Comparative Biochemistry and Physiology, Part A 257 (2021) 110967

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

journal homepage: www.elsevier.com/locate/cbpa

Knock out of a major vitellogenin receptor gene with eight ligand binding
repeats in medaka (Oryzias latipes) using the CRISPR/Cas9 system
Jin Namgung a, Hiroko Mizuta a, Yo Yamaguchi a, Jun Nagata c, Takashi Todo b, Ozlem Yilmaz d,
Naoshi Hiramatsu b, *
a
Graduate School of Fisheries Sciences, Hokkaido University, 3-1-1 Minato, Hakodate, Hokkaido 041-8611, Japan
b
Division of Marine Life Sciences, Faculty of Fisheries Sciences, Hokkaido University, 3-1-1 Minato, Hakodate, Hokkaido 041-8611, Japan
c
Mariculture Fisheries Research Institute, Fisheries Research Department, Hokkaido Research Organization, 1-4-1 Masuura, Abashiri, Hokkaido 099-3119, Japan
d
Institute of Marine Research, Austevoll Research Station, Storebø, Norway

A R T I C L E I N F O A B S T R A C T

Editor: Michael Hedrick Recent studies of vitellogenesis engendered a novel model of teleost yolk formation in which multiple yolk
precursors, vitellogenins (Vtgs), and their receptors (Vtgrs) interact to ensure proper yolk composition for em­
Keywords: bryonic development and larval growth. As a step toward verification of this concept, we examined the role of
Vitellogenin one candidate Vtgr, termed low-density lipoprotein receptor relative with eight ligand-binding repeat (Lr8), in
Vitellogenin receptor
the medaka, a representative teleost and established laboratory model. A homozygous lr8 knock out (lr8-KO)
Egg quality
medaka was produced to perform reverse-genetic functional analyses. In ovaries of wild type (WT) medaka,
Knockout
Medaka Western blotting detected a putative Lr8 protein band at ~130 kDa, while immunohistochemistry detected the
putative Lr8 signal at the periphery of the oocyte underneath the zona radiata. These signals disappeared in
ovaries of the lr8-KO group. Offspring of lr8-KO medaka exhibited decreased survival rate compared to WT fish,
but KO of lr8 was not 100% lethal. There was no significant difference in total yolk protein content or size of eggs
between WT and lr8-KO fish. However, LC-MS/MS analyses revealed a remarkable decrease in the relative
abundance of yolk proteins derived from VtgAb in lr8-KO eggs, in conjunction with a compensatory increase in
proteins derived from VtgAa1. These findings strongly support the conclusion that Lr8 is an important receptor
for VtgAb in medaka. The disruption of proper yolk composition by lr8-KO is possibly one cause of the low
offspring survival.

1. Introduction
Production of good quality eggs yielding robust larvae and juveniles
is required for stable production of target species in the global fish
farming industry. However, reliable techniques for programmed pro­
duction of seedstock have been established for comparatively few
aquatic species to date. Thus, generation of basic knowledge that leads
to sustainable production of high-quality seedlings is important for
expansion and diversification of aquaculture practices.
In egg laying (oviparous) teleosts, including most farmed fishes, the
yolk is the major source of nutrients that provide cellular energy and
structural components for formation of embryos and larvae. Multiple
types of yolk precursor proteins, vitellogenins (Vtgs), and lipids are the
major sources of critical nutrients, but the yolk contains many other
components such as hormones, vitamins, and metal ions that contribute
to and directly affect early development of embryos and larvae (Lubzens
et al., 2017).
Multiplicity of Vtg has been reported in most oviparous vertebrates
examined to date. The multiple Vtg system of acanthomorph teleosts
consists of two complete forms of VtgA (VtgAa and VtgAb), each

Abbreviations: ldlr, low-density lipoprotein receptor gene and transcript; LDLR, low-density lipoprotein receptor protein; lr8, LDLR relative with eight ligand-
binding repeat gene and transcript; LR8, LDLR with 8 ligand binding repeats; LRP, low-density lipoprotein receptor related protein; VLDL, very low-density lipo­
protein; vldlr, very low-density lipoprotein receptor gene and transcript; VLDLR/Vtgr, vitellogenin receptor ortholog of mammalian very low-density lipoprotein
receptor protein; Vtg, vitellogenin; KO, knockout; VtgAa, Aa-type Vtg; VtgAb, Ab-type Vtg; IHC, immunohistochemistry; LC-MS/MS, liquid chromatography and
tandem mass spectrometry; PAM, protospacer adjacent motif.
* Corresponding author.
E-mail address: naoshi@fish.hokudai.ac.jp (N. Hiramatsu).

