA-Integrated-Predictive-Modeling-Program Software�� 68
Brief Procedures�� 68
References (After Class Reading)�� 68
10 T
hermal Inactivation of Escherichia coli O157:H7
in Mechanically Tenderized Beefsteaks
and Color Measurement�� 71
Example of the Lab Result�� 73
General Operating Procedure for Minolta
Colorimeter CR 300 Series�� 75
Equipment Reset Steps�� 75
Contents xiii
Results Picture from Previous Lab Sections�� 76

Color Meter Lab Work Flowchart�� 77
11 valuate Antimicrobial Activity of Chlorine Water
E
on Apples and Measurement of Free Chlorine
Concentrations �� 81
Procedure: Two Students/One Group�� 82
Test Free Chlorine Concentration Using DPD Kit Flowchart �� 85
12 Evaluate Cross-Contamination of Salmonella
on Tomatoes in Wash Water Using Most Probable
Number (MPN) Technique�� 89
Procedure: Two Students/One Group�� 90
MPN Work Flowchart�� 92
MPN Calculation Lab Work Flowchart �� 93
13
Cultivation of Anaerobic Bacteria in Canned Food�� 97
Introduction�� 97
Procedure �� 98
Procedure of Cooked Meat Medium�� 98
Procedure of Detecting Possible Clostridium Perfringens�� 98
Pictures�� 99
14 Observation and Enumeration of Molds
from Spoiled Bread�� 103
Procedure: Lacto-Phenol Cotton Blue Stain�� 104
Enumeration of Molds in Bread�� 104
Part of Results Figures (Work from Previous Students)�� 106
15 DNA Extraction and Purity Determination
of Foodborne Pathogens�� 109
DNA Extraction and Purity Measurement
16
Practice of Multiplex PCR for Bacteria Identification�� 115
xiv Contents
PCR Lab Work Flowchart�� 117

17 P
CR Identification of Listeria Monocytogenes
in Deli Meat�� 121
Major Materials and Equipment�� 121
Equipment�� 122
Procedure �� 122
18 Cheese
Making and Characterization�� 127
Major Materials and Equipment�� 127
Lab Work FlowChart�� 128
19 Wine
and Pickle Making and Characterization�� 131
20 Antimicrobial
Resistance of Commensal Bacteria
from Environment�� 139
Disk Diffusion Test�� 140
Kirby-Bauer Test Lab Work Flowchart�� 141
21 Introduction
of Oral Presentation
and Job Interview Preparation�� 145
Major Presentation Topics �� 145
Presentation Bodies�� 145
Suggested Peer-Reviewed Journals�� 146
Suggested Literature Search Website�� 146
Tips for a Good Oral Presentation �� 146
Presenter/Leader: Evaluation Rubrics (150 Points) �� 146
Practice of Job Interview�� 147
Tips for Job Search�� 147
Course Description�� 149
Methods of Instruction�� 149
Expected Learning Outcomes�� 149
Outlines of Topics�� 149
Required Equipment�� 150
Attendance Requirements�� 150
Grading�� 150
Grading Scale�� 150
Availability of Lecture Notes �� 151
General Education Curriculum Statement �� 151
Physical Handicap Statement�� 151
Contents xv
Inclusivity Statement�� 151

Cell Phone Usage�� 151
Academic Integrity Statement�� 151
Laboratory Safety Rules/Procedures�� 151
Adverse Weather Statement �� 152
COVID-19 Syllabus Statement�� 152
Course Description�� 152
Course Objectives�� 153
Reference Books�� 153
Course Evaluation�� 154
Grading Scales �� 156
Course Drops and Withdrawals�� 156
Academic Dishonesty: Plagiarism and Cheating�� 156
Student Disabilities Services�� 156
Index�� 159
About the Authors
Cangliang Shen is an Associate Professor/

Extension Specialist at Davis College, Division
of Animal and Nutritional Sciences and Family
and Community Development, West Virginia
University. Dr. Shen worked at IEH Consulting
Groups (Research Associate), USDA-ARS
(Postdoctoral Research Microbiologist), and
Western Kentucky University (Assistant
Professor) after obtaining his Ph.D. from
Colorado State University. Dr. Shen is currently
teaching General Microbiology, Food
Microbiology Lab, and Food Chemistry courses.
Dr. Shen’s research interest is in developing post-
harvest sanitizing procedures for reducing micro-
bial food safety risks on poultry meat products
and fresh produce. Dr. Shen has published 52
peer-review journal articles, 3 textbooks, and 2
book chapters, and secured USDA-NIFA grants
over $3.1 million. Dr. Shen serves as the editorial
board member of Journal of Food Protection and
Food Protection Trends. Dr. Shen received
Outstanding Volunteer Award of Food
Microbiology Division-Institute of Food
Technologists (IFT) in 2018. He was the Chair of
Food Microbiology Division-IFT (2019–2020),
and he is the Chair of Biotechnology Division-
IFT (2022–2023).
Yifan Zhang is a Professor in the Department

of Nutrition and Food Science at Wayne State
University, Michigan. She is an Editorial Board
member of Journal of Food Protection, and a
member of International Association of Food
Protection (IAFP), Institute of Food Technologists
(IFT), and American Society for Microbiology
(ASM). Prior to joining the Wayne State faculty,
Dr. Zhang has worked as a Postdoctoral
xvii
xviii About the Authors
Researcher at The Ohio State University. Dr.

Zhang’s research is on molecular characterization
and risk analysis of foodborne bacteria, food and
agricultural reservoir of antimicrobial resistance,
urban agriculture, and the development of novel
food safety control. Dr. Zhang is currently teach-
ing Introductory Food Science and Advanced
Food Science at the undergraduate level and
Microbial Food Safety at the graduate level.
Food Microbiology Laboratory
Safety and Notebook Record 1
Abstract BSL-3: Microbial agents may cause serious or

potentially lethal disease through the inhala-
We will provide food microbiology labora- tion route of exposure, that is, Clostridium
tory safety training for all students taking this botulinum.
class and emphasize the importance of lab BSL-4: Microbial agents pose a high individual
notebook record, and finally we will show risk of aerosol-transmitted laboratory infec-
students the examples of good lab notebook tions and life-threatening disease, that is,
record. Mycobacterium tuberculosis (TB).
We only use BSL-1 and BSL-2 microbial

hree Principles of Conducting
T organisms in this lab manual.
Food Microbiology Lab Work
Safety: Before doing anything in lab, ask your- Lab Safety Rules
self if it is safe; otherwise do not do it.
Quality: All lab work should be conducted based 1. Always wash your hands with antimicrobial
on scientifically high quality. soap water for at least 30 s before and after
Quantity: Based on high quality, we will com- lab work.
plete as much lab work as we can. 2. Always wear a clean lab coat and gloves, and
do not wear open toe shoes and very short
pants when conducting lab work.
I ntroduction of Biosafety Level 3. Always wear eye protection (goggles) when
(BSL) staining or handling hazardous laboratory
chemicals.
BSL-1: Microbial agents are not well known for 4. Clean and sanitize your working bench with
causing disease and present minimal potential a disinfection solution before and after lab
hazard to lab personnel, that is, generic work.
Escherichia coli and Pseudomonas spp. 5. Report any lab accidents immediately.
BSL-2: Microbial agents cause moderate hazard 6. Clearly label petri dishes, tubes, and flasks
to lab personnel and environment, that is, E. before lab work; label name, bench (seat)
coli O157:H7 and Salmonella spp. number, date, microorganism name, etc.
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 1

C. Shen, Y. Zhang, Food Microbiology Laboratory for the Food Science Student,
https://doi.org/10.1007/978-3-031-26197-8_1
2 1 Food Microbiology Laboratory Safety and Notebook Record
7. Place any biohazard trash into biohazard 2. A purpose statement: Describe the purpose of
trash can. the exercise. Ask yourself “What are the goals
8. Smoking, eating, drinking, or placing any- of this exercise?”
thing into your mouth is prohibited. 3. A Materials and Methods section—The
9. Do not handle any electronic devices (i.e. cell Materials and Methods for each lab will be
phone, ipad, laptop) while doing the lab described at the beginning of the period by the
work. instructor. You will have an opportunity to
10. Please let your instructor know if you are copy this information into your notebook at
pregnant or planning to be pregnant. the beginning of each lab period. You should
11. Know the location of nearest fire alarm pull describe what was needed and the steps taken
station, fire extinguisher, eyewash station, (including any modifications that were made).
and first aid kit. Be as specific as possible. Be sure to use cor-
rect spelling for all microorganism names,
and italicize scientific names.
Lab Notebook Requirement 4. A Results section: Record all observations in
your lab notebook. Colored pencils/pens
Notebooks can be checked after each lab section should be used to illustrate results (i.e., obser-
before you leave the classroom. vations made with the microscope)—all fig-
The front cover of your notebook will be ures/tables must have a title and legend (a
labeled with following information: your name, description of what is being shown—label all
course name, professor’s name, and semester. relevant information).
Reserve the first three pages of your notebook 5. A Discussion—Summarize your findings and
for a table of contents. You will update the table discuss how the exercise helped you under-
of contents each week. stand the learning objectives. Describe why
Number all pages. something may not have worked and what
Each notebook entry for any given lab period you would do differently next time to improve
will be formatted in the following way: the outcome.
1. The title. Each section must be labeled.

Lab Notebook Requirement 3
Examples of Good Notebook Records (from Ms. Payton Southall)

Examples of Good Notebook Records (from Ms. Payton Southall)

Examples of Good Notebook Records (from Ms. Jessica Clegg)

Examples of Good Notebook Records (from Ms. Jessica Clegg)

Class Notes
Staining Technology
and Bright-Field Microscope Use 2
Abstract Introduction of Gram Stain Gram stain was

created by Hans Christian Gram (Danish micro-
We will introduce bright-field microscope use biologist), which differentiates all bacteria into
and practice Gram staining with foodborne two groups Gram positive (blue/purple color) and
pathogens and endospore staining with Gram negative (pink/red color). The theory of
Bacillus cereus. Gram stain differentiation is based on cell wall
structure and lipid component; therefore it comes
out with two theory below
Objective Practice Gram staining and endo-
spore staining with common foodborne 1. Cell wall theory: Gram-positive bacteria has
pathogens. heavy peptidoglycan, which helps decolorizer
(alcohol) to dehydrate the Gram-positive cell
Gram Stain Strain Culture Escherichia coli wall and traps the crystal violet complex
ATCC25822, Listeria monocytogenes, inside the cell wall and maintains the purple
Salmonella enterica serovar Typhimurium, and color of crystal violet.
Staphylococcus aureus ATCC 25923 (non- 2. Lipid theory: Gram-negative bacteria has high
MRSA strain). lipid amount (10–15%) in the cell wall, which
makes decolorizer (alcohol) to easily remove
Endospore Stain Culture Bacillus cereus. the crystal violet complex, and then colorless
cell walls are stained with safranin and appear
pink/red color.
Major Experimental Materials
Gram stains need to be done on a very young
• Bright-field light microscope. fresh culture (within 24–48 h).
• Gram stain reagents (crystal violet, Gram
iodine, 95% alcohol, safranin). Introduction of Bacterial Endospore Two
• Endospore reagent (malachite green). bacteria genera that will generate endospore (ger-
• Sterilized loop. mination) under stressful environment (poor
• Glass slides. nutrition, low humidity, desiccation, and high
• Lens paper. temperature) are Bacillus and Clostridium. The
• Bunsen burner. calcium-dipicolinic acid (DPA) stabilizes the

https://doi.org/10.1007/978-3-031-26197-8_2
10 2 Staining Technology and Bright-Field Microscope Use
endospore’s DNA along with small soluble DNA (b) Add 1–2 drops of Gram iodine (a mor-
protein to protect the bacteria from stress envi- dant to help crystal violet stain strong) for
ronment. When the growth condition improves, 60 s, and then gently rinse with water.
the endospore will generate vegetative cells (c) Decolor by adding 1–2 drops of 95%
(sporulation). Endospore stain is intended to find alcohol for 10–15 s, and then gently rinse
the presence/absence of endospore and the loca- with water.
tion of endospore. The location of endospore is (d) Counter-stain by adding 1–2 drops of saf-
species specific which can be located in the mid- ranin and then gently rinse with water.
dle of cells (central), and the end (terminal, that 5. Drain off excess water, blot dry with paper
is, Clostridium sporogenes), or between the end towel, and air-dry slide.
and the middle (sub-terminal, that is, Clostridium 6. Observe your stained smear with low power
botulism). Endospore stain needs to be done on 10X and then switch to 100X with oil immer-
old culture (>5–7 days). sion; record your results in the notebook.
7. Gram stain results should include three items:
(1) Gram reaction, positive or negative; (2)
Gram Stain Procedure morphology, rods, cocci, etc.; and (3) arrange-
ment, single, chain, grape shape, tetrad, etc.
1. Prepare a fixed smear: label two large circles 8. Please refer to Fig. 4 as a Gram staining result.
(dime) using marker onto a clean glass slide,
flip over slides, place one drop of sterilized
water in the center of each circle, and use loop Endospore Stain Procedure
aseptically, pick bacteria cells from stock cul-
ture, and spread them in their drops of water 1. Smear preparation including air-drying and
to cover the whole circle of the dime (Fig. 1). heat fixing is the same as Gram stain.
Note: Flipping over slides is very impor- 2. Flood the smear with malachite green (cover
tant; otherwise the dye from marker may the whole slides with the dye, Fig. 3).
damage the lens of microscope later on. A 3. Heat steam slides for 3–5 min using the flame
smear needs to be thin. of burner back and forth couple of times, but
2. Air-dry the smear for 5 min (Fig. 2). do not let the slides dry out.
3. Heat fix the cells on slides by passing three 4. Cool down slides, remove dye, and gently
times back and forth through the Bunsen rinse with water.
flame. Heat fixing will inactivate bacteria 5. Add safranin onto the slide.
enzyme and stick cells onto glass slides. 6. Drain off excess water, blot dry with paper
4. Major steps of Gram stain are the following: towel, and air-dry slide.
(a) Place your slide on staining rack, put 1–2 7. Observe your stained smear with low power
drops of crystal violet onto the smear for 10X, and then switch to 100X with oil immer-
60 s, and then gently rinse with water. sion; record your results in the notebook.
Bright-Field Microscope Use 11
Bright-Field Microscope Use
Microscope Structure
Brief Procedure 8. Adjust fine focus (small and thin wheel) to

find specimen.
1. Stage down with course focus (large and thick
wheel).
2. Spin/rotate objective lens. Questions for Review
3. Place 10X objective lens in position.
4. Adjust light to “low” or “10X” with con- 1. Why Gram-positive stains purple and Gram-
denser (iris diagram). negative stains pink color?
5. Bring stage up as high as it can reach. 2. Describe two conditions in which bacteria
6. Look into 10X ocular lens and find organism will stain Gram variable (showing
specimen. Gram-negative results).
7. Slightly switch 10X objective lens; add one 3. Is bacterial endosporulation a reproductive
drop of oil. (Do not take microscope out of mechanism? Why?
focus.) 4. Why the location of endospore is a very
important information?
Figures
1. Fig 1. Clean slides and label
2. Fig 2. Smear preparation, air-drying, and heat fixing
3. Fig 3. Flooding with dye (only for endospore staining)

4. Fig 4. Examples of Gram staining result (from previous students’ lab work)
Gram Staining Lab Work Flowchart

Endospore Staining Lab Work Flowchart

Class Notes
Class Notes
Enumeration of Bacteria in Broth
Suspension by Spread and Pour 3
Plating
Abstract Introduction Most bacteria grow in support

medium like tryptic soy broth incubating at
We will practice spread plating and pour plat- 35 °C for 24 h will generate around 109cells/ml
ing using 10- or 100-fold dilution technique to (=9.0 log10colony-forming unit/ml), which is
enumerate bacteria cells in solutions on agars. too much to put onto agar medium to manually
count the colony. Therefore, we need to do
10-fold or 100-fold serial dilution and then add
Objective: Understand serial dilution technique, 0.1 ml of the diluted solution from the final
and practice spread and pour plating. dilution tube onto agar medium through
spreading or pour plating, and count bacterial
Bacterial strain: Escherichia coli ATCC25822 colonies after incubation. For 10-fold and 100-
grown in tryptic soy broth at 35 °C after 24 h. fold dilution, we usually use 9.0 ml or 9.9 ml
0.1% buffered peptone water (BPW). Spread
plating is conducted by spreading liquid solu-
Major Experimental Materials tion on agar medium using sterilized plastic
spreader or flamed glass spreader. Pour plating
• Tryptic soy agar. is conducted by adding liquid solution onto an
• Buffered peptone water (0.1%), in 15 ml dilu- empty petri dish followed by pouring 20–25 ml
tion tubes. of melted agar, rotating the petri dish and mix-
• Water bath (50–55 °C) with melted agar ing very well. Due to the use of melted agar
(25 ml) in glass bottles. (50–55 °C), heat-sensitive bacteria will be
• Empty petri dishes. killed by the mild heat; the number of colonies
• Sterilized spreaders and pipette tips (200 μl of pour plating will be slightly lower than
and 1,000 μl). spread plating.

https://doi.org/10.1007/978-3-031-26197-8_3
20 3 Enumeration of Bacteria in Broth Suspension by Spread and Pour Plating
Dilution technique figs. (ten-fold serial dilution, assume 0.1 ml of each dilution tube adding onto
agar plates)
1 ml 1 ml 1 ml 1 ml
1 ml
9.0ml 9.0ml 9.0ml 9.0ml 9.0ml

Bac. BPW BPW BPW BPW BPW
broth (0.1%) (0.1%) (0.1%) (0.1%) (0.1%)
-1 -4 -5
Dilution factor of tubes “0” 10 10 -2 10-3 10 10
-2 -3 -4 -5 -6
Final dilution factor of plates “0” 10 10 10 10 10
“0” Dilution averagely spreading 1.0 ml origi- 2. Each dilution blank contains 9.0 ml of sterile
nal solution onto three agar plates, adding all 0.1% BPW.
colony-forming units (CFU) of three agars after 3. To make a 1/10 dilution, transfer 1.0 ml of
incubation. sample into a 9.0 ml sterile dilution blank
(0.1% BPW). This is a 10−1 dilution.
4. Alternately, you can transfer 1.0 ml of diluent
Dilution Procedure into a 9.0 ml blank and make a 10−2 dilution.
5. Continue to make dilutions as necessary.
1. The original bacterial broth is considered to Note: We also can add 0.1 ml into 9.9 ml of
be at a dilution factor of “0.” diluent to make a 10−2 dilution.
Dilution technique figs. (100-fold serial dilution, assume 0.1 ml of each dilution tube adding onto
agar plates).
0.1 ml 0.1 ml 0.1 ml
9.9ml 9.9ml 9.9ml

Bac. BPW BPW BPW
broth (0.1%) (0.1%) (0.1%)
Dilution factor of tubes “0” 10-2 10-4 10-6

Final dilution factor “0” 10-3 10-5 10-7
of plates
Review Questions 21
Numeration If colonies are 30–300, count and record it; the

final counts will be final colony number/final
After spread and pour plating, incubate plates dilution factor, for example, 40 colonies on the
inverted at 35 °C for 24–48 h; manually count plate with final dilution factor 10−6, and then the
colonies on the agar plates. The acceptable and final count is 40/10−6 = 40,000,000 CFU/
countable zone is 30–300 CFU/plate (CFU— ml = 7.60 log10 CFU/ml.
colony-forming unit). If colonies on more than two plates are
If colonies <30, count and record it, but we 30–300, count and record each and take average.
will not use it, because colonies may come from If colonies are >300, record as TNTC
contamination. (too-numerous-to-count).
Work figure of dilution procedure of plating ~ 109 CFU/ml E. coli solution onto agar plates.
Method 10−5 10−6 10−7 Reported count spread plating, yielding 50 colonies. Calculate
Spread plating the CFU/mL in the original culture.
Pour plating _____________.
2. A pure bacterial culture was diluted by adding
a 1.0 mL aliquot to 9.0 mL 0.1% BPW. Then,
Review Questions 1.0 mL of this dilution was plated out by pour
plating, yielding 82 colonies. Calculate the
1. A pure bacterial culture was diluted by adding CFU/mL in the original culture.
a 0.1 mL aliquot to 9.9 mL 0.1% BPW. Then, ______________________.
0.1 mL of this dilution was plated out by
Pour Plating and Spread Plating Lab Work Flowchart
Label at the bottom of

the agar plate and label
the dilution tubes
Mixing the bacterial

solution by shaking 30
sec or vortex 10 sec
Mixing the bacterial

diluted solution by
vortex 10 sec
Pour plating with melted agar solution Spread plating sterile spreader
Incubate at 35°C for 24 h

