Republic of the Philippines

Graduate School
Leyte Normal University
Tacloban City

Module 4: From Gene to Protein: Basic

Molecular Genetic Mechanisms
Key Terms: Central dogma, Genes, Genetic code, Transcription, Translation, Protein,
Initiation, Elongation, Termination, Amino acid, RNA Polymerase, Promoter, mRNA, tRNA,
mutation, Codon, Anticodon, Ribosomes, Promoters, mRNA splicing, intron, exon.

From: https://meme.com/labome/status/1106822101154050048

Voice-Over PowerPoint Presentation

The Central Dogma

Prokaryotic Transcription
Eukaryotic Transcription

Learning Outcomes:

1. Explain the “central dogma” of DNA-protein synthesis.

2. Describe the genetic code and how the nucleotide sequence prescribes the
amino acid and the protein sequence.
3. Describe and compare protein synthesis in prokaryotes and eukaryotes.
 4. List the different steps in prokaryotic and eukaryotic transcription.
5. Discuss the role of promoters in prokaryotic transcription.
6. Discuss the role of RNA polymerase in eukaryotic transcription.
7. Describe how and when transcription is terminated.
8. Know the general functions of the three major types of RNA (mRNA, rRNA,
tRNA).
9. Describe the DNA sequence motifs and proteins required to initiate
transcription.
10. Predict the RNA transcribed from a DNA sequence identified as either the
template strand or the coding strand.
11. Use the genetic code to predict the protein amino acid sequence translated
from an mRNA sequence.
12. Describe the process of and key components required for translation.
13. Predict the likely effects of mutations in DNA on protein amino acid sequence,
structure and function.
14. Describe the genetic code and how the nucleotide sequence prescribes the
amino acid and the protein sequence

Getting Started Activity!

Before starting your journey with this module, test yourself
first with your current knowledge about chromosomes,
mitosis and meiosis. Answer the following questions by
encircling the correct letter that corresponds to the option
that best answers the question.

1. Control of gene expression in eukaryotic cells occurs at which level(s)?

A. only the transcriptional level
B. epigenetic and transcriptional levels
C. epigenetic, transcriptional, and translational levels
D. epigenetic, transcriptional, post-transcriptional, translational, and post-
translational levels

2. The binding of ________ is required for transcription to start.

A. a protein C. RNA polymerase
B. DNA polymerase D. a transcription factor

3. What will result from the binding of a transcription factor to an enhancer

region?
A. decreased transcription of an adjacent gene
B. increased transcription of a distant gene
 C. alteration of the translation of an adjacent gene
D. initiation of the recruitment of RNA polymerase

4. Post-translational modifications of proteins can affect which of the following?

A. protein function C. chromatin modification
B. transcriptional regulation D. all of the above

5. Prokaryotic cells lack a nucleus. Therefore, the genes in prokaryotic cells are:
A. all expressed, all of the time
B. transcribed and translated almost simultaneously
C. transcriptionally controlled because translation begins before transcription
ends
D. b and c are both true

6. Post-translational control refers to:

A. regulation of gene expression after transcription
B. regulation of gene expression after translation
C. control of epigenetic activation
D. period between transcription and translation

7. How does the regulation of gene expression support continued evolution of

more complex organisms?
A. Cells can become specialized within a multicellular organism.
B. Organisms can conserve energy and resources.
C. Cells grow larger to accommodate protein production.
D. Both A and B.

8. Which of the following are involved in posttranscriptional control?

A. control of RNA splicing C. control of RNA stability
B. control of RNA shuttling D. all of the above

9. Binding of an RNA binding protein will ________ the stability of the RNA
molecule.
A. increase C. neither increase nor decrease
B. decrease D. either increase or decrease

10. Cancer causing genes are called ________.

A. transformation genes C. oncogenes
B. tumor suppressor genes D. mutated genes
Introduction

Regardless of what kind of organism, (bacteria, archaea, or eukaryotes), the

primary role of DNA is to store heritable information that encodes the instruction set
required for creating the organism in question. While we have gotten much better at
quickly reading the chemical composition like the sequence of nucleotides in a
genome and some of the chemical modifications that are made to it, we still don't
know how to reliably decode all of the information within and all of the mechanisms
by which it is read and ultimately expressed. Since the rediscovery of Mendel’s work in
1900, the definition of the gene has progressed from an abstract unit of heredity to a
tangible molecular entity capable of replication, expression, and mutation. Now, genes
are composed of DNA and are linearly arranged on chromosomes. Further, genes
specify the sequences of amino acids, which are the building blocks of proteins. In
return, proteins are responsible for orchestrating nearly every function of the cell.
Together, genes and the proteins they encode are absolutely essential to life.

There are, however, some core principles and mechanisms associated with the
reading and expression of the genetic code whose basic steps are understood and that
need to be part of the conceptual toolkit for all biologists. Two of these processes are
transcription and translation, which are the coping of parts of the genetic code written
in DNA into molecules of the related polymer RNA and the reading and encoding of
the RNA code into proteins, respectively. The basic flow of genetic information in
biological systems is often depicted in a scheme known as "the central dogma". This
states that information encoded in DNA flows into RNA via transcription and ultimately
to proteins via translation. Processes like reverse transcription (the creation of DNA
from and RNA template) and replication also represent mechanisms for propagating
information in different forms. This scheme, however, doesn't say anything per se
about how information is encoded or about the mechanisms by which regulatory
signals move between the various layers of molecule types depicted in the model.
Therefore, while the central dogma is a nearly required part of the lexicon of any
biologist, perhaps left over from old tradition, students should also be aware that
mechanisms of information flow are more complex as we'll learn about some as we
go, and that "the central dogma" only represents some core pathways.
 I. The Central Dogma: DNA Encodes RNA;
RNA Encodes Protein

As our understanding of biological molecules increased in the 20th century,

researchers discovered that all living organisms share a genetic code. In 1956, Francis
Crick proposed that DNA is an informational storage molecule capable of replicating
itself. Thus, he proposed that the information that was transmitted had to be “read” by
a manufacturing body within the cell which puts amino acids together in a specific
sequence ultimately synthesizing a protein. This became known as the central dogma
of molecular biology. Genes generally are the information for making proteins. The
central dogma describes the flow of genetic information in cells from DNA to mRNA
to protein (Figure 1). It also states that genes specify the sequence of mRNAs, which
in turn specify the sequence of amino acids making up all proteins. With the help of
specific proteins and RNAs, the decoding of one molecule to another is made possible.
Because the information stored in DNA is so central to cellular function, it makes
intuitive sense that the cell would make mRNA copies of this information for protein
synthesis, while keeping the DNA itself intact and protected. The copying of DNA to
RNA is relatively straightforward, with one nucleotide being added to the mRNA strand
for every nucleotide read in the DNA strand. The translation to protein is a bit more
complex because three mRNA nucleotides correspond to one amino acid in the
polypeptide sequence. However, the translation to protein is still systematic and
collinear, such that nucleotides 1 to 3 correspond to amino acid 1, nucleotides 4 to 6
correspond to amino acid 2, and so on.

In the central dogma, DNA serves as a template for the direct synthesis of a
messenger RNA (mRNA) molecule, in a process known as transcription. Secondly,
mRNA is “read” at a ribosome by transfer RNAs (tRNAs), which work together to
assemble a specific chain of amino acids, which collectively assemble to generate a
protein, in a process known as translation. Proteins are the cell’s internal machinery.
Similar to parts of a car, each protein has a specific three-dimensional shape that
determines its function. Any change in the shape potentially changes the function of
the protein.

