BIO198L Gene Biotechnology Laboratory

1st Quarter SY 2015-2016

cDNA Cloning
Lomugdang, Fiord Jogardy B.1

1Student (s), Subject/Section, School of Chemical Engineering, Chemistry and Biotechnology, Mapua Institute of Technology

ABSTRACT

The cloning of cDNAs, copies of cellular RNA, is one of the classical technologies in molecular biology. Over the past 30 years cDNA cloning
technologies have been improved to enable the cloning of large cDNA collections, which are fundamental to today's understanding of the
utilization of genetic information. With the discovery of noncoding RNAs, additional new approaches to the cloning of short RNAs have
been developed. However, with the realization that much larger portions of genomes are transcribed than anticipated from genome
annotations, cDNA cloning faces new challenges to uncover rare transcripts and to make the corresponding cDNAs available for functional
studies. The objectives of this experiment is to design an oligonucleotide primer that corresponds to the amino acid sequence of a protein,
hybridize the primer to a cDNA library, and identify the hybridizing clones among the background spots.

Keywords: cDNA cloning, cDNA library, mRNA,

INTRODUCTION

cDNA cloning is one of the fundamental technologies in molecular
biology, and most of our knowledge about transcripts and proteins
is derived from the ability to prepare cDNA copies from RNA and
to clone them into cDNA libraries. Starting with the discovery of
reverse transcriptases, different protocols for cDNA library
construction have been developed over time. Improvements in
library preparation have been instrumental to gene discovery and
the creation of large genomic resources. Recent discoveries of
new classes of RNA and transcripts expressed at very low levels
demand new cDNA cloning approaches to make such RNAs
available for functional analysis. Although it is beyond the scope
of this article to review all the technical developments of the past
30 years, key steps in cDNA library preparation are addressed to
highlight general principles of cDNA cloning and to give an
overview on the current status of cDNA cloning and future
directions.
I. Design primers to probe the cDNA library
1. Your first task is to design the primers that you will use to
probe the cDNA library. The DNA sequence of the
primers must reflect the amino acid sequence of the
protein that you are interested in.
2. To enter the primer sequence, click on the arrow on the
plexiglass shield in front of the oligonucleotide rack. On
the menu that appears, select New oligonucleotide
sequence. Alternatively, you can choose one of the test
sequences.
3. In the dialog box, use the four yellow keys to enter the
nucleotides for your primer in the 5 to 3 direction. For
degenerate primers, use / to separate nuclotides at the
same position. Your primer should be 20 bases long.
4. Click DONE when the primer is entered. Primers are at a
concentration of 0.5 milligram/millilitre. The sequence of
the primer that you designed will be automatically
entered into your notebook.
5. If you have made a mistake, dispose of the primer tube
by dragging it to the trash can.