Review Questions 23
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Isolation of Foodborne Pathogens
on Selective, Differential, 4
and Enrichment Medium
by Streak-Plating
Abstract Differential Medium It contains one or more

chemical component that can differentiate differ-
We will introduce the selective, differential, ent microorganism growths based on the color
and enrichment medium for several foodborne and morphology of colony.
pathogens, practice streak-plating to get bac-
terial single colonies on various agars, and Note A medium can be both a selective and a
observe bacterial colony morphology. differential medium.
Objective Practice streak-plating of foodborne Introduction of Medium

pathogens on selective, differential, and enrich- for Isolating Foodborne Pathogens
ment medium and observe colony morphology.
MacConkey agar, containing neutral red, crystal
Bacterial Strain Generic Escherichia coli violet, and bile salts, which inhibit Gram-positive
ATCC25822, Listeria innocua ATCC33090, organisms (due to crystal violet) and support
Salmonella enterica serovar Typhimurium, and Gram-negative organisms to grow. Colonies of E.
Staphylococcus aureus ATCC 25923 (non- coli O157:H7 are pink/red colony (due to lactose
MRSA strain). fermentation) surrounded by a bile salt precipita-
tion zone. Non-lactose fermentation colony is
Medium Blood agar, MacConkey agar, manni- colorless (e.g., non-O157 shiga toxin-producing
tol salt agar, modified Oxford agar, XLT-4 agar, E. coli).
and HardyCHROM agar. Mannitol salt agar, containing 7.5% salt, six-
carbon mannitol and phenol red, used for isolat-
ing S. aureus (yellow colony). The 7.5% salt
Introduction of Selective inhibits most bacteria other than staphylococci.
and Differential Medium Mannitol can be fermented by S. aureus which
cause phenol red turns yellow color at acidic pH.
Selective Medium It contains one or more Modified Oxford agar (MOX) contains
components (chemical or antibiotics) that sup- oxford agar base plus selective ingredients, used
press the growth of some microorganisms with- for isolating Listeria spp. (black colony). Agar
out affecting the ability of wanted organism to base provides basic nutrition of nitrogen, carbon,
grow. amino acids, and vitamins. Listeria spp. hydro-

https://doi.org/10.1007/978-3-031-26197-8_4
26 4 Isolation of Foodborne Pathogens on Selective, Differential, and Enrichment Medium by Streak-Plating
lyze esculin to form 6,7-dihydroxycoumarin magenta colored colonies. Bacteria other than
(esculetin), which reacts with ferric ions (ferric Salmonella spp. may break down the other chro-
ammonium citrate) to form black colony. Lithium mogenic substrates and produce blue colonies. If
chloride inhibits growth of enterococci other than none of the substrates are utilized, natural or
Listeria spp. (high salt tolerance). Selectivity is white colored colonies will be present.
increased by adding colistin sulfate and moxalac- Blood agar, a tryptic soy agar containing 5%
tam to the base and completely inhibits Gram- sheep blood, differentiates pathogen growth
negative organisms and most Gram-positive based on the hemolysis of the red blood cells
organisms after 24 hours of incubation. caused by hemolysin (exotoxin from L.
XLT-4 agar is used for isolating non-typhi monocytogenes).
Salmonella (red colony with black center), which
can ferment multiple sugar including xylose, lac-
tose, and sucrose, and decarboxylase of lysine Practice of Streak-Plating
and generate hydrogen sulfide. Hydrogen sulfide
production (black color) is detected by the addi- Streak-plating is to “dilute” microorganism onto
tion of ferric ions. Sodium thiosulfate is added as solid agar medium and then obtain pure culture
a source of inorganic sulfur. Sodium chloride (single colony, representing one genera name and
maintains the osmotic balance of the medium. one species name) on agar surface.
Phenol red is added as a pH indicator. XLT-4
Supplement-Tergitol 4 is added to inhibit growth Step 1. Use flamed loop pick bacteria (agar, slant,
of non-Salmonella organisms. or broth) begin with inoculating from the first
HardyCHROM agar, HardyCHROM™ quadrant of the agar surface. Light touch with-
Salmonella agar facilitates the isolation and dif- out damaging the agar surfaces.
ferentiation of Salmonella spp. from other mem- Step 2. Flame loop; cool down by touching the
bers of the family Enterobacteriaceae. Peptones un-inoculated area of the agar surface.
in the medium supply the necessary nutrients. Step 3. Rotate the plate, picking up area from the
Selective agents inhibit the growth of Gram- first quadrant, and streak again.
positive organisms. Artificial substrates (chromo- Step 4. Flame loop, rotate plate, and repeat pro-
gens) are broken down by specific microbial cedure for fourth and fifth quadrants.
enzymes which release insoluble colored com- Step 5. Incubate plate inverted at incubator for
pounds. Salmonella species break down only one 35 °C for 24–48 h.
of the chromogens and will produce deep pink to
Figure of Streak-Plating
Culture flame loop flame loop flame loop
Quadrant 1 Quadrant 2 Quadrant 3 Quadrant 4

Question for Review 27
Lab Task Two students/group share seven SA SAL Use your loop “spot inoculate” each
agars, finish streak-plating of assigned pathogen section with pathogen.
on a specific agar, and “spot” plating with four Incubate plates inverted at 35 °C for 24 h.
pathogens on blood agar.
Question for Review

1. Streak-plate generic Escherichia coli
ATCC25822 onto MacConkey agar, and 1. _________Mannitol salt agar (MSA) only
incubate plates inverted at 35 °C for 24 h. allows the growth of halophiles (salt-loving
2. Streak-plate Staphylococcus aureus ATCC microbes); nonhalophiles will not grow.
25923 onto mannitol salt agar, and incubate Among the halophiles, mannitol fermenters
plates inverted at 35 °C for 48 h. will produce acid that turns the pH indicator
3. Streak-plate Listeria innocua ATCC33090 yellow; mannitol nonfermenters leave the
onto MOX agar, and incubate plates inverted medium red. Onto MSA, you inoculate a
at 35 °C for 48 h. halophilic mannitol fermenter and a halo-
4. Streak-plate Salmonella enterica serovar philic mannitol nonfermenter. In this case, the
Typhimurium onto XLT-4 agar and medium is acting as (a) __________
HardyCHROM agar, and incubate plates medium(s).
inverted at 35 °C for 24 h. A. selective
5. “Spot”-plate of foodborne pathogens onto B. differential
blood agar. C. selective and differential
D. enrichment
Divide a blood agar into four sections; label each
section with one assigned culture: 2. Briefly explain why Salmonella growing on
XLT-4 agar is a red colony with black center.
LI EC 3.__________Phenol red is utilized in

MacConkey agar to.
SA SAL
A. inhibit microscopic organisms.
B. detect the production of gas by-products.
C. conduct the sulfate reduction test.
D. detect the acid reaction of lactose
LI EC LI, L. innocua; EC, E. coli; SA, S. fermentation.
aureus; and SAL, S. typhimurium.
Part of results figure (from previous lab students)
Escherichia coli on MacConkey agar: pick

colony, lactose fermentation positive
Staphylococcus aureus on Mannitol Salt agar:

yellow colony, mannitol sugar fermentation
positive (note: tiny colonies due to grow at
35oC for only 24h)
Salmonella spp. on XLT-4 agar: red colony with

black center, suggests sulfur reduction (note:
black color will be fade after 5 days due the
oxidation of sulfur)
Salmonella spp. on Hardy@Chrom agar: deep

pink colony
Question for Review 29
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Enumeration of Aerobic Plate
Counts, Coliforms, and Escherichia 5
coli of Organic Fruit Juice
on Petrifilm
Abstract survival characteristics are similar to those

pathogens.
We will practice using Petrifilm to enumerate
food microbial quality index, including aero-
bic plate counts, coliform, and E. coli from Coliforms They are most commonly used indi-
organic fruit juice. cator organisms, usually from the intestine of
warm-blooded animals. They are gram-negative,
non-endospore-forming, facultative, fermenta-
Objective Organic juice made from whole foods tion lactose-generating acid and gas and mem-
will be plating upon 3 M@petrifilm to test aerobic bers of Enterobacteriaceae family.
plate counts (APCs), E. coli, and total coliform
populations. E. coli A member of the coliform group, the
presence of E. coli may have more accurate cor-
relation to the presence of pathogens than coli-
Major Experimental Materials forms and indicates fecal contamination.
• Organic fruit juice. Petrifilm Plates Created by the Food Safety

• APC, ECC/TCC 3 M@ petrifilm. Division of 3 M Corporation, it contains a foam
• Buffered peptone water (0.1%), 15 ml dilution barrier accommodating the plating surface, the
tubes. plating surface itself (a circular area of about
• Sterilized pipette tips (200 μl and 1000 μl). 20 cm2), and a top film. Petrifilm has a cold
• Incubator. water-soluble gelling agent containing dehy-
drated nutrients and indicators for microorgan-
ism activity and enumeration.
Introduction
Dilution factor APCs, 10−1 and 10−3; coliform/E.
Indicator Microorganism Indicator organ- coli, 0 and 10−2; and total coliform, 0, 10−1,
isms of foodborne pathogens are present high and 10−3.
number and easily to detect. Their growth and

https://doi.org/10.1007/978-3-031-26197-8_5
32 5 Enumeration of Aerobic Plate Counts, Coliforms, and Escherichia coli of Organic Fruit Juice…
Diluon protocol
APCs and total

9.0 ml
BPW 1.0 ml coliform petrifilm
(0.1%) (10-1 diluon)
Orange
Juice
APCs and total

9.0ml
9.9 ml
BPW
coliform petrifilm
1.0 ml
BPW 1.0 ml
(0.1%)
1.0 ml (0.1%) (10-3 diluon)
Coliform/E.coli and
total coliform
petrifilm (0 diluon)
1.0 ml
Coliform/E.coli
petrifilm (10-2
diluon)
Procedure of Plating Upon Petrifilm 4. Roll down the film and prevent air bubble.
5. Use plastic template to gently press down the
1. Label each petrifilm. sample to fill the area (coliform/E. coli film
2. Make dilution according to the work protocol can skip this step).
0.1% BPW solution. Because 1 ml of solution 6. Incubate at 35 °C for 24–48 h. Petrifilms can-
will be plated onto petrifilm. The final dilu- not stack more than 20 pieces.
tion is the same as tube dilution factor.
3. Pull up the film, and add 1 ml onto the center APCs, red colony; coliform, pink colony; and
of petrifilm with dehydrated medium. E. coli, blue colony with gas.
Procedure of Plating Upon Petrifilm 33
Coliform: red colony
E.coli: blue colony with gas
APC: red colony
Review Question If you are a microbiologist notebook. The dilution factor will be APCs, 10−2
working in a dairy farm and will test APCs and and 10−4; coliform/E. coli, 0, 10−1, and 10−2; and
coliform/E. coli in unpasteurized raw milk, total coliform, 0, 10−1, and 10−3.
please write down your dilution flowchart in your
Lab Work Flowchart
Fresh organic fruit juice
Shake and mix very well
10 or 100 fold diluon
Coliform/E.coli Aerobic Plate Counts

(35oC, 24h) (25oC, 72h)
Part of Result Figures (work from previous students)
APC counts = 64 × 103 = 6.4 × 104 CFU/ Note: Coliforms are all E. coli cells.
ml = 4.81 log10 CFU/ml.
E. coli counts (less than 30 CFU on, only esti-
mated results) = [(28 + 23)/2] × 100 = 2550 = 3.
41 log10 CFU/ml.
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Enumeration and Identification
of Staphylococcus aureus 6
in Chicken Salads
Abstract • Gram stain reagents.

• StaphTEX™ Blue latex agglutination text kit.
We will practice enumerating Staphylococcus • Coagulase plasma (6 × 3 ml tubes).
aureus in chicken salads by inoculating, dilu-
tion technique, and spread plating onto selec- Introduction Staphylococcus aureus is the most
tive medium. The presumptive colonies will be commonly identified pathogen in all postsurgical
identified using Gram staining, catalase test, infections with methicillin-resistant S. aureus
coagulase test, and latex agglutination test. (MRSA) becoming an emerging health problem.
Staphylococcal food intoxication is a gastrointes-
tinal illness caused by eating foods contaminated
Objective Test the population of Staphylococcus with the one produced by S. aureus. Foods fre-
aureus in inoculated chicken salads using spread quently incriminated include meat and poultry
plating, and identify S. aureus colonies by Gram products; egg products; and salads such as egg,
staining, catalase test, latex agglutination test, tuna, chicken, potato, and macaroni. Food han-
and coagulase test. dlers are usually the main source of food contam-
ination in outbreaks. Symptoms develop within
6 hours after eating contaminated foods, which
Major Experimental Materials include nausea, vomiting, cramps, and diarrhea,
and most often are self-limiting within 1–3 days.
• Staphylococcus aureus ATCC 25923 (non-
MRSA strain).
• Chicken salads from commercial Enumeration of S. aureus in Chicken
supermarket. Salads
• Buffered peptone water (100% and 0.1%),
15 ml dilution tubes. Commercial chicken salads will be inoculated
• Sterilized spreader. with S. aureus (your instructor will do this).
• Sterilized pipette tips. 1. Inoculated chicken salads (200 g) will be ster-
• Whirl@ filtered food sampling bags. ilized and transferred into filtered whirl@ food
• Stomacher. sampling bag.
• Mannitol Salt Agar and Tryptic Soy Agar. 2. Add 200 ml of 0.1% buffered peptone water
• H2O2 reagent (for catalase test). into the sample bag.

https://doi.org/10.1007/978-3-031-26197-8_6
40 6 Enumeration and Identification of Staphylococcus aureus in Chicken Salads
3. Stomach for 1 min. D. Latex Agglutination Test.

4. Conduct serial dilution into 9.0 or 9.9 ml Latex agglutination test detects the agglutination
0.1% BPW solution to obtain final dilution (clumping) happened when the unknown organ-
factor 10−2, 10−3, and 10−5, and spread plating ism isolated in a culture is mixed with an antise-
onto Mannitol Salt Agar and Tryptic Soy rum that contains antibodies specific for its
Agar. Please draw your dilution diagram and antigen. The antibody (antiserum) usually is con-
check with instructor! jugated to a latex particle in order to enhance the
5. Incubate plates at 35 °C for 48 h. visibility of the agglutination reaction.
6. Manually count colonies of agar plates
and record onto notebook; calculate as
follows: Procedure
Log10 CFU/g = Log10 [(final CFU on plates/
dilution factor)*(200 g + 200 ml)/200 g]. For 1. Place one drop of saline solution onto two
example, 50 CFU on plates with dilution factor wells of the test card.
10−5, and then final log10 CFU/g. 2. Use sterilized loop pick presumptive colony
= log10 (50*105 * 2) = log10107 = 7 log10 from Mannitol Salt Agar, and mix with the
CFU/g. saline solution.
7. Typical colonies (yellow color) of S. aureus 3. Shake (very important!) the latex reagent bot-
will be identified using the following tests: tle (control and test reagent), and place one
free failing drop into each well.
A. Gram Stain 4. Use a new sterilized loop to mix the regent
Major Steps of Gram Stain with colony very well.
1. Place your slide on staining rack and put 1–2 5. Rock the card for 1 min to observe the
drops of crystal violet onto the smear for 60 s, clumping.
and then gently rinse with water.
2. Add 1–2 drops of Gram iodine (a mordant to
help crystal violet stain strong) for 60 s, and Review Question
then gently rinse with water.
3. Decolor by adding 1–2 drops of 95% alcohol A chicken salad was picked from a local subway
for 10–15 sec, and then gently rinse with and brought to the laboratory. Two hundred
water. grams were added to 200 ml of sterile buffered
4. Counter-stain by adding 1–2 drops of safra- peptone water and homogenized for 2 min. The
nin, and then gently rinse with water. solution was chilled to prevent overheating. The
B. Catalase Test: Positive (Bubble). final dilutions and the collected data are pre-
1. Place one drop of H2O2 on a clean glass sented below. The plate medium is TSA agar.
slides. Answer parts (a), (b), and (c):
2. Use sterilized loop pick presumptive colony a. There are ______________ CFU per ml of
from Mannitol Salt Agar, and slowly immerse homogenate.
with cells into H2O2. b. There are_______________ CFU per gram of
3. A positive test is read immediately from the the chicken salad.
slide, showing oxygen gas bubbles.
C. Coagulase Test. (a) What does CFU stand for?
Transfer a presumptive colony from Mannitol ______________________________________
Salt Agar into the commercial coagulase plasma Plate Colonies observed Final dilution
with EDTA (ethylenediaminetetraacetic) and A Too numerous to count 10−1
incubate at 35 °C; examine after 12 h for the clot B 564 10−2
formation. Firm and complete clot stays in place C 275 10−3
when tube is tilted or inverted. D 19 10−4
Part of Result Figures (Work from Previous Students) 41
Lab Work Flowchart

Lab work flowchart
Chicken Salads Filtered Food Bag
Inoculate S. aureus
Transfer chicken salads

and 200 ml BPW
Homogenize and
stomach for 1 min
10 or 100-fold dilution and spread

plating, incubate at 35oC for 48 h.
Part of Result Figures (Work from Previous Students)
A. Gram stain results (×100 with oil immersion).

Staphylococcus aureus is Gram positive, cocci, and grape shape.
B. Latex agglutination test.
Posive (clumping) Negave
C. Spread plating.
Yellow colonies suggest mannitol

fermentaon posive, total 134 CFU with
diluon factor 100, final calculaon:
134×100 × (200+200)/200=26800 CFU/g
Please note: this is not a perfect label, we

should label date, bench number, and
bacteria name.
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Enumeration and Identification
of Listeria monocytogenes 7
on Ready-to-Eat (RTE) Frankfurters
Abstract • H2O2 reagent (for catalase test).

• Gram stain reagents.
We will practice enumerating Listeria monocy- • 12 L@ listeria test kit.
togenes on commercial frankfurters by inocu-
lating, dilution technique, and spread plating
onto selective medium Modified Oxford Agar. Introduction Listeria monocytogenes is a
The presumptive colonies will be identified Gram-positive, non-endospore-forming, facul-
using Gram staining, catalase test, and 12 L tative bacterium that can survive/grow in a wide
test. In this chapter, students are required to variety of foods, including dairy products, meat
finish part of the work independently. and poultry products, vegetables, and seafood.
L. monocytogenes is a remarkably difficult
organism to control in food-processing environ-
Objective Test the population of Listeria mono- ments due to its psychrotrophic nature and abil-
cytogenes on inoculated frankfurters by spread ity to tolerate adverse growth conditions. In the
plating, and identify L. monocytogenes using United States, from 1998 to 2002, ready-to-eat
Gram staining, catalase test, and 12 L@ biochem- (RTE) meat products, including commercially
istry test. cured ham, were involved in several multistate
outbreaks of listeriosis. These outbreaks trig-
gered the US Department of Agriculture’s Food
Major Experimental Materials Safety and Inspection Service (USDA-FSIS) to
require RTE meat processors, starting from
• Listeria monocytogenes (BSL-2). 2003, to select at least one of three alternatives
• Frankfurters (hotdog) from commercial for L. monocytogenes control: (i) both a post-
supermarket. lethality treatment (e.g., steam, pressure, or
• Buffered peptone water (100% and 0.1%). antimicrobial agent) and an antimicrobial pro-
• Whirl@ food sampling bags. cess, (ii) either a post-lethality system or an
• Stomacher. antimicrobial process, and (iii) sanitation prac-
• Modified Oxford Agar, Tryptic Soy Agar, and tices only, with more frequent microbial verifi-
Blood Agar. cation testing.