LINKS TO LEARNING:
View this link http://thebiologyprimer.com/the-central-
dogma-lecture-video for additional information about the
central dogma of biology.
 Figure 1. Gene expression: The flow of genetic information from DNA via RNA to protein. In transcription, the
enzyme RNA polymerase copies DNA to produce an RNA transcript. In translation, the cellular machinery uses
instructions in mRNA to synthesize a polypeptide, following the rules of the genetic code

II. The Genetic Code

A code is a system of symbols that equates information in one language with

information in another. In the Genetic Code, a triplet codon represents an amino acid.
The language of nucleic acids is written in four nucleotides— A, G, C, and T in the DNA
dialect; A, G, C, and U in the RNA dialect, while the language of proteins is written in
amino acids. To understand how the sequence of bases in DNA or RNA encodes the
order of amino acids in a polypeptide chain, it is a must to know how many distinct
amino acids there are. Watson and Crick produced the now accepted list of the 20
amino acids that are genetically encoded by DNA or RNA sequence. They created the
list by analyzing the amino-acid sequence of a variety of naturally occurring
polypeptides. The protein sequences consist of 20 commonly occurring amino acids;
therefore, it can be said that the protein alphabet consists of 20 “letters” (Figure 2).
Different amino acids have different chemistries (such as acidic versus basic, or polar
and nonpolar) and different structural constraints. Variation in amino acid sequence is
responsible for the enormous variation in protein structure and function.

Figure 2. Structures of the 20 amino acids found in proteins are shown. Each amino acid is
composed of an amino group, a carboxyl group, and a side chain (blue). The side chain may be nonpolar,
polar, or charged, as well as large or small. It is the variety of amino acid side chains that gives rise to
the incredible variation of protein structure and function.
 The four nucleotides encode 20 amino acids through specific groupings of A,
G, C, and T or A, G, C, and U. Each codon, designated by the bases defining its three
nucleotides, specifies one amino acid. For example, GAA is a codon for glutamic acid
(Glu), and GUU is a codon for valine (Val). Because the code comes into play only
during the translation part of gene expression, that is, during the decoding of
messenger RNA to polypeptide, geneticists usually present the code in the RNA dialect
of A, G, C, and U, as depicted in Fig.3. When speaking of genes, they can substitute T
for U to show the same code in the DNA dialect. Each amino acid is defined by a three-
nucleotide sequence called the triplet codon. Given the different numbers of “letters”
in the mRNA and protein “alphabets,” scientists theorized that single amino acids must
be represented by combinations of nucleotides. Nucleotide doublets would not be
sufficient to specify every amino acid because there are only 16 possible two
nucleotide combinations (42).
In contrast, there are 64 possible nucleotide triplets (43), which is far more than
the number of amino acids. Scientists theorized that amino acids were encoded by
nucleotide triplets and that the genetic code was “degenerate.” In other words, a given
amino acid could be encoded by more than one nucleotide triplet. This was later
confirmed experimentally by Francis Crick and Sydney Brenner who used the chemical
mutagen proflavin to insert one, two, or three nucleotides into the gene of a virus.
When one or two nucleotides were inserted, the normal proteins were not produced.
When three nucleotides were inserted, the protein was synthesized and functional. This
demonstrated that the amino acids must be specified by groups of three nucleotides.
These nucleotide triplets are called codons. The insertion of one or two nucleotides
completely changed the triplet reading frame, thereby altering the message for every
subsequent amino acid. Though insertion of three nucleotides caused an extra amino
acid to be inserted during translation, the integrity of the rest of the protein was
maintained.
Further, in codons that instruct the addition of a specific amino acid to a
polypeptide chain, three of the 64 codons terminate protein synthesis and release the
polypeptide from the translation machinery. These triplets are called nonsense
codons, or stop codons. Another codon, AUG, performs a special function, specifying
the amino acid methionine, it also serves as the start codon to initiate translation. The
reading frame for translation is set by the AUG start codon near the 5' end of the
mRNA. Following the start codon, the mRNA is read in groups of three until a stop
codon is encountered.
Figure 3. The genetic code: 61 codons represent the 20 amino acids, while 3 codons signify stop. To
read the code, find the first letter in the left column, the second letter along the top, and the third letter
in the right column; this reading corresponds to the 5′-to-3′ direction along the mRNA.

The arrangement of the coding table reveals the structure of the code. There
are sixteen "blocks" of codons, each specified by the first and second nucleotides of
the codons within the block, e.g., the "AC*" block that corresponds to the amino acid
threonine (Thr). Some blocks are divided into a pyrimidine half, in which the codon
ends with U or C, and a purine half, in which the codon ends with A or G. Some amino
acids get a whole block of four codons, like alanine (Ala), threonine (Thr) and proline
(Pro). Some get the pyrimidine half of their block, like histidine (His) and asparagine
(Asn). Others get the purine half of their block, like glutamate (Glu) and lysine (Lys).
Note that some amino acids get a block and a half-block for a total of six codons.
The specification of a single amino acid by multiple similar codons is called
"degeneracy." Degeneracy is believed to be a cellular mechanism to reduce the
negative impact of random mutations. Codons that specify the same amino acid
typically only differ by one nucleotide. Moreover, amino acids with chemically similar
side chains are encoded by similar codons. For example, aspartate (Asp) and
glutamate (Glu), which occupy the GA* block, are both negatively charged. This
nuance of the genetic code ensures that a single-nucleotide substitution mutation
might specify the same amino acid but have no effect or specify a similar amino acid,
preventing the protein from being rendered completely nonfunctional.
 The genetic code is nearly universal. With a few minor exceptions, virtually all
species use the same genetic code for protein synthesis. Conservation of codons
means that a purified mRNA encoding the globin protein in horses could be
transferred to a tulip cell, and the tulip would synthesize horse globin. Having only one
genetic code is powerful evidence that all of life on Earth shares a common origin,
especially considering that there are about 1084 possible combinations of 20 amino
acids and 64 triplet codons.

A scientist sequencing mRNA identifies the

following strand:
CUAUGUGUCGUAACAGCCGAUGACCCG

What is the sequence of the amino acid chain

this mRNA makes when it is translated?

LINKS TO LEARNING: Transcribe a gene and translate

it to protein using complementary pairing and the
genetic code at this site
http://openstax.org/l/create_protein .

A. Four general themes for gene expression

(i) Pairing of complementary bases is the key to the transfer of
information from DNA to RNA and from RNA to protein
(ii) Polarities of DNA, RNA, and polypeptides help guide the
mechanisms of gene expression
(iii) Gene expression requires input of energy and participation of
specific proteins and macromolecular assemblies
(iv) Mutations that change genetic information or obstruct the flow of
its expression can have dramatic effects on phenotype

B. The Genetic Code: A Summary

The following list summarizes the code’s main features:

(i) The code consists of triplet codons, each of which specifies an amino acid.
As written in Fig. 8.3 on p. 240, the code shows the 5′-to-3′ sequence of
 the three nucleotides in each mRNA codon; that is, the first nucleotide
depicted is at the 5′ end of the codon.
(ii) The codons are nonoverlapping. In the mRNA sequence 5′ GAAGUUGAA
3′, for example, the first three nucleotides (GAA) form one codon;
nucleotides 4 through 6 (GUU) form the second; and nucleotides 7 through
9 (GAA), the third. Each nucleotide is part of only one codon.
(iii) The code includes three stop, or nonsense, codons: UAA, UAG, and UGA.
These codons do not encode an amino acid and thus terminate translation.
(iv) The code is degenerate, which means that in many cases more than one
codon specifies the same amino acid. Despite its “degeneracy,” the code is
unambiguous, because each codon specifies only one amino acid.
(v) In reading the transcript of a gene, the cellular machinery scans a single
strand of mRNA from a fixed starting point that establishes a reading
frame. As we see later, the nucleotide triplet AUG, which specifies the
amino acid methionine, serves in certain contexts as the initiation codon,
marking the precise spot in the nucleotide sequence of an mRNA where
the code for a particular polypeptide begins.
(vi) Moving from the 5′ to the 3′ end of an mRNA, each successive codon is
sequentially interpreted into an amino acid, starting at the N terminus and
moving toward the C terminus of the resulting polypeptide.
(vii) Mutations may modify the message encoded in a sequence of
nucleotides in three ways. Frameshift mutations are nucleotide insertions
or deletions that alter the genetic instructions for polypeptide construction
by changing the reading frame. Missense mutations change a codon for
one amino acid to a codon for a different amino acid. Nonsense mutations
change a codon for an amino acid to a stop codon.

