Mapua Institute of Technology Introduction to Bioelectronics and Bioinformation Engineering

School of Chemical Engineering and Chemistry DNA TECHNOLOGY AND GENOMICS

DNA Technology Examples of Some Restriction Endonucleases

- DNA tools that allow gene cloning for basic No. of
research and for commercial application. RE Source Target size Base Products
- provides detailed knowledge of the genomes of pairs
GAATTC 4-base-long
humans and other organisms. Eco RI E. coli R13 6
sticky ends
CTTAAG
- provide methods for making recombinant DNA. Haemophilus GCGC 2-base-long
- applied in many fields such as agriculture, Hha I 4
haemolyticus CGCG sticky ends
medicine, criminal law, etc. Serretia CCCGGG
Sma I 6 Blunt ends
marcescens GGGCCC
Recombinant DNA Haemophilus GGCC
Hae III 4 Blunt ends
aegyptius CCGG
- is DNA in which genes from different sources –
often different species- are combined in vitro into
Restriction enzyme cleavage of a sugar-phosphate
the same molecule.
backbone can produce double-stranded DNA
- sequence comprising DNA from different sources
fragment with either blunt or staggered ends.
that have been joined together.
Blunt ends – when both strands of the molecule are
cut at the same position that leaves no unpaired
DNA (Gene) Cloning
nucleotides.
1. Isolation of plasmid DNA from bacteria and
Staggered or “Sticky” ends – when each strand of
DNA carrying a gene of interest from cells of
the molecules is cut at different position so that one
another organism (e.g. animal).
strand (either 5’ or 3’) overhangs by several
2. A piece of DNA containing the gene is inserted
nucleotides, these single-stranded ends can be
into a plasmid, producing recombinant DNA
spontaneously base pair with each other –that is,
3. Recombinant plasmid is returned to a bacterial
they are sticky or cohesive.
cell.
4. This cell is then grown in culture, forming a 2. DNA ligase
clone of cells. The foreign DNA spliced into the - is the “glue’ that joins two DNA molecules.
plasmid is replicated with the rest of the plasmid - joins DNA fragments that have complimentary
as the host cell multiplies. In this way, the gene sticky ends or blunt ends; catalyzes formation of
of interest is “cloned”. covalent bonds between the sugar and phosphate
5. Identification of the bacterial clone carrying the of the adjacent nucleotides, requiring only that
gene of interest. one nucleotide have a free 5’-phosphate and
6. Cloned genes and proteins: adjacent one have a 3’-hydroxyl group.
 For pest resistance inserted into plants
 Gene used to alter bacteria for cleaning up
Restriction enzyme recognition
toxic waste sequence
 Basic research on genes
 Protein dissolves blood clots in heart attack 5’ GAATTC 3’
therapy DNA 3’ CTTAAG 5’
 Human growth hormone treat stunted growth
 Basic research on proteins Restriction
enzyme cuts DNA

Elements in DNA Recombination

1. Restriction endonuclease 5’ G AATTC 3’
-enzymes that cut DNA internally, each 3’ CTTAA G 5’
Sticky end
recognizes a specific short double-stranded DNA
sequence and hydrolyzes phosphodiester bonds Addition of DNA AATT C G
fragment from another G CTTAA
on both strands. source; fragments stick
-are found primarily in bacteria, where they cut, or together by base DNA fragment produced by
fragment foreign DNA of bacteriophage before pairing same enzyme
the invading DNA can replicate within the host
DNA ligase seals
cell to produce new phage that would ultimately the strands
destroy the host.
5’ G A AT T C G A A T T C 3’
-are named for the organisms from which they are 3’ C T T AA G C TT A A G 5’
isolated. Recombinant DNA molecule

