The Journal of Maternal-Fetal & Neonatal Medicine

ISSN: 1476-7058 (Print) 1476-4954 (Online) Journal homepage: http://www.tandfonline.com/loi/ijmf20

Cytokine modulation (IL-6, IL-8, IL-10) by human

breast milk lipids on intestinal epithelial cells
(Caco-2)

Girolamo J. Barrera & Gabriela Sánchez

To cite this article: Girolamo J. Barrera & Gabriela Sánchez (2015): Cytokine modulation (IL-6,
IL-8, IL-10) by human breast milk lipids on intestinal epithelial cells (Caco-2), The Journal of
Maternal-Fetal & Neonatal Medicine, DOI: 10.3109/14767058.2015.1091879

To link to this article: http://dx.doi.org/10.3109/14767058.2015.1091879

Published online: 06 Oct 2015.

Submit your article to this journal

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=ijmf20

Download by: [University of Otago] Date: 07 October 2015, At: 14:59

 http://informahealthcare.com/jmf
ISSN: 1476-7058 (print), 1476-4954 (electronic)

J Matern Fetal Neonatal Med, Early Online: 1–8

! 2015 Taylor & Francis. DOI: 10.3109/14767058.2015.1091879

ORIGINAL ARTICLE

Cytokine modulation (IL-6, IL-8, IL-10) by human breast milk lipids on

intestinal epithelial cells (Caco-2)
Girolamo J. Barrera1,2 and Gabriela Sánchez2
1
Facultad De Ciencias De La Salud, Universidad De Carabobo, Edo, Carabobo, República Bolivariana De Venezuela and 2Laboratorio De
Biotecnologı́a Aplicada L.B.A, Edo, Carabobo, República Bolivariana De Venezuela

Abstract Keywords
Downloaded by [University of Otago] at 14:59 07 October 2015

Human breast milk is the best form of nourishment for infants during the first year of life. It is Breast milk, cytokine, inflammation, lipids
composed by a complex mixture of carbohydrates, proteins and fats. Breast milk provides
nutrients and bioactive factors that themselves modulate maturation and development of the History
gastrointestinal tract. Many studies have shown that it provides protection against gastro-
intestinal tract inflammation. In this sense, this study aimed to evaluate the effect of human Received 2 November 2014
breast milk lipids on epithelial intestinal cells (Caco-2) cytokine regulation and the fatty acid Revised 31 August 2015
transporter protein (FATP) involved in this process. Caco-2 cells were cultivated and stimulated Accepted 4 September 2015
with different concentration of human milk lipids from healthy human mothers (18–30-year- Published online 5 October 2015
olds) or single commercial lipids for 48 h. We measured the concentrations and mRNA levels of
IL-6, IL-8 and IL-10 cytokines by immunoassay (ELISA) and quantitative-PCR (qRT-PCR)
technique, respectively. We observed a two to three times decrease in pro-inflammatory
cytokine levels (p50.01) as well as an increase in anti-inflammatory IL-10 levels in cells
stimulated with increasing concentrations of breast milk lipids. These results suggest that
human breast milk lipids could have an important role on the cytokine modulation in the
newborn bowel.

