RNA Synthesis March 20

Topics To Be Covered
RNA Synthesis, Processing, Central dogma.

& Modification The structure of the gene;

 Gene Promoter
Transcription Apparatus;
 RNA Polymerase

RNA synthesis (Transcription).

Post-transcriptional processing of RNA
UNIVERSITY OF LIBERIA Regulation & Antibiotic Inhibitors of
A.M. Dogliotti College of Medicine
Department of Medical Biochemistry
By Mehidi K. Asst. Prof of Biochemistry 2019/20
Transcription
Mehidi K. 3

RNA is synthesized from a DNA template

Learning Objectives


 by an RNA Polymerase
 After reading this chapter you should be able
to:  the processes of DNA & RNA synthesis
 Describe the major steps in transcription of an  are similar in that they involve:
RNA molecule.
1. The general steps of initiation, elongation, &
 Explain the function of the different RNA termination with 5' to 3' polarity
polymerase enzymes.
2. Large, multicomponent initiation complexes
 Describe the different processing & splicing
events; 3. Adherence to Watson-Crick base-pairing rules
 that occur during synthesis of eukaryotic mRNAs.

Mehidi K. 2 Mehidi K. 4

Mehidi Kassim, Asst. Professor of Biochemistry 1

RNA Synthesis
 These processes differ in several important
ways, including the following:
1.Ribonucleotides are used in RNA synthesis rather
than deoxyribonucleotides
2. U replaces T as the complementary bp for A in RNA
3.a primer is not involved in RNA synthesis
4.only a portion of the genome is transcribed or
copied into RNA,
 whereas the entire genome must be copied during DNA
replication;
5.there is no proofreading function during RNA
transcription
Mehidi K.
 The process of synthesizing RNA from a
DNA template:
 has been characterized best in prokaryotes
 Although in mammalian cells;
 the regulation of RNA synthesis & the processing of the
RNA transcripts are different from those in prokaryotes,
 The process of RNA synthesis per se is;
 quite similar in these two classes of organisms
The description of RNA synthesis in prokaryotes,
 where it is better understood,
 is applicable to eukaryotes even though;
 the enzymes involved & the regulatory signals,
though related, are different
Mehidi K.
Mehidi Kassim, Asst. Professor of Biochemistry
March 20
Transcription (RNA Synthesis)
 The structure of the gene: Fig-1
 The transcription unit (i.e., a gene) is a sequence
(stretch) of DNA, which consists of:
a) the regulatory gene response sequences
(enhancer/silencer),
b) the basal rate controlling sequence (the promoter),
c) the transcription initiation start point,
d) the gene proper, and
e) the transcription termination sequence
 b/n genes or islands of related genes there are
insulator sequences;
 that separate the coordinately regulated gene(s)
 so as regulatory sequences would work only on these
isolated gene(s)
5 Mehidi K. 7
A. The gene enhancer/silencer,
 are cis-acting response sequences
 that regulate the rate of gene expression through
 specific binding into transacting basal transcription
machinery regulatory proteins.
B. The gene promoter region or
 transcription initiator sequence up-stream the gene
proper
 provides the region of binding of the RNA polymerase
C. Transcribed region or gene proper,
 the DNA sequence that is copied as hnRNA or
 other types of RNAs that is mostly composed of
 introns & exons in eukaryotes,
 but introns-containing genes are very rare in prokaryotes
6 Mehidi K. 8
2
RNA Synthesis March 20

D. Termination region, Structure & Function of the Gene Promoter

 It is transcription initiator sequence
 a regulatory DNA sequence down-stream the gene
 works in the same orientation of the gene reading
proper of some genes, at w/c; frame (3'5')
 the RNA polymerase disassembles from the DNA template  is located in a close continuity with the gene proper
 RNA polymerase binds DNA template at the gene
TCCGGTAATTTGGGCGCTAATTTCCCG
5' 3' Coding Strand promoter:
AGGCCATTAAACCCGCGATTAAAGGGC  to initiate the basal (unregulated) rate of transcription
3' 5' Template Strand
Enlancer/ Terminator  Some promoters are weak & others are strong,
silencer/ Gene proper sequence  with a rate of transcription that is much faster
Promoter  nevertheless there are certain promoter less genes
 One gene may also have more than one promoter;
UCCGGUAAUUUGGGCGCUAAUUUCCCG
5' 3'RNATranscript  to be used differentially according to tissue specific needs

