Genomics: Experimental methods

Dr. Pragasam Viswanathan

Professor, SBST
• The use of diagnostic tests (aka biomarkers) to identify in
advance which patients are likely to respond well to a
therapy
• The benefits of this approach are to
– avoid adverse drug reactions
– improve efficacy
– adjust the dose to suit the patient
– differentiate a product in a competitive market
– meet future legal or regulatory requirements
• Potential uses of biomarkers
– Risk assessment
– Initial/early detection
– Prognosis
– Prediction/therapy selection
– Response assessment
– Monitoring for recurrence
Rationale 1:
Why now ? Regulatory path becoming more clear

There is more at stake than

efficient drug development.
FDA « critical path initiative »
Pharmacogenomics
guideline

Biomarkers are the foundation

of « evidence based
medicine » - who should be
treated, how and with what.

Without Biomarkers advances in

targeted therapy will be
limited and treatment remain
largely empirical.
It is imperative that Biomarker
development be accelerated
along with therapeutics
First and maturing second generation molecular
profiling methodologies allow to stratify clinical
trial participants to include those most likely to
benefit from the drug candidate—and exclude
those who likely will not—pharmacogenomics-
based
Clinical trials should attain more specific results
with smaller numbers of patients. Smaller
numbers mean fewer costs (factor 2-10)
An additional benefit for trial participants and
internal review boards (IRBs) is that
stratification, given the correct biomarker, may
reduce or eliminate adverse events.
Molecular Profiling

The study of specific patterns (fingerprints) of proteins,

DNA, and/or mRNA and how these patterns correlate with
an individual's physical characteristics or symptoms of
disease.
Before molecular profiling …
This Mini Microscope for the Apple iPhone is a convenient in-field
device you can use for doing important close up inspection of samples
or taking photos of items of interest.
This fun gadget, with a magnification rate of 60x and 2 bright white
LEDs to illuminate your close-ups. This pocket sized microscope is the
must have item for every inspector, nurse, scientist, and explorer /
hobbyist to have in their travel pack.
Before molecular profiling …
Before molecular profiling …
First Generation Molecular Profiling

• Flow cytometry correlates surface markers,

cell size and other parameters
• Circulating tumor cell assays (CTC’s)
quantitate the number of tumor cells in the
peripheral blood.
• Exosomes are 30-90 nm vesicles secreted by a
wide range of mammalian cell types.
• Immunohistochemistry (IHC) measures
protein expression, usually on the cell
surface.
First Generation Molecular Profiling

• Gene sequencing for mutation

detection
• Microarray for m-RNA message
detection
• RT-PCR for gene expression
First Generation Molecular Profiling

• Clone the DNA.

• Generate a ladder of labeled (colored)
molecules that are different by 1
nucleotide.
• Separate mixture on some matrix.
• Detect fluorochrome by laser.
• Interpret peaks as string of DNA.
• Strings are 500 to 1,000 letters long
• 1 machine generates 57,000
nucleotides/run
Genetic Variation
Among People
Single nucleotide polymorphisms
(SNPs)
GATTTAGATCGCGATA
GAG
GATTTAGATCTCGATA
GAG

0.1% difference among

people
mRNA Expression Microarray
Basics of the ― new technology
• Get DNA.
• Attach it to something.
• Extend and amplify signal with some color
scheme.
• Detect fluorochrome by microscopy.
• Interpret series of spots as short strings of
DNA.
• Strings are 30-300 letters long
• Multiple images are interpreted as 0.4 to 1.2
GB/run (1,200,000,000 letters/day).
• Map or align strings to one or many genome.
Next Generation Technologies

• Roche (454)
–Emulsion PCR
–Polymerase
–Natural Nucleotides
• 100-500 Mb for 5-15k
–1% error rate
–Homopolymers
One additional
insight ...
Short Read Techologies

• Illumina GA (HiSeq, MySeq)

• ABI
SOLID
Other second generation technology: (ABI) SOLID
Second generation DNA/RNA profiling
Second Generation DNA profiling

