Genetic Engineering and Plant Biotechnology

Genetic Engineering and Plant Biotechnology

-Methodologies

Transgenic Plants and its Applications

Edible Vaccines and Current Issues

 Genetic Engineering and Plant Biotechnology

➢ What is Biotechnology?

➢ How Plant Genetic Engineering Is Accomplished

➢ Basics and Benefits

➢ Success Stories in Plants

➢ Issues
 What is Biotechnology?

• "Biotechnology" means any technological application that

uses biological systems, living organisms, or derivatives
thereof, to make or modify products or processes for specific
use.
 Span of Biotechnology Over Time

➢ Traditional Biotechnology
• Growing plants
• Raising animals
• Plant and animal breeding
• Fermentation (bread, beer, wine, fish sauce)

➢ Genetic Engineering - Recombinant DNA and tissue-culture-based

biotechnology.

• Genome Editing , Cloning, ability to transform Plants and animals.

 Current Uses of Biotechnology

➢ Agriculture
• Transgenic Plants [disease resistance, drought tolerance, nutrient use
efficiency, plant-based products such as vaccines]
• Transgenic Animals
• Transgenic Microbes
➢ Pharmaceutical
• Insulin
• Antibiotics
• Cancer therapy
➢ Others
• Mining
• Petroleum spill clean-up with microbes
 Genetic Modification Of Plants

• Considerable Effort has gone into developing varieties of Plants over plant
breeding for various needs, e.g.

> improvement of Crop Yield and quality (Agricultural).

> Improvement in tolerance level of biotic and abiotic stresses (Viable Traits).
> Catering for Human needs in the area of health issues (Pharmaceutical).
> Increase in Economical values (Horticultural /Ornamental).
> Catering to Environmental needs – clean-up, biodegradable variety
(Environmental).

* Basic characteristics of Plant – Being Totipotent.

National Academy of Science Report on GE Crops - May
2016

• While recognizing the inherent

difficulty of detecting subtle or long-
term effects in health or the
environment, the study committee
found no substantiated evidence of a
difference in risks to human health
between currently commercialized
genetically engineered (GE) crops and
conventionally bred crops, nor did it
find conclusive cause-and-effect
evidence of environmental problems
from the GE crops.
 National Academy of Science Report on GE Crops - May
2016

• Figure 1. Commercially
Grown Genetically
Engineered Crops
Worldwide.

In 2015, almost 180 million hectares of GE crops were planted

globally, which was about 12% of the world’s planted cropland that
year. There were herbicide-resistant varieties of maize (corn),
soybean, cotton, canola, sugar beet, and alfalfa, and insect-
resistant varieties of maize, cotton, poplar and eggplant.
Food Quiz: Pick the GMO

Japanese Pear
 Lets Get To Know Them Better
>> Major Reasons: Why the Genetic Engineering Path was chosen?
• The addition of genes often improves the agricultural, horticultural, or
ornamental value of a crop plant.
• Transgenic plants can act as living bioreactors for the inexpensive production
of economically important proteins or metabolites.
• Plant genetic transformation provides a powerful means for studying the
actions of genes during development and other biological processes.

>> Way of introduction:

• By a single gene or a small cluster of genes having either insectisidal activity
or protection against viral infection, or resistance to herbicides, or protection
against pathogenic fungi and bacteria.

• Delay of senescence, tolerance of environmental stresses, altered flower

pigmentation, improved nutritional quality of seed proteins, increased
postharvest shelf life, and self incompatibility.
• In addition, to produce a variety of useful compounds, including therapeutic
agents, polymers, and diagnostic tools, such as antibody fragments, making
edible vaccines.

• To date, over 150 different plant species have been genetically transformed.
• Many crops and forest species over in 50 countries worldwide.
• Plant biotechnology is having an enormous impact over plant breeding
programs which has been decreased over 10-15 years.

• By mid 2008, researchers had reported transformation with complete DNA

sequences of 100 microorganisms and dozens of animals, but only 3 different
plants: Arabidopsis thaliana, rice and poplar became successful.
 Progress in Genetic Engineering Front

• The genome sequencing of several other plants: Corn, soybean, canola,

tomato, cotton, potato, cassava, sorghum, grape and peach had been initiated.

• This made it possible to spread implementation of the techniques in them.

• Though there are opposes in a larger number in Europe and North America……

• Each succeeding year since mid 1990s, the use of transgenic crops has
continued to increase both in absolute terms and in the number of countries
using this technology.
>> Basic Principles Behind The Success
 Various Methods Of Plant Genetic Engineering

➢ Agrobacterium-mediated gene transfer

➢ Gene Gun – Microprojectile Bombardment
➢ Protoplast transfer and Fusion
➢ Genome Editing
➢ Gene Silencing
➢ CRISPR mediated
Agrobacterium mediated transfer was reported in monocot species including the most
important food crops like rice (1994), maize (1996) & wheat (1997).

