SRI CHAITANYA EDUCATIONAL INSTITUTIONS

A.P,TELANGANA,KARNATAKA,TAMILNADU,MAHARASHTRA,DELHI,RANCHI,CHANDIGARH

NEET GRAND TEST-

TEST - 9
Name :........................................... Hall Ticket No:

INSTRUCTIONS TO CANDIDATES
1. The Model NEET- 2019 is of 3 Hrs duration. Time: 02.00 PM –
05.00 PM.
2. The question paper for NEET-2019 consists of 180 questions
comprising 45 questions in Botany, 45 in Zoology, 45 in Physics
and 45 in Chemistry for NEET.
3. All questions are of objective type (Multiple choices only)
4. Each question carries four marks.
5. Negative marking: one mark will be deducted for every wrongly
answered question.
6. Total Marks 720.
7. The candidates are prohibited from carrying any paper to the
examination hall except HALL TICKET.
8. No Calculators, Mini-Cards, Watches with Calculators, Pager, Cell
Phone, Slide rules or outer aids to calculation will be allowed in
the examination hall.
9. Candidates once admitted will not be allowed to leave the hall till
half an hour before the closing of the test.
10. A separate sheet is attached in the middle of this booklet for rough
work, you can detach and use it.
11. A detachable answer sheet with 180 question blocks, with 4 circles
corresponding to 4 multiple choice for each question will be
provided. Use HB Pencil to darken the appropriate circle against
the question number provided in the sheet. Answer should be
marked only on the answer sheet, but not on the question
paper booklet.
Sri Chaitanya Page 1 Educational Institutions
 SRI CHAITANYA EDUCATIONAL INSTITUTIONS,
INSTITUTIONS,INDIA
A.P,TELANGANA,KARNATAKA,TAMILNADU,MAHARASHTRA,DELHI,RANCHI,CHANDIGARH
A.P,TELANGANA,KARNATAKA,TAMILNADU,MAHARASHTRA,DELHI,RANCHI,CHANDIGARH
Sec: SR BiPC ALL & LTC-IC Date : 01.05.19
TIME : 3 Hrs. NEET GRAND TEST – 09 Max.Marks : 720

01. Which of the following set cannot be (1) 600 towards north
selected as fundamental quantities (2) 600 towards
rds south
(1) Density,youngs modulus, (3) 300 towards north
velocity. (4) 300 towards south
(2) Force ,velocity, coefficient of 05. The mass of empty helicopter is
viscosity 2000kg. The total mass of the crew and
(3) Force, Pressure, area. passengers is 500kg. When it is rising
(4) Planks constant, Universal with a vertical acceleration of 15m/s2 ,
gravitational constant,area
constant,are a) the force on the floor of the
02. At time t=0, two bodies A and B are at helicopter by the crew and passengers.
the same point. A moves with constant b) the action of the rotor of the
velocity V and B starts from rest and helicopter on the surrounding air
moves with constant acceleration. are respectively given by( g = 10m/s2 )
Relative velocity of B with respect to A (1) 12500N, 62500N
when the bodies meet each other is (2) 12000N,62000N
(1) 2V (3) 10500N, 60500N
(2) V/2 (4) 12500N, 61500N
(3) V/3 06. A block of mass m is lying on a wedge
(4) V having inclination angle
03. The velocity of a projectile when it is at
1
2 α = tan −1   .Wedge is moving with
its greatest height is
5
of its velocity  
5
when at half of its greatest height, find a constant acceleration a = 2ms-2 . The
the angle of projection minimum value of coefficient of
(1) 300 friction µ so that m remains
(2) 600 stationary w.r.t. wedge is ( g=10m/s 2 )
(3) 450
(4) 900
04. Rain is falling
ing vertically with a speed
of 10ms-1. A woman rides a bicycle
with a speed of 10 3ms-1 in the north to (1) 2/9
south direction. The direction in which (2) 5 /12
she should bend the umbrella from (3) 1/ 5
vertical position is (4) 2 / 5
07. The kinetic energy K of a particle 3a
a height above the base. The
moving along a circle of radius R 4
depends upon the distance s as minimum value of F for which the

K = as 2 (where ‘a’ is a constant.The cube begins to topple about an edge, is

force acting on the particle is (1) Mg
Mg
s2 (2)
(1) 2a 2
R
1/ 2 2
 s2  (3) Mg
(2) 2 a 1 + 2  3
 R  4
(4) Mg
(3) 2 as 3
(4) 2a 11. A body of mass m accelerates

08. Two balls at same temperature collide. uniformly from rest to v1 in time t1 . As

Which quantity is conserved? a function of time t, the instantaneous

(1) Temperature power delivered to the body is
(2) Velocity mv1t
(1)
(3) Kinetic energy
t1

(4) Momentum mv12t

(2)
t1
09. Two particles move towards each
other from rest under a mutual force of mv1t 2
(3)
t1
attraction. At the instant, when the
V mv12t
speed of A is V, the speed of B is . (4)
2 t12
The speed of centre of mass of the 12. A uniform disc of radius R lies in x-y
system is plane with its centre at origin. Its
(1) zero moment of inertia about the axis x=2R
V and y=0 is equal to the moment of
(2)
2 inertia about the axis y=d and z=0.
3
(3) V Where d is equal to
2
4
3 (1) R
(4) V 3
4
10. A uniform cube of side ‘ a ‘ and mass 17
(2) R
2
M rests on a rough horizontal table. A
(3) 13R
horizontal force F is applied normal to
15
one of the faces at a point that is (4) R
2
directly above the centre of the face, at

Sri Chaitanya Page 3 Educational Institutions

13. Two identical satellites A and B are 16. A soap film of surface tension
circulating round the earth at the 3×10-2 Nm-1 formed in square frame,
height of R and 2R respectively, can support a straw. The length of the
(where R is radius of the earth). The
film is 10 cm. Mass of the straw the
ratio of kinetic energy of A to that of B
film can support is
is
(1) 0.06 gm
(1) 1/2
(2) 0.6 gm
(2) 2/3
(3) 6 gm
(3) 2
(4) 60 gm
(4) 3/2 17. A rectangular block of size
14. A particle is in simple harmonic 10cm×8cm×5cm is kept in three
motion with amplitude 4 cm and time
different positions P, Q and R in turn
period 12 sec. The ratio between the
as shown in the figure. In each case,
times taken by it in going from its
the shaded area is rigidly fixed and a
mean position to 2 cm and from 2 cm
definite force F is applied tangentially
to extreme position is
to the opposite face to deform the
(1) 1
block. The displacement of the upper
(2) 1/2
face will be
(3) 1/3 8
8 5
(4) 1/4
10
15. To get the maximum flight, a ball must 10
be thrown as 5

