Super 20 Biology Sample Paper

D:\Full Marks\Super-20_Biology-12_(Term-2)\Open_Files\0.
Prelims
\ 07-Feb-2022 Bharat Arora Proof-4 Reader’s Sign _______________________ Date __________
TERM - 2
12
2022
BIOLOGY
SAMPLE PAPERS
(Strictly Based on the Sample Paper issued by CBSE)
Full Marks Pvt Ltd

(Progressive Educational Publishers)
New Delhi-110002
D:\Full Marks\Super-20_Biology-12_(Term-2)\Open_Files\0.Prelims
Published by:
9, Daryaganj, New Delhi-110002

Phone: 011- 40556600 (100 Lines)
Website: www.fullmarks.org
E-mail: info@fmpl.in
© Publishers
All rights reserved. No part of this publication may be reproduced or transmitted, in any form or by any means, without permission. Any person
who does any unauthorised act in relation to this publication may be liable to criminal prosecution and civil claims for damages.
Branches:
• Chennai • Guwahati
Marketing Offices:
• Ahmedabad • Bengaluru • Bhopal • Dehradun • Hyderabad • Jaipur • Jalandhar • Kochi • Kolkata • Lucknow
• Mumbai • Patna • Ranchi
NEW EDITION
“This book is meant for educational and learning purposes. The author of the book has taken all reasonable care to ensure that the contents of the
book do not violate any existing copyright or other intellectual property rights of any person in any manner whatsoever. In the event the author has
been unable to track any source and if any copyright has been inadvertently infringed, please notify the publisher in writing for corrective action.”
Note from the Publishers
Biology-XII (Term-2) based on the latest Sample Question Paper issued

by CBSE on 14th January 2022 for 2022 (Term-2) Board Examination.
Each Practice Paper is developed by highly experienced subject experts as per the
level and the pattern followed by the CBSE. These Practice Papers will familiarise
the students with the questioning pattern.
This book contains 11 Practice Papers (3 Solved, 7 Unsolved and 1 issued by CBSE
with Marking Scheme). Undoubtedly, students will get some parameter to evaluate
their preparation for better performance.
Features of Sample Papers
• Designed exclusively to test the knowledge and preparation level of students.
• Latest CBSE Sample Question Paper have been given with Marking Scheme.
• Each Practice Paper covers the weightage of each unit/chapter as per the latest
syllabus issued by CBSE.
Any suggestions for further improvement of this book will be thankfully received
and incorporated in the next edition.
(iii)
CONTENTS
SOLVED SAMPLE PAPERS
1. Practice Paper–1......................................................................................................................................................... 7
2. Practice Paper–2....................................................................................................................................................... 12
3. Practice Paper–3....................................................................................................................................................... 17
UNSOLVED SAMPLE PAPERS

4. Practice Paper–4....................................................................................................................................................... 23
5. Practice Paper–5....................................................................................................................................................... 26
6. Practice Paper–6....................................................................................................................................................... 28
7. Practice Paper–7....................................................................................................................................................... 31
8. Practice Paper–8....................................................................................................................................................... 34
9. Practice Paper–9....................................................................................................................................................... 36
10. Practice Paper–10..................................................................................................................................................... 39
11. Practice Paper – 11 [CBSE Sample Paper 2021-22 (Term-2) with Marking Scheme] �� 42
(iv)
BIO
LOG
BIOLOGY
Y
Practice Papers
3 3 Solved Practice Papers
3 7 Unsolved Practice Papers
3 CBSE Sample Question Paper 2021-22 (Term-2) with Marking Scheme

BIOLOGY
WEIGHTAGE
CLASS-XII (TERM-2)
Units Term-II Marks
VIII Biology and Human Welfare: Chapter – 8 and 10 14
IX Biotechnology and its Applications: Chapter – 11 and 12 11
X Ecology and Environment: Chapter – 13 and 15 10
Practicals Term – II 15
Total 50
JEE NEET ADDA
This Pdf Is
Download From
www.jeeneetadda.in
Visit www.jeeneetadda.in for

More Premium Stuffs,Latest
Books,Test Papers,Lectures etc.
jeeneetadda
jeeneetadda_official
jeeneetadda
VISIT NOW !!
D:\Full Marks\Super-20_Biology-12_(Term-2)\Open_Files\Super-20_Biology-12
Time Allowed: 2 Hours

Practice Paper– 1 Maximum Marks: 35
General Instructions:
(i) All questions are compulsory.
(ii) The question paper has three sections and 13 questions. All questions are compulsory.
(iii) Section–A has 6 questions of 2 marks each; Section–B has 6 questions of 3 marks each; and Section–C has
a case-based question of 5 marks.
(iv) There is no overall choice. However, internal choices have been provided in some questions. A student has
to attempt only one of the alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.
SECTION-A
1. (i) Given below are pairs of diseases and causative organisms. Which out of these is not a matching pair?
Filariasis : Wuchereria, Ringworm : Ascaris, AIDS : Human immuno virus, Malaria : Plasmodium.
(ii) Highlight the role of thymus as a lymphoid organ. Name the cells that are released from the above mentioned
gland. Mention how they help in immunity. 2
Ans. (i) Ringworm : Ascaris.
(ii) Thymus T–lymphocytes mature in thymus, and responsible for both cellular and humoral immune response
2. In which way have microbes played a major role in controlling diseases caused by harmful bacteria? Name any
one such substance and its source organism. 2
OR
Explain the significant role of the genus Nucleopolyhedrovirus in an ecological sensitive area.
Ans. Some microbes produce chemicals – Antibiotics – that prevent multiplication of bacterial population allowing
hosts to fight against infection, which is done by stopping the mechanism responsible for building cell wall. For
example, Penicillium notatum produces penicillin.
OR
Baculoviruses are pathogens that attack insects and other arthropods.
• The majority of baculoviruses used as biological control agents are in the genus Nucleopolyhedrovirus.
• These viruses are excellent candidates for species-specific, narrow spectrum insecticidal applications.
• They have been shown to have no negative impacts on plants, mammals, birds, and fish or even on non-target
insects.
• This is especially desirable when beneficial insects are being conserved to aid in an overall integrated pest
management (IPM) programme, or when an ecologically sensitive area is being treated.
3. What is the role of Recombinant DNA technology for preparing vaccines. 2
Ans. Recombinant DNA technology has allowed the production of antigenic polypeptides of pathogen in bacteria
or yeast. Vaccines produced using this approach allow large scale production and hence greater availability for
immunisation, e.g., hepatitis B vaccine produced from yeast.
4. Name the blank spaces a, b, c, and d in the table given below: 2
Type of microbe Name Commercial Product
Fungus a Penicillin
Bacterium Acetobacter aceti b
c Clostridium butylicum d
Yeast e citric acid
Ans. a-Penicillium notatum, b-vinegar [acetic acid], c-bacterium, d-butyric acid, e-Aspergillus nige
7
5. How many biosphere reserves, national parks and wildlife sanctuaries do we have in India? Which approach do
they cover for conservation of biodiversity? 2
Ans. In India, ecologically unique and biodiversity-rich regions are legally protected as biosphere reserves, national
parks and sanctuaries. India now has 14 biosphere reserves, 90 national parks and 448 wildlife sanctuaries.
6. (i) If 8 individuals in a laboratory population of 80 fruitflies died in a week, then what would be the death rate
for population for the said period?
(ii) In a pond, there were 200 frogs. 40 more were born in a year. Calculate the birth rate of the population. 2
OR
What is age pyramid? List any two informations given by them. Draw an age pyramid of an expanding population.
Number of individuals died
Ans. Death rate =
Total number of individuals
8 40

The birth rate of frog population = = 0.1 individuals/week = = 0.2 per frog/year
80 200
OR
(i) Death rate will be 0.1 individuals/week.
(ii) 200 per thousand/year.
Age pyramid–When the age distribution (per cent individuals of a given age or age group) is plotted for the
population, this is called age pyramid.
Information given-
• Population at any given time is composed of individuals of different ages. Post-reproductive
• For human population, the age pyramids generally show age distribution
of males and females in a combined diagram. Reproductive
• The shape of the pyramids reflects the growth status of the population Pre-reproductive
that whether it is expanding (triangular shaped), stable (bell-shaped) or Expanding
declining. [any two]
SECTION-B
7. (i) Name and explain giving reasons, the type of immunity provided to the newborn by the colostrum and
vaccinations.
(ii) Name the type of antibody
(a) Present in colostrum
(b) Produced in response to allergens in human body. 3
OR
Identify A, B and C in the schematic diagram of an antibody given above and answer the questions.
(i) Write the chemical nature of an antibody.
8 n Biology– XII
(ii) Name the cells that produce antibodies in humans.