• Enrichment Sequencing
• ChIP-Seq (Chromosome
Immunoprecipitation)
• A substitute for ChIP-chip
• Eg. to find the binding sequence of proteins
(TFBS)
Second Generation DNA profiling
Second Generation DNA profiling

• Exome Sequencing (aka known as

targeted exome capture) is an
efficient strategy to selectively
sequence the coding regions of the
genome to identify novel
genes associated with rare and comm
on disorders.
• 160K exons
Second Generation RNA profiling

Besides the 6000 protein coding-genes …

• 140 ribosomal RNA genes
275 transfer RNA genes
• 40 small nuclear RNA genes
• >100 small nucleolar genes

• Function of RNA genes

• pRNA in 29 rotary packaging

motor (Simpson et el. Nature 408:745-750,2000)
• Cartilage-hair hypoplasmia mapped to an RNA
• (Ridanpoa et al. Cell 104:195-203,2001)
• The human Prader-Willi ciritical region (Cavaille et
al. PNAS 97:14035-7, 2000)
Second Generation RNA profiling

RNA genes can be hard to detects

UGAGGUAGUAGGUUGUAUAGU

C.elegans let-27; 21 nt
(Pasquinelli et al. Nature 408:86-89,2000)

Often small
Sometimes multicopy and redundant Often
not polyadenylated
(not represented in ESTs)
Immune to frameshift and nonsense
mutations
No open reading frame, no codon bias
Often evolving rapidly in primary sequence
Second Generation RNA profiling

Although details of the methods vary, the concept

behind RNA-seq is simple:
• isolate all mRNA
• convert to cDNA using reverse transcriptase
• sequence the cDNA
• map sequences to the genome
The more times a given sequence is detected, the more
abundantly transcribed it is. If enough sequences are
generated, a comprehensive and quantitative view of
the entire transcriptome of an organism or tissue can
be obtained.
Second Generation RNA profiling

• Comparing to microarray
– Microarray
• Closed technology: Prior knowledge required
• Affected by pseudo-genes (homologous of real genes)
• Low sensitivity
– RNA-Seq
• Open technology: No prior knowledge required
• Not affected by pseudo-genes because exact
sequence is measured
• Other information could be yielded (SNP,
Alternative
splicing)
 Next generation sequencing
-Third generation sequencing
Ultra-low-cost SINGLE molecule sequencing
Pacific Biosciences: A Third Generation Sequencing Technology
Complete genomics
Nanopore Sequencing
Second Generation Protein profiling

• Proteomics MS-MS-based
exclusively in discovery mode
 MS/MS identification
pipeline overview
pipeline
Goal

Bonanza

Bonanza + IggyPep
Second Generation Protein profiling

• Proteomics - MS-MS-based exclusively in

discovery mode
• Automate diagnostics assay generation
(next generation proteomics)
• Aptamers as alternative to
antibodies
• ImmunoPCR
Next Generation Epigenetics sequencing
 Next Generation Epigenetic Profiling
Genome-wide methylation
…. by next generation sequencing
# markers

3 000 000
MethylCap_Seq

6 000

EpiHealth
50
Deep_Seq

Discovery Verification Validation

<50 > 50 # samples CONFIDENTIAL

only models
and fresh frozen
Bioinformatics, a life science discipline … management of
expectations
Math

Computer Science Theoretical Biology

NP AI, Image Analysis
Datamining structure prediction (HTX)
Bioinformatics
Discovery Informatics – Computational Genomics
Interface Design Expert Annotation
Sequence Analysis
(Molecular)
Informatics
Biology
Computational Biology
Translational Medicine: An inconvenient truth

• 1% of genome codes for proteins, however

more than 90% is transcribed
• Less than 10% of protein experimentally
measured can be ―explained‖ from the
genome
• 1 genome ? Structural variation
• > 200 Epigenomes ??

• Space/time continuum …
Thank you!!!!!!!!!