• Efficient transformation of rice (Oryza sativa L.)mediated by Agrobacterium

and sequence analysis of the boundaries of the T-DNA
- Yukoh Hiei et al., The Plant Journal (1994) 6(2), 271-282.

• High efficiency transformation of maize (Zea Mays L.) mediated by

Agrobacterium tumefaciens.
- Ishida Y et al., Nature Biotechnol (1996)14: 745-750.

• Genetic transformation of wheat mediated by Agrobacterium tumefaciens.

- Cheng M et al., Plant Physiol (1997) 115:971-980.
 Facts on Agrobacterium Species

• Agrobacteria are naturally occurring, ubiquitous soil borne

pathogens.
• Agrobacterium tumefaciens or Agrobacterium rhizogenes-
mediated transformation is to date the most commonly used
method for obtaining transgenic plants.

• The tumorigenic host plant species for range A. tumefaciens

include: Large number of dicots and some monocots and
Gymnosperms.

• A. tumefaciens causes crown gall disease (tumors).

• A. rhizogenes causes root hair disease (hairy root).
 Agrobacterium-mediated gene transfer

• Just as animal viruses can be used as gene delivery

vehicles for the introduction and expression of genes in
animal cells, bacteria which infect plants can be
exploited for delivering genes into plant cells.

• Agrobacterium tumifaciens, causes a disease known as the ‘crown gall

disease’ in a variety of dicotyledonous plants, especially members of the
rose family such as apple, pear, peach, cherry, almond, raspberry and
roses.

• Plants infected with this bacterium develop large

tumour-like swellings (galls) that typically occur at the
crown of the plant, just above soil level.

• Following infection, the bacterium transfers part of its

DNA to the plant, and this DNA integrates into the
plant’s genome, causing the production of tumours and
associated changes in plant metabolism.
 Components in Agrobacterium mediated Genetic Transfer

• Agrobacterium tumefaciens has been naturally genetically engineering plants for centuries!

• A: Agrobacterium tumefaciens
• B: Agrobacterium genome
• C: Ti Plasmid : All Ti plasmids code for functions associated with i) plasmid replication and maintenance, ii)
conjugative transfer, iii) virulence, iv) opine utilization, and v) sensory perception of exogenous signals released by
the plant host and neighboring agrobacterial cells at the site of infection

• a: T-DNA
• b: Vir genes
• c: Replication origin
• d: Opines catabolism genes

• D: Plant cell
• E: Mitochondria
• F: Chloroplast
• G: Nucleus
 Plant Genetic Engineering History
- Agrobacterium tumefaciens infects plant cell

• Steps 1 & 2: Bacterial cell weakly attaches

itself to the plant cell. It then produces
cellulose fibrils to anchor it to the plant cell
(infection).

• Step 3: When the bacterium detects certain

compounds produced by the plant in
response to bacterial infection, vir
(virulence) genes [located on b of the Ti
plasmid (C)] start producing various
compounds (10-30 kbp).

• Step 4: One vir gene complex cuts the T-

DNA (a) from the Ti plasmid (C).
 Plant Genetic Engineering History
Agrobacterium tumefaciens infects plant cell

• Step 5: In the meantime, other vir genes produce compounds that coat the
T-DNA to help export it into the recipient plant cell

• Step 6: Other vir genes make the nucleus of the plant cell receiving the T-
DNA more receptive.

• Step 7: T-DNA is integrated into the host genome.

• T-DNA contains genes that will force the plant to produce special amino
acids called opines, which the bacteria can metabolize as its food source!
 Why This Gall Formation Happens?

* Once integrated into the plant nuclear genome, these T-DNAs encode 13
proteins with two main functions. One set of enzymes promotes synthesis of
two plant growth regulators, auxins and cytokinin zeatin.
• To cause gall formation, the T-DNA encodes genes for the production of
auxin or indole-3-acetic acid via a pathway not normal for plants, so the
plant can’t regulate its production . . . only the pathogen!
• Other T-DNA genes code for production of cytokinins. Together, cell
proliferation and gall formation occur.
Way to Plant Genetic Engineering
Agrobacterium tumefaciens infects plant cell

• To transform plant cells, the desired gene

sequence is cloned into the T-DNA.

• The T-DNA is the delivery vehicle of the

desired gene sequence into the plant
cell.
 Mechanism of Gene Transfer using Agrobacterium

------ Three Steps for entry into a Plant Cell

► Entry into plant cell?

► Nuclear uptake?

► Integration into chromosome?