https://doi.org/10.1016/j.cbpa.2021.110967
Received 16 February 2021; Received in revised form 19 April 2021; Accepted 19 April 2021
Available online 23 April 2021
1095-6433/© 2021 Elsevier Inc. All rights reserved.
J. Namgung et al.
containing all known yolk protein domains, and a smaller, incomplete
form of Vtg, VtgC, that is composed of lipovitellin (Lv) heavy chain
(LvH) and Lv light chain (Lvl) only (Hiramatsu et al., 2002; Finn and
Kristoffersen, 2007; Reading et al., 2009). In some species spawning
pelagic eggs in seawater, the yolk proteins derived from VtgAa are
selectively proteolyzed by cathepsins during oocyte maturation,
providing free amino acids that drive water influx underlying oocyte
hydration, thereby adjusting egg buoyancy, and that serve as a major
energy substrate in early embryos (Finn and Fyhn, 2010). In these spe­
cies, relatively intact major products of the other forms of Vtg, such as
LvH from VtgAb (LvHAb) and possibly VtgC (LvHC) may be utilized as
nutrients at later stages by the developing larvae (Matsubara et al.,
2003; Hiramatsu et al., 2005). Alternative patterns of yolk utilization are
also evident among teleosts. For example, maturational yolk proteolysis
does not always involve selective degradation of VtgAa products in
acanthomorphs. In moronids it involves limited degradation of all three
forms of LvH (LvHAa, LvHAb, LvHC) (Williams et al., 2014; Yilmaz
et al., 2016). Results of targeted vtg gene knock-out (vtg-KO) in the
zebrafish (Danio rerio), an ostariophysean teleost, suggest that yolk
proteins derived from type 1 Vtgs (orthologs of acanthomorph VtgAa)
are required at late larval stages, while products of type 3 Vtg (ortholog
of acanthomorph VtgC) may be required as early as 8 h after fertiliza­
tion. Yolk protein requirements were inferred from the timing of sig­
nificant mortality in homozygous vtg1-KO and vtg3-KO offspring (Yilmaz
et al., 2019).
The maternal cargo of yolk components is generated and transferred
to developing oocytes during the process of ovarian growth called
vitellogenesis. The fundamental molecular mechanisms underlying
teleost vitellogenesis are well documented (Reading et al., 2011b; Hir­
amatsu et al., 2015; Lubzens et al., 2017; Sullivan and Yilmaz, 2018).
Vitellogenin is secreted by the liver, transported via the bloodstream to
the ovaries, taken up by the oocytes via receptor mediated endocytosis,
and then accumulated in yolk granules or globules in the ooplasm. An
ovarian membrane receptor, generally termed Vtg receptor (Vtgr), is
responsible for the selective capture of Vtg from the bloodstream for
endocytosis by growing oocytes (Stifani et al., 1990b; Hiramatsu et al.,
2015). This Vtgr is an ortholog of mammalian very-low-density lipo­
protein receptor (VLDLR), which belongs to the low-density lipoprotein
receptor (LDLR) family (Nimpf and Schneider, 1998; Strickland et al.,
2002; Reading et al., 2011a; Hiramatsu et al., 2015). In the chicken
(Gallus gallus), this VLDLR ortholog has been characterized as Vtgr
(Nimpf et al., 1989; Bujo et al., 1994) and termed an LDLR relative with
eight ligand repeats (Lr8).
The aforementioned VLDLR ortholog has been reported to function
as a possible Vtgr in various teleosts including, as examples, the
following species: rainbow trout, Oncorhynchus mykiss; (Stifani et al.,
1990; Lancaster and Tyler, 1994; Davail et al., 1998), coho salmon,
Oncorhynchus nerka (Stifani et al., 1990), white perch, Morone americana
(Tao et al., 1996; Hiramatsu et al., 2004; Reading et al., 2011b), and
cutthroat trout, Oncorhynchus clarki (Mizuta et al., 2013). In addition to
the VLDLR ortholog (hereafter designated as lr8/Lr8), recent studies
have suggested that multiple Vtgr candidates are present in teleost
ovaries (Hiramatsu et al., 2015). A novel receptor called LDLR related
protein 13 (hereafter designated as lrp13/Lrp13) was characterized in
two distantly related teleosts (genera: Morone and Oncorhynchus) and
suggested to be a potential Vtgr (Reading et al., 2014; Mushirobira et al.,
2015; Hiramatsu et al., 2015).
With regard to Vtgr ligand binding affinities, in moronids the two A-
type Vtgs, VtgAa and VtgAb, seem to preferentially bind to their specific
receptors, Lrp13 and Lr8, respectively (Reading et al., 2011a, 2014;
Hiramatsu et al., 2015). In Oncorhynchus, a salmon A-type Vtg (VtgAs)
seems to have affinity for both receptors (Hiramatsu et al., 2015;
Mushirobira et al., 2015). Information on the relationship between
multiple Vtg subtypes and their receptors is presently limited to the
species described above. In order to understand the physiological and
evolutionary significance of the “multiple Vtg/Vtgr system”, further
2
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
functional studies on ovarian receptors are needed.
The main objectives of the present study were; 1) to better under­
stand the attributes of lr8/Lr8 via molecular and biochemical charac­
terization, and 2) to assess the contribution(s) of Lr8 to Vtg uptake and
early development using the CRISPR/Cas9 gene KO system in Minami
medaka (Oryzias latipes) (Sakaizumi, 1990), hereafter referred to as
medaka. The invalidation of lr8 is expected to result in one of the
following outcomes: (1) homozygous lr8-KO (− /− ) females might be
sterile, (2) homozygous lr8-KO (− /− ) females might spawn fertile eggs
producing offspring that do not survive early development, (3) homo­
zygous lr8-KO (− /− ) offspring may hatch but exhibit lower survival rate
than WT larvae, and (4) homozygous lr8-KO (− /− ) and WT offspring
may exhibit no differences in survival rate.
As a representative model for other oviparous vertebrates, medaka
has several advantages for reverse genetic studies. Aside from those
advantages previously reported by Inoue and Takei (2003) and Witt­
brodt et al. (2002) the publicly available medaka genome contains in­
formation on the complex multiple Vtg/Vtgr system and is an invaluable
source for sequences of respective target genes/proteins, facilitating
construction of guide RNAs (gRNAs) for use in the CRISPR/Cas9 system.
2. Materials and methods
2.1. Animal care and biological material
Mature medaka from an inbred population that has been reproduced
for over 30 years at the Faculty of Fisheries Sciences of Hokkaido Uni­
versity were used as broodstock in this study. Fertilized eggs used for
microinjection (MI) were collected from spawns of wild type (WT)
medaka obtained from crosses of 1–3 mature females and one mature
male, which were kept in 4 L plastic aquaria supplied with recirculating
28 ◦ C water under a long-day photoperiod (14 L:10 D). Fish were fed a
commercial diet (Otohime B1, Marubeni Nisshin Feed, Tokyo, Japan)
once a day to satiety. Females and males were normally kept separated
by a net and mating commenced once the net was removed at the
beginning of the light period. Eggs that remained attached near the fe­
males’ anal fin after being fertilized were collected within 30 min
following the start of mating and placed in 8.5 cm diameter plastic Petri
dishes containing 500 mL ice-cold dechlorinated city water supple­
mented with one drop of methylene blue solution (Green F 0.82 g/100
mL, Japan Pet Design Co., Tokyo, Japan). Following MI, dishes con­
taining developing embryos were warmed to and held at 25 ◦ C in an
incubator (Mir-154, Sanyo, Osaka, Japan) for three weeks with daily
enumeration and removal of dead eggs before changing the rearing
water. Hatched larvae were fed a ground commercial diet (SHOKIJIRYO
KYOWA-B, Kyowa Hakko Kogyo, Tokyo, Japan) 3 times per day. Three
weeks after fertilization, the fish were transferred to a 2 L plastic
aquarium connected to a recirculating water system where they were
held at 25–26 ◦ C under a long-day photoperiod and fed artemia (MT
brine shrimp, Marinetech, Wakayama, Japan) and commercial food
(SHOKIJIRYO KYOWA-B) once daily to satiety until they reached adult
size (~2 cm; 3–4 months) and were used for mating as described above.
Our general strategy for production of the homozygous lr8-KO line is
shown in Fig.1 Mosaic F0 mutants were produced by injecting fertilized
WT eggs (+/+) at the one cell stage (prior to first cell division) with a
mix of two gRNAs and Cas9 mRNA and the introduced mutations were
detected by PCR genotyping and sequencing (see 2–4. Microinjection and
genotyping, below). The mosaic F0 mutants were reared to adulthood and
males carrying the desired mutation were mated with WT females to
produce the heterozygous F1 population (+/− ). Adult F1 mutants car­
rying the same mutation genotype (see Results for genotyping infor­
mation) were mated to produce the F2 population, which included some
individuals bearing the homozygous lr8 (− /− ) genotype. Adult F2 lr8
(− /− ) females and males were mated to produce the pure lr8 (− /− ) F3
population. Individuals in the F3 population carrying the selected
introduced mutation, lr8 (− /− ), were used in subsequent experiments as
J. Namgung et al.
P VtgAa2;
WT WT
(+/+) (+/+)
Microinjection
F0
Mosaic WT
(+/+)
F1 lr8-KO
Hetero Mut lr8-KO
(+/-) (+/-)
F2 lr8-KO lr8-KO
Homo Mut
(-/-) (-/-)
F3
Homo Mut
F4
lr8-KO (-/-) line
Fig. 1. Outline of mutant strain production from the wild type (WT) medaka
performed in this study. Fertilized eggs harvested from the WT parents (P) were
microinjected with two distinct gRNAs and Cas9 mRNA to create mosaic F0
mutants (Mosaic). Heterozygous (+/− ) mutants (Hetero Mut) were selected
from the first generation (F1) produced by mating F0 Mosaic males with WT
females. Paired F1 mutants exhibiting the same genotype were bred to produce
F2 homozygous (− /− ) mutants (Homo Mut). F2 Homo Mut pairs were selected
and bred to produce the F3 Homo Mut generation, which was utilized to pro­
duce the F4 Homo Mut generation.
the pure lr8-KO line.
All experiments using WT and mutant fish described above were
performed under regulation and permission of Institutional Animal Care
and Use Committee of National University Corporation Hokkaido Uni­
versity (project#: 17–0064 and 17–0052), and Safety Committee on
Genetic Recombination Experiments Hokkaido University (project#:
2017-006).
2.2. Medakalr8 and vtg sequences and Vtg classification
A publicly available medaka (Oryzias latipes) sequence database
(https://www.ncbi.nlm.nih.gov) was carefully scrutinized to acquire
genetic information on the lr8 and vtgs in this species. One lr8 gene (Gene
ID: 100125475; designated as vldlr in NCBI database) and its two pre­
dicted transcripts (reported as two potential isoforms: Genbank acces­
sion no. XM_011482112.1, XM_004075142.2), as well as four vtg genes
(Gene ID: 100049227, 101159180, 100049479, 101161140; desig­
nated as vitellogenin 1, vitellogenin-1-like, vitellogenin II, vitellogenin 3
phosvitinless, respectively, in NCBI database) and their transcripts were
obtained from this analysis (see Results for detailed information on these
genes). Sequences of the lr8 transcripts were used in gRNA design and
the predicted amino acid sequences for medaka Vtgs were used in
generating a reference database for the liquid chromatography tandem
mass spectrometry (LC-MS/MS) analysis. To avoid confusion, we use the
nomenclature of Vtg subtypes (i.e., Aa, Ab, and C types) proposed by
Finn and Kristoffersen (2007) hereafter in this study to describe
vtg transcripts/Vtg proteins. Their respective Genbank accession
3
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
numbers are as follows: NM_001104677.1/NP_001098147.1,
vtgAa1/VtgAa1; XM_004067732.3/XP_004067780.1, vtgAa2/
NM_001104840.1/NP_001098310.1, vtgAb/VtgAb;
XM_004067740.3/ XP_004067788.1, vtgC/VtgC.
Classification of the four medaka Vtgs was done based on phyloge­
netic analyses of their primary structure in comparison with orthologous
sequences of 13 other teleost fishes obtained from the NCBI sequence
database (Supplemental material 1). The Vtg protein dendogram (Sup­
plemental material 2) was constructed following CLUSTALW alignment
analysis (Thompson et al., 1994) by the Neighbor-joining method using
the mega-X program (https://www.megasoftware.net).
2.3. Production of guide RNA and Cas9 mRNA
Gene editing using a CRISPR/Cas9 system was performed according
to the procedure of Gagnon et al. (2014). The CHOPCHOP tool (avail­
able online at http://chopchop.cbu.uib.no) was used to design gRNAs.
The highest-ranking candidate gRNAs, for which no off-target effects
were predicted, with up to 50% GC content and up to 70% efficiency
were chosen for application. Two distinct gRNAs (gRNA1 and gRNA2;
Fig. 2A, Table 1) targeting the medaka lr8 gene on exon 1 where both lr8
isoforms exhibited identical sequence were chosen and thus both iso­
forms were targeted for KO simultaneously. The mixture of these two
gRNAs was expected to introduce an ~80 bp deletion (here termed inter-
gRNA deletion) between the target sites on the lr8 gene (Fig. 2A,
Table 1).
The gRNAs were produced following the protocol from Gagnon et al.
(2014). Gene-specific oligonucleotides, which link each gRNA-targeted
DNA sequence to a T7 promoter and an overlap region (see Fig. 2B,
Table 1), were synthesized by a commercial company (Sigma, St. Louis,
USA). The gene specific oligonucleotides, an ̃80 bp target site without
Protospacer Adjacent Motif (PAM) site and a complementary region
were annealed to a constant oligonucleotide encoding the reverse-
complement of the tracer RNA tail (tractr RNA) common oligonucleo­
tide (see Table 1) by the following annealing program: incubation at
95 ◦ C for 5 min, incubation under gradual decrease in temperature from
95 ◦ C to 85 ◦ C (− 2 ◦ C/s) followed by another gradual decrease from
85 ◦ C to 25 ◦ C (− 1 ◦ C/s) for one cycle and storage at 4 ◦ C until use. The
ssDNA overhangs in the constant oligonucleotide were filled in with T4
DNA polymerase (Biolabs, Massachusetts, USA) to generate the full-
length guide RNA template (sgRNA). Following incubation at 12 ◦ C
for 20 min, the full length sgRNAs were cleaned up using a GeneClean®
Turbo Kit (MP, Los Angeles, USA) and in vitro transcribed using a
MEGAscript™ T7 Transcription Kit (Thermo Fisher Scientific, Massa­
chusetts, USA) according to the manufacturer’s instruction, unless
otherwise stated. sgRNAs were treated with TURBO™ DNase (Thermo
Fisher Scientific) and precipitated with 5 M ammonium acetate followed
by 100 and 70% ethanol washes, respectively. The air-dried gRNA was
dissolved into 30 μL of nuclease free water and stored at − 80 ◦ C until
use.
Cas9 mRNA was transcribed from Not1 digested and Phenol-
Chloroform (1:1) precipitated pcs2 + hspcas9 vector (Addgene, Massa­
chusetts, USA) using a mMESSAGE mMACHINE™ SP6 Transcription Kit
(Thermo Fisher Scientific) according to the manufacturer’s instruction.
Quantification of Cas 9 mRNA was conducted by measuring absorbance
at 260 nm, while quality of Cas9 mRNA was checked by measuring the
260 nm/280 nm absorbance ratio using a NanoDrop™ spectrophotom­
eter (Thermo Fisher Scientific). The mRNA quality was also judged by
examining the relevant band after routine electrophoresis on a 1%
agarose gel. The resulting Cas9 mRNA was stored at − 80 ◦ C until use.
2.4. Microinjection and genotyping
The solution for microinjection (final concentration: 20 ng/μL Cas9
mRNA, 6.625 ng/μL each gRNA, 0.24% phenol red) was prepared by
mixing 2 μL Cas9 mRNA (100 ng/μL), 5.3 μL gRNAs (a mixture two
J. Namgung et al. Comparative Biochemistry and Physiology, Part A 257 (2021) 110967

