Anal Bioanal Chem (2014) 406:1163–1172
DOI 10.1007/s00216-013-7314-2
RESEARCH PAPER
Electrochemical transduction of DNA hybridization
at modified electrodes by using an electroactive
pyridoacridone intercalator
Laurent Bouffier & Bingquan Stuart Wang & André Roget &
Thierry Livache & Martine Demeunynck & Pascal Mailley
Received: 10 April 2013 / Revised: 9 August 2013 / Accepted: 15 August 2013 / Published online: 12 September 2013
# Springer-Verlag Berlin Heidelberg 2013
Abstract A synthetic redox probe structurally related to natural
pyridoacridones was designed and electrochemically
characterised. These heterocycles behave as DNA intercalators
due to their extended planar structure that promotes stacking in
between nucleic acid base pairs. Electrochemical characteriza-
tion by cyclic voltammetry revealed a quasi-reversible electro-
chemical behaviour occurring at a mild negative potential in
aqueous solution. The study of the mechanism showed that the
iminoquinone redox moiety acts similarly to quinone involving
a two-electron reduction coupled with proton transfer. The easily
accessible potential region with respect to aqueous electro-
inactive window makes the pyridoacridone ring suitable for
the indirect electrochemical detection of chemically unlabelled
DNA. Its usefulness as electrochemical hybridization indicator
Published in the special issue Analytical Science in France with guest
editors Christian Rolando and Philippe Garrigues.
L. Bouffier
Univ. Bordeaux, ISM, UMR 5255, 33400 Talence, France
L. Bouffier (*)
CNRS, ISM, UMR 5255, 33400 Talence, France
e-mail: laurent.bouffier@enscbp.fr
B. S. Wang : A. Roget : T. Livache : P. Mailley
CREAB/SI3M/DRFMC, UMR 5819, CEA Grenoble,
17 Avenue des Martyrs, 38054 Grenoble cedex 9, France
B. S. Wang
Genzyme Corporation, 49 New York Avenue, Framingham,
MA 01701, USA
M. Demeunynck
Department of Pharmacomolecular Chemistry,
UMR 5063 & FR 2607 CNRS/Joseph Fourier University, BP 53,
38041 Grenoble cedex 9, France
P. Mailley
Laboratory of Electricity Storage, LSE/DTS, CEA,
50 Avenue du Lac Leman, 73377 Le Bourget du Lac cedex, France
was assessed on immobilised DNA and compared to doxorubi-
cin. The voltamperometric response of the intercalator acts as an
indicator of the presence of double-stranded DNA at the elec-
trode surface and allows the selective transduction of
immobilised oligonucleotide hybridization at both macro- and
microscale electrodes.
Keywords DNA hybridization . Redox intercalator .
Pyridoacridone . Doxorubicin . DNA microsensor
Introduction
The development of DNA biosensors for the detection of
DNA hybridization has been an expanding field of research
since decades motivated by constant needs for medical diag-
nosis and biochemical assays. Various analytical approaches
including optics or spectroscopy [1–3] are generally used to
transduce hybridization events, but electrochemistry is very
often considered as a convenient alternative technique. Elec-
trochemical detection of DNA hybridization has been recently
well reviewed [4–8]. The success of electrochemical transduc-
tion comes from intrinsic advantages including sensitivity,
experimental simplicity or ease of integration. Moreover, a
range of techniques can be employed with typical examples
being linear sweep voltammetry, pulse techniques and alter-
nating current (AC) voltammetry. Thereby, DNA hybridiza-
tion detection may be performed directly through guanosine
electro-oxidation or indirectly via heterogeneous electron
transfer with an electroactive probe or labelling with a redox
tag [9]. More recent approaches are also taking advantage of
label-free signal processing using AC impedance spectrosco-
py [10–12], photocurrent spectroscopy [13] or electrochemi-
cal response of electronic conductive or electroactive polymer
matrices [14, 15]. In order to amplify the detected signal and
improve therefore the limits of detection, a number of works
1164
focused on enzymatic [16–18] or metal nanoparticle [19, 20]
labelling. However, such labels necessitate additional chemi-
cal steps and are time consuming and potentially expensive.
Another attractive route of DNA labelling, which does not
require any chemical derivatization of the DNA complemen-
tary strand, involves the use of small molecules interacting
directly and selectively with the duplex, namely DNA
intercalators. These natural or synthetic compounds were first
studied as drugs for potential anticancer applications but are
now also considered as interesting tools for DNA detection
especially when they are redox active [21, 22].
The chemical structure of DNA intercalators may be either
fully organic or organometallic (transition metal complexes con-
taining an intercalating ligand). There are also examples of
aromatic structures combining intercalation between base pairs
with electrostatic interaction within the grooves. In that context,
we describe in this contribution the electrochemical properties of
an intercalator combining a planar pyridoacridone skeleton
(pyrido[4,3,2-kl]acridin-4-one) and a functional aliphatic chain
bearing a terminal amine group in order to improve the solubility.
We have previously reported the synthesis of such compounds
[23, 24] and a full study of their physical chemistry and bio-
chemical properties [25, 26]. These pyridoacridones are struc-
turally related to a large family of bioactive alkaloids [27–30],
but natural analogues were not reported to exhibit reversible
aqueous electroactivity. The tetracyclic chromophore contains a
quinone-imine function and has been previously reported as a
promising redox-active intercalator in a proof of principle hy-
bridization assay [31]. Here, we are describing further develop-
ments of a DNA biosensor exploiting this pyridoacridone, fo-
cusing particularly on the comparison with doxorubicin which
has been commonly used in the field. Moreover, the biosensor
configuration is optimised and also scales down from a macro-
scopic modified electrode to a microelectrode array.