Mehidi K. 9 Mehidi K. 11

 RNA polymerase also must recognize which genes to transcribe Characteristics of Prokaryotic Promoter in
 b/c transcribed genes are only a small fraction of the total DNA
 the genes that are transcribed:
the E coli
 differ from one type of cell to another &  it is the region recognized by RNA polymerases
 change with changes in physiologic conditions  it is simpler than eukaryotic promoter
 The signals in DNA that RNA polymerase recognizes are  is formed of three parts: Fig-2
called promoters;
 promoters are sequences in DNA (often composed of smaller i. Pribnow or TATA box:
sequences called boxes or elements)  It is a 6 bp stretch; 5'-TATAAT-3'
 that determine the start point & the frequency of transcription  located 10 nt upstreams the transcription start
 b/c they are located on the same molecule of DNA and near the site
gene they regulate,
ii.The spacer stretches of nucleotides of:
 they are said to be cis acting (i.e., “cis” refers to acting on the same side)
 about 10 bp in b/n the Transcription start & Pribnow box
 Proteins that bind to these DNA sequences & facilitate or prevent
the binding of RNA polymerase,  about 19 nt in b/n the Pribnow box & the -35 region,
 are said to be trans acting Fig-on next slide
Mehidi K. 10 Mehidi K. 12

Mehidi Kassim, Asst. Professor of Biochemistry 3

RNA Synthesis March 20

iii.The -35 region:  Still ~25% of the genes have:

 Initiator sequence &
 It is a stretch of 8 nt; 5'-TGTTGACA-3'
 Downstream promoter sequence; A/GGA/TCGTG,
 Located about 35 nt upstream the transcription start
 25 bp downstream transcription start site
site
 The remaining ~15 of the genes contain the 3
 Both Pribnow box & the -35 region are elements:
 recognized by RNA polymerases
 TATA, initiator & downstream promoter sequences
 These elements determine where transcription
-35 -10 starts;
DNA TGTTGACA 19 nucleotides TATAAT 10 nucleotides +1 RNA Transcription Start  through the binding of the:
 TATA binding protein (TBP) & its
-35 Region Pribnow Box associating factors (TAFs)
 that form the TFIID complex,
Sequences recognized by RNA Polymerase
 to recruit the RNA polymerase
Mehidi K. 13 Mehidi K. 15

Example of Eukaryotic Promoter: ii. The spacer stretches of about;

 it is more complex than the prokaryotic one  25 bp DNA b/n the transcription start & TATA box
 consists of at least 3 parts:
 40 nucleotides b/n the CAAT box & TATA box
i. Hogness or TATA box: Fig-2a
 It is an 8 bp stretch of DNA, e.g., 5'-TATAAAAG-3' iii.cis-acting upstream promoter elements:
 located 25-30 nt upstream the transcription start site
 e.g., CAAT box,
 ~30% of the eukaryotic genes do not have TATA box;
 instead they have Initiator Sequence that spans the  a 9 bp stretch of nucleotides; 5'-GGNCAATCT-3'
transcription start site –3 to +5,
 located about 70 to 80 nt upstreams the site for
 e.g.,TCAG/TTT/C start of transcription and
 ~30% of the stronger genes have both:
 TATA & Initiator Sequences
 GC boxes, e.g., 5'-GGGCGG-3’

Mehidi K. 14 Mehidi K. 16

Mehidi Kassim, Asst. Professor of Biochemistry 4

RNA Synthesis March 20

 Specific trans-activating proteins;  The response elements may:

 bind these elements by their DNA-binding domain  activate transcription above the basal rate,
 interact with basal transcription machinery through their
are called Enhancer elements or
trans-activation domains
 They control the frequency of transcription:  suppress transcription below the basal rate,

 initiation for the basal rate of expression are called Silencer/Repressor elements