Introduction tumor necrosis factor (TNF) receptor, acetylhydrolase and

IL-1 receptor antagonist [6,7]. In this sense, previously, we
Human breast milk is the best form of nourishment for infants
have found that trefoil factor 3 (TFF3) isolated from breast
during the first year of life. It is a dynamic secretion, and its
milk can activate intestinal epithelial cells by producing an
composition varies at different stages of lactation. Breast milk
anti-inflammatory effect through cytokine regulation and also
provides nutrients and bioactive factors [1,2] that themselves
promoting human beta defensin expression [8].
modulate maturation, development, and also could act as
Recently, an important role in regulation of cell inflam-
mediators on the protection against gastrointestinal diseases
mation has been attributed to lipids. In fact, it has been shown
[3]. A study of chemical induced colitis in rats revealed a
the agonist or antagonist role of lipids on the cytokine profile
decreased myeloperoxidase activity in rats fed with human
modulation into an inflammatory response [9]. The lipid
milk [4]. Likewise, human milk has shown to be protective
content mean in human breast milk is variable, around 15 to
against gastrointestinal inflammation such as necrotizing
90 g/L [10]. It has been identified more than 200 fatty acids
enterocolitis (NEC). In a comparative study, it have been
of different chain length and unsaturations in breast milk.
proved that infants breastfed have a minor risk to suffer NEC
During the first 6 months of lactation, mono-unsaturated
in relation to formulae-fed infants [5]. However, cellular and
fats contributed the majority of human milk fat (42–47%),
molecular mechanisms that underlie this protective effect are
followed by saturated (38–43%) and polyunsaturated fatty
largely unknown. Milk provides a large number of proteins
acids (PUFA) (13–17%). Palmitic acid was the major
with anti-inflammatory properties such as caseins, lactalbu-
contributor of saturated fat (25%). Between birth and
min, lactoferrin, immunoglobulins, lactoperoxidase, super-
12 months, the content of two essentials fatty acids linoleic
oxide dismutase, alkaline phosphatase, growth factors, soluble
acid (18:2n–6) and a-linoleic acid (18:2n–3) are increased,
whereas long chain PUFA, arachidonic acid (AA) (20:4n–6),
eicosapentanoic acid (EPA) (20:5n–3) and docosahexaenoic
acid (DHA) (22:6n–3) remained constant [11,12]. The intake
Address for correspondence: Girolamo J. Barrera, Facultad De Ciencias
of PUFA is important to the newborn, because their enzymes
De La Salud, Universidad De Carabobo, Edo, Carabobo, República
Bolivariana De Venezuela. Tel: +0058245-5640380. E-mail: are not still able to generate a fatty acid from another source
girolamobarrera@hotmail.com [13]. Given variations on structure, instaurations, length,
 2 G. J. Barrera & G. Sánchez
relative quantity of large amount lipids, many of the studies
that have focused its role on the immune system regulation
have contradictory results, remaining the total effect unclear. In
this sense, we evaluated the role of lipidic fraction and specific
lipids from human breast milk into the modulation of pro-
inflammatory (IL-6 e IL-8) and anti-inflammatory (IL-10)
cytokines on human cancer epithelial colon cells (Caco-2). We
found an anti-inflammatory effect by increasing concentra-
tions of human breast milk on Caco-2 cells. Also, from a
screening of commercial lipids, we have found that this anti-
inflammatory effect is mainly caused by phosphatidylcholine,
phosphatidylserine, palmitoleic acid, oleic acid and AA.
Methods
Samples and isolation of lipids from human breast
milk
Samples of human breast milk (n ¼ 50) were collected within
2–5 weeks postpartum from healthy human mothers (18–30-
year-olds) by manual breast massage. Nobody of the mother
Downloaded by [University of Otago] at 14:59 07 October 2015
had a history of rheumatologic, respiratory, cardiovascular, or
gastrointestinal diseases. All samples were obtained with
informed consent. The study was approved by the Research
Ethics Committee of the Applied Biotechnology Laboratory
(San Diego, Carabobo, Venezuela). Lipid extraction was
made following the method of Folch et al. [14]. Briefly, lipids
were extracted by homogenizing the human breast milk with
2:1 chloroform–methanol (v/v), and filtering the homogenate.
Then, it was added to the filtrate at least fivefold its volume of
water, which freed the solution of non-lipid substances [14].
