Professional Documents
Culture Documents
ISBN 978-618-80242-2-9
HydroMedit 2014, November 13-15, Volos, Greece
Table of Contents
THEMATIC FIELD: INLAND AQUATIC RESOURCES ........................................................................................... 8
ORAL PRESENTATIONS IN GREEK .......................................................................................................... 8
THE IMPACT OF STOCKING ACTIVITIES ON THE NATIVE BROWN TROUT POPULATIONS OF THE NESTOS
RIVER ........................................................................................................................................................... 9
ASSESSMENT OF WATER QUALITY MONITORING BASED ON TWO YEARS DATA (2008 & 2011) IN LAKE
KASTORIA, WESTERN MACEDONIA, GREECE............................................................................................. 14
MONITORING PARAMETERS Tw, DO AND ENVIRONMENTAL EVALUATION OF THE ARTIFICIAL LAKE OF
THESAURUS FOR THE YEARS 2004-2007 ................................................................................................... 19
ORAL PRESENTATIONS IN ENGLISH .................................................................................................... 25
INTERRELATIONSHIP BETWEEN TOC, IC, TC AND DO, BOD, COD OF WATER IN REGARD TO
STRATIFICATION OF AN ABANDONED OCP AT RANIGANJ COAL FIELD AREA, BURDWAN, WEST BENGAL
................................................................................................................................................................... 25
TRANSCRIPTION RESPONSES IN THE KILLIFISH (Aphanius dispar) DURING LONG-TERM EXPOSURE TO
HIGH TEMPERATURE OF HOT SPRING.......................................................................................................
3
HydroMedit 2014, November 13-15, Volos, Greece
CONTENTS OF As, Cd, Hg AND Pb IN TWO CULTURED FISH SPECIES FROM TURKEY................................ 99
EFFECT OF DIETARY SUPPLEMENTATION OF Spirulina platensis ON THE GROWTH AND HAEMATOLOGY
OF THE STRESSED CATFISH Clarias gariepinus ........................................................................................ 102
SUBSTITUTION OF FISHMEAL BY FLY Hermetia illucens PREPUP AE MEAL IN THE DIET OF GILTHEAD
SEABREAM (Sparus aurata) ..................................................................................................................... 110
HIGH-THROUGHPUT SEQUENCING IN AQUACULTURE: THE COMPLEXITIES OF SEX DETERMINATION IN
FARMED FISH WITH SEXUAL DIMORPHISM ............................................................................................ 115
THEMATIC FIELD: ENVIRONMENTAL MANAGEMENT ................................................................................. 119
ORAL PRESENTATIONS IN ENGLISH .................................................................................................. 120
METHODOLOGICAL CONTRIBUTION TO THE FORMATION OF MARITIME SPATIAL PLANS AS A
MANAGEMENT TOOL TO MINIMISE CONFLICTS BETWEEN AQUACULTURE AND OTHER COASTAL
ACTIVITIES................................................................................................................................................ 120
ASSESSMENT OF CONSECUTIVE PLANKTON BLOOMS ON MARCH AND APRIL 2014 IN IZMIT BAY (THE
MARMARA SEA) ....................................................................................................................................... 127
THE COMPREHENSIVE CHARACTERISTIC OF POPULATION PARAMETERS OF HIGH BODY PICKAREL
Spicara flexuosa FROM DIFFERENT BAYS IN COASTAL AREA OF SEVASTOPOL (BLACK SEA) .................. 132
UNDERWATER TRAILS: INNOVATIVE ACTIVITY IN SITHONIA (CHALKIDIKI, GREECE).............................. 138
IMPLEMENTING STANDRAD EU METHOD FOR SAMPLING FRESHWATER FISH WITH MULTI-MESH
GILLNETS IN A LAKE'S SUB-BASINS (PRESPA LAKE, ALBANIA) ................................................................. 144
Cu AND Zn CONTENT IN WILD SEA BREAM AND SEA BASS FROM THE PAGASITIKOS GULF (EASTERN
MEDITERRANEAN) ................................................................................................................................... 151
THE EFFECTS OF RAINBOW TROUT (Oncorhynchus mykiss) FARMS ON WATER QUALITY OF KHALKAI
RIVER, MASAL, GUILAN............................................................................................................................ 155
BIOCHEMICAL EFFECTS OF ALMIX HERBICIDE IN THREE FRESHWATER TELEOSTEAN FISHES ................ 162
EFFECTS OF CHROMIUM ON TISSUE-SPECIFIC BIOCHEMICAL PARAMETERS IN FRESHWATER CATFISH,
Anabas testudineus (Bloch) ..................................................................................................................... 168
ORAL PRESENTATIONS IN GREEK ...................................................................................................... 175
TOLERANCE OF SEAGRASS Cymodocea nodosa PHOTOSYNTHETIC ACTIVITY ΤΟ SALINITY………………….175
PRELIMINARY RESULTS ON THE BENEFITS FROM THE RESTORATION OF LAKE KARLA TO ITS WIDER
PROTECTED AREA POPULATION .............................................................................................................. 180
COASTAL WATER POLLUTION FROM THE URBAN RUNOFF NETWORK IN CHANIA, GREECE .................. 185
CHEMICAL WATER QUALITY OF LAKE AND LAGOON OF VISTONIS (PORTO LAGOS, N. GREECE) ........... 191
EFFECTS OF BISPHENOL-A (BPA) ON SEX DIFFERENTIATION AND ON GROWTH OF F1 GENERATION
NAYPLII OF THE AMPHIGONIC POPULATION Artemia franciscana ......................................................... 197
TEMPORAL CHANCES OF THE TECHNICAL AND SPATIAL FEATURES OF AQUACULTURE FARMS IN GREECE
AND TURKEY ............................................................................................................................................ 203
4
HydroMedit 2014, November 13-15, Volos, Greece
5
HydroMedit 2014, November 13-15, Volos, Greece
6
HydroMedit 2014, November 13-15, Volos, Greece
7
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
INLAND AQUATIC
RESOURCES
8
HydroMedit 2014, November 13-15, Volos, Greece
Iakovaki D.1, Giantsis Η.Α.1, Sapounidis Α.2, Koutrakis Μ.2, Apostolidis Α.P.1*
1
Lab of Ichthyology & Fisheries, Department of Animal Production, Faculty of Agriculture, Forestry and Natural
Environment, Aristotle University of Thessaloniki, 54124, Thessaloniki, Greece
2
Fisheries Research Institute-NAGREF, Nea Peramos, 64007, Kavala, Greece
ABSTRACT
The aim of the present study was to evaluate the impact of stocking activities, which were carried out during the last
decades with fingerlings from Acheloos hatcheries, on the native brown trout (Salmo sp.) populations of Nestos river. In
total, 60 trout individuals collected in the years 2006-2013 from seven sampling sites of the Nestos river system were
included in the analysis. The PCR-RFLP technique was applied on a c. 2500 bp mitochondrial DNA segment containing
the ND5 and ND6 genes. Two restriction enzymes, which discriminate the indigenous individuals from the intruders,
were used. The results revealed that the indigenous trout populations of three tributaries (Arkoudorema, Mousda,
Vathyrema-Kalikarpo) were strongly affected by the stoking from Acheloos river. However, all individuals collected
from higher sampling sites (Diavolorema, Farasino, Vathyrema-Elatia Forest) seem to be pure i.e. without being mixed
with those of Acheloos. Our data suggest the urgent need of appropriate strategies in order to conserve and protect these
native populations.
Key words: Salmo sp., River Nestos, fish stocking, PCR-RFLP
*Corresponding author: Apostolidis P. Apostolos (apaposto@agro.auth.gr)
Ηαθσβάθε Γ.1, Γηάληζεο Η.Α.1, απνπλίδεο Α.2, Κνπηξάθεο Μ.2, Απνζηνιίδεο Α.Π.1*
1
Δνβαζηήνζμ Ηπεομημιίαξ & Αθζείαξ, Σμιέαξ Εςζηήξ Παναβςβήξ, πμθή Γεςπμκίαξ, Γαζμθμβίαξ & Φοζζημφ
Πενζαάθθμκημξ, Ανζζημηέθεζμ Πακεπζζηήιζμ Θεζζαθμκίηδξ, 54124, Θεζζαθμκίηδ, Δθθάδα
2
Ηκζηζημφημ Αθζεοηζηήξ Ένεοκαξ – ΔΛΓΟ ΓΖΜΖΣΡΑ, Νέα Πέναιμξ, 64007, Κααάθα, Δθθάδα
ΠΔΡΗΛΖΦΖ
ηδκ ενβαζία ιεθεηήεδηε δ έηηαζδ ηαζ μζ ζοκέπεζεξ ηςκ ―ειπθμοηζζιχκ‖ ιε αθθυπεμκα ζπεφδζα πέζηνμθαξ ζημοξ
εκδδιζημφξ πθδεοζιμφξ πέζηνμθαξ ημο Νέζημο. οκμθζηά, ζηδκ ακάθοζδ ζοιπενζθήθεδηακ 60 άημια άβνζαξ
πέζηνμθαξ, πμο ζοθθέπεδηακ ηα έηδ 2006-2013 απυ 7 ζηαειμφξ δεζβιαημθδρίαξ ημο ζοζηήιαημξ ημο Νέζημο, υπμο ηζξ
πνμδβμφιεκεξ δεηαεηίεξ είπακ απεθεοεενςεεί αθθυπεμκα ζπεφδζα πέζηνμθαξ απυ ημ ζφζηδια ημο Απεθχμο. Ζ ακάθοζδ
πναβιαημπμζήεδηε ιε ηδ πνήζδ ηδξ PCR-RFLP ιεεμδμθμβίαξ, ζε πενζμπή ημο ιζημπμκδνζαημφ DNA πμο πενζθαιαάκεζ
ηα βμκίδζα ND5 ηαζ ND6, πνδζζιμπμζχκηαξ 2 έκγοια πενζμνζζιμφ. Σα έκγοια αοηά ζηδ ζοβηεηνζιέκδ πενζμπή,
δζαηνίκμοκ 2 απθυηοπμοξ παναηηδνζζηζημφξ βζα ηα αοηυπεμκα άημια ημο Νέζημο ηαζ αοηά πμο πνμένπμκηαζ απυ ημκ
Απεθχμ. Σα απμηεθέζιαηα απμηάθορακ έκημκδ πανμοζία ηςκ εζζαπεέκηςκ αηυιςκ πέζηνμθαξ ζημοξ εκδδιζημφξ
πθδεοζιμφξ ημο Νέζημο, ηαεχξ ζε ηνεζξ παναπμηάιμοξ ημο δ πθεζμκυηδηα ηςκ αηυιςκ πμο ιεθεηήεδηακ ειθάκζζε ημκ
απθυηοπμ πμο παναηηδνίγεζ ηδκ πέζηνμθα ημο Απεθχμο. Πανυθα αοηά, ζε δείβιαηα πμο ζοθθέπεδηακ απυ ζδιεία ιε
ιεβαθφηενμ ορυιεηνμ δεκ ανέεδηε ηακέκα άημιμ ιε ημκ απθυηοπμ ημο Απεθχμο. οκεπχξ, ηαηαδεζηκφεηαζ δ άιεζδ
ακάβηδ θήρδξ ηαηάθθδθςκ δζαπεζνζζηζηχκ ιέηνςκ βζα ηδκ πνμζηαζία ηςκ εκδδιζηχκ πθδεοζιχκ πέζηνμθαξ πμο δεκ
έπμοκ επδνεαζηεί απυ ημοξ ―ειπθμοηζζιμφξ‖ ημο πανεθευκημξ ηαζ πμο απμηεθμφκ πμθφηζιμ βεκεηζηυ οθζηυ.
Λέξειρ κλειδιά: Salmo sp., Νέζηνο, εκπινπηηζκνί, PCR-RFLP
*οββναθέαξ επζημζκςκίαξ: Απμζημθίδδξ Π. Απυζημθμξ (apaposto@agro.auth.gr)
1. Δηζαγσγή
Ζ ζπεομπακίδα ηςκ εζςηενζηχκ οδάηςκ ηδξ Δθθάδαξ εεςνείηαζ ιζα απυ ηζξ πθμοζζυηενεξ ηδξ Δονχπδξ,
ανζειχκηαξ πενζζζυηενα απυ 170 είδδ (Λεμκάνδμξ & Μπυιπμνδ 2013). Χζηυζμ, πμθθά απυ ηα είδδ αοηά απακηχκηαζ
απμιμκςιέκα ηαζ ζε ιζηνμφξ πθδεοζιμφξ, ιε απμηέθεζια κα ανίζημκηαζ οπυ ηδκ απεζθή ελαθάκζζδξ (Κμοηνάηδξ
2013). Χξ ιέεμδμζ βζα ηδκ εκίζποζδ ηςκ ζπεομαπμεειάηςκ, ηυζμ ζηδ πχνα ιαξ υζμ ηαζ ζε παβηυζιζμ επίπεδμ,
πνδζζιμπμζήεδηακ μζ εζζαβςβέξ λεκζηχκ εζδχκ ηαεχξ ηαζ μζ ιεηαηζκήζεζξ πθδεοζιχκ απυ έκα οδάηζκμ μζημζφζηδια
πνμξ έκα άθθμ, εκένβεζεξ πμο, πανυηζ ζε ανηεηέξ πενζπηχζεζξ απμδείπηδηακ εοενβεηζηέξ (Economidis et al. 2000),
9
HydroMedit 2014, November 13-15, Volos, Greece
δδιζμφνβδζακ ηαζ έκα απυ ηα ζδιακηζηυηενα πνμαθήιαηα ιε ηα μπμία ανίζηεηαζ ζήιενα ακηζιέηςπδ δ εθθδκζηή
ζπεομπακίδα (Economidis et al. 2000, Λεμκάνδμξ & Μπυιπμνδ 2013).
Ζ πενίπηςζδ ηδξ Μαηεδμκζηήξ πέζηνμθαξ πμο δζααζεί ζημ ζφζηδια ημο πμηαιμφ Νέζημο (Π.Δ. Γνάιαξ)
απμηεθεί παναηηδνζζηζηυ πανάδεζβια εκυξ εκδδιζημφ είδμοξ πέζηνμθαξ (Salmo sp), ημο μπμίμο δ ζοζηδιαηζηή
ηαηάηαλδ δεκ έπεζ λεηαεανζζηεί πθήνςξ (Koutrakis et al. 2013) εκχ μζ θοζζημί πθδεοζιμί ημο έπμοκ δζαηαναπεεί
ζδιακηζηά απυ ηδκ εζζαβςβή αηυιςκ πέζηνμθαξ απυ άθθα οδάηζκα μζημζοζηήιαηα ηδξ πχναξ. Δζδζηυηενα, ζηα ιέζα ηαζ
ηέθδ ηδξ δεηαεηίαξ ημο 1970, 20.000 ζπεφδζα άβνζαξ πέζηνμθαξ πνμενπυιεκα απυ ζπεομβεκκδηζηυ ζηαειυ ημο Απεθχμο,
απεθεοεενχεδηακ ζηδ θεηάκδ ημο Νέζημο (Apostolidis et al. 1996) ηαζ ζοβηεηνζιέκα ζημοξ παναπμηάιμοξ
Ανημοδυνεια ηαζ Γζααμθυνεια (Δζηυκα 1) (Economidis et al. 2000). Δπζπθέμκ, είκαζ πζεακυ κα έπμοκ θάαεζ πχνα ηαζ
ιεηαβεκέζηενεξ, ιδ ηαηαβεβναιιέκεξ, εζζαβςβέξ άβνζαξ πέζηνμθαξ πνδζζιμπμζχκηαξ ζπεφδζα πνμενπυιεκα απυ ημκ ίδζμ
ζπεομβεκκδηζηυ ζηαειυ ή ηαζ απυ άθθεξ πενζμπέξ ηδξ Δθθάδαξ. Σέημζεξ ιεηαηζκήζεζξ έπμοκ απμδεζπεεί πμθφ επζαθααείξ
βζα ημοξ ημπζημφξ αοηυπεμκμοξ πθδεοζιμφξ, ζε ζδιείμ πμο, ζε ηάπμζεξ πενζπηχζεζξ, κα παναηηδνζζεμφκ ςξ ―βεκεηζηή
νφπακζδ‖ (Economidis et al. 2000). ηδκ πνχηδ εηηεκή βεκεηζηή ένεοκα εθθδκζηχκ πθδεοζιχκ άβνζαξ πέζηνμθαξ πμο
δζελήπεδ ζε επίπεδμ DNA (Apostolidis et al. 1996), ιεθεηήεδηακ βζα πνχηδ θμνά μζ ιεηαηζκήζεζξ – ειπθμοηζζιμί πμο
πναβιαημπμζήεδηακ ζημοξ ημπζημφξ πθδεοζιμφξ ημο Νέζημο. φιθςκα ιε ηα απμηεθέζιαηα ηδξ ακάθοζδξ πμο
ααζίζηδηε ζηδκ PCR-RFLP ιεεμδμθμβία, ηα 17 απυ ηα 22 άημια πέζηνμθαξ πμο ελεηάζηδηακ απυ ημ Νέζημ είπακ ημκ
ίδζμ βεκυηοπμ ιε ηα άημια ημο Απεθχμο, απμηεθμφζακ δδθαδή απμβυκμοξ ηςκ εζζαπεέκηςκ ρανζχκ.
ημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ δ δζενεφκδζδ ηδξ πανμοζίαξ αηυιςκ πέζηνμθαξ πμο πνμένπμκηαζ απυ ημκ
Απεθχμ ζε υθμοξ ημοξ παναπμηάιμοξ ημο ζοζηήιαημξ ημο Νέζημο ηαεχξ ηαζ ηδξ πμνείαξ ηςκ ειπθμοηζζιχκ πμο
έθααακ πχνα ηζξ πνμδβμφιεκεξ δεηαεηίεξ, πνδζζιμπμζχκηαξ ημοξ ίδζμοξ ιμνζαημφξ δείηηεξ, χζηε κα ηαηαζηεί εθζηηή δ
ζφβηνζζδ ηςκ απμηεθεζιάηςκ.
10
HydroMedit 2014, November 13-15, Volos, Greece
Πίλαθαο 1. Κσδηθφο (Κ), πεξηνρή δεηγκαηνιεςίαο (S), αξηζκφο αηφκσλ πνπ ζπιιέρζεθαλ απφ θάζε πεξηνρή (Ν)
θαη εκεξνκελία δεηγκαηνιεςίαο (t) γηα θάζε δείγκα.
K S Ν T
3. Απνηειέζκαηα
Σα πενζμνζζηζηά πνυηοπα πμο πνμέηορακ βζα ηα δφμ έκγοια πμο ελεηάζηδηακ θαίκμκηαζ ζημκ Πίκαηα 2 ηαζ ηδκ
Δζηυκα 2. Σα ίδζα αηνζαχξ πνυηοπα, ζηα ίδζα έκγοια, ανέεδηακ απυ ημοξ Apostolidis et al. (1996). θα ηα άημια απυ ημ
νέια Μμφζδα, υπςξ επίζδξ ηαζ ηα πενζζζυηενα απυ ημ Ανημοδυνεια ηαζ ημ Βαεφνεια ζημ φρμξ ημο Καθθίηανπμο
ειθάκζζακ ημκ ίδζμ απθυηοπμ (ζφκεεημ βεκυηοπμ ΒΒ) ιε ηα άημια ημο Απεθχμο, εκχ υθα ηα δείβιαηα απυ ημ Φαναζζκυ,
ημ Γζααμθυνεια ηαζ ημ νέια Μφθμο ειθάκζζακ ημκ απθυηοπμ ΑΑ (Πίκαηαξ 3).
11
HydroMedit 2014, November 13-15, Volos, Greece
AluI HaeIII
A B A B
1090 870
Πίλαθαο 3. Απιφηππνη (ζχλζεηνη γελφηππνη) θαη απινηππηθέο ζπρλφηεηεο ησλ ππφ εμέηαζε δεηγκάησλ.
Γείβια
φκεεημξ
Απθυηοπμξ ΜΟΤ ΒΑΘ1.1 ΒΑΘ1.2 ΒΑΘ1.3 ΒΑΘ ΜΤ ΓΗΑΒ ΑΡΚ ΦΑΡ
βεκυηοπμξ
2 Λ
4. πδήηεζε
Οζ πθδεοζιμί άβνζαξ πέζηνμθαξ ηδξ κυηζαξ Βαθηακζηήξ πενζμκήζμο πανμοζζάγμοκ ζδζαίηενα εηηεηαιέκδ
βεκεηζηή πμζηζθυηδηα (Apostolidis et al. 1996, Apostolidis et al. 1997). Με αάζδ πνμδβμφιεκεξ ιεθέηεξ ημο mtDNA, μζ
πθδεοζιμί ημο Απεθχμο ακήημοκ, ςξ επί ημ πθείζημκ, ζηδ θοθμβεκεηζηή μιάδα marmoratus (Ma), εκχ μζ αοηυπεμκεξ
πέζηνμθεξ ημο Νέζημο ζε αοηήκ ηδξ Αδνζαηζηήξ (Ad). Δκημφημζξ, ζημ Νέζημ ηαζ ζοβηεηνζιέκα ζημ Ανημοδυνεια έπμοκ
ανεεεί άημια ―marmoratus‖ ηα μπμία ελδβμφκηαζ απυ ημοξ ειπθμοηζζιμφξ ιε ζπεφδζα απυ ημκ Απεθχμ (Apostolidis et al.
1996, Apostolidis et al. 1997).
ηδκ πανμφζα ενβαζία, εηηυξ απυ ηδκ πθεζμκυηδηα ηςκ δεζβιάηςκ απυ ημ Ανημοδυνεια, υθα ηα άημια απυ ημ
νέια Μμφζδα ηαζ ηα πενζζζυηενα απυ ημ Βαεφνεια ζε παιδθυ ορυιεηνμ (ημκηά ζημ πςνζυ Καθθίηανπμ, Δζηυκα 1),
είπακ ημκ απθυηοπμ 2 (Πίκαηαξ 3) δδθαδή απμηεθμφκ απμβυκμοξ ηςκ ζπεοδίςκ πμο πνμήθεακ απυ ημκ Απεθχμ. Καηά
ζοκέπεζα μζ ειπθμοηζζιμί ζηζξ πενζμπέξ αοηέξ επδνέαζακ ζδιακηζηά ημοξ εκδδιζημφξ πθδεοζιμφξ ιε πζεακυ εκδεπυιεκμ
ηδκ μθμηθδνςηζηή ελαθάκζζή ημοξ. Ακηίεεηα, μζ ημπζημί πθδεοζιμί άβνζαξ πέζηνμθαξ απυ ημοξ παναπμηάιμοξ
Γζααμθυνεια, Φαναζζκυ ηαζ Βαεφνεια (πθδζίμκ ημο Γάζμοξ Δθαηζάξ), πμο ανίζημκηαζ ζε ορδθυ ορυιεηνμ, θαίκεηαζ
υηζ δεκ επδνεάζηδηακ απυ ειπθμοηζζιμφξ ηαεχξ δεκ ανέεδηε ζε αοημφξ ηακέκα άημιμ πμο κα θένεζ ημ βεκυηοπμ ημο
Απεθχμο. ε υηζ αθμνά ημ Μφθμο Ρέια, δ πανμοζία βέθοναξ ζημ ζδιείμ ηςκ δεζβιαημθδρζχκ, ιάθθμκ ειπυδζγε ηδκ
πνμξ ηα ακάκηδ ιεηακάζηεοζδ ηδξ πέζηνμθαξ, ζοκηεθχκηαξ ζηδκ ακαπαναβςβζηή ηδξ απμιυκςζδ, δζαηδνχκηαξ έηζζ ημκ
αοηυπεμκμ πθδεοζιυ, ημοθάπζζημκ ιέπνζ ηδ πνμκζηή ζηζβιή ηδξ δεζβιαημθδρίαξ (Ημφκζμξ 2006, Πίκαηαξ 1). Έηημηε
εκημφημζξ, δεκ έπεζ ανεεεί ηακέκα άημιμ άβνζαξ πέζηνμθαξ ζηζξ επυιεκεξ δεζβιαημθδρίεξ πμο πναβιαημπμζήεδηακ,
ηαεζζηχκηαξ έκημκδ ηδκ πζεακυηδηα ελαθάκζζδξ ημο πθδεοζιμφ άβνζαξ πέζηνμθαξ απυ ημ νέια αοηυ. Δπμιέκςξ,
ζδζαίηενδ πνμζμπή πνέπεζ κα δμεεί απυ ηζξ δζαπεζνζζηζηέξ ανπέξ έηζζ χζηε κα απμηναπεί μπμζαδήπμηε ιεηαηίκδζδ
ζπεομπθδεοζιμφ πνμξ ηα νέιαηα αοηά ζημ ιέθθμκ.
12
HydroMedit 2014, November 13-15, Volos, Greece
οιπεναζιαηζηά, ανηεημί ημπζημί πθδεοζιμί άβνζαξ πέζηνμθαξ ημο ζοζηήιαημξ ημο πμηαιμφ Νέζημο θαίκεηαζ
πςξ έπμοκ δζαηαναπεεί ζδιακηζηά, εκχ ζε μνζζιέκα ζδιεία ηείκμοκ πνμξ ελαθάκζζδ ή ακηζηαηάζηαζδ απυ άθθμοξ πμο
πνμήθεακ απυ ειπθμοηζζιμφξ. Καηαδεζηκφεηαζ επμιέκςξ δ ακάβηδ εθανιμβήξ ηαηάθθδθςκ δζαπεζνζζηζηχκ ιέηνςκ
ηέημζςκ χζηε κα απμηναπμφκ ιεθθμκηζηέξ ιεηαηζκήζεζξ, εζδζηυηενα ζε πενζμπέξ υπςξ ημ Φαναζζκυ, ημ Γζααμθυνεια,
αθθά ηαζ ζηα μνεζκά ηιήιαηα ημο Βαεονέιαημξ, υπμο δζαηδνμφκηαζ ημπζημί - ιμκαδζημί πθδεοζιμί άβνζαξ πέζηνμθαξ.
Βηβιηνγξαθία
Κμοηνάηδξ Μ. (2013). Δπζπηχζεζξ ηςκ θναβιάηςκ ζηδκ ζπεομπακίδα ηςκ πμηαιχκ. Πναηηζηά 15μο Πακεθθδκίμο
οκεδνίμο Ηπεομθυβςκ, Θεζζαθμκίηδ, (2013), ζεθ. 441-442.
Λεμκάνδμξ Η., Μπυιπμνδ Γ. (2013). Ζ ζπεομπακίδα ηςκ εζςηενζηχκ οδάηςκ ηδξ Δθθάδαξ. Πναηηζηά 15μο Πακεθθδκίμο
οκεδνίμο Ηπεομθυβςκ, Θεζζαθμκίηδ, (2013), ζεθ. 439-440.
Apostolidis A.P., Karakousis Y., Triantaphyllidis C. (1996). Genetic differentiation and phylogenetic relationships
among Greek Salmo trutta L. (brown trout) populations as revealed by RFLP analysis of PCR amplified
mitochondrial DNA segments. Heredity 77, 608-618.
Apostolidis A.P., Trantaphyllidis C., Kouvatsi A., Economidis P.S. (1997). Mitochondrial DNA sequence variation and
phylogeography among Salmo trutta L. (Greek brown trout) populations. Molecular Ecology 6, 531-542.
Economidis P.S., Dimitriou E., Pagoni R., Michaloudi E., Natsis L. (2000). Introduced and tranlocated fish species in the
inland waters of Greece. Fisheries management and Ecology 7, 239-250.
Hillis D.M., Moritz C., Mable B.K. (1996). Molecular Systematics, 2nd edn. Sinauer Associates, Sunderland, MA
Koutrakis E.T., Sapounidis A., Apostolou A., Vassilev M., Pehlivanov L., Leontarakis P., Tsekov A., Sylaios G.,
Economidis P.S. (2013). An integrated ichthyofaunal survey in a heavily-modified, cross-borded watershed.
Journal of Biological Research-Thessaloniki 20, 326-338.
Nielsen E.E. Hansen M.M., Mensberg K.LD. (1998). Improved primer sequences for the mitochondrial ND1, ND3/4 and
ND5/6 segments in salmonid fishes: Application to RFLP analysis of Atlantic salmon. Journal of Fish Biology 53,
216-220.
13
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
Lake Kastoria is a very important aquatic ecosystem, situated in the Region of Western Macedonia, Greece. A two years
monthly monitoring program (2008 and 2011) in 5 Sampling Stations in the Lake area is demonstrated in this study as a
part of a twelve years monitoring programme, that is operated in order to collect water quality and quantity data. The
study is focused on the water quality parameters of Water Temperature (Tw), Dissolved Oxygen (DO), pH, Water
Transparency (Wt), Total Nitrogen (TΝ), Total Phosphorus (TP), Chl-a and BOD5. The time fluctuation, the impacts and
the assessments of this monitoring data are presented here.
Keywords: Lake Kastoria, eutrophication, monitoring data, water-quality.
Corresponding author:: Psilovikos Ar ( psiloviko@uth.gr)
Πεξίιεςε
Η λίμνθ τθσ Καςτοριάσ είναι ζνα ςθμαντικό υδάτινο λιμναίο οικοςφςτθμα που βρίςκεται ςτθν Δυτικι Μακεδονία. Στθν
παροφςα εργαςία παρουςιάηονται τα δεδομζνα προγράμματοσ παρακολοφκθςθσ αβιοτικϊν και βιοτικϊν παραμζτρων
δυο ετϊν (2008 και 2011) ςε 5 ςτακμοφσ δειγματολθψίασ, τα οποία αποτελοφν μζροσ των δεδομζνων δωδεκαετοφσ
παρακολοφκθςθσ. Η μελζτθ επικεντρϊκθκε ςε ποιοτικζσ παραμζτρουσ του νεροφ ειδικότερα ςτθν κερμοκραςία νεροφ
(Tw), ςτο διαλυμζνο οξυγόνο (DO), το pH, τθν διαφάνεια νεροφ (Wt), το ολικό άηωτο (TΝ), τον ολικό φϊςφορο (TP) τθν
χλωροφφλλθ-α (Chl-a) και το BOD5. Η μζτρθςθ των παραπάνω αβιοτικϊν και βιοτικϊν παραμζτρων και θ χρονικι
διακφμανςθ τουσ εκτιμοφνται και παρουςιάηονται.