 Depending on their type, they are less rigid in:  They mediate responses to various signals;
 their orientation dependency than the TATA box group  Including:
 hormones,
-70 -25 -3 Initiator +5 +25 Downstream Promoter
 environmental changes &
DNA GGNCAATCT TATAAAAG TCAG/TTT/C A/GGA/TCGTG  toxins such as dioxin
CAAT Box TATA Box +1 RNA Transcription Start  though interaction with a large number of specific
37 nucleotides 25 nucleotides
transcription factors
Sequences recognized by RNA Polymerase
Mehidi K. 17 Mehidi K. 19

Gene Response Elements (Enhancer or  The best examples for these elements are the
hormone-response elements:
Silencer)
 for steroid-thyroid superfamily of hormones,
 are transcription regulatory sequences that may be:  including vitamins D &A
 remote from the gene by hundreds or thousands of nt’s;
Transcription Factors:
 up- or down-stream the gene proper, or
 are activator or suppressor proteins
 even within the transcription unit
 that bind at these elements & interact with:
 work in an orientation-independent manner  RNA polymerases directly or indirectly through
 There are hundreds of types of response elements;  coactivator or corepressor proteins
 to increase or decrease rate of transcription
 with rigid or flexible sequence

Mehidi K. 18 Mehidi K. 20

Mehidi Kassim, Asst. Professor of Biochemistry 5

RNA Synthesis March 20

 Transcription factors have certain specific kind of Structure & Types of Prokaryotic & Eukaryotic DNA-
secondary structures, dependent RNA Polymerases
 i.e., motifs for the interaction with the responsive  Transcription is the process of synthesis of
DNA elements
complementary RNA copies:
 Zinc-finger motif is one common secondary
structure for these factors  from specific regions along the length of gene DNA,
 Tens of these elements may work on one gene  i.e., the gene proper
with the transcription factors binding to them in:  using DNA-dependent RNA polymerase (RNAP) &
 a cooperative, agonistic, ribonucleotides

 synergistic or antagonistic fashion  The general characteristics of the RNAP from

eukaryotes & prokaryotes:
 This brings about the tissue-specific pattern of
gene expression:  are compared in the following Fig-A,B & Table-1
 such as albumin gene in the liver  they do not have proofreading ability
Mehidi K. 21 Mehidi K. 23

 Genes usually have several regulatory elements but

some genes have none;
 such as the constitutional or housekeeping genes
 that have a constant rate of basal transcription
 The interaction & the mechanism of binding of transcription factors with the
responsive elements is depicted in figure below:

Fig-A. RNA polymerase (RNAP).

 Catalyzes the polymerization of ribonucleotides into an RNA sequence
that is complementary to the template strand of the gene.
Mehidi K. 22 Mehidi K. 24

Mehidi Kassim, Asst. Professor of Biochemistry 6

RNA Synthesis March 20

Table-1b. Nomenclature & Properties of Mammalian

Nuclear DNA-Dependent RNA Polymerases
Major Products Sensitivity to
-Amanitin, NB

rRNA Insensitive
High
mRNA, miRNA Sensitivity

tRNA + Intermediate
Sensitivity
Fig-B. Comparison of Three-Dimensional Structures of Bacterial & 5S rRNA, snRNA
Eukaryotic RNA Polymerases
Mehidi K. 25 27

Table-1a. Comparison of General Characteristics of RNA
Polymerase (RNAP) In Eukaryotes & Prokaryotes
RNAP In Prokaryotes
A single type of RNA polymerase
 that is responsible for synthesis of all
types of RNA
Products of RNA polymerase require
 slight or no modification after
transcription
The holoenzyme is formed of five
subunits:
 two identical  subunits,
 two similar but not identical ' the
catalytic subunits &
 a regulatory  subunit (2')
The core part of the enzyme is formed
of the four 2' subunits.
 The mushrooms picked by Amanda Tin contained
-amanitin, an inhibitor of eukaryotic RNA polymerases
 It is particularly effective at blocking the action of RNAP-II
RNAP In Eukaryotes
3 types of RNA polymerases;  This toxin initially causes GI disturbances, then:
 each is specific for the synthesis of a  electrolyte imbalance & fever,
specific type of RNA  followed by liver & kidney dysfunction
Mostly require extensive  b/n 40 & 90% of the individuals who ingest -amanitin
 post-transcriptional modifications  die within a few days NB
particularly in mRNA
They are much complex in structure
 formed of 2 large (homologous to
') & up to 14 small subunits
The 3 types of RNA polymerases are:
 RNA polymerase I
 RNA polymerase II
 RNA polymerase III
Mehidi K. 26 Mehidi K. 28