C. Using Genetics to Verify the Genetic Code

The experiments that cracked the genetic code by assigning
codons to amino acids were all in vitro studies using cell-free extracts and
synthetic mRNAs. A logical question thus arose: Do living cells construct
polypeptides according to the same rules?
(i) The study of Yanofsky, was used to verify the code. He found two
trp auxotrophic mutations in the E. coli tryptophan synthetase gene
that produced two different amino acids (arginine, or Arg, and
glutamic acid, or Glu) at the same position—amino acid 211—in
the polypeptide chain (Fig. 4a). According to the code, both of
these mutations could have resulted from single-base changes in
the GGA codon that normally inserts glycine (Gly) at position 211.
(ii) Yanofsky obtained better evidence yet that cells use the genetic
code in vivo by analyzing proflavin-induced frameshift mutations of
the tryptophan synthetase gene (Fig. 4b). He first treated
populations of E. coli with proflavin to produce trp mutants.
Subsequent treatment of these mutants with more proflavin
generated some trp+ revertants among the progeny. The most
likely explanation for the revertants was that their tryptophan
synthetase gene carried both a single-base-pair deletion and a
single-base-pair insertion (+,- ).
(iii) Yanofsky’s results helped confirm not only amino-acid codon
assignments but other parameters of the code as well. His
interpretations make sense only if codons do not overlap and are
read from a fixed starting point with no pauses or commas
separating the adjacent triplets.

b
Figure 4a and b. (a) Altered amino acids in trp– mutations and trp+ revertants; (b) Amino acid
alterations that accompany intragenic suppression. Experimental verification of the genetic code. (a)
Single-base substitutions can explain the amino-acid substitutions of trp mutations and trp+ revertants.
(b) The genetic code predicts the amino-acid alterations (yellow) that would arise from single-base-pair
deletions and suppressing insertions.

III. Prokaryotic Transcription

The prokaryotes, represented Bacteria and Archaea, are mostly single-celled
organisms that lack membrane bound nuclei and other organelles. A bacterial
chromosome is a closed circle that, unlike eukaryotic chromosomes, is not organized
around histone proteins. The central region of the cell in which prokaryotic DNA
resides is called the nucleoid region. In addition, prokaryotes often have abundant
plasmids, which are shorter, circular DNA molecules that may only contain one or a
few genes. These plasmids can be transferred independently from the bacterial
chromosome during cell division and often carry traits such as those involved with
antibiotic resistance.
Transcription in prokaryotes (and in eukaryotes) requires the DNA double
helix to partially unwind in the region of mRNA synthesis. The region of unwinding is
called a transcription bubble. Transcription always proceeds from the same DNA
strand for each gene, which is called the template strand. The mRNA product is
complementary to the template strand and is almost identical to the other DNA strand,
called the non-template strand, or the coding strand. The only nucleotide difference is
that in mRNA, all of the T nucleotides are replaced with U nucleotides (Figure 5). In an
RNA double helix, A can bind U via two hydrogen bonds, just as in A–T pairing in a
DNA double helix.

Figure 5. Messenger RNA is a copy of protein-coding information in the coding strand of DNA, with
the substitution of U in the RNA for T in the coding sequence. However, new RNA nucleotides base pair
with the nucleotides of the template strand. RNA is synthesized in its 5'-3' direction, using the enzyme
RNA polymerase. As the template is read, the DNA unwinds ahead of the polymerase and then rewinds
behind it

The nucleotide pair in the DNA double helix that corresponds to the site from
which the first 5' mRNA nucleotide is transcribed is called the +1 site, or the initiation
site. Nucleotides preceding the initiation site are denoted with a “-” and are designated
upstream nucleotides. Conversely, nucleotides following the initiation site are
denoted with “+” numbering and are called downstream nucleotides.

Steps in Prokaryotic Transcription

(i) The Initiation of Transcription. RNA polymerase binds to double-stranded DNA

at the beginning of the gene to be copied. RNA polymerase recognizes and binds to
promoters, specialized DNA sequences near the beginning of a gene where
transcription will start. Although the promoters of different genes vary substantially in
size and sequence, all promoters contain two characteristic short sequences of 6–10
nucleotide pairs that help bind RNA polymerase. These short sequences are nearly
identical in different promoters. In bacteria, the complete RNA polymerase (the
holoenzyme) consists of a core enzyme, plus a α subunit involved only in initiation. The
α subunit reduces RNA polymerase’s general affinity for DNA but simultaneously
increases RNA polymerase’s affinity for the promoter. As a result, the RNA polymerase
holoenzyme can hone in on a promoter and bind tightly to it, forming a so-called
closed promoter complex.

Prokaryotic Promoters

A promoter is a DNA sequence onto which the transcription machinery,

including RNA polymerase, binds and initiates transcription. In most cases,
promoters exist upstream of the genes they regulate. The specific sequence of
a promoter is very important because it determines whether the corresponding
gene is transcribed all the time, some of the time, or infrequently. Although
 promoters vary among prokaryotic genomes, a few elements are evolutionarily
conserved in many species. At the -10 and -35 regions upstream of the initiation
site, there are two promoter consensus sequences, or regions that are similar
across all promoters and across various bacterial species (Fig.6). The -10
sequence, called the -10 region, has the consensus sequence TATAAT. The -35
sequence has the consensus sequence TTGACA. These consensus sequences
are recognized and bound by σ. Once this interaction is made, the subunits of
the core enzyme bind to the site. The A–T-rich -10 region facilitates unwinding
of the DNA template, and several phosphodiester bonds are made. The
transcription initiation phase ends with the production of abortive transcripts,
which are polymers of approximately 10 nucleotides that are made and
released.

Figure 6. The σ subunit of prokaryotic RNA polymerase recognizes consensus

sequences found in the promoter region upstream of the transcription start site. The σ subunit
dissociates from the polymerase after transcription has been initiated.