T7 region gRNA1 overlap region

5 -TAATACGACTCACTATA GAGATGGTCACGTCCGCAG GTTTTAGAGCTAGAAATAGCAAG
CAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAA-

constant oligonucleotide

In vitro transcription

5’- GAGATGGTCACGTCCGCAGCAAAATCTCGATCTTTATCGTTCAATTTTATTCCGATCAGGCAATAGTTGAACTTTTTCACCGTGGCTCAGCCACGAAAA- ’

gRNA1 constant oligonucleotide

Fig. 2. Outline of lr8 gene mutation targeted by dual guide RNAs (gRNAs). Panel A. Sequence of both gRNAs targeting exon 1 of the lr8 gene, and location of an inter-
gRNA deletion (− 67 bp) found in homozygous lr8 knockout (lr8-KO) individuals. The sequence of exon1 in wild-type (WT) individuals is given for comparison to the
lr8-KO sequence. Panel B. Simple strategy for gRNA generation (Gagnon et al., 2014), showing three-part organization of the gene-specific oligo with T7 region,
target gRNA1 and overlap region. The gene-specific oligo was annealed to the constant oligo and subjected to in vitro transcription.

Table 1
Primers for genotyping and oligonucleotides used in guide RNA (gRNA) construction.
Name Sequence

gRNA T7 region 5′ -TAATACGACTCACTATA-3′

gRNA overlap region
gRNA constant oligonucleotide
gRNA1 common oligonucleotide
gRNA2 common oligonucleotide
Genotyping forward primer
Genotyping reverse primer
5′ -GTTTTAGAGCTAGAAATAGCAAG-3′
5′ -AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′
5′ -GAGATGGTCACGTCCGCAGCGG-3
5′ -CCACCGCGGTCACGTTCACGGTA-3′
5′ -TTCTGTGTGACTGACAGCTCG-3′
5′ -CACGAGCCTCCTTGAAATAATC-3′

Horizontal lines under gRNA sequences represent PAM site.

gRNA T7region, overlap region, and constant oligonucleotide were used based on Gagnon et al., 2014.

gRNAs each 25 ng/μL), 1.2 μL phenol red (2%), and 1.5 μL NFW.
Approximately 2.5 nL of this solution was delivered into the blastocyst
of fertilized eggs (1 cell stage) obtained from the WT medaka using a
microneedle prepared on a pc-10 puller (Narishige, Tokyo, Japan) from
Capillary tube GD-1 (Narishige). Thirty embryos were microinjected, of
which 18 fish survived to adulthood (F0 generation).
Generational transfer of mutations was evaluated in adult fish via
PCR after gDNA extraction from finclips (Table 2). The fish were anes­
thetized in a plastic container filled with 400 mL of 0.1% 2-phenoxye­
thanol (Kanto chemical, Tokyo, Japan) solution for 2 min and part of
their caudal fin (~ 2 mm × 2 mm) was excised with sterile scissors.
Genomic DNA was extracted individually from adult finclips or from 3
d embryos by the Hotshot method (Truett et al., 2000) and used as
template in genotyping PCR reactions along with genotyping primers to
screen for the introduced mutation(s) on exon 1 of the target lr8 gene
(see Table 1 for primer information). One microliter of gDNA extract,
0.5 μL of each primer (100 nM in final concentration) and 5 μL AmpliTaq
Gold™ 360 Master Mix (Thermo Fisher Scientific) were mixed (10 μL
final volume) and subjected to the following thermocycling conditions;
one cycle of initial denaturation at 95 ◦ C for 10 min, 40 cycles of
denaturation at 95 ◦ C for 30 s, annealing at 60 ◦ C for 30 s and extension
at 72 ◦ C for 1 min/kb plus one cycle of final extension at 72 ◦ C for 7 min.
A hetero duplex mobility assay (HMA) was also conducted according to
the method described by Delwart et al. (1995) for supplementary gen­
otyping to select mutants from the F0 generation. Products of the initial
screening PCR were re-annealed by heating at 95 ◦ C for 10 min and
subjected to a stepwise temperature decrease from 85 ◦ C to 25 ◦ C
(− 10 ◦ C/min). One microliter of PCR amplified product was subjected to
electrophoresis on a 15% polyacrylamide gel after being mixed with 5 μL
of 6 X sample loading buffer (Takara Bio, Sigma, Japan). A 100 bp DNA