utasevilla@mapua.edu.ph Page 1
Mapua Institute of Technology Introduction to Bioelectronics and Bioinformation Engineering
School of Chemical Engineering and Chemistry
Cell Transformation
-introduction of new DNAs into organisms or to a
host for gene cloning.
Methods of DNA/gene transfer (transfection):
 Electroporation – protoplasts of host organism are
exposed to a brief electrical pulse, which is
thought to introduce transient openings in the cell
membrane through which DNA molecule enters.
 Microprojectile bombardment or biolistics – very
small (4μm) microprojectiles made of gold or
tungsten are coated with DNA and is shot at high
velocity from a particle gun into cells or tissues.
 Microinjection – for multicellular animals, DNA is
injected directly into the nucleus of animal with an
extremely fine pipette. After the DNA is
transferred into the cell, it is integrated into the
chromosome, and the transformed fertilized egg
is implanted into an animal for completion of
development.
Genes can be cloned in recombinant DNA vectors.
Cloning vectors
- a DNA molecule that can carry foreign DNA into a
cell and replicate there.
- must have:
 have an origin of replication so that the DNA
can be replicated within a host cell
 small enough to be isolated without undergoing
degradation during purification
 have several unique restriction sites for cloning
a DNA fragment so that the vector will cut only
once
 have selectable markers for determining
whether cloning vehicle has been transferred
into cells and to indicate whether the foreign
DNA has been inserted into the vector.
Bacterial Vectors
a. Plasmids
- circular double strands of DNAs that are
extrachromosomal.
Cloning Eukaryotic Gene in a Bacterial Plasmid
Ex: E. coli and human DNA
1. Isolation of vector and gene-source DNA
- DNA containing gene of interest obtained
from human tissue culture and plasmid from
R are packaged into viral particles in a test tube.
E. coli carrying two genes (amp – resistance
to ampicillin and lacZ – encoding enzyme β-
galactosidase). Plasmid has a single
recognition sequence that lies within lacZ.
utasevilla@mapua.edu.ph
DNA TECHNOLOGY AND GENOMICS
2. Insertion of DNA into the vector
- Vector and human DNAs are cut by same
restriction enzymes creating compatible sticky
ends. DNA fragments are mixed with clipped
plasmids. The sticky ends of plasmid base-pair
with the complimentary sticky ends of the
human DNA fragment. DNA ligase joins the
DNA molecule by covalent bonds.
3. Introduction of the cloning vector into cells
- by cell transformation (transfection)
4. Cloning of cells
- culturing of transformed bacteria on solid
nutrient medium containing ampicillin and a
sugar X-gal.
5. Identification of cell clones carrying gene of
interest
Nucleic acid hybridization
-process in which complimentary single strands
of desired gene form hydrogen bond with
nucleic acid probe that is labeled by radioactive
isotope or fluorescent tag.
Denaturation of the cells
-separation of the two strands by heat or
chemicals.
Once cell clones are identified, they are grown in
liquid culture in a large tank and then easily isolate
large amounts of the gene.
b. Bacteriophage
- a virus that infects a bacterium. Recombinant
DNA containing viral DNA and DNA of interest
Host bacterial cells are infected with
recombinant phage DNA, the DNA replicates
within the host cells, and progeny phage are
produced when the host cell undergoes lysis.
Page 2
Mapua Institute of Technology Introduction to Bioelectronics and Bioinformation Engineering
School of Chemical Engineering and Chemistry DNA TECHNOLOGY AND GENOMICS

c. Cosmids Cloning and expressing eukaryotic genes in

- engineered hybrids of phage DNA and plasmids
that are used for large DNA fragments.
d. Other Vectors
 Yeast Artificial Chromosomes
-useful for eukaryotic molecular studies and for
large DNA fragments.
 Plant Cloning Vectors
- commonly used are plant viruses: Tobacco
mosaic virus and Ti plasmid (Agrobacterium
tumefaciens).
prokaryotic setting is difficult:
 Different promoter and DNA control sequence
 Eukaryotic genes contain long noncoding regions
(introns)
Expression vector
-a cloning vector that contains the requisite
prokaryotic promoter just upstream of a restriction
site where the eukaryotic gene can be inserted. The
bacterial host cell will then recognize the promoter
and proceed to express the foreign gene that has
been linked to it.

T-DNA
Foreign gene T-DNA with Complimentary DNA (cDNA)
inserted into inserted gene -DNA that carries the complete coding sequence for
Ti plasmid
Ti a gene but no introns.
Plasmid Recombinant Making a cDNA:
Ti plasmid  Fully processes mRNA (introns removed)
extracted from eukaryotic cell nucleus.
 Addition of reverse transcriptase to synthesize
Agrobacterium tumefaciens
DNA from RNA.
Agrobacterium
tumefaciens is  DNA polymerase is used to synthesize a second
transformed DNA strand.
with Result is cDNA, which carries the complete
recombinant Ti coding sequence of the gene but no introns.
Recombinant
plasmid
Ti plasmid
Cloned genes are stored in DNA libraries.
Thousand of different recombinant plasmids are
Leaf discs or
produced in cloning, each carrying copies of a
protoplasts are particular segment from the initial genome. These
infected with A. sets of recombinant plasmid clones are saved in
tumefaciens such a library called Genomic libraries.
Genomic libraries:
Plasmid library
Regenerate TRANSGENIC Phage library
PLANT cDNA library
T-DNA with inserted gene is incorporated Screening library
into host genome Expression library