1.Δηζαγσγή
Ζ μζημθμβζηή ηαηάζηαζδ είκαζ έκα ζφκεεημ απμηέθεζια θοζζηχκ ηαζ ακενςπμβεκχκ δζενβαζζχκ αθθά ηαζ ηςκ
αθθδθεπζδνάζεςκ ημοξ ζημ πχνμ ηαζ ζημκ πνυκμ. Ο ζημπυξ ηδξ παναημθμφεδζδξ πμζμηζηχκ ηαζ πμζμηζηχκ παναιέηνςκ
ζηα οδάηζκα μζημζοζηήιαηα (πδβέξ, πμηάιζα, εηαμθέξ, εζςηενζηά κενά , εάθαζζεξ, ςηεακμφξ) είκαζ δ πνμζέββζζδ ηαζ δ
εηηίιδζδ ηδξ μζημθμβζηήξ ηαηάζηαζδξ ηαζ ηςκ ηάζεςκ πμο παναηδνμφκηαζ. Έκα ηαθμζπεδζαζιέκμ πνυβναιια
παναημθμφεδζδξ ιπμνεί κα απμηεθέζεζ ηδκ αάζδ ηαζ ημκ ηαεμνζζιυ ηδξ επζηοπίαξ ή ηδξ απμηοπίαξ δνάζεςκ
απμηαηάζηαζδξ ηαζ ιπμνεί κα ηαεμνίζεζ ηδκ ακαπνμζανιμβή αοηχκ (Bruns & Wiersma 2004). Ζ θίικδ Καζημνζάξ είκαζ
ιζα νδπή ιεζμβεζαηή θίικδ δ μπμία ανίζηεηαζ ζηδκ πενζθένεζα ηδξ Γοηζηήξ Μαηεδμκίαξ. Ζ θίικδ Καζημνζάξ (40°30΄N,
21°18΄E), είκαζ πμθοιζηηζηή ιε επζθάκεζα 27,9 km², ιέβζζημ αάεμξ 9 m,ηαζ ιέζμ αάεμξ 4 m,ηαζ πνυκμ παναιμκήξ > 2 yr.
Δίκαζ ιζα αζηζηή θίικδ ζηδκ μπμία πανμπεηεφμκηακ ηα αζηζηά απυαθδηα έςξ ηδκ ίδνοζδ ηαζ θεζημονβία ημο αζμθμβζημφ
14
HydroMedit 2014, November 13-15, Volos, Greece
ηαεανζζιμφ ημ 1991 (Moustaka–Gouni et al 2006). Ακηίεεηα απυ άθθεξ θοζζηέξ θίικεξ, δ θίικδ ηδξ Καζημνζάξ έπεζ
οδναοθζηυ ζφζηδια νφειζζδξ ηδξ ζηάειδξ ημο κενμφ ιε ηδκ πνήζδ ηαζ θεζημονβία εονμθναβιάηςκ, ζδζαίηενα υηακ μ
υβημξ ημο κενμφ αολάκεζ ελαζηίαξ ηςκ πεζιενζκχκ εζζνμχκ. Ζ ιδκζαία δζαηφιακζδ ηδξ ζηάειδξ ημο κενμφ ελανηάηαζ απυ
ηζξ επμπζηέξ ιεηααμθέξ ηδξ εενιμηναζίαξ ηαζ ηςκ ανμπμπηχζεςκ. Ζ θίικδ ηδξ Καζημνζάξ έπεζ ιεβάθδ μζημθμβζηή αλία
ηαεχξ ζηδνίγεζ ηδκ ημπζηή πνςημβεκή παναβςβή αθθά ηαζ ηδκ ημονζζηζηή δναζηδνζυηδηα. Καηά ηδκ δζάνηεζα ηςκ
ηεθεοηαίςκ δεηαεηζχκ δεπυηακ έκημκεξ ακενςπμβεκείξ πζέζεζξ υπςξ άνδεοζδ, πανμπέηεοζδ ηςκ αηαηένβαζηςκ αζηζηχκ
απμαθήηςκ, εκαπυεεζδ ζγήιαημξ ηα μπμία πνμηάθεζακ ζμαανά πνμαθήιαηα ηαζ ηδκ μζημθμβζηή οπμαάειζζδ ηδξ. Ζ
θεηάκδ απμννμήξ ηδξ είκαζ ηονίςξ αβνμηζηή ηαζ εηπθφζεζξ ηςκ αβνμηζηχκ πενζμπχκ απμηεθμφκ ηφνζα πδβή ενεπηζηχκ
ζοζηαηζηχκ ιε απμηέθεζια ηα θαζκυιεκα εοηνμθζζιμφ. Ζ αζηζηή νφπακζδ πνμένπεηαζ απυ ηδκ πυθδ ηδξ Καζημνζάξ
(πθδεοζιμφ 15.000) δ μπμία εηηείκεηαζ ηαηά ιήημξ ηδξ αηημβναιιήξ ηδξ θίικδξ. Σα εοηνμθζηά επεζζυδζα είκαζ ζοπκά
ζηδκ θίικδ, ζοκμδεφμκηαζ ιε ηδκ εθάηηςζδ ημο δζαθοιέκμο μλοβυκμο ηαζ ηδκ ιεβάθδ αφλδζδ ηςκ θοηχκ. Ζ άκεζζδ ηςκ
ηοακμθοηχκ ηαζ μζ ημλίκεξ ημοξ ηαοημπμζήεδηακ ζηδκ θίικδ βζα πνχηδ θμνά ημ 1987 (Lanaras et al.1989). Ζ
απμηαηάζηαζδ νδπχκ εοηνμθζηχκ θζικχκ πανμοζζάγεζ ιεβαθφηενδ δοζημθία ζοβηνζηζηά ιε ηζξ ααεζέξ θίικεξ ελαζηίαξ
ηδξ ζζπονήξ αθθδθεπίδναζδ πμο παναηδνείηαζ ιεηαλφ ημο ζγήιαημξ ημο ποειέκα ηαζ ηδξ οδάηζκδξ ζηήθδξ (Bengtsson.
1975, Threlked 1994). ηζξ νδπέξ θίικεξ δ εζςηενζηή ακαηνμθμδυηδζδ ενεπηζηχκ ζοζηαηζηχκ απυ ημ ίγδια ζηδκ
οδάηζκδ ζηήθδ ζοιααίκεζ αηυιδ ηαζ υηακ ζηδκ οδάηζκδ ζηήθδ οπάνπεζ μλοβυκμ (Kleebery & Kozerski 1997). Πνζκ ηδκ
εηπυκδζδ ζηναηδβζημφ ζπεδίμο απμηαηάζηαζδξ ιζα θίικδξ είκαζ ακαβηαία δ ζοβηέκηνςζδ δεδμιέκςκ βζα ηδκ εηηίιδζδ
ηδξ οδνμθμβζηήξ ηαζ μζημθμβζηήξ ηαηάζηαζήξ ηδξ (Heyman et al. 1984). H μζημθμβζηή ηαηάζηαζδ επδνεάγεηαζ ηυζμ απυ
ημοξ ααζμηζημφξ, υζμ ηαζ απυ ημοξ αζμηζημφξ παναιέηνμοξ (Hutulla & Noges 1998, Huszar & Caracao 1998). Ζ
δζαεεζζιυηδηα ηςκ ενεπηζηχκ ,ζδζαίηενα ημο θςζθυνμο (Schindler 1997) ηαεμνίγεζ ηδκ δοκαιζηή ηδξ
θοημπθαβηημκζηήξ αζμιάγαξ (Carpenter 1991).
ηδκ πανμφζα ιεθέηδ ιεηνήεδηακ ααζμηζημί ηαζ αζμηζημί πανάβμκηεξ βζα δομ έηδ ιε ζημπυ ηδκ δδιζμονβία ιζαξ
αάζδξ δεδμιέκςκ βζα ηδκ θίικδ Καζημνζάξ. Σα αηυθμοεα δεδμιέκα απμηεθμφκ έκα ιυκμ ιένμξ απυ ηδκ δςδεηαεηή αάζδ
δεδμιέκςκ πμο έπεζ ζοιπθδνςεεί ηαζ ανίζηεηαζ ζε ζηάδζμ επελενβαζίαξ, ιε ζημπυ ηδκ ηαηακυδζδ ηδξ δμιήξ ηαζ
θεζημονβίαξ ημο μζημζοζηήιαημξ ηδξ θίικδξ Καζημνζάξ, ηδκ αλζμθυβδζδ ηδξ μζημθμβζηήξ ηδξ ηαηάζηαζδξ ηαζ ηςκ
ιεηααμθχκ ηδξ ζημ πχνμ ηαζ ζημ πνυκμ, αθθά ηαζ ηδκ εηπυκδζδ δζαπεζνζζηζημφ ζπεδίμο ιε ζηυπμ ηδκ ελοβίακζδ ηαζ
απμηαηάζηαζήξ ημο θζικαίμο μζημζοζηήιαημξ ηδξ.
Ζ δεζβιαημθδρία πναβιαημπμζήεδηε ζε πέκηε ζηαειμφξ ζηα ααεφηενα ηιήιαηα ηδξ θίικδξ (αάεμξ ≥ 4m). Ζ Tw ηαζ
ημ DO ιεηνήεδηακ ζημ πεδίμ ιε ηδκ πνήζδ θμνδημφ μνβάκμο Oxy330 VTV, δ Wt ιεηνήεδηε ιε ηδκ πνήζδ δίζημο ημο
Secchi. Σμ pH ιεηνήεδηε ιε Orion ph-meter. Οζ δεζβιαημθδρίεξ πναβιαημπμζήεδηακ απυ ημκ Ηακμοάνζμ 2008 έςξ ημκ
Γεηέιανζμ ημο 2008 ηαζ απυ ημκ Ηακμοάνζμ ημο 2011 έςξ ημκ Γεηέιανζμ ημο 2011 ιδκζαία. Σα δείβιαηα κενμφ
θαιαάκμκηακ ζε αάεμξ 30 cm απυ ηδκ επζθάκεζα. Ο πμζμηζηυξ πνμζδζμνζζιυξ ημο ΣΝ ηαζ ημο TP, πναβιαημπμζήεδηε ιε
θαζιαημθςηυιεηνμ ηφπμο Merck, ζφιθςκα ιε ηζξ πζζημπμζδιέκεξ ηαζ εβηεηνζιέκεξ APHA ιεευδμοξ (APHA 2000).
Γζα ημκ πνμζδζμνζζιυ ηδξ Cl-a, ηα δείβιαηα θζθηνάνμκηακ ιε θίθηνα ηφπμο Whatman GF/A αιέζςξ ιεηά ηδκ ζοθθμβή.
Ζ ελαβςβή πνχιαημξ βζκυηακ ιε ηδκ πνήζδ 90% αηεηυκδξ ηαζ μζ ζοβηεκηνχζεζξ πνμζδζμνζγυηακ θαζιαημθςημιεηνζηά.
To BOD5 ιεηνήεδηε ζφιθςκα ιε ηζξ ιεευδμοξ APHA 2000. Οζ ιέζεξ ιδκζαίεξ ηζιέξ πνδζζιμπμζήεδηακ βζα ηδκ επμπζηή
δζαηφιακζδ ηςκ οπυ ελέηαζδ παναιέηνςκ.
3. Απνηειέζκαηα
ηδκ δζεηή πενίμδμ παναημθμφεδζδξ πανυιμζεξ επμπζηέξ δζαηοιάκζεζξ παναηδνήεδηακ βζα ηδκ Tw, δ μπμία
ηοιάκεδηε ιεηαλφ 3.04 oC ζηζξ ηνφεξ πενζυδμοξ έςξ 28.27 oC ζηζξ εενιέξ πενζυδμοξ (πήια 1). Σμ DO ηοιάκεδηε
ιεηαλφ 2.92 mg/L ημκ Ημφκζμ ημο 2008 ηαζ 12.02 mg/L ημκ Ημφθζμ 2011. Οζ εθάπζζηεξ ηζιέξ παναηδνμφκηαζ ηονίςξ
ιεηαλφ ηςκ εενιχκ πενζυδςκ υπμο μζ δζαδζηαζίαξ απμζημδυιδζδξ ηαζ μζ απαζηήζεζξ ημο ζγήιαημξ ζε μλοβυκμ
πνμηαθμφκ ηδκ παιδθή πενζεηηζηυηδηα δζαθοιέκμο μλοβυκμο ζηδκ οδάηζκδ ζηήθδ ηαηά ηδκ δζάνηεζα ημο ηαθμηαζνζμφ.
(πήια 2) ηαζ μζ ιέβζζηεξ ηζιέξ ειθακίγμκηαζ ηονίςξ ημοξ πεζιενζκμφξ ιήκεξ. Ζ Wt ήηακ βεκζηά παιδθή. Κοιάκεδηε
ιεηαλφ 0.45 m ημκ Αφβμοζημ ημο 2008 ηαζ 4.05 m ημ Γεηέιανζμ ημο 2011 (πήια 3). Οζ ορδθυηενεξ ηζιέξ πζεακά
ζοκδέεηαζ ιε ηδκ παιδθή πενζεηηζηυηδηα θοημπθαβηημκζηήξ αζμιάγαξ. Πανάβμκηεξ πμο πνμηαθμφκ εμθενυηδηα ζηδκ
θίικδ Καζημνζάξ, είκαζ δ αζμιάγα ηςκ θοηχκ ηαζ δ ακαηάναλδ ημο ζγήιαημξ ημο ποειέκα έπεζηα απυ ζζπονμφξ ακέιμοξ
ηαζ έκημκεξ ανμπμπηχζεζξ. Ζ επμπζηή δζαηφιακζδ ηδξ Wt αημθμοεεί ημ ίδζμ ιμηίαμ. Καηά ηδκ δζάνηεζα ημο ηαθμηαζνζμφ
15
HydroMedit 2014, November 13-15, Volos, Greece
ηαζ ηςκ ανπχκ θεζκμπχνμο, παναηδνμφκηαζ μζ ιζηνυηενεξ ηζιέξ, εκχ μζ ορδθυηενεξ ηζιέξ παναηδνμφκηαζ ημκ πεζιχκα
ηαζ ηδκ άκμζλδ. Ζ ιζηνυηενδ ηζιή ημο pH ήηακ 7.6 ημκ Ηακμοάνζμ ημο 2008 ηαζ δ ορδθυηενδ ηζιή 9.102 ημ επηέιανζμ
ημο 2011 (πήια 4). Οζ ηζιέξ ημο pH επδνεάγμκηαζ απυ ηδκ θςημζοκεεηζηή δναζηδνζυηδηα ηαζ ημκ ιζηνμαζμθμβζηυ
ιεηααμθζζιυ ηαζ αολάκμοκ ιε ηζξ δζενβαζία ηδξ απμκζηνμπμίδζδξ.
Οζ ζοβηεκηνχζεζξ ημο TN παναηδνμφκηαζ ζδζαίηενα ορδθέξ ζηζξ οβνέξ πενζυδμοξ (Απνίθζμξ ηαζ Μάζμξ) ηαζ
πνμξ ημ ηέθμξ ημο ηαθμηαζνζμφ (Αφβμοζημξ ηαζ επηέιανζμξ) (πήια 5). Αοηυ ιπμνεί κα μθείθεηαζ απυ ηζξ εζζαβςβέξ
αγχημο ιε ηζξ εηπθφζεζξ ηςκ βεςνβζηχκ εδαθχκ είηε θυβς ανμπμπηχζεςκ είηε θυβς άνδεοζδξ. Καηά ηδκ δζάνηεζα ημο
ηαθμηαζνζμφ, μζ παιδθυηενεξ ηζιέξ ηοιάκεδηακ απυ 36.8 ιg/L ημκ Ημφθζμ ημο 2011 έςξ 19.1 ιg/L ημκ Αφβμοζημ ημο
2011.
Οζ ζοβηεκηνχζεζξ ημο TP είπακ επμπζηή δζαηφιακζδ απυ 2 ιg/l ημκ Ηακμοάνζμ ημο 2008 έςξ 200 ιg/l ημκ
Ημφθζμ ημο 2008 ζημ επζθακεζαηυ κενυ, ιε ηζξ ιέβζζηεξ ηζιέξ κα ειθακίγμκηαζ ηονίςξ ημοξ ιήκεξ Ημφθζμ, Αφβμοζημ ηαζ
επηειανίμο (πήια 6), πζεακά απυ ηδκ επίδναζδ ηδξ θοημπθαβηημκζηήξ δοκαιζηήξ ηαζ ηδκ εζςηενζηή
επακαηνμθμδυηδζδ. Καηά ηδκ εενιή πενίμδμ μζ ηζιέξ ημο δζαθοιέκμο μλοβυκμο DO ηαζ ημο pH, εκεαννφκμοκ ηζξ
δζενβαζίεξ απεθεοεένςζδξ θςζθυνμο απυ ημ ίγδια ειπθμοηίγμκηαξ ηδκ οδάηζκδ ζηήθδ (Bengtsson 1975). Οζ
ζοβηεκηνχζεζξ ηςκ ενεπηζηχκ ζοζηαηζηχκ ειθακίγμκηαζ κα επδνεάγμκηαζ απυ ηδκ αζμιάγα ηςκ θοηχκ, ηδ δζάνηεζα ηδξ
εενιήξ ηαζ οβνήξ πενζυδμο, ημ DO ηαζ ηζξ ηζιέξ ημο pH. Τρδθέξ ηζιέξ ημο pH ζοκδέμκηαζ ιε ορδθέξ ζοβηεκηνχζεζξ TN,
ηαεχξ δ αζμθμβζηή δναζηδνζυηδηα αολάκεζ ημ pH. πςξ ηαζ μζ ορδθέξ ηζιέξ ημο TP ζοκδέμκηαζ ιε ηδκ παιδθή
πενζεηηζηυηδηα DO ζηδκ οδάηζκδ ζηήθδ ηαζ εκζζπφεζ ηδκ απεθεοεένςζδ ημο θςζθυνμο απυ ημ ίγδια.
H επμπζηή δζαηφιακζδ ημο BOD5 ειθακίγεζ ηδκ ίδζα επακαθδρζιυηδηα ιε παιδθέξ ηζιέξ ηαηά ηδκ δζάνηεζα ημο
πεζιχκα, ελαζηίαξ ηδξ ιζηνήξ θοημπθαβηημκζηήξ αζμιάγαξ, εκχ αολάκεζ ημ ηαθμηαίνζ, υπμο δ απαίηδζδ ζε μλοβυκμ απυ
ημοξ ιζηνμνβακζζιμφξ βζα κα μθμηθδνχζμοκ ηδκ αενυαζα δζάζπαζδ αολάκεζ (πήια 7). Οζ ηζιέξ ηδξ Chl-a, ζδιείςζακ
16
HydroMedit 2014, November 13-15, Volos, Greece
επμπζηή δζαηφιακζδ ιε ιέβζζηεξ ηζιέξ ηαηά ηδκ δζάνηεζα ημο ηαθμηαζνζμφ ελαζηίαξ ηδξ ακάπηολδξ ημο θοημπθαβηημφ
(πήια 8).
Δπίζδξ μζ ορδθέξ ηζιέξ πθςνμθφθθδξ ειθακίζηδηακ ημ επηέιανζμ. Πανυιμζεξ ηζιέξ παναηδνήεδηακ ηαζ ζημ
πανεθευκ (Moustaka et al. 2006, Stefanidis, & Papastergiadou 2010). φιθςκα ιε ημοξ πίκαηεξ ηαηάηαλδξ μζημθμβζηήξ
πμζυηδηαξ θζικχκ (Vollenweider 1968, OECD 1982, Vollenweider & Kerekes 1982, Straskraba & Tundisi 1999, Wetzel
2001) δ θίικδ Καζημνζάξ ηαλζκμιείηαζ ςξ εοηνμθζηή ιε ζδιάδζα οπενεοηνμθζζιμφ ηαηά ηδκ δζάνηεζα ημο ηαθμηαζνζμφ
ημο 2011 υπμο δ Chl-a πανμοζζάγεζ ιέβζζηδ ηζιή ημκ Αφβμοζημ ημο 2011. Απυ ηδκ ενβαζία ηςκ Kagalou & Psilovikos
(2014) πνμηφπηεζ υηζ δ θίικδ ηδξ Καζημνζάξ ηαζ βζα ημ έημξ 2008 πανμοζζάγεηαζ απυ εοηνμθζηή ιέπνζ οπενεοηνμθζηή,
πνδζζιμπμζχκηαξ υπζ ιυκμ ημοξ πίκαηεξ ηαηάηαλδξ ηδξ μζημθμβζηήξ ηαηάζηαζδξ ηςκ θζικχκ αθθά ηαζ ημοξ δείηηεξ ηαηά
Carlson (1977).
οβηνίκμκηαξ ηα απμηεθέζιαηα ηαζ ζημοξ πέκηε ζηαειμφξ πνμηφπηεζ υηζ μζ ζηαειμί πμο ανίζημκηαζ ημκηά ζηζξ
βεςνβζηέξ εηηάζεζξ ειθακίγμοκ αολδιέκεξ ηζιέξ ενεπηζηχκ ( TN, TP) ηαηά ηδκ άκμζλδ ηαζ ημ θεζκυπςνμ, πζεακά
ελαζηίαξ ηςκ εηπθφζεςκ ηςκ βεςνβζηχκ εδαθχκ .
Δπζπνυζεεηα μ ζηαειυξ μ μπμίμξ ανίζηεηαζ ζηδκ Β.Παναθία πανμοζζάγεζ ηζξ πνχηεξ εκδείλεζξ ηςκ επεζζμδίςκ
ημο εοηνμθζζιμφ .
4.πδήηεζε
ηδκ πανμφζα ενβαζία πανμοζζάζηδηε δ επμπζηή δζαηφιακζδ ααζζηχκ αζμηζηχκ ηαζ ααζμηζηχκ παναιέηνςκ
ηδξ θίικδξ Καζημνζάξ Σα ενεπηζηά ζοζηαηζηά ειθάκζζακ επμπζηή δζαηφιακζδ υπςξ ζ΄ υθεξ ηζξ νδπέξ εοηνμθζηέξ θίικεξ
(Kagalou et al. 2008). Έηζζ ηαηά ηδκ δζάνηεζα ηδξ άκμζλδξ αολάκμκηαζ ηα ενεπηζηά ζημζπεία ελαζηίαξ ηςκ εζζνμχκ απυ
αζηζηή ηαζ βεςνβζηή νφπακζδ ιε απμηέθεζια ηδκ ακάπηολδ ημο θοημπθαβηημφ. Ζ ζοβηέκηνςζδ πνμκμζεζνχκ
δεδμιέκςκ, απμηεθεί ενβαθείμ εηηίιδζδξ ηδξ μζημθμβζηήξ ηαηάζηαζδξ ημο θζικαίμο μζημζοζηήιαημξ αθεκυξ ηαζ
αθεηένμο δζαπεζνζζηζηυ ενβαθείμ επζαμθήξ ιέηνςκ ελοβίακζδξ. ηδ ζοκέπεζα βζα κα ελεηαζηεί δ επάνηεζα ηαζ δ επζηοπία
ηςκ θδθεέκηςκ ιέηνςκ, είκαζ ζηυπζιδ δ παναημθμφεδζδ υθςκ ηςκ αζμηζηχκ ηαζ ααζμηζηχκ παναιέηνςκ, μζ μπμίμζ
ανίζημκηαζ ζε άιεζδ αθθδθεπίδναζδ ιε ηζξ αζμθμβζηέξ δζενβαζίεξ ημο ζοζηήιαημξ. Ο ηεθζηυξ ζηυπμξ είκαζ δ εθανιμβή
απμηεθεζιαηζηχκ ιέηνςκ ηαζ δ ηεθζηή αεθηίςζδ ηδξ μζημθμβζηήξ ηαηάζηαζδξ ηδξ θίικδξ, ζηυπμξ πμο επζαάθθεηαζ ηαζ
απυ ηδκ εθανιμβή ηδξ Δονςπασηήξ Οδδβίαξ 60/2000 βζα ηα οδάηζκα ζχιαηα (water bodies) ηδξ Δονχπδξ. Έηζζ είκαζ
επζαεαθδιέκδ δ ζοκεπήξ παναημθμφεδζδ ηςκ αζμηζηχκ ηαζ ααζμηζηχκ παναιέηνςκ, δ μπμία ζε αάεμξ πνυκμο εα είκαζ ζε
εέζδ κα πνμαθέπεζ ηδκ ακηαπυηνζζδ ημο μζημζοζηήιαημξ ζφιθςκα ιε ηζξ ζοκεήηεξ πμο επζηναημφκ π.π παναηεηαιέκδ
λδναζία, ορδθέξ εενιμηναζίεξ ημοξ ηαθμηαζνζκμφξ ιήκεξ, πεζιχκεξ ιε ιεζςιέκδ πζμκυπηςζδ ηθπ (Matzafleri 2007,
Matzafleri et al. 2009).
Βηβιηνγξαθία:
1. APHA, 2000. Standard Methods for the Examination of Water and Wastewater, 20 th ed. American Public Health
Association, Washington DC.
2. Bengtsson L., 1975. Phosphorus release from a highly eutrophic lake sediment, Verh. Int. Ver. Limnol., 19, 1107-
1116.
3. Bruns D. & Wiersma G., 2004. Conceptual Basis of Environmental Monitoring Systems: A Geospatial Perspective,
in Wiersma G.B. (Ed.), Environmental Monitoring, CRC Press, Florida.
4. Carpenter S., 1991. Patterns of primary production and herbivory in 25 North American lake ecosystems, In: J.Cole
et al (eds), Springer,USA.
17
HydroMedit 2014, November 13-15, Volos, Greece
5. Carlson R.E., 1977. A trophic state index for lakes. Limnology & Oceanography, 22, 2, p. 361–369.
6. European Parliament Council (2000). Directive 2000/60/EC of the European Parliamentb and of the council of 23
October 2000 establishing a framework for community action in the field of water policy.Official journal of the
European Communities,L327,1-72.
7. Heyman U, Ryding S. & Forsberg C., 1984. Frequency distribution of water quality variable, Water Research, 18,
787-794.
8. Hutulla J. & Noges J., 1998. Present state and future fate of Lake Vortsjary, In: Finish- Estorian Report: The Finish
Environment, Tampere, Finland.
9. Huszar V. & Caracao N., 1998. The relationship between phytoplankton composition and Physical - Chemical
variables, Freshwater Biology, 40, 679–696.
10. Kagalou I., Papastergiadou E. & Leonardos I., 2008. Long term changes in the eutrophication process in a shallow
Mediterranean lake ecosystem of W. Greece. Response after the reduction of extended load, Journal of
Environmental Management, 87, 497–506.
11. Kagalou I. & Psilovikos A., 2014. Assessment of the Typology and the Trophic Status of Two Mediterranean Lake
Ecosystems in Northwestern Greece. Water Resources, 41, 3, 335 – 343.
12. Kleebery A. & Kozerski H.P. 1997. Phosphorous release in Lake Grosser Muggelsee and its implications for lake
restoration, Hydrobiologia, 342, 9–26.
13. Lanaras T., Tsitsamis C., Chilichilia & Cook C., 1989. Toxic cyanobacteria in Greek freshwaters. Journal of Applied
Phycology, 1, 67–73.
14. Matzafleri N., 2007. Geographic Simulation of the Water Quality of Lake Kastoria. Postgraduate Dissertation, Dept.
of Agriculture Ichthyology & Aquatic Environment, University of Thessaly (in Greek), 257p.
15. Matzafleri N., Psilovikos Ar. & Blanta A., 2009. Water Quality Simulation Model in Lake Kastoria (Western
Macedonia – Greece), using Monitoring Data and GIS. Assessment and Management of Pollution Sources, Water
Resources Management, DOI: 10.1007/s 11269–009–9461–4.
16. Moustaka–Gouni M., Vardaka E., Michaloudi E., Kormas K., Tryfon E., Mihalatou H., Gkelis S. & Lanaras T.,
2006. Plankton Food Web Structure in a Eutrophic Polymictic Lake with a History of Toxic Cyanobacterial Blooms.
Limnololy & Oceanography, 51 (1, part 2), 715–727.
17. Organization for Economic Cooperation and Development (OECD), 1982. Eutrophication of Waters: Monitoring,
Assessment and Control. Cooperative Program on Monitoring of Inland Waters (Eutrophication Control).
Environment Directorate OECD, Paris France.
18. Schindler D., 1997. The evolution of phosphorus limitation in Lakes, Science, 195,260–262
19. Stefanidis K. & Papastergiadou E., 2010. Influence of hydrophyte abudance on the spatial distribution of
zooplankton in selected lakes in Greece. Hydrobiologia 656:55-65.
20. Straskraba M. & Tundisi J., 1999. Guidelines of lake management, International Lake Environment Committee,
Japan, 9.
21. Threlked S., 1994. Benthic-pelagic interactions in shallow water columns: and experimentalist‘s perspective,
Hydrobiologia, 275/276, 293–300.
22. Vollenweider R., 1968. Scientific Fundamentals of the Eutrophication of lakes and flowing waters with particular
reference to nitrogen and phosphorus as factors in Eutrophication, OECD, Paris.
23. Vollenweider R. & Kerekes J., 1982. Eutrophication of Waters. Monitoring, Assessment and Control, OECD, Paris.
24. Wetzel R.G., 2001. Limnology, Lake and River Ecosystems, Amsterdam, Elsevier.
18
HydroMedit 2014, November 13-15, Volos, Greece
University of Thessaly, School of Agricultural Sciences, Department of Ichthyology and Aquatic Environment,
Fytoko st., 38466, N. Ionia Magnisias, Greece
ABSTRACT
The average flow of the river Nestos is the area of the river with the largest anthropogenic interference, because
a system of two dams (Thesaurus and Platanovrisi) is operated in this region. Our study area is the reservoir of the
Thesaurus. The assessment and evaluation of the water reservoir is achieved by analyzing data at four different depths (1,
20, 40 and 70m). Applying statistical analysis extracted the following conclusion about the situation and the natural
function of the reservoir.
Upwelling and turnover phenomena were detected once a year, especially during early spring months (March),
so Thesaurus Lake is characterized as a monomictic lake.For the rest of the seasons, strong stratification was observed at
these three water bodies: Epilimnion, Metalimnion, Hypolimnion. Based on the water temperature at different depths and
the varying thickness of thermocline during the year, Thesaurus can be characterized as a deep lake. The high values of
DO on the surface (1m) from mid-March to end of April and from mid-June to mid-July are observed, meaning
photosynthesis phenomena which occur during spring and early summer, due to the evolvement of phytoplankton.
Key words: Nestos, Thesaurus, lake stratification, dissolved oxygen, water temperature
*Corresponding author: Sentas Antonis (antsentas@yahoo.gr)
ΠΔΡΗΛΖΦΖ
Ο ιέζμξ νμοξ ημο πμηαιμφ Νέζημο απμηεθεί ηδκ πενζμπή ημο πμηαιμφ ιε ηδ ιεβαθφηενδ ακενςπμβεκή
πανέιααζδ ηαεχξ ζηδκ πενζμπή αοηή θεζημονβεί ζφζηδια δφμ θναβιάηςκ ημο Θδζαονμφ ηαζ ηδξ Πθαηακυανοζδξ.