(iii) Mention the type of immune response provided by an antibody.
Ans. (i) Colostrums provides passive immunity, direct antibodies are transferred from mother to new born via
colostrums and vaccines are in the form of living or dead microbes or their proteins which when introduced
in body activates active immune system of the body. Body starts producing antibodies and protecting from
further infections.
(ii) (a) IgA; (b) IgE
OR
A – Antigen binding site, B – Light chain, C – Heavy chain,
(i) Antibodies are proteinaceous in nature.
(ii) B-lymphocytes
(iii) Humoral immune response
8. Drug addicts are vulnerable to getting infected by a deadly virus. Name the virus and explain the mechanism that
may result into infection. 3
Ans. Human Immuno Deficiency virus as the drug addicts share the needles to inject the drugs very often.
The HIV virus attacks the macrophages cells in human body. (i) RNA is replicated to form viral DNA by the
enzyme reverse transcriptase. (ii) Viral DNA now gets incorporated into the host cell’s DNA and directs the infected
cells to produce viruses. (iii) Macrophages continue to produce virus particles and function as HIV factories. (iv)
The virus particles enter helper T-lymphocytes in the blood, where they continue to replicate and produce viral
progenies. (v)The number of helper T-lymphocytes progressively decreases in the body of the infected person.
(vi) With the decrease in number of T-cells, the immunity also decreases. The person is unable to produce any
immune response even against common bacteria like Mycobacterium, parasites like Toxoplasma, viruses and
fungi.
9. What happens when Meloidegyne incognita consumes cells with RNAi gene? Explain. 3
Ans. Several nematodes parasitize a wide variety of plants and animals including human beings.
A nematode Meloidegyne incognitia infects the roots of tobacco plants and causes a great reduction in yield. A
novel strategy was adopted to prevent this infestation which was based on the process of RNA interference (RNAi).
RNAi takes place in all eukaryotic organisms as a method of cellular defense. This method involves silencing of
a specific mRNA due to a complementary dsRNA molecule that binds to and prevents translation of the mRNA
(silencing). The source of this complementary RNA could be from an infection by viruses having RNA genomes
or mobile genetic elements (transposons) that replicate via an RNA intermediate.
10. (i) Write the importance of measuring the size of a population in a habitat or an ecosystem.
(ii) Explain with the help of an example, how the percentage cover is a more meaningful measure of population
size than mere numbers? 3
Ans. (i) Measurement of population in a habitat determines the relative abundance of a particular species and its effect
on the available resources of that particular habitat.
(ii) The percentage cover is more meaningful measure of population size than mere numbers because the relative
abundance of a species is not only determined by number of individuals but by both the relative abundance
in biomass and number.
For example, in a unit area the number of grass species or relative abundance in number is high but not the
relative biomass, if the same area has one or two Ficus bengalensis tree, it is very low in relative abundance
but high in relative abundance of biomass.
11. For many decades, ecologists believed that communities with more species, generally, tend to be more stable than
those with less species. What exactly is stability for a biological community? 3
What is the importance of species diversity for human beings?
Ans. A stable community should not show too much variation in productivity from year to year; it must be either resistant
or resilient to occasional disturbances (natural or man-made), and it must also be resistant to invasions by alien
Practice Paper–1 n 9
species. David Tilman’s long-term ecosystem experiments using outdoor plots found that plots with more species
showed less year-to-year variation in total biomass. He also showed that in his experiments, increased diversity
contributed to higher productivity. Rich biodiversity is not only essential for ecosystem health but imperative for
the very survival of the human race on this planet.
12. What are the differences in lab cultures and the continuous cultures? What is a recombinant protein? 3
Ans. The cells harbouring cloned genes of interest may be grown on a small scale in the laboratory. The cultures may
be used for extracting the desired protein and then purifying it by using different separation techniques. In lab
cultures can’t be done at large scale or for long period of time as culture medium gets contaminated by wastes
produced by cells being cultured.
In a continuous culture system wherein the used medium is drained out from one side while fresh medium is added
from the other to maintain the cells in their physiologically most active log/exponential phase. Such procedures
are generally followed at commercial or industrial level.
If any protein encoding gene is expressed in a heterologous host, is called a recombinant protein.
SECTION-C
13. The ability to manipulate the most basic genetic information, DNA, has resulted in an exponential increase in the
number of tech companies using recombinant DNA. Biotechnology is used in four major industries, healthcare,
agriculture and crop production, non-food (industrial) application of crops and other products (for example,
vegetable oil, biodegradable plastics, biofuels) and environmental uses. Many pharmaceuticals are already made
using synthetic enzymes and microorganisms; these are products which contain substances such as insulin,
interferon or activating plasmids and which were very complicated or very expensive to manufacture in the past.
The first applications of enzymes in the biotechnology industry were manufacturing sweeteners (such as obtaining
fructose syrup from wheat) and the use of lipases and proteases in detergents for removing difficult stains.
(i) Explain five areas where biotechnology has influenced human lives. 2
(ii) Name two enzymes that are used in household products in our daily life. 1
(iii) Name a life saving drug that had been extracted from animals earlier but later was manufactured at mass scale
by inserting its genes in E.coli, pioneered by Eli Lilly. Discuss how it was successfully done by his company.
2
OR
Herbert Boyer performed studies on a couple of enzymes of the E. coli bacterium
that have the capability of cutting DNA strands in a particular fashion, which left
what has became known as ‘sticky ends’ on the strands. This discovery, in turn,
led to pioneering work by Stanley Cohen. Cohen had been studying plasmids and
had developed a method of removing them from the cell and then reinserting them
in other cells. Combining this process with that of DNA splicing enabled Boyer
and Cohen to recombine segments of DNA in desired configurations and insert
the DNA in bacterial cells, which could then act as manufacturing plants for specific proteins.
Before Boyer and Cohen could isolate the recombinant plasmid they wanted, they need to way to get their ligated
plasmids into E coil. Classic experiments by Oswald Avery and his group that Preumococcus bacteria are
“transformed“ to virulence when they take up DNA from virulent strains.
(i) Which enzymes are being referred to in the paragraph? How sticky ends are formed by them, depict through
a diagram? 2
(ii) What are some enzymes called“molecular scissors”? Give one example. How do they perform its job? 2
(iii) Explain the nomenclature of an endonuclease by taking an example? 1
Ans. (i) Genetically modified crops with high nutritive value are provided by biotechnology.
• It has helped in the production of recombinant vaccines.
• It has devised techniques such as gene therapy for the treatment of genetic diseases.
10 n Biology– XII
• Genetically engineered microbes are produced to control