The lipidic fraction was re-suspended in DMSO (0.1%)
at 80  C until use.
Cultured cells
The Caco-2 colonic cell line (passages 5–15) was obtained
from the American Type Culture Collection (ATCC,
Manassas, VA) and cultured according to the supplier’s
instructions in Dulbecco’s Modified Eagle medium (DMEM)
containing 2 mM glutamine, 50 IU/mL penicillin, 50 mg/mL
streptomycin and 10% heat-inactivated fetal bovine serum as
standard medium at 37  C in a water-saturated atmosphere
with 5% CO2.
Peroxidase activity and C-reactive protein (CRP)
measurement
Peroxidase activity was measured in culture supernatants of
Caco-2 cells according to the 2-nitrobenzoic acid/thiocyanate
(NBS-SCN) assay as previously described [8,15]. Briefly,
the colorimetric change induced by the reaction between the
enzyme and the substrate, Dithiobis-2-nitrobensoic acid
(DTNB) in the presence of mercaptoethanol was read at a
wavelength of 412 nm for 20 s. One unit of enzyme activity
was defined as the level of enzyme activity needed to cleave
1 mmol NBS/min at 22  C, using a molar extinction coefficient
of 12 800. Also, CRP was measured employing the commer-
cial kit Biogamma (Laboratorios Biogamma, Caracas,
Venezuela), according to the manufacturer’s instructions.
Absorbance was measured using a microtiter plate spectro-
photometer Synergy HT (BioTek Instruments, Winooski, VT).
J Matern Fetal Neonatal Med, Early Online: 1–8
Quantitative reverse transcriptase–polymerase chain
reaction (qRT-PCR)
Caco-2 cells were grown to 80% confluence in 24-well plates
and serum-starved for 24 h. Cells were incubated by 48 h with
different concentration of human breast milk lipids (10–
200 mg/mL), specific commercial lipids (100 ng/mL) or DMSO
0.1%. In some experiments, cells were pre-incubated by 24 h
with lipopolysaccharide (LPS) (1 mg/mL) or perhexiline
maleate (80 mM), before treating with lipids for 48 h. Total
RNA (1 mg) was reverse transcribed into cDNA using a com-
mercial kit TrizolTM (Invitrogen, Waltham, MA) according to
the manufacturer’s instructions. RNA concentration and purity
was measured using a spectrophotometer (Synergy HT spec-
trophotometer – BioTek Instruments, Winooski, VT). qRT-
PCR amplification was performed using the Sybr Green kit
(Applied Biosystems, Lincoln Centre Drive, Foster City, CA),
GAPDH for normalizing the threshold cycle (Ct), while H2O
was used as negative control. All measurements were per-
formed in triplicate. The primer sequences were: b-actin sense,
CACGCCATCCTGCGTCGGAC; b-actin antisense, CATGC
CATCCTGCGTCTGGAC; IL-8 sense, GGCTCTCTTGGCA
GCCTTCCTG; and IL-8 antisense, CTTCTCCACAACCGTC
TCACCC; IL-6 sense, CGAGCCCACCGGGAACGAAA; and
IL-6 antisense, GCTTCGTCAGCAGGCTGGCAT, IL-10
sense CAAGCTGAGAACCAAGACC3 and IL-10 antisense
AAGGCATTCTTCACCTGCTC3. The results were analyzed
by using the comparative Ct method. This method is based on
the sample data which were normalized to b-actin mRNA and
are presented as fold change relative to mRNA from untreated
cells. Assumption that target and reference template DNA
amplifies with the same efficiency. Only PCR experiments
producing a single DNA fragment, analyzed by gel electro-
phoresis, were used for the statistical analysis.
ELISA
Caco-2 cells were grown in 6-well plates at 50% confluence
and serum-starved for 24 h. The cell number in wells was
normalized by seeding equal quantity of Caco-2 cells,
previously counted and diluted at final concentration of
2  105 cells/mL. Then, cells were incubated by 48 h with
different concentration of human breast milk (10–200 mg/mL),
or dimethyl sulfoxide (DMSO) 0.1%. In some experiments,
cells were pre-incubated by 24 h with LPS (1 mg/mL) or
perhexiline maleate (80 mM), before treatment with lipids for
48 h. Afterwards, it was made a centrifugation at 1000 g and
4  C for 15 min. The supernatant was collected and proteins
were precipitated by trichloroacetic acid (TCA) as described
by Barrera et al. [8]. IL-6, IL-8 and IL-10 were measured by
commercial ELISA kits Invitrogen (Catalogue number
KHC0069, KHC0081 y KHC0101, respectively) following
the instructions provided by the manufacturer. Absorbance
was measured using a microtiter plate spectrophotometer
Synergy HT (BioTek Instruments, Winooski, VT).
Statistical analysis
Data are represented as mean ± standard deviation, and
comparisons were made using unpaired t-student test,
values of p50.05 had significant differences.
 DOI: 10.3109/14767058.2015.1091879 Cytokine modulation by human breast milk lipids 3