(1) 10
(P) 5 (Q)

v
8

(R)
(2)
(1) Same in all the three cases
(2) Maximum in P position
v
(3) Maximum in Q position
(4) Maximum in R position
(3) 18. 1gm of ice at 0°C is mixed with 1gm of
water at 100°C, the resulting
temperature will be
v
(1) 5°C
(2) 0°C
(4) Any of (1), (2) and (3) (3) 10°C
(4) 100°C

Sri Chaitanya Page 4 Educational Institutions

19. Water and turpentine oil (specific heat temperature. The amount of heat (in
less than that of water) are both heated kcal) converted into work is equal to
to same temperature. Equal amounts (1) 3.5
of these are placed in identical (2) 1.6
calorimeters and then left in air. The (3) 1.2
cooling curves between the (4) 4.8
temperature T and the time t are 22. The average translational kinetic
shown. energy of O (molar mass 32)
2
T molecules at a particular temperature
is 0.048 ev. The translational kinetic
A
energy of N (molar mass 28)
B 2
t
molecules in ev at the same
(1) Their cooling curves will be
temperature is
identical
(1) 0.0015
(2) A and B will represent cooling
(2) 0.036
curves of water and oil respectively
(3) 0.048
(3) B and A will represent cooling
(4) 0.768
curves of water and oil respectively
23. The distance between two consecutive
(4) None of the above
crests in a wave train produced in a
20. Volume versus temperature graph of
string is 5 cm. If 2 complete waves pass
two moles of helium gas is as shown in
through any point per second, the
figure. The volume and temperature at
velocity of the wave is
the state 1 are (V,T) and that at state 2
(1) 10 cm/sec
are (3V,3T).The ratio of heat absorbed
(2) 2.5cm/sec
and the work done by the gas in
(3) 5 cm/sec
process 1-2 is
(4) 15 cm/sec
V
24. The wavelength is 120 cm when the
2
source is stationary. If the source is
moving with velocity of 60 m/sec
1
towards the observer, then the
T
wavelength of the sound wave
(1) 3
reaching to the observer will be nearly
(2) 5/2
(velocity of sound = 330 m/s)
(3) 5/3
(1) 98 cm
(4) 7/2
(2) 140 cm
21. An ideal gas heat engine operates in a
(3) 120 cm
Carnot cycle between 227°C and
(4) 144 cm
127°C. It absorbs 6 kcal at the higher

Sri Chaitanya Page 5 Educational Institutions

25. A ray of light strikes a plane mirror M (1) 1.5 mm
at an angle of 45° as shown in the (2) 3mm
figure. After reflection, the ray passes (3) 4.5 mm
through a prism of refractive index 1.5 (4) 6 mm
whose apex angle is 4°. The total angle 29. A photon and an electron have equal
through which the ray is deviated is energy E. Then λphoton / λelectron is
proportional to
45° (1) E
(2) 1/ E
(1) 90° 4° (3) 1/ E
(2) 91° (4) Does not depend upon E
(3) 92° 30. For intensity I of a light of wavelength
(4) 93° 5000Å the photoelectron saturation
26. The separation between two current is 0.40 µ A and stopping
microscopic particles is measured PA potential is 1.36 V, the work function
and PB by two different lights of of metal is
wavelength 2000 Å and 3000 Å (1) 2.47 eV
respectively, then (2) 0.36 eV
(1) PA > PB (3) 1.10 eV
(2) PA < PB (4) 0.43 eV
(3) PA < 3 / 2 PB 31. How much work must be done to pull
(4) PA = PB apart the electron and the proton that
27. The dual nature of light is exhibited by make up the Hydrogen atom, if the
(1) Photoelectric effect atom is initially in the state with n = 2
(2) Refraction and interference (1) 13.6 ×1.6 ×10−19 J
(3) Diffraction and reflection (2) 3.4 ×1.6 ×10−19 J
(4) Diffraction and photoelectric (3) 1.51×1.6 ×10−19 J
effect (4) 0
28. In a Young's double slit experiment, 32. At a given instant there are 25%
the slits are 2 mm apart and are
undecayed radioactive nuclei in a
illuminated with a mixture of two
same. After 10 sec the number of
wavelength λ 0 =750nm and λ=900nm .
undecayed nuclei reduces to 6.25%, the
The minimum distance from the mean life of the nuclei is
common central bright fringe on a (1) 14.43 sec
screen 2m from the slits where a
(2) 7.21 sec
bright fringe from one interference
(3) 5 sec
pattern coincides with a bright fringe
(4) 10 sec
from the other is

Sri Chaitanya Page 6 Educational Institutions

33. A waveform shown when applied to the 35. An arc of radius r carries charge. The
following circuit will produce which of linear density of charge is λ and the arc
the following output waveform. π
subtends an angle at the centre.
Assuming ideal diode configuration 3
and R = R What is electric potential at the centre
1 2 R1
5V λ
(1)
Vin 4ε 0
R2 V0
λ
–5V (2)
8ε 0
+ 5V λ
(3)
12ε 0
λ
(4)
16ε 0
(1) 36. Four condensers are joined as shown
in the adjoining figure. The capacity of
2.5V each is 8µF . The equivalent capacity
between the points A and B will be