4
J. Namgung et al.
Table 2
Incidence of mutant genotypes over five generations.
Generation Number Mozaic Indel Inter Inter Wild
screened (+/− ) gRNA gRNA type
deletion deletion (+/+)
(+/− ) (− /− )
F0 18 18
F1 71 52 10 9 DAPI (Nacalai, Kyoto, Japan) and a cover glass (18 mm × 18 mm,
F2 32 21 7 4
F3 8 8
F4 16 16
Indel (+/− ): heterozygous indel mutation.
Inter gRNA deletion (+/− ): heterozygous 67 bp inter-guide RNA deletion, also
termed lr8-KO (+/− ) (see Fig. 1).
Inter gRNA deletion (− /− ): homozygous 67 bp inter-guide RNA deletion, also
termed lr8-KO (− /− ) (see Fig. 1).
Numbers in the table represent numbers of individuals per generation bearing
the referenced mutation.
ladder (Takara Bio) was used as a marker to estimate the size of PCR
products. Electrophoresis was performed at 200 V for 80 min using Tris-
borate EDTA Buffer (TBE buffer). Following staining of the gel with 0.5
μg/mL ethidium bromide (EtBr) solution for 15 min, signals on the gel
were photographed using AE-6933FXES (ATTO, Tokyo, Japan). PCR
products carrying the generated mutation were ligated into pGEM®-T
Easy Vector (Promega, Wisconsin, USA) and sequenced according to Luo
et al. (2013). Obtained sequences were aligned to the corresponding
medaka genomic sequence using CLC Sequence Viewer 8 (Qiagen, Hil­
den, Germany) for characterization and localization of introduced mu­
tations, and then were blasted against all sequences available online
using NCBI nucleotide Blast (Blastn) (Altschul et al., 1990) for confir­
mation of the consistency, accuracy, and type of mutations created at the
target sites.
2.5. Western blotting
Ovary samples from WT (N = 1) and F3 lr8-KO (N = 1) mature female
medaka were homogenized in phosphate buffered saline (PBS, pH 7.0; 5
X w/v) and then centrifuged at 1000 ×g for 10 min at 4 ◦ C. The super­
natant containing yolk proteins was discarded and the pellet was
reconstituted in the 100 μL of PBS. This process was repeated 3 times to
remove any yolk. The final pellet containing ovarian cells and mem­
branes was reconstituted in PBS (3 X w/v) and homogenized with 1.0
mm beads (Zirconia Beads, Tomy, Tokyo, Japan) using a uT-12 Beads
crusher (TAITEC, Saitama, Japan) in order to recover its protein content.
Samples were moved to a new test tube and mixed with an equal volume
of 4 X sample buffer (Biorad) containing 0.05% 2-mercaptoethanol and
boiled at 100 ◦ C for 2 min. The samples were stored until use at − 30 ◦ C
and subjected to SDS-PAGE and Western blotting procedures according
to Mizuta et al. (2013) unless otherwise stated below.
A polyclonal rabbit IgG raised against recombinant cutthroat trout
Lr8 (anti-Lr8) by Mizuta et al. (2013) was used as a primary antibody in
this study. After blotting, membranes were blocked as stated by Mizuta
et al. (2013) and incubated overnight at 4 ◦ C in anti-Lr8 solution pre­
pared in Super block (Thermo Fisher Scientific) at 1:2000 dilution (10
μg/mL final IgG concentration). Two μL goat anti-rabbit IgG HRP-
conjugated antibody (Thermo Fisher Scientific) was mixed with 10 μL
Normal Human Serum (Hemoglobin, ≤25 mg/dl, Sigma, USA) and 8 μL
Tris-buffered saline (TBS, pH 7.5), pre-incubated for 30 min at room
temperature (RT) and diluted to 1:10000 in TBS before being used to
incubate membranes for 1 h at RT. Amersham ECL prime Western
blotting detection reagent (Thermo Fisher Scientific) was used accord­
ing to the manufacturer’s instruction in order to detect chem­
iluminescence signals on the membranes after development in the dark
for 1 min. Images of signals were captured using an ImageQuant LAS
500 chemiluminescence detector (Cytiva, Marlborough, USA) after 1 ̃0 s
5
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
of exposure.
2.6. Immunohistochemistry
Immunohistochemistry (IHC) was performed according to the pro­
tocol by Mizuta et al. (2013) with the following changes; sections were
covered by Fluoro-KEEPER Antifade Reagent, Non-Hardening Type with
MATSUNAMI, Osaka, Japan). Ovaries from mature female medaka were
sampled from WT (N = 2) and F3 lr8-KO (N = 2) fish. Photography
conditions are described in the figure legends.
2.7. Egg weight, diameter, and yolk protein content
The WT and F3 lr8-KO breeders were held in three aquarium tanks
per group (6 tanks total). Three females were mated with one male in
each tank and fertilized eggs (1-cell stage) were collected less than 30
min after spawning.
Five eggs were randomly sampled from 3 spawns per group (WT
versus lr8-KO). Eggs were placed on a Kimwipe® (Crecia,Tokyo, Japan)
to remove excess water from their surface, placed in a pre-weighed test
tube (5 eggs/tube), and weighed on an electronic balance (XS105 dual
range, Mettler toledo, Ohio, USA). The data were used to estimate the
average weight of each egg for that sample (spawn). For each group,
these data are reported as the mean of the three replicates (N = 3
spawns) ± SEM egg weight. The diameter of each egg was individually
measured in images taken under a stereomicroscope (Model 80iTUW-
31-1, Nikon, Tokyo, Japan) using Nikon NIS elements software
(Nikon). These data are expressed as the mean of 15 observations (N =
15 eggs) ± SEM for each group.
For yolk protein quantification, egg samples (5 per spawn) were
homogenized in PBS (5 x w/v) and the homogenates were centrifuged at
10,000 ×g for 10 min at 4 ◦ C to separate the yolk from remaining
insoluble components. The supernatant was collected and 25 μL aliquots
were further diluted 40-fold with PBS before their yolk protein con­
centration was quantified using a Pierce™ BCA Protein Assay Kit
(Thermo Fisher Scientific) according to the manufacturer’s instruction.
The color reaction was measured by absorbance at 562 nm using a
multimode plate reader (ArvoX4, Perkin Elmer, Massachusetts, USA).
The protein concentration of the diluted yolk from each sample of eggs
was measured in triplicate and the average protein concentration was
recorded and used to calculate the protein quantity (μg) per egg in that
sample. Data was expressed as the mean of the three replicates (N = 3
spawns) ± SEM for each egg type (WT versus lr8-KO).
2.8. Survival of offspring
To evaluate any effects of lr8-KO on offspring survival, daily spawns
(14–43 eggs/spawn) were periodically pooled into a single batch (N =
1–3 spawns/batch) for each group (WT versus lr8-KO) and incubated for
28 d after fertilization to observe daily survival rate. Three pooled
batches of eggs per group in total were analyzed in this experiment.
Survival rate (%) at each time point was calculated as follows: (number
of surviving offspring / initial number of eggs) × 100. Data at each time
point were expressed as the mean (N = 3 pooled batches) ± SEM.
2.9. LC-MS/MS
The 6-fold diluted yolk samples obtained from WT and lr8-KO
medaka eggs for protein assay (N = 5 eggs in 3 replicates per group)
were subjected to in solution tryptic digestion using In-Solution Tryptic
Digestion and Guanidination Kit (Thermo Fisher Scientific) according to
the manufacturer’s instruction prior to label-free quantification using
LC-MS/MS at the Instrumental Analysis Division, Global Center, Crea­
tive Research Institution, Hokkaido University. The high pressure liquid
chromatography (HPLC) section of LC-MS/MS consisted of EASY-
J. Namgung et al. Comparative Biochemistry and Physiology, Part A 257 (2021) 110967

nLC100 (Thermo Fisher Scientific) and a column NTCC-36075-3-125
(Nikkyo technos). The following solvents were used for the HPLC sep­
aration; A solvent: 0.1% formic acid in H2O, B solvent: 0.1% formic acid
in acetonitrile. The flow rate was 300 nL/min. The mass-spectrometry
(MS) section of the LC-MS/MS consisted of Orbitrap Elite Hybrid Ion
Trap-Orbitrap Mass Spectrometer (Thermo Fisher Scientific) which was
set up with the following ms conditions: FT-MS + IT-MS/MS, m/z: 380-
1600. Samples were diluted 50-fold with the A solvent and injected in 2
μL volume. The spectra data obtained from the LC-MS/MS was searched
against the reference database which consisted of four predictive
medaka Vtg sequences (Supplemental material 1) using SEQUEST HT
(Thermo Fisher Scientific) and analyzed using Proteome discoverer 2.4
SP1 (Thermo Fisher Scientific). Vtg quantification was done based on
peak area intensity of each after normalization to the top 3 detected

Indel Inter gRNA Inter gRNA

WT
mutant deletion (+/-) deletion (-/-)
A

336bp
269bp 269bp

336bp
269bp 269bp

C WT Shown/screened(8/18)
F0
500bp 83.3% of indel mutant
336bp Mozaic
16.7% of Inter gRNA deletion
269bp

WT Shown/screened (11/71)
500bp 12.7% of WT
F1 336bp
269bp
73.2% of Indel mutant (+/-)
14.1% of Inter gRNA deletion (+/-)

Shown/screened (9/32)
F2
500bp WT 12.5% of WT
336bp 65.6% of Inter gRNA deletion (+/-)
269bp 21.9% of Inter gRNA deletion (-/-)

Shown/screened (6/8)

F3 500bp WT

336bp 100% of Inter gRNA deletion (-/-)

269bp

Shown/screened (8/16)
500bp WT
F4 336bp 100% of Inter gRNA deletion (-/-)
269bp

Fig. 3. Representative genotyping results. Agarose gel electrophoresis of PCR amplicons (panel A) and the corresponding polyacrylamide gel electrophoresis of
heteroduplex mobility assay (HMA) products (panel B) were performed to confirm genotype variations. Typical banding patterns representing the following four
genotypes are shown in Panels A and B: WT, wild type; Indel mutant, single gRNA cutting mutation(s); Inter gRNA deletion (+/− ), heterozygous for 67 bp inter gRNA
deletion; Inter gRNA deletion (− /− ); homozygous for 67 bp inter gRNA deletion. HMA-based genotyping was performed only for selection of mutants in the F0
generation. PCR-based genotyping was performed through the F4 generation (panel C), followed by sequencing where necessary. Numbers with arrowheads indicate
sizes (bp) of corresponding bands. Numbers in parenthesis in panel C indicate the number of individuals whose results are shown / total numbers of individuals
screened at that generation. For each generation, the percentage representation of each mutation pattern is indicated on the right side of panel C.