Results
Human breast milk total lipids reduce inflammation
markers in Caco-2 cells
We measured the effect of lipids on CRP quantities and
peroxidase activity, two indicators of cell inflammation and
tissue damage in Caco-2 cells supernatants [16,17]. Cells
were grown in 24-well plates to 50% confluence and then
serum-starved for 24 h. Then, Caco-2 cells were pre-incubated
by 24 h with LPS (1 mg/mL), before treatment with different
concentrations of lipids (10–200 mg/mL) or the vehicle
DMSO (0.1%) for 48 h. As shown in Figure 1, the peroxidase
activity and CRP levels after treatment with LPS were
significantly higher than in untreated cells. Then, Caco-2 cells
incubation with lipids (48 h) after LPS treatment led to a
directly proportional decrease in CRP and peroxidase activity
compared with increasing total lipids concentration. The
highest concentrations of lipids assayed led to a decrease
similar to basal levels in both cases. The treatment with
vehicle (DMSO 0.1%) for 48 h after LPS incubation did not
Downloaded by [University of Otago] at 14:59 07 October 2015
These results suggest that lipids from human breast milk
could have an anti-inflammatory effect in Caco-2 cells,
offsetting the LPS effect.
Human breast milk total lipids downregulates IL-6 and
IL-8 and upregulates IL-10 in Caco-2 cells
In order to elucidate the anti-inflammatory effect observed
by human breast milk lipids, qRT-PCR and ELISA were
used to determine cytokine expression levels and concen-
tration in Caco-2 cells, respectively. Caco-2 cells were
treated as described previously. Cells treated with LPS, had
significantly higher expression levels and concentrations of
IL-6 and IL-8 than untreated cells; and the addition of 0.1%
DMSO did not significantly modified this response.
Incubation with different concentrations of total lipids
significantly decreased the concentration of pro-
inflammatory cytokines IL-6 and IL-8, secreted in Caco-2
cells pretreated with LPS. Decreased values of interleukin
similar to basal level were observed at high concentration