environmental pollution.
Transgenic animals are developed that can produce human proteins.
(ii) • Lipases in detergents
• Proteases and pectinases in fruit juices
(iii) Insulin used for diabetes was earlier extracted from pancreas of slaughtered cattle and pigs. Insulin from
an animal source, though caused some patients to develop allergy or other types of reactions to the foreign
protein.
In 1983, Eli Lilly an American company prepared two DNA sequences corresponding to A and B, chains of human
insulin and introduced them in plasmids of E. coli to produce insulin chains. Chains A and B were produced
separately, extracted and combined by creating disulphide bonds to form human insulin.
OR
(i) Restriction enzymes. Eco RI is used to cut a segment of foreign DNA and that of a vector DNA to form a
recombinant DNA.
EcoRI
Recognition Sequence
5′ GAATTC 3′
3′ CTTAAG 5′
Cleavage
EcoRI
Stick Ends
5′ G AATTC 3′
3′ CTTAA G 5′
(ii) The restriction endonucleases are called“molecular scissors” as they can cleave the DNA like scissors can
cut paper or fabric that too at specific locations. These restriction endonucleases used in genetic engineering
to join DNA from different sources.
(iii) EcoRI
E first letter of genus Eschirichia
co two letter of species coli
R from strain RY13
I order of its discovery in roman numerals
Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1
SECTION-A
1. A heavily bleeding and bruised road accident victim was brought to a nursing home. The doctor immediately gave
him an injection to protect him against a deadly disease.
(i) Write what the doctor injected into the patient’s body.
(ii) How do you think this injection would protect the patient against the disease? Name the disease against which
this injection was given and the kind of immunity it provides. 2
Ans. (i) The patient was injected with anti Tetanus serum.
(ii) If a person is infected with some deadly microbes to which quick immune response is required as in tetanus,
we need to directly inject the preformed antibodies, or antitoxin (a preparation containing antibodies to the
toxin).
2. Give examples to prove that microbes release gases during metabolism. 2
OR
Name the two different categories of microbes naturally occurring in sewage water. Explain their role in cleaning
sewage water into usable water.
Ans. • The puffed-up dough, of dosa and idli due to the production of CO2 gas during fermentation by bacteria.
• The dough used for making bread is fermented using baker’s yeast (Saccharomyces cerevisiae).
• The large holes in ‘Swiss cheese’ are due to production of a large amount of CO2 by a bacterium named
Propionibacterium sharmanii.
OR
Use of aerobic microbes reduces the BOD (biochemical oxygen demand) of the effluent. In large tanks called
anaerobic sludge digesters other kinds of anaerobic bacteria, digest the bacteria and the fungi in the sludge. During
this digestion, bacteria produce a mixture of gases such as methane, hydrogen sulphide and carbon dioxide[ biogas]
The effluent from the secondary treatment plant is generally released into natural water bodies like rivers and
streams.
3. Identify the substance depicted in the figure. What is its source and its ill effects on human body? 2
Ans. Morphine. Heroin, commonly called smack is chemically diacetylmorphine which is a white,
odourless, bitter crystalline compound. This is obtained by acetylation of morphine (Figure),
which is extracted from the latex of poppy plant Papaver somniferum. Generally taken by
snorting and injection, heroin is a depressant and slows down body functions. Opioids are
the drugs, which bind to specific opioid receptors present in our central nervous system and
gastrointestinal tract.
4. (i) How do organic farmers control pests? Give two examples.
(ii) State the difference in their approach from that of conventional pest control methods. 2
Ans. (i) The organic farmer, works to create a system where pests are not eradicated, but instead are kept at manageable
levels by a complex system of checks and balances within an ecosystem.
Eradication of the pests is not only possible, but also undesirable, they are part of a food chain and its predators
may be desirable to us. Examples: use of Nucleopolyhedrovirus with respect to pest management, the bacteria
Bacillus thuringiensis to control butterfly caterpillars, use of the fungus Trichoderma in the treatment of plant
disease and several plant pathogens.
(ii) This is a holistic approach that seeks to develop an understanding of the webs of interaction between the
myriad of organisms that constitute the field fauna and flora. The ‘conventional’ farming practices which
often use chemical methods to kill both useful and harmful life forms indiscriminately.
12
5. What are sacred groves? What is their role in conservation? Why are sacred groves highly protected? 2
Ans. India has also a history of religious and cultural traditions that emphasized protection of nature. In many cultures,
tracts of forest were set aside, and all the trees and wildlife within were venerated and given total protection. Such
sacred groves are found in Khasi and Jaintia Hills in Meghalaya, Aravalli Hills of Rajasthan, Western Ghat regions
of Karnataka and Maharashtra and the Sarguja, Chanda and Bastar areas of Madhya Pradesh. In Meghalaya, the
sacred groves are the last refuges for a large number of rare and threatened plants.
6. Study the graph given alongside and answer the questions that follow.
(i) Write the status of food and space in the curves (A) and (B)
(ii) In the absence of predators, which one of the two curves would
appropriately depict the prey population?
(iii) Time has been shows on x-axis and there is a parallel dotted line
above it. Give the significance of this dotted line. 2
OR
(i) Explain giving reasons why the tourists visiting Rohtang Pass or
Mansarovar are advised to resume normal active life only after a
few days of reaching there.
(ii) It is impossible to find small animals in the polar regions. Give
reasons.
Ans. (i) The status of food and space in curves ‘A’ is unlimited resources, while in curve ‘B’ the sources of food and
space are limited.
(ii) In the absence of predators, the curve ‘B’ would appropriately depict the competition for limited food and
shelter resources within the prey population. But if food and shelter is also unlimited that is there is no
environmental resistance, Curve A will depict the growth curve.
(iii) The dotted line in the above graph represents the carrying capacity (K). The carrying capacity signifies the
limit of habitat, i.e. limited resources in a given habitat to support growth upto a certain level beyond which
no further growth can take place.
OR
(i) Tourists visiting to Rohtang Pass near Manali (> 3500 m) may suffer from altitude sickness. They resume
normal active life only after a week because in low atmospheric pressure at high altitudes, the body does not
get enough oxygen. Gradually, the body compensates low oxygen availability by increasing red blood cell
production. (b) Decreasing the binding affinity of haemoglobin. (c) Increasing the breathing rate.
(ii) Small animals have a large surface area relative to their volume. So, they tend to lose body heat very fast
during cold conditions. They need to spend more energy to generate body heat. Due to this smaller animals
are rarely found in polar regions.
SECTION-B
7. Name the following with respect to ringworm.
(i) Causative organism and the target organ
(ii) Any two symptoms
(iii) Optimal conditions for its spread and mode of transmission. 3
OR
Name the following with respect to common cold.
(i) Causative organism and the target organ
(ii) Any two symptoms
(iii) Mode of transmission
Ans. (i) Fungi belonging to the genera Microsporum, Trichophyton and Epidermophyton
(ii) Appearance of dry, scaly lesions on various parts of the body such as skin, nails and scalp are the main
symptoms of the disease. These lesions are accompanied by intense itching.
(iii) Heat and moisture help these fungi to grow, which makes them thrive in skin folds such as those in the groin
or between the toes. Ringworms are generally acquired from soil or by using towels, clothes or even the comb
of infected individuals.
OR
(i) Rhino viruses infect the nose and respiratory passage but not the lungs.
(ii) The common cold is characterized by nasal congestion and discharge, sore throat, hoarseness, cough, headache,
tiredness, etc., which usually last for 3-7 days.
(iii) Droplets resulting from cough or sneezes of an infected person are either inhaled directly or transmitted
through contaminated objects such as pens, books, cups, doorknobs, computer keyboard or mouse, etc., and
cause infection in a healthy person.
8. (i) Name the causative organisms for the following diseases.
(a) Elephantiasis (b) Ringworm (c) Amoebiasis
(ii) How can public hygiene help control such diseases? 3
Ans. (i) (a) Elephantiasis: Wuchereria bancrofti
(b) Ringworm: Microsporum, Trichophyton and Epidermophyton
(c) Amoebiasis: Entamoeba histolytica
(ii) Public hygiene can help to control the water and food borne diseases such as typhoid, ascariasis and amoebiasis
and in certain cases air borne diseases too.
9. Describe any three potential applications of genetically modified plants. 3
Ans. GM plants have been useful in many ways.
Genetic modification has:
(i) Made crops more tolerant to abiotic stresses (cold, drought, salt, heat).
(ii) Reduced reliance on chemical pesticides (pest-resistant crops).
(iii) Helped to reduce post harvest losses.
(iv) Increased efficiency of mineral usage by plants (this prevents early exhaustion of fertility of soil).
(v) Enhanced nutritional value of food, e.g., vitamin ‘a’ enriched rice.
(vi) In addition to these uses, GM has been used to create tailor-made plants to supply alternative resources to
industries, in the form of starches, fuels and pharmaceuticals. [any three]
10. List the different ways by which organisms cope or manage with abiotic stresses in nature. Explain any three
ways. 3
Ans. Organisms cope up with abiotic stress by:
(i) Regulating: Some organisms maintain homeostasis by physiological and behavioural means. They are called
regulators, e.g.
• In summers, when outside temperature is more, we sweat profusely that results in evaporative cooling to
bring down the body temperature.
• In winters, when temperature is low, we shiver (a kind of exercise) that produces heat and raise the body
temperature.
(ii) Conforming: Organisms that cannot maintain a constant internal environment. Their body temperature
changes with the ambient temperature. Such animals are called conformers. For example, small animals have
larger surface area relative to their volume. They lose body heat very fast in low temperature. So, they expend
energy to generate body heat through metabolism for adjusting.
(iii) Migrating: The temporary movement of organisms from the stressful habitat to a more hospitable area and
return when favourable conditions reappear is called migration. The long distance migration is very common
in birds.
11. What is so special about tropics that might account for their greater biological diversity? 3
Ans. Some important hypotheses are: (a) Speciation is generally a function of time, unlike temperate regions subjected
to frequent glaciations in the past, tropical latitudes have remained relatively undisturbed for millions of years
14 n Biology– XII
and thus, had a long evolutionary time for species diversification, (b) Tropical environments, unlike temperate
ones, are less seasonal, relatively more constant and predictable. Such constant environments promote niche
specialization and lead to a greater species diversity and (c) There is more solar energy available in the tropics,
which contributes to higher productivity; this in turn might contribute indirectly to greater diversity.
12. How is Gene Transfer carried out? 3
Ans. It is carried out by two methods, vector transfer and direct transfer.
(i) Vector Transfer: rDNA is present in the form of plasmid, virus, cosmid or artificial chromosome. It is
introduced into host cell by adding it into culture of plasmid free bacteria or animal cells. The host cells are
made permeable through electroporation or chemically. Once inside the host cell, the recombinant DNA
begins to multiply and form the desired product.
(ii) Direct or Vectorless Transfer: The desired gene as well as recombinant DNA can be passed into plant,
animal or human cells through:
(a) Microinjection: by means of micropipettes
(b) Particle or gene gun: where tungsten or gold particles coated with desired genes are bombarded into the
cells with great force. Instead special sprays are also used for this.
SECTION-C
13. Reducing environmental pollution through biotechnology
Genetic manipulation made it possible to obtain
microorganisms or specific enzymes for the
degradation and metabolism of toxic residual
products. In the waste processing sector , this use
of manipulated or selected microorganisms or the
enzymes they produce is called bioremediation.
On the other hand, different industrial sectors are
currently applying biotechnological techniques to
replace industrial techniques which are dangerous
for the environment or which pollute it. The in situ
use of microorganisms or enzymes is a cleaner technique or less polluting. There is thus reduction of harmful
effects of biodegradable waste, as well as its quantity, but also very often reducing water costs and energy.
(i) Cite two current applications of biotechnology which involve the use of genetic engineering for environmental
conservation. 2
(ii) Give four examples of bioremediation techniques. 2
(iii) List any two advantages of using biotechnology to treat industrial organic waste like waste from potato wafers
manufacturing or molasses in sugar industry by microorganism avoiding chemicals. 1
OR
Cry is a family of proteins originating from strains of the bacterium Bacillus thuringiensis. There are more than
200 different types of Bt toxins, each affecting different types of insects. The cotton plants are genetically modified
by the addition of genes encoding these Cry group protein crystals. When ingested by insects, the Cry toxins are
dissolved and activated by the high pH environment of the animal's gastrointestinal system. In the midgut, the
activated Cry molecules bind to cadherin-like proteins on cells comprising the brush border membrane. With
the formation of Cry ion channels and the subsequent efflux of potassium ions, the affected epithelial cells lyse
and die. The Bt cotton plants are genetically modified by the addition of genes encoding this endotoxin so that
the insect larva on consuming cells of such a GM plant will not survive.
(i) Which vector is used to clone the cry gene? 2
(ii) Name any two components of host cell required by the vector DNA for cloning foreign gene in it. 1
(iii) Enlist any two areas where genetic modifications of plants had been useful. 2
Ans. (i) (a) Treatment and reuse of waste products via biotechnological methods (bioremediation).
(b) Obtaining fuel by degradation of organic raw material as an alternative to petroleum by using biotechnology.
(ii) Bioremediation and cleaner technologies-
(a) methane and gas from urban solid waste
(b) digestion of plant waste via bacteria
(c) biological purifiers
(d) obtaining biomass from organic by-products
(e) digestion of oil slicks via microorganisms [any four]
(iii) (a) Cleaner environment
(b) Obtaining some useful product, for example, spirulina [for nutrition] can be cultured in these waste water
or they can be used for making biogas.
OR
(i) Ti plasmid. Ti plasmid can be used as good cloning vector after the removal of tumor causing genes. rDNA
carrying Cry gene can be inserted into the bacterium by the use of Biolistic method
(ii) rDNA multiples inside the host with the help of
(a) Ori (b) DNA polymerase of the host
(iii) • Reducing use of chemical pesticides to grow a pest free crop like Bt cotton, GM tobacco to silence nematode
specific genes to check spread of root knot disease caused by nematode Meloidegyne incognitia
• Nutrient rich plant product like Golden rice rich in vitamin A
• Plant products with higher shelf life e.g, flavr savr tomato
• Increased resistance to abiotic stresses in some crop plants [any two]
16 n Biology– XII

SECTION-A
1. Elaborate on meaning and role of MALT. 2
Ans. There is lymphoid tissue also located within the lining of the major tracts (respiratory, digestive and urogenital
tracts) called mucosal associated lymphoid tissue (MALT). It constitutes about 50 per cent of the lymphoid tissue
in human body.
2. Microbes can be used to decrease the use of chemical fertilizers and pesticides. Explain how this can be
accomplished. 2
OR
What are flocs formed during secondary treatment of sewage? What is their fate in the next step of treatment?
Ans. Fertilizers and pesticides are synthetic and may be non-biodegradable in nature. They may cause environmental
pollution, biomagnification and eutrophication. To counter these problems associated with the overuse of chemical
fertilizers, there is a need to switch to organic farming – to use biocontrol of pests and bio fertilizers.
OR
Flocs are aerobic microbes -bacteria associated with fungal filaments that consume the major part of the organic
matter in the effluent which is then passed into a settling tank where the bacterial ‘flocs’ are allowed to sediment.
This sediment is called activated sludge. A small part of the activated sludge is pumped back into the aeration
tank to serve as the inoculum. The remaining major part of the sludge is pumped into large tanks called anaerobic
sludge digesters. Here, other kinds of bacteria, which grow anaerobically, digest the bacteria and the fungi in the
sludge. During this digestion, bacteria produce a mixture of gases such as methane, hydrogen sulphide and carbon
dioxide
3. (i) How is the disease in which there is an uncontrolled division of cells detected?
(ii) How do interferons help in controlling the disease? 2
Ans. (i) The two techniques useful in detecting cancers of internal organs, are CT (Computed Tomography) and MR1
(Magnetic Resonance Imaging).
(ii) As tumour cells are capable of avoiding recognition and destruction by immune system, the cancer patients
are given a-interferons which are biological response modifiers. It helps activate the immune system and
destroy tumours.
4. Mention the name of the microbes from which Cyclosporin A (an immunosuppressive drug) and Statins (blood
cholesterol lowering agents) are obtained. How are these substances useful? 2
Ans. Streptokinase produced by the bacterium Streptococcus and modified by genetic engineering is used as a ‘clot
buster’ for removing clots from the blood vessels of patients who have undergone myocardial infraction leading
to heart attack.
Statins produced by the yeast Monascus purpureus have been commercialized as blood-cholesterol lowering
agents. It acts by competitively inhibiting the enzyme responsible for synthesis of cholesterol.
Cyclosporin A, that is used as an immunosuppressive agent in organ-transplant patients, is produced by the fungus
Trichoderma polysporum.
5. (i) Bear hibernates, whereas some species of zooplanktons enter diapause to avoid stressful external conditions.
How are these two ways different from each other?
(ii) How does our body adapt to low oxygen availability at high altitudes? 2
17
Ans. (i) Difference between diapause and hibernation