Success Stories in Plant Genetic Engineering
using Agrobacterium tumefaciens

• “Transient and stable expression of the

firefly luciferase gene in plant cells and
transgenic plants” (Ow et al. Science
Nov. 1986)
• When tobacco plant was expressing
the chemical substrate Luciferin.
Gene Gun - Biolistic
• Hawaiian Rainbow Papaya
• Inserted papaya ring spot virus coat protein
using high speed particle bombardment
method.
 Helium pressure builds up to a certain point, the plastic rupture disk bursts, and the
released gas accelerates the flying disk with the DNA-coated gold particles on its lower
side. The gold particles pass the stopping screen, that
holds the flying disk, and penetrates the cells of the sterile leaf.
Success Stories
➢ Mechanism of Gene Transfer using Agrobacterium

➢ Agrobacterium tumefaciens & Crown Gall Disease

➢ Ti-plasmid and regulatory contents

➢ Engineering Binary vectors for plant transformation

➢ Transformation protocols using Agrobacterium

➢ Factors influencing transformation efficiency

Basic Principle
 Gene Transfer using Agrobacterium
Ti-plasmid

GGCAGGATATTCAATTGTAAAT

GGCAGGATATTCAATTGTAAAT

Right and left border (RB, LB) sequences are the only parts of T-
DNA needed to enable transfer into plants (removal of other T-
DNA genes creates a disarmed plants).
 Gene Transfer using Agrobacterium -Agro types

Ti plasmid-carrying strains of Agrobacteria induce not only plant tumor formation

but also production of various amino acid and sugar phosphate derivatives termed
Opines.
• Agropine-type (strainEHA105::pEHA105):
Carry genes for agropine synthesis
and catabolism.
Tumors do not differentiate and die out.

• Octopine-type (strain LBA4404::pAL4404):

Carry genes (3 required) to synthesize
octopine in the plant and catabolism in the
bacteria.
Tumors do not differentiate, but remain as
callus tissue.

• Nopaline-type (strain GV3101::pMP90 (pTiC58)):

Carry gene for synthesizing nopaline in the plant
and for utilization (catabolism) in the bacteria.
Tumors can differentiate into shooty masses
(teratomas). Hellens et al (2000; Trends in Plant Science 5:446-451
 Gene Transfer using Agrobacterium

• Chromosomal and vir genes of

bacterial cells are both
involved in T-DNA transfer Gene
• Virulence genes
• vir A
• vir B Chemoreceptor, activator of vir G
• vir C Transmembrane complex
• vir D Host-range specificity
• vir E Site-specific endonuclease
• vir F T-DNA processing and protection
• vir G Host range specificity
Positive regulator of vir B, C, D, E, F
Chromosomal genes Attachment to plant cell, vir gene
regulation
 Summary: T-DNA transfer
1. Agrobacteria attach to plant cell surfaces at wound sites.
2. The plant releases wound signal compounds, such as acetosyringone.
3. Vir C and/or Vir F recognize the host plant cells.
4. The signal binds to Vir A on the Agrobacterium membrane.
5. Vir A with signal bound activates Vir G.
6. Activated Vir G turns on other vir genes, including Vir D and E.
7. Vir D cuts at a specific site in the Ti plasmid (tumor-inducing), the left order.
8. Single stranded T-DNA is bound by Vir E product as the DNA unwinds from
the Vir D cut site. Binding and unwinding stop at the right border.
9. Vir B + T-DNA complex is transferred to the plant cell, where it
integrates in nuclear DNA.

T-DNA codes for proteins that produce hormones and opines. Hormones
encourage growth of the transformed plant tissue.
Opines feed bacteria a carbon and nitrogen source.
How to Construct Ti Plasmid-Derived Vector Systems
 > A selectable Marker gene, that confers resistance on transformed cells.

> A Origin of DNA replication that allows the plasmid to replicate.

> The right border sequence of the T-DNA region, required for T-DNA integration
into plant DNA.

> A polylinker (multiple cloning site) to facilitate insertion of the gene of interest.

> A “killer” gene encoding a toxin downstream to prevent unwanted vector DNA.
 Various Vector Construct Approaches

• These cloning vectors lack vir genes, they cannot by themselves infect the
transfer and intergration of the T-DNA region into recipient plant cells.

• Two different Approaches:

• 1. A binary vector system is used – that contains either E. coli and A.
tumefaciens origin of DNA replication, an E. coli-A. tumefaciens shuttle
vector. It is comparatively large size (> 10Kb).

• 2. The Cointegrate Vector System – has a plant selectable marker gene,

the target gene, the right border, an E. coli origin of replication and a
bacterial selectable marker gene.
• This cointegrate vector recombines with a modified Ti plasmid lacks both
the tumor-producing genes and the right border.
 A Binary Vector Map

Plant selectable marker:

Bacterial selectable marker:

 Reporter genes used in transgenic plants
The gusA gene encodes ß-glucuronidase (GUS)

• GUS is a hydrolase that cleaves a wide variety of ß-glucuronides, is the most

widely used reporter system for plants.
• It is easy to quantify, highly sensitive and very specific.
• Substrates for GUS are available for spectrometric, fluorometric and histochemical
detection assays.