6
J. Namgung et al.
Vtgs.
2.10. Statistical analysis
Statistical differences in phenotypic observations (total yolk protein
content, egg diameter, egg weight, larval survival rate, and yolk
composition, LC-MS/MS) between WT and lr8-KO groups were detected
via Chi-square test (Fisher, 1922) at p≤0.05 significance level using the
R software (https://www.r-project.org).
3. Results
3.1. Medaka lr8
The single medaka lr8 gene is predicted to be located on chromosome
12 and to be composed of 19 exons and 18 introns with a total size of
34,892 bp gDNA and of 6266 bp cDNA encoding an 847 amino acid (aa)
protein.
3.2. Identification of mutations and homozygous lr8-KO line production
A 67 bp deletion type of mutation was introduced via Cas9 guided by
two gRNAs to target sites on exon1 of the homozygous F2 medaka lr8
gene in this study (Fig. 2). The introduced mutation was proven to create
a frame shift in the coding sequence that prevents the resulting tran­
script from being translated (Supplemental material 3). The introduced
deletion mutation was detected and characterized using HMA- and PCR-
based genotyping (Fig. 3), confirmed where necessary by sequencing
and sequence alignments (see below). According to the genotyping re­
sults, 100% of the embryos microinjected with the gRNA and Cas9
mixture carried an introduced mutation. For all generations (F0 to F4)
during the selection process for homozygous lr8-KO line production, the
incidences of mutant genotypes confirmed by either PCR-based or HMA-
based genotyping are given in Table 2 For each type of mutation, the
typical electrophoretic banding pattern of PCR products on agarose gels,
and the corresponding banding pattern of HMA products on acrylamide
gels, is shown in Fig. 3A and B, respectively. A single ~336 bp band,
representing intact genomic DNA at the target site, was observed by both
PCR- and HMA-based genotyping of WT fish (WT +/+). Individuals
exhibiting a single band migrated near ~336 bp in PCR-based geno­
typing, but multiple other bands above the 336 bp band in HMA-based
genotyping, were considered as putative indel mutants arising from
single gRNA cutting with insertion or deletion of one or a few nucleo­
tides at the target genomic DNA site(s). Their genotypes were termed
“Indel mutant” in the F0 generation and “Indel mutant (+/− )” in the F1
generation (Fig. 3C). Individuals exhibiting a double banding pattern,
with the ~336 bp band and an additional band of lower size (~269 bp)
in both PCR- and HMA-based genotyping, were considered to be mutants
heterozygous for the deletion flanked by the two gRNAs. Their genotype
was termed “Inter gRNA deletion” in the F0 generation and “Inter-gRNA
deletion (+/− )” in subsequent generations (Fig. 3C). In these hetero­
zygous (+/− ) mutants, the higher size band (~336 bp) represents the
wild type allele and the lower size band (~269 bp) represents the lr8-KO
allele. Individuals exhibiting only the ~269 bp band in PCR- and HMA-
based genotyping were considered to be homozygous (− /− ) for the lr8-
KO allele. Their genotype was termed “Inter gRNA deletion (− /− )” in
the F2 ~ F4 generations (Fig. 3C). Fish exhibiting an inter gRNA deletion
with either the heterozygous or homozygous banding pattern were
considered as lr8-KO mutants, with the heterozygous genotype termed
“lr8-KO (+/− )” and the homozygous genotype termed “lr8-KO (− /− )”
(see Fig. 1).
Typical electrophoretic patterns of PCR-based genotyping obtained
for each generation are shown in Fig. 3C Representative results for 8 out
of 18 (F0), 11 out of 71 (F1), 9 out of 32 (F2), 6 out of 8 (F3), and 8 out of
16 (F4) individuals screened by genotyping are shown in the figure. All
of the injected F0 embryos exhibited the double banding pattern (~336
7
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
bp and 269 bp) in HMA-based genotyping (see Fig. 3B), suggesting
possible mosaic introduction of the inter-gRNA deletion. About 14.1% of
the F1 offspring from crosses of WT females with selected F0 males
exhibited the heterozygous inter gRNA mutation banding pattern indi­
cated above. Sequence analysis of the PCR products confirmed two
patterns (data not shown) of inter-gRNA mutation in the F1 mutants
(deletion sizes: 58 bp and 67 bp). Since the 67 bp deletion was expected
to cause a codon frame shift in the lr8 sequence (see nucleotide and
deduced amino acid sequences of KO shown in Fig. 2 and Supplemental
material 3), only adult male and female mutants with this deletion were
selected for mating to produce the F2 generation (Fig. 1).
Only PCR-based genotyping was performed from F2 generation on­
ward. About 21.9% of F2 offspring exhibited a homozygous lr8 − /−
banding pattern while 65.6% and 12.5% exhibited the heterozygous (lr8
+/− ) and WT (lr8 +/+) banding patterns, respectively (Fig. 3C). All F3
offspring from homozygous F2 mutants exhibited single ~269 bp size
amplicon. Sequencing results from these amplicons confirmed the 67 bp
deletion in exon 1 of the lr8 sequence, in accordance with the results
obtained for the F1 generation. Thus, all F3 individuals were definitively
confirmed to be homozygous lr8-KO (− /− ) mutants. As expected, all F4
offspring (results for 8 of 16 total shown in Fig. 3C) produced from F3
parents were also confirmed to be lr8-KO (− /− ) mutants (see also
Table 2).
3.3. Lr8 protein detection and localization
In order to confirm the lack of Lr8 protein in lr8-KO female ovaries,
SDS-PAGE and the corresponding Western blotting of the ovarian
membrane products were performed using anti-Lr8 in WT and F3 KO
fish. Protein patterns of WT and KO samples were identical (Fig. 4A) on
SDS-PAGE. An immuno-reactive band with a relative mass of ~130 kDa
was observed in WT ovary via Western blotting, while this was clearly
absent in lr8-KO ovary (Fig. 4B).
Localization of Lr8 was confirmed in adult WT medaka ovaries at the
peri-nucleolus, yolk vesicle and secondary yolk stages (Fig. 5A, B, and
A SDS-PAGE B Western blot
WT lr8-KO WT lr8-KO
(kDa)
250
150
130 kDa
100
75
50
37
Fig. 4. 7.5% SDS PAGE (A) of ovarian membrane preparations and corre­
sponding Western blot (B) using an antibody raised against recombinant Lr8 of
cutthroat trout. The SDS PAGE gel was stained by Coomassie Brilliant Blue,
while Western blot membrane was visualized by enhanced chemiluminescence
(ECL). WT: wild type; lr8-KO: homozygous lr8 knockout type. (For interpreta­
tion of the references to color in this figure legend, the reader is referred to the
web version of this article.)
J. Namgung et al.
C). No immuno-reactive Lr8 signal was observed in peri-nucleolus stage
oocytes, while a weak positive signal was detected in theca cells sur­
rounding the follicles (Fig. 5A and G). WT yolk vesicle stage oocytes
exhibited a strongly positive anti-Lr8 signal in the peripheral region
underneath the zona radiata. Some immuno-positive granules were also
observed in the peripheral ooplasm (Fig. 5B and H), while no signal was
observed in theca cells surrounding yolk vesicle stage follicles. In WT
secondary yolk stage oocytes, the anti-Lr8 signal was strongly observed
in the peripheral region of the oocyte underneath the zona radiata. The
signal appeared to be further condensed to the peripheral region as
compared to the signal observed in yolk vesicle stage oocytes. The
immuno-reactivity was also observed in the theca cells surrounding
secondary yolk stage follicles (Fig. 5C and I). All of these specific signals
observed in WT ovary were absent in oocytes and surrounding follicle
cells of the lr8-KO ovary at all stages (Fig. 5D, E, F, J, K, and L). However,
a very faint signal was detected in the outer follicular layer in lr8-KO
ovaries (Fig. 5F and L).
3.4. Observed lr8-KO phenotypes
No significant differences were observed between WT females and F3
lr8-KO females in egg wet weight (Fig. 6A; WT 1.036 ± 0.05 mg, lr8-KO
1.056 ± 0.07 mg), egg diameter (Fig. 6B; WT 1223.2 ± 24 μm, lr8-KO
1209.17 ± 21.9 μm) or egg yolk protein content (Fig. 6C; WT 39.2.33 ±
0.4 μg/egg, lr8-KO 42.8 ± 1.1 μg/egg).
Fertilized eggs/embryos and hatched larvae derived from either WT
or F3 lr8-KO females were raised for 28 days post fertilization (dpf) to
confirm whether KO of lr8 effects survival during early life stages
(Fig. 7). All eggs hatched at around 12–13 dpf with no significant dif­
ferences between WT and lr8-KO offspring. Even though a sharp
decrease in survival of lr8-KO larvae was observed between 19 and 22
dpf, no statistically significant differences between WT and lr8-KO
offspring were evident until 26 dpf (Fig. 7). Survival rate was signifi­
cantly and substantially lower in lr8-KO offspring as compared to WT
fish from 27 dpf onward (27 dpf, p = 0.003, df = 2; 28 dpf, p = 0.006, df
= 2). By day 28 after fertilization, the average survival rates in the WT
and lr8-KO groups were 65.9% and 30.7%, respectively. The surviving
lr8-KO larvae appeared to behave normally with regard to swimming
and feeding.
3.5. Classification of vitellogenin subtypes and LC-MS/MS
Four medaka Vtg subtypes were classified based on phylogenetic
comparisons using sequences of multiple Vtg subtypes from 13 other
teleost species. The four medaka Vtgs appeared to be orthologs of the
three Vtg subtypes, VtgAa, VtgAb, and VtgC previously reported for this
group of fish (Finn and Kristoffersen, 2007). Two paralogous subtypes of
medaka VtgAa were evident in the VtgAa clade and were thus desig­
nated here as VtgAa1 and VtgAa2 (Supplemental material 2). The
remaining two medaka Vtg subtypes fell into the VtgAb and VtgC clades
and were designated as medaka VtgAb and VtgC, respectively. Quanti­
tative LC-MS/MS analyses of egg yolk extracts were performed in order
to assess the effects of lr8-KO on the composition of yolk proteins
derived from the four different medaka Vtg subtypes. The average ratios
of yolk proteins derived from VtgAa1, VtgAa2, VtgAb and VtgC in WT
medaka eggs were 43%, 12%, 30%, and 15%, respectively. Incapacita­
tion of lr8 caused these ratios to change to 60%, 15%, 14%, and 11%,
respectively. The percentage of VtgAa1-derived yolk proteins was
significantly higher (~17% increase), while the percentage of VtgAb-
derived yolk proteins was significantly lower (~16% decrease) in lr8-
KO eggs in comparison to WT eggs (p = 0.03, df = 5). No significant
differences between WT and lr8-KO eggs in VtgAa2 content or VtgC
content were detected (Fig. 8).
8
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
4. Discussion
In this study we incapacitated the lr8 gene, for the first time in any
vertebrate, using the CRISPR/Cas9 system in the medaka as a model fish.
Although Lr8 has long been proposed to be the typical receptor for
vertebrate Vtg, it has become apparent that multiplicity of Vtgs is the
norm in teleosts and that different types of receptors may preferentially
bind one or more forms of Vtg (Reading et al., 2011a, 2014; Hiramatsu
et al., 2015; Mushirobira et al., 2015). It is proposed that regulation of
the complex multiple Vtg/Vtgr system may form the basis for formation
of yolk with a composition specially tailored to each individual species
(Hiramatsu et al., 2015). As a step toward verification of this “multiple
Vtg/Vtgr” model, the results of this study provide a clear description of
the effects of lr8-KO on medaka yolk formation and composition, and on
early development, as well as an initial molecular and biochemical
characterization of lr8/Lr8 in this species.
The molecular structure of the deduced medaka Lr8 targeted for KO
in this study contained a single ligand-binding (LB) domain consisting of
eight ligand-binding repeats, the typical structure of Lr8 type Vtgrs in
oviparous vertebrates and of mammalian VLDLRs (Bujo et al., 1995;
Hiramatsu et al., 2013). In teleosts, Lr8 is typically a ~ 100–110 kDa
protein (Reading et al., 2017). Western blotting and IHC of ovary sam­
ples were performed using anti-Lr8 to reveal basic biochemical prop­
erties and tissue distribution of Lr8 in WT medaka. Western blotting
detected a single ~130 kDa immunoreactive band, while the molecular
mass of medaka Lr8 predicted from its deduced primary structure is
~93 kDa. A major Vtg-binding protein (putative Lr8) of similar size has
been detected by ligand blotting of oocyte membrane extracts in several
oviparous vertebrates including chicken (~97 kDa; Bujo et al., 1994)
and Xenopus (~115 kDa; Stifani et al., 1990c). In teleosts, including
Morone species where several Vtg-binding proteins were evident, major
~116–110.5 kDa bands evident in ligand blots were considered to
represent Lr8 (Reading et al., 2011a). Thus far, the masses determined
for putative Lr8 proteins in biochemical analyses (ligand binding assay
and/or Western blotting) tend to be higher (~2–20 kDa) than those
which were deduced from the primary structures. The reason of this
difference is unclear, but such a tendency has also been reported for
LDLR family receptors other than Lr8 (Driel et al., 1987; Reading et al.,
2014). In the cutthroat trout, protein bands with sizes of 105 kDa and 95
kDa were detected by Western blotting of ovarian membrane extracts
using the homologous Lr8 antibody (Mizuta et al., 2013), which was also
employed in the present study (anti-Lr8).
The IHC of Lr8 in ovary samples from WT medaka (see Fig. 5) closely
mirrored that reported for Lr8 in cutthroat trout ovaries by Mizuta et al.
(2013). Lr8 appears to be produced and translocated in a similar manner
in both species. Translation of Lr8 protein starts in the oocyte at the yolk
vesicle stage, proceeding onward to the vitellogenic (secondary yolk)
stage with accumulation of Lr8 by the oocyte. As the oocyte grows, Lr8
protein is translocated to the oocyte periphery in preparation for uptake
of Vtg proteins from the circulation (Fig. 5C). Beside the dominant
localization of Lr8 inside the medaka oocytes, additional weak immuno-
reaction was also confirmed in the theca cells surrounding the follicles.
Two splice variants of lr8/Lr8, a somatic cell type (LR8 with O-linked
sugar domain: LR8+) and an oocyte type (LR8 without O-linked sugar
domain: LR8-), appear to be present in ovaries of several oviparous
vertebrates (Bujo et al., 1995; Reading et al., 2011b). The antibody used
in this study was prepared using a recombinant protein encoding a part
of ligand binding domain of cutthroat trout Lr8 as the antigen. Since this
portion exists commonly in both Lr8 variants, the positive immuno-
reaction in the theca cells possibly indicates the presence of the so­
matic cell type Lr8 in this region.
In this study, we produced homozygous lr8-KO (− /− ) individuals in
order to perform reverse genetic functional studies of the Lr8 receptor.
In the F0 population, various types of mutations, including on-site de­
letions and insertions (indels) as well as inter gRNA deletions, were
introduced at the target site on the lr8 gene (data not shown). These
J. Namgung et al. Comparative Biochemistry and Physiology, Part A 257 (2021) 110967