(ii) Elongation: Constructing an RNA copy of the gene. When the α subunit
separates from the RNA polymerase, the enzyme loses its enhanced affinity for the
promoter sequence and regains its strong generalized affinity for any DNA. These
changes enable the core enzyme to leave the promoter yet remain bound to the gene.
The region of DNA unwound by RNA polymerase is called the transcription bubble.
Within the bubble, the nascent RNA chain remains base paired with the DNA template,
forming a DNA-RNA hybrid. Once an RNA polymerase has moved off the promoter,
other RNA polymerase molecules can move in to initiate transcription. If the promoter
is very strong, that is, if it can rapidly attract RNA polymerase, the gene can undergo
transcription by many RNA polymerases simultaneously. (See figure below)
(iii) Termination: The End of Transcription. As shown in the illustration below, RNA
sequences that signal the end of transcription are known as terminators. There are
two types of terminators: intrinsic terminators, which cause the RNA polymerase core
enzyme to terminate transcription on its own, and extrinsic terminators, which require
proteins other than RNA polymerase—particularly a polypeptide known as rho
protein—to bring about termination. All terminators, whether intrinsic or extrinsic, are
specific sequences in the mRNA; they are transcribed from specific DNA regions and
they signal the termination of transcription. Terminators often form hairpin loops in
which nucleotides within the mRNA pair with nearby complementary nucleotides.
Upon termination, RNA polymerase and a completed RNA chain are both released
from the DNA.

By the time termination occurs, the prokaryotic transcript would already have
been used to begin synthesis of numerous copies of the encoded protein because
these processes can occur concurrently. The unification of transcription, translation,
and even mRNA degradation is possible because all of these processes occur in the
same 5' to 3' direction, and because there is no membranous compartmentalization in
the prokaryotic cell. In contrast, the presence of a nucleus in eukaryotic cells precludes
simultaneous transcription and translation.

Figure 7. Multiple polymerases can transcribe a single bacterial gene while numerous ribosomes
concurrently translate the mRNA transcripts into polypeptides. In this way, a specific protein can rapidly
reach a high concentration in the bacterial cell.

A fragment of bacterial DNA reads:

3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

Assuming that this fragment is the template strand,

what is the sequence of mRNA that would be
transcribed? (Hint: Be sure to identify the initiation
site).

The product of transcription is a single-stranded primary transcript. The RNA

produced by the action of RNA polymerase on a gene is a single strand of nucleotides
known as a primary transcript. The bases in the primary transcript are complementary
to the bases between the initiation and termination sites in the template strand of the
gene. The nucleotides carrying these bases include groupings for a start codon, codons
specifying all the amino acids in the polypeptide to be built, and a stop codon. (Fig. 8).

Figure. 8. The Product of Transcription Is a Single-Stranded Primary Transcript

 LINKS TO LEARNING: Visit this BioStudio animation
(http://openstax.org/l/transcription2 ) to see the process of
prokaryotic transcription.
View this Molecular Movies animation
(http://openstax.org/l/transcription ) to see the first part of
transcription and the base sequence repetition of the TATA
box.

IV. Eukaryotic Transcription

Prokaryotes and eukaryotes perform fundamentally the same process of
transcription, with some key differences. The most important difference between
prokaryote and eukaryote transcription is due to the presence of membrane-bound
nucleus and organelles in eukaryotes. With the genes bound in a nucleus, the
eukaryotic cell must be able to transport its mRNA to the cytoplasm and must protect
its mRNA from degrading before it is translated. Eukaryotes also employ three different
polymerases that each transcribe a different subset of genes. Eukaryotic mRNAs are
usually monogenic, which means that they specify a single protein.

(i) Initiation of Transcription in Eukaryotes. Unlike the prokaryotic

polymerase that can bind to a DNA template on its own, eukaryotes
require several other proteins, called transcription factors, to first bind
to the promoter region and then to help recruit the appropriate
polymerase.
(ii) The Three Eukaryotic RNA Polymerases. The features of eukaryotic
mRNA synthesis are markedly more complex than those of prokaryotes.
Instead of a single polymerase comprising five subunits, the eukaryotes
have three polymerases that are each made up of 10 subunits or more.
Each eukaryotic polymerase also requires a distinct set of transcription
factors to bring it to the DNA template.
a) RNA polymerase I is located in the nucleolus, and a specialized
nuclear substructure in which ribosomal RNA (rRNA) is transcribed,
processed, and assembled into ribosomes. RNA polymerase I
synthesizes all of the rRNAs from the tandemly duplicated set of 18S,
5.8S, and 28S ribosomal genes.
b) RNA polymerase II is located in the nucleus and synthesizes all
protein-coding nuclear pre-mRNAs. Eukaryotic pre-mRNAs undergo
extensive processing after transcription but before translation. RNA
 polymerase II is responsible for transcribing the overwhelming
majority of eukaryotic genes.
c) RNA polymerase III is also located in the nucleus. This polymerase
transcribes a variety of structural RNAs that includes the 5S pre-rRNA,
transfer pre-RNAs (pre-tRNAs), and small nuclear pre-RNAs.

(iii) RNA Polymerase II Promoters and Transcription Factors. Eukaryotic

promoters are much larger and more intricate than prokaryotic
promoters. However, both have a sequence similar to the -10 sequence
of prokaryotes. But in eukaryotes, this sequence is called the TATA
box, and has the consensus sequence TATAAA on the coding strand. It
is located at -25 to -35 bases relative to the initiation (+1) site.
This sequence is not identical to the E. coli -10 box, but it conserves the
A–T rich element.

(iv) Eukaryotic Elongation and Termination. Following the formation of the

preinitiation complex, the polymerase is released from the other
transcription factors, and elongation is allowed to proceed as it does in
prokaryotes with the polymerase synthesizing pre-mRNA in the 5' to 3'
direction. Although the enzymatic process of elongation is essentially
the same in eukaryotes and prokaryotes, the DNA template is
considerably more complex. When eukaryotic cells are not dividing,
their genes exist as a diffuse mass of DNA and proteins called
chromatin. The DNA is tightly packaged around charged histone
proteins at repeated intervals. These DNA–histone complexes,
collectively called nucleosomes, are regularly spaced and include 146
nucleotides of DNA wound around eight histones like thread around a
spool.

For polynucleotide synthesis to occur, the transcription

machinery needs to move histones out of the way every time it
encounters a nucleosome. This is accomplished by a special protein
complex called FACT, which stands for “facilitates chromatin
transcription.” This complex pulls histones away from the DNA
template as the polymerase moves along it. Once the pre-mRNA is
synthesized, the FACT complex replaces the histones to recreate the
nucleosomes.

The termination of transcription is different for the different

polymerases. Unlike in prokaryotes, elongation by RNA polymerase II in
eukaryotes takes place 1,000 to 2,000 nucleotides beyond the end of
the gene being transcribed. This pre-mRNA tail is subsequently
 removed by cleavage during mRNA processing. Further, RNA
polymerases I and III require termination signals. Genes
transcribed by RNA polymerase I contain a specific 18-nucleotide
sequence that is recognized by a termination protein. The process of
termination in RNA polymerase III involves an mRNA hairpin similar to
rho-independent termination of transcription in prokaryotes.

(v) In Eukaryotes, RNA processing after transcription produces a mature

mRNA. Some RNA processing in eukaryotes modifies only the 5′ or 3′
ends of the primary transcript, leaving untouched the information
content of the rest of the mRNA. Other processing deletes blocks of
information from the middle of the primary transcript so that the
content of the mature mRNA is related, but not identical, to the
complete set of DNA nucleotide pairs in the original gene.

Adding a Methylated Cap at the 5′ End and a Poly-A Tail at the 3′

End

The nucleotide at the 5′ end of a eukaryotic mRNA is a G in

reverse orientation from the rest of the molecule; it is connected
through a triphosphate linkage to the first nucleotide in the primary
transcript. This backward G is not transcribed from the DNA. Instead, a
special capping enzyme adds it to the primary transcript after
polymerization of the transcript’s first few nucleotides. Enzymes called
methyl transferases adds methyl (–CH3) groups to the backward G
and to one or more of the succeeding nucleotides in the RNA, forming
a so-called methylated cap (Fig. 9). The methylated cap is critical for
efficient translation of the mRNA into protein, even though it does not
help specify an amino acid.