Experimental section
Chemicals and reagents
Electrochemical assessment in organic media was made in
acetonitrile (Acros) containing 0.1 M triethylammonium
phosphate (TEAP, Fluka). All electrochemical measurements
in aqueous media were made in 0.1 M phosphate buffer (PB)
solutions prepared with Na2HPO4 and NaH2PO4 (Aldrich)
Fig. 1 Functionalisation of
pyridoacridone (1) by
regioselective nucleophilic
addition of 3-(dimethylamino)-1-
propylamine (DMAPA) to afford
conjugate (2) and structure of
doxorubicin (3)
L. Bouffier et al.
except electropolymerisation procedures which were carried
out in 0.1 M LiClO4 (Fluka) solutions. Pyrrole monomer was
purchased from Acros. Both double-stranded (ds-) and single-
stranded (ss-) calf thymus DNA were purchased from Sigma.
All chemicals were of the highest purity available and were
used without further purification. The synthesis of compound
(2) has been described elsewhere [23] and is illustrated in
Fig. 1. Oligonucleotides (ODN) have been synthesized using
specific reagents (PerkinElmer) on a DNA synthesizer (model
381A from Applied Biosystems). The 40-mer ODN probe (5′-
Py(T5)AGAGTGCCTTGACGATACAGCTAATTCAGAA
TCATTTTGT-3′) corresponds to a point mutation of k-ras
proto-oncogene. The fully complementary ODN target (40c)
is also 40-mer long and has the following sequence: 5′-biotin-
ACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCA
CTCT-3′. A non-complementary target (20nc) for negative
control purpose is a 20-mer ODN with the following se-
quence: 5′-biotin-GGGCAGGACCGGGCAGGACC-3′.
Electrochemical experiments
Electrochemical experiments in organic media were made in a
glove box using a one-compartment electrochemical cell con-
taining a Pt working electrode (Ø =5 mm), a Pt counter electrode
and a double-junction Ag/Ag+ reference electrode. Electrochem-
ical experiments were performed with a computer-controlled
PAR 273 EGG potentiostat from Princeton Applied Research.
Electrochemical characterization of 2 in aqueous media was
made in a one-compartment cell using a Pt working electrode
(Ø =5 mm), a Pt wire as counter electrode and a KCl-saturated
Ag/AgCl reference electrode. DNA hybridization electrochem-
ical detections on biochips were made on API T8 microelectrode
array provided by bioMérieux (France). This API T8 biochip is
an array of eight individually addressable gold disc electrodes
(Ø =150 μm) printed on a PCB card. Differential pulse
voltammetry (DPV) parameters are 30 mV pulse amplitude
and 50 ms pulse width. For hybridization detection, the modified
electrode was stabilised during 30 s at a potential value of −0.45
vs. Ag/AgCl, and the DPV was recorded by scanning the
potential anodically from −0.45 to 0.20 V vs. Ag/AgCl.
Biosensor preparation
Calf thymus DNA adsorption was performed onto polypyrrole-
modified Pt electrodes obtained by cycling the potential
Electrochemical transduction of DNA hybridization 1165

between −0.35 and 0.70 V vs. Ag/AgCl three times in 20 mM
pyrrole 0.1 M LiClO4 aqueous solution at a scan rate of 20 mV
s−1. Then the adsorption was continued by applying a potential
of 0.50 V vs. Ag/AgCl during 8 min in 0.1 M PB (pH 7)
containing 1 nM of DNA. Films of copolymers were deposited
on a Pt macroelectrode by scanning the electrode potential
between −0.30 and 0.70 V vs. Ag/AgCl at a scan rate of
20 mV s−1 in a mixture of 25 mM pyrrole monomer and 5 μM
of ODN-functionalised pyrrole with 0.1 M LiClO4 supporting
electrolyte. Copolymer films were deposited on API-T8 gold
electrodes using a previously reported electrospotting methodol-
ogy [32] from solutions containing the same concentrations of
pyrrole (25 mM) and pyrrole-ODN (5 μM). In such a case, the
electrodeposition electrolyte contains 50 mM PB pH 7.4, 50 mM
NaCl and 10 wt% glycerol. It is noteworthy that a series of
modified electrodes were prepared independently to allow con-
sistent and reproducible DNA transduction experiments.
Hybridization, intercalation and denaturation procedures
Hybridization was carried out by immersing the ODN-
modified electrodes in PB (pH 7.4) containing 200 nM of
ODN targets. The hybridization step lasted for 20 min at room
temperature. After that, the electrode was washed three times
with PB. Intercalations of pyridoacridone 2 and doxorubicin
were performed by immersion of the obtained modified elec-
trode in stirred 0.1 M PB (pH 7) solutions containing 125 μM
of intercalator during 90 min. Denaturation was performed by
washing the modified electrodes for 30 s in 0.1 M NaOH,
distilled water and PB, respectively.
Fluorescence microscopy experiment
Fluorescence microscopy images were recorded for 1 s with
an epifluorescence microscope (BX 60, Olympus) equipped
with a Peltier cooled CCD camera (Hamamatsu) and an image
analysis software (Imagepro plus, Media Cybernetics) using
streptavidin–phycoerythrin conjugate (Molecular Probe) as
fluorescent probe. Briefly, the ODN target was labelled with
a biotin to enable streptavidin-specific recognition. The typi-
cal procedure is described elsewhere [33].