Peri-nucleolus stage Yolk vesicle stage Secondary yolk stage

WT A B C

75um 75um 75um

D E F
lr8-KO

75um 75um 75um

Peri-nucleolus stage Yolk vesicle stage Secondary yolk stage

G H I
WT

75um 75um 75um

J K L
lr8-KO

75um 75um 75um

Fig. 5. Immunohistochemistry of ovaries photographed by a confocal laser scanning microscope. A-F: overlay images of differential interference contrast and
fluorescence images. G-L: fluorescence images. A-C and G-I: ovaries of wild type (WT); D-F and J-L: ovaries of homozygous lr8 knockout (lr8-KO). Square boxes in A,
D, G and J indicate peri-nucleolus stage follicles. B, E, H and K: yolk vesicle stage follicles. C, F, I and L: secondary yolk stage follicles. All images were taken by using
63 × 1.4 oil immersion objective lens. Scale bar = 75 μm.

9
J. Namgung et al. Comparative Biochemistry and Physiology, Part A 257 (2021) 110967

A B C
1.2 1500
50

1200 40
0.8
900 30

600 20
0.4

300 10

0 0 0
WT lr8-KO WT lr8-KO WT lr8-KO

Fig. 6. The representative wet weight (A), diameter (B) and total protein content (C) of eggs. WT (light grey column): wild type; lr8-KO (dark grey column): ho­
mozygous lr8 knockout. Columns and vertical brackets represent means and standard errors, respectively.

100

80
Survival rate (%)

60

40

* *
20

WT lr8-KO
lr8-KO

0
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

Days post fertilization (dpf)

Fig. 7. Changes in survival rates after fertilization. WT (grey closed circle and solid line), wild type; lr8-KO (black closed square and solid line), homozygous lr8
knockout. Dpf, days post fertilization. Asterisks (*) indicate days on which survival rates significantly differed (p ≤ 0.05) between WT and lr8-KO groups. Circles or
squares represent mean values and vertical brackets indicate standard errors.

mutations were passed to the F1 generation with high probability
(87.3%; see Table 2), indicating that the injected gRNA/Cas9 mRNA
mixture functioned efficiently in targeted gene/genome editing. Among
F0 mutants, we chose those exhibiting inter gRNA deletions to produce
heterozygous F1 mutants; such large deletions were easy to follow by
PCR-based genotyping alone. The F1 generation included several het­
erozygous mutants bearing one of two types of inter gRNA deletion
(− 67 bp and − 58 bp). We selected mutants bearing the − 67 bp deletion
for production of F2 homozygous mutants because this deletion was
expected to cause a codon frame shift and introduce multiple stop co­
dons (see Supplemental material 3) and a male and female pair carrying
the same heterozygous − 67 bp deletion was available. Within the F2
population, 21.9% of individuals were homozygous for the − 67 bp inter
gRNA deletion; these were termed lr8-KO (− /− ) mutants and used to
produce the F3 generation. Genotyping results revealed 100% of both
the F3 and F4 populations to be lr8-KO (− /− ) homozygotes; the F4 and
any subsequent generations are henceforth referred to as the lr8-KO line.
The sequence analyses of the mutation introduced into the lr8-KO
(− /− ) line confirmed the presence of a codon frameshift in the corre­
sponding gene transcript that would definitely impair proper translation
of the product protein. This was additionally confirmed via immuno-
biochemical analyses of WT and homozygous lr8-KO (− /− ) ovaries
using anti-Lr8. The absence of positive Lr8 signals in both the Western
blotting and IHC analyses of lr8-KO (− /− ) ovaries confirms the inca­
pacitation of the medaka lr8 gene in this study. The detection of anti-Lr8
positive signals in WT medaka ovaries in both types of analysis
confirmed that the heterologous trout anti-Lr8 recognized the trans­
lation product of medaka lr8 in this study, supporting our contention