(2)
A

B
(1) 32µ F
– 5V (2) 2µ F
(3) (3) 8µ F
(4) 16µ F
37. Consider the charge configuration and
spherical Gaussian surface as shown in
– 2.5V
the figure. When calculating the flux of
(4) the electric field over the spherical
34. The pressure exerted by an surface , the electric field will be due to
electromagnetic wave of intensity I +q1 q2
(watts/m2) on a nonreflecting surface –q1
is [c is the velocity of light]
(1) Ic (1) q2 only
(2) I c2 (2) Only the positive charges
(3) All the charges
(3) I /c
(4) + q1 and − q1 only
(4) I / c2
Sri Chaitanya Page 7 Educational Institutions
38. A carbon resistor has colour strips as (1) North
violet, yellow brown and golden. The (2) South
resistance is (3) East
(1) 740 ± 10 0 Ω (4) West
0
42. The coil of a galvanometer consists of
(2) 740 ± 5 0 Ω
0 100 turns and effective area of 1 square
(3) 740 ± 20 0 Ω cm. The restoring couple is
0

(4) 750 ± 10 0 Ω 10-8 N-m/radian . The magnetic field

0
between the pole pieces is 5 T. The
39. In the circuit shown in figure, switch S1
current sensitivity of this galvanometer
is closed and S2 is open. Find Va – Vb
will be
1Ω b 5Ω
(1) 5 ×104 rad / µ amp
10µF (2) 5 ×10−6 rad per amp

(3) 2 ×10−7 rad per amp

S2
(4) 5 rad / µ amp
3Ω 3Ω
43. A tangent galvanometer shows a
a deflection 45° when 10 mA current
24V S1
pass through it. If the horizontal
component of the earth’s field is
(1) 4V
(2) 8V 3.6 ×10-5 T and radius of the coil is 10

(3) 12V cm. The number of turns in the coil

(4) 16V is(nearly)
40. A long copper tube of inner radius R (1) 5700 turns
(2) 57 turns
carries a current i. The magnetic field B
(3) 570 turns
inside the tube is
(4) 5.7 turns
µ 0i
(1) 44. A copper disc of radius 0.1 m rotates
2π R
µ 0i about its centre with 10 revolutions per
(2)
4π R second in a uniform magnetic field of
µ0i 0.1 Tesla. The emf induced across the
(3)
2R radius of the disc is
(4) Zero π
(1) V
41. Particles having positive charges 10
occasionally come with high velocity 2π
(2) V
10
from the sky towards the earth. On
(3) 10 π mV
account of the magnetic field of earth,
(4) 20 π mV
they would be deflected towards the
Sri Chaitanya Page 8 Educational Institutions
45. A resistor R, an inductor L and a 48. Which of the following is correct
capacitor C are connected in series to sequence in advancement of
an oscillator of frequency n. if the classification systems over the years ?
resonant frequency is n , then the (1) Artificial, Phylogenetic, Natural
r
current lags behind voltage, when (2) Natural ,Phylogenetic, Artificial
(1) n = 0 (3) Artificial ,Natural, Phylogenetic
(2) n < nr (4) Cladistic,Phenetic,Cytotaxonomic
Phenetic,Cytotaxonomic
49. A correct statement regarding viruses
(3) n = nr
is
(4) n > nr
(1) Most of them have their own
46. Which statements are correct about the
enzymes and ribosomes
given animal ?
(2) Genetic material in plant viruses
is mostly DNA
(3) In some viruses same nucleic acid
sequence
quence is shared by two or
more identical genes
(4) Viruses posses
possess inherent
a) aterally symmetrical,
Bilaterally metabolism
triploblastic 50. Identify the organisms (A and B) in the
b) Worm like fresh water animal given diagrams and notice correct with
c) Circulatory system is of open type respect to their phyla
d) Coelomate animals
e) Fertilisation is internal, direct
development
(1) a,b,c,d,e are correct
(2) a,b,c,d are correct
(3) a,b,d are correct
(4) a,c,d are correct
Organisms Phyla
47. The characteristic that proves frog’s
(1) A-Octopus A-Mollusca and
A
ancestry from fishes is :-
and B-Asterias B-Echinodermata
B
(1) The ability to swim in water
(2) A-Asterias A
A-Mollusca and
(2) The tadpole larva in frogs
and B-Octopus B-Echinodermata
B
resembles the fishes in many
(3) A-Octopus A-
A
characters
(3) Similarity in the shape of the head and B-Asterias Echinodermata
and B-Mollusca
B
and tail
(4) The tadpole larva of frogs and (4) A-Asterias A
A-
fishes are ureotelic and B-Octopus Echinodermata
and B-Mollusca
B
51. Arrange the following plants in 56. Incorrect for tendril modification is
increasing order of elaboration of (1) Axillary buds of watermelon
gametophyte (2) Entire leaf of garden pea (Pisum)
a – Salvia (3) Stipule of Smilax
b – Sphagnum (4) Axillary buds of cucumber
c – Selaginella 57. Correct for Gracilaria and Gelidium are :
d - Marchantia (1) Presence of phycoerythrin
(1) a, c, d, b
(2) Polysulphate esters in the cell wall
(2) b, c, d, a
(3) Stored food is floridean starch
(3) b, d, c, a
(4) All of these
(4) c, a, b, d
58. The second most abundant formed
52. The nerve cord of cockroach is
element in human blood
(1) Single, dorsal & solid
(1) Erythrocytes
(2) Double, dorsal & hollow
(2) Thrombocytes
(3) Double, ventral & solid
(3) Leucocytes
(4) Single, ventral & hollow
53. Find the correct match : (4) Neutrophils
(1) Elution - Separation of 59. Conidia, ascospore, zoospore,
DNA from a cell basidiospore, microspore, megaspore
(2) PCR - Intracellular and sporangiospore. How many of the
DNA amplification above are sexual spores/meiospores ?
(3) Gel electrophoresis - Separation (1) 4
by density gradient centrifugation (2) 1
(4) Autoradiography - Tracing (3) 7
pathway of a chemical using (4) 6
radioisotope 60. Which of the following gastric cells
54. Alveoli of the lungs are lined by- help indirectly in erythropoiesis?
(1) Cuboidal epithelium (1) Peptic cells
(2) Columnar epithelium (2) Parietal cells
(3) Squamous epithelium
(3) Goblet neck cells
(4) Compound epithelium
(4) Goblet cells
55. Which is the incorrect statement for
61. A structure found in woody stem of
areolar connective tissue?
dicot trees is:
(1) Present beneath the skin
(1) Hydathode
(2) It contains fibroblasts.
(2) Stomata
(3) Fibres are densely packed
(3) Sclerenchyma
(4) Serves as support framework for
(4) Lenticels
epithelium
Sri Chaitanya Page 10 Educational Institutions
62. Features of human teeth are :- 66. Which of the following factors favour
(1) Thecodont, homodont, the formation of oxyhaemoglobin in
diphyodont lungs ?
(2) Thecodont, heterodont, (1) Po ↓ PCO ↑, Temperature ↑ H ⊕ concentration ↑
2 2