modified the enzyme activity or the protein concentration. of studied total lipids, 50–200 mg/mL for IL-6 (Figure 2A),

Figure 1. Effect of human breast milk lipids

on inflammation markers levels in Caco-2
cells. Cells were grown in 24-well plates to
50% confluence and then serum-starved for
24 h. Then, Caco-2 cells were pre-incubated
by 24 h with LPS (1 mg/mL), before treatment
with different concentrations of lipids (10–
200 mg/mL) or the vehicle DMSO (0.1%) for
48 h, as indicated. C-reactive protein (CRP)
quantities and peroxidase activity were mea-
sured in Caco-2 cells supernatants as
described in ‘‘Materials and methods’’ sec-
tion. The figure shows the measured con-
centrations of CRP expressed as mg/mL (A)
and the relative peroxidase activity expressed
in percentage (B). Each assay was carried out
in three independent experiments, and the
results are reported as mean ± SD.
 4 G. J. Barrera & G. Sánchez J Matern Fetal Neonatal Med, Early Online: 1–8
Downloaded by [University of Otago] at 14:59 07 October 2015

Figure 2. Effect of human breast milk total lipids on IL-6, IL-8 and IL-10 expression and production in Caco-2 cells. Cells were grown in 24-well
plates to 50% confluence and then serum-starved for 24 h. Then, Caco-2 cells were treatment with different concentrations of lipids (10–200 mg/mL) or
DMSO (0.1%) for 48 h. In some experiments, cells were pre-incubated by 24 h with LPS (1 mg/mL), before treatment with total lipids for 48 h.
Subsequently, qRT-PCR technique was used to determine gene expression at the mRNA level or supernatant was collected for determination of
cytokine protein expression. It is shown the cytokine protein secretions expressed as mg/mL (A, C and E) and the relative amount of mRNA product
quantiEed and normalized with b-actin are expressed as fold change, (B, D and F) as indicated. Each assay was carried out in three independent
experiments, and results are reported as mean ± SD.