• 5-Bromo-4-chloro-3-indolyl β-D-glucuronide (X-glu)

GUS oxidative
dimerization
X-glu --------→ colourless soluble ------------------------→ Blue precipitate of
intermediate diX-indigo
Common Selection Markers and Reporter Genes
 Other Relevant Components and Their Contributions
* Promoters used for expression in transgenic plants Cauliflower mosaic virus 35S promoter
• CaMV 35S is a strong promoter that is active in essentially all dicot plant tissues

• US 6255560 - Chimeric genes for transforming plant cells using viral promoters (U.S. patent expired in 2005).

* Selectable markers used in generation of transgenic plants nptI, nptII

• Two neomycin phosphotransferase genes are used in selection of transformed organisms: the neomycin
phosphotransferase I (nptI) gene and the neomycin phosphotransferase II (nptII) gene.

• It was initially isolated from the transposon Tn5 present in Escherichia coli K12.

• The gene codes for the aminoglycoside 3'-phosphotransferase (denoted NPTII) enzyme, which inactivates by
phosphorylation a range of aminoglycoside antibiotics such as kanamycin, neomycin, geneticin (G418), and
paromomycin.

• The hygromycin phosphotransferase (hpt) gene was originally derived from Escherichia coli.

• The gene codes for hygromycin phosphotransferase (HPT), which detoxifies the aminocyclitol antibiotic
hygromycin
 Introduction of Binary Vector into Agro

• Electroporation
• Freeze/Thaw
• Triparental Mating

Agrobacterium

Competent Agrobacterial Cells

 Introduction of Binary Vector into Agro

• Electroporation

• Freeze/Thaw

- Liquid nitrogen (196C) 3 min----37C for 30 min

 Introduction of Binary Vector into Agro

Agro colonies Agro culture

Agro stock

(-80C with Glycerol)

• Various Other Direct Approaches of Making
Transgenic Plants
 Gene Silencing

• RNA interference, or RNAi, a molecular mechanism that defends plants,

fungi, and animals against viruses made of RNA, a chemical relative of DNA.

• When a RNA virus takes over a host cell, it needs to copy itself and the
copying process creates double strands of RNA.

• The RNAi defense mechanism recognizes these double-stranded RNAs as

foreign and degrades them plus any single-stranded RNAs that it
“recognizes”.
 Gene Silencing

• Proteins are made on single-stranded RNA templates, so a gene targeted by

RNAi can’t produce the protein that it usually makes.

• The gene has not been changed, but it no longer can be used to make
proteins or duplicate the viral RNAs. We speak of a RNAi-targeted gene as
being “knocked down” or “silenced.”

• This natural gene silencing mechanism is why genetically modified (GM)

papaya that contains a coat protein gene from Papaya Ringspot Virus is
able to resist the virus.
Protoplast Fusion and Somatic Fusion

• Protoplasts of two distinct species

of plants are fused together to form
a new hybrid plant with the
characteristics of both.

• Example for plant disease resistance: Plant Cell

Reports, August 2013, Volume 32, pp. 1231-
1241 Development of somatic hybrids Solanum
× michoacanum Bitter. (Rydb.) (+) S. tuberosum
L. and autofused 4x S. × michoacanum plants as
potential sources of late blight resistance for
potato breeding by P. Smyda et al.
 Genome Editing Using CRISPR
Clustered Regularly Interspaced Short Palindromic Repeats
• How CRISPR/Cas9
technology works:
• The “guide RNA” is attached to
Cas9, a bacterial enzyme that will
cut the DNA sequence at the
desired site in the genome.
• Once the genome is broken, the
guide RNA/Cas9 disappear, and
the cell will try to repair the cut,
which can disable or knock out a
particular gene.
• Or, scientists can insert a new
segment of DNA into the cut,
essentially pasting a gene into the
desired location and changing the
genome.
 Genome Editing Using CRISPR
Clustered Regularly Interspaced Short Palindromic Repeats

• The CRISPR system was first discovered in bacteria and functions as a

defense against foreign DNA, either viral or plasmid.

• Used for gene knock-outs, repression or activation

• CRISPR does have limits! But, because of its precision and simplicity, it is
“the” genetic tool of the moment.
 Success Stories Using CRISPR

• Successful examples have also been reported for several other crops with more
complex genomes, such as sorghum (Sorghum bicolor), maize (Zea mays), citrus
(Citrus sinensis), poplar (Populus tricocarpa), tomato (Solanum esculentum),wheat
(Triticum aestivum) and Sorghum.

• This simple, affordable, and elegant genetic scalpel is expected to be widely applied
to enhance the agricultural performance of most crops in the near future.

• Using CRISPR/Cas9 to research genetic resources of medicinal plants can select

excellent traits and increase yield.