diphyodont (2) Po ↑ PCO ↑, Temperature ↑ H ⊕ concentration ↑

2 2

(3) Thecodont, heterodont, mono

(3) Po ↓ PCO ↓, Temperature ↓ H ⊕ concentration ↓
2 2
phyodont
(4) Po ↑ PCO ↓, Temperature ↓ H ⊕ concentration ↓
2 2
(4) Thecodont, heterodont,
67. If a vascular bundle contains the
polyphyodont
cambium for formation of secondary
63. Competitive inhibition of enzymes is
vascular tissue then such vascular
advantageous in :
bundle is called
1) Lowering blood cholesterol
(1) Open
2) Control of bacterial pathogen
(2) Closed
3) Inhibiting calvin cycle
(3) Radial
4) Both (1) and (2)
(4) Conjoint
64. Which one of the following statements
68. An artificial pacemaker is implanted
is true regarding digestion of food in
subcutaneously and connected to the
human?
heart in patients :-
(1) About 60% of starch is hydrolysed
(1) Having 90% blocking in the three
by salivary amylase in our mouth
main coronary arteries
(2) Oxyntic cells in our stomach
(2) Having a very high blood
secrete the proenzyme
pressure
pepsinogen
(3) With irregularity in the heart
(3) Dipeptides are end products of
rhythm
trypsin and pepsin action on
(4) Suffering from arteriosclerosis
protein
69. Arrange the following in increasing
(4) Bile contains bile salts
order of complexity :
65. Mitotic anaphase is characterized by
a – Nucleoside
(1) Daughter chromosomes begin
b – Nitrogenous base
their migration towards two
c – gene
opposite poles
d – Nucleotide
(2) Terminal chiasmata disappears
(1) c, b, d, a
(3) Each daughter chromosome is
(2) b ,a, d, c
attached to two spindle fibres
(3) b ,d, a, c
from two different poles
(4) a ,b, c, d
(4) All of these
Sri Chaitanya Page 11 Educational Institutions
70. Read the following and identify A, B 73. One turn of Calvin cycle consumes
and C blood vessels related to liver (1) 18 ATP, 12 NADPH, 6 CO2
correctly (2) 30 ATP, 12 NADPH, 6 CO2
(A) Nutrients from intestine are (3) 3 ATP, 2 NADPH, 1 CO2
carried to liver (4) 5 ATP, 2 NADPH, 1 CO2
(B) Synthesized urea from liver is 73. One turn of Calvin cycle consumes
carried to post caval vein (1) 18 ATP, 12 NADPH, 6 CO2
(C) Oxygenated blood from dorsal (2) 30 ATP, 12 NADPH, 6 CO2
aorta is given to liver (3) 3 ATP, 2 NADPH, 1 CO2
The correct names of A, B and C are:- (4) 5 ATP, 2 NADPH, 1 CO2
A B C 74. Incorrect related with angiotensin-II is-
(1) Hepatic Portal Hepatic (1) It is a part of RAAS.
(2) It is a potent vasoconstrictor
artery vein vein
(3) It is a potent vasodilator
(2) Portal Hepatic Hepatic
(4) Its precursor is Angiotensin – I
vein vein artery
75. An incorrect match is
(3) Hepatic Hepatic Portal
(1) Spring variety wheat –
vein artery vein
Vernalization required for
(4) Hepatic Portal Hepatic flowering
vein vein artery (2) Tobacco – Flowers below critical
71. Carotenoids photoperiod
(1) Protect chlorophyll from (3) Gibberellins – Increase yield in
photooxidation sugarcane
(2) Are used for synthesis of auxins (4) Stratification – Method to break
(3) Do not absorb visible light (400 – seed dormancy
700 nm) 76. Given below are two statements (A-B).
(4) All of these Select the option which correctly fills
72. In a medico-legal case of accidental up the blanks :-
interchange between two babies in a A) Malfunctioning of kidneys can lead
hospital, the baby of blood group ‘A’ to accumulation of urea in blood, a
could not be rightly given to a couple :- condition is called ---- (A) ----.
(1) With both husband and wife of B) In kidney patients the urea is
removed from blood by using a
group ‘O’
process called ---- (B) ----.
(2) Husband of group ‘O’ and wife of
(1) (A)Uremia, (B) Kidney
group ‘A’
transplantation
(3) Husband of group ‘AB’ and wife
(2) (A) Uremia, (B) Haemodialysis
of group ‘O’
(3) (A) Ketonuria, (B) Haemodialysis
(4) Both husband and wife of group
(4) (A) Glycosuria, (B) Kidney
‘A’
transplantation
Sri Chaitanya Page 12 Educational Institutions
77. Correct about C4 plants is 82. Estimate the number of species of
(1) Bundle sheath cells are rich in tortoises on an island having an area of
RUBISCO 3600 square kilometers, if the
(2) Lack Calvin Cycle regression coefficient of the species-
(3) Distribution in temperate regions area relationship curve is 0.5 and Y-
(4) Use PEP carboxylase for intercept is 0.1 –
carboxylation of RuBP (1) 9
78. The joint between humerus and (2) 3
(3) 6
pectoral girdle is :-
(4) 12
(1) Hinge joint
83. The hormone which stimulates
(2) Pivot joint
reabsorption of Ca+2 by the renal
(3) Ball & Socket joint
tubules and increases Ca+2 absorption
(4) Gliding joint
from digested food is :-
79. Find the incorrect match
(1) Aldosterone
(1) RER – synthesis of steroidal
(2) Anti Diuretic hormone
hormones
(3) Parathormone
(2) Golgi complex – Glycolipid
(4) Thyrocalcitonin
formation 84. Incorrect for classification of mango is
(3) Lysosome – Sac of acidic (1) Genus - Mangifera
hydrolases (2) Family - Anacardiaceae
(4) Mitochondria – Site of aerobic (3) Order - Sapindales
respiration (4) Division – Dicotyledonae
80. Choose incorrect statement about 85. Mode of nutrition in Euglena is by
axoplasm closer to axonal membrane (1) Photoautotrophic and predation
(1) It has low concentration of Na+ (2) Only photoautotrophic
(2) It has high concentration of K+ (3) Photo autotrophic and Chemo
(3) It has negatively charged proteins autotrophic
which diffuse out (4) Only heterotrophic
(4) It is negatively charged at rest 86. Gorilla like man with large head,
81. Satellite is a part of hands and protruding jaws, is
(1) Endoplasmic reticulum produced due to ……..
(2) Trans face of golgi complex (1) Over secretion of thyroxin