Results and discussion
The electrochemical behaviour of 2 in aqueous and organic
media was studied by cyclic voltammetry (CV) at platinum
electrode. Figure 2 gathers the voltamperometric responses of
2 in deaerated phosphate buffer, for pH values ranging be-
tween 5 and 8 (Fig. 2A), and in deaerated acetonitrile (Fig. 2C,
inset), as well as the dependence of peak current with the
square root of the scan rate at pH 7 in aqueous media (Fig. 2B,
inset).
In acetonitrile, the electrochemical reduction of 2 (Fig. 2C)
occurs through two successive quasi-reversible electron trans-
fers centred at half-wave potentials of −0.830 and −1.360 V
vs. Ag/Ag+, respectively. The electrochemistry of such
pyridoacridone in aprotic solvent has not been reported so
far in the literature. Nevertheless, such behaviour was previ-
ously observed for a structurally related iminoquinone [34]
and was attributed to the para -iminoquinone ring of the

Fig. 2 Cyclic voltammograms of

2 (1 mM) in deaerated 0.1 M pH
5, 6, 7 and 8 phosphate buffer
solutions (PBS) at platinum
electrode for a scan rate of
100 mV s−1 (A). The potential of
the CV was swept from 0 (start
potential) to −400 mV (first
vertex) to +400 mV (second
vertex) and to 0 mV (end
potential). Electrochemical
response of 2 (1 mM) in
acetonitrile containing 0.1 M
TEAP at platinum electrode for a
scan rate of 50 mV s−1 (C, inset).
Dependency of Ipeak (anodic and
cathodic) with the square root
of the scan rate in the range
25–200mVs−1 (B, inset) for a pH
7 buffered solution containing
1 mM of 2
1166
diplamide molecule by comparison to quinone systems.
Therefore, each redox system was attributed to a mono-
electronic exchange from the iminoquinone to the
semiquinone radical and the dianion. This redox process was
confirmed chronocoulometrically by the authors. However,
contrary to the herein described derivative 2, which displays
fully reversible reductions, the authors observed reversibility
only over the first reduction process. In contrast to aprotic
conditions, the CVs of 2 in pH 5 to 8 buffered aqueous
solutions exhibit only one quasi-reversible redox wave
(Fig. 2A) in the water electrochemical window as already
observed for a naturally occurring pyridoacridine [35]. The
peak separation between cathodic and anodic peaks is about
60 mV over the range of tested pH and was attributed to a
transfer of two electrons and two protons. This change in
electrochemical behaviour from aprotic to protic conditions
is known for quinone and related to the instability of the
radical anion intermediate. The CV half-wave potentials are
pH dependant taking values of −300, −230, −170 and
−110 mV vs. Ag/AgCl for pH of 8, 7, 6 and 5, respectively.
The displacement of E 1/2 toward cathodic potentials following
a slope of 60 mV per pH unit demonstrates the concomitant
contribution of two protons to the redox mechanism. Howev-
er, it is noteworthy that the current response of 2 decreases
slightly when increasing pH from 5 to 7 and is dramatically
lowered at pH 8. The latter comportment could be related to
the deprotonation of the pyridoacridone salt at pH 8, since the
pK a of this molecule was measured to 7.0, which led to
pyridoacridone precipitation and aggregation due to intrinsic
lack of solubility. Nevertheless, further works are currently
underway to investigate more in depth the electrochemical
behaviour of 2 and of other molecules issued from the same
family of compounds, especially in the context of proton-
coupled electron transfer [36]. Otherwise, Fig. 2B confirms
a linear dependence of i peak with the square root of the scan
rate, thus indicating a diffusion control process of the redox
behaviour of 2 at pH 7. Please, note that this was also
observed for all pH levels included within this study. In
summary, the voltamperometric characterisation has demon-
strated the electrochemical reversibility of 2 and has also
shown that its redox potential value lies within the electro-
chemical stability window of DNA. The aforementioned
properties made 2 an attractive candidate for DNA hybridiza-
tion biosensors since 2 may allow the hybridization detection
without DNA degradation and thereby signals perturbation
due to the intrinsic redox activity of the duplex bases.
In order to qualitatively verify the effectiveness of the
interaction between 2 and DNA, we have recorded the evo-
lution of the electrochemical response of the intercalator in
solution after consecutive additions of double-stranded calf
thymus DNA (ds-DNA) on independently prepared modified
electrodes. Figure 3A shows the CV responses of 2 (125 μM),
recorded in aerated phosphate buffer solution (PBS, 0.1 M, pH
L. Bouffier et al.
7) prior to the addition of ds-DNA (0.5 g mL−1, i.e. 40 nM)
and after 2, 4, 12 and 16 min of incubation. The initial
voltamperometric response clearly shows the characteristic
signal assigned to redox probe 2. Then, the amplitude of the
redox wave rapidly decreases following additions of ds-DNA
and ultimately disappears after 16 min of incubation. Such
behaviour is related to the interaction of 2 with the duplex that
generates a decrease in free intercalator concentration and
therefore limits the quantity of electroactive species available
to diffuse at the surface of the electrode. It is noteworthy that
this off signal has been used by others to electrochemically
monitor polymerase chain reaction (PCR) amplification [37].