Figure 9. How RNA processing

adds a tail to the 3′ end of
eukaryotic mRNAs. A ribonuclease
recognizes AAUAAA in a particular
context of the primary transcript and
cleaves the transcript 11–30
nucleotides downstream to create a
new 3′ end. The enzyme poly-A
polymerase then adds 100–200 As onto
this new 3′ end
 The eukaryotic pre-mRNA undergoes extensive processing before
it is ready to be translated. Eukaryotic protein-coding sequences are not
continuous, as they are in prokaryotes. The coding sequences called
exons are interrupted by noncoding introns, which must be removed to
make a translatable mRNA. The additional steps involved in eukaryotic
mRNA maturation also create a molecule with a much longer half-life
than a prokaryotic mRNA. Eukaryotic mRNAs last for several hours,
whereas the typical E. coli mRNA lasts no more than five seconds (Fig.
10).

Pre-mRNAs are first coated in RNA-stabilizing proteins; these

protect the pre-mRNA from degradation while it is processed and
exported out of the nucleus. The three most important steps of pre-
mRNA processing are the addition of stabilizing and signaling factors at
the 5' and 3' ends of the molecule, and the removal of the introns. In rare
cases, the mRNA transcript can be “edited” after it is transcribed.

Figure 10. Eukaryotic mRNA contains introns that must be spliced out. A 5' cap and
3' poly-A tail is also added.

Pre-mRNA Splicing

Eukaryotic genes are composed of exons, which correspond to

protein-coding sequences (ex-on signifies that they are expressed), and
intervening sequences called introns (intron denotes their intervening
role), which may be involved in gene regulation but are removed from
the pre-mRNA during processing. Intron sequences in mRNA do not
encode functional proteins. The discovery of introns came as a surprise
to researchers in the 1970s who expected that pre-mRNAs would specify
protein sequences without further processing, as they had observed in
prokaryotes. The genes of higher eukaryotes very often contain one or
more introns. These regions may correspond to regulatory sequences;
however, the biological significance of having many introns or having
very long introns in a gene is unclear.

All of a pre-mRNA’s introns must be completely and precisely

removed before the translation of protein synthesis. If the process errs
by even a single nucleotide, the reading frame of the rejoined exons
would shift, and the resulting protein would be dysfunctional. The
process of removing introns and reconnecting exons is called splicing
(Figure 11). Introns are removed and degraded while the pre-mRNA is
still in the nucleus. Splicing occurs by a sequence-specific mechanism
that ensures introns will be removed and exons rejoined with the
accuracy and precision of a single nucleotide. The splicing of pre-mRNAs
is conducted by complex proteins and RNA molecules called
spliceosomes.

Figure 11. Pre-mRNA

splicing involves the
precise removal of
introns from the
primary RNA transcript.
The splicing process is
catalyzed by protein
complexes called
spliceosomes that are
composed of proteins and
RNA molecules called small
nuclear RNAs (snRNAs).
Spliceosomes recognize
sequences at the 5' and 3'
end of the intron
 Using the figure above, errors in splicing are
implicated in cancers and other human diseases. What
kinds of mutations might lead to splicing errors? Think
of different possible outcomes if splicing errors occur.

How do cells make a mature mRNA from a gene whose coding sequences are
interrupted by introns? Figure 12 illustrates a more detailed process of RNA splicing.
Three types of short sequences within the primary transcript—splice donors, splice
acceptors, and branch sites—help ensure the specificity of splicing. These sites make
it possible to sever the connections between an intron and the exons that precede and
follow it, and then to join the formerly separated exons. The mechanism of splicing
involves two sequential cuts in the primary transcript. The first cut is at the splice-donor
site, at the 5′ end of the intron. The second cut is at the splice-acceptor site, at the 3′
end of the intron; this cut removes the intron. The discarded intron is degraded, and
the precise splicing of adjacent exons completes the process of intron removal.

Figure 12. How RNA processing splices out introns and joins adjacent exons. (a) Three short sequences within the primary
transcript determine the specificity of splicing. (1) The splice-donor site occurs where the 3′ end of an exon abuts the 5′ end of an
intron. In most splice-donor sites, a GU dinucleotide (arrows) that begins the intron is flanked on either side by a few purines (Pu;
that is, A or G). (2) The splice-acceptor site is at the 3’ end of the intron where it joins with the next exon. The final nucleotides of
the intron are always AG (arrows) preceded by 12–14 pyrimidines (Py; that is, C or U). (3) The branch site, which is located within
the intron about 30 nucleotides upstream of the splice acceptor, must include an A (arrow) and is usually rich in pyrimidines. (b)
Two sequential cuts, the first at the splice-donor site and the second at the splice-acceptor site, remove the intron (which is
subsequently degraded), allowing precise splicing of adjacent exons.
 LINKS TO LEARNING:
See how introns are removed during RNA splicing at this
website (http://openstax.org/l/RNA_splicing ) .

V. (Proteinsynthesis)Translation: Base Pairing Between mRNA and

tRNAs Directs Assembly of a Polypeptide on the Ribosome
Virtually all cells—both prokaryotic and eukaryotic—use the same basic
genetic code to translate the sequence of nucleotides in a messenger RNA to the
sequence of amino acids in the corresponding polypeptide. This process of translation
takes place on ribosomes that coordinate the movements of transfer RNAs carrying
specific amino acids with the genetic instructions of an mRNA. tRNA, ribosomes and
aminoacyl tRNA synthetases are the machineries of proteinsynthesis.

(i) Transfer RNAs Mediate the Translation of mRNA Codons to

Amino Acids. There is no obvious chemical similarity or affinity
between the nucleotide triplets of mRNA codons and the amino
acids they specify. Rather, transfer RNAs (tRNAs) serve as adaptor
molecules that mediate the transfer of information from nucleic
acid to protein.
tRNAs Carry an Anticodon at One End and an Amino
Acid at the Other tRNAs are short, single-stranded RNA molecules
74–95 nucleotides in length. Several of the nucleotides in tRNAs
contain modified bases produced by chemical alterations of the
principal A, G, C, and U nucleotides (Fig. 13 ). Each tRNA carries one
particular amino acid, and cells must have at least one tRNA for
each of the 20 amino acids specified by the genetic code. The
name of a tRNA reflects the amino acid it carries.
Transfer RNAs serve as adaptor molecules. Each tRNA
carries a specific amino acid and recognizes one or more of the
mRNA codons that define the order of amino acids in a protein.
Aminoacyl-tRNAs bind to the ribosome and add the corresponding
amino acid to the polypeptide chain. Therefore, tRNAs are the
molecules that actually “translate” the language of RNA into the
language of proteins. As the adaptor molecules of translation, it is
surprising that tRNAs can fit so much specificity into such a small
 package. Consider that tRNAs need to interact with three factors: 1)
they must be recognized by the correct aminoacyl synthetase (see
below); 2) they must be recognized by ribosomes; and 3) they must
bind to the correct sequence in mRNA.

Figure 13. tRNAs mediate the transfer of information from nucleic acid to protein.
(a) Many tRNAs contain modified bases produced by chemical alterations of A, G,
C, and U. (b) The primary structures of tRNA molecules fold to form characteristic
secondary and tertiary structures. The anticodon and the amino-acid attachment
site are at opposite ends of the “L” formed by a tRNA.