Πενζμπή ιεθέηδξ απμηεθεί δ ηεπκδηή θίικδ ημο Θδζαονμφ. Ζ εηηίιδζδ ηαζ αλζμθυβδζδ ηςκ οδάηςκ ηδξ ηεπκδηήξ θίικδξ
επζηοβπάκεηαζ ακαθφμκηαξ δεδμιέκα ζε ηέζζενα δζαθμνεηζηά αάεδ (1, 20, 40 ηαζ 70m). Δθανιυγμκηαξ ζηαηζζηζηή
ακάθοζδ ελάβεηαζ ημ παναηάης ζοιπέναζια βζα ηδκ ηαηάζηαζδ ηαζ ηδ θοζζηή θεζημονβία ηδξ.
Ζ ηεπκδηή θίικδ ημο Θδζαονμφ είκαζ ιία ιμκμιζηηζηή θίικδ, ιε ηδκ ακαζηνμθή ηςκ οδάηςκ κα ηαηαβνάθεηαζ
ιία θμνά εηδζίςξ ηαηά ημοξ ιήκεξ Φεανμοάνζμ – Μάνηζμ. Σμκ οπυθμζπμ πνυκμ πανμοζζάγεζ ζζπονή ζηνςιάηςζδ,
δδιζμονβχκηαξ ηνία ζηνχιαηα (επζθίικζμ, ιεηαθίικζμ, οπμθίικζμ). Βάζεζ ηδξ εενιμηναζίαξ ζηα δζάθμνα αάεδ ηαζ ηδξ
ιεηααμθήξ ημο πάπμοξ ημο εενιμηθζκμφξ ηαηά ηδ δζάνηεζα ημο έημοξ, ιπμνεί κα παναηηδνζζηεί ςξ ααεζά θίικδ. Καηά
ηδκ πενίμδμ Μανηίμο έςξ Απνζθίμο ηαζ απυ ηα ιέζα Ημοκίμο ςξ ηα ιέζα Ημοθίμο, ηαηαβνάθμκηαζ ορδθέξ ηζιέξ
δζαθοιέκμο μλοβυκμο μζ μπμίεξ μθείθμκηαζ ζημ θαζκυιεκμ ηδξ θςημζφκεεζδξ θυβς ηδξ ακάπηολδξ ημο θοημπθαβηημφ.
Λέξειρ Κλειδιά: Νέζηνο, Θεζαπξόο, ζηξσκάησζε ιίκλεο, δηαιπκέλν νμπγόλν, ζεξκνθξαζία λεξνύ
* οββναθέαξ επζημζκςκίαξ: έκηαξ Ακηχκδξ (antsentas@yahoo.gr)
19
HydroMedit 2014, November 13-15, Volos, Greece
1. Δηζαγσγή
Ο πμηαιυξ Νέζημξ είκαζ έκαξ απυ ημοξ ιεβαθφηενμοξ πμηαιμφξ ηδξ Δθθάδαξ ηαεχξ είκαζ μ πέιπημξ ζε ιέβεεμξ
θεηάκδξ απμννμήξ. οκζζηά δζαζοκμνζαηυ οδαηζηυ πυνμ ζηδ Βαθηακζηή πενζυκδζμ, υπμο ιμζνάγεηαζ ιεηαλφ ηςκ πςνχκ
Βμοθβανίαξ ηαζ Δθθάδαξ. πεηζηά πνυζθαηα (1997-2000) ζημ πχνμ ηδξ εκδμμνεζκήξ ημζθάδαξ ηαζ θεηάκδξ ημο Νέζημο
ηαηαζηεοάζηδηακ ηαζ θεζημφνβδζακ απυ ηδ Γ.Δ.Ζ. μζ δ ηεπκδηέξ θίικεξ ημο Θεζαπξνύ, ηδξ Πιαηαλόβξπζεο ηαζ ημο
Σεκέλνπο (οπυ ηαηαζηεοή ακαννοειζζηζηυ ένβμ ηαηάκηδ ηδξ Πθαηακυανοζδξ). Σα ένβα αοηά, ηα μπμία δέπηδηακ ηνζηζηή
απυ επζζηήιμκεξ ηαζ θμνείξ βζα πζεακέξ δοζιεκείξ επζπηχζεζξ ημοξ ζημ θοζζηυ πενζαάθθμκ, ηαηαζηεοάζηδηακ
πνμηεζιέκμο κα αλζμπμζδεεί ημ οδαηζηυ δοκαιζηυ ημο πμηαιμφ βζα ηδκ παναβςβή εκένβεζαξ, ηδκ ακηζπθδιιονζηή
πνμζηαζία ηδξ δεθηασηήξ πεδζάδαξ, ηδκ άνδεοζδ ηςκ ηαθθζενβεζχκ ηδξ ηαζ ηδκ οπμζηήνζλδ ημο οβνμημπζημφ ηδξ
πενζαάθθμκημξ. Ζ ηαηαζηεοή ηςκ θναβιάηςκ ζηδκ εκδμμνεζκή πενζμπή, έπεζ επζθένεζ ζδιακηζηέξ πενζααθθμκηζηέξ
αθθαβέξ ζημ νμο ημο πμηαιμφ ηαζ ημοξ μνβακζζιμφξ πμο γμοκ ζε αοηυκ, ηαεχξ ημ ιεβαθφηενμ ηιήια ημο ιεηαηνάπδηε
απυ πμηάιζμ ζε θζικαίμ. Ζ αλζμπμίδζδ ηςκ ιεηνήζεςκ ηςκ παναιέηνςκ ηςκ οδάηςκ ηδξ ηεπκδηήξ θίικδξ ημο
Θδζαονμφ, ημ αάεμξ ηδξ μπμίαξ θηάκεζ πενίπμο ηα 140 ιέηνα, βεβμκυξ πμο ηδκ ηαεζζηά ηδκ πζμ ααεζά θίικδ ζημκ
Δθθαδζηυ πχνμ, απμηηά ζδζαίηενμ εκδζαθένμκ βζα ημκ εκημπζζιυ ηαζ ηδ δζενεφκδζδ ζδιακηζηχκ θαζκμιέκςκ πμο
θαιαάκμοκ πχνα ζηδκ οδάηζκδ ζηήθδ.
Πενζμπή ιεθέηδξ ηδξ πανμφζδξ ενβαζίαξ απμηεθεί μ ηαιζεοηήναξ ημο Θδζαονμφ, δ έκανλδ θεζημονβίαξ ημο
μπμίμο έθααε πχνα ημ 1997. Πνζκ απυ ηδκ ηαηαζηεοή ηςκ θναβιάηςκ μ πμηαιυξ ακαπηοζζυηακ ζε ορυιεηνμ 250–
300m. Μεηά ηδκ ηαηαζηεοή ηςκ θναβιάηςκ, πένα απυ ηζξ ηεπκδηέξ θίικεξ πμο δδιζμονβήεδηακ, έπεζ πθδιιονίζεζ ιζα
εονφηενδ γχκδ ιήημοξ πενίπμο 50 km ηαζ ιέζμο πθάημοξ 250m (ημ ιέβζζημ πθάημξ λεπενκά ηαηά ηυπμοξ ηα 400m), εκχ
δ ιέζδ ζηάειδ ηςκ οδάηςκ αημθμοεεί ηδκ ζζμτρή ηαιπφθδ ηςκ 360m (Albanakis et al. 2001, Sentas & Psilovikos
2010). Ο Θδζαονυξ απμηεθεί έκα ρδθυ πςιάηζκμ θνάβια (θζευννζπημ) ιε αδζαπέναζημ ανβζθζηυ πονήκα, ημ φρμξ ημο
θηάκεζ ηα 175m, βεβμκυξ πμο ημ ηαεζζηά έκα απυ ηα ορδθυηενα βεςθνάβιαηα ηδξ Δονχπδξ. Ζ επζθάκεζα ημο
ηαιζεοηήνα είκαζ 18km2, εκχ δ ιέβζζηδ πνήζζιδ ζηακυηδηα απμεήηεοζδξ κενμφ, είκαζ ηδξ ηάλδξ ηςκ 700x106 m3. Σμ
αάεμξ ηδξ θίικδξ θηάκεζ πενίπμο ηα 140m, πνάβια πμο ηδκ ηαεζζηά ηδκ πζμ ααεζά θίικδ ζημκ Δθθαδζηυ πχνμ. Ο ηφνζμξ
ζημπυξ ημο θνάβιαημξ είκαζ δ παναβςβή οδνμδθεηηνζηήξ εκένβεζαξ. Έηζζ έπεζ ηαηαζηεοαζηεί οδνμδθεηηνζηυ
ενβμζηάζζμ, ημ μπμίμ είκαζ εβηαηεζηδιέκμ ζημ δελζυ ακηένεζζια ζε αάεμξ 400m. Λεζημονβμφκ ηνεζξ ιμκάδεξ ηςκ 100
MW δ ηαεειζά ηαζ δ παναβυιεκδ εηήζζα εκένβεζα είκαζ πενίπμο 400 GWh. Γζα ηδκ μνεμθμβζηή δζαπείνζζδ ηςκ οδάηςκ
ημο πμηαιμφ ζηδκ ηεπκδηή θίικδ, αθθά ηαζ βζα ηδ ζςζηή θεζημονβία ημο οδνμδθεηηνζημφ ζηαειμφ Θδζαονμφ (ΤΖ), εα
πνέπεζ κα βίκεζ αλζμθυβδζδ ηςκ θαζκμιέκςκ πμο θαιαάκμοκ πχνα ζηδκ οδάηζκδ ζηήθδ. Γζα ημ ζημπυ αοηυ, έβζκε
ακάθοζδ ηςκ διενήζζςκ ηζιχκ ηςκ παναιέηνςκ δηαιπκέλν νμπγφλν (DO) ηαζ ζεξκνθξαζίαο λεξνχ (Tw), λεπςνζζηά
βζα ηάεε έημξ. Οζ ιεηνήζεζξ πνμένπμκηαζ απυ ζφζηδια παναημθμφεδζδξ οδάηςκ, ημ μπμίμ εβηαηαζηάεδηε ζηδκ
εκδμμνεζκή ημζθάδα ημ 2001, απυ ηδκ ενεοκδηζηή μιάδα ΠΔΡΔΑ ημο ΑΠΘ. Απμηεθείηαζ απυ έκα ηαειυ Βάζδξ
(.Β.), έκακ Πενζθενεζαηυ (Π..) ηαζ έκα Μεηεςνμθμβζηυ ηαειυ (Μ..). Ο .Β. ηαζ μ Μ.. ανίζημκηαζ ζηδ ζηέρδ ημο
θνάβιαημξ ημο Θδζαονμφ, εκχ μ Π.. ιέζα ζηδ θίικδ (πθςηυξ).
3. Απνηειέζκαηα
Γζα ημ 2004, δ πανάιεηνμξ Tw ζηδκ ανπή ημο έημοξ ειθακίγεζ ήπζα πηςηζηή ηάζδ ζε υθα ηα ζηνχιαηα, δ μπμία
ζοκεπίγεηαζ ιέπνζ ηα ιέζα Μανηίμο μπυηε μζ ηζιέξ ζηαεενμπμζμφκηαζ, ιε ημ ακχηενμ ζηνχια ημο 1m κα ανίζηεηαζ ζημοξ
7 oC ηαζ ημ ηαηχηενμ ηςκ 70m ζημοξ 5 oC (πήια 1α). Δίκαζ πνμθακχξ δ πενίμδμξ ηδξ ακαζηνμθήξ ηςκ οδάηςκ ηαζ ηδξ
εενιμηναζζαηήξ μιμζμβέκεζαξ ηδξ ζηήθδξ ημο κενμφ. Γζα ημ οπυθμζπμ ημο έημοξ παναηδνείηαζ ζζπονή ζηνςιάηςζδ, ιε
απμηέθεζια ηδ δδιζμονβία ηνζχκ ζηνςιάηςκ: επζθίικζμ, ιεηαθίικζμ (εενιμηθζκέξ) ηαζ οπμθίικζμ. Δζδζηά βζα ηα
ααεφηενα ζηνχιαηα ηςκ 70m δ Tw δζαηδνείηαζ ζε πμθφ παιδθά επίπεδα, ιε εθάπζζηεξ δζαηοιάκζεζξ, πανμοζζάγμκηαξ ηδ
ιέβζζηδ ηζιή ζημ ηέθμξ Ημοθίμο εκχ ηαηά ημ ηέθμξ θεζκμπχνμο μδδβείηαζ ζε ζηαζζιυηδηα. Δπζζδιαίκεηαζ επίζδξ ημ
βεβμκυξ υηζ, ηαηά ηα ιέζα Οηηςανίμο μζ εενιμηναζίεξ ημο επζθακεζαημφ ζηνχιαημξ είκαζ παιδθυηενεξ απυ ηζξ
εενιμηναζίεξ ημο ζηνχιαημξ ημο αάεμοξ ηςκ 20m. Αοηυ ελδβείηαζ απυ ημ βεβμκυξ υηζ ημκ Οηηχανζμ, εκχ ημ
επζθακεζαηυ ζηνχια έπεζ ήδδ ανπίζεζ κα ρφπεηαζ ζηαδζαηά, ημ ζηνχια ηςκ 20m ελαημθμοεεί κα εενιαίκεηαζ ηαζ κα
πθδζζάγεζ ηζξ ιέβζζηεξ ηζιέξ ημο, ιε δζαθμνά θάζδξ – οζηένδζδ. Αοηά ηα θαζκυιεκα ειθακίγμκηαζ θυβς ηδξ ιεβάθδξ
εενιμπςνδηζηυηδηαξ ημο κενμφ, ημο ιεβάθμο υβημο ημο ηαιζεοηήνα (700 x 106 m3) ηαζ ημο αάεμοξ ημο (140m). Γζα ηδκ
πανάιεηνμ DO, υπςξ παναηδνείηαζ ζημ ζπήια 1α, ημ πνχημ ελάιδκμ ημο 2004 οπήνλε ζηακμπμζδηζηή μλοβυκςζδ υθδξ
20
HydroMedit 2014, November 13-15, Volos, Greece
ηδξ ζηήθδξ ημο κενμφ, βεβμκυξ πμο απμδίδεηαζ ζηζξ ζηακμπμζδηζηέξ εζζνμέξ ροπνμφ – μλοβμκςιέκμο κενμφ ημο Νέζημο
ζημκ ηαιζεοηήνα. Καηά ηα ιέζα Μανηίμο – ιέζα Απνζθίμο ηαηαβνάθμκηαζ ορδθέξ ηζιέξ DO ζημ επζθίικζμ, πμο
μθείθμκηαζ ζε αζμθμβζηέξ δζενβαζίεξ ηαηά ηδκ πενίμδμ ηδξ άκμζλδξ, πμο έπμοκ κα ηάκμοκ ιε ακάπηολδ θοημπθαβηημφ
ηαζ θαζκυιεκα θςημζφκεεζδξ. ηζξ ανπέξ Μανηίμο παναηδνείηαζ ημ πανάδμλμ θαζκυιεκμ ηα ααεφηενα ζηνχιαηα ηςκ 40
ηαζ 70m κα οπενααίκμοκ ηζξ ηζιέξ ημο DO ηςκ επζθακεζαηχκ ζηνςιάηςκ ημο 1 ηαζ 20m, πνάβια πμο απμδεζηκφεζ υηζ
ηαηά ηδκ πενίμδμ αοηή οπήνλε ιζα ακαζηνμθή ηςκ οδάηςκ, ιε μλοβυκςζδ ηαζ ηςκ ααεφηενςκ ζηνςιάηςκ, πμο
ηεηιδνζχκεηαζ ηαζ απυ ηδκ ελίζςζδ ηςκ εενιμηναζζχκ ζε υθμ ημ εφνμξ ηδξ ζηήθδξ. Μζα πνχηδ ενιδκεία ημο
θαζκμιέκμο αοημφ ιπμνεί κα απμδμεεί ζηδκ εζζνμή ιεβάθςκ υβηςκ ροπνμφ κενμφ απυ ημ Νέζημ ζημ Θδζαονυ θυβς
ηήλδξ πζμκζμφ ή εηδήθςζδξ πθδιιονζηχκ θαζκμιέκςκ. Δπίζδξ, ηαηά ημοξ ιήκεξ επηέιανζμ ηαζ Οηηχανζμ παναηδνείηαζ
πενίπμο ηαφηζζδ ηςκ ηζιχκ ημο DO ζηα 40 ηαζ 70m, εκχ πνμξ ημ ηέθμξ ημο έημοξ μζ ηζιέξ ζηα 20 ηαζ 40m οπενααίκμοκ
αοηέξ ημο επζθακεζαημφ ζηνχιαημξ υπςξ αηνζαχξ παναηδνήεδηε ηαζ ζηδκ πενίπηςζδ ηδξ Tw.
ρήκα 1: Μεηξήζεηο ησλ παξακέηξσλ (α) Tw θαη (β) DO, ζηα ηέζζεξα βάζε, γηα ην έηνο 2004
ηδκ ανπή ημο έημοξ 2005, δ πανάιεηνμξ Tw ειθακίγεζ ηδκ ίδζα ζοιπενζθμνά ιε ημ έημξ 2004, ιε ιυκδ
δζαθμνά υηζ δ πενίμδμξ ζφβηθζζδξ ηςκ Tw ζηα 4 αάεδ, εκημπίγεηαζ ζηζξ ανπέξ Φεανμοανίμο (πήια 2α). ημ δζάζηδια
αοηυ μζ ηζιέξ ζημ αάεμξ 1m ηοιαίκμκηαζ βφνς ζημοξ 9 μC, εκχ ζημ οπμθίικζμ ανίζημκηαζ ζημοξ 6,5 ιε 7 μC. Γζα ημ
οπυθμζπμ ημο έημοξ παναηδνείηαζ ζζπονή δζααάειζζδ ηδξ Tw ιε ημ αάεμξ. Οζ Tw ημο επζθακεζαημφ ζηνχιαημξ, ηαηά ηα
ιέζα Οηηςανίμο ηαζ βζα ημ έημξ 2005, ειθακίγμκηαζ παιδθυηενεξ απυ ηζξ ακηίζημζπεξ ημο ζηνχιαημξ αάεμοξ 20m, βζα
ημοξ ίδζμοξ θυβμοξ πμο ελδβήεδηακ πνμδβμφιεκα. Γζα ημ DO μζ ηζιέξ ηαηά ημ πνχημ ελάιδκμ ημο 2005 πανμοζζάγμοκ
ακμδζηέξ ηάζεζξ, ιε έκημκεξ δζαηοιάκζεζξ εκχ ζηαεενμπμζμφκηαζ απυ ημ ηέθμξ Μανηίμο έςξ ηαζ ημ Μάζμ. Δπίζδξ
παναηηδνζζηζηυ ηδξ πενζυδμο αοηήξ είκαζ μζ ζδζαίηενα ορδθέξ ηζιέξ ημο DO ζε αάεμξ 70m (πήια 2α). Καηά ηα ιέζα
Μανηίμο παναηδνείηαζ ακαζηνμθή ηςκ οδάηςκ ηδξ ζηήθδξ, ιε ηζξ ηζιέξ ζηα 40 ηαζ 70m κα οπενααίκμοκ αοηέξ ηςκ
επζθακεζαηχκ ζηνςιάηςκ. Ζ ενιδκεία ημο θαζκμιέκμο είκαζ αοηή πμο ακαπηφπεδηε ηαζ ζηδκ πενίπηςζδ ημο έημοξ
2004. Απυ ημ ηέθμξ Μαΐμο ηαηαβνάθεηαζ έκημκα πηςηζηή ηάζδ ηςκ ηζιχκ βζα υθα ηα αάεδ, ιε εκημκυηενδ βζα ηα 70m.
Δπίζδξ, ηαηά ημοξ ιήκεξ επηέιανζμ ηαζ Οηηχανζμ παναηδνείηαζ πενίπμο ηαφηζζδ ηςκ ηζιχκ ημο DO ζηα 40 ηαζ 70m.
Πνμξ ημ ηέθμξ ημο έημοξ, μζ ηζιέξ ζηα 20 ηαζ 40m οπενααίκμοκ αοηέξ ημο επζθακεζαημφ ζηνχιαημξ, βζα ημοξ θυβμοξ πμο
ακαθφεδηακ βζα ηδκ πενίπηςζδ ημο 2004. Αλζμζδιείςηδ είκαζ δ ορδθή πενζεηηζηυηδηα DO ςξ ηαζ ηα ααεφηενα
ζηνχιαηα ημο κενμφ, βεβμκυξ ελαζνεηζηά εεηζηυ βζα ηδκ ηαθή θεζημονβία ημο ηαιζεοηήνα ηαζ ημο ΤΖ. Απμηεθεί
ακαζηαθηζηυ πανάβμκηα δδιζμονβίαξ θαζκμιέκςκ ζηαζζιυηδηαξ, οπμλίαξ ηαζ πζεακήξ ακμλίαξ ηαζ δδιζμονβίαξ ημλζηχκ
εκχζεςκ (CH4, NH3, H2S), θυβς ακαβςβζηχκ δζενβαζζχκ ζοκμδεουιεκςκ ιε ηδκ πανμοζία εεζμααηηδνίςκ, υπςξ είπε
παναηδνδεεί ηαηά ηα πνχηα ζηάδζα ηδξ θεζημονβίαξ ημο (Moustaka et al. 2000, Albanakis et al. 2001).
21
HydroMedit 2014, November 13-15, Volos, Greece
ρήκα 2: Μεηξήζεηο ησλ παξακέηξσλ (α) Tw θαη (β) DO, ζηα ηέζζεξα βάζε, γηα ην έηνο 2005
Γζα ημ 2006 δ πενίμδμξ ελίζςζδξ ηδξ Tw ζηα 4 αάεδ, πναβιαημπμζείηαζ ζηα ηέθδ Ηακμοανίμο ιε ανπέξ
Φεανμοανίμο, ιε ηζιέξ απυ 6 έςξ 8,5 μC (πήια 3α). Υαναηηδνζζηζηυ είκαζ υηζ μζ ηζιέξ ζηα 70m είκαζ ίζεξ ή
ιεβαθφηενεξ απυ ηζξ ακηίζημζπεξ ηςκ 40m, απυ ηέθδ Ηακμοανίμο έςξ ιέζα Απνζθίμο. Γζα ημ οπυθμζπμ ημο έημοξ
παναηδνείηαζ ζηνςιάηςζδ ηδξ ζηήθδξ ηςκ οδάηςκ υιμζα ιε αοηή ημο 2004 ηαζ 2005. πςξ ηαζ ηα πνμδβμφιεκα έηδ,
έηζζ ηαζ ζηδκ πενίπηςζδ ημο 2006 ημ DO πανμοζζάγεζ ακμδζηέξ ηάζεζξ ημοξ πνχημοξ ιήκεξ ημο έημοξ έςξ ηα ιέζα
Απνζθίμο. ηζξ 20 ιε 25 Ηακμοανίμο παναηδνείηαζ ιζα πνμζέββζζδ ηςκ ηζιχκ ημο ζηα ηέζζενα αάεδ, ιε ηζιέξ πμο
ηοιαίκμκηαζ απυ 8 έςξ 8,5 mg/l, βεβμκυξ πμο ηαηαδεζηκφεζ ακαζηνμθή ηςκ οδάηςκ δ μπμία ηαηαβνάθεηαζ πνμκζηά
κςνίηενα απυ ηα πνμδβμφιεκα έηδ (πήια. 3α). Αοηυ είκαζ πζεακυ κα μθείθεηαζ ζημ δνζιφ ρφπμξ πμο παναηδνήεδηε ημ
ιήκα Ηακμοάνζμ ημο 2006, ιε πμθφ παιδθέξ εενιμηναζίεξ αένα ηαζ κενμφ. ημ επζθακεζαηυ ζηνχια, κςνίηενα απυ ηα
πνμδβμφιεκα έηδ έπεζε δ εενιμηναζία ζηα επίπεδα ημο οπμθζικίμο, μπυηε επήθεε ηαζ δ ζηνςιάηςζδ έκα ιήκα πζμ
κςνίξ. Απυ ηα ιέζα Απνζθίμο έςξ ηζξ ανπέξ Οηηςανίμο παναηδνείηαζ ιείςζδ ηςκ ηζιχκ ημο DO, ζε υθα ηα αάεδ. Ζ
ιείςζδ αοηή δεκ είκαζ ίδζα, ηαεχξ μζ ηζιέξ ζηα 70m δζαηδνμφκηαζ ζε ορδθά βζα ηδκ επμπή επίπεδα. Αοηυ έπεζ ςξ
απμηέθεζια κα ηαηαβνάθμκηαζ ιζηνυηενεξ ηζιέξ απυ ηζξ ανπέξ Αοβμφζημο έςξ ανπέξ Οηηςανίμο βζα ηα 20m ηαζ απυ ηζξ
ανπέξ Αοβμφζημο έςξ ηέθδ Οηηςανίμο βζα ηα 40m. Σέθμξ, απυ ηα ιέζα Οηηςανίμο έςξ ηα ιέζα Νμειανίμο, ακηίζημζπα,
ιεζςιέκεξ ηζιέξ παναηδνμφκηαζ ηαζ βζα ημ επζθακεζαηυ ζηνχια.
ρήκα 3: Μεηξήζεηο ησλ παξακέηξσλ (α) Tw θαη (β) DO, ζηα ηέζζεξα βάζε, γηα ην έηνο 2006
Οζ ιεηνήζεζξ ημο ηεθεοηαίμο έημοξ 2007 δζαθμνμπμζμφκηαζ ζε ζπέζδ ιε ηα πνμδβμφιεκα έηδ. Έηζζ δ
πανάιεηνμξ Tw ζηζξ ανπέξ ημο έημοξ πανμοζζάγεζ πηςηζηή ηάζδ, αθθά ιυκμ βζα ηα ηνία πνχηα αάεδ, εκχ μζ ιεηνήζεζξ
ηςκ 70m πανμοζζάγμοκ ακμδζηή ηάζδ ζε υθμ ημ πνχημ ελάιδκμ ημο έημοξ (πήια 4α). Ζ ζπέζδ δ μπμία παναηδνήεδηε
ακάιεζα ζηζξ εενιμηναζίεξ ηςκ 40 ηαζ 70m ανπέξ ημο 2006 παναηδνείηαζ ηαζ ημ έημξ 2007 ιε ιεβαθφηενδ υιςξ
δζάνηεζα (απυ 26/3 έςξ 25/6). Καηά ημοξ εενζκμφξ ιήκεξ ηαηαβνάθμκηαζ ορδθέξ ηζιέξ εενιμηναζζχκ ζημ επζθακεζαηυ
ζηνχια ηαζ έκημκδ ζηνςιάηςζδ βζα ηα οπυθμζπα αάεδ. Απυ ηα ιέζα Οηηςανίμο παναηδνμφκηαζ παιδθυηενεξ ηζιέξ βζα
ηζξ εενιμηναζίεξ ζε αάεμξ 1m απυ ηζξ ακηίζημζπεξ ηςκ 20m. Πνμξ ημ ηέθμξ ημο έημοξ ημ οπμθίικζμ πανμοζζάγεζ ορδθέξ
βζα ηδκ επμπή εενιμηναζίεξ, μζ μπμίεξ ημκ ηεθεοηαίμ ιήκα είκαζ ορδθυηενεξ ηςκ ακηίζημζπςκ ηςκ 40m. Γζα ημ 2007 ημ
DO πανμοζζάγεζ έκημκεξ δζαηοιάκζεζξ ηαε‘ υθδ ηδ δζάνηεζα ημο έημοξ, ηονίςξ ζημ επζθίικζμ ηαζ οπμθίικζμ. Σμοξ ιήκεξ
Απνίθζμ ηαζ Μάζμ ηαηαβνάθμκηαζ μνζζιέκεξ ηζιέξ ζημ 1m ιζηνυηενεξ απυ αοηέξ ηςκ 70m. Ηδζαίηενα ορδθέξ ηζιέξ
παναηδνμφκηαζ ζημ επζθακεζαηυ ζηνχια απυ ανπέξ Ημοκίμο έςξ ιέζα Οηηςανίμο. Σμ ακηίζημζπμ δζάζηδια ζηα 70m
ηαηαβνάθμκηαζ πμθφ παιδθέξ ηζιέξ, ιε θαζκυιεκα οπμλίαξ ηαζ ακμλίαξ ζημ οπμθίικζμ απυ ηζξ 27/8 έςξ ηζξ 23/11.
22
HydroMedit 2014, November 13-15, Volos, Greece
ρήκα 4: Μεηξήζεηο ησλ παξακέηξσλ (α) Tw θαη (β) DO, ζηα ηέζζεξα βάζε, γηα ην έηνο 2007
4. πδήηεζε
Ζ ακά έημξ ακάθοζδ μδδβεί ζηα ελήξ ζοιπενάζιαηα βζα ηδκ ηεπκδηή θίικδ ημο Θδζαονμφ:
1. Υαναηηδνίγεηαζ ςξ ιμκμιζηηζηή θίικδ, ηαεχξ ιζα θμνά ημ πνυκμ ηαζ ζοκήεςξ ηαηά ημοξ ιήκεξ Φεανμοάνζμ –
Μάνηζμ, πανμοζζάγεηαζ ημ θαζκυιεκμ ηδξ ακαζηνμθήξ ηςκ οδάηςκ ιε απμηέθεζια ηδκ ακάιζλδ ηδξ οδάηζκδξ
ζηήθδξ. Ζ ακάιζλδ ηςκ οδάηςκ έπεζ ζα ζοκέπεζα ηδκ ηοηθμθμνία ηςκ ενεπηζηχκ ζημζπείςκ πμο οπάνπμοκ ζηδκ
επζθάκεζα ηδξ θίικδξ, ζε υθδ ηδ ιάγα ημο κενμφ, εκζζπφμκηαξ ηδκ μιμζυιμνθδ ηαηακμιή ηςκ ενεπηζηχκ ζημζπείςκ
ηαζ ημο δζαθοιέκμο μλοβυκμο ζε υθδ ηδ ζηήθδ ημο κενμφ ηαηά ηδκ πενίμδμ ηδξ ακαζηνμθήξ. Σμ ζοιπέναζια αοηυ
ζοιθςκεί ηαζ ιε παθαζυηενεξ ιεθέηεξ πμο έπμοκ βίκεζ (Moustaka – Gouni et al. 2000, Albanakis et al. 2001, Sentas
& Psilovikos 2010).