Mehidi Kassim, Asst. Professor of Biochemistry 7

RNA Synthesis March 20

Steps of Transcription Fig-TT  RNA polymerase recognizes the promoter

region:
I. Initiation Fig-IE
 occurs on a single strand of a transcription unit (a  by the help of the  (sigma) factor Fig-3a
gene) that is;
 called template (non-coding or non-sense) strand
 that then recruits the core enzyme (2') for
tight binding into DNA
 complementary to the RNA,
 it never occurs in the other strand,  There are several types to  factors:
 non-template, coding or sense strand
 that recognize different promoters
 coding strand is similar to mRNA sequence,
 except for U/T exchange  to differentially control gene transcription;
 according to the growth & environmental conditions
of the bacterium
29 Mehidi K. 29 Mehidi K. 31

 The core enzyme unwinds 17-20 bp nt;

 ~60 bp in eukaryotes, from –30 to +30,
 to separate the two strands
 i.e., the transcription bubble Fig-IE
 The template strand is read in 3'5'  this requires:
 so that the synthesized RNA will be formed in  unwindase, disruption of the nucleosome structure
5'3’  the participation of topoisomerases
 w/c DNA strand is the template & w/c is the  The enzyme complex then;
coding,  searches for the transcription initiation site
 differs from one gene to the other  an open reading frame starting at TAC
 but is always the strand that contains the  this process requires:
prompter sequence read in 3'5' direction  participation of topoisomerases

Mehidi K. 30 Mehidi K. 32

Mehidi Kassim, Asst. Professor of Biochemistry 8

RNA Synthesis March 20

 The synthesized RNA:  with the release of a PPi each time

 always starts with a purine that enters at,
 the initiation site of the enzyme
 this 5’-purine ribonucleotide at the 5’ end;
 retains its triphosphate & stays in mature mRNA
 When the 2nd nt enters at the elongation site
of the enzyme; Fig-3b
 it forms a phosphodiester bond b/n:
 3'-OH group of ribose of the 1st nt &
 5'-OH of the phosphate group on C5 of ribose of the
2nd nt
 While on the promoter, the polymerase;
 synthesizes 10 – 20 nt stretch of RNA
Mehidi K.
 a new nt is added to the growing RNA chain
 Pyrophosphatases hydrolyze PPi into 2 Pi;
 to ensure irreversibility of the polymerization
 The RNA polymerase continues transcription
 from 3' towards 5' end of the template strand
 according to the base pairing role in an anti-
parallel manner Fig-3a,b
 Elongation continues,
 through the termination sequence
33 Mehidi K. 35

II. Elongation: Fig-IE  This suggests that RNA polymerase has associated
with it;
 The  Factor is released before elongation
starts:  an "unwindase" activity that opens the DNA helix

 leading to core enzyme conformational change  The fact that the DNA double helix must unwind &
 that enables its translocation to clear the  the strands part at least transiently for transcription
promoter implies;
 some disruption of the nucleosome structure of eukaryotic
 The 4 ribonucleotides triphosphate; cells
 ATP, GTP, CTP & UTP
 Topoisomerase both precedes & follows the
 continue to enter into the polymerization (or progressing RNAP; Fig-3c
elongation) site of  unit
 to prevent the formation of super helical complexes
Mehidi K. 34 Mehidi K. 36