Diapause Hibernation
State of suspended development during unfavourable. Process of spending winer’s extreme cold conditions
in a domat state.
e.g. zooplanktons. e.g. some animals like bear.
1
(ii) Body adaptations at high altitudes are: The physiological condition or responses in order to get acclimatised
to high attitudes are:
(a) To compensate low oxygen, the production of red blood cells is increased.
(b) High haemoglobin content and its decreased binding capacity.
(c) Faster breathing rate. [any two] 1
6. With an example, explain how biotechnology has been applied in each of the following:
(i) In producing more nutritionally balanced milk
(ii) Chemical safety testing 2
OR
Draw the figure of vector pBR322 and label the following: Origin of replication, Ampicillin resistance site,
Tetracycline resistance site, Bam H1 restriction site.
Ans. (i) In 1997, the first transgenic cow, Rosie, produced human protein-enriched milk (2.4 grams per litre). The
milk contained the human alpha-lactalbumin and was nutritionally a more balanced product for human babies
than natural cow-milk.
(ii) Vaccine safety: Transgenic mice are being developed for use in testing the safety of vaccines before they
are used on humans. Transgenic mice are being used to test the safety of the polio vaccine. If successful and
found to be reliable, they could replace the use of monkeys to test the safety of batches of the vaccine.
OR
SECTION-B
7. (i) Name the Protozoan parasite that causes amoebic dysentery in humans.
(ii) Mention two diagnostic symptoms of the disease.
(iii) How is this disease transmitted to others? 3
OR
(i) Why do the symptoms of malaria not appear immediately after the entry of sporozoites into the human body
when bitten by female Anopheles? Explain.
(ii) Give the scientific name of the malarial parasite that causes malignant malaria in humans.
(iii) Give a flow chart of the part of the life cycle of this parasite passed in this insect.
Ans. (i) Entamoeba histolytica is a protozoan parasite in the large intestine of human which causes amoebiasis (amoebic
dysentery).
(ii) Symptoms of this disease include constipation, abdominal pain and cramps, stools with excess mucous and
blood clots.
18 n Biology– XII
(iii) Houseflies act as mechanical carriers and serve to transmit the parasite from faeces of infected person to food
and food products, thereby contaminating them. Drinking water and food contaminated by the faecal matter
are the main source of infection.
OR
(i) Malarial parasite completes its asexual cycle in liver cells and then it attacks the Red Blood Cells (RBCs)
resulting in their rupture. The ruptured RBCs release toxic substance called haemozoin that is responsible for
the symptoms of malaria like chill and high fever. Thus, no symptoms appear in the infected person between
the period, the parasite enters the body and till RBCs release haemozoin,
(ii) Plasmodium falciparum causes malignant malaria. It enters into human body in sporozoites form.
(iii) Female Anopheies mosquito takes up gametocyte
Fertilisation and development occur in mosquito intestine
Mature sporozoites released from intestine and migrate to the salivary glands of mosquito
Released into the host’s body while sucking blood, along with saliva.
8. Study the diagram showing replication of HIV in humans and answer the following questions accordingly.
(i) Write the chemical nature of the coat.

(ii) Name the enzyme B acting on X to produce molecule C. Name C.
(iii) Mention the name of the host cell D the HIV attacks first when it enters into the human body.
(iv) Name the two different cells the new viruses E subsequently attack.
(v) Name the widely used diagnostic test when a person gets this disease. 3
Ans. (i) A – Protein coat

(ii) B – Reverse transcriptase C – It is viral DNA
(iii) Macrophage (animal or human cell)
(iv) Macrophages and helper T-cells
(v) A widely used diagnostic test for AIDS is enzyme linked immuno-sorbent assay (ELISA).
9. (i) Given below is a single stranded DNA molecule. Frame and label its sense and antisense RNA molecule. 5’
ATGGGGCTC 3’ sense
(ii) How the RNA molecules made from above DNA strand help in silencing of the specific RNA molecules?3
Ans. (i) Template DNA strand = antisense DNA strand
3’ TACCCCGAG 5’
5’ AUGGGGCUC 3’ sense RNA = mRNA
3’ UACCCCGAG 5’ a ntisense RNA
These two RNA’s being complementary to each other formed a double stranded (dsRNA).
If the introduction of a gene of a pathogen/pest [DNA] is such that it produced both sense and anti-sense RNA
in the host cells.
The two RNA’s being complementary to each other formed a double stranded (dsRNA). This initiates RNAi.
(ii) RNAi takes place in all eukaryotic organisms as a method of cellular defense. This method involves silencing
of a specific mRNA due to a complementary dsRNA molecule that binds to and prevents translation of the
mRNA (silencing).
10. The following graph represents the organismic response to certain environmental condition (e.g. salinity)
(i) Which one of these depicts conformers?

(ii) What does the other line of graphs depict?
(iii) How do B and C organisms differ from each other with reference to homeostasis?
(iv) Mention the category to which human belong with respect to temperature.
(v) What are partial regulators? 3
Ans. (i) C depicts conformers.
(ii) The other line B depicts regulators while A are partial regulators.
(iii) Differences given:
Conformer Regulator
These cannot maintain a constant internal These organisms maintain a constant internal
environment and change according to the ambient environment despite changes in the environment
atmospheric conditions.
They show a narrow range of distribution. They show a much wider range of distribution.
(iv) Humans are thermoregulators.
(v) Partial regulators are those organism that try to maintain a constant level of internal environment first but
conform later.
20 n Biology– XII
11. Recombinant DNA-technology is of great importance in the field of medicine. With the help of a flow chart, show
how this technology has been used in preparing genetically engineered human insulin. 3
Ans. Insulin consists of two polypeptide chains A and B → they are linked by disulphide bonds → Eli Lilly company
introduced the human genes of both A and B chains into plasmids of E. coli separately → these genes expressed in
E. coli in the form of A and B chains → the chains were extracted and mature insulin was produced by formation
of disulphide bonds.
Insulin DNA Vector DNA

Same restriction enzyme cutting both insulin (plasmid)
DNA and vector DNA at specific point
Ligases join insulin

DNA to plasmid
Transformation
E.coli
Cells divide
12. A policeman finds a very small piece of body tissue from the site of a crime and takes it to the forensic department.
(i) By which technique will they amplify the DNA collected from the tissue sample?
(ii) Mention in a sequence, the 3 steps involved in each cycle of this technique;
(iii) What is the role of thermostable DNA polymerase in this technique? 3
Ans. (i) Amplification of Gene of Interest using PCR :PCR stands for Polymerase Chain Reaction.
(ii) In this reaction, multiple copies of the gene (or DNA) of interest is synthesized in vitro using two sets of
primers (small chemically synthesized oligonucleotides that are complementary to the regions of DNA) and
the enzyme DNA polymerase. The enzyme extends the primers using the nucleotides provided in the reaction
and the genomic DNA as template.
(iii) If the process of replication of DNA is repeated many times, the segment of DNA can be amplified to
approximately billion times, i.e., 1 billion copies are made. Such repeated amplification is achieved by the
use of a thermostable DNA polymerase (isolated from a bacterium, Thermus aquaticus), which remain active
during the high temperature induced denaturation of double stranded DNA. The amplified fragment if desired
can now be used to ligate with a vector for further cloning.
SECTION-C
Read the paragraph and answer the questions that follow.
13. The way the world has changed in recent years, it’s no surprise that some wild species are finding themselves at
risk for extinction as they can’t adapt to these changes fast enough or find food sources readily available without
herbicides and pesticides interfering with their natural habitats.
Researchers from the University of Queensland recently concluded that animal species who live in habitats
containing greater diversity are able to survive better than those residing among fewer varieties, and further
research should be conducted on how our environment is affecting this phenomenon. There are many ways that
the loss of biodiversity can harm plants. Scientists have found that in a wide range of species, loss of diversity in
biotic community has led to an increase in vulnerability to climate change-related stresses such as drought and
heatwaves. The loss of biodiversity is a significant issue for agriculture. Without diverse habitats, we will lose
many species!
(i) What features make a community stable? 1
(ii) What are the major cause for loss of biodiversity amongst the four main causes of loss of biodiversity?
2
(iii) In the past, which factor would have caused a mass extinction of species? 2
OR
Human activities cause loss to biodiversity at a very fast rate. According to IUCN Red list (2004) , a number of
invertebrates, vertebrates and plants have become extinct in last 500 years. The main cause of the loss of biodiversity
can be attributed to the influence of human beings on the world’s ecosystem, In fact human beings have deeply
altered the environment, and have modified the territory, exploiting the species directly, for example by fishing
and hunting, changing the biogeochemical cycles and transferring species from one area to another of the Planet.
(i) Why are certain regions on the earth called hot -spots? Name any one hotspots in India. 1
(ii) State a difference between endemic and exotic species. 1
(iii) In comparison to other animal groups, why are amphibians more vulnerable to extinction? 1
(iv) What is Red list? Give two uses of the red list. 2
Ans. (i) Rich biodiversity and hence good productivity.
(ii) Habitat loss and fragmentation, alien species invasion, over-exploitation and co-extinctions.
(iii) Hint: As per scientists, the following would have triggered the mass extinction:
• Temperature fluctuation
• Meteorite/Asteroid hitting the planet
• Emission of lethal hydrogen sulphide from the sea
• The outburst of gamma radiations/supernova
OR
(i) Regions of rich biodiversity especially habitats for many endemic species. Generally these regions also are
vulnerable to major biodiversity losses. Examples: Western ghats.
(ii) Endemic species are confined to one particular region mostly where it would have originated. Exotic species
are species that have been shifted from another region.
(iii) Hint: It is because of the following:
• Habitat fragmentation
• Habitat destruction or modification
• Large scale climate change
(iv) Hint: IUCN maintains a red data book or red list which is a catalogue of taxa facing risk of extinction.
It aims to convey the urgency of conserving threatened species to the public and policy makers so
as to reduce species extinction.
Uses:
(a) Identification and documentation of endangered species of plants and animals.
(b) Creating awareness about the importance of preserving the threatened biodiversity.
22 n Biology– XII

SECTION-A
1. (a) How are B lymphocytes different from T lymphocytes? 2
(b) What are interferons? Mention their role.
2. Do you think microbes can also be used as source of energy? If yes, how? 2
OR
Explain the process of secondary treatment given to the primary effluent up to the point it shows significant change
in the level of biological oxygen demand (BOD).
3. In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided? 2
4. List the three critical areas of biotechnology. 2
5. Explain any two important components of biodiversity with one example each. 2
6. The following graph represents the organismic response to certain environmental condition (e.g. temperature)
(i) Which one of these A or B depicts conformers?