2. Γζα ημοξ οπυθμζπμοξ ιήκεξ παναηδνείηαζ ζζπονή ζηνςιάηςζδ ζηδκ οδάηζκδ ζηήθδ, δδιζμονβχκηαξ ηνία ζηνχιαηα.
i. Δπηιίκλην: απακηάηαζ ζηα 0 – 5 έςξ 0 – 40m ακαθυβςξ ηδξ επμπήξ, ιε αάζδ ηδκ παναπάκς ακάθοζδ.
ii. Μεηαιίκλην ή ζεξκνθιηλέο: είκαζ ημ ιεηαααηζηυ ζηνχια κενμφ, ιεηααθδημφ πάπμοξ πμο πανμοζζάγεζ έκημκδ
δζααάειζζδ εενιμηναζίαξ ηαζ εκημπίγεηαζ ζε δζαθμνεηζηά αάεδ ηαε‘ υθδ ηδ δζάνηεζα ημο πνυκμο.
Υαναηηδνίγεηαζ απυ απυημιεξ δζαααειίζεζξ ημο DO, εκχ ηαζ μζ δφμ πανάιεηνμζ ιεζχκμκηαζ ιε ηδκ αφλδζδ ημο
αάεμοξ. Παναηδνείηαζ ιεηαλφ ηςκ 5 ηαζ 60m.
iii. Τπνιίκλην: απακηάηαζ απυ ηα 60 – 70m ηαζ ηάης, απμηεθεί ημ ααεφηενμ, ροπνυηενμ ηαζ αδζαηάναηημ ζηνχια
ηδξ θίικδξ ηαζ έπεζ ηζξ παιδθυηενεξ ηζιέξ DO ηαζ Tw. Παναηδνήεδηακ ζε εθάπζζηεξ πενζπηχζεζξ ιζηνήξ
πνμκζηήξ δζάνηεζαξ ακμλζηέξ ζοκεήηεξ.
3. Ζ Tw βζα ηδκ πενίμδμ ιεθέηδξ ειθακίγεζ ημ αλζμζδιείςημ θαζκυιεκμ ηαηά ημ μπμίμ ηα ζηνχιαηα ημο κενμφ ζε
αάεδ 20 ηαζ 40m απμννμθμφκ ηαζ απμηαιζεφμοκ εενιυηδηα ηαηά ηδ δζάνηεζα ηδξ εενζκήξ πενζυδμο ηαζ
ηαηαβνάθμοκ ηζξ ιέβζζηεξ ηζιέξ ηδξ εενιμηναζίαξ ζηα ιέζα ημο θεζκμπχνμο. Σα παναπάκς επζαεααζχκμοκ ημ
βεβμκυξ υηζ μ ηαιζεοηήναξ ημο Θδζαονμφ θεζημονβεί ζα ιζα θοζζηή ααεζά θίικδ, υπμο ημοξ ακμζλζάηζημοξ ιήκεξ ημ
εενιμηθζκέξ ζοκακηάηαζ ζε νδπά αάεδ εκχ ημοξ θεζκμπςνζκμφξ ιεηαημπίγεηαζ ααεφηενα, ηάης απυ ηα 40m, αθμφ
ιέπνζ αοηυ ημ αάεμξ θηάκεζ δ εένιακζδ απυ ημ επζθακεζαηυ ζηνχια.
4. Οζ ορδθέξ ηζιέξ ημο DO ζημ 1m, απυ ηα ιέζα Μανηίμο έςξ ηα ιέζα Ημοθίμο πενίπμο, πμο παναηδνμφκηαζ ζε υθα ηα
έηδ, μθείθμκηαζ ζημ θαζκυιεκμ ηδξ θςημζφκεεζδξ ημ μπμίμ ζοιααίκεζ ηαηά ηδ δζάνηεζα ηδξ άκμζλδξ ηαζ κςνίξ ημ
ηαθμηαίνζ ελαζηίαξ ηδξ ακάπηολδξ θοημπθαβηημφ. ηδ ζοκέπεζα, θυβς ηδξ ακάπηολδξ ημο θοημπθαβηημφ ιε
βεςιεηνζηή πνυμδμ, μζ ακάβηεξ ζε DO βζα ηδκ απμζημδυιδζδ ηςκ ενεπηζηχκ είκαζ πμθφ ιεβαθφηενεξ απυ ηδκ
πνμζθμνά θυβς θςημζφκεεζδξ, ιε απμηέθεζια κα ιεζχκμκηαζ μζ πμζυηδηεξ ημο δζαθοιέκμο μλοβυκμο ηαζ ζηαδζαηά
ημ θοημπθαβηηυ κα εακαηχκεηαζ, μπυηε ηαζ παναηδνμφκηαζ μζ παιδθυηενεξ ηζιέξ ημο DO, ιεηαλφ Οηηςανίμο –
Γεηειανίμο.
5. Καηά ηδ δζάνηεζα ημο πνχημο ελαιήκμο ηάεε έημοξ, παναηδνείηαζ ζηακμπμζδηζηή μλοβυκςζδ ηδξ οδάηζκδξ ζηήθδξ,
ιε ελαίνεζδ ηα 70m αάεμξ, ηα μπμία υπςξ έπεζ είδδ ακαθενεεί απμηεθμφκ ημ οπμθίικζμ ζηνχια. Καηά πενζυδμοξ
ηαζ ζημ οπμθίικζμ έπμοκ ηαηαβναθεί ηζιέξ ιεβαθφηενεξ απυ 7 ςξ 8,2 mg/l.
6. Απυημιεξ δζαηοιάκζεζξ ημο DO παναηδνμφκηαζ ζημ επζθακεζαηυ ζηνχια ηαζ βζα ηα ηέζζενα έηδ. Οζ έκημκεξ αοηέξ
ιεηααμθέξ ημο ζηδκ επζθάκεζα, μθείθμκηαζ ζηζξ έκημκεξ ιεηααμθέξ πμο θαιαάκμοκ πχνα ηαηά ηδ δζάνηεζα ηδξ
διέναξ. Γεκζηά εα ιπμνμφζαιε κα πμφιε υηζ δ πενζεηηζηυηδηα ζε DO ζε υθδ ηδκ οδάηζκδ ζηήθδ είκαζ
ζηακμπμζδηζηή.
23
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
έκηαξ Α., (2013). ημπαζηζηά ιμκηέθα πνμζμιμίςζδξ ζηδκ Πμζυηδηα Δπζθακεζαηχκ Τδάηςκ ζημκ Πμηαιυ Νέζημ.
Γζδαηημνζηή Γζαηνζαή, Πακεπζζηήιζμ Θεζζαθίαξ, Σιήια ΓΗΤΠ, ζεθ. 215.
Albanakis K., Mitrakas M., Moustaka-Gouni M., Psilovikos A. (2001) Determination of the environmental parameters
that influence sulphide formation in the newly formed Thesaurus reservoir, in Nestos River, Greece. Fresenius
Environmental Bulletin, 10(6):566-571
Anastassopoulos K. (2006) Treatment of big landslides affecting construction of Thissavros hydroelectric project.
Proceedings of Hydro 2006, Maximizing the Benefits of Hydropower, 2006, Greece. Paper 6.05.
Sentas A., Psilovikos A. (2010) Comparison of ARIMA and Transfer Function (TF) Models in Water Temperature
Simulation in Dam – Lake Thesaurus, Eastern Macedonia, Greece. Proceedings International Symposium:
Environmental Hydraulics, Athens, Greece, June 23-25, pp 929-934.
Sentas A., Psilovikos A. (2012) Dissolved oxygen assessment in Dam-Lake Thesaurus using stochastic modeling.
Proceedings International Conference: PRE XI, Thessaloniki, Greece, July 2012, pp 1573-1582.
Μitsiou Κ.Α., Antonopoulos, V.Ε., Papamichail, D.Μ. (1999). Statistical Analysis of Water Quality Parameters Time
Series of Strymon River. Hydrotechnika, 9: pp. 59-74 (in Greek).
Moustaka–Gouni M., Albanakis K., Mitrakas M., Psilovikos A. (2000) Planktic autotrophs and environmental conditions
in the newly-formed hydroelectric Thesaurus reservoir, Greece. Archiv. Hydrobiol., 149(3):507–526.
24
HydroMedit 2014, November 13-15, Volos, Greece
Mondal S.1, Mukherjee A. K.2, Senapati T.3, Haque S.1, Ghosh A. R.1*
1
Ecotoxicology Lab, Department of Environmental Science, The University of Burdwan, Golapbag, Burdwan 713104,
West Bengal, India
2
P.G. Department of Conservation Biology, Durgapur Govt. College, Durgapur – 14, West Bengal, India
3
School of Basic and Applied Sciences, Poornima University, Jaipur-302022, Rajasthan, India
Abstract
This paper studied the stratification of an abandoned Opencast Coal Pit (OCP) locally called „khadan‟ to establish a
relationship between the carbon content of an ecosystem and other ecological parameters like dissolved oxygen (DO),
biochemical oxygen demand (BOD) and chemical oxygen demand (COD). The carbon content of an aquatic ecosystem
indicates the productivity of the system and is mainly determined by the parameters like total organic carbon (TOC),
inorganic carbon (IC) and total carbon (TC). The reactions like photosynthesis, respiration and oxidative degradation of
organic matters are caused through chemical and biological reactions, so, the values of other ecological parameters like
DO, BOD and COD are changing according to the stratification of the OCP water body which may affect the total
amount of organic and inorganic carbon throughout the water column. DO, BOD, and COD show their changes in
concentration with the depths, temperature and seasons. Present study shows that TC and IC are positively correlated
with COD and BOD but negatively correlated with DO concentration. TOC is negatively correlated with COD and BOD
but positively related with DO concentration. This present investigation has intended to establish the mathematical
correlation and changing patterns of the ecological parameters according to the depth and seasonal variation of the OCP
water column.
Keywords: Opencast Coal Pit (OCP), Stratification, Carbon forms, Ecological parameters
* Corresponding author: Apurba Ratan Ghosh (apurbaghosh2010@gmail.com)
1. Introduction
All living organisms consist of complex molecules built on a framework of carbon atoms which are able to bind readily
with other carbon atoms along with other major elements like hydrogen, oxygen, nitrogen, phosphorus and sulfur to keep
the structure, energetics, and function of life forms (Reddy & Delaune 2008). The hydrological features with the carbon
content of lakes can influence to alter its basic appearance (Cre´taux et al. 2005), or stratification pattern all through the
column due to adverse anthropogenic activities (Jellison & Melack 1993). In an aquatic ecosystem, there is a connection
between the hydrological and carbon cycles along with the exchange of materials between terrestrial and aquatic systems
(Walling 2006; Cole et al. 2007). The amount of carbon in an aquatic ecosystem and productivity of the system are
intermingling with each other. Organic and inorganic carbons constitute the main component of total amount of the
carbon in systems which are broken down through the biological action mainly by bacteria (Findlay et al. 1993; Vervier
et al. 1993; Jones et al. 1995) and by biogeochemical processes, occurring within soil–aquatic interfaces (Hedin et al.
1998). On the other side, another main component of the surface water, the dissolved oxygen, requires for both
biodegradation of complex carbon components into simpler form as well as survival of these microbes like, bacteria, and
other aquatic organisms. So, biochemical oxygen demand (BOD) is concerned with the amount of oxygen consumed by
microorganisms to decompose the organic matters under aerobic conditions while chemical oxygen demand (COD)
relates the oxygen requirement to oxidize all organic materials both biologically available and inert organic matter into
carbon dioxide and water. Usually, there is a hydrological relation between DO, BOD and COD which can affect the
total amount of organic (TOC) and inorganic carbon (IC) in an ecosystem. In deep water body, according to its feature of
thermal stratification, DO concentration changes with depth, temperature and season. Over the last decades, not only
have new large water bodies, e.g., reservoirs, been created on the earth‘s surface, but also entirely novel aquatic systems
developed in the aftermath of mining in abandoned opencasts (Miller et al. 1996; Kru¨ger et al. 2002). Abandoned
opencast coal pits (OCPs) of Raniganj-Asansol coal field area are the important water resource of the area. The present
study is proposed to establish the mathematical correlation and changing pattern of these parameters along with the
depths of OCP water column and the seasonal variations.
25
HydroMedit 2014, November 13-15, Volos, Greece
26
HydroMedit 2014, November 13-15, Volos, Greece
by microbes. BOD is the oxygen consumption in water bodies required for TOC degradation, and increased with the
depth. COD, is also an associated indicator to consume oxygen for different chemical reactions along with oxygen taken
for respiration. In both the conditions, CO2 is generated from the containing organics, which ultimately increases the
inorganic carbon concentration in aquatic medium. Metabolic CO 2 and air CO2 are dissolved in water and produce
carbonate (CO3=) and bicarbonate (HCO3-), resulting into production of inorganic carbon (IC) content in water bodies.
These ICs are also taking part to generate the organic carbons. These assimilated and dissolved organic carbons
collectively termed as total organic carbons (TOC) and ultimately TOC and IC form the total carbon (TC) concentration
in an aquatic system. Buffering capacity of water by carbon dioxide through carbonate and bicarbonate, sometimes must
have taken influential role in total carbon concentrations in water.
4. Conclusion
The results obtained from this opencast coal mine water body are maintaining a prominent carbon cycle at epilimnion
zone throughout the water column which can be otherwise potentially used as a valuable source of water for pisciculture
by adopting a special indigenous technique called ―cage culture‖. Because at the higher depth as the concentration of the
dissolved oxygen is very low which may affect the respiration of the aquatic organisms. The schematic diagram
represents the source, labile forms of carbon in a coal mine aquatic system and also their pathway of assimilation through
the organisms. The total carbon concentration remains in equilibrium stage throughout the column where inflow occurs
from both atmospheric exchanges as well as runoff from terrestrial system but outflow in gaseous exchange.
5. Acknowledgements
The authors are grateful to the Head, Department of Environmental Science, The University of Burdwan, West Bengal,
India. The authors are also grateful to West Bengal Pollution Control Board ; Paribesh Bhavan, India for rendering helps
in the analysis of TC, IC and TOC.
6. Reference
APHA. Standard methods for the examination of water and wastewater. (2005). 21st. Ed. American Public Health
Association, the American Water Works Association and the Water Pollution ControlFederation (APHA, AWWA,
WPCF), Washington, D. C., USA.
Boehrer B., Schultze M. (2008). Stratification of lakes. Rev. Geophys 46, RG2005, doi:10.1029/2006rg000210
Cole J.J., Prairie Y.T., Caraco N.F., McDowell W.H., Tranvik L.J., Striegl R.G., Duarte C.M., Kortelainen P.,
Downing J.A., Middelburg J.J., Melack J. (2007). Plumbing the global carbon cycle: integrating inland waters into the
terrestrial carbon budget. Ecosystems 10, 171–184.
Cre´taux J.F., Kouraev A.V., Papa F., Berge´-Nguyen M., Cazenave A., Aladin N., Plotnikov I.S. (2005). Water
balance of the Big Aral Sea from satellite remote sensing and in situ observations. J Great Lakes Res 31(4), 520–534.
Findlay S., Strayer D., Goumbala C., Gould K. (1993). Metabolism of streamwater dissolved organic carbon in the
shallow hyporheic zone. Limnol Oceanogr 38, 1493–1499.
Hanson P.C., Bade D.L., Carpenter S.R., Kratz T.K. (2003). Lake metabolism: relationships with dissolved organic
carbon and phosphorus. Limnology and oceanography 48, 1112–1119.
Hedin L.O., von Fischer J.C., Ostrom N.E., Kennedy B.P., Brown M.G., Robertson G.P. (1998). Thermodynamic
constraints on nitrogen transformations and other biogeochemical processes at soil–stream interfaces. Ecology 79 684–
703.
Jellison R., Macintyre S., Millero F.J. (1999). Density and conductivity properties of Na-CO3-Cl-SO4 brine from
Monolake, California, USA. int J Salt lake; res 8, 41–53. doi:10.1007/bf02442136
Jones J.B., Jr Fisher S.G., Grimm N.B. (1995). Vertical hydrologic exchange and ecosystem metabolism in a sonoran
desert stream. Ecology 76, 942–952.
Kru¨ger B., Kadler A., Fischer M. (2002) The creation of post-mining landscapes of lignite mining in the New Federal
States, Surface Mining-Braunkohle and other minerals. 54, 161–169.
Miller G.C, Lyons W.B., Davis A. (1996) Understanding pit water quality. Environ. Sci Technol 30,118–123.
Reddy K.R., Delaune R.D. (2008). Biogeochemistry of wetlands science and application. Crc press, Boca Raton, FL.
Schwoerbel J. (1999). einfu¨hrung in die limnologie, 6th edn. gustav fischer, stuttgart, Germany.
Vervier P., Dobson M., Pinay G. (1993). Role of interaction zones between surface and ground waters in doc transport
and processing: considerations for river restoration. Freshwat Biol, 29,275–284.
Walling D.E. (2006). Human impact on land-ocean sediment transfer by the world‘s rivers. Geomorphology 79,192–
216.
Wetzel R.G. (2001). limnology: lake and river ecosystems, 3rd edn. Academic. san diego, calif.
27
HydroMedit 2014, November 13-15, Volos, Greece
28
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1. Analysis of DO as per Figure 2. Analysis of BOD as per Figure 3. Analysis of COD as per
season and depth season and depth season and depth
Figure 4. Analysis of TOC as per Figure 5. Analysis of BOD as per Figure 6. Analysis of COD as per
season and depth season and depth season and depth
Figure 7. Interrelationship among the different forms of carbon and their exchange pathway in an aquatic
ecosystem
29
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
In the present study, we investigated the hypothesis that adaptation of killifish to thermal extreme of hot spring is
associated with the regulation of genes involved in stress response and metabolic regulation. We exposed a killifish
species Aphanius dispar to long term (44 days) thermal regime of hot spring environment (37-40°C) and examined the
liver mRNA expression of heat shock proteins (Hsp70, Hsp90ɑ, Hsp90b), glucokinase (gck), and high mobility group b1
(hmgb1) protein using quantitative real-time PCR. Our results showed that the transcripts of Hsp70 and Hsp90b were
mildly induced (>twofold) the time when temperature reached to 37-40°C, while the transcripts of other homologous
encoding for Hsp90a was strongly induced (17 fold increase). After 44 days of keeping in extreme, the levels of Hsp90ɑ
was dramatically up regulated, so that it was approximately 42 foldchange higher than the ambient temperature, but
Hsp90b was only two foldchange more upregulated. Our results showed a significant up regulation of hmgb1 (2-fold
increase) during the first day of exposure to thermal extreme compared with fish kept at ambient temperature. Moreover,
liver gck transcript levels were strongly affected by temperature, so that significant downregulation of gck transcripts was
observed at the time when temperature was raised to 37-40 °C (80-fold decrease) and during exposure to long term
thermal extreme (56-fold decrease). The preliminary conclusion can be drawn that killifish has hsp90ɑ is likely to be
responsible for an adaptive heat shock response during extended exposure to thermal extreme of hot spring environment.
1. Introduction
With reference to temperature, thermal waters are normally considered as those having temperatures sufficiently
high so that members of the general freshwater fauna do not usually live in them. Nevertheless, some fish species have
successfully survived and acclimated to the high temperature of hot springs. The presence of a few cyprinid, cyprinodont
and cichilid species in the hot spring environment (Coad, 1980; Piazzini et al., 2010; Tutar and Okan, 2012) seems to be
a remarkable phenomenon as prolonged exposure to such thermal extremes may result in rapid deterioration in
physiologic state (LeMoullac and Haffner, 2000). Because these thermal effects have such major consequences for
cellular function, fish in thermal waters are assumed to manifest extensive evolutionary adaptations that establish distinct
thermal optima and limits for physiological function, as well as the capacity for altering the phenotype in response to
constant thermal extremes that could vastly impact various life-history stages (e.g. early development, reproduction).
Thermal acclimation responses in teleosts commonly result in gene expression changes at a large number of loci
associated with protein processing, transcription and translation (Narum et al., 2013). Current molecular and genomic
tools provide the opportunity to investigate the heat shock response of fishes from varying thermal regimes and link that
information with adaptive regions of the genome that may be under selection. It is known that changes in expression of
the genes involved in protein homeostasis, cell cycle control, cytoskeletal reorganization, cell growth and proliferation,
and signal transduction, as well as several other categories have been associated with thermal acclimation in fish (e.g.
Podrabsky and Somero, 2004; Buckley et al., 2006). Specifically, the heat-shock protein (HSP) response has been
demonstrated to be one of the most important cellular mechanisms to prevent the damaging effects of thermal cellular
30
HydroMedit 2014, November 13-15, Volos, Greece
stress (Feige et al. 1996). Hsp70 and Hsp90 are known to be the most strongly upregulated genes in response to chronic
high temperatures in fish (Podrabsky and Somero, 2004). The regulatory factors and signaling pathways shaping
metabolism and mitochondrial functioning may be also important for thermal adaptation or sensitivity (Windisch et al.,
2011). The expression of genes involved in regulating metabolism may be expected to respond to heat shock, as cellular
energy pools are accessed to fuel stress response and repair mechanisms.
In south of Iran, there exists a geothermal hot spring, called Geno hot spring where a killifish species Aphanius
ginaonis occurs (Reichenbacher et al., 2009). A. ginaonis is exclusive to the Geno hot spring, where it is the only native
species (Coad, 2000). It has been stated that A. ginaonis is the sister taxon to a geographically close A. dispar population
from Hormozgan, Iran in which was introduced to this stream many years ago (Hrbek and Meyer, 2003). According to
our monthly measurements, the water temperature of this hot spring is almost in the range of 37 – 40 °C throughout the
year. Despite the importance of hot springs as unique environments with constant thermal extremes beyond the tolerance
of many fish species, little is known about the adaptation of fish to such high temperature in this ecosystem. Because of
its ability to thrive in this high temperature environment, we reasoned that killifish would be an excellent study organism
for examining the adaptive responses of fish to extreme environmental conditions of hot springs. Here, in an effort to
elucidate the mechanisms that may be responsible for the capacities of killifish to cope so successfully with thermal
extremes similar to hot springs, we exposed A. dispar to long term thermal regime similar to Geno hot spring
environment and studied and compared the profile of the expression of some candidate genes associated with stress
response and metabolic regulation. heat shock proteins (Hsp70, Hsp90ɑ, Hsp90b), glucokinase (gck), and high mobility
group b1 (hmgb1) protein have been chosen as genes in which the transcription changes were studied.
The procedure of sampling and common garden experiments has earlier been described by Akbarzadeh et al
(2014). Briefly, the samples of killifish were collected from adjacent rivers near to the Geno hot spring Hormozgan, Iran
using a small seine net in November 2012. Fish were transferred to the Aquaculture laboratory of University of
Hormozgan, where they were held in 300-l circular tanks at ambient temperature (24 °C). Following a week of holding at
ambient temperature, 114 uniform sized animals were equally distributed between two groups including a control group
(24 °C) and a treatment group (37-40 °C) with each replicated three times in 100 L tanks with a stocking density of 25
individuals/100 L water. Treatment tanks were raised gradually to 37-40 °C over the course of seven days at a rate of 2
°C per day. Once at this temperature, 10 individuals were sampled and killed with an overdose of anesthetic (MS-222
tricaine methanesulfonate) and the liver tissue was dissected from each fish and immediately deep-frozen in liquid
nitrogen, and stored in a −80 °C freezer until RNA extraction. This temperature regime was designed to mimic the
natural temperature experienced daily by A. ginaonis in Geno hot spring. The animals in control and thermal tanks were
then maintained for a further 44 days. After 44 days, 10 specimens of killifish from both stressed exposed and control
groups were sampled as described before. Prior to the tissue sampling, the length and weight of each fish were
determined and the growth parameters of both control and thermal stress treatments were measured (Akbarzadeh et al.,
2014).
For RNA preparation, 100 mg portion of liver tissue from six individual (n = 6) under each of the thermal
conditions was cut and homogenized in a Qiagen Tissue Lyser using 1 ml Tri Reagent TRI Reagent® (Ambion, Austin,
TX, USA), treated with DNase (Promega, USA) in accordance with the manufacturers‘ instructions. RNA quantification
was carried out with a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA) reading at
260/280 nm and the quality of the RNA checked with the Bioanalyzer 2100 using the 6000 Nano LabChip kit (Agilent
Technologies). All RNA integrity number values obtained were >8, indicative of excellent RNA integrity and quality.
One microgram of total RNA was used to synthesize first-strand cDNAs using iScript™ cDNA Synthesis kit (BioRad)
for RT-PCR, following the manufacturer‘s instructions and a mixture of oligo-dT as primer.
The qPCR primers for Hsp70, Hsp90ɑ, Hsp90b, gck, hmgb1, actin beta (ACTB) and elongation factor alpha
(EF1A) were designed based on the sequences from killifish species and conserved regions of the teleost sequences
available in the GenBank. Multiple qPCR primer combinations were designed for each gene using Primer3 and tested
(Table 1). The specificity and size of the amplicons obtained with primer pairs was checked on a 1.5% agarose gel. The
31
HydroMedit 2014, November 13-15, Volos, Greece
fragments were sequenced using the ABI 3130 Genetic Analyzer (Applied Biosystems). The identities of the sequences
were verified by BLAST search against the GenBank database (http://ncbi.nlm.nih.gov/BLAST).
Quantitative real-time PCR was run on QuantStudio™12K Flex Real-Time PCR System (Applied Biosystems)
with iTaq™ Universal SYBR® Green supermix (2x) (BioRad) and all primers at 100 nM using standard protocol: initial
denaturation at 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 s and annealing/ extension at 60 °C for 1 min.
All reactions were run in triplicate. The mRNA expression levels of genes were recorded as Ct values that corresponded
to the number of cycles at which the fluorescence signal can be detected above a threshold value. Baseline and threshold
for Ct calculation were set automatically using the QuantStudio™ 12K Flex Software v1.2.1 (Applied Biosystems).
Conversion of Ct values to relative quantities was done using standard curves. Standard curves were constructed from
dilution series of pooled cDNA (including five dilutions from 1/10 to 1/1000), and the PCR efficiency was calculated
using the equation E% = (101/slope _ 1) × 100. Data of each target gene were then normalized with the geometric mean of
the two reference genes.
Differences in normalized mRNA expression levels of Hsp70, Hsp90ɑ, Hsp90b, gck and hmgb1 between
control and treatment groups were analyzed by a one-way analysis of variance (ANOVA), followed by a Tukey‘s HSD
post hoc analysis for multiple comparisons. Differences were considered statistically significant at P < 0.05. SPSS
software (version 18.0) was used for statistical analysis.
Table 1. Primers used for qPCR reference and target genes in the present study.
GCCCTCTTGTTGTCTCTGATGT
CTCGTCCTCAGGCAGCTC
GCTCGACGAATGCAGAGTT
CCTTGTCATATTTCTCCTTCAGC
Gck GCACTGGCTGTAATGCTTGTT 89
ACTCCGTGTTCACACACATCC
ACTB CCCACCAGAGCGTAAATACTC 90
CTCCTGCTTGCTGATCCACA
GCCTTGGGTGGGTCGTTC
32
HydroMedit 2014, November 13-15, Volos, Greece
3. Results
There was a significant increase in hsp70 mRNA expression at the time when temperature was raised to 37-40
°C. After 44 days at this temperature, the level of hsp70 transcripts remained higher compared with control group (Figure
1). However, in treatment d44T, hsp70 transcripts decrease but it was not statistically significant. The transcription of
both isoforms of Hsp90 (Hsp90a and Hsp90b) was constant during the 44 days of our experiment on fish kept at normal
temperature. There was a significant increase in Hsp90a in fish (17 fold increase) at the time temperature reached to 37-
40 °C. After 44 days, the levels of hsp90ɑ was strongly up regulated during exposure to long term thermal extreme so
that it was approximately 42 foldchange higher than the ambient temperature (Figure 1). In thermal stress temperature,
Hsp90b was significantly up regulated at the time when temperature was raised to 37-40 °C and after 44 days at this
temperature. However, the amount of increase in Hsp90b levels was not as high as Hsp90a and it was only about two
foldchange more upregulated (Figure 1). In fish exposed to the temperature of hot spring, a significant increase (2-fold
increase) was found in the hmgb1 mRNA levels when compared with control group. After 44 days, hmgb1 transcripts
were elevated significantly in both fish kept at ambient temperature and 37-40 °C compared with control group at the
first day of exposure.
There was a significant decrease (80-fold increase) in gck mRNA expression at the time when temperature was
raised to 37-40°C. After 44 days of the beginning of our experiment, gck transcripts were significantly increased (8-fold
increase) in fish kept at ambient temperature. Moreover, gck mRNA expression was dramatically down regulated during
exposure to long term thermal extreme so that it was approximately 56 foldchange lower than the ambient temperature
(Figure 2).
4. Discussion
Very little currently is known about the molecular mechanisms underlying the adaptation of organisms to
extreme environmental conditions such as geothermal springs. Some killifish species could successfully acclimate to
extreme environmental conditions of hot spring. So, we reasoned that killifish would be an excellent study organism for
examining the adaptive responses of fish to extreme environmental conditions. In the present study, we exposed a
killifish species A. dispar to constant thermal regime of hot spring environment (37-40°C) and examined the liver mRNA
expression of some candidate genes involved in heat shock response and metabolism. The results of the current study in
killifish demonstrates that a portion of individual fish may acclimate to thermal extremes and survive, but also that
experimental fish have evolved an adaptive heat shock response in the environment similar to the temperature of hot
spring. Overall, results of our molecular data showed that the mRNA expression of Hsp70, Hsp90a, Hsp90b and hmgb1
were significantly upregulated as soon as the fish exposed to 37-40. On the contrary, the transcripts of gck were
dramatically declined during which fish exposed to the thermal regime of hot spring.
33
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1. Relative mRNA expression levels (means ± SE) of hsp70, hsp90a, hsp90b and hmgb1 in killifish kept in
thermal extreme. d1C: Control day 1, d1T: Thermal day 1, d44C: Control day 44, d44T: Thermal day 44. Treatments
with different letters are significantly different at P < 0.05.
Figure 2. Relative mRNA expression levels (means ± SE) of gck in killifish kept in thermal extreme. d1C: Control day 1,
d1T: Thermal day 1, d44C: Control day 44, d44T: Thermal day 44. Treatments with different letters are significantly
different at P < 0.05.
Our results showed that heat-shock proteins Hsp70 and one isoform of Hsp90 (Hsp90b) were mildly induced
(>twofold) by elevated temperatures, while the transcripts of other homologous encoding for Hsp90a was strongly
induced when fish exposed to long term thermal regime of hot spring. If the mRNA levels indicate differences in
functionally active proteins, the correlation between HSP expression and temperature elevation might reflect a direct role
of the heat shock proteins in thermal tolerance in hot spring by killifish. The HSP response has been demonstrated to be
one of the most important cellular mechanisms to prevent the damaging effects of thermal cellular stress (Feige et al.