Polymerase Chain Reaction (PCR)

 Mammalian Cell Vectors
-many animal proteins can be produced only in
eukaryotic hosts.
-First eukaryote-infecting virus used for cloning
was Simian virus 40 or SV40, a small circular,
double-stranded DNA tumor virus.
-Retroviruses are single-stranded RNA viruses.
They replicate using reverse transcriptase to
make a double-stranded DNA from RNA
template.
-Adenovirus is a double-stranded DNA virus
suited as vectors for gene therapy.
-a technique by which any piece of DNA can be
quickly amplified without using cells.
1. Double-stranded DNA sample is unwound by
heating to 92-94ºC. The single strands will serve as
templates for reaction.
2. Short nucleotide sequences are mixed with the
DNA sample to base-pair.
3. The mixture is cooled 42-55ºC and the short
nucleotide sequences base-pair with the ends of
the template strands. These short nucleotides serve
as primers.
4. DNA molecules in the mixture become doubled.
5. The mixture is heated again which cause
unwinding of the double-strands and the cycle
repeats producing new DNA strands.

utasevilla@mapua.edu.ph Page 3
Mapua Institute of Technology
School of Chemical Engineering and Chemistry
*A special DNA polymerase is used: Taq
polymerase isolated from Thermus aquaticus, a
thermophilic bacterium.
PCR is used to:
1. Rapidly isolate specific sequences for further
analysis or for cloning
2. Identify specific genetic loci for diagnostic or
medical purposes
3. Generate DNA fingerprints to determine genetic
relationships or to establish identity in forensics
4. Rapidly sequence DNA
DNA ANALYSIS and GENOMICS
Gel Electrophoresis
- technique used to separate macromolecules
(nucleic acids or proteins) on the basis of size,
electrical charge, and other physical properties. It
sorts a mixture of DNA molecules into bands, each
consisting of DNA molecules of the same length.
To make agarose gel: a powder of purified agar is
mixed with buffer, boiled and poured into mold
where the gel solidifies into a slab.
1. Samples containing mixture of DNA molecule are
placed in wells near one end of a thin slab of
polymeric gel. The gel is supported by glass
plates and bathed in an aqueous solution.
Electrodes are attached to both ends, and voltage
is applied.
2. The DNA molecules, which are negatively
charged, migrate towards the positive electrode.
A molecule’s rate of movement is determined
mostly by its length. Longer molecules travel
more slowly through the gel.
3. When the current is turned off, the DNA
molecules in each sample are arrayed in bands
along a “lane” according to their size. The
shortest molecules, having traveled the farthest,
are in bands at the bottom of the gel.
Ethidium bromide is added in the gel to make the
DNA bands visible. Ethidium bromide intercalates
between bases causing the DNA to fluoresce
orange when the gel is illuminated with UV light.
Southern Blot Hybridization
-is a method of transferring denatured DNA from an
agarose gel after gel electrophoresis to a
membrane for hybridization to detect specific
sequences.
-is used to identify specific gene fragment from
many DNA bands on the gel.
utasevilla@mapua.edu.ph
Introduction to Bioelectronics and Bioinformation Engineering
DNA TECHNOLOGY AND GENOMICS
Steps:
1. DNA fragments are denatured by an alkaline
buffer and the single strands are transferred to a
nylon or nitrocellulose membrane cut to the size
of the agarose gel.
2. A sandwich is made. The membrane is placed on
the gel and paper towels are stacked on top of
the membrane.
3. Buffer in a trough moves by capillary action
through a wick placed under the agarose slab
which facilitates the transfer of DNA from the gel
to the membrane. The membrane is a replica of
the agarose gel and is used in hybridization.
4. Radioactive probe is added. If a probe hybridizes
to fragments on the membrane, photographic
films placed next to the membrane will be
exposed where the probe has hybridized to a
specific DNA band/s.
Restriction Fragment Length Polymorphism
- DNA sequence on homologous chromosomes
that result in different restriction fragment
patterns.
- RFLPs can be detected and analyzed by
Southern blotting.
RFLPs are used to generate individual DNA
“fingerprints”.
DNA fingerprinting is a method in identifying
individual DNA banding patterns derived from
RFLPs and is a powerful tool used in forensic
analysis.
Similar blotting and hybridization methods:
Northern Blotting – used to probe RNA molecules
separated by denaturing agarose gel
electrophoresis. It is useful for identifying isolated
RNAs and for studying the expression of specific
genes.
Western Blotting – method to transfer
electrophoretically separated proteins to a
membrane for antibody binding to detect specific
proteins.
DNA Sequencing
Sanger Method - (Frederick Sanger)
Steps:
1. Preparation of one of the strands of the DNA
fragment is divided into four portions, and each
portion is incubated with all the ingredients
needed for the synthesis of complementary
strands: a labeled primer, DNA polymerase and
four dideoxyribonucleoside triphosphates. In
addition, each reaction mixture contains a
Page 4
Mapua Institute of Technology Introduction to Bioelectronics and Bioinformation Engineering
School of Chemical Engineering and Chemistry DNA TECHNOLOGY AND GENOMICS