https://doi.org/10.1007/978-3-031-26197-8_7
46 7 Enumeration and Identification of Listeria monocytogenes on Ready-to-Eat (RTE) Frankfurters
Lab Work Procedure 3. Decolor by adding 1–2 drops of 95% alcohol

for 10–15 sec, and then gently rinse with water.
Inoculation Two frankfurter links will be 4. Counter-stain by adding 1–2 drops of safra-
received by two students/group and will be inoc- nin and then gently rinse with water.
ulated (0.2 mL) by rolling-spreading L. monocy- B. Catalase Test: Positive (Bubble)
togenes on the surface of each frankfurter 1. Place one drop of H2O2 on a clean glass
(56 cm2) with a sterile bent plastic rod on a foiled slide.
paper. The inoculated hotdogs were left at room 2. Use sterilized loop pick presumptive col-
temperature for 10 min to encourage attachment. ony from MOX Agar and slowly immerse
with cells into H2O2.
3. A positive test is read immediately from
Enumeration of L. monocytogenes the slide, showing oxygen gas bubbles.
or L. monocytogenes C. Hemolysis test: streak plating typical colony
on Frankfurters onto blood agar, and observe α-, β-, or γ-
hemolytic. L. monocytogenes and L. innocua
1. Inoculated two frankfurters will be sterilized is β-hemolytic (transparent zone).
transferred into whirl@ food sampling bag. D. 12 L@ test: multiple channel biochemistry
2. Add 100 ml of 0.1% Buffered Peptone Water test for Listeria spp.; please follow instruc-
into the sample bag and rolling bag. tion in the fact sheet.
3. Vigorously shake for 30 sec (30 “Mississippi”).
4. Conduct serial dilution into 9.0 or 9.9 ml 0.1%
BPW solution to obtain final dilution factor Procedure
10−2 and 10−4, and spread plating onto
Modified Oxford Agar and Tryptic Soy Agar. 1. Pick 4–5 suspect colonies from MOX Agar
Please draw your dilution diagram in your and suspend in Listeria suspending medium.
notebook. 2. Place test strip in holding tray and remove lid.
5. Incubate plates at 35 °C for 48 h. 3. Place four drops (100 μl) bacterial suspension
6. Manually count colonies of agar plates and to each well.
record onto notebook; calculate as follows: 4. Add one drop of hemolysis to well 12. (We
Log10 CFU/g = Log10 [(Final CFU on plates/ will do this on blood agar.)
dilution factor)*100 ml)/112 cm2] 5. Replace lid and incubate at 35 °C ± 2 °C for
For example, 50 CFU on plates with dilution 24 hours.
factor 10−4, and then final Log10CFU/cm2. 6. Record results on report forms and interpret
= Log10 (50*104 * 0.89) = Log10445, 000 = 5.65 using the color sheet.
log10CFU/g. 12 L positive and negative results table
7. Typical colonies of L. monocytogenes will be
identified using the following tests:
Well Negative
A. Gram stain: Gram positive, single, large rod no. Substrate reaction Positive reaction
shape. 1 Esculin (ESC) Pink or Black
Major Steps of Gram Stain brown
1. Place your slide on staining rack and put 2 Mannitol Purple Yellow, brown,
1–2 drops of crystal violet onto the smear (MAN) or straw
for 60 s, and then gently rinse with water. 3 Xylose (XYL) Purple Yellow, brown,
or straw
2. Add 1–2 drops of Gram iodine (a mordant 4 Arabitol (ARL) Purple Yellow, brown,
to help crystal violet stain strong) for 60 s, or straw
and then gently rinse with water. 5 Ribose (RIB) Purple Yellow, brown,
or straw
Lab Work Flochart 47
Well Negative Well Negative

no. Substrate reaction Positive reaction no. Substrate reaction Positive reaction
6 Rhamnose Purple Yellow, brown, 10 Methyl-D- Purple Yellow, brown,
(RHA) or straw glucose (MDG) or straw
7 Trehalose Purple Yellow, brown, 11 Methyl-D- Purple Yellow, brown,
(TRE) or straw mannose or straw
8 Tagatose (TAG) Purple Yellow, brown, (MDM)
or straw 12 Hemolysin Red cell Partial or
9 Glucose-1- Purple Yellow, brown, (HEM) deposit complete red
phosphate or straw cell lysis
(G1P) Note: Well 12 can be done on the blood agar
Listeria spp. should be positive in well 1 (aes- culin), well 4 (arabitol), and well 7 (trehalose).
1ESC 2MAN 3XYL 4ARL 5RIB 6RHA 7TRE 8TAG 9G1P 10MDG 11MDM 12HEM
L. Monocytogenes + − − + − + + − − + + +
Review Questions 2. There is a Listeria monocytogenes outbreak

in a hotdog plant; as a microbiologist, your
1. Name the “three alternatives” for controlling job is to isolate and identify this pathogen
Listeria monocytogenes on RTE meats. from hotdogs, describe the details how you
will do; please be specific, including
medium, test name, and possible results.
Lab Work Flochart

Lab work flowchart
Fresh vacuum-packed
Non-Filtered Food Bag
frankfurters
Inoculate L. monocytogenes
Transfer 2 frankfurters
and 100 ml BPW
Rolling the bag and

shake for 30 sec
10 or 100-fold diluon and spread

plang, incubate at 35oC for 48 h
Part of Result Figures (Work from Previous Students)
A. Positive L. monocytogenes by 12 L test.
B. β-Hemolytic (transparent zone) of L. monocytogenes on blood agar.
C. Spread plating.
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Isolation and Identification
of Salmonella and Campylobacter 8
spp. on Broiler Carcasses
Abstract • XLT-4 and Hardy@CHROM agar.

• Bolton broth and modified Campy Cefex
We will practice isolating and identifying Agar.
Salmonella and Campylobacter spp. on com- • Microaerophilic jar and gas generator.
mercial chicken broiler carcasses by modified • Campy-latex agglutination test kits.
Food & Drug Administration-Bacteriological • API 20E biochemistry test kits.
Analytical Manual (FDA-BAM) methods. We • Mineral oil.
will introduce the function of pre- and second- • Kovac Reagent, 10% ferric chloride, 40%
ary enrichment and practice growing KOH, and 6% alpha-naphthol.
Campylobacter in a microaerophilic environ- • Gram staining reagents.
ment. The presumptive colonies will be identi-
fied using Gram staining, latex agglutination Introduction Contaminated poultry meat repre-
test, and API -20e biochemistry test. In this sents the greatest public health impact among
chapter, students are required to finish part of foods and is responsible for an estimated $2.4
the work independently. billion in annual disease burden. Salmonella and
Campylobacter spp. are the two most common
foodborne pathogens associated with poultry
Objective Salmonella and Campylobacter spp. meat, causing an estimated 9.4 million illnesses,
will be isolated from commercial broiler car- 55,961 hospitalizations, and 1351 deaths annu-
casses and identified using Gram staining, bio- ally in the United States. Starting in July 2011,
chemistry test and immunology test. United States Department of Agriculture-Food
Safety and Inspection Service (USDA-FSIS)
established new performance standards in
Major Experimental Materials response to national baseline studies requiring
routine testing for Salmonella and Campylobacter
• Raw chicken carcass. in all processing plants, where the percentage of
• Poultry sampling bag. Salmonella-positive samples must be below 7.5%
• Buffered peptone water. and Campylobacter-positive samples should be
• RV medium, TT medium. less than 10.4%.

https://doi.org/10.1007/978-3-031-26197-8_8
54 8 Isolation and Identification of Salmonella and Campylobacter spp. on Broiler Carcasses
ajor Medium Used for Salmonella

M poultry sampling bag, and vigorously shake
Isolation for 60 s.
Please do this within a large container;
Rappaport-Vassiliadis (RV) Salmonella make sure the bags are not broken!
Enrichment Broth Malachite Green is inhibi- 3. Transfer 25 ml of shaken BPW solution into
tory to organisms other than Salmonella spp. The 25 ml of Bolton broth in a tube, and mix very
low pH (5.2) of the medium, combined with the well. These mixtures will be incubated at
presence of malachite green and magnesium 42 °C for 48 h under microaerophilic condi-
chloride, is selected for the highly resistant tions (5.0% O2, 10% CO2, 85% N2) in a 2.5-
Salmonella spp. liter microaerophilic jar.
4. The 370 ml BPW will be transferred into a
Tetrathionate Broth (TT) Selectivity is accom- sterilized bottle and incubated at 35 °C for
plished by the combination of sodium thiosulfate 24 h.
and tetrathionate, which suppresses commensal
intestinal organisms. Tetrathionate is formed in After 24 h
the medium upon addition of the iodine and 1. Subculture 0.1 ml of primary enriched BPW
potassium iodide solution. Organisms containing into 10 ml RV and 1.0 ml of enriched BPW
the enzyme tetrathionate reductase will prolifer- into 10 ml TT medium, and incubate at 42 oC
ate in the medium. Bile salt, a selective agent, (RV) and 35 oC (TT) for 24 h.
suppresses coliform bacteria and inhibits Gram-
positive organisms. Calcium carbonate neutral- After 48 h
izes and absorbs toxic metabolites. 1. A loop of secondary enriched RV and TT
solution will be streak plated onto XLT-4 and
Hardy@CHROM agar, and incubate at 35 °C
ajor Medium Used
M for 24–48 h.
for Campylobacter Isolation 2. A loop of Bolton’s broth will be streaked on
modified Campy Cefex Agar and incubated at
Modified Campy Cefex Agar A Brucella agar 42 °C for 72 h under aforementioned micro-
(agar base plus horse blood and hemin) supple- aerophilic conditions.
mented with cephalothin and amphotericin B for
the selective isolation of cephalothin-resistant Identification Test
Campylobacter species such as C. jejuni, C. coli, 1. Presumptive Salmonella colonies (red col-
and C. lari from food samples. ony with black center on XLT-4 agar and
purple colonies on Hardy@CHROM agar)
will be verified by Gram staining,
Lab Work Procedure Salmonella latex agglutination test, and API
20E test.
Today 2. Presumptive Campylobacter colonies on
the modified Campy Cefex Agar will be
1. Each group (two students) will pick up one confirmed using the Campy Latex aggluti-
broiler carcass. nation test and Gram staining (Gram nega-
2. The broiler carcass will be immersed into tive, rods) to observe for corkscrew
400 ml buffered peptone water (BPW) in a morphology.
Lab Work Procedure 55
Since we already practiced Gram staining and latex agglutination test, please write major steps
of Gram staining and latex agglutination test below:
Gram Staining
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
Latex Agglutination Test
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
API-20E Test Procedure After 24 h
1. Pick 1–3 presumptive Salmonella colonies 1. IND: add one drop of Kovac Reagent to
from XLT-4 and Hardy@CHROM agar and record results in 2 min.
suspend into a 5 ml of sterilized saline 2. TDA: add one drop of 10% ferric chloride
solution. immediately.
2. Use a bulb dropper to add the saline suspen- 3. VP: add one drop 40% KOH and then one
sion into the cupules of the strip. drop of 6% alpha-naphthol in 10 min.
3. Fill the cupule with mineral oil for underlined 4. Record the results (+ or -) on the worksheet.
test ADH, LDC, and URE. 5. Record the API number and add number up
4. Fill both the tube and cupule for boxed tests for the positive reaction, and search the code
CIT, VP, and GEL. in the API reference book.
5. Add 5 ml of water into the plastic base and 6. Record and confirm if the identity of the isola-
place strip in the base. tion is Salmonella spp.
6. Incubate the strip for 24 h at 35 °C. 7. A possible Salmonella spp. code is 6704752.
Figure of API-20 E Results Sheet
Review Question Test name Positive Negative

ADH Red or Yellow
orange
Starting in July 2011, USDA-FSIS established
LDC Red or Yellow
new performance standards in response to orange
national baseline studies requiring routine testing ODC Red or Yellow
for Salmonella and Campylobacter in all pro- orange
cessing plants. Questions: What are the perfor- CIT Turquoise/ Light green/
mance standards? If you are a microbiologist dark blue yellow
H2S Black deposit No black
working in a poultry company, how you will do
deposit
for your company to meet this requirement, and URE Red or Yellow
if there are outbreaks happening, what you will orange
do to isolate these two pathogens from contami- TDA Golden Yellow
nated chicken samples. brown/red
IND Pink-red ring Yellow
VP Pink-red Colorless
GEL Diffusion No
PI 20 E Test Results Table of Color
A diffusion
Change GLU Yellow or Blue to
gray green
Test name Positive Negative MAN, INO, SOR, Yellow- Blue to
ONPG Yellow Colorless RHA, SAC, MEL, yellow green blue-green
AMY, and ARA
Positive Salmonella spp. Result 57
Positive Salmonella spp. Result
Salmonella Typhimurium ATCC 14028 (Positive Control)
A Salmonella spp. Positive Sample Isolated from Chicken Carcass

Lab Work Flowchart (Salmonella)
Commercial chicken
carcass
Transfer the carcass

into poultry sampling
bag with 400 ml BPW
and shake 30 s
Carcass rinse water

storage at 35oC for 24 h
(The residual chicken

blood is good for
enrichment)
Transfer 0.1 ml of enriched Transfer 1.0 ml of enriched

BPW into RV, incubate at BPW into TT, incubate at
42oC for 24 h 35oC for 24 h
Streak-plating RV Streak-plating TT
enrichment on enrichment on
HardyChrome and HardyChrome and
XLT-4 agar, incubate XLT-4 agar, incubate
35oC for 24h 35oC for 24h
Lab Work Flowchart (Campylobacter) 59
Lab Work Flowchart (Campylobacter)
Commercial
chicken carcass
Transfer the carcass

into poultry sampling
bag with 400 ml BPW
and shake 30 s
Transfer 25 ml of
shaken BPW solution
into 25 ml of Bolton
broth in a tube
Store the tube into a

microaerophilic jar at
42.5oC for 48h.
Streak-plating onto a
modified campy-cefex
agar and stored into a
microaerophilic jar at
42.5oC for 48h.
Part of Results Figures (Work from Previous Students)
A. Latex agglutination test
Negative Positive (clumping)
B. Gram staining results of presumptive Campylobacter spp.
Gram-negative, single rods with S-shape

Part of Results Figures (Work from Previous Students) 61
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Class Notes
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Thermal Inactivation of Escherichia
coli O157:H7 in Non-intact 9
Reconstructed Beef Patties
Abstract • Kitchen aid and manual hamburger patty

maker.
We will manufacture non-intact reconstructed • Foam trays and air-permeable plastic film.
beef patties, inoculating it with E. coli • Griller and type-K thermocouple.
O157:H7 and aerobically storing in a PVC • Buffered peptone water (100% and 0.1%).
film-covered foam tray. We will evaluate the • Filtered food sampling bag.
cooking inactivation activity of E. coli • MacConkey agar, MacConkey agar with
O157:H7 in beef patties with various cooking MUG, and tryptic soy agar.
times. We will enumerate survivals on support • E. coli PRO™ O157 Latex Kit.
and selective medium and use USDA-IPMP • Enterotube II.
2013 software to analyze data and determine
the fitted model. Finally, presumptive E. coliIntroduction As defined by the US Department
O157:H7 survivals will be identified using of Agriculture Food Safety and Inspection
Enterotube II biochemistry test and latex Service (USDA-FSIS), non-intact beef products
include ground beef, mechanically or chemically
agglutination test. In this chapter, students are
required to finish part of the work tenderized beef cuts, restructured entrees, and
independently. meat products that have been injected with brin-
ing solutions for enhancement of flavor and/or
tenderness. Escherichia coli O157:H7 (ECOH)
Objectives Practice the cooking procedure to or non-O157-Shiga toxin-generating Escherichia
inactivate E. coli O157:H7 in manufactured non- coli (STEC) can generate shiga toxin and cause
intact reconstructed beef patties, and model the severe hemolytic uremic syndrome, with as little
results using USDA-IPMP 2013 software. as ten cells causing death in a formerly health
person. Since 1999, ECOH has been considered
an adulterant of raw, non-intact beef products. On
Major Experimental Material November 2011, the USDA-FSIS announced
that, as of June 2012, non-intact beef products
• Fresh ground beef. would also be considered adulterated if they were
• E. coli O157:H7 strains. contaminated with non-O157-STEC serogroups
• Benchtop meat grounder. O26, O45, O103, O111, O121, or O145.

https://doi.org/10.1007/978-3-031-26197-8_9
64 9 Thermal Inactivation of Escherichia coli O157:H7 in Non-intact Reconstructed Beef Patties
Lab Work Procedure metric center of the patty to monitor the internal
temperature throughout the cooking using
Inoculation and Beef Patty Parathion The PicoLog, a real-time data recording software.
meat will be manually cut into trimmings and
then coarse grounded in a meat grinder (Gander
Mountain #5 Electric Meat Grinder, Saint Paul, Enumeration
MN). Ground meat will be then mixed with 1. Cooked beefsteaks (needed to weigh) will be
40 mL of the E. coli O157:H7 inoculum cocktail sterilized transferred into filtered-whirl at
in a bowl-lift stand mixer (Kitchen Aid food sampling bag immediately.
Professional 600, Benton Harbor, MI) at medium 2. Add 200 ml of 0.1% buffered peptone water
speed for 2 min to ensure even distribution of the into the sample bag.
inoculum into the sample, which simulates E. 3. Stomach for 1 min.
coli O157:H7 contamination during non-intact 4. Conduct serial dilution into 9.0 or 9.9 ml
beef preparation. A manual hamburger patty 0.1% BPW solution to obtain final dilution
maker (mainstays 6-ounce patty maker, Walmart, factor 10−1 and 10−3, and spread plating onto
Bentonville, AR) will be then used to make beef MacConkey Agar and Tryptic Soy Agar.
or veal patties with 170–180 g of grounded meat. Please draw your dilution diagram in your
notebook.
Packaging The reconstructed beef patties will 5. Incubate plates at 35 °C for 48 h.
be packaged aerobically in foam trays and cov- 6. Manually count colonies of agar plates and
ered using air-permeable plastic film and stored record onto notebook; calculate as follows:
at 4.0 °C for 5 days. log10 CFU/g = Log10 [(final CFU on plates/
dilution factor)*(beefsteaks
Cooking After the 5-day storage, the beefsteaks gram+200 ml)/beefsteaks gram].
will be taken out from their packages, weighed For example, after cooking, the beef is 100
and double pan-broiled in a Farberware@ griller grams, 50 CFU on plates with dilution fac-
with setup temperature of 177 °C (or 350 °F) for tor 10−1, and then final log10CFU/g.
0, 0.5, 0.75, 1, 1.5, 2, 3, 4, 5, 7, and 10 min. A = log10 (50*101 * 3) = log101,500 = 3.2
type-K thermocouple was attached to the geo- log10CFU/g.
Identification of E. coli O157:H7 65
Please draw your dilution procedure below: Identification of E. coli O157:H7
Lab Work Flowchart Pick a typical presumptive E. coli O157:H7 from

MacConkey Agar (pink colony due to lactose fer-
mentation positive) to conduct the following test:
1) Streak plating onto sorbitol MacConkey Agar
Course ground fresh beef with MUG and incubate at 35 °C for 24 h.
Note: MUG is a 4-methylumbelliferyl-β-D-
glucuronide. E. coli O157:H7 cannot ferment
sorbitol, and it does not have enzyme β-D-
glucuronidase; therefore, it is a nonfluorescent
white colony under UV light.
2) Latex Agglutination Test (E. coli
Inoculate E.coli O157:H7 PRO™O157 Latex Kit).
in a kitchen kid 1. Place one drop of saline solution onto two
wells of the test card.
2. Use sterilized loop pick presumptive col-
ony from MacConkey Agar and mix with
the saline solution.
3. Shake (very important!) the latex reagent
Making beef paes using bottle (control and test reagent), and place
manual pay maker one free failing drop into each well.
4. Use a new sterilized loop to mix the regent
with colony very well.
5. Rock the card for 1 min to observe the
clumping.
3) Enterotube II Test.
PVC film, aerobic storage
Enterotube II (picture below) is a tube of 12
for 48 h at 4oC
compartmentalized, conventional agar media that
can be inoculated rapidly from a single isolated
colony on an agar plate. The media provided
indicate whether the organism ferments the car-
bohydrates such as glucose, lactose, adonitol,
arabinose, sorbitol, and dulcitol; produces H2S
and/or indole; produces acetylmethylcarbinol;
Double pan-broiling on a deaminates phenylalanine; splits urea; decarbox-
griller set at 176oC ylates lysine and /or ornithine; and can use citrate
when it is the sole source of carbon in the
medium. The Enterotube II is an example of a
rapid, multi test system used in the identification
of unknown oxidase negative, Gram-negative,
rod-shaped bacteria of the family
Enterobacteriaceae. The Enterobacteriaceae is
a family of bacteria normally present in the intes-
tinal tract of humans and animals. All members
of the family ferment glucose and are oxidase-
negative, facultatively anaerobic, Gram-negative
rods with simple nutritional requirements.
Procedure If positive, circle number 2 under ornithine on

your results pad.
Step 1. Remove the screw caps from both ends; Compartment 4. Interpret the results of H2S
aseptically pick one presumptive E. coli production.
O157:H7 colony from MacConkey Agar with true black = +; beige = −.
the sharp end (white end). If positive, circle number 1 under H2S on your
Step 2. Twist the needle and pass it through the results pad.
12 wells and put it back to the original end and Compartment 4. Indole production.
screw the white cap back. Your instructor will give you the indole test
Step 3. Bend and break the needle at the blue cap results of your unknown.
end; break the “window” (punch the plastic Compartment 5. Interpret the results of
film) of ADO, LAC, ARB, SOR, VP, DUL/PA, adonitol fermentation.
URE, and CIT compartments. Screw the blue Compartment 6. Interpret the results of lac-
cap back. tose fermentation.
Step 4. Incubate the Enterotube II at 35 °C and Compartment 7. Interpret the results of arab-
read results in 24 h. inose fermentation.
Step 5. Interpret the results of your Enterotube II Compartment 8. Interpret the results of sor-
using the instructions below. bitol fermentation.
any yellow = +; red or orange = −.
Interpreting the Compartments: Circle the If positive, circle the points granted for each
numerical value of each positive reaction. carbohydrate given on your results pad.
Compartment 1. Interpret the results of glu- Compartment 9. Voges-Proskauer test.
cose fermentation. This test is not used unless a final VP confirm-
any yellow = +; red or orange = −. ing test is later called for.
If positive, circle number 2 under glucose on Compartment 10. Interpret the results of dul-
your results pad. citol fermentation.
Compartment 1. Interpret the results of gas yellow = +; any other color = −.
production. If positive, circle number 1 under dulcitol on
wax lifted from agar = +; wax not lifted from your results pad.
agar = −. Compartment 10. Interpret the results of PA
If positive, circle number 1 under gas on your deaminase.
results pad. black or smoky gray = +; any other color = −.
Compartment 2. Interpret the results of If positive, circle number 4 under PA on your
lysine decarboxylase. results pad.
any purple = +; yellow = −. Compartment 11. Interpret the results of urea
If positive, circle number 4 under lysine on hydrolysis in.
your results pad. red or purple = +; beige = −.
Compartment 3. Interpret the results of orni- If positive, circle number 2 under urea on your
thine decarboxylase. results pad.
any purple = +; yellow = −.
Procedure 67
Compartment 12. Interpret the results of vided below the arrow on your results page.
citrate utilization. You now have a five-digit reference number.
any blue = +; green = −. • Locate the five-digit number in the
If positive, circle number 1 under citrate on Interpretation Guide booklet, and find the best
your results pad. identification in the column entitled “ID Value.”
Once you have completed your biochemical Results pad for calculating identification code
readout, be sure you do the following: number:
• Add all the circled numbers in each bracketed You may use the results pad above to keep in
section and enter the sum in the space pro- your laboratory notebook.
E. coli O157:H7 code should be 75340.
Enterotube II Lab Work Flowchart
Label the Enterotube II
Break the needle to create

an end
Pick colonies from the

agar plate
Passing the needle though

all wells
Close the cap and break the side well

to create aerobic environment
USDA-Integrated-Predictive- 3. Reparametrized Gompertz survival model.