(3) Centromere of chromosome (2) Over secretion of growth

hormone in adult
(4) Arm of chromosome beyond
(3) Excess of vitamin ‘C’ in diet.
secondary constriction
(4) Excess secretion of TSH.

Sri Chaitanya Page 13 Educational Institutions

87. Incorrect for gymnosperms is : 91. Best method for rapid clonal
(1) Sporophyte can be monoecious or propagation of plants like potato,
dioecious sugarcane, banana and production of
(2) Sporophylls may or may not form virus free plants is
cone (1) Somatic hybridization
(3) Endosperm is triploid (2) Repeated selfing
(4) Leaves are well adapted to (3) Meristem culture
withstand extremes of (4) Embryo rescue
temperature 92. Incorrect related with ZIFT is-
88. Which of the following disorder is not (1) It is zygote intra fallopian tube
related with malfunctioning of thyroid transfer
(2) Zygote is transferred into
gland?
fallopian tube after IVF
(1) Cretinism
(3) Early embryos upto 8 blastomeres
(2) Myxoedema
can be transferred in to fallopian
(3) Hashimoto disease
tubes.
(4) Myasthenia gravis (4) Embryo with more than 8
89. Correct statement for human AB blood blastomeres are transferred in the
group is fallopian tubes
(1) Antigen A on RBC, antigen B in 93. A homothallic plant is
plasma (1) Chara
(2) Antigen A and B in RBC, (2) Marchantia
antibody A and B in plasma (3) Cycas
(3) No antigen on RBC, antibody A (4) Date palm
and B in plasma 94. Diaphragms are contraceptive devices
used by the females. Choose the
(4) Antigen A and B on RBC, no
correct option from the statements
antibody in plasma
given below:-
90. Find out the incorrect one
a) They are introduced into the
(1) hCG, hPL and relaxin are uterus
produced in women only during b) They are placed to cover the
pregnancy. cervix region
(2) During pregnancy the levels of c) They act as physical barrier for
sperm entry
hormones like estrogens increased d) They mainly function as
several folds. spermicidal agents
(3) Foetal ejection reflex related with The correct options are :-
lactation. (1) a & b
(4) Foetal ejection reflex is related (2) b & c
with parturition (3) a & c
(4) c & d
Sri Chaitanya Page 14 Educational Institutions
95. Floral formula of a family is (3) Roundup ready tobacco
(4) Nucleopolyhedrovirus
100. Origin of different varieties of finches
.
from seed-eating finches explains
Which of the following is a correct
(1) Convergent evolution
match for this family ?
(2) Adaptive radiation
(1) Ashwagandha – medicinal
(3) Directional selection
(2) Gloriosa – ornamental
(4) Parallel evolution
(3) Tobacco – fumigatory
101. In EcoRI, I stands for
(4) Sesbania – fodder
(1) Inhibitor
96. Oral Contraceptive Pills
(2) Type 1 restriction enzyme
(1) Inhibit ovulation (3) First isolated RE from Escherichia
(2) Are always non-steroidal coli RY 13
preparations (4) First discovered RE from
(3) Promote the pregnancy chances Escherichia coli RY 13
(4) Inhibit coitus 102. The study of fossils in different aged
97. In sewage treatment rocks showed that most fossils exist in
(1) Primary sludge is subjected to (1) Sedimentary rock
aerobic digestion (2) Igneous rock
(2) Effluent of primary settling tank (3) Marble
has very high BOD (4) All of these
(3) Flocks bring about anaerobic 103. In pBR322, tetR gene helps in
digestion of dissolved organic (1) Screening of recombinants and
matter present in primary effluent non recombinants amongst
(4) All of these are correct transformants
98. The karyotype of human ovum is n+1 (2) Screening of transformants and
due to nondisjunction of 21st pair of nontransformants
chromosomes. If, it is fertilized by a (3) Integration of desired gene at
normal sperm with ‘x’ chromosome, it ROP
develops into (4) Screening blue and colourless
(1) Turner’s female colonies
(2) Klinefelter syndrome male 104. The immediate adverse effects of
(3) Down syndrome-male drugs and alcohol abuse are
(4) Down syndrome – female manifested in the form of
99. Best microbial agent for biological (1) Anxiety, shakiness, nausea,
control of insect pests aiding in sweating
integrated pest management is (2) Reckless behavior, vandalism,
(1) Agrobacterium violence
(3) Death
(2) Ladybird beetle
(4) Fever
Sri Chaitanya Page 15 Educational Institutions
105. Addition of preservatives after 109. A tailor made plant is :
separation and purification of foreign (1) Continuously pruned to remove
gene product is called apical dominance
(1) Formulation (2) Plant produced by tissue culture
(2) Transformation (3) Transgenic plant that produces
(3) Hybridization products required by specific
(4) Fortification industry
106. When there is a sudden loss of blood (4) Pest resistant plant
from the body, the organ which 110. A biologist studies the population of
releases, supplies blood cells is rats in a barn. He found that the
(1) Heart average natality was 250, average
(2) Lung mortality 240, Immigration 20 and
(3) Spleen Emigration 30. The net increase in
(4) Liver population is-
107. Nematode resistance was imparted in (1) 10
tobacco by using the process of RNAi. (2) 15
In this : (3) 05
(1) Nematode specific gene were (4) Zero
introduced in the nematode 111. Find the incorrect match
(2) Agrobacterium was used as vector (1) Okra – Pusa Sawani - Aphids
(3) Foreign gene produced only anti- (2) Wheat – Himgiri – Hill bunt
sense RNA (3) Brassica – Pusa Gaurav – Aphids
(4) All of these (4) Cowpea – Pusa Komal – Bacterial
108. Which of the components of following blight
options correctly applies to structural 112. According to David Tilman, greater
formula shown in the diagram? the diversity, greater is the primary
OH productivity. Which of the following
has least diversity but high primary
productivity?
O
H (1) Desert ecosystem
(2) Cropland ecosystem
(1) Opium Unripe fruit Analgesic (3) Tropical rainforest
action (4) Composite fish culture pond
(2) Hemp Inflorescence Effects 113. Prabhani Kranti is a variety of _______
cardio resistant to ______________. Fill in the
vascular blanks correctly
system (1) Abelmoschus, shoot and fruit borer
(3) Coca Dopamine CNS
(2) Mung bean, yellow mosaic virus
inhibition stimulation
(3) Chilli, chilly mosaic virus
(4) Datura Atropine Halluci
nations (4) Abelmoschus, yellow mosaic virus