10
J. Namgung et al.
70% *
60%
50%
Yolk composition (%)
40%
30%
20%
10%
0%
VtgAa1 VtgAa2
Vitellogenin type
Fig. 8. Relative contribution to egg yolk proteins of the four Vtg subtypes (VtgAa1, Aa2, Ab, and C) determined by LC-MS/MS. WT (light grey columns), wild type;
lr8-KO (dark grey columns), homozygous lr8 knockout. Asterisks (*) indicate significant difference (p ≤ 0.05) between WT and lr8-KO by Chi-square test columns and
vertical brackets indicate means and standard errors, respectively.
that the immuno-reactive signals observed in IHC and Western blotting
(~130 kDa band) indicate the presence of medaka Lr8 protein.
Phenotypic observations indicated no significant effects of lr8-KO on
egg formation (size, weight, yolk protein content) and early develop­
ment, including hatching. However, even though it was not completely
lethal to offspring, lr8-KO did substantially diminish survival during late
larval stages. This is in close agreement with one of our several initial
predictions considering potential effects of lr8-KO on egg developmental
potential (stated in the Introduction). Predictions 1 or 2, where homozy­
gous lr8-KO (− /− ) females are expected to be sterile or to spawn eggs
with no early developmental competence, respectively, could occur if
Lr8 is the only receptor functioning for Vtg uptake in this species, while
prediction 4, where no significant differences between survival rates of
homozygous lr8-KO (− /− ) and WT offspring is expected, might occur if
Lr8 is not a major essential receptor involved in Vtg uptake. Our results
contradict predictions 1 and 2, indicating that Lr8 is not the only Vtgr in
medaka, and that Lr8 is not essential for early development, respec­
tively. However, our findings also contradict prediction 4, confirming
that Lr8 is strongly related to the quality of medaka eggs and offspring as
evidenced by successful completion of larval development. Thus far,
only prediction 3, where homozygous lr8-KO (− /− ) offspring may hatch
but exhibit lower survival rate than WT larvae, appears to be the case in
the present study, indicating that Lr8 is an important Vtgr whose
extirpation results in profound loss of larval viability.
The substantial decrease in survival of lr8-KO late-stage larvae and
early juveniles is likely to be related to suppressed uptake of VtgAb. The
significant decrease in relative levels of yolk proteins derived from
VtgAb in lr8-KO medaka, which was revealed by LC-MS/MS, can be
taken as an indication of the function of Lr8 as VtgAb carrier. The Lr8
receptor has been shown to preferentially bind VtgAb in Morone species
(Reading et al., 2011b; Hiramatsu et al., 2015). Even though there was
no significant decrease in the total yolk protein content of lr8-KO eggs,
the lack of Lr8 potentially impaired VtgAb uptake and deposition of its
product yolk proteins, resulting in a shortage of certain essential nutri­
ents supporting late larval development.
The LC-MS/MS quantification of yolk proteins derived from each
form of medaka Vtg revealed the most dominant Vtg subtype delivering
11
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
WT lr8-KO
lr8-KO
*
VtgAb VtgC
yolk proteins into WT medaka eggs to be VtgAa1. VtgAa1 was the source
of 43% of total Vtg-derived yolk protein, followed by the VtgAb, which
accounted for 30% of Vtg-derived yolk protein (Fig. 8). Thus, these two
forms of Vtg can considered to be the major Vtg subtypes supporting
vitellogenesis in medaka and, therefore, the major sources of nutrients
for their developing embryos and larvae. There were significant differ­
ences in Vtg composition between lr8-KO medaka eggs and WT eggs
with respect to VtgAa1 and VtgAb. A drastic (~50%) decrease in the
proportion of VtgAb-derived yolk proteins in lr8-KO eggs relative to that
seen in WT eggs occurred and is clearly related to absence of the Lr8
receptor. We are uncertain about the mechanisms allowing delivery of
the remaining portion of VtgAb into lr8-KO oocytes/eggs lacking the Lr8
receptor. If, among ovarian lipoprotein receptors, Lr8 was the only re­
ceptor for VtgAb, then lr8-KO should have led to complete absence of
VtgAb in the eggs. The fact that VtgAb-derived yolk proteins were
detected in substantial, although diminished, quantities in the eggs of
lr8-KO medaka suggests that other ovarian lipoprotein receptor(s) can
bind to VtgAb and support its uptake by the oocytes. We previously
discovered four Vtgr proteins in the Morone ovary: one receptor that
binds only VtgAa (Lrp13; Reading et al., 2014), two (putative Lr8) re­
ceptors that preferentially bind VtgAb (Reading et al., 2011b), and an
unidentified receptor that weakly and indiscriminately binds both VtgAa
and VtgAb (Reading et al., 2011b, 2014; Hiramatsu et al., 2015). Further
studies are needed to clarify the specific functions of these receptors.
The significant increase in proportion of VtgAa1-derived yolk pro­
teins, from ~43% in WT medaka eggs to ~60% in lr8-KO eggs (Fig. 8),
suggests the existence of compensatory mechanism(s) to cope with the
decrease of VtgAb products after ablation of Lr8. Such compensatory
actions have been described before for zebrafish. For example, ~3- and
~1.5-fold increases in relative Vtg7 protein levels have been observed in
zebrafish eggs after vtg1-KO and vtg3-KO, respectively (Yilmaz et al.,
2019), although this compensation could not rescue the deleterious
phenotypic effects of vtg-KO. Such compensation has also been reported
regarding increased LH levels following fsh-KO in zebrafish ovaries
(Zhang et al., 2015). The novel ovarian receptor termed Lrp13 is pro­
posed as a possible VtgAa receptor in moronids (Reading et al., 2011b,
2014; Hiramatsu et al., 2015), and an ortholog of the gene encoding this
J. Namgung et al.
receptor can be found in the genome of medaka (Genbank
XM_023958725.1). It is possible that lr8-KO increases VtgAa1 uptake
mediated by Lrp13 and/or other ovarian lipoprotein receptors in this
species. The proximate molecular mechanism(s) underlying such
compensation cannot be ascertained from the data obtained in the
present study and remain to be verified in future research.
The complementary involvement of other ovarian Vtg receptors (e.
g., Lrp13 and others) in VtgAb uptake into oocytes of lr8-KO medaka
perhaps offsets the loss of Lr8 function, securing the minimum necessary
supply of VtgAb-derived yolk proteins while simultaneously supporting
compensatory increases in the uptake of VtgAa1. We speculate that such
coordinated complementation and compensation may explain why lr8
KO was not 100% lethal in medaka, allowing nearly a third of the lr8-KO
fish to complete larval development (Fig. 8).
Specific functions of multiple Vtg subtypes in acquisition of egg
buoyancy via their provision of free amino acids, which are critical os­
motic effectors in oocyte hydration, and in sustaining high develop­
mental competence by providing critical nutrients and structural
building blocks have mostly been reported for marine fishes laying
pelagic eggs (Matsubara et al., 2003; Finn and Kristoffersen, 2007;
Hiramatsu et al., 2015). Very little is known about this topic in fresh­
water fishes laying benthic, adhesive eggs, such as medaka. Recently,
gene KO targeting type 1 Vtgs (vtg1,4, and 5; vtg1-KO), which are
orthologs of medaka VtgAa’s, and type 3 Vtg (vtg3; vtg3-KO), which is
orthologous to medaka VtgC, was performed in zebrafish, which also lay
demersal eggs in freshwater. KO of these specific vtg subtypes had severe
negative effects on offspring developmental competence and survival
(Yilmaz et al., 2019). Yilmaz et al. (2019) suggested that type 1 Vtgs
have specific functions supporting late larval development while the
type 3 Vtg supports very early stages of embryonic development. The
results of the present study indicates that VtgAb supports late stages of
larval development in medaka, most probably along with other types of
Vtg (e.g. VtgAas and/or VtgC), although this requires verification by
further research.
In summary, in this study we discovered, identified and partially
characterized one lr8 gene and several vtg genes in medaka. Results of
Western blotting and IHC assays strongly supported the concept that Lr8
is engaged in uptake of Vtg into the medaka oocytes. In addition, VtgAa1
and VtgAb were found to account for ~70% of total Vtg-derived yolk
proteins in the WT medaka. Furthermore, a homozygous lr8-KO line of
medaka lacking ovarian Lr8 protein was generated to investigate Lr8
function(s). The lr8 KO did lead to a substantial decrease in the survival
rate of late stage larvae compared to that of WT fish. The reverse genetic
study proved that Lr8 is a receptor for VtgAb because lr8-KO induced a
remarkable decrease in the proportion of egg yolk proteins derived from
VtgAb. The mechanisms by which the remaining portion of VtgAb-
derived proteins entered lr8-KO eggs remains to be investigated with
respect to the involvement of additional types of Vtg receptors. Our
findings indicate specific functions of VtgAb in late larval development,
perhaps along with other types of Vtg. The future direction of this line of
research should maintain focus on the functioning and regulation of
multiple Vtg/Vtgr systems and their significance in vertebrate
reproduction.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgements
We thank S. Oka, Global Facility Center, Hokkaido University, for
assistance with LC-MS/MS analyses. We also thank K. Okubo, Graduate
School of Agricultural and Life Sciences, The University of Tokyo, and K.
Kawakami, Division of Molecular and Developmental Biology, National
12
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
Institute of Genetics, for their assistance with genome editing. We thank
M. Shimizu and H. Kudo, Faculty of Fisheries Sciences, Hokkaido Uni­