However, at pH 7, due to the protonation of the acridine
moiety and the amine chain, 2 is polycationic and may also
interact non-specifically through purely electrostatic interac-
tions with DNA phosphate backbone. To assess the selectivity
of the interaction process through intercalation, the same
experiment was accomplished by addition of single-stranded
calf thymus DNA (ss-DNA) instead of ds-DNA. Figure 3B
displays the voltamperometric response of 2 following inter-
action with ss-DNA (0.5 g mL−1, i.e. 30 nM) after 25 min of
incubation. As observed for the addition of ds-DNA, the
current amplitude is significantly lowered compare to the
value recorded in DNA-free solution (Fig. 3A) thus demon-
strating the existence of non-specific interactions between 2
and ss-DNA. On the other hand, it is important to notice that
extended incubation duration does not provoke any further
depletion of the current response of 2 thus demonstrating a
fast completion of the non-specific interaction process. Such
interactions may be due to electrostatic interactions of the
cationic polyamine chain with DNA phosphate backbone, as
already mentioned, or/and to π stacking with the unmatched
guanine residues of the ss-DNA [38]. Moreover, it should be
mentioned that calf thymus ss-DNA sample may also poten-
tially contain hybridized DNA fragments (from Sigma
datasheets, ss-DNA contains at least 65 % of single strand)
that may participate to partial intercalation process. Neverthe-
less, Fig. 3B demonstrates the selectivity of the interactions,
e.g. intercalation, between ds-DNA and the redox intercalator
when comparing the current values. Thereby, 2 could be used
to electrochemically label the hybridization state of adsorbed
calf thymus DNA in order to demonstrate an indirect DNA
detection methodology.
However, the electrochemical response of 2 may be
inhibited by a lack of accessibility consecutive to the interac-
tion with the duplex. Since DNA adsorption onto bare plati-
num or glassy carbon electrodes is rather weak, another im-
mobilisation strategy consists in adsorbing more firmly DNA
at polypyrrole (Ppy)-modified platinum electrodes. In fact,
DNA is well known to strongly adsorb on oxidised Ppy films
[39]. Then, a platinum electrode was electrochemically mod-
ified by electrogeneration of a thin homogenous film of Ppy
obtained by CV (200 mC cm−2). DNA adsorption was
Electrochemical transduction of DNA hybridization
Fig. 3 Cyclic voltammograms of
2 (125 μM) in absence (solid
line) and in presence of ds-DNA
(0.5 mg mL−1, dotted lines) for 2,
4, 12 and 16 min, respectively
(A), recorded in 0.1 M PBS (pH
7). Comparison of the CV
response with ds-DNA
(0.5 mg mL−1, dotted line) and ss-
DNA (0.5 mg mL−1, solid line)
for 16 and 25 min, respectively
(B, inset)
performed by dipping the obtained electrode when polarised
at a potential of 0.5 V vs. Ag/AgCl, in solutions of calf thymus
ds-DNA or ss-DNA. Moreover, since we expect to build up
DNA sensors made of ODN-functionalised polypyrrole films,
this preliminary experiment will provide an insight on Ppy
role toward signal processing. The voltammograms of Fig. 4A
were obtained in PB media after immersion of the ds-DNA-
modified electrode in an aqueous solution containing 125 μM
of 2 during 90 min that corresponds to the time needed to
obtain completion of the intercalation process [31]. After
washing twice the modified electrodes with PB, the
voltamperometric response of this complex assembly was
recorded in pH 7 aqueous media using CV with scan rates
from 25 to 150 mV s−1. Figure 4A reveals the quasi-reversible
redox system assigned to compound 2 intercalated in between
DNA base pairs. Moreover, the peak current depends linearly
on the scan rate (Fig. 4B) thus demonstrating that 2 is
immobilised at the electrode interface presumably through
interaction with ds-DNA. We found the corresponding linear
equation: I (μA)=0.0381×scan rate (mV s−1) with a correla-
tion factor R 2 =0.994. However, as previously mentioned, 2
interacts also non-specifically with calf thymus ss-DNA and
may also be directly adsorbed onto the polypyrrole surface.
Thus, we have investigated the specificity of this response by
recording DPV and by comparison of the responses recorded
for ds-DNA/Ppy-, ss-DNA/Ppy- and Ppy-independent modi-
fied electrodes (Fig. 4C) following the intercalation proce-
dure. The recorded peak current responses were of 2.62,
0.84 and 1.21 μA, respectively. As expected, the response
associated to ds-DNA is markedly higher than the one
1167
observed in the other cases due to the specific interaction
between the duplex and 2. More surprisingly, the response
associated to ss-DNA is sensitively lower than such obtained
for an electrode only modified with Ppy. This behaviour
indicates first that 2 interacts quite strongly with Ppy presum-
ably due to hydrophobic interactions. Moreover, since the Ppy
films thus obtained are rather thick (around 900 nm for an
electropolymerisation charge of 40 mC cm−2) [13], 2 may also
penetrate the polymeric structure. Since Ppy is at its reduced
insulated states at the detection potential value, these incorpo-
rated species may play the role of electron relay through the
insulated polymer film and may be then important for the
electrochemical transduction process. Thus, it would be ben-
eficial to decrease the thickness of the film in order to achieve
better specific to non-specific signal ratio. Secondly, the lower
response obtained for the ss-DNA could be attributed to a
saturation of the surface adsorption sites with DNA strands
that reduces non-specific interactions between Ppy and 2 .