• Utilizing new technologies like CRISPR/Cas9 can promote research on biosynthetic

pathways and regulatory mechanisms of effective components those might be
important for human or animal needs. 
 Transgenic Plants and Benefits
• Agriculture – Yield and quality (nutritional).
Lipids, amino acids, vitamins, iron, starch, sweetness.

• Environmental Stress- Insect Resistance, Disease Resistance, Herbicide Resistance,

SaltTolerance.

• Horticulture- Ornamental (Flower quality).

• Economical - Delaying fruit ripening, discoloration, appearance, alteration of Lignin

content.

• Environment – Oil cleaning and polymers, increase in O2 content.

Phyto remediation

• Pharmaceutical – Vaccines, Biopharmaceuticals, antibodies.

• Transgenic Plants can be used as Bioreactors without having any Purification steps.
Where We have Reached So Far?
National Academy of Science Report on GE Crops - May 2016

H
 Genetically Modified Crops
currently planted in the U.S.

CROP TRAITS
Maize Herbicide tolerance, insect resistance
(corn)
Soybean Herbicide tolerance, insect resistance,
high oleic acid content
Cotton Herbicide tolerance, insect resistance
Canola Herbicide tolerance, high oleic acid content
Sugar beet Herbicide tolerance
Alfalfa Herbicide tolerance
Papaya Disease (virus) resistance
Squash Disease (virus) resistance
Potato Resists bruising; reduced asparagine
content
Apple Delayed browning
Some of the Leading Agri Biotech Companies

*Monsanto
*BASF
*Dow Agro Sciences
*Bayer Crop Science
*DuPont
*Syngenta
 Food Quiz: Pick the GMO

No, derived No
by interspecies cross YES
grapefruit x tangerine
mutagenesis
No, derived
MAYBE by
No mutagenesis

No
No YES interspecies cross
apricot x plum
Transgenic Plants and Benefits

• Improved Nutritional Quality

• Insect Resistance

• Disease Resistance

• Herbicide Resistance

• Salt Tolerance

• Delaying fruit ripening

• Phytoremediation

• Biopharmaceuticals & vaccines

 Improved Nutritional Quality

Milling rice removes the husk and any beta-carotene it contained.

Beta-carotene is a precursor to Vitamin A, and consuming milled rice leads to

vitamin A deficiency, especially in the countries of Southeast Asia.

The synthesis of beta-carotene requires a number of enzyme-catalyzed steps.

In January 2000, a group of European researchers reported that they had

succeeded in introducing three transgenes into rice that enabled these
plantsto manufacture beta-carotene in their endosperm.

Carotenoid ----------- 1.6 mg/g 37 mg/g

 Enrichment of Tomato Fruit

Expression of two genes from snapdragon that induce the production of

anthocyanins in tomatoes, generates purple tomatoes.

Anthocyanins offer protection against certain cancers, cardiovascular disease

and age-related degenerative diseases. There is evidence that anthocyanins
also have anti-inflammatory activity, promote visual acuity and hinder obesity
and diabetes.
'Enrichment of tomato fruit with health-promoting anthocyanins by expression of select
transcription factors'
Nature Biotechnology doi: 10.1038/nbt.1506
Miraculin - taste-modifying protein – miracle fruit, the red
berries of Richadella dulcifica - shrub native to West Africa.

Active principle - protein miraculin

Sour foods - lemons, limes & grapefruit, taste sweet when

tasted together with this protein
 Tearless Onion
Dr Colin Eady of Crop & Food Research in New Zealand

As onions are sliced, cells are broken, alliinases - break down aa sulphoxides –
generate sulphenic acids - unstable - rearrange into a volatile gas - diffuses by
air - reaches the eye - reacts with the water to form a diluted solution of
sulphuric acid – Tear glands produce tears to dilute and flush out the irritant

Dr Colin Eady of Crop & Food Research in New Zealand By shutting down the
lachrymatory factor synthase gene using RNAi technology, the conversion of
valuable sulphur compounds to the tearing agent was inhibited
 Insect Resistance And Disease Resistance

Bacillus thuringiensis is a bacterium that is pathogenic for a number of

insect pests. Its lethal effect is mediated by a protein toxin (Bt toxin) it
produces.

When the toxin gene was introduced into economically important crop
plants, they develop resistance for major insect pests obviating the need
for the use of insecticides.

Genes that provide resistance against plant viruses have been successfully
introduced into such crop plants as tobacco, tomatoes, and potatoes.

>99% of all transgenic crops are either herbicide or insect resistant

<1% have other traits

 Salt Tolerance

A large fraction of the world's irrigated land cannot be used to grow most
important crops due to increases salinity in the soil.

Researchers have created transgenic tomatoes that grew well in saline

soils.