different one of the four nucleotides in the

G tube A tube T tube C tube
modified, dideoxy form. 3’
2. Synthesis of the new strands start at the primer A
and continues until a dideoxyribonucleotide is A
incorporated, which prevents further synthesis. A G
G
dideoxynucleotide is inserted every so often, at C
random, instead of its normal equivalent. T
Eventually, a set of labeled strands of various T
lengths is generated. A
G
3. The new DNA strands in each reaction mixture G
are separated by electrophoresis on a C
polyacrilamide gel, which can separate strands C
differing by as little as one nucleotide in length. C
5’
Autoradiography is then used to detect
radioactive bands. Autoradiogram of a sequencing gel showing the bands that are
4. The sequence of the newly synthesized strands read to obtain the sequence.
can be read directly from the bands in the
autoradiograph, and from that the sequence of
the original template strand is deduced. PROTEIN METHODS
Protein Gel Electrophoresis
Example: -used to separate proteins by size and charge.
DNA template to be sequenced: Proteins are separated either one or two-
3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’ dimensional polyacrylamide gel electrophoresis.
Proteins are visualized by a dye that binds to the
The sequencing primer is annealed to the denatured proteins in the gel, or by radiolabeling and
template to initiate DNA sequencing: autoradiography.
3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’
5’ CCCGGATTCGG 3’
 Proteins are separated by charge in a slender
tube gel (a pH gradient is established in the gel)
Deoxiribonucleotides used:
in a process called isoelectric fusing.
dCTP, dATP, dGTP, dTTP
 Tube then is placed horizontally along the top
Dideoxyribonucleotide used to terminate DNA vertical slab gel and proteins are electrophoresed
sequencing in the “A” tube: out of the tube and into the gel, which separates
O O O them by size.
-O P O P O P O adenine  Detergent sodium dodecyl sulfate (SDS) that is
O
O- O- O- used in the second dimension binds to the
hydrophobic regions of the proteins, giving
H H proteins an overall negative charge. Thus the
Sequencing reaction in the tube (A* indicates sequencing proteins resolved by difference in size rather than
that was terminated by a ddATP): charge.
3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’  Proteins appear as visible spots rather than
5’ CCCGGATTCGGA* bands in the two-dimensional separation.
3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’
5’ CCCGGATTCGGAA*

3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’
5’ CCCGGATTCGGAATTTGA*
3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’
5’ CCCGGATTCGGAATTTGACTTCCA*

3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’
5’ CCCGGATTCGGAATTTGACTTCCAA*
Reference:

3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’ Campbell, N. and Reece, J., BIOLOGY 6

th
ed.
5’ CCCGGATTCGGAATTTCACTTCCAATA*
Benjamin Cummings, 2002
3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’
5’ CCCGGATTCGGAATTTGACTTCCAATACGGGGA* Barnum, S. BIOTECHNOLOGY, An Introduction.
3’ GGGCCTAAGCCTTAAACTGAAGGTTATGCCCCTTAGCC 5’ Wadsworth Publishing Co., 1998
5’ CCCGGATTCGGAATTTGACTTCCAATACGGGGAA*

utasevilla@mapua.edu.ph Page 5
Mapua Institute of Technology Introduction to Bioelectronics and Bioinformation Engineering
School of Chemical Engineering and Chemistry DNA TECHNOLOGY AND GENOMICS

utasevilla@mapua.edu.ph Page 6
Mapua Institute of Technology Introduction to Bioelectronics and Bioinformation Engineering
School of Chemical Engineering and Chemistry DNA TECHNOLOGY AND GENOMICS

Southern Blot Hybridization

DNA SEQUENCING

utasevilla@mapua.edu.ph Page 7