1996; Sorensen, 2010). HSPs are molecular chaperones which are involved in maintaining regular cellular functions with
a crucial role in protein folding, unfolding, aggregation, degradation, and transport (Sorensen et al. 2003). The role of
HSPs in cell protection and as stress markers has been well-recognized in many organisms, although considerable
variability in the HSPs stress response was also observed in some marine organisms depend on species, tissue, HSP
34
HydroMedit 2014, November 13-15, Volos, Greece
family, developmental stage, and stressor (Iwama et al. 2004; Rosic et al., 2011). Both Hsp70 and Hsp90 are known to be
the most strongly upregulated genes in response to chronic high temperatures in fish (e.g. Podrabsky and Somero, 2004;
Buckley et al., 2006). Our results in killifish showed that one isoform of hsp90 (hsp90a) is transcriptionally more
regulated during which fish maintained in thermal extreme, whereas the transcription of the other isoform was mildly
induced. HSP90α, is an abundant, well conserved cytosolic protein that accounts for 1–2% of all cellular proteins in most
cells under basal, non stress conditions and the levels increase in response to heat stress and other proteotoxic insults
(Bagatell et al., 2000). HSP90α plays a key role in the response of cells to stress and is thought to be important in
buffering cells against the effects of mutation (Maloney and Workman, 2002; Padmini and Rani, 2009). Consistent with
these, our results provide evidence that keeping in thermal extreme differentially modulate HSP90α expression in fish
hepatocytes.
Our results showed a significant up regulation of hmgb1 gene during the first day of exposure to thermal
extreme compared with fish kept at ambient temperature. However, unlike the thermal treatment, the transcript levels for
hmgb1 significantly increased after keeping at constant 25°C for 44 days. These results provide further evidence that this
gene is involved in temperature responses. It has been known that HMGB1 binds DNAs and functions as a DNA
chaperone, modulating multiple processes in chromatin, including transcription, replication, recombination, DNA repair,
and genomic stability (Stros, 2010; Tsan, 2011). A study of transcriptome changes in the liver of the eurythermal
killifish, Australofundulus limnaeus during thermal acclimation (Podrabsky and Somero 2004) has revealed a role for
HMGB1 as a putative global regulator of transcription in response to temperature (Podrabsky and Somero, 2004).
According to Podrabsky and Somero (2004), HMGB1 mRNA content increases in response to a temperature decrease
(either diurnal or seasonal) to effectively counteract the tendency of DNA to assume a more closed configuration at lower
temperatures. HMGB1 promotes transcription, not in a global non-targeted fashion but by maintaining an ‗open‘ DNA
configuration of transcription factors and thereby allowing sequence-specific access to gene promoter regions (Roelofs,
et al., 2010).
In this study, we also found that gck mRNA expression was dramatically declined during which fish exposed to
thermal stress. Our results indicate that liver gck transcript levels were strongly affected by temperature. The remarkable
downregulation of gck during keeping in thermal extreme in killifish is likely to be associated with the concentration of
glucose. Glucokinase is an enzyme that catalyzes the phosphorylation of glucose to glucose 6-phosphate and is mainly
expressed in liver and pancreatic α-cells, where it plays a key role in glucose metabolism (Caseras et al., 2000). G6P, the
product of glucokinase, is the principal substrate of glycogen synthesis, and glucokinase has a close functional and
regulatory association with glycogen synthesis. When ample glucose is available, glycogen synthesis proceeds at the
periphery of the hepatocytes until the cells are replete with glycogen. When killifish held in a high temperature of hot
spring, it is possible that hepatic glycogen stores are depleted as a result of this chronic thermal stress. So, higher
activities of glycolytic enzymes after exposure to high temperature may be necessary to cope with the increased energy
demand of the liver, including enhanced gluconeogenesis, which is required to re-establish homeostasis. On the contrary,
the activity of enzymes involved in glycogen synthesis like glucokinase might be decreased under thermal stress.
Therefore, the remarkable downregulation of glucokinase in hepatocites of killifish under thermal extreme can be
associated with a decrease in glucose 6-phosphate activity and depletion in glycogen synthesis. In a killifish, species A.
limnaeus the levels of gck were also reduced during chronic thermal acclimation (Podrabsky and Somero 2004). In
another study, hepatic Glucokinase showed different pattern of mRNA expression in two populations of Fundulus
heteroclitus in response to handling stress. In one population, glucokinase mRNA increased significantly in response to
stress, while in other population glucokinase mRNA declined (Picard and Schulte, 2004).
References
Akbarzadeh A., Mosayebi A.N., Noori A., Parto P., Asadi M., Yousefzadi M., Dehghani H., Kamrani E., (2014).
Responses of killifish (Aphanius dispar) to long-term exposure to elevated temperatures: growth, survival and
microstructure of gill and heart tissues. Marine and Freshwater Behaviour and Physiology.
10.1080/10236244.2014.952989.
Bagatell R., Paine-Murrieta G.D., Taylor C.W., Puccini E.J., Acing S., Benjamin I.J., Whitesell L. (2000). Induction of a
heat shock factor1-dependent stress response alters the cytotoxic activity of HSP90-binding agents. Clin. Cancer
Res. 6, 3312–3318.
35
HydroMedit 2014, November 13-15, Volos, Greece
Buckley B.A., Gracey A.W., Somero G.N. (2006). The cellular response to heat stress in the goby Gillichthys mirabilis: a
cDNA microarray and protein-level analysis. Journal of Experimental Biology 209, 2660-2677.
Caseras A., Meton I., Fernandez F., Baanante I.V. (2000). Glucokinase gene expression is nutritionally regulated in liver
of gilthead sea bream (Sparus aurata). Biochimica et Biophysica Acta 1493, 135-141.
Coad B.W. (1980). A re-description of Aphanius ginaonis (Holly, 1929) from southern Iran (Osteichthyes:
Cyprinodontiformes). Journal of Natural History 14, 33–40.
Coad B.W., (2000). Distribution of Aphanius species in Iran. Journal of the American Killifish Association 33, 183–191.
Feige U., Morimoto R.I., Yahara I., Polla B.S. (1996). Stress-inducible cellular responses. Birkhauser Verlag, Basel,
Switzerland.
Hrbek T., Meyer A. (2003). Closing of the Tethys Sea and the phylogeny of Eurasian killifishes (Cyprinodontiformes:
Cyprinodontidae). Journal of Evolutionary Biology 16, 17–36.
Iwama G.K., Afonso L.O.B., Todgham A., Ackerman P., Nakano K. (2004). Are Hsp suitable for indicating stressed
states in fish? Journal of Experimental Biology. 207, 15-19.
LeMoullac G., Haffner P. (2000). Environmental factors affecting immune responses in Crustacea. Acluaculture 191,
121-131.
Maloney A., Workman P. (2002). HSP90 as a new therapeutic target for cancer therapy: the story unfolds. Expert Opin.
Biol. Ther. 2, 3–24.
Narum S.R., Campbell N.R., Meyer K.A., Miller M.R., Hardy R.W. (2013). Thermal adaptation and acclimation of
ectotherms from differing aquatic climates. Molecular Ecology 22, 3090-3097.
Padmini E., Rani M.U. (2009). Seasonal influence on heat shock protein 90α and heat shock factor 1 expression during
oxidative stress in fish hepatocytes from polluted estuary. Journal of Experimental Marine Biology and Ecology
372, 1–8.
Podrabsky J.E., Somero G.N. (2004). Changes in gene expression associated with acclimation to constant temperatures
and fluctuating daily temperatures in an annual killifish Austrofundulus limnaeus. Journal of Experimental
Biology 207, 2237-2254.
Piazzini S.,Lori E., Favilli, L., Cianfanelli S., Vanni S., Manganelli G. (2010). A tropical fish community in thermal
waters of southern Tuscany. Biological Invasions 12, 2959-2965.
Picard D.J., Schulte P.M. (2004). Variation in gene expression in response to stress in two populations of Fundulus
heteroclitus. Comparative Biochemistry and Physiology Part A 137, 205–216.
Reichenbacher B., Kamrani E., Esmaeili H.R., Teimori A. (2009). The endangered cyprinodont Aphanius ginaonis
(Holly, 1929) from southern Iran is a valid species: evidence from otolith morphology. Environmental Biology of
Fishes 86, 507–521.
Roelofs D., Morgan J., Sturzenbaum S. (2010). The significance of genome-wide transcriptional regulation in the
evolution of stress tolerance. Evol Ecol 24, 527–539.
Rosic N.N., Pernice M., Dove S., Dunn S., Hoegh-Guldberg O. (2011). Gene expression profiles of cytosolic heat shock
proteins Hsp70 and Hsp90 from symbiotic dinoflagellates in response to thermal stress: possible implications for
coral bleaching. Cell Stress Chaperones 16, 69-80.
Sorensen J.G., Kristensen T.N. Loeschcke, V. (2003). The evolutionary and ecological role of heat shock proteins. Ecol.
Lett. 6, 1025–1037.
Stros M. (2010). HMGB proteins: interactions with DNA and chromatin. Biochim Biophys. Acta 1799, 101-113.
Tsan M. F. (2001). Heat shock proteins and high mobility group box 1 protein lack cytokine function. Journal of
Leukocyte Biology 89, 847-853.
Tutar Y., Okan S. (2012). Heat shock protein 70 purification and characterization from Cyprinion macrastomus
macrastomus and Garra rufa obtusa. Journal of Thermal Biology 37, 95–99.
Windisch H.S., Kathöver R., Pörtner H.O., Frickenhaus S., Lucassen M. (2011). Thermal acclimation in Antarctic fish:
transcriptomic profiling of metabolic pathways. American Journal of Physiology - Regulatory, Integrative and
Comparative Physiology 301, R1453–R1466.
akbarzadeh@alumni.ut.ac.ir
36
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
AQUACULTURE
37
HydroMedit 2014, November 13-15, Volos, Greece
Syvri R.1*, Neofitou N.1, Vafidis D.1, Mente E.1, Panagiotaki P.1, Tziantziou L.1
1
Department of Ichthyology and Aquatic Environment, School of Agricultural Sciences, University of Thessaly, Fytokou
str., N. Ionia, 38446 Volos, Greece
ABSTRACT
The effects of conventional and organic fish farming on macrofauna communities in Evoikos gulf, in Larymna were
investigated. In the area three sampling stations were selected. At each station seasonal sediment samples were collected
for analysis of grain-size, organic matter, organic carbon and benthic community parameters. Samples were separated
and sorted and benthic community parameters were calculated. The results of statistical comparisons between
concentrations of organic matter and organic carbon indicated no significant interaction among stations and seasons
(two-way ANOVA), while the one-way ANOVA indicated significant differences between stations. Species diversity
and evenness were higher at organic farm station and control station than at conventional farm station. The polychaete
Capitella capitata was the most dominant species. The SIMPER analysis indicated that the highest dissimilarity observed
between conventional and organic farm stations and the species mainly responsible for the dissimilarity was principally
the polychaete C. capitata. The two-way ANOVA showed significant interaction among stations and seasons for all
benthic community parameters, except for species number and species richness. Furthermore, one-way ANOVA
indicated that the significant differences detected in the biotic data, were spatial for Shannon‘s diversity index and
species evenness. According to the results of this study the conclusion was that the organic farming could reduce the
negative effects of aquaculture on macrofauna communities.
Key words: Larymna, organic aquaculture, macrofauna.
*Corresponding author: Syvri Rafailia (r.sivri@yahoo.gr)
πβξή Ρ.1*, Νενθχηνπ Ν.1, Βαθείδεο Γ.1, Μεληέ Δ.1, Παλαγησηάθε Π.1, Σδηάληδηνπ Λ.1
1
Σιήια Γεςπμκίαξ Ηπεομθμβίαξ ηαζ Τδάηζκμο Πενζαάθθμκημξ, πμθή Γεςπμκζηχκ Δπζζηδιχκ, Πακεπζζηήιζμ
Θεζζαθίαξ, Οδυξ Φοηυημο, Ν. Ηςκία, 38446, Βυθμξ, Δθθάδα
ΠΔΡΗΛΖΦΖ
Με ζημπυ ηδκ εηηίιδζδ ηδξ επίδναζδξ ηδξ ζοιααηζηήξ ηαζ αζμθμβζηήξ οδαημηαθθζένβεζαξ ζημ ιαηνμγςμαέκεμξ ζηδκ
πενζμπή ηδξ Λάνοικαξ, επζθέπεδηακ ηνεζξ δεζβιαημθδπηζημί ζηαειμί, απυ ημοξ μπμίμοξ θήθεδηακ επμπζηά δείβιαηα
ζγήιαημξ βζα ημκ πνμζδζμνζζιυ ηδξ ημηημιεηνζηήξ ζφζηαζδξ, ημο μνβακζημφ οθζημφ, ημο μνβακζημφ άκεναηα ηαζ ημο
ιαηνμγςμαέκεμοξ. Έβζκε δζαπςνζζιυξ ηαζ ηαλζκυιδζδ ηςκ μνβακζζιχκ ημο ιαηνμγςμαέκεμοξ ηαζ εηηίιδζδ ηδξ
ηαηάζηαζδξ ηςκ εζδχκ ιε μζημθμβζημφξ δείηηεξ. Ζ πμθοπαναβμκηζηή ακάθοζδ δζαηφιακζδξ έδεζλε ιδ ζδιακηζηή
αθθδθεπίδναζδ ιεηαλφ ζηαειχκ ηαζ επμπχκ ηυζμ βζα ημ μνβακζηυ οθζηυ υζμ ηαζ βζα ημκ μνβακζηυ άκεναηα, εκχ δ
ιμκμπαναβμκηζηή ακάθοζδ δζαηφιακζδξ έδεζλε υηζ οπάνπμοκ ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ ιεηαλφ ηςκ ζηαειχκ. Ο
ζηαειυξ εθέβπμο ηαζ μ ζηαειυξ ηδξ αζμθμβζηήξ εηηνμθήξ πανμοζζάγμοκ ιεβαθφηενδ πμζηζθμιμνθία εζδχκ ηαζ είκαζ πζμ
μιμζμβεκείξ υζμκ αθμνά ηδ ιαηνμγςμαεκεζηή ημοξ ζφζηαζδ, ζε ζπέζδ ιε ημ ζηαειυ ηδξ ζοιααηζηήξ εηηνμθήξ.
Δπζηναηέζηενμ είδμξ είκαζ μ πμθφπαζημξ Capitella capitata. φιθςκα ιε ηδκ ακάθοζδ πμζμζημφ μιμζυηδηαξ ηςκ
38
HydroMedit 2014, November 13-15, Volos, Greece
ιαηνμγςμαεκεζηχκ εζδχκ ημ ορδθυηενμ πμζμζηυ ακμιμζυηδηαξ παναηδνείηαζ ιεηαλφ ηςκ ζηαειχκ ηδξ ζοιααηζηήξ ηαζ
αζμθμβζηήξ εηηνμθήξ ηαζ μθείθεηαζ ηονίςξ ζηδκ πανμοζία ημο είδμοξ C. capitata. Ζ πμθοπαναβμκηζηή ακάθοζδ
δζαηφιακζδξ ηςκ δζαθυνςκ παναηηδνζζηζηχκ ημο ιαηνμγςμαέκεμοξ έδεζλε ζδιακηζηή αθθδθεπίδναζδ ιεηαλφ ζηαειχκ
ηαζ επμπχκ βζα υθεξ ηζξ παναιέηνμοξ, εηηυξ απυ ημκ ανζειυ ηςκ εζδχκ ηαζ ημ δείηηδ αθεμκίαξ. Ζ ιμκμπαναβμκηζηή
ακάθοζδ δζαηφιακζδξ έδεζλε υηζ μζ δζαθμνέξ πμο παναηδνμφκηαζ ζημοξ δείηηεξ πμζηζθυηδηαξ ηαζ μιμζμιμνθίαξ είκαζ
πςνζηέξ. Σα απμηεθέζιαηα ηδξ πανμφζαξ ένεοκαξ δείπκμοκ υηζ μ ααειυξ επίδναζδξ ηδξ αζμθμβζηήξ οδαημηαθθζένβεζαξ
ζημ ιαηνμγςμαέκεμξ είκαζ ιζηνυηενμξ απυ αοηυκ ηδξ ζοιααηζηήξ.
Λέξειρ κλειδιά: Λάξπκλα, βηνινγηθή πδαηνθαιιηέξγεηα, καθξνδσνβέλζνο.
*οββναθέαξ επζημζκςκίαξ: οανή Ραθαδθία (r.sivri@yahoo.gr)
1. Δηζαγσγή
Ζ ναβδαία ακάπηολδ ηςκ οδαημηαθθζενβεζχκ ηζξ ηεθεοηαίεξ δεηαεηίεξ έπεζ πνμηαθέζεζ ζε ανηεηέξ πενζπηχζεζξ έκημκμ
πνμαθδιαηζζιυ υζμκ αθμνά ηδκ επίδναζδ ημοξ ζημ πενζαάθθμκ. Ζ πθέμκ δζαδεδμιέκδ επίδναζδ ηςκ ζπεομηαθθζενβεζχκ
αθμνά ημκ μνβακζηυ ειπθμοηζζιυ ηςκ ζγδιάηςκ (Karakassis et al. 2000). Σμ ορδθυ πμζμζηυ ημο μνβακζημφ οθζημφ ζημ
ίγδια ιπμνεί κα επδνεάζεζ άιεζα ηδ ζφκεεζδ ηαζ ηα παναηηδνζζηζηά ηςκ αεκεζηχκ ημζκμηήηςκ (Klaoudatos et al. 2006,
Yucel-Gier et al. 2007). Πμθθέξ ένεοκεξ έπμοκ δζελαπεεί ζπεηζηά ιε ηδκ επίδναζδ ηςκ ζπεομηαθθζενβεζχκ ζημ
ιαηνμγςμαέκεμξ, αθμφ εεςνείηαζ ςξ έκαξ απυ ημοξ πζμ εοαίζεδημοξ δείηηεξ πενζααθθμκηζηχκ αθθαβχκ (Bilyard 1987).
ηζξ πενζζζυηενεξ πενζπηχζεζξ έπεζ ηαηαβναθεί ιζα επζηνάηδζδ ηαζνμζημπζηχκ ηαζ ακεεηηζηχκ ζηδ νφπακζδ εζδχκ
(Weston 1990).
Ζ αζμθμβζηή εηηνμθή ζημκ ηθάδμ ηςκ οδαημηαθθζενβεζχκ απμηεθεί ιζα ζπεηζηά κέα ιέεμδμ, δ μπμία δδιζμονβήεδηε απυ
ημ εκδζαθένμκ ηςκ ηαηακαθςηχκ βζα γδηήιαηα οβείαξ, αζθάθεζαξ ηςκ ηνμθίιςκ ηαζ οπμαάειζζδξ ημο πενζαάθθμκημξ.
Σμ ζπεηζηά ιζηνυ πνμκζηυ δζάζηδια πμο εθανιυγεηαζ δ αζμθμβζηή οδαημηαθθζένβεζα δεκ έπεζ δχζεζ ηδ δοκαηυηαηα
δζελαβςβήξ εκδεθεπμφξ ένεοκαξ υζμκ αθμνά ηζξ επζπηχζεζξ ηδξ ζημ πενζαάθθμκ, ζε ακηίεεζδ ιε ηδ ζοιααηζηή δ μπμία
έπεζ ιεθεηδεεί βζα πμθθέξ δεηαεηίεξ.
Με ζημπυ ηδκ εηηίιδζδ ηδξ επίδναζδξ ηδξ ζοιααηζηήξ ηαζ αζμθμβζηήξ οδαημηαθθζένβεζαξ ζημ ιαηνμγςμαέκεμξ
ζοθθέπεδηακ δείβιαηα ζγήιαημξ απυ ηδκ πενζμπή ηδξ Λάνοικαξ.
Γζα ηδ δζελαβςβή ηδξ ένεοκαξ επζθέπεδηακ ηνείξ δεζβιαημθδπηζημί ζηαειμί. Οζ ζηαειμί S1 ηαζ S2 ςξ ηφνζμζ ζηαειμί
ιεηνήζεςκ ηδξ ηάεε εηηνμθήξ (ζοιααηζηήξ ηαζ αζμθμβζηήξ) ηαζ μ S3 ςξ ζηαειυξ εθέβπμο.
Δπμπζηά δείβιαηα ζγήιαημξ θήθεδηακ βζα ημκ πνμζδζμνζζιυ ημο μνβακζημφ οθζημφ, ημο μνβακζημφ άκεναηα ηαζ ημο
ιαηνμγςμαέκεμοξ ιε ηδ πνήζδ δεζβιαημθήπηδ ηφπμο Van Veen (επζθάκεζαξ 0,25m2). Απυ ηάεε ζηαειυ ζοθθέπεδηακ
ηνία επακαθδπηζηά δείβιαηα, ηδκ άκμζλδ ηαζ ημ ηαθμηαίνζ ημο 2008.
Ο πνμζδζμνζζιυξ ηδξ ημηημιεηνζηήξ ζφζηαζδξ έβζκε ζφιθςκα ιε ηδ ιέεμδμ Bouyoucou (1962). Σμ πμζμζηυ ημο
μνβακζημφ οθζημφ πνμζδζμνίζεδηε ιεηά ηδκ απμλήνακζδ ηαζ μιμβεκμπμίδζδ, απυ ηδ δζαθμνά αάνμοξ πνζκ ηαζ ιεηά ηδκ
ηαφζδ (Byers et al. 1978). Ζ ιέεμδμξ πμο πνδζζιμπμζήεδηε βζα ηδ ιέηνδζδ ημο πμζμζημφ ημο μνβακζημφ άκεναηα ζημ
ίγδια ζηδνίγεηαζ ζηδκ οβνή μλείδςζδ ηςκ μνβακζηχκ μοζζχκ ιε δζπνςιζηυ ηάθζμ ηαζ εεζζηυ μλφ (Gaudette et al. 1974).
Πνμηεζιέκμο κα εηηζιδεεί δ επίδναζδ ηςκ οδαημηαθθζενβεζχκ ζημ ιαηνμγςμαέκεμξ έβζκε δζαπςνζζιυξ ηαζ ηαλζκυιδζδ
ηςκ μνβακζζιχκ ζε πέκηε μιάδεξ: πμθφπαζημζ, βαζηενυπμδα, δίεονα, ηανηζκμεζδή ηαζ δζάθμνα ηαζ εηηίιδζδ ηδξ
ηαηάζηαζδξ ηςκ εζδχκ ιε μζημθμβζημφξ δείηηεξ. Ο πνμζδζμνζζιυξ ηςκ μνβακζζιχκ έβζκε ζημ παιδθυηενμ δοκαηυ
ηαλζκμιζηυ επίπεδμ (είδμοξ ή βέκμοξ) ιε ηδ πνήζδ ζηενεμζημπίμο ηαζ δζαθυνςκ έβηονςκ ηαλζκμιζηχκ ηθεζδχκ (Fauvel
1923, 1927, Day 1967a, b, Fauchald 1977, D' Angelo & Gargiullo 1978, Ruffo 1982, 1989, 1993).
Γζα ηδκ ακμιμζυηδηα ιεηαλφ ηςκ ζηαειχκ έβζκε δ ακάθοζδ ημο πμζμζημφ μιμζυηδηαξ (SIMPER). Με ηδ αμήεεζα ημο
δείηηδ μιμζυηδηαξ ηςκ Bray & Curtis (1957), έβζκε μιαδμπμίδζδ ηςκ ζηαειχκ ηδξ πενζμπήξ ένεοκαξ ιε αάζδ ημ ααειυ
39
HydroMedit 2014, November 13-15, Volos, Greece
ζοββέκεζαξ ημο ιαηνμγςμαέκεμοξ. Γζα ηδ δζζδζάζηαηδ απεζηυκζζδ ηςκ πςνζηχκ ηαζ πνμκζηχκ δζαθμνχκ ζηδ ζφκεεζδ
ηςκ εζδχκ ζημοξ ζηαειμφξ πμο ενεοκήεδηακ ηαηαζηεοάζηδηε δζάβναιια πμθοδζάζηαηδξ δζάηαλδξ (MDS) (Field et al.
1982). Δπίζδξ ηαηαζηεοάζηδηε δζάβναιια αενμζζηζηήξ ηονζανπίαξ ηςκ εζδχκ (K-dominance) ζε ζπέζδ ιε ηδ ιέεμδμ
εηηνμθήξ (ζοιααηζηή ηαζ αζμθμβζηή), ζφιθςκα ιε ηδ ιέεμδμ πμο ακαθένεηαζ απυ ημκ Warwick (1986).
Γζα ηδ ζηαηζζηζηή ζφβηνζζδ ημο πμζμζημφ ημο μνβακζημφ οθζημφ ηαζ ημο μνβακζημφ άκεναηα ζημ ίγδια, ηαεχξ ηαζ ηςκ
δζαθυνςκ παναηηδνζζηζηχκ ημο ιαηνμγςμαέκεμοξ ιεηαλφ ηςκ ζηαειχκ ηαζ ιεηαλφ ηςκ επμπχκ πνδζζιμπμζήεδηε δ
ιμκμπαναβμκηζηή ακάθοζδ δζαηφιακζδξ (one-way ANOVA), εκχ βζα ηδκ αθθδθεπίδναζδ ιεηαλφ ζηαειχκ ηαζ επμπχκ
δ πμθοπαναβμκηζηή ακάθοζδ δζαηφιακζδξ (two-way ANOVA) (Zar 1996). Οζ οπμθμβζζιμί έβζκακ ιε ηδ πνήζδ ημο
PRIMER.
3. Απνηειέζκαηα
Ζ ημηημιεηνζηή ακάθοζδ έδεζλε υηζ ημ ίγδια ηςκ ηνζχκ δεζβιαημθδπηζηχκ ζηαειχκ είκαζ αιιχδεξ. Σα ορδθυηενα
πμζμζηά ημο μνβακζημφ οθζημφ ηαζ ημο μνβακζημφ άκεναηα ηαηαβνάθμκηαζ ζημ ζηαειυ ηδξ ζοιααηζηήξ εηηνμθήξ, εκχ
ηα παιδθυηενα ζημ ζηαειυ εθέβπμο. Ζ πμθοπαναβμκηζηή ακάθοζδ δζαηφιακζδξ έδεζλε ιδ ζδιακηζηή αθθδθεπίδναζδ
ιεηαλφ ζηαειχκ ηαζ επμπχκ, ηυζμ βζα ημ μνβακζηυ οθζηυ υζμ ηαζ βζα ημκ μνβακζηυ άκεναηα. Ζ ιμκμπαναβμκηζηή
ακάθοζδ δζαηφιακζδξ έδεζλε υηζ οπάνπμοκ ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ ζηα πμζμζηά ημο μνβακζημφ οθζημφ ηαζ ημο
μνβακζημφ άκεναηα ιεηαλφ ηςκ ζηαειχκ (Πζκ. 1).
Ο ζοκμθζηυξ ανζειυξ ηςκ αηυιςκ πμο ακαβκςνίζεδηε είκαζ 4.322, ηα μπμία ακήημοκ ζε 180 είδδ. Οζ ορδθυηενεξ ηζιέξ
ηςκ δεζηηχκ αθεμκίαξ, μιμζμιμνθίαξ ηαζ πμζηζθυηδηαξ ηαηαβνάθμκηαζ ζημ ζηαειυ S3, εκχ μζ παιδθυηενεξ ζημ ζηαειυ
S1. Ζ πμθοπαναβμκηζηή ακάθοζδ δζαηφιακζδξ ηςκ δζαθυνςκ παναηηδνζζηζηχκ ημο ιαηνμγςμαέκεμοξ έδεζλε ζδιακηζηή
αθθδθεπίδναζδ ιεηαλφ ζηαειχκ ηαζ επμπχκ βζα υθεξ ηζξ παναιέηνμοξ, εηηυξ απυ ημκ ανζειυ ηςκ εζδχκ ηαζ ημ δείηηδ
αθεμκίαξ. Ζ ιμκμπαναβμκηζηή ακάθοζδ δζαηφιακζδξ έδεζλε υηζ μζ δζαθμνέξ πμο παναηδνμφκηαζ ζημοξ δείηηεξ
μιμζμιμνθίαξ ηαζ πμζηζθυηδηαξ είκαζ πςνζηέξ (Πζκ. 1).
Πίκαηαξ 1. Δπμπζηή ζφβηνζζδ ημο μνβακζημφ οθζημφ, ημο μνβακζημφ άκεναηα ηαζ ηςκ παναιέηνςκ ημο
ιαηνμγςμαέκεμοξ ιεηαλφ ηςκ ζηαειχκ ηδξ πενζμπήξ ένεοκαξ (F: Λυβμξ, P level: Δπίπεδμ ζδιακηζηυηδηαξ).
Δπζηναηέζηενμ είδμξ είκαζ μ πμθφπαζημξ Capitella capitata, ημο μπμίμο ημ πμζμζηυ ειθάκζζδξ ζημ ζηαειυ S1 θεάκεζ ημ
74,14%, ζημ ζηαειυ S2 ιυθζξ ημ 1,15%, εκχ ζημ ζηαειυ S3 δεκ ηαηαβνάθεηαζ δ πανμοζία ημο. ημ ζηαειυ S2
επζηναηέζηενα είκαζ ηα βαζηενυπμδα ημο βέκμοξ Bittium sp. ιε πμζμζηυ 18,51%, εκχ ζημ ζηαειυ S3 ημ επζηναηέζηενμ
είδμξ ακήηεζ ζηα επζκμεζδή ηαζ είκαζ ημ Echinocyamus pusillus ιε 9,42%.
Ζ ακάθοζδ ημο πμζμζημφ μιμζυηδηαξ ηςκ ιαηνμγςμαεκεζηχκ εζδχκ (SIMPER), έδεζλε υηζ ημ ορδθυηενμ πμζμζηυ
ακμιμζυηδηαξ παναηδνείηαζ ιεηαλφ ηςκ ζηαειχκ S1 ηαζ S2 (81,09%), εκχ ημ παιδθυηενμ ιεηαλφ ηςκ ζηαειχκ S2 ηαζ
S3 (52,13%). Ζ ακμιμζυηδηα ιεηαλφ ηςκ ζηαειχκ S1 ηαζ S2, ηαεχξ επίζδξ ηαζ ιεηαλφ ηςκ ζηαειχκ S1 ηαζ S3
μθείθεηαζ ηονίςξ ζηδκ πανμοζία ημο είδμοξ C. capitata, εκχ ιεηαλφ ηςκ ζηαειχκ S2 ηαζ S3 μθείθεηαζ ηονίςξ ζηδκ
πανμοζία ηςκ εζδχκ ημο βέκμοξ Bittium sp. ηαζ E. pusillus.
40
HydroMedit 2014, November 13-15, Volos, Greece
Απυ ημ δζάβναιια πμθοδζάζηαηδξ δζάηαλδξ (MDS) (π. 1), ιε αάζδ ημ ααειυ ζοββέκεζαξ ημο ιαηνμγςμαέκεμοξ,
πνμηφπηεζ έκαξ ζαθήξ δζαπςνζζιυξ ημο ζηαειμφ S1 απυ ημοξ μιαδμπμζδιέκμοξ ζηαειμφξ S2 ηαζ S3 ηαηά ηδ δζάνηεζα
ηαζ ηςκ δομ επμπχκ.