(ii) Ribosomes Are the Sites of Polypeptide Synthesis. A ribosome is

a complex macromolecule composed of structural and catalytic
rRNAs, and many distinct polypeptides. In E. coli, ribosomes consist
of 3 different ribosomal RNAs (rRNAs) and 52 different ribosomal
proteins (Fig. 14). These components associate to form two different
ribosomal subunits called the 30S subunit and the 50S subunit (with
S designating a coefficient of sedimentation related to the size and
shape of the subunit; the 30S subunit is smaller than the 50S
subunit).
Ribosomes facilitate polypeptide synthesis in various ways.
First, they recognize mRNA features that signal the start of
translation. Second, they help ensure accurate interpretation of the
genetic code by stabilizing the interactions between tRNAs and
mRNAs; without a ribosome, codon-anticodon recognition,
mediated by only three base pairs (one of which may wobble), would
 be extremely weak. Third, they supply the enzymatic activity that
links the amino acids in a growing polypeptide chain. Fourth, by
moving 5′ to 3′ along an mRNA molecule, they expose the mRNA
codons in sequence, ensuring the linear addition of amino acids.
Finally, ribosomes help end polypeptide synthesis by dissociating
from both the mRNA directing polypeptide construction and the
polypeptide product itself.

Figure 14. The ribosome: Site of polypeptide synthesis. (a) A ribosome

has two subunits, each composed of rRNA and various proteins. (b) The small
subunit initially binds to mRNA. The large subunit contributes the enzyme peptidyl
transferase, which catalyzes the formation of peptide bonds in the growing
polypeptide chain. The two subunits together form the A and P tRNA binding sites

(iii) Aminoacyl tRNA Synthetases. The process of pre-tRNA synthesis

by RNA polymerase III only creates the RNA portion of the adaptor
molecule. It is the corresponding amino acid that must be added
later, once the tRNA is processed and exported to the cytoplasm.
Through the process of tRNA “charging,” each tRNA molecule is
 linked to its correct amino acid by one of a group of enzymes
called aminoacyl tRNA synthetases.

VI. The Mechanism of Translation (Proteinsynthesis)

Translation consists of an initiation phase that sets the stage for
polypeptide synthesis; elongation, during which amino acids are added to a growing
polypeptide; and a termination phase that brings polypeptide synthesis to a halt and
enables the ribosome to release a completed chain of amino acids.

The details of the three stages are illustrated and discussed below:

Initiation: Setting the stage for polypeptide synthesis. The first three nucleotides of
an mRNA do not serve as the first codon to be translated into an amino acid. Instead,
a special signal indicates where along the mRNA translation should begin. In
prokaryotes, this signal is called the ribosome binding site, and it has two important
elements. The first is a short sequence of six nucleotides—usually 5′ . . . AGGAGG . . .
3′—named the Shine-Dalgarno box after its discoverer. The second element in an
mRNA’s ribosome binding site is the triplet 5′ AUG 3′, which serves as the initiation
codon. A special initiator tRNA, whose 5′ CAU 3′ anticodon is complementary to AUG,
recognizes an AUG preceded by the Shine-Dalgarno box of a ribosome binding site.
The initiator tRNA carries N-formylmethionine (fMet), a modified methionine whose
amino end is blocked by a formyl group. The specialized fMet tRNA functions only at
an initiation site. During initiation, the 3′ end of the rRNA in the 30S ribosomal subunit
binds to the mRNA’s Shine-Dalgarno box, the fMet tRNA binds to the mRNA’s
initiation codon, and a large 50S ribosomal subunit associates with the small subunit
to round out the ribosome. At the end of initiation, the fMet tRNA sits in the P site of
the completed ribosome. Proteins known as initiation factors play a transient role in
the initiation process. In eukaryotes, the small ribosomal subunit binds first to the
methylated cap at the 5′ end of the mature mRNA. It then migrates to the initiation
site—usually the first AUG it encounters as it scans the mRNA in the 5′-to-3′ direction.
The initiator tRNA in eukaryotes carries unmodified methionine (Met) instead of fMet.

Elongation: The addition of amino acids to a growing polypeptide. With the mRNA
bound to the complete two subunit ribosome and with the initiating tRNA in the P site,
the elongation of the polypeptide begins. A group of proteins known as elongation
factors usher the appropriate tRNA into the A site of the ribosome. The anticodon of
this charged tRNA must recognize the next codon in the mRNA. The ribosome holds
the initiating tRNA at its P site and the second tRNA at its A site so that peptidyl
transferase can catalyze formation of a peptide bond between the amino acids carried
by the two tRNAs. Once formation of the first peptide bond causes the initiating tRNA
in the P site to release its amino acid, the ribosome moves, exposing the next mRNA
codon. Like the first steps of elongation, the ribosome’s movement requires the help
of elongation factors and an input of energy. As the ribosome moves, the initiating
tRNA in the P site, which no longer carries an amino acid, dissociates from the
ribosome, and the other tRNA carrying the dipeptide shifts from the A site to the P
site.
The movement of ribosomes along the mRNA has important implications. Once a
ribosome has moved far enough away from the mRNA’s ribosome binding site, that
site becomes accessible to other ribosomes. In fact, several ribosomes can work on the
same mRNA at one time. A complex of several ribosomes translating from the same
mRNA is called a polyribosome. This complex allows the simultaneous synthesis of
many copies of a polypeptide from a single mRNA.

Termination: The ribosome releases the completed polypeptide No normal tRNAs

carry anticodons complementary to the three nonsense (stop) codons UAG, UAA, and
UGA. Thus, when movement of the ribosome brings a nonsense codon into the
ribosome’s A site, no tRNAs can bind to that codon through complementary base
pairing. Instead, proteins called release factors recognize the termination codons and
bring polypeptide synthesis to a halt. During termination, three events must occur:
(a) the tRNA specifying the C-terminal amino acid releases the completed polypeptide,
(b) the same tRNA as well as the mRNA separate from the ribosome, and (c) the
ribosome dissociates into its large and small subunits.

Many antibiotics inhibit bacterial protein synthesis.

For example, tetracycline blocks the A site on the
bacterial ribosome, and chloramphenicol blocks
peptidyl transfer. What specific effect would you
expect each of these antibiotics to have on protein
synthesis?

A. Protein Folding, Modification, and Targeting. During and after translation,

individual amino acids may be chemically modified, signal sequences
appended, and the new protein “folded” into a distinct three-dimensional
structure as a result of intramolecular interactions. A signal sequence is a short
sequence at the amino end of a protein that directs it to a specific cellular
compartment. These sequences can be thought of as the protein’s “train ticket”
to its ultimate destination, and are recognized by signal-recognition proteins
that act as conductors. For instance, a specific signal sequence terminus will
direct a protein to the mitochondria or chloroplasts (in plants). Once the protein
reaches its cellular destination, the signal sequence is usually clipped off. Many
proteins fold spontaneously, but some proteins require helper molecules, called
chaperones, to prevent them from aggregating during the complicated process
of folding. Even if a protein is properly specified by its corresponding mRNA, it
could take on a completely dysfunctional shape if abnormal temperature or pH
conditions prevent it from folding correctly.

B. There Are Significant Differences in Gene Expression Between Prokaryotes

and Eukaryotes.

