SBI4U Molecular Biology Review

DNA
1. Explain the function of histones and nucleosomes. What problem do
they help solve? What problem do they create?
2. Explain the function of both centromeres and telomeres.
3. Chromosomes can only be seen during Cellular replication. Explain.
4. What is meant by DNA being anti-parallel.
5. What is meant by the coding strand and complementary strand? How
does an RNA transcript relate to these terms?

DNA Replication
1. Explain how the lagging and leading strand DNA synthesis is different.
Why is this the case?
2. What is the function of topisomerase, DNA helicase, primase, DNA ligase,
DNA pol I, and DNA pol III?

Transcription
1. What is the difference between a promoter and an enhancer?
2. What does TFIID stand for? What is its role in transcription?
3. HIV uses an enzyme called reverse transcriptase turn its genome into
dsDNA to integrate into the host chromosomes. What type of genome
does HIV have?
4. How must the RNA transcript be modified before it can be translated?

Translation
1. What are the major steps in translation? Describe each in detail.

General
1. Gene expression is highly regulated. Provide four control points in this
process.

Answer the following questions using the sequence below.

2. Using the codon table provided, list the peptide sequence that could be
produced from this DNA sequence.
3. How would a deletion of the bold G affect this peptide? How would you
describe this mutation?
4. What would be the effect of mutating the bold: T to an A?
C to a G?
Deletion of T?
5. How would you describe each mutation?

CCTTATAGCTCATAGCATGCCTTACACGGGGGTAATTACAGAC
CGAAGTTAGAGAGTG