This behaviour suggests a weak non-specific interaction of 2
with ss-DNA, which may essentially originate from double-
stranded fractions of calf thymus DNA. Nevertheless, such an
experiment demonstrates the selective interaction of 2 with
ds-DNA and then supports its further application as redox
indicator in the case of electrochemical DNA chips.
Redox intercalators have been extensively used for DNA
hybridization labelling. Among the early used intercalators,
anthracyclines such as doxorubicin and daunomycin were
studied as redox markers and can be considered as model
molecules [5, 21, 22, 40, 41]. In such a context, we have
compared the electrochemical response of 2 with that of
1168
Fig. 4 Cyclic voltammograms of a ppy/ds-DNA-modified electrode
incubated with 2 (125 μM) for 90 min. Data recorded in 0.1 M PBS
(pH 7) free of 2 at scan rates from 25 to 150 mV s−1(A). Dependency of
I peak (anodic) with the scan rate (B). Differential pulse voltammetry of ds-
doxorubicin when interacting with calf thymus ds-DNA
adsorbed onto a polypyrrole functionalised electrode. The
DPV responses of 2 and doxorubicin (Fig. 5A) were recorded
following immersion of the ds-DNA/polypyrrole electrode in
buffered solutions containing 125 μM of each intercalator
during 90 min and transfer in a PBS free of intercalator. Such
intercalation duration corresponds to the kinetics of interac-
tion of 2 with ds-DNA but is also in accordance with doxo-
rubicin intercalation kinetics [42]. This duration of 1.5 h cor-
responds to the longer step in the preparation of the DNA
biosensor but cannot be shortened in order to fully complete
DNA/intercalator interaction.
As compound 2, doxorubicin has a quinone function that
may be reduced in water media. Such reduction takes place at
a more cathodic potential (−430 mV vs. Ag/AgCl; Fig. 5A,
grey markers) than that recorded for 2 (Fig. 5A, black
markers). The current response measured with doxorubicin
is higher than such with 2 , but at a potential where the
electrode response is superimposed with a rather large back-
ground. Oxidation of daunomycin has also been widely used
for DNA detection owing to its irreversible oxidation
L. Bouffier et al.
DNA/polypyrrole-modified electrode (black line), ss-DNA/polypyrrole-
modified electrode (dotted line ) and polypyrrole-modified electrode
(dashed line) recorded in comparable conditions (C)
behaviour at 600 mV vs. Ag/AgCl [43]. In such a detection
process, the generated species interact with guanine residues
through charge transfer within the duplex. This detection
principle is then destructive and essentially well adapted for
one-shot-based DNA sensors. Compound 2 advantageously
exhibits a reversible behaviour in PBS which is finely depicted
in Fig. 5A. It is noteworthy that the reduction process of 2 when
recorded in aerated media is superimposed with oxygen reduc-
tion that could be observed on doxorubicin DPV response at a
potential of −170 mV vs. Ag/AgCl. Then, the current responses
obtained for 2 in reduction and oxidation are not perfectly
equals (7.5 and 6.1 μA, respectively), and this difference in
current response may be attributed to oxygen reduction. There-
by, in order to obtain quantitative response independent on
oxygen evolution, DNA detection was performed by scanning
anodically the potential from −450 mV vs. Ag/AgCl following
a stabilisation step of 30 s. Figure 5B illustrates the reliability of
the measurement for aerated and deaerated solutions for which
the recorded responses are virtually identical in presence and
absence of oxygen. Thus, the aforementioned protocol allows
to isolate the signal due to the intercalator from the background
Electrochemical transduction of DNA hybridization
Fig. 5 Differential pulse voltammetry responses of 2 and doxorubicin
were recorded following immersion of the ds-DNA/polypyrrole electrode
in buffered solutions containing 125 μM of each intercalator during
signal and to record fully relevant data concerning DNA
hybridization.
Since ds-DNA electrochemical labelling was demonstrat-
ed, 2 was used as redox indicator of ODN hybridization
(Fig. 6). For this purpose, we built up polypyrrole-based
biolayers at a 5-mm-diameter platinum electrode by
electrocopolymerization of non-substituted pyrrole (py) and
modified pyrrole (py-ODN with 10-, 20- or 40-mer-long
ODN) in an aqueous solution containing an optimised ratio
of 25×10−3 and 5×10−6 M of the respective precursors [13,
31–33]. To demonstrate the effectiveness of the hybridization
event together with the detection procedure, we confirmed the
formation of the duplex by fluorescence microscopy using
conventional fluorescent probes (biotin/streptavidin, Fig. 6).