Modeling-Program Software 4. Weibull model.
5. Linear curve with shoulder, two-phase
IPMP 2013 is a new-generation predictive micro- model.
biology tool. It is designed to analyze. 6. Linear with tail three-phase model.
experimental data commonly encountered in Step 5. Find your RMSE and AIC number of
predictive microbiology and for the development each model equation; the best model that fits
of predictive models. In this chapter, we will use your results should have the smallest value of
survival models to analyze the results. RMSE and AIC.
Brief Procedures References (After Class Reading)
Step 1. Download and install “USDA-IPMP Huang, L. 2013. USDA Integrated Pathogen
2013 software” into your computer: Modeling Program (http://www.ars.usda.gov/
https://www.ars.usda.gov/northeast-area/wyn- Main/docs.htm?docid=23355). USDA
dmoor-pa/eastern-regional-research-center/docs/ Agricultural Research Service, Eastern
integrated-p athogen-m odeling-p rogram- Regional Research Center, Wyndmoor, PA.
ipmp-2013/ Huang, L. 2014. IPMP 2013 – A comprehensive
Then click “Link to download IPMP2013.” data analysis tool for predictive microbiology.
Step 2. Enter cooking time into “x-data” column, International Journal of Food Microbiology,
and enter microbial raw data into “y-data” col- 171: 100–107.
umn. Click “submit raw data”; all raw micro-
bial data will transfer to “log CFU/unit.”
Step 3. Select the “Survival Models,” and click Review Question
the radio button of “Linear Model,” “Gompertz
Model,” “Weibull Model,” and “Two/Three- Cooking ground beef patties at 176 °C for 0–15 min,
Phase Linear Model.” For “Linear Model,” we get the following results of Escherichia coli sur-
choose both “with” and “without” tails. vival population; please use USDA-Integrated-
Step 4. Your results should fit one of the follow- Predictive-Modeling-Program software to calculate
ing curves: all parameters and choose the best model that fits
1. Linear curve. the thermal inactivation curves (CFU/g, it needs to
2. Linear curve with tail. transfer to log10CFU/g) (5 points).
Time (min) 0 1 2 3 5 7 9 10 12 15
CFU/g 2,000,000 1,200,000 1,100,000 1,000,000 90,000 20,000 5000 4000 200 50
Review Question 69
Class Notes
Class Notes
Thermal Inactivation of Escherichia
coli O157:H7 in Mechanically 10
Tenderized Beefsteaks and Color
Measurement
Abstract • MacConkey Agar, MacConkey Agar with

MUG, and tryptic soy agar.
We will purchase beefsteaks from the local • E. coli PRO™O157 Latex Kit.
supermarket, inoculating it with E. coli • Color meter.
O157:H7 and manually mechanically tender-
ize beefsteaks with a portable meat tenderizer.
We will evaluate the cooking inactivation Introduction Escherichia coli O157:H7 is a
activity of E. coli O157:H7 in tenderized beef highly virulent foodborne pathogen, causing
with various internal temperatures. We will hemolytic uremic syndrome (HUS), that results
enumerate survivals on support and selective in approximately 62,000 cases of symptomatic
medium and introduce color measurement of infections, about 1800 hospitalizations and 52
raw and cooked beef samples. deaths annually in the United States. According
to the US Department of Agriculture’s Food
Safety and Inspection Service (USDA-FSIS),
Objectives Practice the cooking procedure to non-intact beef products include ground beef,
inactivate E. coli O157:H7 in mechanically ten- chemical or mechanically tenderized, restruc-
derized beefsteaks and introduce meat color tured into formed entrees, or needle injection
measurement. with marination or salt solutions for enhance-
ment of flavor and tenderness. E. coli O157:H7
translocated from the meat surface to internal tis-
Major Experimental Material sue by mechanical tenderization in the tissue dur-
ing restructuring could be protected from thermal
• Fresh beefsteaks. inactivation process, especially if the products
• E. coli O157:H7 strains. are undercooked or cooked directly from un-
• Portable manual meat tenderizer. thawed semi-frozen status. The microbiological
• Griller and type-K thermocouple. safety concern related to non-intact beef prod-
• Buffered peptone water (100% and 0.1%). ucts, including ground beef, is supported by out-
• Filtered food sampling bag. breaks of E. coli O157:H7 illness from 2002 to
• L-shaped sterile plastic spreader. 2006 linked to consumption of such products.

https://doi.org/10.1007/978-3-031-26197-8_10
72 10 Thermal Inactivation of Escherichia coli O157:H7 in Mechanically Tenderized Beefsteaks…
Lab Work Procedure as contact grilling, is when the food (usually

meat, especially burger patties, chicken, and
Inoculation One beefsteak will be received by steaks) is cooked on both sides simultaneously by
two students/group and will be inoculated with applying two cooking surfaces, from both the
1.0 mL of prepared inoculum of E. coli O157:H7 bottom and the top, greatly reducing the cooking
by spreading on the surface of each side of steak time. A type-K thermocouple was attached to the
with a sterile bent plastic rod on a foiled paper geometric center of the patty to monitor the inter-
under biohazard hood. The inoculated beefsteaks nal temperature throughout the cooking using
will be left at room temperature for 10 min to PicoLog, a real-time data recording software.
encourage attachment of the pathogen onto the
beef samples.
Enumeration
Mechanical Needle Tenderization Inoculated 1. Cooked beefsteaks will be sterilized trans-
beefsteaks will be “needle tenderized” by press- ferred into filtered food sampling bag
ing and passing through Jaccard@ Meat Tenderizer immediately.
for each side. 2. Add 200 ml of refrigerated 0.1% of buffered
peptone water (BPW) into the sample bag.
Packaging The tenderized beefsteaks will be 3. Weigh the sample bags; the weight of the
packaged aerobically in foam trays and covered cooked steak = total weight – 200 g (added
using air-permeable plastic film and stored at 0.1% BPW) – weight of the sample bag
4.0 °C for 5 days. (needed to weigh before adding samples).
4. Stomach for 1 min.
Cooking After the 5-day storage, the beefsteaks 5. Conduct 10- or 100-fold serial dilution using
will be taken out from their packages, weighed 9.0 or 9.9 ml 0.1% BPW solution to obtain
and double pan-broiled in a Farberware@ griller appropriate final dilution factor of 101 and
with setup temperature of 177 °C (or 350 °F) to 103.
the internal temperatures of 55 °C, 62.5 °C, 6. Conduct spread plating onto MacConkey
71.1 °C, and 75 °C. Double-broiling, also known Agar and Tryptic Soy Agar.
Please draw your dilution diagram below and checked by the instructor:
7. Incubate agar plates at 35 °C for 48 h. For example, after cooking, the beef is 100
8. Manually count colonies of agar plates and grams, 50 CFU on plates with dilution factor 101,
record onto notebook. and then final log10CFU/g.
Calculate as Follows = Log10 [50 × 101 × (100 + 200)/100] = Log101,5

Log10 CFU/g = log10 [(final CFU on plates × dilu- 00 = 3.2 log10CFU/g.
tion factor) × (beefsteaks gram+200 ml)]/
weight of beefsteaks (gram).
Example of the Lab Result 73
Example of the Lab Result
Total bacterial colonies on this MacConkey agar is 20, and the

diluon factor is 101, and the cooked beef sample is 100
grams, therefore, the calculaon is as follows:
Log10 [20 × 101 × (100 + 200)/100] = Log10600=2.6 log10CFU/g.
Note: 200 is the “200 ml of 0.1% BPW added into the sample
bags”
Please write down procedure.
Latex Agglutination Test (E. coli PROTMO157 Latex Kit)

Lab Work Flowchart
Add bacteria soluon

onto beef surface
Spread bacteria soluon

onto beef surface
Mechanically tenderizaon
using Jaccard@ Meat
Tenderizer
Double pan-broiling beef

steaks with
thermocouple in the
geometric center
Add BPW into sample bags, homogeniza on, 10 or 100-fold serial dilu on
and spread pla ng onto agar medium
Equipment Reset Steps 75
Color Measurement We will practice using the measuring button. (Please note, viscous or
Minolta Colorimeter (CR 300) to measure the nonsolid samples should be measured
raw and cooked beef sample (55 °C, 62.5 °C, through a clear bag, so measuring head lamp
65 °C, and 71.1 °C) surfaces and internal colors will not be damaged.)
using Hunter tristimulus data including L-value 11. Once finished, turn off data processing
(white or black), a-value (redness or greenness), unit; unplug power supply and measuring
and b-value (yellowness or blueness). head.
12. Clean up: Wipe all parts including cords with
a paper towel dampened with 70% ethanol.
eneral Operating Procedure
G Do not spray directly on any parts of the
for Minolta Colorimeter CR 300 colorimeter.
Series 13. Place all the parts to the colorimeter back
into the black storage case.
1. Remove data processing unit from the black 14. Additional notes: Do not get solvents or oils
storage case and confirm the data processing on the paper readout. The numbers will dis-
unit is turned off. appear. Also, do not tape the readout to a
2. Attach power cord to data processing unit notebook. Staple it only. Tape will cause the
and plug in. numbers to fade.
3. Connect pinned measuring head to data pro-
cessing unit. (Be careful not to break pins.)
4. Open white calibration plate and place mea- Equipment Reset Steps
suring head on the plate.
5. Turn data processing on unit. 1. Turn off Minolta Data Processor.
6. Once the data processing unit reads “R-300 2. Hold the “ALL DATA CLEAR” and turn the
Series,” push the calibrate button on the data Minolta Data Processor on. Do not release
processing unit. “ALL DATA CLEAR” until you hear a beep
7. Measuring head should be on white calibra- or tone.
tion plate and will beep once. 3. Select “INDEX SET” and use scroll keys “()”
8. Take a reading by pushing the dark gray to select “D65” and press ENTER.
measuring button on the back of the measur- 4. Select “CALIBRATE” and enter “Yxy” num-
ing head. It will beep three times. (Note: bers of D65 found on inside cover of the white
your reading should be extremely close to L, calibration plate.
97.24; a, 0.01; and b, 1.97.) 5. You may need to push “Color SPACE
9. Remove measuring head from white plate SELECT” to choose L*a*b* values for your
and push “display print” on the unit. measurements.
10. You can now measure samples by placing 6. Measure the white calibration plate.
measuring head on sample and pressing 7. Proceed to steps 1–10 for calibration.
Results Picture from Previous Lab Sections
Average Average Average

Average outside inside Average outside inside Average outside inside
Temperature L* L* a* a* b* b*
55 °C 49.39 42.21 4.70 13.23 9.08 6.99
62 °C 42.43 42.47 5.81 16.87 10.20 9.59
71.1 °C 37.90 47.71 6.70 10.05 9.91 7.91
75 °C 39.40 43.70 6.20 11.20 10.10 8.60
Color Meter Lab Work Flowchart 77
Color Meter Lab Work Flowchart
Color meter calibraon
Wipe all parts including cords

with a paper towel dampened
with 70% ethanol
Measure raw and cooked beef

samples on at least 2 different
loca ons
Record and print out results

sheet and clean all parts of the
color meter again aer
measurement
Review Questions and J. E. Call. 2009. Thermal inactivation

of Escherichia coli O157:H7 in blade-
A. After-Class Reading Peer-Reviewed tenderized beef steaks cooked on a com-
Publications. mercial open-flame gas grill. J. Food Prot.
1. C. Shen, A. McKeith, C. Broyles, and 72, 1404–1411.
R. McKeith. 2016. Quality attributes and 3. Laine, E. S., J. M. Scheftel, D. J. Boxrud,
thermal inactivation of shiga toxin- K. J. Vought, R. N. Danila, K. M. Elfering,
producing Escherichia coli in moisture and K. E. Smith. 2005. Outbreak of
enhanced, non-intact beef products are Escherichia coli O157:H7 infections
affected by pump rate, internal tempera- associated with nonintact blade-tenderized
ture, and resting time after cooking. Food frozen steaks sold by door-to-door ven-
Control. 68, 112–117. dors. J. Food Prot. 68, 1198–1202.
2. Luchansky, J. B., A. C. S. Porto-Fett, Please read the above three papers and com-
B. Shoyer, R. K. Phebus, H. Thippareddi, plete a two-page literature review.
B. Lab results are shown below; can we use color measurement results to determine the micro-
bial safety of cooked beef samples? If so, why? (Hint: This is a debate question.)
Review Questions 79
Class Notes
Class Notes
Evaluate Antimicrobial Activity
of Chlorine Water on Apples 11
and Measurement of Free Chlorine
Concentrations
Abstract Introduction Foodborne illness outbreaks asso-

ciated with the consumption of contaminated fresh
We will evaluate the antimicrobial efficacy of and fresh-cut produce have been well documented
chlorine water against Salmonella enterica in the past 20 years. Examples include tomatoes
serovar Typhimurium and Listeria monocyto- contaminated with Salmonella, lettuce contami-
genes on apples by preparing free chlorine nated with Escherichia coli O157:H7 or non-O157
solutions, washing apples, and microbial test- Shiga toxin-producing E. coli (STEC), and apples
ing including serial dilution technique and contaminated with L. monocytogenes. Washing is
spread plating. We will practice measuring one of the most critical processing steps during
free chlorine concentrations of commercial fresh produce preparation to inactivate pathogens
test kit using N,N-diethyl-p-phenylenediamine and improve product quality, safety, and shelf life.
(DPD) method. However, washing also has the potential to cause
pathogen cross-contamination in the absence of
effective disinfectants, especially when water is
Objectives Practice the washing process to reused and recirculated. Chlorine continues to be
inactivate Salmonella spp. and L. monocytogenes the most commonly used sanitizer in the fresh pro-
on apples with chlorine water solution. duce industry due to its established ability to kill
pathogens in solution, minimal impact on product
quality, and low cost.
Major Experimental Material
Chlorine Water In aqueous solutions near neutral
• Apples. pH, free chlorine is predominately present as hypo-
• Salmonella Typhimurium. chlorous acid (HOCl), the most effective form of
• L. monocytogenes strains. chlorine for disinfection. Alkaline pH favors the
• Chlorine solution (Clorox® bleach solution). conversion to the less efficacious hypochlorite ion,
• A three-liter metal bowl and tap water. OCl−, while acidic pH favors the formation of gas-
• Buffered peptone water (BPW, 100% and eous chlorine Cl2, which tends to be released from
0.1%). solution as off-gas in substantial amounts when the
• Food sampling bag. pH is below 4.0. Factors that affect chlorine water
• L-shaped sterile plastic spreader. are (1) pH; (2) chemical oxygen demand (COD),
• MOX agar and XLT-4 agar. sometimes referred to as turbidity (NTU); and (3)
• DPD free chlorine test Kit. temperature.

https://doi.org/10.1007/978-3-031-26197-8_11
82 11 Evaluate Antimicrobial Activity of Chlorine Water on Apples and Measurement of Free Chlorine…
Impact of pH for Chlorine Water Components

100
80
Chlorine Species (%)
HOCl
60
Cl2
40
OCl-
20
0
0 1 2 3 4 5 6 7 8 9 10 11 12
pH values
Cl2 + H2O HOCl OCl-
Impact of Organic Matter on Chlorine Procedure: Two Students/One

Chlorine is a strong oxidant and reacts with Group
organic matter quickly, leading to a rapid decline
in its concentration and sanitation efficacy. This is 1. Add 1 ml of 9 log10CFU/ml mixed culture of
especially problematic for fresh-cut produce Salmonella Typhimurium and L. monocyto-
wash, as wash solutions contain a large amount of genes into a three-liter tap water, mixed well.
organic matter from cut-produce tissue exudates, 2. Dip five apples into the three-liter bacterial
soil, and other debris. inoculum for 5 min and drain for 10 min
under biosafety hood. Repeat this procedure
twice.
Chlorine by-Products During the commercial 3. Add 7.0 ml of fresh sodium hypochlorite
produce washing process, free chlorine is easily (Clorox® bleach solution) into the three-liter
consumed by organic matter. In order to maintain a tap water, mixed well, using prepared 10%
specific level of free chlorine, frequently adding citric acid to adjust the chlorine wash solu-
sodium hypochlorite into wash solutions can tem- tion to pH 6.8, and measure pH and free
porary increase the free chlorine concentration; chlorine concentrations using portable pH
however, repeatedly adding chlorine into wash meter and DPD chlorine color spectrometer,
solutions that are high in organic loads can promote respectively.
the formation of toxic chlorine by-products like tri- 4. Wash six apples into the three-liter of chlori-
halomethanes (THMs), haloacetic acid (HAAs), nated water for 60 s. The left one will be
haloketones, and chloropicrin. Rising concerns treated as control.
over the environmental effects and employee’s 5. Transfer each washed apple into 100 ml buff-
health risks associated with these toxic by-products ered peptone water in a food sample bag, and
have prompted the elimination of chlorine from shake for 60 s to detach bacteria into BPW
commercial produce washing solutions in some solution.
European countries including Belgium, Denmark, 6. Conduct 10- and/or 100-fold serial dilatation
Germany, the Netherlands, and Switzerland. into 0.1% BPW to make the tube dilution
Procedure: Two Students/One Group 83
factor as 101 and 103; therefore, the final dilu- 8. Incubate MOX and XLT-4 agars at 35 °C for
tion factors of agar plates are 102 and 103. 48 h.
7. Spread plating 0.1 ml of diluted solution 9. Manually count the colonies on the plates.
onto MOX and XLT-4 agars. 10. Please do not forget to do the controls!
Please Draw Your Dilution Diagram Below and Checked by the Instructor
Lab Work Flowchart

Lab work flowchart
Bacteria solu on
Prepara on
Inocula on and dry

under biosafety hood
Wash apples and drain

under biosafety hood
Shake 30 s in
food sample
bags with BPW
Spread pla ng
onto MOX agars
Incuba on and
manually count
the colony
forming unit
(CFU)
Test Free Chlorine Concentration Using DPD Kit Flowchart 85
Test Free Chlorine Concentration Using DPD Kit Flowchart

Test free chlorine concentraon using DPD kit flowchart
DPD chlorine
test kit
“Zero” DPD
chlorine meter
using Dislled
water
Add “1-click” of
DPD dispenser into
tesng curvet cup
(~3.0 ml)
Note: The tesng range

of free chlorine is 0 to 10
mg/L (ppm), high
concentraon liquid
soluon needs to be
diluted first
Review Questions Elevated Temperature. Front. in Microbiol.