Mehidi Kassim, Asst. Professor of Biochemistry 9

RNA Synthesis March 20

b.rho-independent termination:
III.Termination of Transcription:
◦ The rho-independent termination, is similar to:
 Inaddition to knowing where to start  that described for eukaryotic transcription, except that;
transcription,  the secondary structure & sequences involved are much better
 RNA polymerase must have a defined site at w/c: characterized in bacterial cells
 to stop RNA synthesis,
◦ In rho-independent termination, a hairpin loop is
 so that the appropriate size of transcript is produced
formed; Fig-12b
 Transcription termination in bacterial cells
 just before a sequence of 6 to 8 uridine (U) residues
occurs by:
 near the 3' end of the newly synthesized RNA
 one of two well-characterized mechanisms
 the formation of this secondary structure dislodges,
a) rho () factor dependent or
 the RNA polymerase from the DNA template,
b) rho () factor independent
 resulting in termination of RNA synthesis in the U stretch
Mehidi K. 37 39

a. rho-dependent termination :  In eukaryotic cells:

 The rho () factor: Fig-12a
 is an ATP-dependent RNA-stimulated helicase
 that recognizes & binds the termination sequence (~40 bp)
 in the template DNA,
 then; it disassembles the enzyme/RNA/DNA complex
 The termination sequence may occur:
 hundreds of base-pairs downstream the site at w/c poly(A)
tail is added in mRNA
 An RNA endonuclease cleaves;
 the primary RNA transcript at 15 - 31 bases 3’ of,
 the cleavage consensus sequence, i.e., AAUAAA
 the poly(A) tail is added to this new 3’ end
Mehidi K.
 termination is less well defined
 it appears to be somehow linked both to;
 initiation & addition of the 3' polyA tail of mRNA
 could involve destabilization of the RNA-DNA complex
 at a region of A–U base pairs
 More than one RNAP molecule may transcribe;
 the same template strand of a gene simultaneously,
 but the process is phased & spaced in such a way that:
 at any one moment each is transcribing a different
portion of the DNA sequence
38 Mehidi K. 40

Mehidi Kassim, Asst. Professor of Biochemistry 10

RNA Synthesis March 20

◦ The 3 eukaryotic RNA polymerases employ;  Rifamycin:

 binds to the core enzyme & occupy the substrate
 different mechanisms to terminate transcription, for e.g., binding site to inhibit,
RNA polymerase I uses a specific protein,  binding of the incoming nucleotides to the initiation
site of the prokaryotic system
 to terminate the transcription of rRNAs
 Actinomycin D:
whereas RNA polymerase III uses:  binds DNA template & inhibiting its transcription
 a specific termination sequence  by preventing translocation of RNAP along DNA

In contrast, RNA polymerase II is more versatile,  Streptoglydigin:

 it binds with the β subunit of prokaryotic RNAP
 utilizing both sequence & protein factors to  thus inhibits the elongation
facilitate:  Heparin:
 pausing of the polymerase &  is a poly anion & binds to the β’ subunit of the RNAP
& inhibits transcription in vitro
 termination of transcription Mehidi K. 41
41 Mehidi K. 43

Regulation & Antibiotic Inhibitors of Post-Transcriptional Modification of

Transcription: RNA
◦ Processing of freshly synthesized transcript in the
 Covalent modification nucleus;
 is different depending upon the type of RNA
 RNAP are zinc containing metalloenzymes  hence processing of mRNA, tRNA & rRNA is discussed
separately
 Several RNAP;
 may transcribe same gene simultaneously
I. Processing of mRNA: Fig-6a,b
 but in a phase & spaced manner ◦ Eukaryotic crude transcript of mRNA produced in
the nucleus is called
 Eukaryotic RNAP & the other transcription
 pre-mRNA or heterogeneous nuclear RNA (hnRNA)
regulators are under control;
◦ The newly synthesized hnRNA might be a complex
 by activating phosphorylation  inactivating transcript;
dephosphorylation mechanisms
 carrying information about more than one RNA (i.e.,
polycistronic)
Mehidi K. 42 Mehidi K. 44