As shown in the corresponding electrochemical data, the
intensities of the 2 DPV signals obtained after hybridization
(black lines) with complementary strands of 10-, 20- or 40-
mer long (abbreviated 10c, 20c and 40c; concentration
200 nM) are higher than those obtained for non-specific
interactions (e.g. interaction of 2 with the biofilm in absence
and in presence of non-complementary ODN, 200 nM, noted
1169
90 min and transfer in a 0.1 M PBS(pH 7) free of intercalator. Comparison
between deaerated (black line) and air-saturated (dashed line) solutions
(B, inset)
20nc, grey lines). The average fluorescence intensity on the
full electrode surface is about 120 to 130 grey levels over 256
for positive biotin/streptavidin recognition and only 5/6 grey
levels with a non-biotinylated ODN (negative control). The
non-specific signal due to pure adsorption of 2 onto the PPy-
ODN film fits the one obtained in presence of the non-
complementary 20nc target, thus highlighting that there is no
deviation of the background signal due to non-specific ad-
sorption of short-length ss-DNA. Moreover, the DPV re-
sponse is increased according to the length of the DNA
duplex. This behaviour is related to the increased number of
intercalation sites with the base pair number involved in the
hybridization event. Indeed, a typical saturation of the duplex
corresponds to about three molecules per ten base pairs in
typical intercalation processes. In the case of the longer ODN
target (40c) to be detected in solution, we have assessed the
electrochemical DPV response of the biosensor for various
ODN concentrations. As depicted in the histogram of Fig. 6,
this method is suitable to detect ODN concentrations in the
range from 10 to 500 nM. For higher concentrations
(micrometre range), the electrochemical signal saturates, and
1170 L. Bouffier et al.

Fig. 6 Differential pulse

voltammetry detection of
immobilised 40-mer
oligonucleotide probe
hybridisation for responses to
complementary targets (40-,
20- and 10-mer, black line), non-
complementary control (20-mer,
grey line) and without target
(dashed grey line); buffer: 0.1 M
PBS (pH 7). Histograms showing
the influence of target ODN
concentration from 10 mM to
2 μM. Fluorescence images when
the biotin-ODN target is coupled
to streptavidin–phycoerythrin
(+/– marks indicate the presence/
absence of fluorescence)

that precludes further quantitative analysis. Furthermore, the
signal obtained for 10 nM concentration emerges significantly
from the background signal thus allowing the anticipation of a
better limit of detection than 10 nM. However, at the aforemen-
tioned ODN concentration, the voltamperometric contrast (de-
fined as the ratio of the specific signal minus the non-specific
one divided by the value of the specific signal) obtained for
Ppy-ODN films takes a rather low value of 20 % and increases
to 30 % for a detected concentration of 500 nM. These contrasts
are markedly lower than those displayed in Fig. 4C (67 and
54 % when considering Ppy/ss-DNA and Ppy responses as
background, respectively). Such behaviour is clearly related to
the density and the length of the immobilised ds-DNA. More-
over, the presented results were obtained for rather low ODN
densities corresponding to optimum signal in fluorescence
imaging [13, 44]. This voltamperometric contrast may be then
optimised through an adjustment of the py-ODN-to-py mono-
mers concentration ratio of the electrocopolymerization

Fig. 7 Differential pulse

voltammetry detection of
immobilised 40-mer
oligonucleotide probe
hybridisation for responses to a
complementary target (20-mer,
black line), a non-complementary
control (20-mer, grey line) and a
blank control without target DNA
(dotted black line); buffer: 0.1 M
PBS (pH 7). Photograph of an
API-T8 150-μm-diameter
electrode array (B) and
corresponding fluorescence
detection when the biotin-ODN
target is coupled to streptavidin–
phycoerythrin (+/– marks
indicate the presence/absence of
fluorescence)
Electrochemical transduction of DNA hybridization
solution. Nevertheless, this voltamperometric contrast is suffi-
cient to discriminate between specific and non-specific interac-
tions, and the effectiveness of the electrochemical detection was
confirmed by the obtained fluorescence images.
Otherwise, as already mentioned, 2 has a strong affinity for
Ppy films and may accumulate in the micrometre-thick poly-
meric structure. Thus, we have designed nanometre-thick
Ppy-ODN films (5 nm) using electrospotting [32] from the
same electrocopolymerization solutions but at gold microelec-
trodes (API-T8 electrode array containing eight microelec-
trodes of 150 μm in diameter, Fig. 7B) instead of a macro-
electrode. In the latter case, the DPV responses (Fig. 7A)
recorded after hybridization or non-specific interaction are,
respectively, of 69.0 and 41.3 μA cm−2 for ODN targets of 20-
mer long. The non-specific response is markedly lowered for
thinner Ppy films while the specific signal remains compara-
ble. In such context, the voltamperometric contrast takes an
enhanced value of 40 %. Moreover, owing to the API-T8
electrode array configuration, differential measurements be-
tween ODN-modified and bare Ppy electrodes could be
performed which would eventually increase the selectivity of
the biological response. Finally, we have tested the reusability
of the obtained DNA sensor through repetitive hybridization–
intercalation–denaturation cycles. The response to DNA hy-
bridization was maintained without recordable loss of inten-
sity after three consecutive cycles on API-T8 chips.