10:1196.
After-Class Reading Peer-Reviewed 3. Macarisin, D., I. Sheth, M. Hur, A. Wooten,
Publications H. J. Kwon, Z. Gao, A. De Jesus, W. Jurick,
and Y. Chen. 2019. Survival of outbreak, food,
1. Sheng, L., K. Edwards, H.-C. Tsai, and environmental strains of Listeria monocy-
I. Hanrahan, and M.-J. Zhu. 2017. Fate of togenes on whole apples as affected by culti-
Listeria monocytogenes on Fresh Apples var and wax coating. Sci. Rep. 9:12170.
under Different Storage Temperatures. Front. 4. Stearns, R., Xue, J., Freshour, N., Matak, K.,
Microbiol. 8:1396. Luo, Y., & Shen, C. (2022). The efficacy of con-
2. Shen, X., L. Sheng, H. Gao, I. Hanrahan, ventional spray, electrostatic spray, and dip with
T. V. Suslow, and M.-J. Zhu. 2019. Enhanced a combination of hydrogen peroxide and per-
Efficacy of Peroxyacetic Acid Against oxyacetic acid to inactivate Listeria monocyto-
Listeria monocytogenes on Fresh Apples at genes on apples. J of Food Prot. 85: 828–834.
Please read the above four papers and complete a two-page literature review.
Review Questions 87
Class Notes
Class Notes
Evaluate Cross-Contamination
of Salmonella on Tomatoes in Wash 12
Water Using Most Probable
Number (MPN) Technique
Abstract Introduction Salmonella contaminated on fresh

tomatoes, causing multistate outbreaks from 2004
We will practice using most probable number to 2008. According to the US Centers for Disease
(MPN) technique to evaluate Salmonella Control and Prevention (CDC), Salmonella infec-
transferring from contaminated tomatoes to tions from raw tomatoes have potentially sickened
uninoculated clean tomatoes during washing 79,000 people due to dozens of consequent out-
process without or with chlorine. breaks since the 1990s. The European Union
reports that Sweden experienced similar out-
breaks in 2019 that affected 71 people. In 2004, a
Objectives Understand and practice using MPN large-scale Salmonellosis outbreak that originated
technique to evaluate bacterial cross-in Canada also affected 18 states in the United
contamination on fresh produce during posthar- States, including a tomato packing house in
vest washing process. Florida, and led to a total of 561 illnesses and 168
hospitalizations. Salmonella Typhimurium along
with five other species was determined in a multi-
Major Experimental Material serotype Salmonella outbreak, making it a cause
for concern to the general public, especially those
• Tomatoes. who are immunocompromised, elderly, or chil-
• Salmonella Typhimurium. dren under the age of five. Postharvest washing is
• Nalidixic acid or nalidixic acid sodium power. essential in fresh and fresh-cut processing with a
• Chlorine solution (Clorox® bleach solution). practical “killing step” (using antimicrobials in a
• A three-liter metal bowl and tap water. triple wash) for eliminating microbial pathogens
• Buffered peptone water (BPW, 100% and without affecting product quality. Water is exten-
0.1%). sively used in the postharvest processing of fresh
• 10 and 1000 μL multiple channel pipettes produce to cool, hydrate, clean, and transport pro-
• Food sampling bag. duce. However, if water becomes contaminated
• L-shaped sterile plastic spreader. with microbial pathogens during processing, it
• Tryptic soy agar with 100 ppm nalidixic acid. can be a means of spreading microbial contamina-
• DPD free chlorine test kit. tion resulting in cross-contamination.

https://doi.org/10.1007/978-3-031-26197-8_12
90 12 Evaluate Cross-Contamination of Salmonella on Tomatoes in Wash Water Using Most Probable…
Procedure: Two Students/One 5. Transfer each washed tomato into 100 ml

Group tryptic soy broth (TSB) in a food sample bag,
and shake for 60 sec to detach bacteria into
1. Add 1 ml of 9 log10CFU/ml of 200 ppm of the TSB solution.
nalidixic acid (NaL)-resistant Salmonella 6. Conduct MPN technique in 6 × 8 sterilized
Typhimurium into a three-liter tap water and MPN microplate (prefilled 2.7 ml of TSB)
mix well. followed by ten-fold serial dilution along
2. Dip two tomatoes into the three-liter bacte- each of the six rows using a 1000 μL multiple
rial inoculum for 5 min and drain for 10 min channel pipette.
under biosafety hood. 7. Incubate MPN microplate at 35 °C for 24 h.
3. Add 3.0 ml of fresh sodium hypochlorite 8. Prerecord the turbidity of each microplate
(Clorox® bleach solution) into a three-liter well.
tap water, mix well, use prepared 10% citric 9. Confirm by adding 3 μL of droplets from
acid solution to adjust pH of the chlorine each well onto tryptic soy agar-NaL.
water to 6.8, and measure pH and free chlo- 10. Incubate the TSA-NaL plates at 35 °C for
rine concentrations using portable pH meter 24 h.
and DPD chlorine color spectrometer, 11. The confirmed positive colonies will be
respectively. recorded and input into an online MPN cal-
4. Wash four fresh clean uninoculated tomatoes culator software to retrieve and convert MPN
together with the two inoculated tomatoes values to log10MPN/g.
from step 2 into three liters of the prepared
chlorinated water for 60 s.
Please draw your procedure below for measuring free chlorine concentration of the wash
solution using DPD methods and checked by the instructor
Lab Work Flowchart 91
Lab Work Flowchart
Bacteria inoculum
soluon Preparaon
Dip inoculaon and dry

under biohazard hood
Washing 2 inoculated
with 4 uninoculated
clean tomatoes in
chlorine soluon and
dry aer washing
Shake tomato for 30 sec

in food sample bags
with TSB soluon
Ready for MPN analysis

MPN Work Flowchart

MPN work flowchart
Absorb tomato solu on

using mul ple channel
pipees
Add 0.3 ml of tomato

solu on into 6 × 8
microplate (prefilled
with 2.7 ml TSB)
Conduct 10-fold serial

dilu on into 6 × 8
microplate
Incubate at
35oC for 24 h
and conduct
confirma on
test
Incubate the confirma on plate at 35oC for 24 h

and record results as “888764”
MPN Calculation Lab Work Flowchart 93
MPN Calculation Lab Work Flowchart

MPN Calculaon Lab Work Flowchart
Download the MPN

calculator from the
website
Install the MPN

calculator into the
computer
Input data into the MPN

calculator and select
MPN type
Input data into the MPN

calculator and click
“Calculate MPN” buon
Review Questions 3. Sreedharan, A., Li, Y., De, J., Gutierrez, A.,
Silverberg, R., Schneider, K.R., 2017.
After-Class Reading Peer-Reviewed Determination of Optimum Sanitizer Levels
Publications for Prevention of Salmonella Cross-
Contamination of Mature Round Tomatoes in
1. Bertoldi, B., Bardsley, C. A., Baker, C. A., a Laboratory Model Flume System. J. Food
Pabst, C. R., Gutierrez, A., De, J., Luo, Y., & Prot. 80, 1436–1442.
Schneider, K. R. (2021). Determining 4. Gombas, D., Luo, Y., Brennan, J., Shergill, G.,
Bacterial Load and Water Quality Parameters Petran, R., Walsh, R., Hau, H., Khurana, K.,
of Chlorinated Tomato Flume Tanks in Florida Zomorodi, B., Rosen, J., Varley, R., Deng, K.,
Packinghouses. J. Food Prot. 84, 1784–1792. 2017. Guidelines To Validate Control of
2. Bolten, S., Gu, G., Luo, Y., Van Haute, S., Cross-Contamination during Washing of
Zhou, B., Millner, P., Micallef, S. A., & Nou, Fresh-Cut Leafy Vegetables. J. Food Prot. 80,
X. (2020). Salmonella inactivation and cross- 312–330. https://doi.org/10.4315/0362-028X.
contamination on cherry and grape tomatoes JFP-16-258.
under simulated wash conditions. Food
microbiology, 87, 103359.
Please read the above four papers and complete a three-page literature review.
Review Questions 95
Class Notes
Class Notes
Cultivation of Anaerobic Bacteria
in Canned Food 13
Abstract Introduction
We will isolate anaerobic bacteria from locally Canned food is usually referred as low acid food, pH
canned food using an anaerobic jar with gas ~4.6, and water activity ~0.86. The State of West
generator. The presumptive Clostridium per- Virginia set up the only standard for local canned
fringens will be identified on various selective food to pH ≤4.0. Clostridium botulinum, Clostridium
media together with Gram staining and endo- tetani, Clostridium perfringens, and Clostridium dif-
spore staining. The pH value of the canned ficile are the four major Clostridium spp. that could
food will be measured. cause endospore in improperly canned food.
Source of trouble: Low-acid foods that were
improperly canned.
Objectives Understand the anaerobic bacteria
safety concern in locally produced canned food, Trouble Signs
measuring pH, cultivation, and identification of • Clear liquids turn milky.
possible Clostridium perfringens in canned • Cracked jars.
food. • Loose or dented jars.
• Swollen or dented cans.
• “Off” odor.
Major Experimental Materials
• Canned food samples. Prevention

• pH meter, • Examine all canned foods before cooking.
• Blood agar. • Cook and reheat food thoroughly.
• Cooked meat medium. • Keep cooked food away from “dangerous
• Tryptose sulfite cycloserine agar. zone” 40–140°F.
• Thioglycollate fluid agar.
• Semisolid motility test agar. Symptoms after eating: double vision, difficulty
• Anaerobic jar and gas generator. in speaking, difficulty in swallowing, difficulty in
• Sterile bacterial loop and needle. breathing, and gas gangrene, and they can be fatal.

https://doi.org/10.1007/978-3-031-26197-8_13
98 13 Cultivation of Anaerobic Bacteria in Canned Food
Cooked Meat Medium A medium for the culti- Note: Cooked meat medium needed to be
vation of anaerobes, provides muscle protein in in flowing steam for 20 min immediately
the heart tissue granules for the growth of anaer- before using.
obes. The muscle tissue also provides reducing 6. Incubate tubes at 37 °C for 5 days and record
substances, particularly glutathione. your observation.
Note: Clostridium perfringens grows with
Tryptose Sulfite Cycloserine Agar Contains gas generation.
peptone and yeast extract to support growth of
Clostridium spp. Some H2S-reducing bacteria
like Clostridium perfringens will reduce the sul- rocedure of Detecting Possible
P
fite to sulfide and generate black colonies with Clostridium Perfringens
the formation of ammonium ferric citrate.
7. Streak plating 100 μl of incubated canned
Thioglycollate Fluid Agar A nutritive medium food liquid onto tryptose sulfite cycloserine
with a reducing agent (sodium thioglycolate) agar and blood agar.
which removes oxygen from the broth. A chemi- Note: Clostridium perfringens show black
cal indicator, methylene blue, is included in the colony on tryptose sulfite cycloserine agar
broth. The greenish to blue color indicates the and double beta-hemolytic zone on blood
presence of oxygen. agar.
8. Incubate agars in an anaerobic jar at 35 °C
for 48 h.
Procedure 9. Inoculate typical colonies (black color) into
thioglycollate fluid agar at 35 °C for 24 h,
1. Measure and record pH of assigned original and record the growth observation.
canned food (95% ethanol rinsing pH meter Note: Clostridium perfringens grows
before measuring pH). thoroughly in the thioglycollate fluid agar.
2. Incubate the canned food samples for 10 days 10. Stab inoculate typical colonies into the mid-
at 37 °C. dle of semisolid motility agar
3. Examine the exterior of the container for any Note: Clostridium perfringens is not motile.
noticeable “trouble sign.” 11. Measure the pH of final canned food
4. Sanitizing the lid of canned food samples with samples.
200 ppm chlorine. 12. Conduct Gram staining and endospore stain-
ing using typical colonies.
Procedure of Cooked Meat Medium

Please write down gram staining and
5. Inoculate two tubes of cooked meat medium, endospore staining procedure below
one with 2 g canned food samples and the
other with 2 ml tube of canned food liquid. Gram Staining
Pictures 99
Endospore Staining
Review Question your area, how will you treat your canned food in
your plant? Please discuss about the possible
What is low-acid food? If there are flooding in pathogen related to canned food.
Pictures
Principles of Anaerobic Jar
Lockscrew
Catalyst palladium
Anaerobic indicator
Methylene Blue (blue
Add 10 ml of water with O2, colorless
into Gaspak, generate without O2
H2 and CO2, H2 reacts
with O2 form water to
remove O2
Results Figure
Clostridium perfringens cause double β-

hemolyc zone on blood agar
100 13 Cultivation of Anaerobic Bacteria in Canned Food
Class Notes
Pictures 101
Class Notes
Observation and Enumeration
of Molds from Spoiled Bread 14
Abstract Major Experimental Material
We will introduce the basic knowledge of • Spoiled bread.

molds from spoiled food. We will practice • Lacto-phenol cotton blue.
staining molds and observe their morphol- • Plastic tape.
ogy. We will enumerate the population of • Buffered peptone water (100% and 0.1%).
fungi from spoiled bread using 3 M@yeast/ • 3 M@ yeast/mold petrifilm.
molds petrifilm and practice the dilution
technique.
Introduction of Fungi Fungi has dimorphic
status, the yeast phase grows best at 35–37 °C,
Objectives Practice the lacto-phenol cotton blue and their mold phase grows at 25 °C. The three
staining to observe molds from spoiled bread, popular mold types are Aspergillus, Rhizopus,
and enumerate the population of molds using and Penicillium.
yeast/mold petrifilm. Molds are composed of filament called
hyphae, abundantly interwoven in a mat (a very
fuzzy appearance) called mycelium. The myce-
lium extends upward from its vegetative base,
thrusting specialized hyphae that bear conidia
into the air, which is called aerial hyphae.
https://doi.org/10.1007/978-3-031-26197-8_14
104 14 Observation and Enumeration of Molds from Spoiled Bread
Aspergillus 100X –
breads, grains,
vegetables, dairy
Rhizopus 100X–breads,
vegetables
Penicillium 400X –breads,

fruits, vegetables, dairy
rocedure: Lacto-Phenol Cotton

P 6. Observe the mold morphology under 10X and
Blue Stain 40X objective lens.
1. Obtain a mold contaminated bread from the

front desk. Enumeration of Molds in Bread
2. Apply the tape to your index finger with the
sticky side out, and do not allow the tape to 1. Use chopstick to take out 15 g of spoiled
stick to itself. bread and place it into 50 ml buffered peptone
3. Open the bag of molded bread and gently water.
apply the sticky side of the tape to the mold 2. Stomach for 2 min, and spread plating onto
surface. yeast/molds petrifilm with 10−3 and 10−5
4. Place one drop of lacto-phenol cotton blue stain dilution.
in the center of your clean microscope side. Note: The presser used on yeast/mold pet-
5. Press the sticky side of the tape onto the drop rifilm is larger than the one used for APC and
of lacto-phenol cotton blue. TCC/ECC petrifilm.
Please write down your dilution procedure below
Review Question
Name and draw three possible molds in a spoilage bread, and briefly describe their structure.
Lab Work Flowchart
Molded bread
Apply the tape to your index

finger with the scky side out
Apply the scky side of the

tape to the mold surface
Add one drop of Lacto-phenol

coon blue on the center of
glass slide
Press scky tape onto glass

slides, observe under 10X and
40X objecve lens
Part of Results Figures (Work from Previous Students)

A. Molds from spoiled bread grown on petrifilm
B. Molds from spoiled bread
Penicillium (400X) from a spoiled bread
Possible Aspergillus (400X) from a

spoiled bread
Part of Results Figures (Work from Previous Students) 107
Class Notes
Class Notes
DNA Extraction and Purity
Determination of Foodborne 15
Pathogens
Abstract • Vortex and vortex adapter for 2 ml tubes

(Qiagen cat. no. 13000-V124)
We will introduce the basic knowledge of • 10 mM Tris-pH 8
molecular food microbiology. We will prac- • NanoDrop Spectrophotometer
tice extracting DNA by the boiling method • Kimwipes (KimTech)
and a commercial kit and determine the purity • Disposables: pipette tips and Eppendorf tubes
of extracted DNA samples.
Lab Work Procedure

Objectives Practice DNA extraction from bac-
terial culture suspension using the boiling method 1. DNA Extraction from Bacteria Culture:
and Qiagen DNeasy UltraClean Microbial Kit,
and determine the purity of extracted DNA A. Crude DNA extraction using the boiling
samples. method:
1. Collect a loopful of E. coli from TSA and
resuspend in 600 μl of 10 mM Tris. Vortex.
Major Experimental Material 2. Heat the suspension at 95 °C for 10 min
on a heat block or water bath.
• E. coli ATCC 25922 grown on Tryptic Soy 3. Centrifuge at 10,000 rpm/min for 5 min.
Agar (TSA) Gently remove the tube from the
• E. coli isolate recovered from food samples centrifuge.
grown on TSA 4. Transfer the supernatant to a fresh tube.
• Inoculation loops 5. Repeat steps 3–4.
• Pipette set 6. Proceed to DNA concentration and purity
• Sterilized deionized water measurement or store at −20 °C.
• Heat block (or water bath) B. DNA extraction using Qiagen DNeasy
• Qiagen DNeasy UltraClean Microbial Kit UltraClean Microbial Kit:
https://doi.org/10.1007/978-3-031-26197-8_15
110 15 DNA Extraction and Purity Determination of Foodborne Pathogens
Before starting: 10. Add 900 μl of Solution SB to the supernatant

and vortex for 5 s.
• If Solution SL (which contains SDS) has pre- (Note: This step is to bind DNA to the
cipitated, heat at 55 °C for 5–10 min. MB Spin Column membrane in the fol-
• Shake to mix Solution SB (highly concen- lowing step.)
trated salt solution) before use. 11. Load about 700 μl into a MB Spin Column
and centrifuge at 10,000 × g for 30 s. Discard
the flow-through, add the remaining superna-
1. Add 1.8 ml of overnight bacteria culture to a tant to the MB Spin Column, and centrifuge
2 ml Collection Tube (provided by the kit), again at 10,000 × g for 30 s.
and centrifuge at 10,000 × g for 30 s. Decant 12. Add 300 μl of Solution CB and centrifuge at
the supernatant and spin the tubes again at 10,000 × g for 30 s.
10,000 × g for 30 s. Completely remove the (Note: Solution CB is an ethanol-based
supernatant with a pipette tip. wash solution used to remove residues of
(Note: Pellet is the bacterial cells.) salt and other contaminants but allow the
2. Resuspend the cell pellet in 300 μl of DNA to stay bound to the silica
PowerBead Solution and gently vortex to membrane.)
mix. Transfer resuspended cells to a 13. Discard the flow-through. Centrifuge at
PowerBead Tube. 10,000 × g for 1 min.
3. Add 50 μl of Solution SL to the PowerBead 14. Place the MB Spin Column in a new 2 ml
Tube. Collection Tube (provided by the kit).
4. Secure PowerBead Tubes horizontally using 15. Add 50 μl of Solution EB (elution buffer) to
the vortex adapter. Vortex at maximum speed the center of the white filter membrane.
for 10 min. 16. Centrifuge at 10,000 × g for 30 s.
(Note: This step is for the combined 17. Discard the MB Spin Column. The DNA is
chemical/mechanical lysis of bacterial cells.) now ready for downstream applications.
5. Make sure the 2 ml PowerBead Tubes rotate (Note: It is recommended to store DNA
freely in the centrifuge without rubbing. frozen (−30 °C––15 °C or − 90 °C––
Centrifuge the tubes at a maximum of 65 °C) as Solution EB does not contain
10,000 × g for 30 s. EDTA.)
(Note: The cell debris is in the pellet while
DNA remains in the supernatant.) 2. DNA Concentration and Purity
6. Transfer the supernatant to a clean 2 ml Measurement.
Collection Tube (provided by the kit).
7. Add 100 μl of Solution IRS to the superna- DNA concentration and purity can be measured
tant and vortex for 5 s. Incubate at 4 °C for using a NanoDrop Spectrophotometer:
5 min.
(Note: Solution IRS removes contaminat- 1. Select DNA from the home screen.
ing organic and inorganic matter that may 2. Select dsDNA assay.
reduce DNA purity.) 3. Establish a blank by pipetting 1–2 μl of the
8. Centrifuge the tubes at 10,000 × g for 1 min. blanking buffer (10 mM Tris) onto the bot-
9. Avoiding the pellet, transfer the entire vol- tom pedestal. Lower the arm.
ume of supernatant to a clean 2 ml Collection 4. Press Blank on the screen.
Tube (provided by the kit). 5. When measurement is complete, raise the
(Note: The pellet contains contaminating arm and wipe the buffer off from both upper
materials, including cell debris and and lower pedestals using a clean Kimwipe.
proteins.) 6. Repeat step 3. Press Measure on the screen.
DNA Extraction and Purity Measurement Lab Work Flowchart 111
(Note: The concentration should be zero 10. Wipe upper and lower pedestals using a clean
if the blank was set up correctly.) Kimwipe.
7. Repeat step 5. 11. Instrument is ready for the next
8. Continue with the DNA sample by pipetting measurement.
1–2 μl of the solution onto the bottom pedes-
tal. Lower the arm. Nucleic acid purity can be interpreted for
9. Press Measure on the screen. Record the DNA and RNA according to the table below:
DNA concentration and purity ratio.
Purity ratio DNA RNA Purity interpretation