Sri Chaitanya Page 16 Educational Institutions

114. Accumulation of toxic substance in 119. A correct statement is :
successive trophic level in food chain is (1) Capping and tailing and splicing
known as is done to form hn RNA
(1) Accelerated eutrophication (2) The split – gene arrangement
(2) Biomagnification represents probably an ancient
(3) Biotype feature of the genome
(4) Aggregation (3) RNA polymerase I of eukaryotes
115. An mRNA has following sequence of transcribes tRNA
nucleotides (4) All of these
5| AUGCACUACGGGACACAGUGA3′ . 120. Secondary productivity is rate of
If 9th nucleotide is replaced by A due to formation of new organic matter by-
point mutation then this mRNA on (1) Parasite
translation will form (2) Consumer
(1) 2 amino acids long peptide chain (3) Decomposer
(2) 2 amino acids and 3 amino acids (4) Producer
long two peptide chains 121. Correct sequence of components of
(3) two types of three amino acids transcriptional unit are
long polypeptide chains (1) Promoter, enhancer, structural
(4) 6 amino acids long polypeptide gene
chain (2) Operator, regulator, stop codon
116. Volume of carbon di oxide carried by (3) SD sequence, coding sequence,
100 ml of deoxygenated blood from stop codon
tissues to the lungs in the form of (4) Promoter, structural gene,
bicarbonate ions is about- terminator
(1) 4 ml
122. The principle of competitive exclusion
(2) 2.8 ml
was stated by-
(3) 1.2 ml
(1) Mac Arthur
(4) 5 ml
(2) Verhulst and pearl
117. According to CPCB, particulate dust of
(3) Charles Darwin
size ------------in diameter, cause the
(4) Gause
greatest harm to human health-
123. During DNA replication
(1) 2.5 micrometers or less
(1) On 31 → 51 template strand
(2) 2.5 micrometers or more
replication is continuous
(3) 3.5 micrometers
(2) DNA dependent DNA
(4) 4.5 micrometers
polymerase always catalyses
118. Genetic code was deciphered by cell
polymerization in both directions
free system of protein synthesis by
(1) Gamow i.e 51 → 31 and 31 → 51 directions
(2) Watson and Crick (3) Okazaki fragments are formed on
(3) Marshall Nirenberg both template strands
(4) Severo Ochoa (4) More than one options are correct

Sri Chaitanya Page 17 Educational Institutions

124. Which of the following genotype 129. Linked genes
shows Intersex drosophila (as per (1) Never separate
genic balance theory)- (2) Always separate
(1) 2A+XXX (3) Have the tendency to remain
(2) 2A+XXY together
(3) 3A+XXY (4) Are present at same locus of
(4) 2A+XY homologous chromosomes
125. In Meselson and Stahl’s experiment 130. The human genome contains about-
when density gradient centrifugation (1) Approximately 3 million
was done after 20 minutes nucleotide base pairs.
(1) Only heavy band was obtained (2) Approximately 3164.7 billion
(2) Both hybrid and light bands were nucleotide base pairs.
obtained (3) Approximately 3 billion
(3) Only hybrid band was obtained nucleotide base pairs.
(4) Both heavy and hybrid bands
(4) Approximately 46 million
were obtained
nucleotide base pairs
126. A Y-linked gene is responsible for
131. In a dihybrid cross of garden pea
hypertrichosis (Long hair on ears) .
involving seed shape and seed colour
When an affected man marries a
960 plants were obtained in F2. How
normal woman, what % of their
many plants will produce yellow,
daughters, would be expected to have
round seeds ?
hairy ears-
(1) 540
(1) 25 %
(2) 320
(2) 0 %
(3) 360
(3) 50 %
(4) 450
(4) 100 %
132. The probability of severe sickle cell
127. In Morgans experiment on Drosophila
disease when both parents are carriers-
involving eye colour and wing size,
percentage of recombinants obtained (1) 1/4
were (2) 1/2
(1) 1.3% (3) 1/3
(2) 62.8% (4) 34
(3) 37.2% 133. An example of pleiotropy is
(4) 98.7% (1) Seed of garden pea
128. DNA fingerprinting profile will be (2) ABO blood groups in human
exactly same for beings
(1) Non Identical twins (3) Eye colour and body colour in
(2) Di-zygotic twins fruit fly
(3) Mono-zygotic twins (4) All of these
(4) Fraternal twins
Sri Chaitanya Page 18 Educational Institutions
134. Which junction helps to stop 139. Wrong match is
substances from leaking across a (1) Humus……protective colloid in
tissue? soil
(1) Interdigitation (2) Colloidal antimony…..cures
(2) Gap junction kalaazar
(3) Desmosome (3) Colloidal gold…..used in
(4) Tight junction intravenous injections
135. ‘Genes do not show blending’. This (4) argyrol……used as antibiotic
statement was given by Mendel after 140. Which among the following is
observing incorrect statement?
(1) F1 of monohybrid cross (1) Excess of Na makes NaCl crystals
(2) F1 of dihybrid cross yellow due to metal excess defect
(3) F2 of monohybrid cross because of anionic vacancy
(4) F2 of dihybrid cross (2) ZnO on heating turns to yellow
136. Boiling point order of the following is due to metal excess defect because
I. CH 3 − CH 2 − CH 2 − CH 2 − Cl of the presence of extra cation at
Cl interstitial site.
|
CH 3−C −CH 3 (3) Doping of Silicon with Al will
II. |
CH3 give n-type semiconductor
(4) AgBr has both Schottky and
III.CH 3 −CH −CH 2−Cl Frenkel defects.
|
CH3 141.
(1) I > II > III Conc.HNO3
 Br2 /FeBr3
0 → A  → B ( maj)
(2) III > II > I Conc.H2SO4 <60 C dark