Mehidi Kassim, Asst. Professor of Biochemistry 11

RNA Synthesis March 20

… cont’d

 Further, transcript of the mRNA of the genes

could contain:
 the intervening sequences known as ‘Introns’
 w/c have to be removed
 the ‘Exons’ joined together (splicing)
 This transcript undergoes various modifications w/c
are also designed for:
 the purpose of identification of different type of
RNA &
NB.The Cap Structure in Eukaryotic mRNA.
 increasing the half life & rate of its usage The phosphates in blue originated from the original
RNA transcript;
Mehidi K. 45 The phosphate in black comes from GTP. Mehidi K. 47

 Post-transcriptional processing of mRNA includes: b. Addition of polyadenylate 3'-tailing: Fig-8a, 8b

 decreasing its size, 5'-capping & 3'-tailing along with the
post-maturation mRNA editing Fig-6a,b
 Addition of 20-250 polyadenylate tail at the 3'-end

a. Capping: S-58 Fig-7a,b  By the action of polyadenylate polymerase

 It is the prompt addition of 7-methyl-GTP to the 5'-
end of hnRNA;
 by guanylate transferase after its transcription
 The cap is attached by 5' to 5' triphosphate linkage
 The function of this structure is:
 The enzyme 1st recognizes the specific polyA
addition signal;
 AAUAAA at the mRNA 3'-UTR,
 where its endonuclease activity cuts extra sequences
to 11 - 30 bases 3' downstream this signal.

 it enhances subsequent hnRNA processing & the  The tail protects 3'-end of mRNA from 3'5'
translation of mRNA, exonuclease &
 protects mRNA from the action of 5’  3’ exonucleases
& phosphatases facilitates mRNA transport into cytoplasm
controlling its half-life
Mehidi K. 46 Mehidi K. 48

Mehidi Kassim, Asst. Professor of Biochemistry 12

RNA Synthesis
Fig-8. Synthesis of the poly(A)
tail:
 As RNA polymerase continues to
transcribe the DNA, enzymes;
 cleave the transcript (hnRNA) at
a point:
 10–20 nt’s beyond an AAUAAA
sequence,
 just before a run of Us (or Gs)
 250 adenine nucleotides are then
added to the:
 3’-end of the hnRNA, one
at a time,
 by poly(A) polymerase
Mehidi K.
Processing of eukaryotic mRNAs:
 Spliceosomes & lariats
◦ In the more complicated post-transcriptional
processing of eukaryotic mRNAs,
 sequences called introns (intervening sequences)
 are removed from the primary transcript &
 the remaining segments, termed exons (expressed sequences),
 are ligated, to form a functional RNA
◦ This process involves:
 a large complex of proteins & auxiliary RNAs called snRNAs
 w/c interact to form a spliceosome
Mehidi K.
Mehidi Kassim, Asst. Professor of Biochemistry
March 20
Spliceosome
 An aggregation formed in the nucleus of hnRNA,
 i.e., the blue script of mRNA or tRNA + 4 snRNAs; U1, U2, U5
& U4/U6 + more than 60 proteins
 There are highly splice conserved consensus
sequences at the 5'- & 3'-ends of essentially; Fig-9
 all intron-exon boundaries, e.g., 5’-GU/AG-3’
 The enzymatic activity of the spliceosome complex
resides in the snRNAs; called ribozymes
 Many introns are self-splicing, i.e.,
 they accurately & efficiently splice themselves without
requiring additional protein factors
 Removal of introns facilitates the transport of;
 mature mRNA from the nucleus to the cytoplasm
49  otherwise it will be degraded in the nucleus Mehidi K. 51
… cont’d
◦ A gene may contain 1 - 80 introns.
◦ Essentially all human genes contain introns
 except the histone & the rRNA genes
◦ Most introns have no known cellular function
 but a few may encode functional RNAs or proteins
◦ Introns also allow recombination b/n
 exons of different genes, i.e., exon shuffling
◦ Introns also may have regulatory role on
 gene expression by have regulatory sequences
50 Mehidi K. 52
13
RNA Synthesis March 20