and 100–200 mg/mL for IL-8 (p50.01) (Figure 2C). In the

same experimental conditions, by qRT-PCR technique we
also observed an approximately three times decreased in
IL-6 and IL-8 relative levels, normalized with b-actin, when
cells were treated with 100 and 200 mg/mL of total lipids
(Figure 2B and D). In contrast, untreated cells incubated
with growing concentrations of total lipids from human
breast milk, produced statistically significant increased
quantities and expression levels of IL-10, an anti-inflamma-
tory cytokine, by effect of high total lipid concentrations
(100 and 200 mg/mL) (Figure 2E–F). DMSO at 0.1%
incubation by 48 h did not increase the basal levels of
IL-10 produced by Caco-2 cells. Together, these results
suggest that total lipids from human breast milk have an
anti-inflammatory effect in Caco-2 cells, evidenced by the
downregulation of pro-inflammatory cytokines and upregu-
lation of IL-10.
Major phospholipids and fatty acids present in human
breast milk have an anti-inflammatory effect in Caco-2
cells
Knowing that human breast milk lipids have an anti-
inflammatory effect, we further investigated the specific
lipids that could be responsible for the observed cytokine
regulation on epithelial colon cells. Therefore, we treated
Caco-2 cells with 100 ng/mL of specific phospholipids, fatty
acids or DMSO (0.1%) for 48 h. In some experiments, cells
were pre-incubated by 24 h with LPS (1 mg/mL), before
treatment with total lipids for 48 h. qRT-PCR and ELISA were
assayed for quantification of mRNA expression and secreted
protein concentration of cytokines. As we previously
described, treatment with LPS showed significantly higher
expression levels and concentrations of IL-6 and IL-8 than
untreated cells; and the addition of 0.1% DMSO, did not
 DOI: 10.3109/14767058.2015.1091879 Cytokine modulation by human breast milk lipids 5
Downloaded by [University of Otago] at 14:59 07 October 2015

Figure 3. Effect of major phospholipids and fatty acids present in human breast milk on IL-6, IL-8 and IL-10 production in Caco-2 cells. Cells were
grown in 24-well plates to 50% confluence and then serum-starved for 24 h. Then, Caco-2 cells were treatment with 100 ng/mL of specific
phospholipids, fatty acids or DMSO (0.1%) for 48 h. In some experiments, cells were pre-incubated by 24 h with LPS (1 mg/mL), before treatment with
total lipids for 48 h. Subsequently, RT-PCR technique was used to determine gene expression at the mRNA level or supernatant was collected for
determination of cytokine protein expression. It is shown the cytokine protein secretions expressed as mg/mL (A, C and E) and the relative amount of
mRNA product quantiEed and normalized with b-actin are expressed as fold change, (B, D and F) as indicated. Negative control is represented by
incubation with capric acid. Each assay was carried out in three independent experiments, and results are reported as mean ± SD.

modified this response. The screening with different specific
lipids found in human milk showed that the major anti-
inflammatory effects observed were from incubation with
phospholipids: phosphatidylcholine and phosphatidylserine,
and the fatty acids: palmitoleic acid, oleic acid and AA. These
lipids significantly decreased IL-6 and IL-8 concentrations
at values similar to the basal level, highlighting that the
palmitoleic acid and phosphatidylcholine produced the
biggest effect (Figure 3A–D). In the same way, we observed
an increase of approximately 2 and 5 times in IL-10
concentration and expression levels, respectively, by effect
of the same phospholipids and fatty acids described above
(Figure 3E–F). Capric acid did not show the downregulation
of pro-inflammatory cytokines or the upregulation of anti-
inflammatory cytokines observed by incubation with the
others lipids. This structurally similar fatty acid, is not
reported as a component of human breast milk, so it was
employed as a negative control in the experiments. Therefore,
we showed that not related specific lipids could produce an
anti-inflammatory effect as the one observed by total lipids
from human breast milk in Caco-2 cells.
Perhexiline maleate inhibits pro-inflammatory
cytokine downregulation produced by phosphatidyl-
choline and palmitoleic acid in Caco-2 cells
The lipid transport mediators were evaluated in the same
experimental system on epithelial colon cancer cells. For this,
cells were pre-incubated by 24 h with LPS (1 mg/mL), before
treatment with phosphatidylcholine or palmitoleic acid
(100 ng/mL) for 48 h. In order to evaluate the effect of lipidic
transport, in some experiments cells were treated also with
perhexiline maleate (80 mM). Incubation with these two
specific lipids caused a decrease in pro-inflammatory
 6 G. J. Barrera & G. Sánchez J Matern Fetal Neonatal Med, Early Online: 1–8