(3) II > III > I ”B” is

(4) I > III > II
NO2
137. Which of the following chemical
cannot be stored in a glass container
(1) Hydrochloric acid
(2) Hydrobromic acid (1) Br

(3) Hydroiodic acid NO2

(4) Hydrofluoric acid Br
138. Which of the following is incorrect? (2)
(1) Quartz - crystalline allotrope of NO2
Silica
(2) H3BO3 – Weak mono basic lewis
(3) Br
acid
(3) +1 state for Tl – due to inert pair NO2
effect
(4) CCl4 – undergoes hydrolysis to NO2
form carbonic acid (4) Br

Sri Chaitanya Page 19 Educational Institutions

142. Which one of the following does not (1) -2.3 V
give NO2 gas on strong heating (2) +2.34 V
(1) Ca ( NO3 ) 2 (3) -1.66 V
(2) LiNO3 (4) +1.66 V
Conc. HI
(3) KNO3 147. A + B → Anisole ∆
→ P + Q.
(4) Mg ( NO3 ) 2 A,B,P,Q respectively
143. Hydroformylation of propene yields (1) C6 H 5 I , CH 3ONa, C6 H 5OH , CH 3 I
an aldehyde. The aldehyde is (2) C6 H 5ONa, CH 3 I , C6 H 5 I , CH 3ONa
(1) Propanal (3) C6 H 5ONa, CH 3 I , C6 H 5OH , CH 3 I
(2) Ethanal
(4) C6 H 5 I , CH 3ONa, C6 H 5 I , CH 3ONa
(3) Butanal
i) O3
(4) Butenal A + B
ii) Zn / H2O
144. Which of the following is free radical
CH3 C=CH CH3
substitution ?
CH3 CH3 KMnO4 / H+ A + C
CH2Br
+ Br2 ∆ 148.
+ HBr
(1) ‘B’ on oxidation gives C. Identify A, B
Br and C respectively in the above
Br
+Br2 reactions
(2) (1) CH 3COCH 3 , CH 3CHO, CH 3COOH
OH
OH Br (2) CH3COOH , CH3CHO, CH3CH2COCH3
Br
+ 3Br2 + HBr (3) CH 3COOH , HCHO, CH 3COCH 3

(3) Br (4) CH 3COCH 3 , CH 3CH 2OH , CH 3CHO

Peroxide 149. Which of the following is the correct
(4) CH 3 − CH = CH 2 + HBr   →
CH 3 − CH 2 − CH 2 − Br position of the element in the long
145. The equivalent conductance at infinite form of the periodic table
dilution of Al+3 and SO4-2 ions are ‘x’ (1) Al is present in 3rd period, 13th
and ‘y’ respectively, then the group and p-block
equivalent conductance at infinite (2) La is present in 3rd group, 6th
dilution of Aluminium sulphate is period and f-block
(1) (2x + 3y) (3) Ne is present in 2nd period, 8th
(2) (x + y) group and p-block
(3) (x + 2y) /6
(4) Zn is present in 4th period, 12th
(4) (3x + 2y)
group and s-block
146. Aluminium displaces hydrogen from
150. The important ingredient in Portland
acids, but copper does not. A galvanic
cell prepared by combining copper cement with highest percentage is
and aluminium electrodes has an emf (1) Dicalcium silicate
of 2.0 V at 298K. If the potential of (2) Tricalcium aluminate
copper electrode is +0.34V, that of (3) Gypsum
aluminium electrode is (4) Tricalcium silicate

Sri Chaitanya Page 20 Educational Institutions

151. Extraction of zinc from zinc blende is CH2 CH2 Br
achieved by (2)
(1) Electrolytic reduction Br
CH3
(2) Roasting followed by reduction (3)
with carbon
CH = CH − Br
(3) Roasting followed by reduction (4)
with another metal C ( CH 3 )3
(4) Roasting followed by self-
H 3CO OH
reduction 156. The BHA is
152. Which of the following pairs can be useful in
cited as an example to illustrate the (1) increasing shelf life of butter
law of multiple proportion? (2) decreasing acidity
(1) Na2O , K2O (3) curing cancer
(2) Al2O3 , Cr2O3 (4) decreasing hypertension
(3) NaCl , NaBr 157. The ratio between t75% and t50% for a 2nd
(4) CO , CO2 order reactions is
153. Which among the following is (1) 3:1
incorrect combination? (2) 2:1
(1) [Ni(CO)4] – sp3 --- Tetrahedral (3) 1:3
(2) K4[Fe(CN)6] – sp3d – Octahedral (4) 1:2
(3) [Co(NH3)6]Cl3 –d2sp3 –Octahedral
158. False statement about Cr ( en ) 2 Cl2  Br
(4) K2[Ni(CN)4] – dsp2 – square
is
planar
(1) Cis form is optically active
154. If energy of the electron in hydrogen
(2) Trans form is optically inactive
atom in the excited state is – 3.4 eV,
(3) Cannot exhibit optical isomerism
then what will be its angular
(4) Cannot exhibit ionization
momentum
isomerism
(1) 1.83 × 10 −30 kgm 2 s −1
159. Compound C in the following reaction
(2) 2.1 × 10 −34 kgm 2 s −1
is:
−37 2 −1
(3) 9.2 × 10 kgm s 3i)CH MgBr
2 4 H SO
CH3CHO 
ii)H O → A 
∆ →
2
(4) 1.2 × 10 −32 kgm 2 s −1
− −
MnO3 /OH
B 
Cold → C
CH=CH2 + HBr X
155. The (1) CH3COOH+HCOOH
major product ‘X’ is (2) CH3CH(OH)CH2OH
CH CH3 (3) CH3CHO+HCHO
Br (4) CH3CHO+HCOOH
(1)
Sri Chaitanya Page 21 Educational Institutions
160. In the following compounds, 163. Equal volumes of two solutions with
OH pH values 8 and 10 are mixed together.
The pH of resulting solution is:
I. (1) 8.7
OH
(2) 10.3
(3) 7.3
CH3
II. (4) 9.7
OH
164. When 1litre of 1M HCl is mixed with
1 litre of 1M NaOH, the rise in
NO2
III.
OH
temperature was found to be T1. In
another experiment 2 litre of 1M
NaOH is mixed with 2 litre of 1M HCl.
NO2
IV. The rise in temperature was found to
The decreasing order of acidic strength be T2. Then
is (1) T1 = T2
(1) III > IV > I > II (2) T1 = 2 T2
(2) I > IV > III > II (3) 2 T1 = T2
(3) II > I > III > IV (4) T1 = 3T2
(4) IV > III > I > II 165. Molecular shapes of SF4, CF4 and XeF4
161. 1.2 moles of SO3 are allowed to
are
dissociate in a 1litre vessel, the reaction
(1) the same with 2, 0 and 1 lone
is