The transgene introduced was a sodium/proton antiport pump that

sequestered excess sodium in the vacuole of leaf cells.
 Transgenic plants expressing Antisense RNA

The Flavr Savr tomato

Most tomatoes that have to be shipped to market are harvested before they
are ripe. Otherwise, ethylene synthesized by the tomato causes them to ripen
and spoil before they reach the customer.

Transgenic tomatoes have been constructed that express an antisense RNA

complementary to the mRNA for an enzyme involved in ethylene production.
These tomatoes make only 10% of the normal amount of the enzyme, thus
delaying ethylene production.
 Phytoremediation
• Phytoremediation is defined as the use of plants to remove,
destroy, or sequester hazardous substances from the
environment.

• Phytoremediation of metals and other inorganic compounds

may take one of several forms: Phytoextraction, absorption and
concentration of metals from soil into the plant.

> Rhizofiltration: the use of plants’ roots to reduce

the spread of effluent,
> Phytostabilization: the use of plants to reduce the
spread of metal in the environment
> Phytovolatilization: the uptake and release into the
atmosphere of volatile materials, e.g., mercury or arsenic
containing compounds.

A number of plants that can naturally accumulate large

amount of metal. These plants are called
Hyperaccumulators.

Trangenic plants that can accumulate greater amounts of

Heavy metals using YCF1 protein and detoxify metals.
 Other Potential Therapeutic Domains

>> Production of vaccines

• Cancer Therapy
• Birth Control
• Role in Autoimmune Diseases
• Recombinant drugs/proteins
• Production of Vaccines
- The Edible One!!!!!
 What is Vaccine??

• A vaccine is a biological preparation that improves immunity to a particular

disease.
• Vaccine: ‘a” word derived from usage of cowpox (cow means in “Vacca” in
Latin.
• It contains an agent that resembles a disease-causing microorganism and is
often made from weakened or killed forms of the microbe, its toxins or one
of its surface proteins.
• The agent stimulates the body’s immune system to recognize the foreign
antigen and destroy it.

** Edward Jenner (1796) used this vaccine in human beings resulting in

protection of human beings from smallpox.
Jenner’s work was continued by Louis Pasteur.
 Vaccines

• Two types:

➢ Prophylactic – to prevent the effects of a future

infection by any natural or “wild” pathogen.

➢ Therapeutic – Vaccines against Cancer.

 Requirement of Vaccines

• Vaccines have been revolutionary for the prevention of infectious

diseases.

• Despite worldwide immunization of children against the six

devastating diseases, 20% of infants are still left un-immunized;
responsible for approximately two million unnecessary deaths
every year, especially in the remote and impoverished parts of
the globe. 

•  This is because of the constraints on vaccine production,

distribution and delivery. 
 Ideal Vaccine

• It should not be toxic or pathogenic.

• Low levels of side effect.
• It should not contaminate the environment.
• Its should not cause problems in individual.
• Technique of vaccination should be simple.
• It should be cheap.
 Why Edible Vaccine??
Edible vaccines hold great promise as a cost-effective, easy-to-administer, easy-to-
store, fail-safe and socioculturally readily acceptable vaccine delivery system,
especially for the poor developing countries.

• Needle Free >>

Oral Vaccines provide “mucosal immunity” at various sites by secreting
antibodies.
Don’t need to worry about re-use, misuse and lack of sterilization. Thus, low
risk of infection.

** CHEAP >>
Estimated cost of $0.005 to grow antigen for one dose of hepatitis B vaccine
in an unprocessed form.
Administering oral vaccines would require little or no training at all.
 Why Edible Vaccine??

• Storage >>
Heat-stable; do not require cold-chain maintainance.
If the local/native crop of particular area in engineered to produce the
vaccine, then the need for transportation and distribution can be eliminated.

• Safe >>
Most importantly, they trigger the immunity at the mucosal surfaces such
as mouth which is the body’s first line of defense.
Needs no purification.
Edible vaccine activates both mucosal and systemic immunity.
 Mechanism of Action

• The breakdown of edible vaccine near outer surface of intestine and

contain follicles.
• These follicles act as the site from which antigen penetrates the intestinal
epithelium, thereby accumulating antigen within organized lymphoid
structure.

• The antigen the comes in contact with Macrophage cells.

• They passes the antigen to macrophages and B cell.
• The B cell activates the T cell to provide immune response.

• In this way the immunity is activated by the Edible vaccine.

 Preparation of Edible Vaccine

• Introduction of foreign DNA into plant's genome can either be done by

bombarding embryonic suspension cell cultures using gene-gun or more
commonly through Agrobacterium tumefaciens.

• - a naturally occurring soil bacterium, which has the ability to get into
plants through some kind of wound (scratch, etc.).

• - It possesses a circular "Ti plasmid" (tumor inducing), which enables it to

infect plant cells, integrate into their genome and produce a hollow tumor
(crown gall tumor), where it can live. This ability can be exploited to insert
foreign DNA into plant genome.