Figure 4. Inhibitory effect of perhexiline

maleate on pro-inflammatory cytokine
downregulation produced by phosphatidyl-
choline and palmitoleic acid in Caco-2 cells.
Cells were grown in 24-well plates to 50%
confluence and then serum-starved for 24 h.
Then, Caco-2 cells were pre-incubated by
24 h with LPS (1 mg/mL), before treatment
with phosphatidylcholine or palmitoleic acid
(100 ng/mL) for 48 h. In some experiments,
cells were treated also with perhexiline
maleate (80 mM). The figure shows IL-6 and
IL-8 concentration expressed as mg/mL (A)
and the relative amount of mRNA normalized
with b-actin and expressed as fold change,
(B) in presence or absence of perhexiline
maleate, as indicated. Each assay was carried
out in three independent experiments, and
results are reported as mean ± SD.
Downloaded by [University of Otago] at 14:59 07 October 2015

cytokine production, as we previously described. Treatment
of Caco-2 cells with an inhibitor of lipid transport, the
perhexiline maleate, caused the re-establishment of IL-6 and
IL-8 levels, where values were compared to LPS-stimulated
cells (Figure 4A–B). We observed that perhexiline maleate
offsetting the anti-inflammatory response produced by
phosphatidilcholine (PC) and palmitoleic acid, by inhibiting
the lipid transport into Caco-2 cells.
Discussion
The importance of breast milk lipids role in the development
of the infant has been studied in the past two decades; the
unique composition and proportion of lipids have been unable
to reproduce in commercial formulas [18]. In comparative
studies, scientist have proved that infants breastfed have a
decreased risk to suffer gastrointestinal diseases such as NEC
in relation to formulae-fed infants [5]. In this sense, it is
thinkable that some of the lipids intake must be related to
defense against gastrointestinal diseases, but the exact mech-
anism and composition of lipids needed has not been
elucidated. It is known that gastrointestinal maturation of
the infant is related to exposition to bacterial colonization that
will create a balance between the tolerance to commensal own
bacterial flora and the recognizing of pathogens microorgan-
isms by the immune system in the next years of life [19]. The
presence of bacteria in the intestinal tract is essential for food
digestion, control of intestinal epithelial homeostasis, intes-
tinal development and human health [20] Although, when an
unbalance of this system is created, the intestinal cells will
recognize all the bacteria as foreign bodies, and will initiate a
strong immune response against them, affecting intestinal
cells by cytokines and chemokines production, which pro-
longed exposure could reduce both electrolyte transport and
barrier capacity to macromolecules through cellular and
paracellular pathways, with the concomitant abnormal infil-
tration of mast cells and lymphocytes [21]. This biological
process is one of the theories that lead to inflammatory
gastrointestinal diseases and also a relationship between
infective microenvironment agents and human colorectal
cancer has been suggested by some authors [22,23].
In order to evaluate the effect of human milk lipids fraction
in cancer colon cells, we observed that stimulation of Caco-2
cells with a bacterial agonist, LPS produce high values of
CRP and peroxidase activity, two inflammation markers.
Nonetheless, total lipids from human breast milk were able to
decrease the CRP concentration and peroxidase activity,
directly proportional to the growing lipidic fraction
 DOI: 10.3109/14767058.2015.1091879
concentration. The notable anti-inflammatory response of
intestinal epithelial cells by lipids isolated from human breast
milk was confirmed by the significant decrease in peroxidase
activity. It is known that inflammatory bowel diseases
(Crohn’s disease and ulcerative colitis) exhibit increase in
peroxidase activity. Peroxidase is considered to be a marker of
the activation and degranulation of polymorphonuclear cells
[17]. In inflammatory disease, activated polymorphonuclear
cells produce reactive oxygen species (ROS), and peroxidase
is involved in this process. We have shown that cells treated
with lipids have a significantly lower peroxidase activity. It is
therefore possible that lipids could reduce the symptoms of
human inflammatory bowel disease. Later, we evaluated the
effect of total lipids on mRNA expression levels and
quantities of cytokines produced by LPS-stimulated Caco-2
cells. In this regard, we observed a decrement between 2 and
3 times in the expression levels and concentration of IL-6 and
IL-8 (Figure 2) and a consequent increase in IL-10 production
by growing concentrations of the lipidic fraction. These
Downloaded by [University of Otago] at 14:59 07 October 2015
results suggest that human breast milk lipids could have an
important role on the cytokine modulation in the newborn
bowel.
Therefore, we made a screening of commercial lipids that
are found at high concentration in human breast milk, and the
results showed that phospholipids: PC and phosphatidilserine;
and the fatty acids palmitoleic acid, oleic acid and AA
reproduced the effect observed with the total lipidic fraction
(Figure 3). It is important to highlight that capric acid, a
structurally similar fatty acid, that is not reported in human
breast milk did not produce this anti-inflammatory effect,
showing the versatility and specificity of the lipids role that
are present in human breast milk. PC has been reported as an
anti-inflammatory lipid. Recent studies show that patients that
suffer any colon inflammatory disease, such as ulcerative
colitis, have a lower PC content than healthy individuals. As
well as they observed that PC treatment to these patients
showed a decrease in the inflammatory activity [24].
Likewise, in-vitro experiments with cell lines have shown
that pretreatment with PC inhibited the inflammatory
response in Caco-2 cells stimulated with TNF-a, while
another phospholipids as sphingomielin did not show this
effect [25].
Fatty acids effect on inflammatory response has also been
studied. AA (unsaturated) promotes an anti-inflammatory
response in macrophages, with the inhibition of COX-2, iNOS
and IL-1a gene expression [26]. In other hand, it has been
shown that nitration products of unsaturated fatty acid such as
nitrooctadecanoic 9-or-10 oleic acid is an agonist of PPARg,
and produce a decrease in inflammatory activity into a bowel