Conclusion
In the present study, a synthetic 6-amino substituted
pyrido[4,3,2-kl]acridin-4-one, which is an analogue of natural
alkaloids, appears to be a promising molecule for the electro-
chemical detection of DNA hybridization. The structure
gathers a planar intercalating core with a functional amine
arm conferring improved solubility in aqueous media and
potential electrostatic interaction within DNA grooves. Elec-
trochemical characterization reveals quasi-reversible redox
behaviour at mild negative potentials for which DNA is not
electroactive. The intrinsic selectivity for ds-DNA vs. ss-DNA
allows the sensitive transduction of DNA hybridization. The
interaction between this redox-active intercalator and DNA
was first studied in solution. CVs revealed the interaction
through suppression of the characteristic redox signature be-
cause the interaction with DNA reduces the availability to-
ward the electrode. However, it is possible to switch from this
“off signal” to a positive signal by immobilising DNA which
was proven by CV and DPV experiments. In this case, DNA
was adsorbed at a Ppy electrode surface, and the current
response for ds-DNA was found superior to controls involving
either ss-DNA or Ppy-modified electrodes. Finally, the immo-
bilisation of a short ODN probe was performed by copoly-
merization of py and Py-ODN in order to record a sequence-
1171
specific hybridization assay. This later was studied on a mac-
roscale electrode with particular focus on target ODN concen-
tration. The calibration shows that a typical concentration
range in tens to hundreds of nanometres allows quantitative
DNA determination with a 10-nM limit of detection which is
achieved without any chemical modification of the target
DNA (i.e. without amplification steps). Transduction of
DNA hybridization was also successfully recorded on a mi-
croelectrode array with superior specific vs. non-specific de-
tection thanks to thinner layers immobilised by an electro-
spotting technique. These results increase the interest of the
pyridoacridone family, as these synthetic compounds not only
find applications as anticancer drugs [24, 25] or gene delivery
promoter [45] but also play a key role as analytical tools
(present work and references [18, 31]).
References
1. Wang J (2000) From DNA biosensors to gene chips. Nucleic Acids
Res 28(16):3011–3016
2. Szunerits S, Bouffier L, Calemczuk R, Corso B, Demeunynck M,
Descamps E, Defontaine Y, Fiche J-B, Fortin E, Livache T, Mailley P,
Roget A, Vieil E (2005) Comparison of different strategies on DNA
chip fabrication and DNA-sensing: optical and electrochemical ap-
proaches. Electroanalysis 17(22):2001–2017
3. Cagnin S, Caraballo M, Guiducci C, Martini P, Ross M, SantaAna M,
Danley D, West T, Lanfranchi G (2009) Overview of electrochemical
DNA biosensors: new approaches to detect the expression of life.
Sensors 9(4):3122–3148
4. Mikkelsen SR (1996) Electrochemical biosensors for DNA sequence
detection. Electroanalysis 8(1):15–19
5. Mascini M, Palchetti I, Marrazza G (2001) DNA electrochemical
biosensors. Fresenius J Anal Chem 369(1):15–22
6. Gooding JJ (2002) Electrochemical DNA hybridization biosensors.
Electroanalysis 14(17):1149–1156
7. Cosnier S, Mailley P (2008) Recent advances in DNA biosensors.
Analyst 133(8):984–991
8. Sassolas A, Leca-Bouvier BD, Blum LJ (2008) DNA biosensors and
microarrays. Chem Rev 108(1):109–139
9. Paleček E, Bartošík M (2012) Electrochemistry of nucleic acids.
Chem Rev 112(6):3427–3481
10. Lisdat F, Schäfer D (2008) The use of electrochemical impedance
spectroscopy for biosensing. Anal Bioanal Chem 391(5):1555–1567
11. Gebala M, Stoica L, Neugebauer S, Schuhmann W (2009) Label-free
detection of DNA hybridization in presence of intercalators using
electrochemical impedance spectroscopy. Electroanalysis 21(3–5):
325–331
12. Grützke S, Abdali S, Schuhmann W, Gebala M (2012) Detection of
DNA hybridization using electrochemical impedance spectroscopy
and surface enhanced Raman scattering. Electrochem Commun 19:
59–62
13. Lassalle N, Mailley P, Vieil E, Livache T, Roget A, Correia JP,
Abrantes LM (2001) Electronically conductive polymer grafted with
oligonucleotides as electrosensors of DNA: preliminary study of real
time monitoring by in situ techniques. J Electroanal Chem 509(1):
48–57
14. Garnier F, Korri-Youssoufi H, Srivastava P, Mandrand B, Delair T
(1999) Toward intelligent polymers: DNA sensors based on
1172
oligonucleotide-functionalized polypyrroles. Synth Met 100(1):89–
94
15. Reisberg S, Piro B, Noël V, Pham MC (2005) DNA electrochemical
sensor based on conducting polymer: dependence of the “signal-on”
detection on the probe sequence localization. Anal Chem 77(10):
3351–3356
16. Caruana DJ, Heller A (1999) Enzyme-amplified amperometric de-
tection of hybridization and of a single base pair mutation in an 18-
base oligonucleotide on a 7-μm-diameter microelectrode. J Am
Chem Soc 121(4):769–774
17. Patolsky F, Lichtenstein A, Willner I (2001) Detection of single-base
DNA mutations by enzyme-amplified electronic transduction. Nat
Biotechnol 19(3):253–257
18. Cosnier S, Ionescu RE, Herrmann S, Bouffier L, Demeunynck M,
Marks RS (2006) An electro-enzymatic polypyrrole-intercalator sen-
sor for determination of the West Nile Virus DNA. Anal Chem
78(19):7054–7057
19. Wang J, Xu D, Kawde A-N, Polsky R (2001) Metal nanoparticle-
based electrochemical stripping potentiometric detection of DNA
hybridization. Anal Chem 73(22):5576–5581
20. Authier L, Grossiord C, Brossier P, Limoges B (2001) Gold
nanoparticle-based quantitative electrochemical detection of ampli-
fied human cytomegalovirus DNA using disposable microband elec-
trodes. Anal Chem 73(18):4450–4456
21. Erdem A, Ozsoz M (2002) Electrochemical DNA biosensors based
on DNA-drug interactions. Electroanalysis 14(14):965–974
22. Ferapontova E (2011) Electrochemical indicators for DNA electro-
analysis. Curr Anal Chem 7(1):51–62
23. Bouffier L, Demeunynck M, Milet A, Dumy P (2004) Reactivity of
pyrido[4,3,2-kl]acridines: regioselective formation of 6-substituted
derivatives. J Org Chem 69(23):8144–8147
24. Bouffier L, Dinica R, Debray J, Dumy P, Demeumynck M (2009)
Functionalization of A ring of pyridoacridine as a route toward
greater structural diversity. Synthesis of an octacyclic analogue of
eilatin. Bioorg Med Chem Lett 19(16):4836–4838
25. Bouffier L, Baldeyrou B, Hildebrant M-P, Lansiaux A, David-
Cordonnier M-H, Carrez D, Croisy A, Renaudet O, Dumy P,
Demeunynck M (2006) Amino- and glycoconjugates of pyrido[4,3,2-
kl]acridine. Synthesis, antitumor activity and DNA binding. Bioorg Med
Chem 14(22):7520–7530
26. Bouffier L, Gosse I, Demeunynck M, Mailley P, Bioelectrochemistry
(2012) Electrochemistry and bioactivity relationship of 6-substituted-
4H-pyrido[4,3,2-kl ]acridin-4-one antitumor drug candidates.