πήια 1. Γζάβναιια πμθοδζάζηαηδξ δζάηαλδξ (MDS) ηςκ δεζβιαημθδπηζηχκ ζηαειχκ ηδξ πενζμπήξ ένεοκαξ ιε αάζδ ημ
ααειυ ζοββέκεζαξ ημο ιαηνμγςμαέκεμοξ ηαηά ηδ δζάνηεζα ηςκ δομ επμπχκ (Sp: Άκμζλδ, S: Καθμηαίνζ).
Σμ δζάβναιια αενμζζηζηήξ ηονζανπίαξ ηςκ ιαηνμγςμαεκεζηχκ εζδχκ (K-dominance) (π. 2), δείπκεζ έκα ζαθή
δζαπςνζζιυ ηςκ ζηαειχκ, ιε ημοξ ζηαειμφξ S2 ηαζ S3 κα ειθακίγμοκ ιζηνυηενδ αενμζζηζηή ηονζανπία εζδχκ.
πήια 2. Γζάβναιια αενμζζηζηήξ ηονζανπίαξ ηςκ ιαηνμγςμαεκεζηχκ εζδχκ ζημοξ ζηαειμφξ S1, S2 ηαζ S3.
4. πδήηεζε
Tα ορδθυηενα πμζμζηά ημο μνβακζημφ οθζημφ ηαζ ημο μνβακζημφ άκεναηα ηαηαβνάθμκηαζ ζημ ζηαειυ ηδξ ζοιααηζηήξ
εηηνμθήξ, εκχ ηα παιδθυηενα ζημ ζηαειυ εθέβπμο. Δπίζδξ, ηα πμζμζηά ζημ ζηαειυ ηδξ αζμθμβζηήξ εηηνμθήξ είκαζ
παιδθυηενα απυ αοηά ημο ζηαειμφ ηδξ ζοιααηζηήξ. Ζ ιμκμπαναβμκηζηή ακάθοζδ δζαηφιακζδξ έδεζλε ζηαηζζηζηά
ζδιακηζηέξ δζαθμνέξ ιεηαλφ ηςκ ζηαειχκ. Οζ Neofitou et al. (2010), ζε ένεοκα πμο δζελήπεδ ζε δομ πενζμπέξ ημο
Παβαζδηζημφ ηυθπμο, δζαπίζηςζακ υηζ ηα πμζμζηά ημο μνβακζημφ οθζημφ ηαζ ημο μνβακζημφ άκεναηα ήηακ ορδθυηενα
ζημ ζηαειυ ηδξ ζοιααηζηήξ εηηνμθήξ απυ ημ ζηαειυ εθέβπμο, ιε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ.
Οζ ορδθυηενεξ ηζιέξ υθςκ ηςκ παναιέηνςκ ημο ιαηνμγςμαέκεμοξ ιε ελαίνεζδ ηςκ ανζειυ ηςκ αηυιςκ ηαηαβνάθμκηαζ
ζημ ζηαειυ εθέβπμο, εκχ μζ παιδθυηενεξ ζημ ζηαειυ ηδξ ζοιααηζηήξ εηηνμθήξ. Ο ζηαειυξ εθέβπμο ηαζ μ ζηαειυξ ηδξ
αζμθμβζηήξ εηηνμθήξ πανμοζζάγμοκ ιεβαθφηενδ πμζηζθμιμνθία εζδχκ ηαζ είκαζ πζμ μιμζμβεκείξ υζμκ αθμνά ηδ
ιαηνμγςμαεκεζηή ημοξ ζφζηαζδ, ζε ζπέζδ ιε αοηυκ ηδξ ζοιααηζηήξ. Ζ ζηαηζζηζηή ακάθοζδ έδεζλε ζδιακηζηή
αθθδθεπίδναζδ ιεηαλφ ζηαειχκ ηαζ επμπχκ ζημοξ δείηηεξ πμζηζθυηδηαξ ηαζ μιμζμιμνθίαξ δ μπμία θαίκεηαζ κα είκαζ
πςνζηή. Σα ακςηένς απμηεθέζιαηα είκαζ ζφιθςκα ιε άθθεξ ακάθμβεξ ένεοκεξ (Klaoudatos et al. 2006, Neofitou et al.
2010).
Δπζηναηέζηενμ είδμξ είκαζ μ πμθφπαζημξ Capitella capitata. To είδμξ αοηυ είκαζ ηαζνμζημπζηυ ηαζ απακηάηαζ ζε
επζαανοιέκα ζγήιαηα ιε ορδθά πμζμζηά μνβακζημφ οθζημφ (Karakassis et al. 2000). φιθςκα ιε ημοξ Karakassis et al.
(2000), ημ πμζμζηυ ειθάκζζδξ αοημφ ημο είδμοξ ιπμνεί κα θηάζεζ έςξ ηαζ ημ 75%. ηδκ πανμφζα ένεοκα ημ πμζμζηυ
αοηυ θεάκεζ ημ 74,14% ζημ ζηαειυ ηδξ ζοιααηζηήξ εηηνμθήξ, εκχ ζημ ζηαειυ ηδξ αζμθμβζηήξ ιυθζξ ημ 1,15%. Ζ
41
HydroMedit 2014, November 13-15, Volos, Greece
πανμοζία αοημφ ημο είδμοξ δεκ ηαηαβνάθεηαζ ζημ ζηαειυ εθέβπμο. Σμ βεβμκυξ αοηυ οπμδεζηκφεζ υηζ μ ααειυξ
επίδναζδξ ηδξ ζοιααηζηήξ οδαημηαθθζένβεζαξ ζημ ιαηνμγςμαέκεμξ είκαζ ιεβαθφηενμξ απυ αοηυκ ηδξ αζμθμβζηήξ.
φιθςκα ιε ηδκ ακάθοζδ SIMPER ημ ορδθυηενμ πμζμζηυ ακμιμζυηδηαξ παναηδνείηαζ ιεηαλφ ηςκ ζηαειχκ ηδξ
ζοιααηζηήξ ηαζ αζμθμβζηήξ εηηνμθήξ, εκχ ημ παιδθυηενμ ιεηαλφ ημο ζηαειμφ ηδξ αζμθμβζηήξ εηηνμθήξ ηαζ ημο
ζηαειμφ εθέβπμο. Ζ ακμιμζυηδηα ιεηαλφ ηςκ ζηαειχκ S1 ηαζ S2, ηαεχξ επίζδξ ηαζ ιεηαλφ ηςκ ζηαειχκ S1 ηαζ S3
μθείθεηαζ ηονίςξ ζηδκ πανμοζία ημο είδμοξ C. capitata, εκχ ιεηαλφ ηςκ ζηαειχκ S2 ηαζ S3 μθείθεηαζ ηονίςξ ζηδκ
πανμοζία ηςκ εζδχκ ημο βέκμοξ Bittium sp. ηαζ E. pusillus. φιθςκα ιε ένεοκεξ πμο έπμοκ δζελαπεεί ζηδκ Ακαημθζηή
Μεζυβεζμ βζα ηζξ επζδνάζεζξ ηδξ ζοιααηζηήξ εηηνμθήξ ζημ αέκεμξ (Klaoudatos et al. 2006, Neofitou et al. 2010), δ
ακμιμζυηδηα ιεηαλφ ηςκ ζηαειχκ ζοιααηζηήξ εηηνμθήξ ηαζ ημο ζηαειμφ εθέβπμο μθείθεηαζ ηονίςξ ζηδκ πανμοζία
πμθφπαζηςκ, υπςξ ημο είδμοξ C. capitata.
Απυ ηδκ μιαδμπμίδζδ ηςκ ζηαειχκ ηδξ πενζμπήξ ένεοκαξ ιε αάζδ ημ ααειυ ζοββέκεζαξ ημο ιαηνμγςμαέκεμοξ,
πνμηφπηεζ έκαξ ζαθήξ δζαπςνζζιυξ ημο ζηαειμφ ηδξ ζοιααηζηήξ εηηνμθήξ απυ ημ ζηαειυ ηδξ αζμθμβζηήξ ηαζ ημ ζηαειυ
εθέβπμο βεβμκυξ πμο είκαζ ζφιθςκμ ηαζ ιε άθθεξ ένεοκεξ (Klaoudatos et al. 2006, Neofitou et al. 2010).
Απυ ηδκ ακάθοζδ ηςκ απμηεθεζιάηςκ ζοιπεναίκεηαζ υηζ δ εθανιμβή αζμθμβζηήξ εηηνμθήξ ζηδκ οδαημηαθθζένβεζα
ιπμνεί κα πενζμνίζεζ ζδιακηζηά ηζξ ανκδηζηέξ επζπηχζεζξ ζημ οδάηζκμ πενζαάθθμκ. Πανυθα αοηά, δ εθανιμβή ηδξ
αζμθμβζηήξ εηηνμθήξ ζε εονεία ηθίιαηα απαζηεί πεναζηένς ένεοκα πνμηεζιέκμο κα εηηζιδεεί πθήνςξ δ έηηαζδ ηαζ ημ
εφνμξ ηςκ επζπηχζεςκ πμο ιπμνεί κα έπεζ ζημ οδάηζκμ πενζαάθθμκ.
Βηβιηνγξαθία
Beveridge M.C. (2004). Cage aquaculture. Third edition. Blackwell, p 377.
Bilyard G.R. (1987). The value of benthic infauna in marine pollution monitoring studies. Marine Pollution Bulletin 18,
581-585.
Bouyoucos G.J. (1962). Hydrometer method improved for making particle size analysis of soils. Agronomy Journal 54,
464-465.
Bray J.R., Curtis J.T. (1957). An ordination of the upland forest communities of southern Wisconsin. Ecological
Monographs 27, 325-349.
Byers S.C., Mills E.L., Stewart L. (1978). A comparison of methods for determining organic carbon in marine sediments,
with suggestion for a standard method. Hydrobiologia 58, 43-47.
D'Angelo G., Gargiullo S. (1978). Guida alle conchiglie Mediterranee. Conoscerle cercarle collezionarle. Fabbri, Milano,
p 224.
Day J.H. (1967a). A monograph on the polychaeta of southern Africa Part I. Errantia. Trustees of the British Museum
(Natural History). London 656, 1-458.
Day J.H. (1967b). A monograph on the polychaeta of southern Africa Part II. Sedentaria. Trustees of the British Museum
(Natural History). London 656, 459-878.
Fauchald K. (1977). The polychaete worms. Definitions and keys to the orders, families and genera. Natural History
Museum of Los Angeles County. Science Series 28, 1-198.
Fauvel P. (1923). Faune de France - Polychètes errantes. Fédération Française des Sociétés de Sciences Naturelles,
Office Central de Faunistique. Paris 5, 1-488.
Fauvel P. (1927). Faune de France - Polychètes sédentaires. Fédération Française des Sociétés de Sciences Naturelles,
Office Central de Faunistique. Paris 16, 1-494.
Field J.G., Clarke K.R., Warwick R.M. (1982). A practical strategy for analysing multispecies distribution patterns.
Marine Ecology Progress Series 8, 37-52.
Gaudette H.E., Flight W.R., Toner L., Floger D.W. (1974). An inexpensive titration method for the determination of
organic carbon in recent sediments. Journal of Sedimentary Research 44, 249-253.
Karakassis I., Tsapakis M., Hatziyanni E., Papadopoulou K.N., Plaiti W. (2000). Impact of cage farming of fish on the
seabed in three Mediterranean coastal areas. Journal of Marine Science 57, 1462-1471.
Klaoudatos S.D., Klaoudatos D.S., Smith J., Bogdanos K., Papageorgiou E. (2006). Assessment of site specific benthic
impact of floating cage farming in the eastern Hios island, Eastern Aegean Sea, Greece. Journal of Experimental Marine
Biology and Ecology 338, 96-111.
42
HydroMedit 2014, November 13-15, Volos, Greece
Mente E., Stratakos A., Boziaris I.S., Kormas K.A., Karalazos V., Karapanagiotidis I.T., Catsiki V.A., Leondiadis L.
(2012). The effect of organic and conventional production methods on sea bream growth, health and body composition: a
field experiment. Scientia Marina, Barcelona 76, 549-560.
Neofitou N., Vafidis D., Klaoudatos S. (2010). Spatial and temporal effects of fish farming on benthic community
structure in a semi-enclosed gulf of the Eastern Mediterranean. Aquaculture Environment Interactions 1, 95-105.
Ruffo S. (1982). The amphipoda of the Mediterranean. Part 1. Gammaridea Acanthonotozomatidae to gammaridae.
Mémoires de l‘Institut Océanographique. Monaco 13, 1-364.
Ruffo S. (1989). The amphipoda of the Mediterranean. Part 2. Gammaridea Haustoriidae to lysianassidae. Mémoires de
l‘Institut Océanographique. Monaco 13, 365-576.
Ruffo S. (1993). The amphipoda of the Mediterranean. Part 3. Gammaridea Melphidippidae to talitridae. Mémoires de
l‘Institut Océanographique. Monaco 13, 577-814.
Yucel-Gier G., Kucuksezgin F., Kocak F. (2007). Effects of fish farming on nutrients and benthic community structure in
the Eastern Aegean (Turkey). Aquaculture Research 38, 256-267.
Warwick R.M. (1986). A new method for detecting pollution effects on marine macrobenthic communities. Marine
Biology 92, 557-562.
Weston D.P. (1990). Quantitative examination of macrobenthic community changes along an organic enrichment
gradient. Marine Ecology Progress Series 61, 233-244.
Zar J.H. (1996). Biostatistical analysis. Third edition. Prentice Hall, New Jersey, p 662.
43
HydroMedit 2014, November 13-15, Volos, Greece
Smpiliri E.1*, Golomazou E.2, Exadactylos A.2, Malandrakis E. 2, Fleris G.3, Dimopoulos D.1, Panagiotaki P.2
1
Dias S.A. Achladi, 353 00, Stylida, Greece.
2
Department of Ichthyology and Aquatic Environment, School of Agricultural Sciences, University of Thessaly, Fytokou
St., 38446, N. Ionia, Magnesia, Greece.
3
Faculty of Animal Science and Aquaculture, Laboratory of Applied Hydrobiology, Agricultural University of Athens,
Iera Odos 75, 11855, Athens, Greece.
ABSTRACT
The experiment took place in real scale, large-capacity hatchery. During the experiment, lasting 90 days, six bass
(Dicentrarchus labrax), populations of common origin were used. The populations were divided into 2 experimental
groups (O200-300 and O200-400) with 3 replicates each. Group O200-300 fed with dry feed particle size ranging from 200 to 300
micrometers and group O200-400 with a grain size from 200 to 400 micrometers respectively. The experiment was divided
into two phases: from the beginning to the size grading (day 47) and grading by the end of the experiment. After grading
the fish populations were separated into two sizes - groups: large (ΓΜ200-300 and ΓM200-400) and small individuals (Γι200-
300 and Γι200-400). Every three days a sample of each population was measured in length and weight. The parameters
evaluated in this study were: growth rate and its size variability. By first grading the fish group O200-400 grew faster, with
statistically significant differences compared to the fish group O 200-300. The variation in group O200-400 although it was
higher showed no statistically significant differences compared with the group O 200-300. After grading, fish in the group
ΓΜ200-300 developed faster in length and weight than those in the ΓM200-400 group, with statistically significant
differences. The differences in growth (length) was statistically significant.
Keywords: Bass, Dicentrarchus labrax, food size, growth rate variability, size variation.
*Corresponding author: Smpiliri Evangelia ( l_smp@hotmail.com)
Πεξίιεςε
Σμ πείναια έθααε πχνα ζε πναβιαηζηέξ ζοκεήηεξ ιεβάθδξ δοκαιζηυηδηαξ Ηπεομβεκκδηζημφ ζηαειμφ.
Υνδζζιμπμζήεδηακ 6 πθδεοζιμί θααναηζμφ (Dicentrarchus labrax), ημζκήξ πνμέθεοζδξ υπμο πςνίζηδηακ ζε 2
πεζναιαηζηέξ μιάδεξ (Ο200-300 ηαζ Ο200-400) ηαζ ιε 3 επακαθήρεζξ ζηδκ ηάεε ιία. Ζ πνχηδ μιάδα (Ο 200-300) δζαηνάθδηε ιε
λδνή ηνμθή ιε εφνμξ ημηημιεηνίαξ 200 - 300 ιm εκχ ζηδ δεφηενδ μιάδα (Ο200-400) πμνδβήεδηε λδνή ηνμθή ιε ιέβεεμξ
ηυηημο 200 - 400 ιm. Σμ πείναια πςνίζηδηε ζε δομ θάζεζξ: απυ ηδκ έκανλδ έςξ ηδ δζαθμβή ιεβέεμοξ (διένα 47) ηαζ
απυ ηδ δζαθμβή έςξ ημ ηέθμξ ημο πεζνάιαημξ. Μεηά ηδ δζαθμβή μζ πθδεοζιμί ηςκ ρανζχκ δζαπςνίζηδηακ ζε δομ ιεβέεδ
- μιάδεξ: ηα ιεβάθα ηδξ δζαθμβήξ (ΓΜ200-300 ηαζ ΓΜ200-400) ηαζ ηα ιζηνά ηδξ δζαθμβήξ (Γι200-300 ηαζ Γι200-400). Κάεε ηνεζξ
ιένεξ θαιαάκμκηακ έκα δείβια ημο ηάεε πθδεοζιμφ ηαζ βζκυηακ ιέηνδζδ ιήημοξ. Μεηά ηδ δζαθμβή δ δεζβιαημθδρία
πενζεθάιαακε ηαζ ιέηνδζδ αάνμοξ. Οζ πανάιεηνμζ πμο εηηζιήεδηακ ήηακ: δ αφλδζδ ηςκ πθδεοζιχκ, μ νοειυξ αφλδζδξ
ημοξ ηαζ δ παναθθαηηζηυηδηα ημοξ. Μέπνζ ηδκ πνχηδ δζαθμβή ηα ράνζα ηδξ μιάδαξ Ο 200-400 αολήεδηακ ηαπφηενα, ιε
ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ, ζε ζπέζδ ιε ηα ράνζα ηδξ μιάδαξ Ο 200-300. Ζ παναθθαηηζηυηδηα ζηδκ μιάδα Ο200-400 ακ
ηαζ ήηακ ιεβαθφηενδ δεκ είπε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ ζε ζπέζδ ιε ηδκ μιάδα Ο 200-300. Μεηά ηδ δζαθμβή πμο
πναβιαημπμζήεδηε, ηα άημια ηδξ μιάδαξ ΓΜ 200-300 ακαπηφπεδηακ βνδβμνυηενα ηαζ ζε ιήημξ ηαζ ζε αάνμξ ζε ζπέζδ ιε
ηα άημια ηδξ μιάδαξ ΓΜ200-400, ιε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ. Ζ δζαθμνά ζηδκ ακάπηολδ ημο ιήημοξ ήηακ
ζηαηζζηζηά ζδιακηζηή εκχ ζημ αάνμξ ιδ ζηαηζζηζηά ζδιακηζηή.
Λέξειρ κλειδιά: Λαβξάθη, Dicentrarchus labrax, κέγεζνο θόθθνπ ηξνθήο, αύμεζε, ξπζκόο αύμεζεο, παξαιιαθηηθόηεηα
κεγεζώλ.
*οββναθέαξ επζημζκςκίαξ: ιπζθίνδ Δοαββεθία ( l_smp@hotmail.com
44
HydroMedit 2014, November 13-15, Volos, Greece
1. Δηζαγσγή
Ζ παναθθαηηζηυηδηα ζημ ιέβεεμξ ηςκ ζπεοδίςκ απμηεθεί έκα απυ ηα ζδιακηζηυηενα πνμαθήιαηα ημο ηθάδμο
ηςκ ζπεομηαθθζενβεζχκ. Σμ πνυαθδια εκημπίγεηαζ ζημοξ ζπεομβεκκδηζημφξ ζηαειμφξ ηαζ δζεονφκεηαζ υζμ πνμπςνάεζ δ
εηηνμθή ηςκ ζπεοδίςκ.
Σμ θαζκυιεκμ ηδξ ακμιμζμιμνθίαξ ακαθένεηαζ βζα πνχηδ θμνά ζηδ αζαθζμβναθία ςξ ―Tobi-Koi phenomenon‖
ημ 1955 (Νakamura & Kasahara 1955). Έηημηε έπμοκ βίκεζ ακαθμνέξ ζε πμθθά είδδ ρανζχκ: ζημ πνοζυρανμ, Carassius
auratus L (Welty 1934), ζηδκ πέζηνμθα, Salmo trutta L. (Brown 1946), ζημ βαηυρανμ Ictalurus punctatus, (Schwedler
et al. 1990).
Οζ αζηίεξ πμο ζοιαάθμοκ ζηδ δζαθμνμπμίδζδ ημο νοειμφ ακάπηολδξ ηαζ έπμοκ ςξ ζοκέπεζα ηδκ ακμιμζμιμνθία
ηςκ ιεβεεχκ είκαζ: μζ βεκεηζημί πανάβμκηεξ, μ νοειυξ αφλδζδξ, ημ ιέβεεμξ ημο αοβμφ, μζ ημζκςκζηέξ ζπέζεζξ ιεηαλφ ηςκ
αηυιςκ ηδξ ίδζαξ μιάδαξ, δ ηαηακάθςζδ ηδξ ηνμθήξ, δ ζπεομποηκυηδηα, δ αλζμπμίδζδ εκένβεζαξ ηδξ ηνμθήξ, μζ
ζοκεήηεξ εηηνμθήξ, δ εκδζζιυηδηα ηαεχξ ηαζ μζ πενζααθθμκηζημί πανάβμκηεξ.
ημπυξ ηδξ ενβαζίαξ είκαζ δ ιεθέηδ ηδξ επίδναζδξ ημο εφνμοξ ηδξ ημηημιεηνίαξ ηςκ πμνδβμφιεκςκ
ζφιπδηηςκ ζηδκ ακάπηολδ ηαζ ζηδκ παναθθαηηζηυηδηα ηςκ ζπεοδίςκ ημο θααναηζμφ ζε πναβιαηζηέξ ζοκεήηεξ ιεβάθδξ
δοκαιζηυηδηαξ Ηπεομβεκκδηζημφ ζηαειμφ.
3. Απνηειέζκαηα
Έςξ ηδκ 47δ διένα
Ζ ακάπηολδ ηςκ ρανζχκ πενζβνάθδηε ιε βναιιζηέξ ελζζχζεζξ βζα ημ πνμκζηυ δζάζηδια απυ 3 έςξ 47
διενχκ ιε ηδ ιμνθή Y = α + αX, υπμο Y: ιήημξ (mm), X: δθζηία (διένεξ), α: νοειυξ αφλδζδξ. Ο Πίκαηαξ 1
πανμοζζάγεζ ηζξ βναιιζηέξ ελζζχζεζξ βζα ηάεε μιάδα.
Ζ ελέθζλδ ηδξ παναθθαηηζηυηδηαξ πενζβνάθδηε ιε βναιιζηέξ ελζζχζεζξ ηδξ ιμνθήξ Τ = α + αΥ (υπμο
Τ: ηοπζηή απυηθζζδ, Υ: δθζηία (διένεξ) ηαζ α: ιέζμξ νοειυξ παναθθαηηζηυηδηαξ ιήημοξ. Οζ βναιιζηέξ
ελζζχζεζξ πμο πενζβνάθμοκ ηδκ ελέθζλδ ηδξ παναθθαηηζηυηαξ πανμοζζάγμκηαζ ζημκ Πίκαηα 2. Ζ
παναθθαηηζηυηδηα ζηα άημια ηαζ ηςκ δφμ πεζναιαηζηχκ μιάδςκ ιΟ 200-300, ιΟ200-400, ΜΟ200-300, ΜΟ200-400
πανέιεζκε ζπεδυκ ζηαεενή ηαζ δεκ ήηακ δοκαηυκ κα πενζβναθεί ιε βναιιζηέξ ελζζχζεζξ.
Πίλαθαο 3. Γξακκηθέο εμηζψζεηο εμέιημεο κήθνπο Πίλαθαο 4. Γξακκηθέο εμηζψζεηο εμέιημεο βάξνπο
θαη ζπληειεζηέο ζπζρέηηζεο ησλ πεηξακαηηθψλ θαη ζπληειεζηέο ζπζρέηηζεο ησλ πεηξακαηηθψλ
νκάδσλ ησλ κεγάισλ αηφκσλ κεηά ηε δηαινγή. νκάδσλ ησλ κεγάισλ αηφκσλ κεηά ηε δηαινγή.
Οιάδα Δλίζςζδ r2 Οιάδα Δλίζςζδ r2
ΓΜ200-300 Τ = 2,3567 + 0,9284 ΓΜ200-300 Τ = -0,6382 + 0,8299
SS SS
ΓΜ200-400 Τ = 1,0348 + 0,881
0,3621Υ ΓΜ200-400 Τ = -0,5007 + 0,7711
0,0134Υ
ΓΜΜ200- Τ
0,3043Υ =-12,084 0,9485 ΓΜΜ200- Τ 0,0109Υ =-1,9564 0,8425
SS SNS
ΓΜΜ
300 200- Τ =-4,7882 + 0,8678
+0,6159Υ ΓΜΜ
300 200- Τ =-1,4922
+0,0388Υ + 0,7069
400 0,4929Υ 400 0,0305Υ
46
HydroMedit 2014, November 13-15, Volos, Greece
Ζ ελέθζλδ ηδξ παναθθαηηζηυηδηαξ ιήημοξ ηαζ αάνμοξ βζα ηάεε ιένα ηδξ ιέηνδζδξ ακαθένμκηαζ ζημκ
Πίκαηα 5 ηαζ Πίκαηα 6.
Πίλαθαο 5. Γξακκηθέο εμηζψζεηο εμέιημεο παξαιιαθηηθφηεηαο κήθνπο θαη ζπληειεζηέο ζπζρέηηζεο ησλ
πεηξακαηηθψλ νκάδσλ ησλ κεγάισλ αηφκσλ κεηά ηε δηαινγή.
Οιάδα Δλίζςζδ r2
ΓΜ200-300 Τ = -3,394 + 0,906
SΝS
ΓΜ200-400 Τ = -2,4764 + 0,8479
0,094Υ
ΓΜΜ200- Τ
0,0761Υ =-1,4724 0,2948
SΝS
ΓΜΜ
300 200- Τ =-0,577
+0,0399Υ + 0,1306
Πίλαθαο
400 0,0283Υ εμηζψζεηο εμέιημεο παξαιιαθηηθφηεηαο βάξνπο θαη ζπληειεζηέο ζπζρέηηζεο ησλ
6. Γξακκηθέο
πεηξακαηηθψλ νκάδσλ ησλ κεγάισλ αηφκσλ κεηά ηε δηαινγή.
Οιάδα Δλίζςζδ r2
ΓΜ200-300 Τ = -0,3997 + 0,8299
SΝS
ΓΜ200-400 Τ = -0,3102 + 0,7127
0,0079Υ
ΓΜΜ200- Τ 0,0062Υ =-0,3327 0,5508
SNS
ΓΜΜ200- Τ
300 =-0,1958
+0,0064Υ + 0,2343
400 0,0042Υ
Μζηνά άημια απυ ηδ δζαθμβή
Ζ αφλδζδ ημο ιήημοξ ηςκ αηυιςκ ηςκ μιάδςκ Γι 200-300 ηαζ Γι200-400 πενζβνάθδηε ιε βναιιζηέξ
ελζζχζεζξ πμο πανμοζζάγμκηαζ ζημκ Πίκαηα 7. Ακηίζημζπα δ αφλδζδ ημο αάνμοξ πανμοζζάγεηαζ ζημκ Πίκαηα 8.
Οζ ελζζχζεζξ πμο πενζβνάθμοκ ηδκ ελέθζλδ ηδξ παναθθαηηζηυηδηαξ ιήημοξ ηαζ αάνμοξ πανμοζζάγμκηαζ
ζημοξ Πίκαηεξ 9 ηαζ 10 ακηίζημζπα.
Πίλαθαο 7. Γξακκηθέο εμηζψζεηο εμέιημε κήθνπο θαη ζπληειεζηέο ζπζρέηηζεο ησλ πεηξακαηηθψλ νκάδσλ
ησλ κηθξψλ αηφκσλ κεηά ηε δηαινγή.
Οιάδα Δλίζςζδ r2
Γι200-300 Τ = -3,6005 + 0,987
SS
Γι200-400 Τ = -0,2803 + 0,874
0,3501Υ 9
0,2739Υ 6
Πίλαθαο 8. Γξακκηθέο εμηζψζεηο εμέιημεο βάξνπο θαη ζπληειεζηέο ζπζρέηηζεο ησλ πεηξακαηηθψλ νκάδσλ
ησλ κηθξψλ αηφκσλ κεηά ηε δηαινγή.
Οιάδα Δλίζςζδ r2
Γι200-300 Τ = -0,3051 + 0,9494
SS
Γι200-400 Τ = -0,1966 + 0,8366
0,0068Υ
0,0047Υ
Πίλαθαο 9. Γξακκηθέο εμηζψζεηο εμέιημεο παξαιιαθηηθφηεηαο κήθνπο θαη ζπληειεζηέο ζπζρέηηζεο ησλ
πεηξακαηηθψλ νκάδσλ ησλ κηθξψλ αηφκσλ κεηά ηε δηαινγή.
Οιάδα Δλίζςζδ r2
Γι200-300 Τ = -1,8523 + 0,9146
SΝS
Γι200-400 Τ = -1,4103 + 0,7439
0,0577Υ
0,0497Υ
Πίλαθαο 10. Γξακκηθέο εμηζψζεηο εμέιημεο παξαιιαθηηθφηεηαο βάξνπο θαη ζπληειεζηέο ζπζρέηηζεο ησλ
πεηξακαηηθψλ νκάδσλ ησλ κηθξψλ αηφκσλ κεηά ηε δηαινγή.
Οιάδα Δλίζςζδ r2
Τ = -0,116 +
Γι200-300 0,9124
0,0025Υ
SΝS
Τ = -0,0792 +
Γι200-400 0,8167
0,0018Υ
4. πδήηεζε
Έςξ ηδ δζαθμβή ηα ράνζα ηδξ μιάδαξ Ο200-400 αολήεδηακ ηαπφηενα, ιε ζηαηζζηζηά ζδιακηζηέξ
δζαθμνέξ, ζε ζπέζδ ιε ηα ράνζα ηδξ μιάδαξ Ο200-300. Οιμίςξ ηα ιεβάθα άημια ηδξ μιάδαξ Ο200-400 αολήεδηακ
ηαπφηενα ζε ζπέζδ ιε ηα ακηίζημζπα άημια ηδξ μιάδαξ Ο 200-300, ιε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ. Σα
ιζηνά άημια ηςκ μιάδςκ αολήεδηακ ιε πανυιμζμοξ νοειμφξ αφλδζδξ. Δκδεπμιέκςξ, δ ζδιακηζηή δζαθμνά
ζηδκ αφλδζδ ηδξ μιάδαξ Ο200-400 μθείθεηαζ ζηα ιεβάθα άημια ηδξ μιάδαξ Ο200-400 ηαζ ζημ πθεμκέηηδια πμο
είπακ θυβς ηδξ πμνήβδζδξ ηαζ ιεβαθφηενμο ηυηημο ηνμθήξ ζε ζπέζδ ιε ηδκ άθθδ μιάδα Ο200-300.