disease experimental model [27]. For palmitoleic acid, there
are not reports in relationship with an immune modulatory
response. Nevertheless, it is present at high concentration in
human breast milk, 25% from general fatty acid composition,
and this is the first time that an anti-inflammatory effect have
been reported. Finally, we describe that anti-inflammatory
effect of human breast milk lipid in intestinal cells could be
suppressed by perhexiline maleate, that recently has been
described as an inhibitor of the fatty acid transporter protein
(FATP) [28]. FATPs are integral membrane proteins, possibly
conformed by six transmembrane domains, that in intestinal
Cytokine modulation by human breast milk lipids 7
class of this protein, the FATP4 is located primarily in the
apical surface of the duodenal brush-border in mouse
enterocytes, with small amounts located in vesicles near to
the apical plasma membrane [29,30]. It is important to
highlight that Stahl et al. observed that FATP4 treatment of
primary enterocytes with antisense FATP4 oligonucleotides
inhibited [3H]- oleate uptake [30], one of the fatty acids
studied in the present work. FATPs are not well characterized
yet, but preliminary studies suggest that it transports the fatty
acid in an ATP-dependent covalent binding of AMP to their
substrates, because of the presence of an AMP binding
sequence located in the first 300 amino acids, that is found in
several transporters of hydrophobic proteins [29].
Declaration of interest
The authors report no conflict of interest.
References
1. Dorea JG, Fenton SE, LaKind JS, Berlin Jr. CM. Researching
chemicals in human milk can be conducted without discouraging
breastfeeding. Bosn J Basic Med Sci 2012;12:137–8.
2. Semenov DV, Kanyshkova TG, Kit YY, et al. Human breast milk
immunoglobulins G hydrolyze nucleotides. Biochemistry Mosc
1998;63:935–43.
3. Bernt K, Walker W. Human milk as a carrier of biochemical
messages. Acta Paediatr Suppl 1999;88:27–41.
4. Grazioso CF, Werner AL, Alling DW, et al. Antiinflammatory
effects of human milk on chemically induced colitis in rats. Pediatr
Res 1997;42:639–43.
5. Lucas A, Cole TJ. Breast milk and neonatal necrotising entero-
colitis. Lancet 1990;336:1519–23.
6. Moya FR, Eguchi H, Zhao B, et al. Platelet-activating factor
acetylhydrolase in term and preterm human milk: a preliminary
report. J Pediatr Gastroenterol Nutr 1994;19:236–9.
7. Chatterton DE, Nguyen DN, Bering SB, Sangild PT. Anti-
inflammatory mechanisms of bioactive milk proteins in the
intestine of newborns. Int J Biochem Cell Biol 2013;45:1730–47.
8. Barrera GJ, Sanchez G, Gonzalez JE. Trefoil factor 3 isolated from
human breast milk downregulates cytokines (IL8 and IL6) and
promotes human beta defensin (hBD2 and hBD4) expression in
intestinal epithelial cells HT-29. Bosn J Basic Med Sci 2012;12:
256–64.
9. Field C. The immunological components of human milk and
their effect on immune development in infants. J Nutr 2005;135:
1–4.
10. Koletzko B, Rodriguez-Palmero M, Demmelmair H, et al.
Physiological aspects of human milk lipids Early Hum Dev 2001;
65:S3–18.
11. Innis S. Human milk: maternal dietary lipids and infant develop-
ment. Proc Nutr Soc 2007;66:397–404.
12. Koletzko B, Agostoni C, Bergmann R, et al. Physiological aspects
of human milk lipids and implications for infant feeding: a
workshop report. Acta Paediatr 2011;100:1405–15.
13. Valentine CJ. Maternal dietary DHA supplementation to improve
inflammatory outcomes in the preterm infant. Adv Nutr 2012;3:
370–6.
14. Folch J, Lees M, Sloane Stanley GH. A simple method for the
isolation and purification of total lipides from animal tissues. J Biol
Chem 1957;226:497–509.
15. Reznick AZ, Klein I, Eiserich JP, et al. Inhibition of oral peroxidase
activity by cigarette smoke: in vivo and in vitro studies. Free Radic
Biol Med 2003;34:377–84.
16. Okamura JM, Miyagi JM, Terada K, Hokama Y. Potential
clinical applications of C-reactive protein. J Clin Lab Anal 1990;
4:231–5.
17. Biasucci LM, D’Onofrio G, Liuzzo G, et al. Intracellular neutrophil
myeloperoxidase is reduced in unstable angina and acute myocar-
dial infarction, but its reduction is not related to ischemia. J Am
Coll Cardiol 1996;27:611–16.
 8 G. J. Barrera & G. Sánchez
18. Smit EN, Martini IA, Kemperman RF, et al. Fatty acids in formulae
for term infants: compliance of present recommendations with the
actual human milk fatty acid composition of geographically
different populations. Acta Paediatr 2003;92:790–6.
19. Stockinger S, Hornef MW, Chassin C. Establishment of intestinal
homeostasis during the neonatal period. Cell Mol Life Sci 2011;68:
3699–712.
20. Hooper LV, Gordon JI. Commensal host-bacterial relationships in
the gut. Science 2001;292:1115–18.
21. Hiribarren A, Heyman M, L’Helgouac’h A, Desjeux JF. Effect of
cytokines on the epithelial function of the human colon carcinoma
cell line HT29 cl 19A. Gut 1993;34:616–20.
22. Parkin DM. The global health burden of infection-associated
cancers in the year 2002. In Int J Cancer 2006;118:3030–44.
23. Marchesi JR, Dutilh BE, Hall N, et al. Towards the human
colorectal cancer microbiome. PLoS ONE 2011;6:e20447.
24. Schneider H, Braun A, Füllekrug J, et al. Lipid based therapy for
ulcerative colitis-modulation of intestinal mucus membrane
phospholipids as a tool to influence inflammation. Int J Mol Sci
2010;11:4149–64.
Downloaded by [University of Otago] at 14:59 07 October 2015
J Matern Fetal Neonatal Med, Early Online: 1–8
25. Treede I, Braun A, Sparla R, et al. Anti-inflammatory effects of
phosphatidylcholine. J Biol Chem 2007;282:27155–64.
26. Lee JY, Sohn KH, Rhee SH, Hwang D. Saturated fatty acids, but
not unsaturated fatty acids, induce the expression of cyclooxygen-
ase-2 mediated through Toll-like receptor 4. J Biol Chem 2001;276:
16683–9.
27. Borniquel S, Jansson EA, Cole MP, et al. Nitrated oleic
acid up-regulates PPARgamma and attenuates experimental
inflammatory bowel disease. Free Radic Biol Med 2010;48:
499–505.
28. Li H, Black PN, Chokshi A, et al. High-throughput screening for
fatty acid uptake inhibitors in humanized yeast identifies atypical
antipsychotic drugs that cause dyslipidemias. J Lipid Res 2008;49:
230–44.
29. Stahl A, Hirsch DJ, Gimeno RE, et al. Identification of the
major intestinal fatty acid transport protein. Mol Cell 1999;4:
299–308.
30. Stahl A, Gimeno RE, Tartaglia LA, Lodish HF. Fatty acid transport
proteins: a current view of a growing family. Trends Endocrinol
Metab 2001;12:266–73.