(ii) What does the other line graph depict?
(iii)How do these organisms differ from each other with reference to homeostasis?
(iv) Mention the category to which human belong. [AI 2009]
OR
Study the three different age pyramids, for human population given below and
answer the questions that follow:
(i) Write the names given to each of these age pyramid. A B C
(ii) Mention the one which is ideal for human population and why?
SECTION-B
7. In spite of the presence of so many pathogens around us, some of us are able to stay healthy? What is this ability
of body known as? How does a human being gain this ability? 3
OR
What is allergy? Name the antibody responsible for it. Also mention two chemicals released from the mast cells
during an allergic reaction. List two symptoms of allergy and name the drugs that reduce them.
8. Explain the work carried out by Cohen and Boyer that contributed immensely in biotechnology. 3
9. How has biotechnology been applied in each of the following? 3
(i) In producing more nutritionally balanced milk
23
(ii) Production of biological products

(iii) Chemical safety testing
10. Explain Verhulst-Pearl Logistic Growth of a population. 3
11. The graph below shows species-area relationship. If b denotes the relationship on log scale-
(i) What does this diagram depict?

(ii) What is meant by largest and smallest in the picture?
(iii) Name the compound used to visualize them.
(iv) Define elution. 3
12. How is the desired DNA for biotechnology experiments first fragmented and later separated by gel-electrophoresis?
Explain. 3
SECTION-C
Read the following and answer the questions:
13. We use microbes or products which are derived from them every day. A common example is the production of curd
from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow
in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented
by bacteria. A number of traditional drinks and foods are also made by fermentation by the microbes. ‘Toddy’, a
traditional drink of some parts of southern India, is made by fermenting sap from palms. The ‘Roquefort cheese’
is ripened by growing specific fungi on them, which give them a particular flavour. Different varieties of cheese
are known by their characteristic texture, flavour and taste, the specificity coining from the microbes used. Apart
from food many commercially important enzymes and acids are produced by microbes which in turn may be used
for improving the quality of juices, detergents and other products.
(i) How does the addition of a small amount of curd to fresh milk help in formation of curd? Mention a nutritional
quality that gets added to the curd. 2
(ii) Food production with the help of microbes may accompany gas production. Comment. 1
(iii) Bottled fruit juices are clearer as compared to those made at home. Why? 1
(iv) What is the microbial source of vinegar and citric acid? 1
24 n Biology– XII
OR
Some diseases are caused by retroviruses. This virus, unlike DNA viruses, has a special enzyme. HIV, unlike
MERS, SARS-CoV, and SARS-CoV-2 is a retrovirus. The mechanism of this retrovirus in the body makes it
difficult to cure because it invades and then commandeers the T cells responsible for defeating it. This reduces
the number of functional T cells and ruptures their cellular membrane in the process.
(i) The immune system of a person is suppressed. In the ELISA test, he was found positive to a pathogen.
(a) Name the disease the patient is suffering from.
(b) What is the causative organism?
(c) Which cells of the body are affected by the pathogen?
(d) What is the basis of ELISA test? Mention its full form. 3
(ii) List any two ways to prevent this disease. 1
(iii) Why do some drug addicts get infected by this virus? 1

SECTION-A
1. Why is secondary immune response more intense than the primary immune response in humans? 2
2. Antibiotics – powerful medicines that fight bacterial infections – can save lives when used properly. Elaborate on
the statement emphasizing various problems arising out of their overuse and misuse. As a well-informed student
of biology, how can you help in countering these problems? What values will you associate with it? 2
OR
Microbes play a dual role when used for sewage treatment as they not only help to retrieve usable water but also
generate fuel. Write in points how this happens?
3. Differentiate between antibody mediated and cell-mediated immune response or cell-mediated immunity (CMI).
4. Name the source of streptokinase. How does this bioactive molecule function in our body? 2
5. How do ecologists estimate the total number of species present in the world? 2
6. How can DNA be isolated from different types of cells? How is DNA precipitated out from rest of the digested
material? What is spooling? 2
OR
What are new ways of detecting diseases? Why are they more effective than conventional methods?
SECTION-B
7. A person in your colony has recently been diagnosed with AIDS. People/ residents in the colony want him to
leave the colony for the fear of spread of AIDS.
(i) Write your view on the situation, giving reasons.
(ii) List the possible preventive measures that you would suggest to the residents of your locality in a meeting
organised by you so that they understand the situation.
(iii) Write the symptoms and the causative agent of AIDS. 3
OR
Cancer is one of the most dreaded diseases.
(i) Explain ‘contact inhibition’ and ‘metastasis’ with respect to disease.
(ii) Name the group of genes that have been identified in normal cells that could lead to cancer. How do these
genes cause cancer?
(iii) Name any two techniques that are useful in detecting cancers of internal organs.
(iv) Why are cancer patients given a-interferon as part of the treatment?
8. In which way has the study of biology helped us to control infectious diseases? 3
9. In a bacterial culture some of the colonies produced blue colour in the presence of a chromogenic substrate and
some did not due to the presence or absence of an insert (rDNA) in the coding sequence of a-galactosidase.
(i) Mention the mechanism and the steps involved in the above experiment.
(ii) How is it advantageous over simultaneous plating on two plates having different antibiotics? 3
10. What is meant by ADA deficiency? How is gene therapy a solution to this problem? Why is it not a permanent
cure? 3
11. What is the ‘rivet popper hypothesis’? 3
12. In plants and animals, how is alien DNA introduced into the host cell ? 3
26
SECTION-C
Read the following and answer the questions that follow:
13. The organism has various adaptations for coping with extreme environments. Some are able to respond through
certain physiological adjustments while others do so behaviourally. Many adaptations have evolved over a long
evolutionary time and are genetically fixed. Many desert plants have a thick cuticle on their leaf surfaces and
have their stomata arranged in deep pits to minimise water loss through transpiration. In the polar seas, aquatic
animals like seals have a thick layer of fat (blubber) below their skin that acts as an insulator and reduces the loss
of body heat. Some organisms possess adaptations that are physiological which allow them to respond quickly to
a stressful situation.
(i) Most living organisms cannot survive at temperatures above 45°. How are some microbes able to live in
habitats with temperatures exceeding 100°? 1
(ii) What are Eurythermal species? Give any one example. 1
(iii) Sunlight is source of heat as well as light. How does light as an abiotic factor affect living beings? 1
(iv) How do adaptation get genetically fixed in a population? 1
(v) Why is thermoregulation more effectively achieved in larger animals than in smaller ones? 1
OR
Deserts by and large do not support as large a number of animal species as other areas do, but the animals that live
there are often highly adapted. It might be expected that those groups of animals which are already well adapted
for terrestrial life in a general way, will be better represented in deserts than those which are not. On these ground
mammals, reptiles and birds among the vertebrates, and insects and arachnids among the invertebrates, include
nearly all the inhabitants of deserts. Adaptation to life on land presents animals with a number of physiological
problems which become most acute in desert regions. These are associated mainly with effecting nitrogenous
excretion and respiration while, at the same time, conserving water and preventing an excessive rise in body
temperature. The greatest physiological problem which faces animals that live on land, and especially in desert
regions, therefore lies in the evaporation of water that inevitably occurs, especially during respiration.
(i) List the different challenges that animals and plants need to cope with in the desert. 2
(ii) What phenotypic adaptations are generally noticed in xerophytes? Give examples of two such plants and the
way they survive in dry and hot climate. 1
(iii) How does kangaroo rat live in the absence of water in North American deserts? Explain its three adaptations.
2

SECTION-A
1. Draw a well-labelled diagram of an antibody molecule. 2
2. How are Anabaena and Nostoc good for the soil? 2
OR
Some farmers prefer to check the population of pest rather than kill them all by using pesticides. Mention any two
reasons for doing so.
3. Name the following with respect to common cold: (i) causative organism and the target organ (ii) Any two
symptoms (iii) Mode of transmission. 2
4. Find out the name of the microbes from which Cyclosporin A (an immunosuppressive drug) and Statins (blood
cholesterol lowering agents) are obtained. 2
5. Identify the curves A and B shown in the graph given below. List the conditions responsible for growth patterns
A and B. 2
6. Draw a schematic sketch of pBR 322 plasmid and label the following in it: (i) Any two restriction sites. (ii) Ori
and rop genes (iii) An antibiotic resistant gene. 2
OR
Show the steps in action of EcoRI to form recombinant DNA.
SECTION-B
7. Name the plant source of the drug popularly called “smack”. How does it affect the body of the abuser? 3
OR
Community Service department of your school plans a visit to a slum area near the school with an objective to
educate the slum dwellers with respect to health and hygiene.
(i) Why is there a need to organise such visits?
(ii) Write the steps you will highlight, as a member of this department, in your interaction with them to enable
them to lead a healthy life.
8. Name the primary and secondary lymphoid organs. Differentiate between the two. 3
What are auto immune disease? Give an example.
9. Rearrange the following in the correct sequence to accomplish an important biological reaction: 3
(a) In vitro synthesis of copies of DNA of interest
28
(b) Chemically synthesized oligonucleotides

(c) Enzyme DNA-polymerase
(d) Complementary region of DNA
(e) Genomic DNA template
(f) Nucleotides provided
(g) Primers
(h) Thermostable DNA-polymerase (from Thermus aquaticus)
(i) Denaturation of ds-DNA
10. (i) State the cause of adenosine deaminase enzyme deficiency.
(ii) Suggest any two possible treatments that can be given to a patient exhibiting adenosine deaminase deficiency.
(iii) Explain enzyme-replacement therapy to treat adenosine deaminase deficiency. Mention two disadvantages
of this procedure. 3
11. At a time when we are losing species at an alarming pace, does it really matter to us if a few species become
extinct? Discuss in the light of explanation given by Paul Ehrlich. 3
12. You have developed a GM organism. Which government organisation will you approach to obtain clearance for
its mass production? Why is such a body necessary? Give two reasons. 3
SECTION-C
13. Persons lost at sea without any fresh water to drink are at risk of severe dehydration because the human body
cannot adapt to drinking seawater, which is hypertonic in comparison to body fluids. Organisms, such as goldfish,
can tolerate only a relatively-narrow range of salinity. About 90 percent of bony fish species can live in either
freshwater or seawater, but not both. However, a few species, such as the salmon, are tolerant of a relatively-wide
range of salinity. They evolved osmoregulatory mechanisms to survive in a variety of aquatic environments.
Dorsal fin
Lateral line
Caudal fin
Scales Eye
Nostril
Mouth
Anal fin
Operculum
Pectoral fin
Pelvic fin
Salmon physiology responds to freshwater and seawater to maintain osmotic balance.