… cont’d
c. Intron Removal (RNA Splicing):
◦ The function of the five snRNAs (U1, U2, U4, U5, U6) in
 The removal of an intron & rejoining of 2 exons;
the spliceosome is: Table-Sp
 to help position reacting groups within the substrate  can be considered to occur in two steps Fig-10 , 11
mRNA molecule,
 The 1st step involves: Fig-10
 so that the introns can be removed & the appropriate
exons can be spliced together precisely  the breaking of the phosphodiester bond at the
◦ The snRNAs accomplish this task; exon/intron boundary
 by binding, through base-pairing interactions,  at the 5' end of the intron
 with the sites on the mRNA that represent  is accomplished by a transesterification rxn, w/c occurs
 intron/exon boundaries b/n the:
◦ Accompanying protein factors are responsible for;  2'-OH of an adenosine nt usually found about 30 nt from
the 3' end of the intron, &
 holding the reacting components together to facilitate the
rxn  phosphate in the phosphodiester bond of a guanosine
residue located at the 5' end of the intron
Mehidi K. 53 Mehidi K. 55

… cont’d

Table-Sp. The function of snRNAs in the splicing  This rxn cleaves the nucleotide chain & produces a
branched structure in w/c; Fig-10
of mRNAs
 the adenine has 2', 3', & 5' phosphate groups.
snRNA Size Function
 The intron forms a looped structure
U1 165 nt Binds the 5'exon/intron boundary  similar in appearance to that of a cowboy's lariat
U2 185 nt Binds the branch site on the intron  The 2nd step in the rxn involves:
U4 145 nt Helps assemble the spliceosome  the cleavage of the phosphodiester bond
 at the 3' end of the intron,
U5 116 nt Binds the 3'intron/exon boundary
 w/c releases the lariat structure from the complex
U6 106 nt Helps assemble the spliceosome

Mehidi K. 54 Mehidi K. 56

Mehidi Kassim, Asst. Professor of Biochemistry 14

RNA Synthesis March 20

… cont’d
◦ Splicing is completed by the joining of
 the 3' end of one exon to the 5' end of the next
exon,
 through the formation of a regular 5'-3'
phosphodiester bond
◦ Typically, the 3' end of one exon will be
spliced to the 5' end of the next closest exon,
 producing a transcript that exhibits all the exons
in the order in w/c they were transcribed
Fig-TT.
The Transcription
Mehidi K. 57 Cycle In Bacteria 59
59

… cont’d
◦ However, depending on cell & tissue type,
 a single gene can give rise to multiple forms of mature
RNA transcripts
 by a process termed alternative RNA splicing

◦ In these instances, some exons may not be

represented in the final transcript,
 yielding an RNA that encodes a different protein.
◦ This process represents a major mechanism by w/c
Fig-1.
eukaryotic cells A Schematic View of
 control synthesis of different proteins from the same gene a Eukaryotic Gene, &
transcript in a cell- or tissue-specific manner Steps Required to
Produce a Protein
Mehidi K. 58 Product. Mehidi K. 60
60

Mehidi Kassim, Asst. Professor of Biochemistry 15

RNA Synthesis March 20

61 Fig-2a. Prokaryotic & Eukaryotic Promoters. Pu purine; Py pyrimidine-16

Mehidi K. 61 Fig-MT. Mechanism of Transcription. 63

Fig-UW. DNA Unwinding.

Fig-2b. Bacterial promoters, such as that from E coli shown here, share two
regions of highly conserved nucleotide sequence. Fig-TB.Transcription Bubble.
Mehidi K. 62 Mehidi K. 64

Mehidi Kassim, Asst. Professor of Biochemistry 16

RNA Synthesis March 20

Mechanism
Fig-3b. Transcription by RNA
polymerase in E. coli.
Fig-IE.Transcription Initiation & Elongation by E. coli RNA Note that this is essentially the same mechanism
polymerase. S-34, 39 Mehidi K. 65 67 used by DNA polymerases.
Mehidi K. 67

Fig-3b.
Polymerization
of
Ribonucleotides
by
RNA Polymerase
During
Transcription.
Mechanism
Fig-3a.
Transcription by
RNA polymerase in
E. coli. S-40 Mehidi K. 66
66 Mehidi K. 68

Mehidi Kassim, Asst. Professor of Biochemistry 17

RNA Synthesis March 20

Mechanism
Fig-3c.
Transcription
by RNA
polymerase
in E. coli. Fig-4a’. Mechanism For the Termination of Transcription by  Protein.
 This protein is an ATP-dependent helicase that binds the nascent RNA chain and pulls
it away from RNA polymerase and the DNA template.
Mehidi K. 69
69 Mehidi K. 71

Fig-4a. rho-Dependent Termination Fig-4b. rho-Independent Termination

70 72
70 72

Mehidi Kassim, Asst. Professor of Biochemistry 18

RNA Synthesis March 20

Fig-5. Primary Transcript.