A260/A280 ratio <1.8 <2.0 Phenol, guanidine, or other contaminants
and
Very low concentration of nucleic acids
~1.8 ~2.0 Generally accepted as “pure”
>1.8 >2.0 Poor-quality blank eliminating signal near
280 nm
DNA Extraction and Purity Measurement Lab Work Flowchart

112 15 DNA Extraction and Purity Determination of Foodborne Pathogens
Class Notes
DNA Extraction and Purity Measurement Lab Work Flowchart 113
Class Notes
Practice of Multiplex PCR
for Bacteria Identification 16
Abstract Major Experimental Material
We will introduce the multiplex polymerase • Enterococcus of unknown species grown on

chain reaction (PCR) procedure for identifying Tryptic Soy Agar (TSA)
foodborne pathogen surrogate Enterococcus. • Standard E. faecium and E. faecalis culture
The lab work will include DNA extraction from grown on TSA
a bacterial suspension, multiplex PCR thermal • Benchtop centrifuge
cycle, and bacteria identification. • Sterile deionized water
• 10 mM Tris-pH 8
• 2× Qiagen PCR Multiplex Master Mix
Objectives Practice the Multiplex PCR method • Working solution of three pairs of PCR prim-
to rapidly detect and identify Enterococcus spp. ers1,2 at 20 μM each:
in bacterial suspension.
Primers Specificity Primer sequence (5′-3′) Amplicon

E1 Enterococcus TCAACCGGGGAGGGT 738 bp
E2 spp. ATTACTAGCGATTCCGG
FL1 E. faecalis ACTTATGTGACTAACTTAACC 360 bp
FL2 TAATGGTGAATCTTGGTTTGG
FM1 E. faecium GAAAAAACAATAGAAGAATTAT 215 bp
FM2 TGCTTTTTTGAATTCTTCTTTA
Introduction PCR stands for polymerase chain

• Thermocycler
reaction. It is a DNA amplification technique that
• 100 bp DNA ladder
takes a specific sequence of DNA of small amounts
• Invitrogen SYBR™ Safe DNA Gel Stain
and amplifies it to be used for detection and further
• Tris-borate-EDTA (TBE) buffer
testing. Multiplex PCR allows for simultaneous
• 2% agarose gel in TBE (5 μl of SYBR Safe
detection of multiple DNA sequences in a single
added to 100 ml of gel)
reaction and therefore enhances detection effi-
• Disposables: Pipette tips, Eppendorf tubes,
ciency. Using a different pair of primers for each
and PCR tubes
https://doi.org/10.1007/978-3-031-26197-8_16
116 16 Practice of Multiplex PCR for Bacteria Identification
target, this practice applies multiplex PCR to iden- Amount of each ingredient added
tify two important species of Enterococcus, E. fae- (μl)
calis, and E. faecium. One Five Ten
Ingredient sample samples samples
Deionized water 2.5 12.5 25
E1 (20 μM) 1 5 10
Lab Work Procedure E2 (20 μM) 1 5 10
FL1 (20 μM) 2 10 20
1. DNA Extraction from Bacteria Culture: FL2 (20 μM) 2 10 20
FM1 (20 μM) 1 5 10
1. Label Eppendorf tubes with sample ID. FM2 (20 μM) 1 5 10
2. Add 600 μl of 10 mM Tris to each tube. 2× PCR master 12.5 62.5 125
3. Collect a loopful of each bacteria culture from mix
TSA and resuspend in the corresponding tube Total volume 23 115 230
and vortex.
4. Heat the suspension at 95 °C for 10 min on a
hot plate or water bath. 3. Dispense 23 μl of the master mix into indi-
5. Centrifuge at 10,000 rpm/min for 5 min. vidual PCR tubes.
Gently remove the tube from the centrifuge. 4. Add 2 μl of DNA template to the tube. The
6. Transfer the supernatant to a fresh tube. final volume of each PCR reaction is 25 μl.
7. Repeat steps 5–6. 5. Run PCR according to the following parame-
8. Proceed to PCR or store at −20 °C. ters: 95 °C for 4 min; 30 cycles at 95 °C for
30 s; 55 °C for 1 min; 72 °C for 1 min; and
elongation at 72 °C for 7 min.
2. Multiplex PCR for Enterococcal species 6. Load 10 μl of PCR product into each well of
identification the 2% agarose gel. Load 5 μl of DNA ladder
in a separate well.
1. Label PCR tubes with sample ID. 7. Run electrophoresis under 110 V for 30 min.
2. Add PCR ingredients according to the follow- 8. Observe PCR results in a Gel Doc Imager.
ing scheme to make the PCR master mix
(excluding DNA template):
Review Question 117
PCR Lab Work Flowchart
Review Question Identification of Enterococci. Journal of

Clinical Microbiology 42(8):3558–65.
After-Class Reading Peer-Reviewed 2. Deasy, B. M., M. C. Rea, G. F. Fitzgerald,
Publications (References for the PCR T. M. Cogan, and T. P. Beresford. 2000. A
Primers) rapid PCR based method to distinguish
between Lactococcus and Enterococcus.
1. Jackson, Charlene R., Paula J. Fedorka-Cray, Systematic and Applied Microbiology
and John B. Barrett. 2004. Use of a Genus- 23:510–522.
and Species-Specific Multiplex PCR for
Please read the above two papers and complete a two-page literature review.
118 16 Practice of Multiplex PCR for Bacteria Identification
Class Notes
Review Question 119
Class Notes
PCR Identification of Listeria
Monocytogenes in Deli Meat 17
Abstract the number of target cells in relation to background

microflora will be followed. After this experiment,
We will introduce the PCR test for rapid iden- students will become familiar with using rapid
tification of L. monocytogenes in deli meat. methods to detect foodborne pathogens and obtain
The lab work will include inoculation, a basic understanding of the concept and applica-
DNA extraction, PCR thermal cycle, and gel tion of PCR.
electrophoresis.
Major Materials and Equipment

Objectives Practice using the PCR method to
rapidly detect L. monocytogenes in deli meat • Squeezed bottle filled with 70% ethanol or
(turkey breast or ham). 10% bleach
• Gloves
Introduction Polymerase chain reaction (PCR) • Deli meat contaminated with Listeria
is a DNA amplification method that produces monocytogenes
many copies of a specific fragment of DNA. PCR • Graduated cylinder
can be used as a rapid method for bacteria identifi- • 250 ml flasks
cation in foods. Key ingredients in a PCR reaction • Buffered Listeria enrichment broth (LEB)
include forward and reverse primers that flank the • DNA extraction kit
DNA sequence to be amplified, a DNA template, • Aerosol barrier pipet tips for PCR
Taq DNA polymerase, and dNTPs as building preparation
blocks for DNA synthesis. In PCR reactions, DNA • Forward primer (P1) (10 pmol/μl)
template is amplified using repeated cycles of • Reverse primer (P2) (10 pmol/μl)
denaturation (strand separation), annealing, and • Go Taq green mix (containing PCR reaction
extension (strand synthesis). The target bacteria in buffer, Taq DNA polymerase, and dNTPs)
this experiment is Listeria monocytogenes from a • De-ionized water
deli meat sample. The DNA template used for • Agarose
PCR will be extracted from the homogenized meat • 1XTBE buffer
sample that has been inoculated with Listeria • Ethidium bromide (EtBr)
monocytogenes, and an enrichment step to increase • 100 bp DNA ladder
https://doi.org/10.1007/978-3-031-26197-8_17
122 17 PCR Identification of Listeria Monocytogenes in Deli Meat
Equipment 7. Set up the PCR reaction (25 μl). Dispense

the following reagents into a PCR tube.
• Scale Be sure that all of the reagents are mixed
• Stomacher well:
• Stomacher bags
• Shaking incubator DNA 2 μl
P1 (10 pmol/μl) 1.25 μl
• Thermocycler
P2 (10 pmol/μl) 1.25 μl
• PIPETMAN
2XGo-Taq 12.5 μl
• Gel electrophoresis apparatus
DI water 8 μl
• GelDoc System
8. Run PCR cycle (approximately 2 h).

Procedure 9. Cast a 1% agarose gel using 1XTBE buffer
with 5 μl/100 ml of EtBr added.
1. Clean work area with 70% ethanol or 10% 10. Remove PCR tubes from the thermocycler.
bleach. Load 15 μl of the PCR product to the agarose
2. Weigh 25 g of deli meat samples (pre- gel.
inoculated with Listeria). 11. Run gel electrophoresis.
3. Transfer sample to a stomacher bag contain- 12. Visualize the PCR product in the GelDoc
ing 225 ml of buffered Listeria enrichment System.
broth (LEB). Stomach for 2 min.
4. Transfer 50 ml of homogenized meat rinse to
a 250 ml flask. Incubate at 30 °C with shaking
at 100 rpm for 4 h.
5. Extract DNA using the DNA extraction kit.
6. Turn on thermocycler and set up the parame-
ters as shown below:
94C 10 min 94C 30s 30 cycles 72C 7min 4C

55C 60s
72C 60s
Lab Work Flowchart
Experimental Procedure of Listeria Identification by PCR
Food samplee Extract DNA

Set up
u PCR reaction
react
Stomach sampl
m e in buffer
sample f Incubate in shaker
Data analysis
Visualize PCR product PCR

Run a gel electrophoresis
124 17 PCR Identification of Listeria Monocytogenes in Deli Meat
Class Notes
Class Notes
Cheese Making
and Characterization 18
Abstract
Major Materials and Equipment
We will practice manufacturing cheese using • Whole milk.
bench top equipment with rennin and testing • Rennin.
the quality parameters of cheese. • Hot plate.
• 250 ml beaker
• Cheese cloth.
Objectives Practice benchtop cheese manufac-
• Thermometer.
turing process and measuring quality of made
• Stirring rod.
cheese including net weight amount, pH, and
• Heatproof gloves.
water activity.
• Heat proof pad.
• pH meter,
Introduction The process of modern cheese
• Dehydrator.
making is a refinement of the techniques discov-
• Water activity meter.
ered thousands of years ago. Traditionally, fer-
mentation of lactose (milk sugar) causes the milk
to curdle due to a pH decrease, separating whey
Procedure
and curds. Another way of making cheese is by
the addition of purified enzymes, such as rennin,
Enzymatic coagulation of the casein from milk:
a type of protease that cleaves the casein into
small fragments that settle out as curds. Rennin
1. Weigh an empty beaker and record the
works best at body temperature (37 °C). If the
weight.
milk is too cold, the reaction is very slow, and if
2. Pour 250 ml of milk in the beaker. Weigh and
the milk is too hot, the heat will denature the ren-
record the weight.
nin, rendering it inactive. There are many rennin
(Weight of milk = Weight of beaker with
cheeses, including Asiago, most brie, most ched-
milk − Weight of beaker).
dar, and Roquefort. Cheese making is dependent
3. Set the hot plate at 43 °C (110°F). Heat up the
on a variety of factors, including the fat content
beaker with the milk on the hot plate.
of milk, pH of the solution, the use of enzymes,
4. Add 3–4 drops of rennin and 2–3 drops of vin-
curing time, and different treatments to influence
egar, stir for 2 min, and allow the milk to sit
taste, texture, and aroma.
on the lab bench for 5 min.
https://doi.org/10.1007/978-3-031-26197-8_18
128 18 Cheese Making and Characterization
5. Cover 2–3 layers of cheesecloth on a clean A. Determination of the moisture content:

beaker. Pour the curds and liquid from the pre- 1. Weigh approximately 100 g sample and
vious step into the clean beaker. record as “wet weight of sample.”
6. Gather up the cheesecloth and squeeze out the 2. Set the dehydrator at no more than 239°F
liquid whey from the curds. Spread out the (115 °C). Dry the sample in the dehydrator
cheesecloth to allow the curds to dry for 5 min. for 24 h.
7. Weigh the curds (excluding the weight of the 3. Allow the sample to cool.
cheesecloth). 4. Weigh the cooled sample again, and
8. Calculate the yield of cheese by dividing the record as “dry weight of sample.”
weight of curds by the weight of milk. 5. Calculate the moisture content using the fol-
lowing equation to the nearest tenth of 1%:
Variations:
%W A B / B 100
9. Test the effect of low and high temperatures
on the activity of rennin. Repeat the where W = Percentage of water in the
experiment with cold milk at 4 °C and hot sample
milk heated to 70 °C.
A = Weight of wet sample.
pH measurement: B = Weight of dry sample.
1. Rinse the electrode of the pH meter with dis-

tilled water. B. Determination of the water activity:
2. Place 5 g of fragmented cheese in a test tube 1. Transfer a small amount of sample (to be
or small beaker. able to cover the bottom of the sample
3. Gently push the electrode into the cheese. cup) for water activity measurement.
Record the pH. 2. Insert the sample cup into the water activ-
ity chamber.
Measurement of the moisture content and 3. Lock the chamber and read the water
water activity: activity when the number is stable.
Lab Work FlowChart

Add rennin and vinegar
Curdling
Cheese
Heat milk on the hot
plate at 43oC
Measure wet Measure water activity
Measure pH
Dry sample in
the dehydrator
for 24 hours
Measure dry weight
Calculate moisture
content
Lab Work FlowChart 129
Class Notes
130 18 Cheese Making and Characterization
Class Notes
Wine and Pickle Making
and Characterization 19
Abstract Introduction Fermentation is an important step

during food manufacturing history to preserve foods
We will introduce the biological function of and includes homo-fermentation generating lactic
bacteria and fungi during fermentation process acid and hetero-fermentation generating alcohol.
and practice manufacturing wine and pickles Wine and pickles are two widely produced nondairy
using bench top equipment and testing the fermented foods. Wine are normal alcoholic fermen-
quality parameters and microbial qualities. tation of grapes (containing sugar such as sucrose)
with aging. The major difference between white and
red wine is that white wines are fermented without
Objectives Practice benchtop wine and pickle the grape skins. Pickle is a fermentation product of
manufacturing process, and measure quality of fresh cucumbers with immersion into salt solutions
made products including pH, water activity and (5%) for 6–9 weeks. Salt inhibits Gram-negative
acid amount, and microbial qualities. bacteria but supports lactic acid bacteria grow.
Major Experimental Materials Procedure
• Lalvin QA23 white wine yeast. Wine Preparation

• One-liter and 500 ml flasks.
• One-liter white grape juice. Method 1 (Grape Juice)
• A new balloon. 1. Add 500 ml of commercial grape juice into a
• Sucrose. 1-l flask.
• Fresh cabbage. 2. Add 10 g of sucrose and 0.6 g of Lalvin QA23
• 2.5% salt solution wine yeast.
• Fresh empty glass can with lid. 3. Incubate the wine flask at 25 °C for 15 days.
• pH meter, 4. Check the aroma (fruity, sweet, or none) and
• Water activity meter. clarity (clear or turbidity).
• 1% phenolphthalein solution and 0.1 N
sodium hydroxide solution Method 2 (Grape)
• 3 M@ Aerobic Plates Counts and yeast/mold 1. Clean grapes with tap water.
petrifilm and 0.1% buffered peptone water. 2. Completely dry the grapes with paper towel.
https://doi.org/10.1007/978-3-031-26197-8_19
132 19 Wine and Pickle Making and Characterization
Note: Grapes must be completely dried out; inch. The cucumber must always be immersed
otherwise molds will grow. into the salt solution.
4. Incubate the cabbage jar at 25 °C for
3. Use knife to cut grapes. 42 days.
Note: Please do not use hand; otherwise stem Note: The above pickle preparation may end
scar will be taken out, and less yeasts will up with yeast/mold contamination, which will
exist. be used for the work of analyzing yeast/molds
on petrifilm. Please apply 100–200 ppm chlo-
4. Weight 300 g grapes into a clean jar and add rine water to wash cucumber and add 5% vin-
25 g sucrose. egar if needed to avoid fungi contamination.
5. Store the jar at 25 °C for 14 days.
For both wine and pickle, the following
quality items will be tested
Pickle Preparation 1. Test the amount of tartaric acid (%):
1. Clean cucumber with tap water and let it com- Take a 10 ml of the fermented wine or
pletely dry. pickle solutions; mix with 10 ml of dis-
2. Use clean knife to shred cucumber (300 g) tilled water and five drops of 1% phenol-
into fine pieces and add into a clean glass can. phthalein solution. Titrate the amount of
3. Add 500 ml of the 5% salt solution into the 0.1 N sodium hydroxide (NaOH) with
glass can to overcover cucumbers about 0.5–1 first present pick color:
%tartaric acid amount of 0.1N NaOH 0.1 7.5 / weight of samples it is10ml
2. Test volatile acidity (% acetic acid).

%acetic acid amount of 0.1N NaOH 0.1 6.0 / weight of samples it is10ml
3. Test pH: Take a 6 ml of the fermented wine or 5. Take 10 ml of wine solution or 25 grams of
pickle solutions to test pH using pH meter. fermented pickles into 225 ml of 0.1% buff-
4. Test water activity: Take a 6 ml of the fer- ered peptone water; conduct tenfold serial
mented wine or sauerkraut solutions using dilution to test total aerobic plate counts and
digital water activity meter. yeast/mold counts onto 3 M@petrifilm.
(a) Transfer a small amount of sample (to be
able to cover the bottom of the sample Note: It is your assignment to conduct this test,
cup) for water activity measurement. including establishing and drawing dilution
(b) Insert the sample cup into the water activ- procedure.
ity chamber. Check with your instructor before you con-
(c) Lock the chamber and read the water duct the tests.
activity when the number is stable.
Procedure 133
Draw your dilution procedure below
6. Fill the results table below:
Quality items Wine 1 Wine 2 Pickles

% tartaric acid
% acetic acid
pH value
Water activity value
Aerobic plate counts
Yeast/mold counts
Note: We can use ebulliometer (costs ~$800–

2500) to test alcohol amount in the wine
(optional).
Lab Work Flowchart
Wine 1 (Grape Juice)
Wine-1 (grape juice)
Fresh grape juice, wine

yeast, and an
autoclaved jar
Add 500 ml of grape

juice into the jar
Add 0.6 gram wine

yeast into 500 ml
grape juice
Add 10 gram sucrose

into 500 ml grape juice
Incubate at 25oC for 14 days.

Lab Work Flowchart
Wine 2 (Grape)
Wash grape under

running tap water
Cut grape using knife, if

use hand stem-scar can
be broken
Dry grape completely

and add into jar
Weigh 20 gram of sucrose
Incubate at 25oC for 14 days.