Most marine invertebrates, on the other hand, may be isotonic with sea water. Their body fluid concentrations
conform to changes in seawater concentration. The blood composition of cartilaginous fishes, such as sharks
and rays, is similar to that of bony fishes. However, the blood of sharks contains urea and trimethylamine oxide
(TMAO). The shark’s blood electrolyte composition is not similar to that of seawater, but maintains isotonicity
with seawater by storing urea at high concentrations.
(i) Which of the animals mentioned in the above paragraph can be classified as stenohaline and Euryhaline? 2
(ii) If a freshwater fish is placed in an aquarium containing sea water, will the fish be able to survive? Explain
giving reasons. 1
(iii) Why do all the freshwater microorganisms have contractile vacuoles whereas the majority of marine organisms
lack them? 1
(iv) What are osmoconformers? Give examples from the above paragraph. 1
OR
The threats to biodiversity can be summarized in the following main points:

• Alteration and loss of the habitats: the transformation of the natural areas determines not only the loss of the
vegetable species, but also a decrease in the animal species associated with them.
• Introduction of exotic species and genetically modified organisms: species originating from a particular area,
introduced into new natural environments can lead to different forms of imbalance in the ecological equilibrium.
Refer to, “Introduction of exotic species and genetically modified organisms”.
• Overexploitation of resources: when the activities connected with capturing and harvesting (hunting, fishing,
farming) a renewable natural resource in a particular area is excessively intense, the resource itself may become
exhausted, as for example, is the case of sardines, herrings, cod, tuna and many other species that man captures
without leaving enough time for the organisms to reproduce.
• Coextinction
(i) How can the loss of one species lead to the extinction of another? 2
(ii) What are the factors that determine a species as threatened? 2
(iii) Identify A and B. 1
30 n Biology– XII

SECTION-A
1. The colostrum and typhoid vaccine both provide immunity. Differentiate between the types of immunity provided
by them. 2
2. Why is curd considered a healthier option than milk? 2
OR
Yeast is a very useful microbe. Justify.
3. Trace the life cycle of Plasmodium in humans from the stage of entry until it is picked up by the female Anopheles. 2
4. Why is Rhizobium categorized as a ‘symbiotic bacterium’? How does it act as a bio fertiliser? 2
5. What are the two core techniques that enabled the birth of modern biotechnology? 2
6. Why is the data on prokaryotic diversity incomplete? How should this problem be solved. 2
OR
How do organisms like fungi, zooplanktons and bears overcome the temporary short-lived climatic stressful
conditions? Explain. [All India 2010; Delhi 2008]
SECTION-B
7. (i) Name and explain any four lymphoid organs present in humans.
(ii) Categorise the named lymphoid organs as primary or secondary lymphoid organs, giving reasons. 3
OR
Name the source of smack. Mention one way in which it affects the human body.
8. Name the parasite that causes filariasis in humans. 3
What are the various public health measures, which you would suggest as safeguard against infectious diseases?
9. An interesting property of restriction enzymes is molecular cutting and pasting. Restriction enzymes typically
recognize a symmetrical sequence of DNA. Notice that the top strand is the same as the bottom strand, but reads
backward. When the enzyme cuts the strand between G and A, it leaves overhanging chains:
(a) What is this symmetrical sequence of DNA known as?
(b) What is the significance of these overhanging chains?
(c) Name the restriction enzyme that cuts the strand between G and A. 3
10. A multinational company (XYZ) marked a medicine extracted from medicinal herbs grown in the sprawling fields
in a foreign country. This herb is found only in our country and no compensation was paid or permission taken
from relevant authority.
(i) What is the term used to refer to such an act committed by the multinational company?
(ii) Justify the meaning of the term.
(iii) What has our government done to prevent such deeds? 3
31
11. How do organisms cope with stressful external environmental conditions which are localised or of short duration?
Write any three ways with examples. 3
12. How has Agrobacterium tumifaciens been suitably modified to act as a cloning vector? Name another vector apart
from it along with its use in biotechnology. 3
SECTION-C
13. A traditional means of biodiversity conservation, sacred groves can be considered the ancient equivalent of
natural sanctuaries where all forms of living creatures are given protection by a deity. No one is permitted to cut
any tree or plant, kill animals and birds, or harm any form of life in this area. Today, there are only about 1000
square kilometres of undisturbed sacred groves, scattered in patches all over the country. Only the groves in the
remote and inaccessible areas remain untouched. While religious taboo protected the groves near towns earlier,
today they are protected with the means of barbed wire fencing or hedges. The decline of sacred groves can be
attributed to the change in social values and religious beliefs as a result of modernization and urbanisation. The
expansion of the market economy, which places heavy demand on resources such as timber, is another major
cause. For most villagers, economics is easier to understand than ecology.
(i) Mention two examples of sacred groves in India? 1

(ii) What are two approaches to biodiversity conservation? To which approach does ‘Sacred groves’ belong?
Provide two examples of the other approach. 2
(iii) What is the need to have a modern way of biodiversity conservation approach at all. 1
(iv) Mention any two ways in which biodiversity is being conserved in modern ways. 1
OR
32 n Biology– XII
Biodiversity is essential for maintaining ecological balance and equilibrium in our planet’s ecosystems; as such,
its detrimental effects when we lose these precious habitats should not go ignored or unmentioned!
Disappearance of biodiversity affects the health and stability of ecosystems. If there are few or no species in an
ecosystem, it can become susceptible to widespread problems such as disease outbreaks.
(i) What is a narrowly utilitarian approach to biodiversity conservation ? Explain the other two arguments that
are put forth in support of the same cause. 2
(ii) If there are few or no species in an ecosystem, it can become susceptible to widespread problems and be
affected by seasonal variations. Name the scientist who performed open field experiments to support that.
1
(iii) Paul Ehlrich proposed a theory to indicate that each species is important for the stability of an ecosystem?
Explain the theory giving analogies. 2

SECTION-A
1. Name the parasite that causes filariasis in humans. Mention its two diagnostic symptoms. How is this disease
transmitted to others? 2
2. Why is Rhizobium categorized as a ‘symbiotic bacterium’? How does it act as a bio fertiliser? 2
OR
Nowadays the detergents remove even greasy stains very efficiently. Why?
3. A person injured in a road accident and requiring an urgent immune response was brought to a doctor.
(a) What did the doctor immediately do?
(b) What kind of an immunity was he providing to the patient? 2
4. What are methanogens? Where are they found? Which is the substrate they use? How do they help to generate
biogas? 2
5. Can you think of a situation where we deliberately want to make a species extinct? How would you justify it? 2
6. How did an American Company, Eli Lilly use the knowledge of r-DNA technology to produce human insulin?
State the role of C peptide in human insulin. 2
OR
What is Downstream Processing? What processes are involved in it?
SECTION-B
7. A person in your colony has recently been diagnosed with AIDS. People/ residents in the colony want him to
leave the colony for the fear of spread of AIDS. (i) Write your view on the situation, giving reasons. (ii) List the
possible preventive measures that you would suggest to the residents of your locality in a meeting organised by
you so that they understand the situation. (iii)Write the symptoms and the causative agent of AIDS. 3
OR
Recently many people all over the world suffered because of a virus. Discuss its causative agent, mode of spread
and symptoms. What preventive measures did you take to prevent it from spreading in your locality?
8. (i) In which parts of the body of the hosts do the following events in the life cycle of Plasmodium take place?
Name both, the body part and the host.
(a) Fertilization
(b) Development of gametocytes
(c) Release of sporozoites
(d) Asexual reproduction
(ii) Name three species of Plasmodium responsible for different types of malaria. 3
9. (i) Explain with reference to PCR a specific enzyme helps in amplification in PCR. Name the bacterium from
which it is isolated and state how its thermostable nature is helpful.
(ii) Explain its use in molecular diagnosis. 3
10. Biotechnology has helped farmers to get pest resistant cotton crops. Explain the technique adopted along with its
mode of action. 3
11. What are the major causes of species losses in a geographical region? 3
12. Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors have over shake
flasks? 3
34
SECTION-C
13. The size of a population for any species is not a static parameter. It keeps changing in time, depending on various
factors including food availability predation pressure and reduces weather. The changes in population density give
an idea of what is happening to the population whether it is flourishing or diminishing. The density of a population
in a given habitat during a given period fluctuates due to changes in four basic processes, two of which contribute
an increase in population density and two to a decrease. Ideally, when resources in the habitat are unlimited, each
species has the ability to realise fully its innate potential to grow in number, as Darwin observed while developing
his theory of natural selection. Then the population grows in an exponential or geometric fashion.
(i) List any three important characteristics of a population and explain. 3

(ii) Write the equation for the Verhulst-Pearl Logistic Growth of population. 1
(iii) Depict the type of population graph of a herbivore which will be observed when the forest hardly has any
carnivores. 1
OR
In nature, all organisms and their populations interact with one another to some degree or the other. When closely
related species fight for limited resources, there is a competition between the species. Competition can occur even
when there is an unlimited supply of resources. Predation ensures that there is stability in the ecosystem.Without
the predators, the prey population will go out of control and lose its species diversity in a community. Herbivory
is also a type of predation. The prey species have also evolved several mechanisms to lessen the impact of predation.
Parasitism is an interaction of populations where one species is completely dependent on the other host species
for all its meals/nutrient requirements. A special type of parasitism is shown by Cuckoo bird over crow.
(i) How do parasites harm the host? 1
(ii) In an aquarium two herbivorous species of fish are living together and feeding on phytoplanktons. Give
possible reasons for both surviving well. 2
(iii) Explain the defence mechanisms evolved in preys to avoid overpopulation of their predators. 1
(iv) Besides acting as conduits for energy transfer across trophic levels, predators play other important roles.
Justify. 1