II. Set up the labelling reaction

MATERIALS AND METHODS

Experiment 01 Date: July 27 2015 1 of 3

 BIO198L Gene Biotechnology Laboratory
1st Quarter SY 2015-2016
1. To attach a radioactive label to the primer use the pipettor
to add 20 microliters of gamma 32P-ATP to the tube that
contains your primer.
2. Use the pipettor to add 7.5 microliters of 10x
(concentrated tenfold) kinase buffer. Buffers are used at
1X concentration.
3. To select the kinase, click on the arrow on the enzyme
cooler. On the enzyme selection menu that appears,
select T4 polynucleotide kinase.
4. Use the pipettor to add 5 microliters of kinase to the
primer tube.
III. Incubate the labelling reaction
1. Drag the primer tube to the heat block. Turn on the heat
block. Set the temperature for 37 degrees C.
2. Set the time of incubation for 45 minutes by clicking on
the primer.
3. When the reaction is complete, drag the tube to the
Plexiglass radioactive tube container. This will shield you
from radioactivity.
IV. Select cDNA libraries
1. Press NEXT to move to the next screen. You will find 4
circular cDNAlibrary filters.
2. You can select two different libraries to screen with your
probe. To select cDNA library, click on the arrow between
the filters.
3. On the selection menu choose the cDNA library that you
wish to have on the two filters on the left. Choose the
library made from a tissue that is likely to contain the
gene that you are looking for.
4. Repeat this process to select a library for the two filters
on the right. The two filters on the left of the screen are
identical to each other, as are the ones on the right. They
are known as replicates.
V. Set up the prehybridization
1. To setup the prehybridization use the forceps to put each
of the filters into theroller bottle.
2. Use the glass pipette to transfer 10ml of the hybridization
solution from its flask to the roller bottle with the filters in
it.
3. To prehybridize the filter, cap and drag the roller bottle to
the hybridization oven.
4. Click on the buttons on the left side of the hybridization
oven to set the temperature on the hybridization oven.
Experiment 01 Date: July 27 2015
5. On the timer set the prehybridization. One hour is usually
sufficient.
6. When the prehybridization is complete, click on the
hybridization oven to have the roller bottle to return to the
bench.
VI. Add probe to the roller bottle
1. Use the pipettor to add 25 microliters of the radioactively
labelled probe to the roller bottle with the filters.
2. Drag the capped roller bottle into the hybridization oven.
3. Set the temperature on the hybridization oven.
4. On the timer set the time for hybridization. It must be at
least 4 hours.
5. When the hybridization is complete, click on the
hybridization oven door to bring the roller bottle back to
the bench.
VII. Wash the filters
1. To wash the filters, take off the cap, then drag the roller
bottle to the radioactive waste bottle and pour off the
hybridization solution.
2. Use the glass pipette to transfer 10ml from the beaker
with wash solution to the roller bottle.
3. Put on the cap and drag the roller bottle back to the
hybridization oven.
4. Set the temperature on the hybridization oven.
5. Set the temperature on the hybridization oven.
6. When the wash is complete, click on the hybridization
oven door to bring the roller bottle back to the bench.
VIII. Place the filters in the X-ray cassette
1. Click next to move to the next screen.
2. Take the cap off the roller bottle and use the forceps to
drag the filters one at a time, to the X-ray cassette.
3. Click the top of the X-ray cassette. After few moments,
you will see the filter exposing the X-ray film.
IX. Interpret the results
2 of 3
 BIO198L Gene Biotechnology Laboratory
1st Quarter SY 2015-2016

RESULTS & DISCUSSION

In the experiment, it is required to design an oligonucleotide primer

that corresponds to the amino acid sequence of a protein,
hybridize the primer to a cDNA library, and identify the hybridizing
clones among the background spots.

The first task is to design a primer. The 20-nucleotide primer used

in this experiment is: CCGTCTGGGCTTCTTGCATT for the amino
acid sequence PCGLLAF which is found in the protein sequence
of p53 protein. The primer was taken from the protein sequence
with low degeneracy.

After designing, the primer was labelled with the enzyme kinase
and gamma 32P-ATP. It is required for detecting successful binding
of the probe to its complementary cDNA.

Next, is the selection of two cDNA library filters. The liver and
spleen was selected as the library since p53 protein is found at
low levels in almost all cells and p53 cDNA can be found in a cDNA
library made from just about any tissue. To be added, the designed
primer was taken from the protein sequence of p53 protein. The Figure 1. Photographs of hybridized cDNA filters.
filters have replicates for us to know when the probe has really Left: Spleen, Right: Liver
bound to the gene we are looking for.

Then, hybridization was performed with the radioactively labelled CONCLUSION

probe and the cDNA library filters. This is done by adding
hybridization solution to the filters and incubating them in the
hybridization oven before adding the radioactively labelled probe.
The filters was then washed with wash solution.
Finally, the filters was placed in the X-ray cassette to visualize the
spots in which the probe hybridizes. As can be seen in the Figure
1, there are spots that line up in the cDNA libraries. The probe
used is complementary to p53 and there are positive clones both
in the spleen and liver cDNA library. This indicates that p53 RNA
is found in the spleen and liver.
In this experiment, we are able to design an oligonucleotide primer
that corresponds to the amino acid sequence of a protein,
hybridize the primer to a cDNA library, and identify the hybridizing
clones among the background spots.
REFERENCES
cDNA Synthesis System, Invitrogen life technologies, Ltd
H. Okayama, P. Berg High-efficiency cloning of full-length
cDNA Mol. Cell. Biol., 2 (1982), pp. 161170

Experiment 01 Date: July 27 2015 3 of 3