Lab Work Flowchart
Pickles
Wash cucumber under

running tap water
Trimming cucumber into

small pieces
Add cucumber pieces

into jar with 500 ml 5%
salt soluon
Saline soluon need to

be up cucumber pieces
0.5-1.0 inch, incubate at
25oC for 42 days
Class Notes
Class Notes
Antimicrobial Resistance
of Commensal Bacteria 20
from Environment
Abstract Introduction Food and agricultural environment

can be an important source of antimicrobial-
We will collect environmental samples and resistant bacteria. Determining the antimicrobial
apply Kirby-Bauer test to evaluate the antimi- susceptibility profiles of foodborne bacteria is
crobial resistance of commensal important to understand the extent of antimicro-
microorganism. bial resistance associated with our food supply.
Disk diffusion test (Kirby-Bauer test) has been
used since the 1940s to determine the antimicro-
Objective Apply disk diffusion test (Kirby- bial susceptibility of bacteria. The principle is
Bauer test) to determine the antimicrobial sus- applying disks containing a wide variety of anti-
ceptibility of commensal bacteria from microbial agents to the surface of Mueller Hinton
environment. Agar plates that have been inoculated with pure
cultures of bacterial isolates. Following incuba-
tion, the plates are examined, and the zones of
Major Experimental Materials inhibition surrounding the disks are measured and
compared with established zone size ranges for
• Tryptic soy agar (TSA) with tetracycline individual antimicrobial agents in order to moni-
(8 μg/ml) and ceftiofur (4 μg/ml). tor bacterial resistance and determine the agent(s)
• Mueller Hinton Agar (MHA). most suitable for use in antimicrobial therapy.
• 0.85% saline and buffered peptone water
• Cotton swabs.
• Culture tubes. Lab Work Procedure
• Stomacher and vortexer.
• Turbidity meter. 1. Each student collects two environmental sam-
• BD BBL Sensi-Disc antimicrobial suscepti- ples such as river water, soil, wildlife animal,
bility test disks. cattle and cow fecal samples, manure, weeds,
• Disk dispenser. grasses, and plant debris in your living area.
• Ruler. 2. One hundred grams of each sample will be
• Incubator. added into 90 ml of buffered peptone water
and stomached for 2 min.
https://doi.org/10.1007/978-3-031-26197-8_20
140 20 Antimicrobial Resistance of Commensal Bacteria from Environment
3. Dilute above sample in a 0.1% buffered pep- Disk Diffusion Test

tone water with 10−1 and 10−3 and spread plated
onto tryptic soy agar (TSA) supplemented with We will test antimicrobial susceptibility of the
tetracycline (8 μg/ml) and ceftiofur (4 μg/ml). following eight antimicrobial agents: ampicillin,
(They will be prepared ahead from lab.) clindamycin, erythromycin, gentamicin, methi-
4. Incubate your plates at 35 °C for 48 h, and cillin, tetracycline, vancomycin, and
manually count colonies. streptomycin:
We will use colonies from the TSA plus tetra-
cycline (8 μg/ml) and ceftiofur (4 μg/ml) agar to 1. Aseptically pick one colony from your TSA
conduct the following lab work: plus tetracycline (8 μg/ml) and ceftiofur
(4 μg/ml) agar.
OD determination and inoculum preparation 2. Transfer the culture to 5 ml of 0.85% saline
(This step can be done ahead of time.): and adjust the OD to the predetermined
value. This corresponds to 1–2 × 108 CFU/
To make 1–2 × 108 CFU/ml of inoculums (i.e., ml of inoculum (i.e., 0.5 McFarland
0.5 McFarland Standard): Standard).
3. Dip a sterile cotton swab into the tube and
1. Add 5 ml of 0.85% saline to each of five cul- rotate it firmly several times against the
ture tubes. Label the tubes with blank, OD upper inside wall of the tube to express
0.05, OD 0.08, OD 0.1, and OD 0.12. excess fluid.
2. Take one colony from TSA plus tetracycline 4. Streak the entire agar surface of MHA three
(8 μg/ml) and ceftiofur (4 μg/ml) with a steril- times, turning the plate 60° between streak-
ized cotton swab, and put into a labeled tube. ing to obtain even inoculation.
Adjust OD value of each tube to 0.05, 0.08, 5. Leave the lid ajar for 3–5 min, but no more
0.1, and 0.12 using a turbidity meter. Label than 15 min, to allow for any surface mois-
each tube with 1 or 10°. ture to be absorbed before applying the anti-
3. Prepare four tubes for serial dilution for each biotic disks.
OD value and label with 10−2, 10−4, 10−5, and 6. Apply the disks using the disk dispenser
10−6. Add 990 μl, 990 μl, 900 μl, and 900 μl of and make sure disks are at least 24 mm
saline to each tube. apart.
4. Vortex tube 10° and transfer 10 μl to tube 10−2. 7. Place the plate’s agar side up in the incubator
Vortex and transfer 10 μl to tube 10−4. and incubate at 35 °C for 16–18 h.
Vortex and transfer 100 μl to tube 10−5. 8. Measure the diameters of the zones of com-
Vortex and transfer 100 μl to tube 10−6. plete inhibition as determined by gross visual
5. Take out 100 μl from the last three dilutions inspection. Measurements are to the nearest
and spread on TSA in duplicate. Incubate whole millimeter.
overnight at 35 °C. 9. Interpret the zone diameter using the break-
6. Choose the 10−5 dilution with 100–200 colo- points (in millimeter) on the zone diameter
nies on plate. This corresponds to interpretive chart provided by BBL
1–2 × 108 CFU/ml in tube 10°. Record the OD Sensi-Disc.
value. This OD will be used for the inoculum 10. Fill the results table:
for disk diffusion.
Kirby-Bauer Test Lab Work Flowchart 141
Code/concentration Diameter of inhibitory zone (mm) Your colony

Antimicrobial agent R I MS S
Ampicillin AM 10–10 mg ≤13 – 14–16 ≥17
Clindamycin CC 2–2 mg ≤14 15–20 – ≥21
Erythromycin E 15–15 mg ≤13 14–22 – ≥23
Gentamicin CN 10–10 mg ≤12 13–14 – ≥15
Methicillin MET 5–5 mg ≤9 10–13 – ≥14
Tetracycline TE 30–30 mg ≤14 15–18 – ≥19
Vancomycin VA 30–10 mg ≤9 10–11 – ≥12
Streptomycin S 10–10 mg ≤14 15–20 – ≥21
Kirby-Bauer Test Lab Work Flowchart
Label the boom of Muller

Hilton Agar
Make bacterial soluon in

0.9% saline to meet 0.5
MacFarland Standard
Spread bacterial soluon onto

the agar surface
Dispense anbioc disks onto

the agar surface
Incubate at 35oC for 24h,

measure the anbioc
inhibitory zone
142 20 Antimicrobial Resistance of Commensal Bacteria from Environment
Class Notes
Kirby-Bauer Test Lab Work Flowchart 143
Class Notes
Introduction of Oral Presentation
and Job Interview Preparation 21
Abstract with 15–20 slides followed with submission of

2–3 pages of summary. All students, teaching
In this chapter, we will do food microbiology assistant, and the instructor will evaluate the
literature review, practice oral presentation presentation.
and mini-thesis writing, and practice mock job
interview.
Major Presentation Topics
Objectives Practice oral presentation with food • Pathogen control during food processing.
science literature review and practice mock job • Function of beneficial bacteria during fer-
interview questions. mented food preparation.
• Antibiotic resistance of pathogens in foods
Introduction By the end of this semester, we all from farm to table.
get hands-on experience of food microbiology • Rapid testing of pathogens in foods.
technique especially on pathogen • Hazard Analysis and Critical Control Points
isolation/identification from various food prod- (HACCP)-, Good Agriculture Practices
ucts and learned basic experience of manufactur- (GAP)-, and Food Safety Modernization Act
ing different fermented foods. Many of us will be (FSMA)-related topics.
interested to look for an internship or a job in real
food science world. Oral communication includ-
ing oral presentation and job interview question/ Presentation Bodies
answer is an important step during job search;
therefore, we will practice these two skills in this • Introduction
chapter to conclude the whole semester. • Objectives
• Material and methods
Practice of Oral Presentation Every student • Results
will do a food microbiology literature search, • Discussion
read and combine 2–4 peer-reviewed publica- • Implication (take-home message).
tions, and give a 15–20-minute oral presentation
https://doi.org/10.1007/978-3-031-26197-8_21
146 21 Introduction of Oral Presentation and Job Interview Preparation
Suggested Peer-Reviewed Journals Presenter/Leader: Evaluation

Rubrics (150 Points)
• Journal of Food Science.
• Journal of Food Protection. Evaluator:______________________________.
• Food Microbiology. Presenter/leader: _______________________.
• International Journal of Food Microbiology.
Criteria Yes No
• Food Control.
Presentation skills
• Applied and Environmental Microbiology.
Was the leader organized and prepared?
• LWT-Food Science and Technology. (does not need to re-read article)
• Meat Science. Was the leader clear and understandable?
• Poultry Science. Was the leader professional (confident,
• Journal of Applied Poultry Research. fluent, good pace, etc.)?
• Journal of Diary Science. Was there good use of communication
aids (clear slides, font size, etc.)?
• Journal of Animal Science.
Total yes = /4
Presentation elements
Did the leader provide pertinent and
uggested Literature Search
S accurate background?
Website Did the leader identify the author’s central
hypothesis and aims?
• Pubmed https://www.ncbi.nlm.nih.gov/ Did the leader explain any uncommon/
unfamiliar methods and statistics?
pubmed/
Did the leader identify the important
• Google Scholar http://scholar.google.com/ finding in the article?
• Science direct http://www.sciencedirect. Did the leader accurately summarize the
com/ conclusions?
• Your university e-library system. Did the leader show non-bias?
Did the leader identify unanswered
questions and future directions?
Total yes= /7
Tips for a Good Oral Presentation Discussion leadership
Was the leader able to answer questions?
• Slides should be full with contents; do not Did the leader involve class participants?
leave lots of space. Did the leader keep the discussion focused
• Not too many words on slides, an appropriate on issues related to the presentation?
combination of words and pictures. Total yes= /3
• Do not read through the words and sentences
on slides and should paraphrase it. Strengths:
• Speak loudly so that audience can hear you
clearly; have eye contacts. Areas for Improvement:
• Clearly explain concepts, terminologies, data
analysis, and results to audience. Outstanding—91–100% (13–14) of items scored,
• Answer questions in detail and be specific to “yes.”
the questions. Very good—81–90% (11–12) of items scored,
• Do not speak over time. “yes.”
• Practice at least three times. Good—71–80% (10) of items scored, “yes.”
Satisfactory—61–70% (9) of items scored, “yes.”
Tips for Job Search 147
Practice of Job Interview • American Meat Science Association

(http://www.meatscience.org).
Three major types of jobs for a food microbiol- • Poultry Science Association (http://www.
ogy major student: poultryscience.org).
• Academic job: post-doctor, faculty, or other • Learn the company and the position respon-
research/teaching/extension positions in a sivity as much as you can.
university. • Tell your potential employer that you are a
• Industry job: R&D scientist, food technolo- hardworking person, and do not tell that you
gist, food microbiologist, and QA/QC know everything.
manager.
• Government job: research microbiologist/ Mock Interview Practice You and your bench
food technologist at USDA-ARS (US partner will be a group; one student is an inter-
Department of Agriculture’s Agricultural viewee, and the other student is a human resource
Research Service), FDA (Food and Drug manager from a food company. Ask the following
Administration), or CDC (Centers for Disease questions, then you two switch your position. Your
Control and Prevention). instructor will give feedback on your answers.
Example: John just got his bachelor’s degree
In this chapter, we will practice a job inter- in food science from West Virginia University
view for an entry-level food microbiology job in has summer internship experience in a food com-
a company. mercial testing company at Pittsburgh; now he is
looking for an entry-level microbiologist job in a
company.
Tips for Job Search
Ten Interview Questions
• Get industry-scale working experience as
much as you can. • Can you briefly introduce yourself?
• Get professional certifications, such as • Why are you interested in this position?
HACCP, GAP, and FSMA training. • Why do you think we should hire you?
• Apply and obtain US Green Card if you are an • Do you have any microbial working
international student. experience?
• Be a student member of food science profes- • What is your weakness?
sional associations, attend annual conferences, • What is your greatest achievement in your life
and involve in networking mixer with food time?
industry personnel: • How can you think you are a good teamwork
• Institute of Food Technologist (https:// member?
www.ift.org). • If there is an accident happening in a BSL-2
• International Association of Food microbial lab, what you should do?
Protection (https://www.foodprotection. • What is the salary you are looking for?
org). • Do you have any questions for us?
Class Notes
Outlines of Topics 149
Food microbiology laboratory syllabus sample Expected Learning Outcomes

FDST449/549, 3:30–4:20 pm Tuesday and Thursday,
50 min/section, two sections/week, one credit,
Agricultural Sciences South 1011
• Understand the principles of microorganism
Instructor Dr. Cangliang Shen; TA: during various food processing and
KaWang Li, and Lacey preservations.
Lemonakis • Understand the isolation, identification, and
Office 2423 agricultural sciences numeration of the most common microorgan-
building
isms found in specific food products.
Telephone 304–293-2691 (office,
please leave message) • Recognize specific types of microbial spoil-
970–222-2975 (cell age during various foods’ shelf life storage.
phone, please leave • Analyze different foods for the presence of
message) hazardous microorganisms using traditional
Email cashen@mail.wvu.edu
and modern food microbiology technology.
Office hours Tuesday and Thursday
4:30–5:00 pm or by
• Describe the situations where improper food
appointment handling and storage may lead to the spoilage
Course hours Tuesday and Thursday or contamination of food.
3:30–4:20 pm • Identify desirable microorganisms and their
Prerequisite FDST 445/545: Food effects in preservation and fermentation.
microbiology lecture
Outlines of Topics
Course Description
Date Laboratory experiment
January 10–12 Chapter 1. Food
This course is designed to give students an under-
Microbiology
standing of the role of microorganisms in food Laboratory Safety and
processing and preservation; relation of microor- Notebook Record
ganisms to food spoilage, foodborne illness and 17–19 Chapter 2. Staining
intoxication, general food processing and quality Technology and
Bright-Field
control, role of microorganisms in health promo- Microscope Use
tion, and federal food processing regulations. The 24–26 Chapter 3.
listed laboratory exercises are aimed to provide a Enumeration of
hands-on opportunity for the student to practice Bacteria in Broth
Suspension by
and observe the principles of food microbiology.
Spread and Pour
Students will familiarize themselves with the Plating.
techniques used to research; regulate, prevent, February 1–2 Chapter 4. Isolation
and control the microorganisms found in food; of Foodborne
and understand the function of beneficial micro- pathogens on
Selective, Differential
organism during food manufacturing process. and Enrichment
Medium by Streak
Plating.
Methods of Instruction 7–9 Chapter 5.
Enumeration of
Aerobic Plate Counts,
Laboratory course. Coliforms, and
Escherichia coli of
Organic Fruit Juice on
Petrifilm.
Date Laboratory experiment Attendance Requirements

14–16 Chapter 6.
Enumeration and **Attendance for this course are required and
Identification of
Staphylococcus will be graded as two points/class time. You must
aureus in Chicken contact me no later than the lecture and labora-
Salads. tory period immediately following the date of
21–23 Chapter 7. your absence in order to determine whether your
Enumeration and
absence will be excused without the loss of two
Identification Listeria
monocytogenes on points. Preferably, I would appreciate hearing
Ready-to-Eat (RTE) from you in advance of the laboratory session
Frankfurters. that you expect to miss
March 1–3 Chapter 8. Isolation Missed labs cannot be made up at a later time.
and Identification of
Salmonella and Thus, it is your responsibility to check with your
Campylobacter spp. laboratory partners for notes/information that
on Broiler Carcasses. you missed.
14–16 Chapter 8. Isolation
and Identification of
Salmonella and
Campylobacter spp. Grading
on Broiler Carcasses.
21–23 Chapter 9. Thermal The total number of points possible from the
Inactivation of course is 200 points and is determined as
Escherichia coli
O157:H7 in
follows:
Non-intact Attendance 50 points, 2 points/lab section/week.
Reconstructed Beef Note: Two lab sections each week, first week two
Patties. lab sections are not calculated for attendance
28–30 Chapter 10.
point
Cultivation of
Anaerobic Bacteria in Laboratory notebook record 50 points.
Canned Food Middle term exam 30 points.
April 4–6 Chapter 11. Final exam 30 points.
Observation and Presentation, mock interview, and mini-thesis 40
Enumeration of
Molds from Spoiled
points.
Bread Total 200 points.
11–12 Flexible (Plant Trip (Please note that there is requirement for atten-
with Dr. J) dance. Also, laboratory notebooks will be col-
18–20 Students’ Presentation lected for evaluation or grading.)
Grading Scale
Required Equipment A: 90–100%, ≥ 180 points.

B: 80–89%, 160–179 points.
Biohazard hood, incubator, microscope, refriger- C: 70–79%, 140–159 points.
ator, bench top meat grounder, griller, stomacher, D: 60–69%, 120–139 points.
and centrifuge. F: less than 60% < 120 points.
Laboratory Safety Rules/Procedures 151
Availability of Lecture Notes you are a person with a disability and anticipate
needing any type of accommodation in order to
Laboratory handouts (PowerPoint and Word text participate in this class, please advise me and
outlines) are available on e-CAMPUS or will be make appropriate arrangements with the Office
delivered by the instructor. of Accessibility Services (293–6700). For more
information on West Virginia University’s
Diversity, Equity, and Inclusion initiatives, please
eneral Education Curriculum
G see http://diversity.wvu.edu.
Statement
This course has been approved for inclusion in Cell Phone Usage
West Virginia University’s General Education
Curriculum (Group C of Objective 2—Basic Cell phones, headsets, and pagers are not to be
Mathematical Skills and Scientific Inquiry or used at any time during laboratory or during
Objective 4—Contemporary Society). A signifi- examinations. If you have any of these devices,
cant part of this class will focus on increasing they must be turned off during class.
your ability to understand issues confronting
society, understand an interdependent world, and
use quantitative and scientific knowledge Academic Integrity Statement
effectively.
The integrity of the classes offered by any aca-
demic institution solidifies the foundation of its
Physical Handicap Statement mission and cannot be sacrificed to expediency,
ignorance, or blatant fraud. Therefore, I enforce
If you are a person with a disability and antici- rigorous standards of academic integrity in all
pate needing any type of accommodation in order aspects and assignments of this course. For the
to participate in this class, please advise me after detailed policy of West Virginia University
the first class meeting and make appropriate regarding the definitions of acts considered to fall
arrangements with Disability Services Contact under academic dishonesty and possible ensuing
information for the Office of Accessibility sanctions, please see the Student Conduct Code
Services: at http://www.arc.wvu.edu/rightsc.html. Should
The Division of Diversity, Equity and you have any questions about possible improper
Inclusion is located on the second floor at 1085 research citations or references, or any other
Van Voorhis Road in the Suncrest Center. activity that may be interpreted as an attempt at
Phone: 304-293-6700 academic dishonesty, please see me before the
Online: http://accessibilityservices.wvu.edu/ assignment is due to discuss the matter.
Email: Access2@mail.wvu.edu
Per university policy, please do not request
accommodations directly from the professor or Laboratory Safety Rules/Procedures
instructor without a letter of accommodation
from the OFSDS. We will cover food microbiology laboratory
safety rules in our first class. Students require to
pass the lab safety quiz. Basically, students
Inclusivity Statement require to wear gloves and wear lab coats and no
any open toe shoes allowed, wear goggles (some
The West Virginia University community is com- sections) during the laboratory course period,
mitted to creating and fostering a positive learn- require handwashing before and after each lab
ing and working environment based on open section, and report any lab accidents immediately
communication, mutual respect, and inclusion. If to the instructor.
Adverse Weather Statement concerns related to the COVID-19 pandemic, it is

possible that this course will move to a fully online
In the event of inclement or threatening weather, delivery format. If that occurs, students will be
everyone should use his or her best judgment advised of technical and/or equipment require-
regarding travel to and from campus. Safety ments, including remote proctoring software.
should be the main concern. If you cannot get to In a face-to-face environment, our commit-
class because of adverse weather conditions, you ment to safety requires students, staff, and
should contact me as soon as possible. Similarly, instructors to observe the social distancing and
if I am unable to reach our class location, I will personal protective equipment (PPE) guidelines
notify you of any cancellation or change as soon set by the University at all times. While in class,
as possible (by X o’clock/X hours before class students will sit in assigned seats when applica-
starts), using eCampus and email to prevent you ble and wear the required PPE. Should a student
from embarking on any unnecessary travel. If forget to bring the required PPE, PPE will be
you cannot get to class because of weather condi- available in the building for students to acquire.
tions, I will make allowances relative to required Students who fail to comply will be dismissed
attendance policies, as well as any scheduled from the classroom for the class period and may
tests, quizzes, or other assessments. be referred to the Office of Student Conduct for
further sanctions.
If a student becomes sick or is required to
COVID-19 Syllabus Statement quarantine during the semester, they should
notify the instructor. The student should work
WVU is committed to maintaining a safe learning with the instructor to develop a plan to receive the
environment for all students, faculty, and staff. necessary course content, activities, and assess-
Should campus operations change because of health ments to complete the course learning outcomes.
Food Microbiology Lecture and Lab Hybrid Couse Syllabus Sample

NFS 4150 Advanced Food Science
3 credits
Winter 2022
Instructor: Dr. Yifan Zhang yifan.zhang@wayne.edu
Office hour: By appointment
Teaching Assistant: Mr. Sumit Paudel sumitpaudel@wayne.edu
Course Format.
Lecture: 2:30–4:10 pm, Monday, synchronous via Zoom (recording available for later viewing).
Lab: Live demonstration combined with recorded videos.
Course Description biological concerns of food, food processing and

preservation, food product development, and sen-
NFS 4150 is a senior-level undergraduate course sory evaluation. The lab sessions provide hands-
that builds on undergraduate coursework in Food on experience on chemical and microbial analysis
Science, Introductory Chemistry, Biology, and and enhance understanding of major issues asso-
Microbiology. The course includes lecture and ciated with the overall food quality and safety.
lab. The lecture covers major principles in food Students will also complete a lab report to fulfill
science, such as chemical ingredients and micro- their Writing Intensive (WI) requirement.
Reference Books 153
Course Objectives Week Date Topic