SECTION-A
1. How do innate immunity barriers protect newborn from diseases? 2
2. State the use of Nucleopolyhedrovirus with respect to pest management. 2
OR
Justify the role of Rhizobium as a biofertiliser.
3. List the symptoms of Ascariasis. How does a healthy person acquire this infection? 2
4. The BOD test measures the polluting potential of water . How? 2
5. What is patent? Name the Indian variety of rice patented by an American company. What does it mean? 2
6. Amazonian rainforest has the greatest biodiversity on earth. List any two hypotheses that are proposed by the
biologists to account for the greater biological diversity. 2
OR
(i) List any three ways of measuring population density of a habitat.
(ii) Mention the essential information that can be obtained by studying the population density of an organism.
SECTION-B
7. What is addiction. Name any two addictive substances that may have long term effect on the health of a person. 3
OR
Some athletes and sportspersons misuse steroids to improve their performance. Discuss the ill effects of such
substances on their body.
8. How are B lymphocytes different from T lymphocytes? What would happen if a retrovirus enters the helper T
cells or a macrophage. Depict in the form of a diagram only. 3
9. Eco RI is used to cut a segment of foreign DNA and that of a vector DNA to form a recombinant DNA, Show
with the help of schematic diagrams. 3
10.
Study the population growth curves in the graph given above and answer the questions that follow.
(i) Identify the growth curves A and B
(ii) Which one of them is considered a more realistic one and why?
 K − N
(iii) In equation of the logistic growth curve, dN / dt = rN  what does K stand for?
 K 
(iv) What is symbolised by N? 3
11. Two of the steps involved in producing nematode resistant tobacco plants based on the process of RNAi are
mentioned below. Write the missing steps in its proper sequence. 3
36
12. Where can a foreign gene be ligated in pBR322? How do antibiotic resistance genes in vector pBR322 as selectable
markers help in selection of transformants and recombinants colonies of E.coli? 3
SECTION-C
13. High proportions of terrestrial and freshwater species occur in the tropics. Moving from high to low latitudes
the average species richness within a sampling area of a given size increases, as has been documented for a wide
spectrum of taxonomic groups (including groups as different as protists, trees, ants, woodpeckers and primates).
Such gradients in species richness may be steep (for a given area, tropical assemblages are often several times
more than
(i) Mention any two countries that are likely to have the highest biodiversity? 1
(ii) Why is the tropical environment able to support greater species diversity? 1
(iii) Which biome is likely to show minimum biodiversity and why? 1
(iv) In which area there will be maximum biodiversity? Give reasons also. 1
(v) Explain the latitudinal gradient with respect to biodiversity. 1

OR
In situ conservation is the on-site conservation of genetic resources in natural populations of plants or animal species
such as forest genetic resources, in natural populations of tree and animal species. The process of protecting an
endangered plant or animal species in its natural habitat is commonly known as in situ conservation. On the other
hand, ex situ conservation is the relocation of endangered or rare species from their natural habitats to protected
areas equipped for their protection and preservation. It is an essential alternative strategy when in situ conservation
is inadequate. In this method genetic information of cultivated and wild plant species is preserved in the form of
in vitro cultures and seeds, which are stored as gene banks for long-term use. This type of conservation creates
a bank of genes/DNA, seeds, and germplasms and forms a genetic information library (e.g., common garden
archives) for endangered, primitive, and commercially valuable species. It also includes certain preservation
(cryopreservation) and gene transformation techniques for the incorporation of disease, pest and stress tolerance
traits, and environmental restoration of endangered plant species.
(i) A particular species of wildcat is endangered. In order to save them from extinction, which is a desirable
approach in situ or ex situ? Justify. 2
(ii) Explain the difference between the two approaches for conservation of biodiversity. 2
(iii) Explain the role of cryopreservation in maintaining biodiversity. 1
38 n Biology– XII

SECTION-A
1. Fill in the blanks in the different columns of the table given below: 2
Disease Causal organism Medium of transfer Symptoms
Filarisasis Wuchereia a Lymphatic vessels
of lower limbs affected
b Trichophyton Using towels of infected Dry, scaly lesions on body
person
Common cold c Droplets from Affect nose, and respiratory
Sneezing of passage, sore throat
infected persons
Ascariasis Ascaris Through contaminted d
water, vegetables and fruits
2. Explain the function of “anaerobic sludge digester” in a sewage treatment plant. 2
OR
Name the type of association that the genus Glomus exhibits with higher plants./How do mycorrhizae act as bio
fertilizers?
3. What are the various public health measures, which you would suggest as safeguard against infectious
diseases? 2
4. Give two examples of biocontrol of pests widely used in crop fields. 2
5. (a) Name some ecosystem services provides by the biodiversity present on earth. How is this achieved by the
biotic components of the ecosystem?
(b) What is bio prospecting’? 2
6. (i) State how the constant internal environment is beneficial to organisms.
(ii) Explain any two alternatives by which organisms can overcome stressful external conditions. 2
OR
(i) Humming birds live among the bushes in tropics, while penguins live on icebergs. They cannot survive if
their habitats are reversed. Justify.
(ii) How does human body maintain constant temperature both in summers and winters? Explain. 2
SECTION-B
7. (i) Give the scientific name of the parasite that causes malignant malaria in humans.
(ii) At what stage does this parasite enter the human body?
(iii) Name the hosts where the sexual and asexual reproduction occur respectively.
(iv) Name the toxin responsible for the appearance of symptoms of malaria in human. 3
OR
A thallasemic child needed repeated blood transfusions got infected by HIV.
(i) Use a rough diagrammatic sketch and arrows to show how the virus increased in number.
(ii) Why did the increased number of the HIV virus deteriorate the child’s immunity?
(iii) Which diagnostic test showed that the infective virus was HIV?
39
8. Acquired immunity occurs because of memory. Explain it by taking example of vaccination. 3

9. What are “molecular scissors”? Give one example. How does an endonuclease perform its job? 3
10. (i) List any three abiotic components that lead to variations in the physical and chemical conditions of habitats.
(ii) Explain the impact of these components on the distribution of organisms in different habitats. 3
11. Since the origin of life on Earth, there were five episodes of mass extinction of species. How is the ‘Sixth
Extinction’ presently in progress different from the previous episodes? Explain the various causes that have
brought about this difference. 3
12. What are Cry proteins? Name an organism that produce it. How has man exploited this protein to his benefit? 3
SECTION-C
13.
Steps of making a GM plant are depicted in the diagram

(i) What is the role of Agrobacterium tumefaciens in plant transformation? 1
(ii) Can the vector in the bacterium be used in its original form? Give a reason. 1
(iii) Mention any two vector-less methods that are used to introduce recombinant DNA into a competent host cell.
1
(iv) A gene was being ligated to the plasmid vector to prepare a recombinant DNA during bacterial transformation.
An exonuclease was added to the tube accidentally. How will it affect the next step of the experiment? 2
OR
The idea of PCR was born, but the technique was still very much in its infancy. The E.coli DNA polymerase used
in the early days was destroyed during the denaturation step so had to be replenished after every cycle.
In 1985, Mullis came up with the idea of using polymerase isolated from the bacterium. The bacterial polymerase,
has optimal activity at 72°C and can withstand the 94°C required for denaturation of the DNA, meaning that many
reaction cycles could be performed without replenishing the enzyme. This breakthrough, together with advances
in oligonucleotide synthesis made PCR both cost effective and convenient and it quickly entered mainstream
research. Today a modification of this technique RT-PCR is in use to amplify the small amount of viral RNA
obtained from samples taken from the patient.
40 n Biology– XII
(i) List one difference and one similarity in the two techniques depicted above. 1
(ii) In a living cell, name the phase when the DNA is replicated occurs in a cell cycle. Do we see RT PCR occurring
in nature? Where? 1
(iii) List any two uses of PCR in biotechnology. 1
(iv) What is the role of primers in step B? Why two of them are required? 2
D:\Full Marks\Super-20_Biology-12_(Term-2)\Open_Files\CBSE_Sample_Paper-11
Practice Paper– 11
[CBSE SAMPLE QUESTION PAPER–2021-22]
Time Allowed: 2 hours Maximum Marks: 35
General Instructions:
(i) All questions are compulsory.
(ii) The question paper has three sections and 13 questions. All questions are compulsory.
(iii) Section–A has 6 questions of 2 marks each; Section–B has 6 questions of 3 marks each; and Section–C has a
case-based question of 5 marks.
(iv) There is no overall choice. However, internal choices have been provided in some questions. A student has to
attempt only one of the alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.
Section-A
1. Humans have innate immunity for protection against pathogens that may enter the gut along with food. What
are the two barriers that protect the body from such pathogens? 2
2. A patient admitted in ICU was diagnosed to have suffered from myocardial
infarction. The condition of coronary artery is depicted in the image below.
Name two bioactive agents and their mode of action that can improve this
condition. 2
OR
Substantiate by giving two reasons as to why a holistic understanding of the
flora and fauna the cropland is required before introducing an appropriate
biocontrol method.
3. Identify the compound chemical structure is shown below. State any three of its physical properties. 2
4. Water samples were collected at points A, B and C in a segment of a river near a sugar factory and tested for BOD
level. The BOD levels of samples A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively. What is this
indicative of? Explain why the BOD level gets reduced considerably at the collection point C? 2
5. An ecologist study an area with population A, thriving on unlimited resources and showing exponential
growth, introduced population B and C to the same area. What will be the effect on the growth pattern of the
population A, B and C when living together in the same habitat? 2
42
6. With the decline in the population of fig species it was noticed that the population of wasp species also started to
decline. What is the relationship between the two and what could be the possible reason for decline of wasps?2
OR
With the increase in the global temperature, the inhabitants of Antarctica are facing fluctuations in the temperature.
Out of the regulators and the conformers, which of the two will have better chances of survival? Give two
adaptations that support them to survive in the ambient environment? Give one suitable example. 2
Section-B
7. How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples of
inducing agent. 3
OR
A person is suffering from a high-grade fever. Which symptoms will help to identify if he/she is suffering
from Typhoid, Pneumonia or Malaria?
8. Recognition of an antigenic protein of a pathogen or exposure to a pathogen occurs during many types of immune
responses, including active immunity and induced active immunity. Specify the types of responses elicited when
human beings get encountered by a pathogen. 3
9. In a pathological lab, a series of steps were undertaken for finding the gene of interest. Describe the steps,
or make a flow chart showing the process of amplification of this gene of interest. 3
10. (i) ‘The Evil Quartet’ describes the rates of species extinction due to human activities. Explain how the
population of organisms is affected by fragmentation the habitats.
(ii) Introduction of alien species has led to environmental damage and decline of indigenous species. Give
any one example of how it has affected the indigenous species?
(iii) Could the extinction of Steller’s sea cow and passenger pigeon be saved by man? Give reasons to support
your answer. 3
11. (i) The image shown below is of a sacred grove found in India. Explain how has human involvement helped in
the preservation of these biodiversity rich regions. 3
12. The image below depicts the result of gel electrophoresis 3
If the ladder represents sequence length upto 3000 base pairs (bp),
(i) Which of the bands (I - IV) correspond to 2500 bp and 100 bp respectively?
(ii) Explain the basis of this kind of separation and also mention the significance of this process.
Section-C
13. Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end
of each molecule is cut and these ends have regions of single stranded DNA. BamH1is one such restriction
enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the
5’- guanine on each strand. 5
(i) What is the objective of this action?
(ii) Explain how the gene of interest is introduced into a vector.
(iii) You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was
cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded
DNA fragments with their respective polarity.
(iv) A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site. What will be its impact on the
recombinant plamids? Give a possible way by which you could differentiate non recombinant to recombinant
plasmids.
OR
GM crops especially Bt crops are known to have higher resistance to pest attacks. To substantiate this an
experimental study was conducted in 4 different farmlands growing Bt and non Bt-Cotton crops. The farm
lands had the same dimensions, fertility and were under similar climatic conditions. The histogram below
shows the usage of pesticides on Bt crops and non-Bt crops in these farm lands.
44 n Biology– XII
(a) Which of the above 4 farm lands has successfully applied the concepts of Biotechnology to show better
management practices and use of agrochemicals? If you had to cultivate, which crop would you prefer (Bt or
Non- Bt) and why?
(b) Cotton Bollworms were introduced in another experimental study on the above farm lands wherein no pesticide
was used. Explain what effect would a Bt and Non Bt crop have on the pest.
Marking Scheme of CBSE Sample Question Paper 2021-22