⇀ 2SO2( g ) + O2 ( g )
2SO3( g ) ↽

and
pairs of electrons respectively
the concentration of oxygen at (2) the same with 1, 1 and 1 lone
equilibrium is 0.1mol.lit-1. The total pairs of electrons respectively
number of moles at equilibrium will be (3) different with 0, 1 and 2 lone pairs
(1) 2.2 of electrons respectively
(2) 1.3 (4) different with 1, 0 and 2 lone pairs
(3) 1.8 of electrons respectively
(4) 1.0 166. 1 gram of magnesium is burnt with
162. Paramagnetic and highspin complex is 0.56grams of oxygen in a closed vessel.
+3
(1) Co ( NH 3 )  Which reactant is left in excess and
 6
−3 how much?
(2) Co ( C2O4 )3 
(1) O2 , 0.2g
−3
(3) [CoF6 ] (2) Mg , 0.16g
−3
(4) Co ( CN )6  (3) Mg , 0.24g
(4) O2 , 0.3g
Sri Chaitanya Page 22 Educational Institutions
167. Helium atom is two times heavier than O
||
i)CH3 NH
2 /conc.H 2SO4
a hydrogen molecules. At 298 K the 170. H3C− C H−C− CH3 
(ii)LiAIH →
| 4

average kinetic energy of helium is CH3

(1) Two times that of hydrogen Identify product of this reaction
molecule
O
(2) The same as that of hydrogen
molecule N
(3) Four times that of hydrogen
molecule OH
(1)
(4) Half that of hydrogen molecule
168.

I II
O N CH3
a) glass reinforcing (2)
I. Bakelite
safety helmets H
II. Acrilan b) substitute to wool N CH3
c) electric switches and
III. Buna-S
handles to utensils (3)

IV. Dacron d) footwear, floor tiles

NH2
Correct match is

(1) I-c, II-b, III-d, IV-a (4) OH

(2) I-a, II-b, III-c, IV-d 171. Stability order of carbanion
(3) I-d, II-a, III-c, IV-b
Ph − C − CH 3
(4) I-b, II-a, III-c, IV-d |
CH3
A.
169. The solubility product, Ksp of Ag2CrO4

is 3.2 × 10-11M3 at 298K. Then the Ph − CH − CH 3

B.
solubility of Ag2CrO4 at same

temperature is Ph −C H 2
C.
(1) 4 × 10-3
(1) C>B>A
(2) 3.2 × 10-11
(2) B>A>C
(3) 2 × 10-4
(3) B>C>A
(4) 8.4 × 10-4
(4) A>C>B

Sri Chaitanya Page 23 Educational Institutions

172. For which one of the following (2) F2 + 2KCl → Cl2 + 2KF
equations is ∆H º reaction equal to ∆H º f (3) Br2 + 2KCl → Cl2 + 2KBr
for the product (4) Br2 + 2KI → I2 + 2KBr

(1) CH 4 ( g ) + 2Cl2 ( g ) 
→ CH 3OH ( l ) 177. False statement is
(1) Esterification involves is O-H
(2) Xe ( g ) + 2 F2 ( g ) 
→ XeF4 ( g )
cleavage of alcohols
(3) N 2 ( g ) + O3 ( g ) 
→ N 2O3 ( g ) (2) Ethyl alcohol gives immediate
(4) 2CO ( g ) + O2 ( g ) 
→ 2CO2 ( g ) turbidity with Lucas reagent

173. Consider the following reaction (3) Alcohols act like nucleophiles

occurring in an automobile (4) Protonated alcohols act like

electrophiles
2C8 H18 ( g ) + 25O2 ( g ) 
→
178. In which among the following
16CO2 ( g ) + 18 H 2O ( g )
oxidation state of central metal atom is
Signs of ∆H , ∆S and ∆ G respectively
zero?
would be (1) K2[Ni(CN)2]
(1) + , −, + (2) Na3[CoF6]
(2) +, +, − (3) [Cu(NH3)4]SO4
(3) −, + , − (4) [Fe(CO)5]
(4) −, +, + 179. Which of the following is not isolated
174. The number of sigma and pi bonds in but detected by radioactive tracer
hydrogen cyanide molecule is equal to techniques
that of ......... molecule (1) XeF2
(1) C2 H 2 (2) KrF2
(2) C2H4 (3) RnF2
(3) CO2 (4) XeO3
(4) N2 180. Statement – I : Fructose reduces
175. Which of the following cannot Tollen's reagent.
undergo disproportionation Statement –II : In presence of dilute
(1) HNO2 alkaline solution, fructose undergoes
(2) H3PO3 rearrangement to form glucose and
(3) Se2Cl2 mannose.
(4) H2S2O8 (1) Both I and II are true
176. Which among the following reaction (2) Both I and II are false
does not take place? (3) I is true but II is false
(1) Cl2 + 2KI → I2 + 2KCl (4) I is false but II is true
Sri Chaitanya Page 24 Educational Institutions