versity for their assistance with immunochemistry and Western blotting.
We thank C.V. Sullivan, Carolina AquaGyn, Raleigh, NC USA for critical
reading of this manuscript. This work was supported in part by Grant-in-
Aid for Scientific Research (B): JSPS KAKENHI Grant number
JP18H02272 to NH and TT.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.cbpa.2021.110967.
References
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local
alignment search tool. J. Mol. Biol. 215, 403–410.
Bujo, H., Hermann, M., Kaderli, M.O., Jacobsen, L., Sugawara, S., Nimpf, J.,
Schneider, W.J., 1994. Chicken oocyte growth is mediated by an eight ligand
binding repeat member of the LDL receptor family. EMBO J. 13 (21), 5165–5175.
Bujo, H., Lindstedt, K.A., Hermann, M., Dalmau, L.M., Nimpf, J., Schneider, W.J., 1995.
Chicken oocytes and somatic cells express different splice variants of a
multifunctional receptor. J. Biol. Chem. 270 (40), 23546–23551.
Davail, B., Pakdel, F., Bujo, H., Perazzolo, L.M., Waclawek, M., Schneider, W.J., Le
Menn, F., 1998. Evolution of oogenesis: the receptor for vitellogenin from the
rainbow trout. J. Lipid Res. 39 (10), 1929–1937.
Delwart, E.L., Herring, B., Rodrigo, A.G., Mullins, J.I., 1995. Genetic subtyping of human
immunodeficiency virus using a heteroduplex mobility assay. Genome Res. 4 (5),
S202–S216.
Driel, V.I.R., Davis, C.G., Goldstein, J.L., Brown, M.S., 1987. Self-association of the low
density lipoprotein receptor mediated by the cytoplasmic domain. J. Biol. Chem. 262
(33), 16127–16134.
Finn, R.N., Fyhn, H.J., 2010. Requirement for amino acids in ontogeny of fish. Aquac. 41,
684–716. https://doi.org/10.1111/j.1365-2109.2009.02220.x.
Finn, R.N., Kristoffersen, B.A., 2007. Vertebrate vitellogenin gene duplication in relation
to the “3R hypothesis”: correlation to the pelagic egg and the oceanic radiation of
teleosts. PLoS One 2 (1), e169.
Fisher, R.A., 1922. On the interpretation of χ 2 from contingency tables, and the
calculation of P. J. R. Stat. Soc. Ser. D 85 (1), 87–94.
Gagnon, J.A., Valen, E., Thyme, S.B., Huang, P., Ahkmetova, L., Pauli, A., Schier, A.F.,
2014. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and
large-scale assessment of single-guide RNAs. PLoS One 9 (5), e98186.
Hiramatsu, N., Chapman, R.W., Lindzey, J.K., Haynes, M.R., Sullivan, C.V., 2004.
Molecular characterization and expression of vitellogenin receptor from white perch
(Morone americana). Biol. Reprod. 70 (6), 1720–1730.
Hiramatsu, N., Cheek, A.O., Sullivan, C.V., Matsubara, T., Hara, A., 2005. Vitellogenesis
and endocrine disruption. In: Mommsen, T.P., Moon, T.W. (Eds.), Biochemistry and
Molecular Biology of Fishes, 6. Elsevier, pp. 431–471.
Hiramatsu, N., Luo, W., Reading, B.J., Sullivan, C.V., Mizuta, H., Ryu, Y.W., Hara, A.,
2013. Multiple ovarian lipoprotein receptors in teleosts. Fish Physiol. Biochem. 39
(1), 29–32.
Hiramatsu, N., Matsubara, T., Hara, A., Donato, D.M., Hiramatsu, K., Denslow, N.D.,
Sullivan, C.V., 2002. Identification, purification and classification of multiple forms
of vitellogenin from white perch (Morone americana). Fish Physiol. 24, 355–370.
Hiramatsu, N., Todo, T., Sullivan, C.V., Schilling, J., Reading, B.J., Matsubara, T.,
Wu, M., 2015. Ovarian yolk formation in fishes: molecular mechanisms underlying
formation of lipid droplets and vitellogenin-derived yolk proteins. Gen. Comp.
Endocrinol. 221, 9–15.
Inoue, K., Takei, Y., 2003. Asian medaka fishes offer new models for studying
mechanisms of seawater adaptation. Comp. Biochem. Physiol. B 136, 635–645.
Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: molecular
evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35,
1547–1549.
Lancaster, P.M., Tyler, C.R., 1994. Developmental expression and modulation of the
vitellogenin receptor in ovarian follicles of the rainbow trout, Oncorhynchus mykiss.
J. Exp. Zool. 269 (5), 458–466.
Lubzens, E., Bobe, J., Young, G., Sullivan, C.V., 2017. Maternal investment in fish
oocytes and eggs: the molecular cargo and its contributions to fertility and early
development. Aquaculture. 472, 107–143.
Luo, W., Ito, Y., Mizuta, H., Massaki, K., Hiramatsu, N., Todo, T., Hara, A., 2013.
Molecular cloning and partial characterization of an ovarian receptor with seven
ligand binding repeats, an orthologue of low-density lipoprotein receptor, in the
cutthroat trout (Oncorhynchus clarki). Comp. Biochem. Physiol. A 166 (2), 263–271.
Matsubara, T., Nagae, M., Ohkubo, N., Andoh, T., Sawaguchi, S., Hiramatsu, N., Hara, A.,
2003. Multiple vitellogenins and their unique roles in marine teleosts. Fish Physiol.
Biochem. 28 (1–4), 295–299.
Mizuta, H., Luo, W., Ito, Y., Mushirobira, Y., Todo, T., Hara, A., Hiramatsu, N., 2013.
Ovarian expression and localization of a vitellogenin receptor with eight ligand
binding repeats in the cutthroat trout (Oncorhynchus clarki). Comp. Biochem.
Physiol. B 166 (1), 81–90.
Mushirobira, Y., Mizuta, H., Luo, W., Todo, T., Hara, A., Reading, B.J., Hiramatsu, N.,
2015. Molecular cloning and partial characterization of a low-density lipoprotein
J. Namgung et al.
receptor-related protein 13 (Lrp13) involved in vitellogenin uptake in the cutthroat
trout (Oncorhynchus clarki). Mol. Reprod. Dev. 82 (12), 986–1000.
Nimpf, J., Schneider, W.J., 1998. The VLDL receptor: an LDL receptor relative with eight
ligand binding repeats, LR8. Atherosclerosis 141 (2), 191–202.
Nimpf, J., Radosavljevic, M.J., Schneider, W.J., 1989. Oocytes from the mutant restricted
ovulator hen lack receptor for very low density lipoprotein. J. Biol. Chem. 264 (3),
1393–1398.
Reading, B.J., Hiramatsu, N., Sullivan, C.V., 2011a. a. Disparate binding of three types of
vitellogenin to multiple forms of vitellogenin receptor in white perch. Biol. Reprod.
84 (2), 392–399.
Reading, B.J., Sullivan, C.V., Schilling, J., 2011b. Vitellogenesis in fishes. In:
Encyclopedia of Fish Physiology: From Genome to Environment, 1, pp. 635–646.
Reading, B.J., Hiramatsu, N., Sawaguchi, S., Matsubara, T., Hara, A., Lively, M.O.,
Sullivan, C.V., 2009. Conserved and Variant Molecular and Functional Features of
Multiple Egg Yolk Precursor Proteins (Vitellogenins) in White Perch (Morone
americana) and other Teleosts. Mar. Biotechnol. https://doi.org/10.1007/s10126-
008-9133-6.
Reading, B.J., Hiramatsu, N., Schilling, J., Molloy, K.T., Glassbrook, N., Mizuta, H.,
Hara, A., 2014. Lrp13 is a novel vertebrate lipoprotein receptor that binds
vitellogenins in teleost fishes. J. Lipid Res. 55 (11), 2287–2295.
Reading, B.J, Sullivan V., C, Schilling, J, 2017. Vitellogenesis in Fishes. Reference
Module in Life Sciences. Elsevier Inc.
Sakaizumi, M., 1990. Intraspecific variation in Japanese medaka, from genetic analysis.
In: Biology of medaka. Tokyo University Press, Tokyo, Japan, pp. 143–161 in
Japanese.
Stecher, G., Tamura, K., Kumar, S., 2020. Molecular Evolutionary Genetics Analysis
(MEGA) for macOS. Mol. Biol. Evol. 37, 1237–1239. https://doi.org/10.1093/
molbev/msz312.
Stifani, S., Le Menn, F., Rodriguez, J.N., Schneider, W.J., 1990. a. Regulation of
oogenesis: the piscine receptor for vitellogenin. Biochimica. et. Biophysica. Acta
Lipids Lipid Metabol. 1045 (3), 271–279.
Stifani, S., Barber, D.L., Nimpf, J., Schneider, W.J., 1990b. A single chicken oocyte
plasma membrane protein mediates uptake of very low density lipoprotein and
vitellogenin. Proc. Natl. Acad. Sci. U. S. A. 87 (5), 1955–1959.
13
Comparative Biochemistry and Physiology, Part A 257 (2021) 110967
Stifani, S., Nimpf, J., Schneider, W.J., 1990c. Vitellogenesis in Xenopus laevis and
chicken: cognate ligands and oocyte receptors. The binding site for vitellogenin is
located on lipovitellin I. J. Biol. Chem. 265 (2), 882–888.
Strickland, D.K., Gonias, S.L., Argraves, W.S., 2002. Diverse roles for the LDL receptor
family. Trends Endocrinol. Metab. 13 (2), 66–74.
Sullivan, C.V., Yilmaz, O., 2018. Vitellogenesis and yolk proteins, fish. In: Swanson, P.,
Skinner, M.K. (Eds.), Encyclopedia of Reproduction, 2nd Edition. Volume 6.
Comparative Reproduction. Biomedical Sciences Module. Elsevier.
Tao, Y., Berlinsky, D.L., Sullivan, C.V., 1996. Characterization of a vitellogenin receptor
in white perch (Morone americana). Biol. Reprod. 55 (3), 646–656.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity
of progressive multiple sequence alignment through sequence weighting, position-
specific gap penalties and weight matrix choice. Nucleic Acids Res. 22 (22),
4673–4680.
Truett, G.E., Heeger, P., Mynatt, R.L., Truett, A.A., Walker, J.A., Warman, M.L., 2000.
Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris
(HotSHOT). Biotechniques 29 (1), 52–54.
Williams, V.N., Reading, B.J., Amano, H., Hiramatsu, N., Schilling, J., Salger, S.A.,
Sullivan, C.V., 2014. Proportional accumulation of yolk proteins derived from
multiple vitellogenins is precisely regulated during vitellogenesis in striped bass
(Morone saxatilis). J. Exp. Zool. A. Ecol. Genet. Physiol. 321 (6), 301–315.
Wittbrodt, J., Shima, A., Schartl, M., 2002. Medaka—a model organism from the far East.
Nat. Rev. Genet. 3 (1), 53–64.
Yilmaz, O., Prat, F., Ibáñez, A.J., Köksoy, S., Amano, H., Sullivan, C.V., 2016. Multiple
vitellogenins and product yolk proteins in European sea bass (Dicentrarchus labrax):
molecular characterization, quantification in plasma, liver and ovary, and
maturational proteolysis. Comp. Biochem. Physiol. B 194, 71–86.
Yilmaz, O., Patinote, A., Nguyen, T., Com, E., Pineau, C., Bobe, J., 2019. Genome editing
reveals reproductive and developmental dependencies on specific types of
vitellogenin in zebrafish (Danio rerio). Mol. Reprod. Dev. 86 (9), 1168–1188.
Zhang, Z., Zhu, B., Ge, W., 2015. Genetic analysis of zebrafish gonadotropin (FSH and
LH) functions by TALEN-mediated gene disruption. Mol. Endocrinol. 29 (1), 76–98.