47
HydroMedit 2014, November 13-15, Volos, Greece
Οζ Helland et al. (1997) ηαηέθδλακ ζημ ζοιπέναζια υηζ μ ζοκδοαζιυξ ηνζχκ ιεβεεχκ ηνμθήξ εοκμεί
ηδκ ηαθφηενδ ακάπηολδ ζηδκ ζππυβθςζζα (Hippoglossus hippoglossus L.). Βζαθζμβναθζηέξ ακαθμνέξ
οπμζηδνίγμοκ υηζ δ εκένβεζα πμο επεκδφεηαζ βζα ηδ ζφθθδρδ ηδξ ηνμθήξ δεκ είκαζ ακάθμβδ ημο ιεβέεμοξ ηδξ
ηνμθήξ. Χξ εη ημφημο, ημ ηαεανυ ηένδμξ εκένβεζαξ ιπμνεί κα είκαζ πμθφ παιδθυ βζα ηα ιζηνά ζςιαηίδζα
ηνμθήξ, ιε απμηέθεζια ηδ παιδθή απμδμηζηυηδηα ηδξ ιεηαηνερζιυηδηαξ ηδξ ηνμθήξ ηαζ ηδξ ανβήξ
ακάπηολδξ (Jobling & Wandsvik 1983, Dos Santos et al. 1993). Ακηίεεηα, μζ Goldan et al. (1997) ηαζ Bailey
et al. (2003) δζαπίζηςζακ υηζ δζαθμνεηζηά ιεβέεδ ηνμθήξ δεκ επδνεάγμοκ ηδκ ακάπηολδ ιε ημκ ηεθεοηαίμ κα
ζοιπεναίκεζ υηζ ηα ράνζα ιπμνμφκ κα πνμζανιμζημφκ ζε θμβζηέξ απμηθίζεζξ απυ ημ αέθηζζημ ιέβεεμξ ηδξ
ηνμθήξ πςνίξ κα οπάνπμοκ ανκδηζηέξ επζπηχζεζξ ζηδκ ακάπηολδ ημοξ.
Χζηυζμ, πνέπεζ κα επζζδιακεεί υηζ μζ ιεβαθφηενεξ ζε ιέβεεμξ ηνμθέξ είκαζ πενζζζυηενμ εθηοζηζηέξ
μπηζηά βζα ηα ράνζα (Stradmeyer et al. 1988, Smith et al. 1995) ηαζ υηζ ημ πνμηζιχιεκμ ή αέθηζζημ ιέβεεμξ
ηδξ ηνμθήξ ελανηάηαζ ηαζ απυ ηδ ζηθδνυηδηα ηδξ (Fessehaye et al. 2006).
Ζ παναθθαηηζηυηδηα ζηδκ μιάδα Ο200-400 ακ ηαζ ήηακ ιεβαθφηενδ δεκ είπε ζηαηζζηζηά ζδιακηζηέξ
δζαθμνέξ ζε ζπέζδ ιε ηδκ μιάδα Ο200-300. Χζηυζμ, δ επί ημζξ % δζαθμνά ηςκ ιέζςκ νοειχκ
παναθθαηηζηυηδηαξ ιήημοξ ακένπεηαζ ζημ 14,5 %, βεβμκυξ πμο εκζζπφεζ ηδκ άπμρδ υηζ μ ηαπφηενμξ νοειυξ
ακάπηολδξ εκζζπφεζ ηδ δζαζπμνά ηςκ ιεβεεχκ βφνς απυ ημ ιέζμ υνμ (Panagiotaki, 1992).
ε ακάθμβεξ ιεθέηεξ ηςκ Tabachek (1988) ηαζ Azaza et al. (2010), δζαπζζηχεδηε πςξ δ δζαζπμνά
ημο ιεβέεμοξ αολάκεηαζ πενζζζυηενμ ζε πθδεοζιμφξ πμο ηνέθμκηαζ ιε ιεβάθμ ηυηημ ηνμθήξ. Αοηυ
ελδβήεδηε ιε δομ ηνυπμοξ: μζ ιεβαθφηενμζ ηυηημζ ηνμθήξ, εκδεπμιέκςξ κα ήηακ πζμ ημκηά ζημ «αέθηζζημ»
ηυηημ ηνμθήξ ηαζ δεφηενμκ μζ ιεβαθφηενμζ ηυηημζ ηνμθήξ είκαζ ζπακζυηενμζ, ακεεηηζηυηενμζ ηαζ δ
ηαηακάθςζδ ημοξ δζεοημθφκεζ ηδ δδιζμονβία ή ηδ ζοκέπζζδ «ζενανπζχκ», απυ ηζξ μπμίεξ ζοκήεςξ
επςθεθμφκηαζ ηα ιεβαθφηενα άημια (Goldan et al.1997, Kestemont et al. 2003). Σέθμξ, μζ Nakamura &
Kasahara (1956) ηαζ μζ Wankowski & Thorpe (1979) οπμζηήνζλακ υηζ μ ακηαβςκζζιυξ βζα ημοξ
ιεβαθφηενμοξ ηυηημοξ ηνμθήξ είκαζ εκημκυηενμξ θυβς ηςκ θζβυηενςκ ηυηηςκ πμο πενζέπμκηαζ ζηδκ ίδζα
αζμιάγα ηνμθήξ ηαζ εκδεπμιέκςξ μδδβεί ζε αφλδζδ ηδξ παναθθαηηζηυηδηαξ.
Μεηά ηδ δζαθμβή ηα άημια ηδξ μιάδαξ ΓΜ200-300 ακαπηφπεδηακ βνδβμνυηενα ηαζ ζε ιήημξ ηαζ ζε
αάνμξ ζε ζπέζδ ιε ηα άημια ηδξ μιάδαξ ΓΜ200-400, ιε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ. Πανυιμζα εζηυκα
πανμοζζάγμοκ ηαζ ηα άημια ηδξ μιάδαξ ΓΜΜ200-300 ηα μπμία αολάκμκηαζ ηαπφηενα ζε ιήημξ ηαζ ζε αάνμξ ζε
ζπέζδ ιε ηα άημια ηδξ μιάδαξ ΓΜΜ200-400. Ζ δζαθμνά ζηδκ ακάπηολδ ημο ιήημοξ ήηακ ζηαηζζηζηά
ζδιακηζηή εκχ ζημ αάνμξ ιδ ζηαηζζηζηά ζδιακηζηή. Ζ δζαπίζηςζδ αοηή ένπεηαζ ζε ζοιθςκία ιε
αζαθζμβναθζηέξ ακαθμνέξ (Jobling & Reinsnes 1987, Barki et al. 2000), πμο οπμζηδνίγμοκ υηζ μ
δζαπςνζζιυξ ηςκ ιζηνχκ εοκμεί ηδκ ακάπηολδ ημοξ.
Τπάνπμοκ υιςξ ηαζ ακαθμνέξ βζα νοειμφξ ακάπηολδξ ιεβαθφηενμοξ, ηυζμ ημο ιήημοξ υζμ ηαζ ημο
αάνμοξ, ζε μιάδεξ πθδεοζιχκ υπμο πενζείπακ άημια ηαζ ηςκ δομ ιεβεεχκ (Imsland et al. 2008),
ζοιπεναίκμκηαξ πςξ μζ αθθδθεπζδνάζεζξ πμο επδνεάγμοκ ηδ ζοιπενζθμνά ιεηαλφ ηςκ ρανζχκ, παίγμοκ
ζδιακηζηυ νυθμ. Σέθμξ μ Kamstra (1993) παναηήνδζε υηζ δ δζαθμβή ιεβεεχκ δεκ πνμηάθεζε ζδιακηζηέξ
ιεηααμθέξ ζηδκ ακάπηολδ ηαζ ηδκ επζαίςζδ ηςκ αηυιςκ.
Ζ παναθθαηηζηυηδηα ζηζξ μιάδεξ ΓΜ200-300 ηαζ ΓΜΜ200-300 είκαζ ιεβαθφηενδ ζε ζπέζδ ιε ηζξ μιάδεξ
ΓΜ200-400 ηαζ ΓΜΜ200-400 ακηίζημζπα, πςνίξ ςζηυζμ κα επζαεααζχκεηαζ ιε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ.
Σμ πθεμκέηηδια πμο είπε ζηδκ ακάπηολδ δ μιάδα Ο200-400 είκαζ πζεακυκ κα απαθείθεηαζ θυβς ηδξ
δζαθμβήξ δ μπμία άθθςζηε ςξ εθανιμγυιεκδ πναηηζηή εκκμεί ηδκ ακάπηολδ ηςκ ιζηνχκ (Jobling &
Reinsnes 1987, De March 1997, Barki et al. 2000).
Δκδεπμιέκςξ, δ επίδναζδ ημο ιεβαθφηενμο εφνμοξ ημηημιεηνίαξ δ μπμία παναηδνήεδηε ιέπνζ ηδκ
διένα 47 κα απέδζδε πανυιμζα απμηεθέζιαηα ακ ιεηά ηδ δζαθμβή πανέπμκηακ ηνμθή ιε ιεβαθφηενμ εφνμξ
ηυηημο.
Βηβιηνγξαθία
Azaza M., Dhraief M., Kraiem M., Baras E. (2010). Influences of food particle size on growth, size
heterogeneity, food intake and gastric evacuation in juvenile Nile tilapia, Oreochromis niloticus, L., 1758.
Aquaculture, 309, 193-202.
Bailey J., Alanärä A.,Crampton V. (2003). Do delivery rate and pellet size affect growth rate in
Atlantic salmon (Salmo salar L.) raised under semi-commercial farming conditions? Aquaculture, 224, 79-
88.
Barki A., Harpaz G., Karplus I. (2000). Effects of larger fish and size grading on growth and size
variation in fingerling silver perch. Aquaculture International, 8, 391-401.
Brown M. (1946). The growth of brown trout (Salmo trutta L.).I. Factors affecting the growth of trout
fry. J. Exp. Biol., 22, 118-129.
Dos Santos J., Burkow I., Jobling M. (1993). Patterns of growth and lipid deposition in cod (Gadus
morhua L.) fed natural prey and fish based feeds. Aquaculture, 110, 173-189.
48
HydroMedit 2014, November 13-15, Volos, Greece
Fessehaye Y., Kabir A., Bovenhuis H., Komen H. (2006). Prediction of cannibalism in juvenile
Oreochromis niloticus based on predator to prey ratio, and effects of age and stocking density. Aquaculture,
255, 314-322.
Goldan O., Popper D., Karplus I. (1997). Management of size variation in juvenile gilthead seabream
(Sparus aurata) I: particle size and frequency of feeding dry and live food. Aquaculture, 152, 181-190.
Helland S., Grisdale-Helland B., Berge G. (1997). Feed intake and growth of Atlantic halibut
(Hippoglossus hippoglossus L.) fed combinations of pellet sizes. Aquaculture 156, 1-8.
Jobling M., Reinsnes T. G. (1987). Effect of sorting on size- frequency distributions and growth of
Arctic char Salvelinus alpinus. Aquaculture, 60, 27-31.
Jobling M., Wandsvik A. (1983). An investigation of factors controlling food intake in Arctic charr,
Salvelinus alpinus L. J. Fish Biol. 23, 391-404.
Imsland A., Jenssen M., Jonassen T., Stefansson S. (2008). Best among unequals? Effect of size
grading and different social environments on the growth performance of juvenile Atlantic halibut.
Aquaculture International doi, 10.1007/s10499-008-9193-7.
Kamstra A. (1993). The effect of size grading on individual growth in eel, Anguilla anguilla,
measured by individual marking. Aquaculture, 112 (1), 67-77.
Kestemont P., Jourdan S., Houbart M., Mélard C., Paspatis M., Fontaine P., Cuvier A., Kentouri M,
Baras E. (2003). Size heterogeneity, cannibalism and competition in cultured predatory fish larvae: biotic and
abiotic influences. Aquaculture 227, 333-356.
Nakamura N., Kasahara S. (1956). A study of the phenomenon of the Tobi Koi or shoot carp. II. On
the effect of particle size and quantity of the food. Bulletin of Japanese Society and Scientific Fisheries, 21,
1022-1024.
Panagiotaki P., 1992. The development of size variation in flatfish larvae. Ph.D. Thesis. University of
Liverpool.
Schwedler T.E., Collier J.A., Davis S.A. (1990). Variability of harvest of channel catfish as related to
stocking-size valiability. Prog.Fish Cult.,52, 185-188.
Smith I., Metcalfe N., Huntingford F. (1995). The effects of food pellet dimensions on feeding
responses by Atlantic salmon (Salmo salar L.) in a marine net pen. Aquaculture, 130, 167-175.
Stradmeyer L., Metcalfe N., Thorpe J. (1988). Effect of food pellet shape and texture on the feeding
response of juvenile Atlantic salmon. Aquaculture, 73, 217-228.
Tabachek J. (1988). The effect of feed particle size on growth and feed efficiency of Arctic charr
(Salvelinus alpinus (L.)). Aquaculture, 71, 319-330.
Wankowski J., Thorpe J. (1979). The role of food particle size in the growth of juvenile Atlantic
salmon (Salmo salar L.). Fish Biol., 351-370.
Welty J. (1934). Experiments on groups behaviour of fishes., Physiolo. Zool, 85-128.
49
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
Greek Mariculture has been rapidly expanded in the Eastern Mediterranean during the last 20 years leading
the sector to an increase of both the number of fish farms and farmed fisheries production. The present study
aims to: (a) investigate the trend of the work related accidents in the Mariculture Industry during the last five
years (2009-2013), (b) create a typology on the types of injuries and their seasonal distribution and (c) seek
potential correlations between changes in the trends of the types of injuries with the production line. Data
were derived from European statistics for accidents at work during 2009-2013 and covered all fish farms in
Greece. Results showed that fatal accidents represented an extremely low part of the total number of cases
(3.6%) and the total number of accidents (fatal and injuries) was decreased through time. Work related
injuries did not showed a seasonal pattern rather a high number of cases were marked at spotted periods
during the year, whereas fatal accidents took place during spring. In contrast, there is daily pattern showing
that a high number of accidents took place during 9am and 3pm. Time of accidents followed a stable pattern;
more than 85% of the cases took place during 6 am and 3 pm. Description and determination for health and
safety working conditions are serving as a reference base for further improvement of health and safety
working conditions and provides a future tool for human resources and production managers for maximizing
production and reducing work place hazards.
*Correspondence author: Tiligadas I., Safety and Health Inspector, Ministry of Labour, Labour Inspection
Body, Piraeus and South Aegean Sea, and, President of the Panhellenic Society of Technologist
Ichthyologists (PASTI), tililias@otenet.gr.
Σπιηγάδαο Ζ.1,2*, Μνπηφπνπινο Γ.Κ.3, Υαηδεεπζηαζίνπ Μ.2,4, Σζνπκάλε Μ.-Μ.2,5, Αλαζηαζίνπ .6
1
Τπμονβείμ Δνβαζίαξ, Δπζεεχνδζδ Αζθάθεζαξ Δνβαζίαξ, Τ.Δ.Κ.Α.Π.-.ΔΠ.Δ.-Κ.ΔΠ.Δ.Κ. Πεζναζά ηαζ
Νμηίμο Αζβαίμο, Δθθάδα, tililias@otenet.gr
2
Πακεθθήκζμξ φθθμβμξ Σεπκμθυβςκ Ηπεομθυβςκ, Δπζζηδιμκζηυξ ηαζ Δπαββεθιαηζηυξ φθθμβμξ, Πεζναζάξ
50
HydroMedit 2014, November 13-15, Volos, Greece
3
Σιήια Σεπκμθυβςκ Αθζείαξ - Τδαημηαθθζενβεζχκ, ΣΔΗ Γοηζηήξ Δθθάδαξ, Μεζμθυββζ, dmoutopo@teimes.gr
4
Δνβαζηήνζμ Σμπζηήξ ηαζ Νδζζςηζηήξ Ακάπηολδξ (Δ.Σ.Ν.Α.), Σιήια Πενζαάθθμκημξ, Πακεπζζηήιζμ Αζβαίμο,
Μοηζθήκδ, Δθθάδα, mhatzi@env.aegean.gr
5
Ηπεομβεκκδηζηυξ ηαειυξ Ηςακκίκςκ, Τπμονβείμ Αβνμηζηήξ Ακάπηολδξ & Σνμθίιςκ, Υάκζ-Σενυαμο,
Ηςάκκζκα, mirandatsoumani@gmail.com
6
Σιήια Γζμίηδζδξ οζηδιάηςκ Δθμδζαζιμφ, ΣΔΗ ηενεάξ Δθθάδαξ, Θήαα, sanastasiou@teiste.gr
Πεξίιεςε
Οζ δναζηδνζυηδηεξ ηδξ Θαθάζζζαξ Τδαημηαθθζένβεζαξ (ΘΤ) έπμοκ επεηηαεεί ιε βνήβμνμοξ νοειμφξ ζηδκ
Ακαημθζηή Μεζυβεζμ ηα ηεθεοηαία 20 πνυκζα μδδβχκηαξ ημκ ηθάδμ ζε αφλδζδ ηυζμ ημο ανζειμφ ηςκ
ιμκάδςκ υζμ ηαζ ηδξ παναβςβήξ ηςκ εηηνεθυιεκςκ πνμσυκηςκ. Ζ πανμφζα ενβαζία έπεζ ςξ ζηυπμ κα: (α)
δζενεοκήζεζ ηδκ ηάζδ ηςκ αηοπδιάηςκ ζηζξ ΘΤ ηαηά ηδ δζάνηεζα ηςκ ηεθεοηαίςκ πέκηε εηχκ (2009-2013),
(α) δδιζμονβήζεζ ιζα ηοπμθμβία ηςκ αηοπδιάηςκ ιε αάζδ ημκ ηφπμ ημο αηοπήιαημξ, ηδκ επμπζηυηδηά ημοξ,
ηδ πςνζηή ημοξ ηαηακμιή ηαζ ηα ημζκςκζηά παναηηδνζζηζηά ηςκ ενβαγμιέκςκ ηαζ (β) δζενεοκήζεζ πζεακμφξ
ζοζπεηζζιμφξ ηςκ αθθαβχκ ζηζξ ηάζεζξ ηςκ ηφπςκ αηοπδιάηςκ ιε ηδ βναιιή παναβςβήξ. Σα δεδμιέκα
πνμήθεακ απυ ηδκ Δονςπασηή ηαηζζηζηή Τπδνεζία αηοπδιάηςκ ζημ πχνμ ενβαζίαξ ηαζ ηαθφπηεζ υθεξ ηζξ
ιμκάδεξ ΘΤ ζηδκ Δθθάδα. Σα απμηεθέζιαηα έδεζλακ υηζ ηα εακαηδθυνα αηοπήιαηα ακηζπνμζςπεφμοκ έκα
ζοκηνζπηζηά εθάπζζημ πμζμζηυ ηςκ αηοπδιάηςκ (3,2%) ηαζ δ ηάζδ ημο ζοκμθζημφ ανζειμφ ηςκ αηοπδιάηςκ
ιεζχκμκηακ ζδιακηζηά ζημ πνυκμ. Ο ανζειυξ ηςκ αηοπδιάηςκ δεκ αημθμοεμφζε έκα επμπζηυ πνυηοπμ πανά
εκημπίγμκηακ ζε ζοβηεηνζιέκμοξ ιήκεξ ηαηά ηδ δζάνηεζα ημο έημοξ, εκχ οπάνπεζ έκα δζάζηδια ιεηαλφ 9 ημ
πνςί ηαζ 3 ημ ιεζδιένζ υπμο θαιαάκμοκ πχνα ηα πενζζζυηενα αηοπήιαηα. Ζ απμηφπςζδ ηςκ ηάζεςκ ηςκ
αηοπδιάηςκ ζηζξ ΘΤ ηαζ μ ηαεμνζζιυξ ιζαξ ηοπμθμβίαξ ημοξ εα πνδζζιεφεζ ςξ αάζδ ακαθμνάξ βζα ηδκ
πεναζηένς αεθηίςζδ ηςκ ζοκεδηχκ ενβαζίαξ, ηδκ οβεία ηαζ ηδκ αζθάθεζα ηαζ εα απμηεθέζεζ έκα ενβαθείμ
βζα ηδ ιεβζζημπμίδζδ ηδξ παναβςβήξ ζε ζοκδοαζιυ ιε ηδ ιείςζδ ηςκ αηοπδιάηςκ ζημ πχνμ ενβαζίαξ.
1. Δηζαγσγή
Ο ημιέαξ ηςκ εαθάζζζςκ οδαημηαθθζενβεζχκ (ΘΤ) ζηδκ Δθθάδα επέδεζλε ιζα ηαπφηαηδ ακάπηολδ ηαηά ηδκ
ηεθεοηαία 25εηία ιε ηδκ παναβςβή κα θεάκεζ ζημοξ 100000 ηυκμοξ ημ 2011, εκχ ιζα ηνζπθάζζα αφλδζδ
ακαιέκεηαζ ζηα επυιεκα πνυκζα. Πανάθθδθα, μζ έκημκμζ αοημί νοειμί ακάπηολδξ αολάκμοκ ημκ ανζειυ ηςκ
ενβαζζχκ ζηζξ ιμκάδεξ πμο ζπεηίγμκηαζ ιε ηζξ επζπηχζεζξ ζημ εζςηενζηυ ηςκ ενβαγμιέκςκ απυ ηζξ βεςνβζηέξ
αζμιδπακίεξ. ε πνμδβμφιεκδ ενβαζία (Σοθζβάδαξ ηαζ Μμοηυπμοθμξ 2013) επζπεζνήεδηε ιζα πνχηδ
πενζβναθζηή ακάθοζδ ημο ανζειμφ ηςκ αηοπδιάηςκ βζα ηδκ πενίμδμ 2009-2011. ηδκ πανμφζα ενβαζία
έβζκε επζηαζνμπμίδζδ ηςκ δεδμιέκςκ ιε αοηά ηδξ πενζυδμο 2012-2013 ηαζ ακαθφεδηακ μζ πανάιεηνμζ πμο
μδδβμφκ ζημ κα ακαπηοπεεί ή/ηαζ κα εηδδθςεεί ιία επζηίκδοκδ ηαηάζηαζδ ζε αηφπδια. Δζδζηυηενα, βίκεηαζ
ιζα: (α) δζενεφκδζδ ηδξ ηάζδξ ηςκ αηοπδιάηςκ ζηζξ ΘΤ ηαηά ηδ δζάνηεζα ηςκ ηεθεοηαίςκ πέκηε εηχκ (2009-
2013), (α) ακάπηολδ ηδξ ηοπμθμβίαξ ηςκ αηοπδιάηςκ ιε αάζδ ημκ ηφπμ ημο αηοπήιαημξ, ηδκ επμπζηυηδηά
ημοξ, ηδ πςνζηή ημοξ ηαηακμιή ηαζ ηα ημζκςκζηά παναηηδνζζηζηά ηςκ ενβαγμιέκςκ ηαζ (β) ιζα ζοζπέηζζδ
ηςκ αθθαβχκ ζηζξ ηάζεζξ ηςκ ηφπςκ αηοπδιάηςκ ιε ηδ βναιιή παναβςβήξ. Σα ζημζπεία ηςκ ενβαηζηχκ
αηοπδιάηςκ ζηζξ ΘΤ βζα ηδκ πενίμδμ πνζκ ημ 2009 δεκ ήηακ δοκαηυ κα ακαθοεμφκ, ηαεχξ ηα παναπάκς
δεδμιέκα ηαηαβνάθμοκ ιαγί ηζξ πενζπηχζεζξ αηοπδιάηςκ ζε ζοζηεοαζηήνζα ηαζ ιεηαπμζδηζηέξ ιμκάδεξ
αβνμηζηχκ ηαζ εαθαζζίςκ πνμσυκηςκ.
Σα δεδμιέκα πνμήθεακ απυ ηζξ εηήζζεξ εηεέζεζξ ημο χιαημξ Δπζεεχνδζδξ Δνβαζίαξ ημο Τπμονβείμο
Δνβαζίαξ ηαζ δ ιεεμδμθμβία πμο αημθμοεήεδηε ζηδνίγεηαζ ζηα πνυηοπα πμο ηαεμνίγμκηαζ απυ ηδκ Eurostat
(ESAW: Δονςπασηέξ ζηαηζζηζηέξ βζα ηα ενβαηζηά αηοπήιαηα 2001). Ζ ακάθοζδ ηςκ δεδμιέκςκ ηςκ
ενβαηζηχκ αηοπδιάηςκ πενζεθάιαακε ηδ δζενεφκδζδ: (α) ηδξ φπανλδξ ηάζδξ, (α) επμπζημφ ηαζ ςνζαίμο
51
HydroMedit 2014, November 13-15, Volos, Greece
πνμηφπμο, (β) παναηηδνζζηζηχκ ηδξ επζπείνδζδξ (ανζειυξ ενβαγμιέκςκ), (δ) θφζδ ημο αηοπήιαημξ (θφζδ
ηςκ ηαηχζεςκ ηαζ ιένμξ ημο ζχιαημξ) ηαζ (ε) ζοζπέηζζδξ ιε ημζκςκζηά παναηηδνζζηζηά ηςκ ενβαγμιέκςκ
(θφθμ, εεκζηυηδηα, δθζηζαηή μιάδα). Γζα ηδκ ηςδζημπμίδζδ ηςκ παναιέηνςκ πμο ιεθεηήεδηακ
αημθμοεήεδηε δ ηςδζημπμίδζδ πμο ακαθένεηαζ ζηδ ιεεμδμθμβία βζα ηα ενβαηζηά αηοπήιαηα απυ ηδκ
Eurostat. Ζ ακάθοζδ ηςκ δεδμιέκςκ πενζεθάιαακε ηδκ εηηίιδζδ ζοπκμηήηςκ βζα ηάεε ιζα απυ ηζξ
παναπάκς παναιέηνμοξ ζημ ζφκμθμ ημο δείβιαημξ εκχ έβζκε ηαζ έθεβπμξ ακελανηδζίαξ (Zar, 1999) ιε ηδ π 2
ηαηακμιή (Likelihood-ratio π2), βζα ηζξ πενζπηχζεζξ ζοβηνίζεςκ ηςκ παναιέηνςκ πμο αθμνμφζακ ηα
ενβαηζηά αηοπήιαηα ιε ηα ημζκςκζηά παναηηδνζζηζηά ηςκ ενβαγμιέκςκ. Ζ ζφβηνζζδ ηςκ ηθίζεςκ ηδξ
ιεηααμθήξ ημο ανζειμφ ηςκ αηοπδιάηςκ ιε ημ θφθμ έβζκε ιε ηδκ ακάθοζδ ζοιιεηααθδηυηδηαξ (ANCOVA)
(Zar, 1999).
3. Απνηειέζκαηα
οκμθζηά 221 ενβαηζηά αηοπήιαηα έθααακ πχνα ζηζξ εθθδκζηέξ εαθάζζζεξ οδαημηαθθζένβεζεξ ηδκ πενίμδμ
2009-2013, ιε ημ ιέζμ εηήζζμ ανζειυ ηςκ αηοπδιάηςκ κα είκαζ 44,2 (ηοπζηή απυηθζζδ 5,5) ηαζ ιε ηα
εακαηδθυνα αηοπήιαηα κα ακηζπνμζςπεφμοκ έκα ζοκηνζπηζηά εθάπζζημ πμζμζηυ ημο ζοκυθμο ηςκ
αηοπδιάηςκ (7 αηοπήιαηα: 3,2%). Ζ ηάζδ ημο ζοκμθζημφ ανζειμφ ηςκ αηοπδιάηςκ ιεζχκμκηακ ζδιακηζηά
(P>0,05) ιέζα ζημ πνυκμ (Δζηυκα 1α), ιε ηδκ ηάζδ κα είκαζ ζδιακηζηή ηαζ κα έπεζ ηδκ ίδζα έκηαζδ ιείςζδξ
(ANCOVA, P>0,05) ηαζ ζηα δφμ θφθα. Ο ανζειυξ ηςκ αηοπδιάηςκ δεκ αημθμοεμφζε έκα επμπζηυ πνυηοπμ
(Δζηυκα 1α) πανά εκημπίγμκηακ ζε ζοβηεηνζιέκμοξ ιήκεξ ηαηά ηδ δζάνηεζα ημο έημοξ (46% ηςκ αηοπδιάηςκ
εκημπίγμκηακ ηαηά ημοξ ιήκεξ Ημφθζμ, επηέιανζμ, Οηηχανζμ ηαζ Γεηέιανζμ), εκχ ηα εθάπζζηα εακαηδθυνα
αηοπήιαηα θάιαακακ πχνα ηονίςξ ηδκ άκμζλδ (Μάνηζμξ-Μάζμξ).
Σμ ζφκμθμ ηςκ εακαηδθυνςκ αηοπδιάηςκ αθμνμφζε απμηθεζζηζηά άκδνεξ ενβαγμιέκμοξ δθζηίαξ απυ 18
έςξ 44 εηχκ, εκχ ζημοξ ηναοιαηζζιμφξ ημ 70,6% ηςκ πενζπηχζεςκ αθμνμφζε άκδνεξ ηαζ ημ οπυθμζπυ
βοκαίηεξ ενβαγυιεκμοξ (Πίκαηαξ 1). Ζ δθζηζαηή μιάδα ιε ημ ιεβαθφηενμ πμζμζηυ ηναοιαηζζιχκ ήηακ
ακάιεζα ζηα 35-44 πνυκζα, ιε ημ ιεβαθφηενμ πμζμζηυ ηςκ ηναοιαηζζιχκ ηαζ ζηα δομ θφθα (>75%) κα
αθμνμφκ ενβαγυιεκμοξ δθζηίαξ απυ 35 έςξ 54 εηχκ, εκχ ηα πμζμζηά αοηά δε δζέθενε ζδιακηζηά (P>0,05)
ιε ημ θφθμ (Πίκαηαξ 1). Πενζζζυηενμ απυ ημ 80% ηςκ αηοπδιάηςκ έβζκακ ζε έθθδκεξ ενβαγυιεκμοξ
(Πίκαηαξ 1) ηαζ ζε ιζηνυηενμ πμζμζηυ αημθμοεμφζακ μζ αθθμδαπμί ενβαγυιεκμζ πνμενπυιεκμζ εηηυξ ηδξ
ΔΔ (13,6%).