1 Lecture 1/10 Introduction, general food
1. To understand the more advanced food sci- science
Lab 1/10, Lab rules, team-up, and
ence concepts, principles of food processing
1/11 orientation
and food preservation, major chemical and 2 1/17, Holiday, no class and lab
microbiological concerns of food and preser- 1/18
vation strategies to improve food safety, and 3 Lecture 1/24 Food analysis
the scientific methods and the importance of (carbohydrate, fat, protein)
sensory science in food product development Lab 1/24, Maillard browning reaction
1/25 and quantitation
(LO 2.9, 3.2).
4 Lecture 1/31 Food analysis and food
2. To understand the current and advanced tech- preservation and
nology in food science research (LO 3.2). fermentation
3. To develop experimental skills needed to per- Lab 1/31, Cheese making and analysis
form procedures used for analysis of food 2/01 (pH, aW, and protein)
ingredients and identification and character- 5 Lecture 2/07 Food deterioration and food
processing
ization of foodborne microorganisms of sig- Lab 2/07, Wine making and lipid
nificant public health concern (LO1.1, 1.5). 2/08 analysis
4. To demonstrate adequate background knowl- 6 Lecture 2/14 Major foodborne bacteria
edge about food science and product develop- Lab 2/14, Bacteria isolation, serial
ment as well as capabilities to apply the 2/15 dilution, and plate count
first lab notes due on 2/15
knowledge and techniques learned in the
7 Lecture 2/21 Microbial isolation and
course to solve the real-world problems. identification (1)
5. To develop writing skills based on the satis- Lab 2/21, Wine analysis:
factory completion of a laboratory report. 2/22 Measurement of total
soluble solid content, pH,
and carbohydrate
Course Prerequisites: NFS 2130, BIO 2200,
8 Lecture 2/28 Exam 1
CHM2200, or equivalent.
Lab 2/28, Wine making report due
3/01
9 Lecture 3/07 Microbial isolation and
Reference Books identification (2)
Lab 3/07, DNA isolation and gene
3/08 identification by PCR
Food Analysis. S. Suzanne Nielsen. 5th ed. 2017,
10 3/14, Spring break, no class and
Springer International Publishing, Cham, 3/15 lab
Switzerland. 11 Lecture 3/21 Food quality assurance,
Food Microbiology: An Introduction. Thomas FSMA, and HACCP
J. Montville, Karl R. Matthews, and Kalmia Lab 3/21, Total plate counts and
E. Kniel. 4th ed. 2017, ASM (American 3/22 coliform counts in surface
water
Society for Microbiology) Press, Washington
12 Lecture 3/28 Product development and
DC. food packaging
Food Microbiology Laboratory for the Food Lab 3/28, Product development,
Science Student. Cangliang Shen and Yifan 3/29 second lab notes due on
Zhang. 1st ed. 2017, Springer International 3/29
Publishing, Cham, Switzerland. 13 Lecture 4/04 Sensory evaluation
Lab 4/04, Product development
4/05
Tentative Schedule (Lab activities are subject 14 Lecture 4/11 Group presentation (1)
to change depending on the progress of individ- 15 Lecture 4/18 Group presentation (2)
ual labs and the pandemic situation). 16 Lecture 4/25 Exam 2
Course Evaluation
Content Points Important Dates

Exam 1 50 1st lab notes due 2/15
Exam 2 100 Exam 1 2/28
Pop quizzes (5 pts each) 20 Wine report due 3/01
Lab notes (20 pts each) 40 2nd lab notes due 3/29
Wine making report 30
Group presentation 4/11, 4/18
Group presentation 40
Peer evaluation due 4/20
Lab participation 20
Exam 2 4/25
Total 300
1. Exams (150 points). Your wine making report will undergo two
The exam format will be short-answer reviews:
questions covering both lecture and lab mate- 1) Technical review (30 points): The report
rials. Exam 2 is cumulative. Both exams will should be 2–3 pages, single-spaced, and typed
require Respondus Lockdown Browser (On in Times New Roman or Arial, with a font size
the left panel of your Canvas page, click of 12. Tables and/or graphs are encouraged to
Help - Students: Links & Downloads). Exams be included in your report but should be no
are closed book and closed notes. more than two. Your report should contain the
2. Pop quiz (20 points). following:
Four pop quizzes (five points each) will be –– Introduction
given throughout the semester. Quiz –– Purpose of the experiment.
announcement will be made during the lec- –– Methodology and procedures.
ture. Students should log on to Canvas using –– Findings/observations.
the Respondus Lockdown Browser and sub- –– Conclusions
mit answers by the next day (Tuesday) at 2) Writing intensive (WI) requirement (satis-
5 pm. No make-ups are available. factory/incomplete). The emphasis of the WI
3. Lab notes (40 points). part of the course is on students’ writing abil-
Students should record all data and obser- ity or writing mechanics (i.e., spelling, gram-
vations from every lab. Your notes are graded mar, sentence construction, etc.). To receive
two times (20 points each) throughout the an S (satisfactory) grade for WI, student either
semester based on the completeness of the submits a report that is completely satisfac-
experiment. Since each submission includes tory in the first submission or addresses all
multiple labs, students should make sure the review comments in revised submissions. The
notes are numbered and organized accord- grade for WI will not affect your overall score
ingly. Your notes for each lab should contain of the class; however, your final grade for the
details on the following: entire class will appear Incomplete until you
–– The date. pass the WI review with an S grade.
–– Purpose of the experiment. (a) The course instructor will review and
–– Materials make corrections to your paper. If the
–– Procedures (protocols). instructor determines that significant mis-
–– Results takes in writing mechanics are made, the
–– Troubleshooting, if applied. report/paper will be returned uncorrected,
–– Conclusions and a resubmission will be due within
4. Wine making report (30 points + S on WI). 1 week of return.
Course Evaluation 155
(b) Make any corrections and submit the • Serving size (e.g., single or multi-serve).
revision along with marked-up copy of • Shelf-life.
original. Corrections are due within
1 week of submission. You will be noti- –– Final remarks.
fied by email or in class within one week –– Score Distribution:
if corrections are satisfactory. –– Presentation (20 points) (A presentation rubric
(c) If writing skills are deemed unsatisfac- can be found on Canvas.)
tory, this process will be repeated on more –– Q/A handling (five points).
laboratory reports. Otherwise, you will –– Attendance of all group members in the pre-
have successfully completed the “Writing sentation (five points).
Intensive” portion of the course. –– Format of slides (organization, font consis-
(d) Plagiarism will have serious tency, spelling, etc.) (five points).
consequences. –– Tips: Avoid wordy slides; use bullets; and use
5. Group project (virtual product development, flowchart.
40 points). –– Submission of final PowerPoint slides within
Students will work remotely in groups 2 hours after presentation (five points).
formed in the lab to develop a novel product 6. Lab performance (20 points).
concept. The novel features can be related to Peer evaluation will be conducted at the end of
enhanced health benefit, improved conve- the semester for students to comment on the per-
nience, reduced calories, targeting a specific formance of group members. Evaluation is due on
population, etc. Once you decide on the April 20, 2022. If a student receives negative com-
topic, please let your TA know as soon as ment from half or more of the team members, a
possible to avoid duplication. Each group five-point deduction will be applied. Evaluation is
will do a 20-min PowerPoint presentation, based on the below aspects for different lab
followed by Q/A. A copy of the slides should formats:
be submitted within 2 hours after the presen- Remote labs (group project):
tation. Your presentation should include the –– Participation and effort in group discussion.
following: –– Response to requests from teammates regard-
–– Name of your product. ing group project.
–– Names of all group members. –– Contribution to the PowerPoint slides.
–– Need or motivation. –– Attendance to the group presentation.
–– Target market/population. In-person labs:
–– Novelty of the product. –– Participation and effort in experiments and
–– Description of the product including the group project.
following: –– Ability to use lab instrument.
• Ingredients and processing procedure. –– Preparedness for the lab.
• Package type (e.g., can, glass bottle, pouch –– Post-lab cleanup and housekeeping.
in box). –– Willingness to share experimental details on
in-person labs.
Grading Scales
Grades Percentages Scores Grades Percentages Scores
A 93–100% 279–300 C 73–76.9% 219–230.5
A− 90–92.9% 270–278.5 C- 70–72.9% 210–218.5
B+ 87–89.9% 261–269.5 D+ 67–69.9% 201–209.5
B 83–86.9% 249–260.5 D 63–66.9% 189–200.5
B- 80–82.9% 240–248.5 D- 60–62.9% 180–188.5
C+ 77–79.9% 231–239.5 F <59.9% < 180
Course Drops and Withdrawals materials, information, or assistance in any

academic exercise. This includes copying
In the first 2 weeks of the (full) term, students can from another student’s test paper, allowing
drop this class and receive 100% tuition and another student to copy from your test, using
course fee cancellation. After the end of the sec- unauthorized material during an exam, and
ond week, there is no tuition or fee cancellation. submitting a term paper for a current class that
Students who wish to withdraw from the class has been submitted in a past class without
can initiate a withdrawal request on Academica. appropriate permission.
You will receive a transcript notation of WP • Fabrication: Intentional or unauthorized falsi-
(passing), WF (failing), or WN (no graded work) fication or invention of any information or
at the time of withdrawal. No withdrawals can be citation, such as knowingly attributing cita-
initiated after the end of the tenth week. Students tions to the wrong source or listing a fake ref-
enrolled in the tenth week and beyond will erence in the paper or bibliography.
receive a grade. Because withdrawing from • Others: Selling, buying, or stealing all or part
courses may have negative academic and finan- of a test or term paper, unauthorized use of
cial consequences, students considering course resources, enlisting in the assistance of a sub-
withdrawal should make sure they fully under- stitute when taking exams, destroying anoth-
stand all the consequences before taking this er’s work, threatening or exploiting students
step. More information on this can be found at or instructors, or any other violation of course
https://reg.wayne.edu/students/information# rules as contained in the course syllabus or
dropping other written information.
Such activity may result in failure of a specific

cademic Dishonesty: Plagiarism
A assignment, an entire course, or, if flagrant, dis-
and Cheating missal from Wayne State University (https://
doso.wayne.edu/conduct/academic-misconduct).
Academic misconduct is any activity that tends to
compromise the academic integrity of the institu-
tion or undermine the education process. Student Disabilities Services
Examples of academic misconduct include the
following: If you have a documented disability that requires
accommodations, you will need to register with
• Plagiarism: To take and use another’s words or Student Disability Services for coordination of
ideas as your own without appropriate refer- your academic accommodations. The Student
encing or citation. Disability Services (SDS) office is located at
• Cheating: Intentionally using or attempting to 1600 David Adamany Undergraduate Library in
use or intentionally providing unauthorized the Student Academic Success Services depart-
Student Disabilities Services 157
ment. The SDS telephone number is 313–577- content in select courses and in strengthening
1851 or 313–202-4216 for videophone use. Once study skills. Visit www.success.wayne.edu for
you have your accommodations in place, I will be schedules and information on study skills
glad to meet with you privately during my office workshops, tutoring, and supplemental instruc-
hours to discuss your special needs. Student tion (primarily in 1000 and 2000 level courses).
Disability Services’ mission is to assist the uni- • The Writing Research and Technology
versity in creating an accessible community Zone is located on the second floor of the
where students with disabilities have an equal Undergraduate Library and provides individ-
opportunity to fully participate in their educa- ual tutoring consultations free of charge. Visit
tional experience at Wayne State University. You http://clasweb.clas.wayne.edu/writing to
can learn more about the disability office at www. obtain information on tutors, appointments,
studentdisability.wayne.edu. and the type of help they can provide.
To register with Student Disability Services,
complete the online registration form at https:// Library Research Assistance Working on a
wayne-a ccommodate.symplicity.com/public_ research assignment, paper, or project? Trying to
accommodation/. figure out how to collect, organize, and cite your
sources? Wayne State librarians provide on-
Student Services campus or online personalized help. Contact
• The Academic Success Center (1600 them at: https://library.wayne.edu/forms/consul-
Undergraduate Library) assists students with tation_request.php.
Index
A DNA, 10, 109–113, 115, 116, 121, 122, 153

Acid amount, 131 DNA extraction, 109–111, 116, 121, 122
Aerobic place counts (APCs), 31–33 DPD method, 81, 89
Anaerobic bacteria, 97–100, 150
Anaerobic jar, 97, 98
Antimicrobial activity, v, 81–85 E
Antimicrobial resistant, 139–140 E. coli O157:H7, v, 1, 25, 63–68, 71–78, 81, 150
API 20E test, 53–56 Endospore staining, 9, 12, 15, 98, 99
Apples, 81, 82 Enrich, 25–28, 54, 121, 122, 149
Aspergillus, 103 Enterococcus, 115, 116
Enterotube II test, 63, 65–67
Escherichia coli (E.coli), 1, 9, 19, 25, 27, 31–35, 63–68,
B 71–75, 78, 81, 149, 150
Bacillus cereus, 9 Extraction, 109–111, 116, 121, 122
Beef steaks, 64, 71, 72, 78
Blood agar, 25–27, 45, 46, 49, 97, 98
Boiling method, 109 F
Bolton broth, 53, 54 Fermentation, 25, 27, 31, 65, 66, 127, 131, 149, 153
Bright-field microscope, 9–15 Frankfurters, 45, 46
Broilers, 53, 54 Free chlorine concentration, 82, 85–86, 90
C G
Campylobacter, 53–60, 150 Gas generator, 53, 97
Canned food, 97–99, 150 Gel electrophoresis, 122
Catalase test, 39, 45 Gram-staining, 39, 45, 53, 55, 60, 98
Cheese, 127–128, 153
Chicken salads, 39–42, 150
Clostridium perfringens, 97, 98 H
Coagulase test, 39 HardyCHROM, 26
Coliform, 31–35, 54, 149, 153 HardyCHROM agar, 27
Color, 9, 11, 25, 26, 40, 46, 56–57, 66, 71, 75, 77–78, 82,
90, 98, 132
Cooked meat medium, 97, 98 I
Cross contamination, 81, 89 Identification, 54, 65–67, 97, 115–117, 121–122, 145,
149, 153
D
Deli meat, 121–122 J
Differentiate, 9, 25, 26 Job interview, 145, 147
Dilution technique, 19, 20 Juice, 31–35, 131, 134, 149
© The Editor(s) (if applicable) and The Author(s), under exclusive license to 159
Springer Nature Switzerland AG 2023
https://doi.org/10.1007/978-3-031-26197-8
160 Index
K Pour-plating, 149
Kirby-Bauer test, 139 Purity determination, v, 109–111
L R
Lab safety training, 1–6, 149, 151 Rappaport-Vassiliadis (RV), 53, 54
Lacto-phenol cotton blue, 103 Record, 1–6, 10, 21, 40, 46, 55, 64, 72, 98, 111, 127,
Latex agglutination test, 39, 40, 42, 54, 55, 60, 73 128, 140, 149, 150, 154
Listeria monocytogenes (L. monocytogenes), 9, 26, Rennin, 127, 128
45–49, 81, 82, 121, 150 Rhizopus, 103
Literature review, 78, 86, 94, 117, 145
12 L test, 46, 49
S
Salmonella, 1, 9, 25–27, 53–60, 81, 82, 89,
M 90, 150
MacConkey agar, 27, 63–65, 72 Selective, 25–27, 54, 68, 149
Mannitol salt agar (MSA), 27, 39, 40 Single colony, 26
Mechanically tenderization, 71, 72 Spoiled food, 103–106
Microbial quality, 131 Spread plating, 19, 21, 40, 42, 46, 49, 64, 83, 104
Modified Campy-Cefex agar, 54, 59 Staphylococcus aureus, 9, 25, 27, 39–42, 150
Modified Oxford agar (MOX), 25, 27, 45, 46, 81, 83 Streak-plating, 25–27
Molds, 103–107, 132, 133, 150
Most probable number (MPN), 89, 90, 92–94
MUG, 63, 65, 71 T
Multiplex PCR, 115–116 Tetrathionate Broth (TT), 53, 54
Thermal inactivation, 68, 71, 78
Thermocouple, 63, 64, 71, 72
N Thioglycollate fluid agar, 98
Non intact beef, 63, 64, 71, 78 Tomatoes, 81, 89, 90
Notebook, 1–6, 10, 33, 40, 46, 64, 67, 72, 75, 149, 150 Tryptose sulfite cycloserine agar, 97, 98
O W
Oral presentation, 145 Wash water, v, 89–93
Water activity, 97, 127, 128, 131–133
Wine, 131–135, 153–155
P Wine yeast, 131
Penicillium, 103
Petrifilm, 31–35, 103, 104, 131, 132, 149
pH, 25–27, 54, 81, 82, 90, 97, 98, 127, 128, 131–133 X
Pickles, 131–133, 136 XLT-4, 26, 53–55, 83
Polymerase chain reaction (PCR), 115–117, 121–123, 153 XLT-4 agar, 25–27, 54, 81

Food Microbiology Laboratory For The Food Science Student: Cangliang Shen Yifan Zhang

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Food Microbiology Laboratory For The Food Science Student: Cangliang Shen Yifan Zhang

Uploaded by

Copyright:

Available Formats

Cangliang Shen

ISBN 978-3-031-26196-1 ISBN 978-3-031-26197-8 (eBook)

Division of Animal and Nutritional Sciences Cangliang Shen

In order to help food science students to understand the relationship between

Division of Animal and Nutritional Sciences Cangliang Shen

I appreciate my division director Dr. Robert Taylor who assigned me to

Division of Animal and Nutritional Sciences Cangliang Shen

1 Food Microbiology Laboratory Safety

Review Question������������������������������������������������������������������������������ 40

Results Picture from Previous Lab Sections������������������������������������ 76

PCR Lab Work Flowchart���������������������������������������������������������������� 117

Inclusivity Statement����������������������������������������������������������������������� 151

Cangliang Shen is an Associate Professor/

Yifan Zhang is a Professor in the Department

Researcher at The Ohio State University. Dr.

Abstract BSL-3: Microbial agents may cause serious or

We only use BSL-1 and BSL-2 microbial

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 1

1. The title. Each section must be labeled.

Examples of Good Notebook Records (from Ms. Payton Southall)

Examples of Good Notebook Records (from Ms. Payton Southall)

Examples of Good Notebook Records (from Ms. Jessica Clegg)

Examples of Good Notebook Records (from Ms. Jessica Clegg)

Abstract Introduction of Gram Stain Gram stain was

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 9

Bright-Field Microscope Use

Brief Procedure 8. Adjust fine focus (small and thin wheel) to

1. Fig 1. Clean slides and label

2. Fig 2. Smear preparation, air-drying, and heat fixing

3. Fig 3. Flooding with dye (only for endospore staining)

Gram Staining Lab Work Flowchart

Endospore Staining Lab Work Flowchart

Abstract Introduction Most bacteria grow in support

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 19

9.0ml 9.0ml 9.0ml 9.0ml 9.0ml

0.1 ml 0.1 ml 0.1 ml

9.9ml 9.9ml 9.9ml

Dilution factor of tubes “0” 10-2 10-4 10-6

Numeration If colonies are 30–300, count and record it; the

Pour Plating and Spread Plating Lab Work Flowchart

Label at the bottom of

Mixing the bacterial

Mixing the bacterial

Incubate at 35°C for 24 h

Abstract Differential Medium It contains one or more

Objective Practice streak-plating of foodborne Introduction of Medium

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 25

Culture flame loop flame loop flame loop

Quadrant 1 Quadrant 2 Quadrant 3 Quadrant 4

Question for Review

LI EC 3.__________Phenol red is utilized in

Part of results figure (from previous lab students)

Escherichia coli on MacConkey agar: pick

Staphylococcus aureus on Mannitol Salt agar:

Salmonella spp. on XLT-4 agar: red colony with

Salmonella spp. on Hardy@Chrom agar: deep

Abstract survival characteristics are similar to those

• Organic fruit juice. Petrifilm Plates Created by the Food Safety

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 31

APCs and total

APCs and total

Coliform: red colony

E.coli: blue colony with gas

Division of Animal and Nutritional Sciences Cangliang Shen

1 Food Microbiology Laboratory Safety

Review Question�� 40

Results Picture from Previous Lab Sections�� 76

PCR Lab Work Flowchart�� 117

Inclusivity Statement�� 151

Bright-Field Microscope Use

Numeration If colonies are 30–300, count and record it; the

Objective Practice streak-plating of foodborne Introduction of Medium

Question for Review

10 or 100 fold diluon

Lab Work Flowchart

Part of Result Figures (Work from Previous Students)

Posive (clumping) Negave

Lab Work Procedure 3. Decolor by adding 1–2 drops of 95% alcohol

Review Questions 2. There is a Listeria monocytogenes outbreak

Lab Work Flochart

10 or 100-fold diluon and spread

Part of Result Figures (Work from Previous Students)

ajor Medium Used for Salmonella

Figure of API-20 E Results Sheet

Review Question Test name Positive Negative

Positive Salmonella spp. Result

Lab Work Flowchart (Salmonella)

Lab Work Flowchart (Campylobacter)

Part of Results Figures (Work from Previous Students)

Please draw your dilution procedure below: Identification of E. coli O157:H7

Procedure If positive, circle number 2 under ornithine on

USDA-Integrated-Predictive- 3. Reparametrized Gompertz survival model.

Brief Procedures References (After Class Reading)