Bioelectrochemistry 88:103–109
27. Molinski TF (1993) Marine pyridoacridine alkaloids: structure, syn-
thesis, and biological chemistry. Chem Rev 93(5):1825–1838
28. Ding O, Chichak K, Lown JW (1999) Pyrroloquinoline and
pyridoacridine alkaloids from marine sources. Curr Med Chem 6(1):
1–28
29. Delfourne E, Bastide J (2003) Marine pyridoacridine alkaloids and
synthetic analogues as antitumor agents. Med Res Rev 23(2):234–252
L. Bouffier et al.
30. Marshall KM, Barrows LR (2004) Biological activities of pyridoacri-
dines. Nat Prod Rep 21(6):731–751
31. Wang B, Bouffier L, Demeunynck M, Mailley P, Roget A, Livache T,
Dumy P (2004) New acridone derivatives for the electrochemical
DNA-hybridisation labelling. Bioelectrochemistry 63(1–2):233–237
32. Guedon P, Livache T, Martin F, Lesbre F, Roget A, Bidan G, Levy Y
(2000) Characterization and optimization of a real-time, parallel,
label-free, polypyrrole-based DNA sensor by surface plasmon reso-
nance imaging. Anal Chem 72(24):6003–6009
33. Livache T, Fouque B, Roget A, Marchand J, Bidan G, Téoule R,
Mathis G (1998) Polypyrrole DNA chip on a silicon device: example
of hepatitis C virus genotyping. Anal Biochem 255(2):188–194
34. Crawford PW, Gross F, Lawson K, Chen CC, Dong Q, Liu DF, Luo
Y, Szczepankiewicz BG, Heathcock CH (1997) Electrochemical prop-
erties of some biologically active quinone derivatives: furanquinones,
pyridoquinones, and diplamine, a cytotoxic pyridoacridine alkaloid. J
Electrochem Soc 144(11):3710–3715
35. Matsumoto SS, Biggs J, Copp BR, Holden JA, Barrows LR (2003)
Mechanism of ascididemin-induced cytotoxicity. Chem Res Toxicol
16(2):113–122
36. Bouffier L, Lister K, Higgins SJ, Nichols RJ, Doneux T (2012)
Electrochemical investigations of dissolved and surface immobilised
2-amino-1,4-naphthoquinones in aqueous solutions. J Electroanal
Chem 664:80–87
37. Deféver T, Druet M, Evrard D, Marchal D, Limoges B (2011) Real-
time electrochemical PCR with a DNA intercalating redox probe.
Anal Chem 83(5):1815–1821
38. Lamm G, Pack GR (1990) Acidic domains around nucleic acids. Proc
Natl Acad Sci U S A 87(22):9033–9036
39. Minehan DS, Marx KA, Tripathy SK (1994) Kinetics of DNA
binding to electrically conducting polypyrrole films. Macromole-
cules 27(3):777–783
40. Palecek E, Fojta M, Tomschik M, Wang J (1998) Electrochemical
biosensors for DNA hybridization and DNA damage. Biosens
Bioelectron 13(6):621–628
41. Piedade JAP, Fernandes IR, Oliveira-Brett AM (2002) Electrochem-
ical sensing of DNA—adriamycin interactions. Bioelectrochemistry
56(1–2):81–83
42. Oliveira-Brett AM, Vivan M, Fernandes IR, Piedade JAP (2002)
Electrochemical detection of in situ adriamycin oxidative damage
to DNA. Talanta 56(5):959–970
43. Chiti G, Marrazza G, Mascini M (2001) Electrochemical DNA
biosensor for environmental monitoring. Anal Chim Acta 427(2):
155–164
44. Livache T, Roget A, Dejean E, Barthet C, Bidan G, Teoule R (1994)
Preparation of a DNA matrix via an electrochemically directed co-
polymerization of pyrrole and oligonucleotides bearing a pyrrole
group. Nucleic Acids Res 22(15):2915–2921
45. Bouffier L, Yiu HHP, Rosseinsky MJ (2011) Chemical grafting of a
DNA intercalator probe onto functional iron oxide nanoparticles: a
physicochemical study. Langmuir 27(10):6185–6192