The table below summarizes the differences of gene expression between

prokaryotes and eukaryotes.
Table 1. Differences Between Prokaryotes and Eukaryotes in the Details of Gene
Expression

C. How Mutations Affect Gene Expression

As mentioned, the information in DNA is the starting point of
gene expression. The cell transcribes that information into mRNA and then
translates the mRNA information into protein. Mutations that alter the
nucleotide pairs of DNA may modify any of the steps or products of gene
expression
(i) Silent Mutations Do Not Alter the Amino Acid Specified. One
consequence of the code’s degeneracy is that some mutations,
known as silent mutations, direct the inclusion of the same amino
acid as the unmutated DNA and therefore have no effect on the
amino-acid composition of the encoded polypeptide or on
 phenotype. The majority of silent mutations change the third
nucleotide of a codon, the position at which most codons for the
same amino acid differ. For example, a change from GCA to GCC
in a codon would still yield alanine in the protein product.
(ii) Missense Mutations Replace One Amino Acid with Another.
Missense mutations that cause substitution in the polypeptide of
an amino acid with chemical properties similar to the one it
replaces may have little or no effect on protein function.
(iii) Nonsense Mutations Change an Amino-Acid-Specifying
Codon to a Stop Codon. Nonsense mutations result in the
production of proteins smaller than those encoded by wild-type
alleles of the same gene. The shorter, truncated proteins lack all
amino acids between the amino acid encoded by the mutant
codon and the C terminus of the normal polypeptide.
(iv) Frameshift Mutations Result from the Insertion or Deletion of
Nucleotides Within the Coding Sequence. This happens if the
number of extra or missing nucleotides is not divisible by 3, the
insertion or deletion will skew the reading frame downstream of
the mutation. As a result, frameshift mutations cause unrelated
amino acids to appear in place of amino acids critical to protein
function, destroying or diminishing polypeptide function.
(v) Mutations Altering Genes Encoding Proteins or RNAs
Involved in Gene Expression Are Usually Lethal. This occurs
because such mutations adversely affect the synthesis of all
proteins in a cell. In Drosophila, for example, null mutations in
many of the genes encoding the various ribosomal proteins are
lethal when homozygous. This same mutation in a heterozygote
causes a dominant Minute phenotype in which the slow growth
of cells delays the fly’s development.
(vi) Mutations in tRNA Genes Can Suppress Mutations in Protein-
Coding Genes. If more than one gene encoded a molecule with
the same role in gene expression, a mutation in one of these
genes would not be lethal and might even be useful.

VII Summary of Gene Expression

A. Gene expression is the process by which cells convert the DNA
sequence of a gene to the RNA sequence of a transcript, and then
decode the RNA sequence to the amino-acid sequence of a polypeptide.
B. The nearly universal genetic code consists of 64 codons, each one
composed of three nucleotides. Of these codons, 61 specify amino acids,
while 3—UAA, UAG, and UGA—are nonsense or stop codons that do not
specify an amino acid.
C. Gene expression based on the genetic code produces the collinearity of
a gene’s nucleotide sequence and a protein’s sequence of amino acids.
D. Transcription is the first stage of gene expression. During transcription,
RNA polymerase synthesizes a single-stranded primary transcript from a
DNA template. (i) RNA polymerase initiates transcription by binding to
the promoter sequence of the DNA and unwinding the double helix to
expose bases for pairing; (ii) RNA polymerase extends the RNA in the 5′-
to-3′ direction by catalyzing formation of phosphodiester bonds
between successively aligned nucleotides; and (iii) Terminator sequences
in the RNA cause RNA polymerase to dissociate from the DNA. d. In
prokaryotes, the primary transcript is the mRNA that guides polypeptide
synthesis.
E. In eukaryotes, RNA processing after transcription produces a mature
mRNA that travels from the nucleus to the cytoplasm to direct
polypeptide synthesis. (i) RNA processing adds a methylated cap to the
5′ end and a poly-A tail to the 3′ end of the eukaryotic mRNA; (ii) The
spliceosome removes introns from the primary transcript and precisely
splices together the remaining exons. Alternative splicing makes it
possible to produce different mRNAs from the same primary transcript.
F. Translation is the stage of gene expression when the cell synthesizes
protein according to instructions in the mRNA. (i) tRNAs carry amino
acids to the translation machinery. Aminoacyl-tRNA synthetases connect
amino acids to their corresponding tRNAs. Each tRNA molecule has an
anticodon complementary to the mRNA codon specifying the amino acid
it carries. Because of wobble, some tRNA anticodons recognize more
than one mRNA codon; (ii) Translation occurs on complex molecular
machines called ribosomes. Ribosomes have two binding sites for
tRNAs—P and A—and an enzyme known as peptidyl transferase that
catalyzes formation of a peptide bond between amino acids carried by
the tRNAs at these two sites; (iii) Initiation: To start translation, part of
the ribosome binds to a ribosome binding site on the mRNA, which
includes the AUG initiation codon. Special initiating tRNAs with codons
complementary to AUG carry the amino acid fMet in prokaryotes or Met
in eukaryotes to the ribosomal P site. This amino acid will become the N
terminus of the growing polypeptide; (iv) Elongation: When the carboxyl
group of the amino acid connected to a tRNA at the ribosome’s P site
 becomes attached through a peptide bond to the amino acid carried by
the tRNA at the A site, the ribosome travels three nucleotides toward the
3′ end of the mRNA, and (V) Termination: When the ribosome encounters
inframe nonsense (stop) codons, it ends translation by releasing the
mRNA and disconnecting the complete polypeptide from the tRNA.
G. Posttranslational processing may alter a polypeptide by adding or
removing chemical constituents to or from particular amino acids, or by
cleaving the polypeptide into smaller molecules.
H. Mutations affect gene expression in several ways: (i) Mutations in a
gene may modify the message encoded in a sequence of nucleotides.
Silent mutations usually change the third letter of a codon and have no
effect on polypeptide production. Missense mutations change the codon
for one amino acid to the codon for another amino acid, and thereby
direct incorporation of a different amino acid. Nonsense mutations
change a codon for an amino acid to a stop codon, causing synthesis of
a truncated polypeptide. Frameshift mutations change the reading frame
of a gene, altering the identity of amino acids downstream of the
mutation; (ii) Mutations outside of coding sequences that alter signals
required for transcription, mRNA splicing, or translation can also disrupt
gene expression; and (iii) Mutations in genes encoding molecules of the
gene expression machinery are often lethal. Among the exceptions to
this rule are mutations in tRNA genes that suppress mutations in
polypeptide-encoding genes.

LINKS TO LEARNING:
Click through the steps of this PBS interactive
(http://openstax.org/l/prokary_protein ) to see protein
synthesis in action.

_________________________________________________________________________________________
 Activity 1:

PART A. Read the following:

Protein synthesis is the process used by the body to make proteins. The first step of
protein synthesis is called Transcription. It occurs in the nucleus. During transcription,
mRNA transcribes (copies) DNA. DNA is “unzipped” and the mRNA strand copies a
strand of DNA. Once it does this, mRNA leaves the nucleus and goes into the
cytoplasm. mRNA will then attach itself to a ribosome. The strand of mRNA is then
read in order to make protein. They are read 3 bases at a time. These bases are called
codons. tRNA is the fetching puppy. It brings the amino acids to the ribosome to help
make the protein. The 3 bases on tRNA are called anti-codons. Remember, amino
acids are the building blocks for protein. On the mRNA strand, there are start and stop
codons. Your body knows where to start and stop making certain proteins. Just like
when we read a sentence, we know when to start reading by the capitalized word and
when to stop by the period.