Section-A Marks
1. Microbial pathogens enter the gut of humans along with food: 2
• Physical barriers: Mucus coating of the epithelium lining the gastrointestinal tract helps in
trapping microbes entering our body. (1 Marks)
• Physiological barriers: Acid in the stomach, saliva in the mouth prevent microbial growth.
(½+½ Mark)
2. Streptokinase (produced by the bacterium Streptococcus) is used as a ‘clot buster’ for removing 2
clots from the blood vessels of patients who have undergone myocardial infarction. (1 mark)
Statins (produced by the yeast Monascus purpureus) act as blood-cholesterol lowering agents.
(1 mark)
OR
Eradication of pests will disrupt predator-prey relationships, where beneficial predatory and
parasitic insects which depend upon flora and fauna as food or hosts, may not be able to survive.
(1 mark) Holistic approach ensures that various life forms that inhabit the field, their life cycles,
patterns of feeding and the habitats that they prefer are extensively studied and considered.
(1 mark)
3. It is Morphine. (1/2 mark) 2
Physically it appears as a white, odourless, crystalline compound. (1½ mark)
4. At collection points A and B, the BOD level is high due to high organic pollution caused 2
by sugar factory and sewage discharge. (1 mark) At the collection point C, the water was
released after secondary treatment/ biological treatment (where vigorous growth of useful
aerobic microbes into flocs consume the major part of the organic matter present in the river
water or effluent due to sugar factory and sewage discharge). (1 mark)
5. This interaction will lead to competition between the individuals of population A,B and C 2
for resources. Eventually the ‘fittest’ individuals will survive and reproduce. (1 mark)
The resources for growth will become finite and limiting, and population growth will become
realistic. (1 mark)
6. The relationship between the plant and pollinator is called mutualism. Fig depends on wasp for 2
pollination, and wasp depends on fig for food and shelter. (1 mark) With the decline in population
of figs, wasp loses its source of food and shelter. (1 mark)
OR
Regulators;
Thermoregulation, Osmoregulation Birds/mammals (any one) (½ x 4 Marks)
Section-B
7. Transformation of normal cells into cancerous neoplastic cells may be induced by following 3
physical, chemical or biological agents causing DNA damage:
• Ionising radiations like X-rays and gamma rays
• Non-ionizing radiations like UV.
• Chemical carcinogens present in tobacco smoke
• Cellular oncogenes (c-onc) or proto-oncogenes, when activated under certain conditions cause
cancer. Viruses with oncogenes can transform normal cells to cancerous cells.
(any 3; 1 x 3 marks)
46 n Biology– XII
OR
If the person has sustained high fever (39° to 40°C), weakness, stomach pain, constipation,
headache and loss of appetite, it is Typhoid. (1 mark)
If the person has fever, chills, cough and headache; and the lips and fingernails turn gray to bluish,
it is Pneumonia. (1 mark)
If the person has chills and high fever recurring every three to four days then, it is Malaria. (1 mark)
8. • When our body encounters an antigenic protein or a pathogen for the first time it produces a 3
response which is of low intensity and our body retains memory of the first encounter.
(1 mark)
• The subsequent encounter with the same pathogen elicits a highly intensified response carried
out with the help of two special types of lymphocytes present in our blood, B- lymphocytes,
and T-lymphocytes. (1 mark)
• The B-lymphocytes produce an army of proteins in response to these pathogens into our blood
to fight with them. These proteins are called antibodies. The T-cells themselves do not secrete
antibodies but help B-cells produce them. (1 mark)
9. The flow chart shows the three steps involved in the process of PCR showing the following -
Denaturation The DNA strands are treated with a temperature of 940C (Heat) and the strands are
separated. - Annealing The primers anneal to the complementary strands - Extension The DNA
polymerase facilitates the extension of the strands. (1x3=3 marks)
OR
Diagram: Polymerase Chain Reaction
10. (i) When a large habitat is broken into small fragments due to various activities, mammals 3
and birds requiring large territories and certain animals with migratory habitats are badly
affected, leading to population decline. (1 mark)
(ii) • Nile perch introduced in Lake Victoria eventually led to the extinction of an
ecologically unique assemblage of more than 200 species of cichild fish.
• Parthenium/Lantana/water hyacinth caused environmental damage and threat to our
native species
• African catfish-Clarias gariepinus introduced for aquaculture purposes is posing a threat
to the indigenous catfishes in our rivers. (Any one) (1 mark)
(iii) Yes; Humans have overexploited natural resources for their ‘greed’ rather than ‘need’
leading to extinction of these animals. Sustainable harvesting could have prevented
extinction of these species. (1 mark)
11. (i) India’s history of religious and cultural traditions emphasized the protection of nature. In 3
many cultures, tracts of forest are set aside, all the trees and wildlife within are venerated
and given total protection. Sacred groves in many states are the last refuges for a large
number of rare and threatened plants. (2 marks)
(ii) Area A will have more species richness and a steeper slope. (1 mark)
12. (i) Band III corresponds to 2500 base pairs, and Band IV corresponds to 100bp. (½ + ½ mark) 3
(ii) The fragments will resolve according to their size. The shorter sequence fragments would
move farthest from well as seen in Band IV (100 bp) which is lighter as compared to Band
III which is heavier being 2500 base pairs. (1 mark) The significance of electrophoresis is
to purify the DNA fragments for use in constructing recombinant DNA by joining them
with cloning vectors.
Section-C
(i) The two different DNA molecules will have compatible ends to recombine. (½ mark) 5
(ii) Restriction enzyme cuts the DNA of the vector and then ligates the gene of interest into
the DNA of the vector. (1 mark)
(iii) 2 fragments (½ mark)
5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAG
5’.3’GCATTACAGGA 5’ (1 mark)
(iv) BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant
plasmids will lose tetracycline resistance due to inactivation of the resistance gene.
(1 mark)
Recombinants can be selected from non recombinants by plating into a medium containing
tetracycline, as the recombinants will not grow in the medium because the tetracycline
resistance gene is cut. (1 mark)
OR
(i) Farm Land II. (½ mark)
Bt crop. (½ mark) Because the use of pesticides is highly reduced for Bt crop // Decrease
of pesticide used is also more significant for Bt crop. (1 mark)
(ii) In Bt cotton a cry gene has been introduce from bacterium Bacillus thuringiensis (Bt)
which causes synthesis of a toxic protein. This protein becomes active in the alkaline gut
of bollworm feeding on cotton, punching holes in the lining causing death of the insect.
(2 marks)
However; a Non Bt crop will have no effect on the cotton bollworm/ the yield of cotton
will decrease / non Bt will succumb to pest attack. ‘‘ (1 mark)
48 n Biology– XII
JEE NEET ADDA
This Pdf Is
Download From
www.jeeneetadda.in
Visit www.jeeneetadda.in for

More Premium Stuffs,Latest
Books,Test Papers,Lectures etc.
jeeneetadda
jeeneetadda_official
jeeneetadda
VISIT NOW !!

Super 20 Biology Sample Paper

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Super 20 Biology Sample Paper

Uploaded by

Copyright:

Available Formats

D:\Full Marks\Super-20_Biology-12_(Term-2)\Open_Files\0.

Full Marks Pvt Ltd

9, Daryaganj, New Delhi-110002

Note from the Publishers

Biology-XII (Term-2) based on the latest Sample Question Paper issued

Features of Sample Papers

• Designed exclusively to test the knowledge and preparation level of students.

UNSOLVED SAMPLE PAPERS

3 7 Unsolved Practice Papers

3 CBSE Sample Question Paper 2021-22 (Term-2) with Marking Scheme

Units Term-II Marks

VIII Biology and Human Welfare: Chapter – 8 and 10 14

IX Biotechnology and its Applications: Chapter – 11 and 12 11

X Ecology and Environment: Chapter – 13 and 15 10

Visit www.jeeneetadda.in for

Time Allowed: 2 Hours

(i) Write the chemical nature of an antibody.

(ii) Name the cells that produce antibodies in humans.

• Genetically engineered microbes are produced to control

Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1

Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1

Ans. (i) Difference between diapause and hibernation

Fertilisation and development occur in mosquito intestine

(i) Write the chemical nature of the coat.

Ans. (i) A – Protein coat

(i) Which one of these depicts conformers?

Insulin DNA Vector DNA

Ligases join insulin

Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1

(i) Which one of these A or B depicts conformers?

(ii) Production of biological products

(i) What does this diagram depict?

Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1

Time Allowed: 2 hours

(b) Chemically synthesized oligonucleotides

Salmon physiology responds to freshwater and seawater to maintain osmotic balance.

The threats to biodiversity can be summarized in the following main points:

Time Allowed: 2 hours

(i) Mention two examples of sacred groves in India?  1

Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1

(i) List any three important characteristics of a population and explain.  3

Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1

(v) Explain the latitudinal gradient with respect to biodiversity. 1

Time Allowed: 2 hours

General Instructions: Same as Practice Paper-1

8. Acquired immunity occurs because of memory. Explain it by taking example of vaccination. 3

Steps of making a GM plant are depicted in the diagram

12. The image below depicts the result of gel electrophoresis 3

Marking Scheme of CBSE Sample Question Paper 2021-22

Diagram: Polymerase Chain Reaction

Visit www.jeeneetadda.in for

You might also like

Time Allowed: 2 Hours

Time Allowed: 2 hours

Time Allowed: 2 hours

Time Allowed: 2 hours

Time Allowed: 2 hours

Time Allowed: 2 hours

Time Allowed: 2 hours

(i) Mention two examples of sacred groves in India? 1

Time Allowed: 2 hours

(i) List any three important characteristics of a population and explain. 3

Time Allowed: 2 hours

(v) Explain the latitudinal gradient with respect to biodiversity. 1

Time Allowed: 2 hours

8. Acquired immunity occurs because of memory. Explain it by taking example of vaccination. 3

12. The image below depicts the result of gel electrophoresis 3