• - The plasmid needs to be disarmed by deleting the genes for auxin

and cytokinin synthesis, so that it does not produce tumor.
 Preparation of Edible Vaccine
• - Genes for antibiotic resistance are used to select out the transformed cells and
whole plants, which contain the foreign gene; and for expressing the desired product,
which can then be regenerated from them. 

• - The DNA integrates randomly into plant genome, resulting in a different antigen
expression level for each independent line,  so that 50-100 plants are transformed
together at a time, from which one can choose the plant expressing the highest levels
of antigen and least number of adverse effects.

• - Production of transgenic plants is species dependent and takes 3-9 months.

Reducing this time to 6-8 weeks is currently under investigation.

• - Some antigens, like viral capsid proteins, have to self-assemble into VLPs (virus-like
particles). VLPs mimic the virus without carrying DNA or RNA and therefore are not
infectious.

• - Each single antigen expressed in plants must be tested for its proper assembly and
can be verified by animal studies, Western blot; and quantified by enzyme-linked
immunosorbent assay (ELISA). 
 Expression of hepatitis B surface antigen in transgenic plants.
Mason HS, Lam DM, Arntzen CJ.
Proc Natl Acad Sci U S A. 1992 Dec 15;89(24):11745-9.

Hepatitis B is one of the world’s most common blood-borne viruses.

It infects some 200,000 people per year in US alone.
The virus is one hundred times more contagious than the HIV virus.

The world’s first genetically engineered vaccine against a human disease – Hep B
Is considered one of biotechnology’s greatest triumph.

Tobacco plants were genetically transformed with the gene encoding hepatitis B
surface antigen (HBsAg) linked to a nominally constitutive promoter were
generated.

Recombinant HBsAg purified from transgenic plants had properties similar to

human serum-derived HBsAg.

We conclude that transgenic plants hold promise as low-cost vaccine production

systems.
Immunogenicity in humans of an edible vaccine for HBV.
 Human Papilloma Virus Infection

Human Papilloma Virus Infection

Sexually transmitted HPV is the major cause of Cervical cancer, the most common cause of cancer deaths among women in developing countries.

Gardasil
A genetically engineered Vaccine

Influenza Virus by Reverse Genetics

Currently, reverse genetics is used to generate vaccines against the influenza
virus.
Expression of the rabies virus glycoprotein in transgenic tomatoes

Biotechnology (N Y). 1995 Dec;13(13):1484-7.

McGarvey PB, Hammond J, Dienelt MM, Hooper DC, Fu ZF, Dietzschold B,
Koprowski H, Michaels FH.

Gene linked to CaMV35S promoter

Introduced to tomato plants by
Agrobacterium- mediated transformation
Expression of recombinant glycoprotein in
leaves and fruits
Protein localized in golgi bodies, vesicles
and plasmalemma
 Edible vaccines not ready for main course
Nature Medicine 10, 881 (2004)

Plant-based vaccines face big scientific and regulatory hurdles

Since 1992, when biologist Charles Arntzen proposed genetically modifying
bananas to serve as cheap vaccines against infectious diseases, research
on plant-based pharmaceuticals has grown rapidly. In the US, several
acres of crops, most of them still experimental, are planted each year.

But even Arntzen now says his original idea of distributing vaccine-bearing
fruit was naive, because regulatory agencies will not approve vaccines
with variable dosing.

Vaccine manufacturers have little reason to replace existing production

lines, as most vaccines are economically unattractive. The medical
community is also focused on high-tech approaches, making farm-grown
vaccines a tough sell.
Transgenic Plant-Based Oral Vaccines (2010)
Lugade AA et al., Immunological Investigations, 39:468-482
Antigenic proteins produced in transgenic
plants retained immunogenic properties when
purified
When injected into mice the antigen caused
production of protein-specific antibodies.
Moreover, in some experiments, if the plant
tissues were simply fed to mice, a mucosal
immune response occurred.
This study was conducted as a proof of
principle to determine if humans would also
develop a serum and/or mucosal immune
response to an antigen delivered in an
uncooked foodstuff.
 'Second-Generation' Edible Vaccines

• Successful expression of foreign genes in plant cells and/or its edible

portions has given a potential to explore further and expand the
possibility of developing plants expressing more than one antigenic
protein.

• Multicomponent vaccines can be obtained by crossing two plant lines

harboring different antigens. Adjuvants may also be co-expressed along
with the antigen in the same plant.

• B subunit of Vibrio cholerae toxin (VC-B) tends to associate with copies of

itself, forming a doughnut-shaped five-member ring with a hole in the
middle. 

• This feature can bring several different antigens to M cells at one time - for
example, a trivalent edible vaccine against cholera, ETEC
(Enterotoxigenic E. coli ) and rotavirus could successfully elicit significant
immune response to all three. 