 Cleavage of this transcript produces:
 5S, 16S, & 23S rRNA molecules & a tRNA molecule.
 Spacer regions are shown in yellow.
Mehidi K. 73 Fig-6c. Overview of mRNA Processing In Eukaryotes. 75

Fig-7a.
The 5’ cap of
mRNA.
a. 7-Methylguanosine
is joined to the 5’
end of almost all
eukaryotic mRNAs
in an unusual 5’,5’-
triphosphate
linkage.

Fig-PE. Transcription & Translation.

Mehidi K. 74 Mehidi K. 76

Mehidi Kassim, Asst. Professor of Biochemistry 19

RNA Synthesis March 20

Fig-7b.  The consensus sequences at the intron/exon

The 5’ cap of mRNA.
b. Generation of the
boundaries of the pre-mRNA
5’ cap involves;  are AGGU (AGGT in the DNA).
 4 to 5 separate
steps
 The sequences vary to some extent on the exon side
 adoHcy is S- of the boundaries,
adenosylhomocysteine
c. Synthesis of the cap  but almost all introns begin with a 5’ GU and end with a 3’
is carried out by AG
 enzymes tethered
to the CTD of Pol II
 The cap remains
tethered to the CTD
 through an
association with  Fig-9. Splice junctions in hnRNA.
the cap-binding
◦ The intron sequences shown in blue dashed boxes are invariant
complex (CBC)
 They always appear at this position in introns.
◦ The sequences on the exon side of the splice sites are more variable
Mehidi K. 77 Mehidi K. 79

Fig-8b
Addition of the
poly(A) tail to
the primary RNA
transcript
of eukaryotes.

78

80 Fig-10. Splicing Process-6780

Mehidi Kassim, Asst. Professor of Biochemistry 20

RNA Synthesis March 20

Fig-10. Splicing process.

◦ snRNAs (U1 to U6) bind to the intron, causing it to
form a loop;
 The complex is called a splicesosome
◦ The U1 binds near the 1st exon/intron junction,
◦ U2 binds within the intron in a region containing
 an adenine nt residue
◦ Another group of snRNAs, U4, U5, & U6, binds
 to the complex, & the loop is formed. Fig-11. Splicing
◦ The phosphate attached to the G residue at the 5’- mechanism in mRNA
primary transcripts.
end of the intron forms a 2’–5’ linkage;
 with the 2’-OH group of the adenine nt residue
Mehidi K. 81 83

… cont’d

◦ Cleavage occurs at the end of the 1st exon, b/n: Fig-11. Splicing mechanism in mRNA
 the AG residues at the 3’ end of the exon & the GU primary transcripts.
residues at the 5’ end of the intron a. RNA Pairing Interactions in the
Formation of Spliceosome Complexes.
◦ The complex continues to be held in place by the b. Assembly Of Spliceosomes.
spliceosome. c. Coordination of splicing with
transcription provides an attractive
◦ A 2nd cleavage occurs at; mechanism for bringing the two splice
sites together.
 the 3’-end of the intron after the AG sequence.
◦ The exons are joined together.
◦ The intron, shaped like a lariat,
 is released & degraded to nucleotides

Mehidi K. 82 (c) 84

Mehidi Kassim, Asst. Professor of Biochemistry 21

RNA Synthesis March 20

Fig-14. rRNA &

85 Fig-12. Overview of mRNA Synthesis. 85 87 Ribosome Synthesis
87

86 Fig-13. Overview of tRNA Synthesis

86

Mehidi Kassim, Asst. Professor of Biochemistry 22