Ribosome mRNA DNA

mRNA tRNA
PART B. Answer the following questions:

1. What is the first step of protein synthesis? _________________________________

2. What is the second step of protein synthesis? _________________________________

3. Where does the first step of protein synthesis occur?

_________________________________

4. Where does the second step of protein synthesis occur?

____________________________

5. Nitrogen bases are read ________ bases at a time.

6. The bases on the mRNA strand are called ______________________.

7. The bases on tRNA are called ______________________.

8. What is the start codon? ______________

9. What are the stop codons? (Use your chart) _______________________________

10. A bunch of amino acids attached together is called a

_____________________________.

PART C. Use your codon chart to determine the amino acid sequence.
Remember to read through the strand and ONLY start on AUG and STOP when
it tells you to stop. Follow example below:

Example:

DNA → AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC

mRNA → UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG

protein → start - glu – ala –thre – hist – asp –glu – threo - stop

acid acid

1. DNA → CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG
CGA TCC ATA ATC

mRNA →

protein →

2. DNA → AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA
ACT GGA GCA

mRNA →

protein →
3. DNA → TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA
CTC GCC ATC

mRNA →

protein →

4. DNA → TAA ACT CGG TAC CTA GCT TAG ATC TAA TTA CCC ATC

mRNA →

protein →

5. DNA → CTA TTA CGA TAC TAG AGC GAA TAG AAA CTT ATC ATC

mRNA →

protein →

6. DNA → TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG CTG ATC

mRNA →

protein →

7. DNA → ACC CGA TAC CTC TCT TAT AGC ATT ACA AAC CTC CGA GCG

mRNA →

protein →

8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC

mRNA →

protein →

Part D. Replication, Transcription & Translation Thinking Questions

1. Draw a DNA nucleotide & an RNA nucleotide. Label each of the 3 major parts.

2. What are the three major differences between DNA & RNA?
 a)

b)

c)

3. What is the point of DNA replication? ____________________________

4. When & where does replication occur? _____________________________

5. What are three nucleotides together called on mRNA? _________

6. The mRNA codons can be used in a chart to find: ____________________

7. What molecule contains an anti-codon? _____________________________

8. Why is this (answer to #13) molecule so important?

9. Translation takes place in the ______________ on a ________________.

10. Transcription and translation together is the process of _______________________

11. What is any change in the DNA sequence called? ______________________________

12. What are some examples of mutations in gene expression?

Activity 2. Complete the diagram by supplying
the missing parts/process. Write at least
2 paragraphs to describe the process.
 Activity 3. Review Quiz

A. Circle the correct choice within the parenthesis for 1 -18.

1. (DNA/RNA) can leave the nucleus.

2. mRNA is made during (transcription/translation).

3. mRNA is made in the (cytoplasm/nucleus).

4. DNA is located in the (nucleus/cytoplasm)

5. (Translation/Transcription) converts DNA into mRNA.

6. (mRNA/rRNA) is used to carry the genetic code from DNA to the ribosomes.

7. (tRNA/rRNA) makes up the ribosome. Look in the book for this.

8. (DNA/RNA) uses uracil instead of thymine.

9. (RNA/amino) acids make up a protein.

11. Transcription takes place in the (nucleus/cytoplasm).

12. tRNA is used in (translation/transcription).

13. tRNA uses (anticodons/codons) to match to the mRNA.

14. Proteins are made at the (nucleus/ribosome).

15. (tRNA/mRNA) attaches the amino acids into a chain.

16. tRNA is found in the (nucleus/cytoplasm).

17. (Translation/Transcription) converts mRNA into a protein.

18. Translation takes place in the (cytoplasm/nucleus).

B. For each of the terms in the left column, choose the best matching phrase in
the right column

a. codon _______1. removing base sequences corresponding

to introns from the primary transcript
b. collinearity _______2. UAA, UGA, or UAG
c. reading frame _______3. the strand of DNA that has the same base
sequence as the primary transcript
d. frameshift mutation ________4. a transfer RNA molecule to which the
appropriate amino acid has been attached
e. degeneracy of the ________5. a group of three mRNA bases signifying
genetic code one amino acid
f. nonsense codon ________6. most amino acids are not specified by a
single codon
g. initiation codon ________7. using the information in the nucleotide
sequence of a strand of DNA to specify the
nucleotide sequence of a strand of RNA
h. template strand ________8. the grouping of mRNA bases in threes to
be read as codons
i. RNA-like strand ________9. AUG in a particular context
j. intron ________10. the linear sequence of amino acids in
the polypeptide corresponds to the linear
sequence of nucleotide pairs in the gene
k. RNA splicing ________11. produces different mature mRNAs from
the same primary transcript
l. transcription ________12. addition or deletion of a number of
base pairs other than three into the coding
sequence
m. translation ________13. a sequence of base pairs within a gene that
is not represented by any bases in the
mature mRNA
n. alternative splicing ________14. the strand of DNA having the base
sequence complementary to that of the
primary transcript
o. charged tRNA ________15. using the information encoded in the
nucleotide sequence of an mRNA molecule
to specify the amino-acid sequence of a
polypeptide molecule
p. reverse transcription ________16. copying RNA into DNA
C. Locate as accurately as possible those of the listed items which are shown
on the following figure. Some items are not shown. You may draw and label
them in the figure (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c)
ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h)
5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of
charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a
nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA
synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential “wobble”
interaction

Activity 4. Article Reading: Read and explore the article entitled

“Genes and Protein Synthesis— Updating Our Understanding
by Brady (2018)”. Make an insight paper about the article. Use the
following as your guide in writing your insights. (a) summarize the
main points; (b) explain the importance of the article; (c) identify the
different perspectives; (d) personal thoughts about the article.
References

Bergtrom, G. (2018). Basic Cell and Molecular Biology: What We Know & How
We Found Out - 4e. University of Wisconsin, Milwaukee.

Lodish, H. et al., (2013). Molecular Cell Biology (5th Ed.) New York: W.H.
Freeman and Co.

Source Material: All images and some texts found in this module are a
derivative of "Biology 2e" and “Genetics: Genes to Genome” by OpenStax CNX
used under CC BY 4.0. 2020.

Brown, T. (2012). Introduction to Genetics.A molecular approach. N.Y.:Garland

Science, Taylor and Francis Grp.

Campbell, N.A. & J.B.Reece. (2008). Biology 8th ed., Pearson Benjamin Cummings,
California.

Cummings, S. (2000). Current Perspecctives in Genetics. USA: Brooks/Cole

Hartl, D.H. & Jones, E. (2002). Essential Genetics. A genomics perspective. (3rd ed.).
MA: Jones and Barlett Publishers, Inc.

Hartwell, L.H., Hood, L. Goldberg, M. Reynolds, Silver, L.M. & Jones, E. (2011).
Genetics from genes to genomes. 4th ed. N.Y: McGraw Hill

Karp, G.C. (2013). Cell and Molecular Biology, (7th ed.). U.S.:John Wiley and Sons,
Inc.

Klug, W.S., Cumming, M.R., Spencer, C. & Palladino, M.A. (2010). Essentials of
genetics. (7th ed.) CA:Pearson Benjamin Cummings

Lewis, R. (2003). Human genetics.Concepts and applications. 5th ed. N.Y: McGraw
Hill

Reece, J.B., et al. (2014). Biology, (10th ed.). U.S.:Pearson Publisher.

Internet Sources:

https://youtu.be/kiqhngnIZ5w (overview of the central dogma of molecular biology)

https://youtu.be/gG7uCskUOrA (overview of gene expression in eukaryotes)