• Global alliance for vaccines and immunization (GAVI) accords very high
priority to such combination vaccines for developing countries.
 Human Vaccines
• Till date there are several vaccines made through edible food.

• Charles Arntzen at Boyce Thompson Institute, USA, accomplished

the first published successful human trial in 1997.

• The present study was conducted as a proof of principle to

determine if humans would also develop a serum and/or mucosal
immune response to an antigen delivered in an uncooked
foodstuff. 

• Eleven volunteers were fed raw transgenic potatoes expressing LT-

B. Ten (91%) of these individuals developed neutralizing
antibodies and six (55%) developed a mucosal response.
Successful Examples Of Edible Vaccines Till Date

Hep B ------- Potato , Tobacco and Lettuce.

Norwalk virus ----- Potato, tomato and Tobacco

HIV ------ Spinach

Rabies virus ------ Tomato

CMV Cytomegalo virus ----- Tobacco

Measles --- Tobacco, Transgenic rice, lettuce

Foot and mouth disease ----- Potato, tobacco and tomato.

Avian influenza -----

Cholera ------- Potato

Anthrax ------- Tobacco and Spinach

 Other Potential Domains

• Cancer Therapy
• Birth Control
• Role in Autoimmune Diseases
• Recombinant drugs/proteins
 Scientific Challenges

• Right doses-number and amount.

• Quality Control?
- Just one mistake by a biotech Company and we will be eating
other people’s prescription drug in our cornflakes.

• Licenses?

• Misuse and Overuse?

 What is the Future of Edible Vaccines??

• 1996-2000 2016
1.7 million Hectares 181 million Hectares
6 Countries 28 Countries
28 Crops
350 Genetically Pharma
products (under development
in US and Canada)

 Edible vaccines offer major economic and technical benefits in the event of
bioterrorism, as their production can be easily scaled up for millions of doses
within a limited period of time (smallpox, anthrax, plague, etc.).
 Could we one day eat plants as a drug instead of
processing them???????

• Yes, It’s a attractive idea and can be possible

• If right doses can be expressed in that plant
• With the help of food processing technology!!
 Challenges in setting Right Dosage
• Three successful human clinical trials have shown that adequate doses of
antigen can be achieved with plant-based vaccines. 

• To determine the right dosage, one needs to consider the person's weight,
age; fruit/plant's size, ripeness and protein content.

• The amount to be eaten is critical, especially in infants, who might spit it,
eat a part or eat it all and throw it up later. Too low a dose would fail to
induce antibodies and too high a dose would, instead, cause tolerance.
Concentrating the vaccine into a teaspoon of baby food may be more
practical than administering it in a whole fruit. The transformed plants can
also be processed into pills, puddings, chips, etc. Regulatory concerns
would include lot-to-lot consistency, uniformity of dosage and purity.
  Nonscientific Challenges

• Presently, small technology companies are undertaking most research, as edible vaccines
are targeted to markets of developing nations. Large companies are more interested in
livestock market than human application.

• Only few international aid organizations and some national governments are rendering
support, but the effort remains largely under-funded.

• Some of the companies funding edible vaccines research have failed to click due to lack of
investors' confidence in returns on investments in genetically-modified (GM) foods.

• There is also a lack of research and development (R&D) personnel in the pharmaceutical
companies.

• In addition, the recombinant (injectable) vaccines against diphtheria, tetanus, etc, are so
cheap now, that there would be little incentive to develop edible vaccines for them.
 Regulatory Issues

• It is still unclear whether the edible vaccines would be regulated under

food, drugs or agricultural products and what vaccine component would be
licensed - antigen itself, genetically engineered fruit or transgenic seeds.
• They would be subjected to a very close scrutiny by the regulatory bodies
in order to ensure that they never enter the food supply.
• This would include greenhouse segregation of medicinal plants from food
crops to prevent out-crossing and would necessitate separate storage and
processing facilities.
• Although edible vaccines fall under "GM" plants, it is hoped that these
vaccines will avoid serious controversy, because they are intended to save
lives.
 Overcoming The Challenges
• Edible plant-derived vaccine may lead to a future of safer and more effective
immunization.
• Hope to overcome some of the difficulties associated with traditional vaccines, like
production, distribution and delivery and this can be incorporated into the
immunisation plans.
• They have passed the major hurdles in the path of an emerging vaccine technology.
• Before becoming a reality, the technical obstacles, though all seem surmountable, need
to be overcome.
• However, with limited access to essential health care in much of the world and with the
scientific community still struggling with complex diseases like HIV, malaria, etc, a cost-
effective, safe and efficacious delivery system in the form of edible vaccines will
become an essential component in our disease-prevention strategy.
 As Hippocrates said, "Let thy food be thy medicine,"

• Hope Edible vaccines provide a greater opportunity in the near

future when no longer injectible needles be used in fruitful
path may be available where an individual get protected from
diseases by simply eating a fruit.
Thank You