Ο ανζειυξ ηςκ ηναοιαηζζιχκ ακά εεκζηυηδηα δζέθενε ζδιακηζηά (P<0,05) ιε ημ θφθμ, ιε ημοξ άκδνεξ
αθθμδαπμφξ ενβαγυιεκμοξ πνμενπυιεκμοξ εηηυξ ΔΔ κα ηναοιαηίγμκηαζ ζε ιεβαθφηενμ πμζμζηυ απυ ηζξ
βοκαίηεξ (Πίκαηαξ 1). Ακαθμνζηά ιε ηδ εέζδ ενβαζίαξ, ημ ζφκμθμ ηςκ εακαηδθυνςκ αηοπδιάηςκ ηαζ ημ
ζοκηνζπηζηυ πμζμζηυ ηςκ ηναοιαηζζιχκ ηαηαβνάθδηε ζε ενβαγυιεκμοξ ιε ζοκήεδ εέζδ ενβαζίαξ Ζ εέζδ
ενβαζίαξ δζαθμνμπμζμφκηακ ζδιακηζηά (P<0.05) ιε ημ θφθμ, ιε ημοξ άκδνεξ ενβαγυιεκμοξ ζε
πενζζηαζηζαηή ή ηζκδηή εέζδ ενβαζίαξ κα ηναοιαηίγμκηαζ ζε ιεβαθφηενμ πμζμζηυ απυ υηζ μζ βοκαίηεξ
ενβαγυιεκεξ.
Πενζζζυηενμ απυ ηζξ ιζζέξ πενζπηχζεζξ ηςκ εακαηδθυνςκ αηοπδιάηςκ έθααακ πχνα ζε επζπεζνήζεζξ ιε
ζοκμθζηυ ανζειυ αηυιςκ απυ 10 έςξ 49 άημια, ιε ημοξ άκδνεξ ενβαγυιεκμοξ κα επζδεζηκφμοκ ιεβαθφηενα
πμζμζηά ηναοιαηζζιχκ ζηζξ επζπεζνήζεζξ ιε ανζειυ αηυιςκ απυ 10 έςξ 49 ηαζ ηζξ βοκαίηεξ ζηζξ
επζπεζνήζεζξ ιε 1 έςξ 9 ενβαγυιεκμοξ (Πίκαηαξ 1).
Καηά ηδκ πνςζκή αάνδζα ενβαζίαξ (6 π.ι. έςξ 2 ι.ι.) θάιαακε πχνα πενζζζυηενμ απυ ημ 85% ηςκ
εακαηδθυνςκ αηοπδιάηςκ ηαζ ημ 75% ηςκ ηναοιαηζζιχκ (Δζηυκα 1β), ιε ημ θφθμ κα ιδ δζαθμνμπμζεί
ζδιακηζηά (P<0,05) ημκ ανζειυ ηςκ ηναοιαηζζιχκ ακά χνα αηοπήιαημξ (Πίκαηαξ 1). ημ 71% ηςκ
εακαηδθυνςκ πενζπηχζεςκ ήηακ άβκςζηδ δ θφζδ ηδξ ηάηςζδξ, εκχ ζηζξ πενζπηχζεζξ ηςκ ηναοιαηζζιχκ ημ
ιεβαθφηενμ πμζμζηυ ηαζ ζηα δφμ θφθα ηαηαβνάθμκηακ βζα επζθακεζαηέξ ηαηχζεζξ ηαζ ζε ιζηνυηενα
πμζμζηά ζε ακμζπηά ηναφιαηα ηαζ απθά ηαηάβιαηα. Ζ ζφβηνζζδ ημο ανζειμφ ηςκ ηναοιαηζζιχκ ακά θφζδ
ηάηςζδξ ζε ζοκάνηδζδ ιε ημ θφθμ έδεζλε υηζ δεκ οπήνπε ζδιακηζηή (P>0,05) δζαθμνά ιε ημ θφθμ (Πίκαηαξ
1). Απυ ηζξ πενζπηχζεζξ πμο είπε πνμζδζμνζζηεί δ θφζδ ηδξ ηάηςζδξ, ημ ιεβαθφηενμ πμζμζηυ (11,9 ηαζ
12,7%) ηαηαβνάθδηε βζα ηαηχζεζξ ζηα δάπηοθα ηςκ πενζχκ, εκχ ηα πμζμζηά δζαθμνμπμζμφκηακ ζδιακηζηά
52
HydroMedit 2014, November 13-15, Volos, Greece
4. πδήηεζε
ηδκ πανμφζα ενβαζία βίκεηαζ, βζα πνχηδ θμνά, ιζα απμηφπςζδ ηδξ ηοπμθμβίαξ ηςκ ενβαηζηχκ αηοπδιάηςκ
πμο έθααακ πχνα ζηζξ εθθδκζηέξ εαθάζζζεξ οδαημηαθθζένβεζεξ ηδκ πενίμδμ 2009-2013, δ μπμία απμηεθεί
ζοκέπεζα πνμδβμφιεκδξ ακαθμνάξ ζημ ίδζμ εέια (Σοθζβάδαξ ηαζ Μμοηυπμοθμξ. 2014). Σα απμηεθέζιαηα
έδεζλακ ζε πνχημ επίπεδμ υηζ οπάνπεζ ιζα πηςηζηή ηάζδ ημο ανζειμφ ηςκ αηοπδιάηςκ ηαζ υηζ μ ανζειυξ ηςκ
εακαηδθυνςκ πενζζηαηζηχκ είκαζ παιδθυξ. Οζ εηηζιήζεζξ ηςκ 44 αηοπδιάηςκ ηαηά ιέζμ υνμ ακά έημξ ηαζ
ημο ανζειμφ ηςκ εακαηδθυνςκ αηοπδιάηςκ ακηζπνμζςπεφμοκ έκα ιζηνυ πμζμζηυ (< 3 ημζξ πζθίμζξ) ημο
ζοκυθμο ηςκ αηοπδιάηςκ ζημοξ έθθδκεξ ενβαγυιεκμοξ, αθθά έκα ιεβάθμ πμζμζηυ ηςκ αηοπδιάηςκ ζημκ
ημιέα ηδξ βεςνβίαξ (ιεβαθφηενμ απυ ημ 25%) (Σοθζβάδαξ ηαζ Μμοηυπμοθμξ, 2013).
ηζξ πενζπηχζεζξ ηςκ παναιέηνςκ μζ μπμίεξ δζαθμνμπμζμφκηακ ςξ πνμξ ημ θφθμ πνέπεζ κα ακαθενεεί υηζ μζ
άκδνεξ ενβαγυιεκμζ απμηεθμφκ ηδκ απυθοηδ πθεζμρδθία ηςκ ενβαγμιέκςκ ζηζξ πθςηέξ ιμκάδεξ παναβςβήξ,
υπςξ απαζηείηαζ απυ ημοξ ελακηθδηζημφξ νοειμφξ ενβαζίαξ ζηζξ εαθάζζζεξ οδαημηαθθζένβεζεξ, εκχ μζ
βοκαίηεξ θυβς ηδξ ζπμθαζηζηυηδηαξ πμο ηζξ δζαηνίκεζ απμηεθμφκ ηδκ πθεζμρδθία ζημοξ ζηαειμφξ
παναβςβήξ ζηδκ λδνά ηαζ ηα ζοζηεοαζηήνζα κςπχκ ή ηαζ ιεηαπμζδιέκςκ εαθάζζζςκ πνμσυκηςκ,
ακελάνηδηα ημο ιεβέεμοξ ηδξ εηαζνείαξ. Πανυθα αοηά, μζ άκδνεξ ενβαγυιεκμζ ζε ιζηνέξ επζπεζνήζεζξ ηάης
10 αηυιςκ ειθακίγμοκ ιζηνυηενα πμζμζηά ηναοιαηζζιχκ απυ ηζξ βοκαίηεξ, ιε ηδκ επζθφθαλδ ηδξ εεχνδζδξ
ςξ λεπςνζζηχκ εβηαηαζηάζεςκ ηδξ ίδζαξ επζπείνδζδξ ημοξ πχνμοξ ζημοξ μπμίμοξ ηαηαβνάθδηακ ηα
αηοπήιαηα.
Απυ ηα απμηεθέζιαηα ηδξ πανμφζαξ ένεοκαξ βίκεηαζ θακενυ υηζ μζ άκδνεξ ενβαγυιεκμζ έπμοκ οπενδζπθάζζμ
ανζειυ αηοπδιάηςκ ηαζ είκαζ ηα απμηθεζζηζηά εφιαηα ηςκ εακαηδθυνςκ ελ αοηχκ. Ακελάνηδηα ηδξ
δθζηζαηήξ μιάδαξ ζηδκ μπμία ακήημοκ άκδνεξ ηαζ βοκαίηεξ, μζ ενβαγυιεκμζ δείπκμοκ εοάθςημζ ζηζξ δθζηίεξ
25-54 έηδ ζοκδβμνχκηαξ ζηδκ οπυεεζδ υηζ δ ενβαζία ζηζξ οδαημηαθθζένβεζεξ είκαζ απαζηδηζηή ηαζ
πνεζάγεηαζ ζοκεπήξ εηπαίδεοζδ ηαζ επίαθερδ ηαηά ηδκ εηηέθεζδ αοηήξ (Hatzakis 2005), αθμφ μζ
πενζζζυηενμζ ηναοιαηζζιμί αθμνμφκ ενβαγυιεκμοξ μζ μπμίμζ δναζηδνζμπμζμφκηαζ ζε παναπάκς απυ ηδ ιζα
εέζδ ενβαζίαξ (πενζζηαζζαηή ή ηζκδηή εέζδ ενβαζίαξ).
Με ηδκ παναδμπή ηδξ 24ςνδξ θεζημονβίαξ ηδξ επζπείνδζδξ, θυβς ηδξ ζοκηήνδζδξ ηαζ δζάεεζδξ γςκηακχκ
μνβακζζιχκ οπάνπεζ έκα δζάζηδια ιεηαλφ 9 ημ πνςί ηαζ 3 ημ ιεζδιένζ υπμο είκαζ ζφκδεεξ κα ζοιααίκμοκ
αηοπήιαηα εκηυξ ημο ςνανίμο ενβαζίαξ ηςκ πενζζζυηενςκ ενβαγυιεκςκ. διεζχκεηαζ υηζ μζ αάνδζεξ, εηηυξ
ηςκ πνςζκχκ, ζηζξ οδαημηαθθζένβεζεξ, απακηχκηαζ ηφνζα ηαηά ηδ δζαδζηαζία ηδξ ζοζηεοαζίαξ ή/ηαζ ηδξ
ιεηαπμίδζδξ ημο πνμσυκημξ, ημ μπμίμ έπεζ αθζεοεεί κςνίηενα ηδκ ίδζα διένα. Δπίζδξ, αμδεδηζηέξ ενβαζίεξ,
υπςξ μ εθμδζαζιυξ ιε ηνμθέξ ή άθθμ ελμπθζζιυ πμο ζοκήεςξ βίκεηαζ εηηυξ πνςζκήξ αάνδζαξ θαίκεηαζ κα
ζοκδβμνμφκ ιε ηα αηοπήιαηα ηαηά ηζξ απμβεοιαηζκέξ χνεξ. Σμ επμπζηυ πνυηοπμ πμο πενζβνάθδηε ιπμνεί κα
μθείθεηαζ ζηδκ εκηαηζημπμίδζδ ημο ηφηθμο παναβςβήξ ηςκ επζπεζνήζεςκ (εζζαβςβή ζε ηθςαμφξ - εηηνμθή -
ελαθίεοζδ - ενβαζίεξ ζοκηήνδζδξ) ηαηά ημοξ ακηίζημζπμοξ ιήκεξ (ηαθμηαζνζκμφξ ιήκεξ: Dimitriou et al.
2007).
Σμ είδμξ ημο ηναοιαηζζιμφ ηαζ ημ ιένμξ ημο ζχιαημξ πμο ζοκήεςξ επδνεάγεηαζ δείπκεζ κα ζοκδβμνεί ζηδ
ζπεηζηά αανζά ζςιαηζηή ενβαζία ηυζμ βζα ημοξ άκηνεξ υζμ ηαζ βζα ηζξ βοκαίηεξ ενβαγυιεκμοξ (Zakia et al.
2012), υπμο μ δζαπςνζζιυξ ηςκ εέζεςκ ενβαζίαξ ιεηαλφ ημοξ, υπςξ ακαθένεδηε, μδδβεί ημοξ ιεκ άκδνεξ ζε
πμθθαπθμφξ ηναοιαηζζιμφξ ηζξ δε βοκαίηεξ ζε ηαηχζεζξ (ηονίςξ 'ημρίιαηα') ηςκ άηνςκ ηαζ ζδζαίηενα ηςκ
δαηηφθςκ ηςκ πενζχκ. Έηζζ μζ άκδνεξ ηναοιαηίγμκηαζ εκ δοκάιεζ ζε υθμ ημ ζχια μζ δε βοκαίηεξ ηφνζα ζηα
άηνα ηαζ ηδκ ιέζδ. Σα πνμδβμφιεκα ζοκδβμνμφκ βζα ηδκ πνήζδ πμθθαπθχκ ελμπθζζιχκ ενβαζίαξ απυ ημοξ
άκδνεξ ηαζ ζδζαίηενα ηαζ εζδζηυηενα απυ ηζξ βοκαίηεξ.
53
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
Dimitriou E., Katselis G., Moutopoulos D.K, Akovitiotis C., Koutsikopoulos C. (2007). Possible influence of
reared gilthead sea bream (Sparus aurata, L.) on wild stocks in the area of the Messolonghi lagoon (Ionian
Sea, Greece). Aquaculture Research 38(4): 398-408.
Δονςπασηή Δπζηνμπή (2001). Δονςπασηέξ ζηαηζζηζηέξ ζπεηζηά ιε ηα ενβαηζηά αηοπήιαηα.
http://europa.eu.int/comm/employment_social/h&s/index_en.htm
Hatzakis K.D., Kritsotakis E.I., Angelaki H.P., Tzanoudaki I.K., Androulaki Z.D. (2005). First aid
knowledge among industry workers in Greece. Industrial Health, 43: 327-332.
Σοθζβάδαξ Ζ., Μμοηυπμοθμξ Γ.Κ. (2013). Δθθδκζηέξ Θαθαζζμηαθθζένβεζεξ: ηνέπμοζα ηαηάζηαζδ
ενβαηζηχκ αηοπδιάηςκ. Τβζεζκή ηαζ Αζθάθεζα ηδξ Δνβαζίαξ. Έηδμζδ ημο Δθθδκζημφ Ηκζηζημφημο Τβζεζκήξ
ηαζ Αζθάθεζαξ Δνβαζίαξ-ΔΛΗΝΤΑΔ, 53: 9-14.
Zakia A.M.Α, Dosiki M.I., Nasr S.A.A. (2012) Occupational Hazards in fish industry. World Journal of Fish
and Marine Sciences, 4(2): 201-210.
Zar J. (1999): Biostatistical Analysis. 4th Edition. Prentice Hall, New Jersey. 663 ζεθ.
20 20
3 21
15 15
Μάρηιος Νοέμβριος 4 20
10 10
5 19
30 5 5
N=35,8-1,4t Απρίλιος 0 Οκηώβριος 6 0 18
R² = 0,210
7 17
N=16,5-1,3t Μάιος Σεπηέμβριος 8 16
R² = 0,579
0 9 15
2009 2010 2011 2012 2013 Ιούνιος Αύγοσζηος 10 14
11 13
Έηος Ιούλιος 12
Δηθφλα 1. Αξηζκφο εξγαηηθψλ αηπρεκάησλ ζηηο ειιεληθέο πδαηνθαιιηέξγεηεο ηελ πεξίνδν 2009-
2013 ζε ρξνληθή θιίκαθα: (α) εηψλ, (β) κελψλ θαη (γ) σξψλ εξγαζίαο.
54
HydroMedit 2014, November 13-15, Volos, Greece
(ζπλερίδεηαη)
Πίλαθαο 1 (ζπλέρεηα)
55
HydroMedit 2014, November 13-15, Volos, Greece
Porlou D.1*, Athanasiou D.1, Vlachonikola E.1, Nathanailides C.2, Karayannakidis P.3,
Chatziantoniou S.3, Karapanagiotidis I.4, Michaelidis B.1
1
Laboratory of Animal Physiology, Department of Zoology, School of Biology, Faculty of Science,
Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
2
Department of Fisheries and Aquaculture Technology, Technological Educational Institute of West
Greece, 30200 Messolonghi, Greece
3
Technology and Quality Control of Fish and Fish Products Laboratory, Department of Food
Technology, Alexander Technological Educational Institute of Thessaloniki, P.O. Box 141,
Thessaloniki, Greece
4*
Department. of Agriculture, Ichthyology and Aquatic Environment, University of Thessaly, 38446
Volos, Greece
ABSTRACT
During this ongoing project we examined the seasonal energy investment in Pagrus pagrus (Linnaeus,
1758). Fish samplings (4) from an aquaculturestation in Evia Gulf, took place from November 2013
until June 2014. At each sampling 20 fish were collected, main biometric parameters (total weight,
fork length, liver weight, gonad weight) were recorded and finally fish were dissected for the isolation
of several tissues (heart, liver, spleen, gonads, white and red muscle). Tissues were immediately
frozen in liquid nitrogen. Samples were kept at – 80μC for further analysis. % Protein in liver, red and
white muscle was quantified by the Kjeldahl method. Furthermore glycogen, total lipid levels and
fatty acids profile were quantified. Fatty acids profile was prepared as described by Karayannakidis et
al. (2008). Of the main energy sources, glycogen and lipids showed a seasonal pattern. Glycogen
levels increased significantly at the end of the breeding period, while fatty acids levels decreased.
Protein levels did not show significant differences in the seasonal pattern.
Key words: Red porgy, Energy investment
*Corresponding author: Porlou Despoina (dporlou@bio.auth.gr)
Ποπλού Γ.1, Αθαναζίος Γ.1, Βλασονικόλα Δ.1, Ναθαναηλίδηρ K.2, Καπαγιαννακίδηρ Π.3,
Χαηζηανηωνίος Σ.3, Καπαπαναγιωηίδηρ Ι.4, Μισαηλίδηρ Β.1
1
Δνβαζηήνζμ Φοζζμθμβίαξ Εχςκ, Σιήια Βζμθμβίαξ, πμθή Θεηζηχκ Δπζζηδιχκ, Ανζζημηέθεζμ
Πακεπζζηήιζμ Θεζζαθμκίηδξ, Πακεπζζηδιζμφπμθδ 54124 Θεζζαθμκίηδ, Δθθάδα
2
Σιήια Σεπκμθυβςκ Αθζείαξ ηαζ Τδαημηαθθζενβεζχκ, Σεπκμθμβζηυ Δηπαζδεοηζηυ Ίδνοια Γοηζηήξ
Δθθάδαξ, 30200 Μεζμθυββζ, Δθθάδα
3
Σιήια Σεπκμθμβίαξ Σνμθίιςκ. Αθελάκδνεζμ Σεπκμθμβζηυ Δηπαζδεοηζηυ Ίδνοια Θεζζαθμκίηδξ. 141
Θεζζαθμκίηδ, Δθθάδα
4
Σιήια Γεςπμκίαξ Ηπεομθμβίαξ ηαζ Τδάηζκμο Πενζαάθθμκημξ, Πακεπζζηήιζμ Θεζζαθίαξ, Φοηυημο
38446, Νέα Ηςκία, Βυθμξ, Δθθάδα
Πεξίιεςε
ηδκ πανμφζα ενβαζία, πανμοζζάγμκηαζ απμηεθέζιαηα ζπεηζηά ιε ημ επμπζηυ πνυηοπμ ηδξ
εκενβεζαηήξ επέκδοζδξ ηαζ ηδξ ιεηααμθήξ ηςκ θζπανχκ μλέςκ ζημ θαββνί Pagrus pagrus (Linnaeus,
1758). Οζ 4 δεζβιαημθδρίεξ έθααακ πχνα απυ ημκ Νμέιανζμ ημο 2013 ιέπνζ ημκ Ημφκζμ ημο 2014 ζε
56
HydroMedit 2014, November 13-15, Volos, Greece
ζπεομηαθθζένβεζα ζημκ Δοαμσηυ Κυθπμ. ε ηάεε δεζβιαημθδρία ζοθθέπεδηακ 20 άημια, βζα ηα μπμία
ηαηαβνάθδηακ μζ ηονζυηενεξ αζμιεηνζηέξ πανάιεηνμζ (μθζηυ αάνμξ, ιεζμοναίμ ιήημξ, αάνμξ ήπαημξ,
αάνμξ βμκάδςκ) ηαζ πναβιαημπμζήεδηε ακαημιία (ηανδζάξ, ήπαημξ, ζπθήκαξ, βμκάδςκ, θεοημφ ηαζ
ενοενμφ ιο). Σα δείβιαηα δζαηδνήεδηακ ζημοξ - 80μC βζα ιεθθμκηζηή πνήζδ. ημοξ ζζημφξ ημο
ήπαημξ, ημο ενοενμφ ηαζ ημο θεοημφ ιο πναβιαημπμζήεδηε μ πμζμηζηυξ πνμζδζμνζζιυξ ηςκ
πνςηεσκχκ ιε ηδ ιέεμδμ Kjeldahl, μ πνμζδζμνζζιυξ ημο βθοημβυκμο, δ ιέηνδζδ ημο μθζημφ
πμζμζημφ ηςκ θζπζδίςκ ηαεχξ ηαζ ημ πνμθίθ θζπανχκ μλέςκ. Σμ πνμθίθ θζπανχκ μλέςκ
παναζηεοάζηδηε υπςξ πενζβνάθεηαζ απυ ημοξ Karayannakidis et al. (2008). ηδ ηανδζά έβζκε ιυκμ μ
πμζμηζηυξ πνμζδζμνζζιυξ ηςκ πνςηεσκχκ. Απυ ηζξ ηφνζεξ πδβέξ εκένβεζαξ, ημ βθοημβυκμ ηαζ ηα
θζπίδζα πανμοζίαζακ επμπζηυ πνυηοπμ. Σα επίπεδα ημο βθοημβυκμο αολήεδηακ ζδιακηζηά ζημ ηέθμξ
ηδξ ακαπαναβςβζηήξ πενζυδμο, εκχ ακηίεεηα ηα επίπεδα ηςκ θζπανχκ μλέςκ ιεζχεδηακ. Οζ πνςηεΐκεξ
δεκ έπμοκ δείλεζ ζδιακηζηέξ δζαθμνέξ ζημ επμπζηυ ημοξ πνυηοπμ.
Λέμεηο θιεηδηά : Φαγγξί, Δλεξγεηαθή επέλδπζε
οββναθέαξ επζημζκςκίαξ: Πμνθμφ Γέζπμζκα (dporlou@bio.auth.gr)
1. Δηζαγσγή
Ζ επμπζαηή ακάπηολδ ηαζ μζ ηφηθμζ απμεήηεοζδξ εκένβεζαξ είκαζ ημζκέξ ιεηαλφ ηςκ ρανζχκ
ηαζ ζπεηίγμκηαζ ζε ιεβάθμ ααειυ ιε ηδκ ακαπαναβςβζηή πενίμδμ. Ζ εκένβεζα πμο είκαζ δζαεέζζιδ ζηα
ράνζα πνέπεζ κα ηαηακέιεηαζ επμπζηά ζηδκ αφλδζδ, ζηδκ ακάπηολδ ηδξ ζςιαηζηήξ ιάγαξ ηαζ ζηδκ
ακαπαναβςβή (Aristizabal 2007). Ζ ακαπαναβςβή επζαάθεζ ζδιακηζηέξ ιεηααμθζηέξ απαζηήζεζξ ζηα
ράνζα, ακελάνηδηα απυ ημ πνυηοπμ ακάπηολδξ ηςκ ςμεδηχκ ηαζ ηδκ ηαηακμιή ηςκ πυνςκ (Tyler &
Sumpter 1996)
Σμ θαββνί Pagrus pagrus (Linnaeus, 1758) ακήηεζ ζηδκ μζημβέκεζα ηςκ Sparidae ηαζ
απμηεθεί ζδιακηζηυ είδμξ βζα άιεζδ ιαγζηή εηηνμθή ηαζ είκαζ πνςηυβοκμ ενιαθνυδζημ είδμξ (Froese
& Pauly 2014). Ζ ακαπαναβςβζηή ημο πενίμδμξ λεηζκά απυ ημκ Απνίθζμ έςξ ημκ Ημφκζμ ηαζ δ
ακαπαναβςβζηή ςνζιυηδηα εκημπίγεηαζ ηαηά ημ ηνίημ έημξ (Cotrina et al. 1994; Kokokiris et al 2001).
ηδκ πανμφζα ενβαζία, δίκμκηαζ ζημζπεία ζπεηζηά ιε ημ επμπζηυ πνυηοπμ ηδξ εκενβεζαηήξ επέκδοζδξ
ζημ θαββνί, ιε ζημπυ ηδκ δζεοηνίκδζδ ηςκ θοζζμθμβζηχκ ηαζ αζμπδιζηχκ ιδπακζζιχκ ημο είδμοξ ζε
ζπέζδ ιε ηδκ επμπζαηή ιεηααμθή ηδξ εενιμηναζίαξ ημο κενμφ.
3. Απνηειέζκαηα
φιθςκα ιε ηα απμηεθέζιαηα πνμηφπηεζ υηζ μζ πνςηεΐκεξ (%) ζημ ήπαν ηοιαίκμκηαζ ζημ
45,7 ηαζ 42 % ιεηαλφ Νμειανίμο ηαζ Ημοκίμο. ημκ ενοενυ ιο πανμοζίαζακ ιία ιζηνή αφλδζδ ιέπνζ
ημκ Ηακμοάνζμ (64%) ηαζ ζηδ ζοκέπεζα ιεζχεδηακ. ημκ θεοηυ ιο παναηδνήεδηε ιζα ζηαηζζηζηά
57
HydroMedit 2014, November 13-15, Volos, Greece
ζδιακηζηή αφλδζδ ηςκ πνςηεσκχκ ημκ Απνίθζμ ιε πμζμζηυ 92,3% ηαζ ζηδκ ζοκέπεζα ιεζχεδηακ ζηα
ανπζηά επίπεδα ημο Νμειανίμο. Σμ ίδζμ πνυηοπμ αθθαβήξ ιε αοηυ ημο θεοημφ ιο παναηδνήεδηε ηαζ
ζηδκ ηανδζά (πήια 1).
60 120
Ήπαρ Λεςκόρ μςρ
White Muscle
50 100 *
Πρωτείνες (%)
Protein (%)
40 80
30 60
20 40
10 20
0 0
11-2013 01-2014 04-2014 06-2014 11-2013 01-2014 04-2014 06-2014
80 100
Ερσθρός μσς Heart
Καπδιά
80
60
Πρωτείνες (%)
Protein (%)
60
40
40
20
20
0 0
11-2013 01-2014 04-2014 06-2014 11-2013 01-2014 04-2014 06-2014
Μήνας
Μήλαο δειγματοληψίας
δεηγκαηνιεςίαο Μήλαο δεηγκαηνιεςίαο
Sampling dates
ρήκα 1: Πνζνζηφ πξσηετλψλ ήπαηνο, ιεπθνχ, εξπζξνχ κπ θαη θαξδηάο (*P<0,05 ζε ζχγθξηζε
κε ηελ πξψηε δεηγκαηνιεςία).
Σα επίπεδα ημο βθοημβυκμο ζημ ήπαν έδεζλακ ζδιακηζηή ιείςζδ απυ ημκ Νμέιανζμ (69,2±5,45 ιg/g
ζζημφ) έςξ ηδκ άκμζλδ (34±4,36 ιg/g ζζημφ) ηαζ ζηδκ ζοκέπεζα αολήεδηακ ζδιακηζηά έςξ ημκ Ημφκζμ
(115,6±4,36 ιg/g ζζημφ). Σμ ίδζμ πνυηοπμ αημθμοεείηαζ ηαζ ζημ θεοηυ ιο, εκχ ζημκ ενοενυ ιο, δ
πμζυηδηα βθοημβυκμο αολάκεηαζ ιέπνζ ημκ Ηακμοάνζμ (21,12±3,36 ιg/g ζζημφ), ημκ Απνίθζμ
ιεζχκεηαζ (12±2,36 ιg/g ζζημφ), εκχ ημκ Ημφκζμ παναηδνείηαζ έκημκδ αφλδζδ 50,11±6,09 ιg/g ζζημφ
ιg (πήια 2).
140 60
Ήπαρ
* Λεσκός μσς
120 50
μg Γλσκογόνο
μg Γλσκογόνο
100
40 *
80
30
60
20
40 *
*
20 10
0 0
11-2013 01-2014 04-2014 06-2014 11-2013 01-2014 04-2014 06-2014
Μήνας δειγματοληψίας Μήνας δειγματοληψίας
58
HydroMedit 2014, November 13-15, Volos, Greece
Red muscle
60
Ερσθρός μσς
μg Γλσκογόνο *
40
20
0
11-2013 01-2014 04-2014 06-2014
Μήνας δειγματοληψίας
ρήκα 2: Απνηειέζκαηα γιπθνγφλνπ ζην ήπαξ, ζην ιεπθφ θαη ηνλ εξπζξφ κπ (*P<0,05 ζε
ζχγθξηζε κε ηελ πξψηε δεηγκαηνιεςία).
Σα επίπεδα ηςκ θζπζδίςκ έδεζλακ αφλδζδ ζημ ήπαν ιέπνζ ημκ Απνίθζμ ιε πμζμζηυ 34% (αάνμξ
θζπζδίςκ/gr ζζημφ), εκχ ημκ Ημφκζμ ιεζχεδηακ ζημ 22,3%. Σμ ίδζμ πνυηοπμ αημθμοεείηαζ ηαζ ζημ
θεοηυ ιο ιε πμζμζηυ 27,2% ημκ Απνίθζμ ηαζ 19% ημκ Ημφκζμ. ημκ ενοενυ ιο παναηδνήεδηε αφλδζδ
ηςκ θζπζδίςκ ιέπνζ ημκ Ηακμοάνζμ ιε πμζμζηυ 28,9%, εκχ έπεζηα ιεζχεδηακ ζηαδζαηά ζημ 21,5% ημκ
Red muscle Red muscle
Ημφκζμ (πήια 3).
50 50
Ήπαρ Λεσκός μσς
40 40
Λιπίδια (%)
Λιπίδια (%)
30 30
20 20
10 Red muscle 10
0 0
11-2013 01-2014 04-2014 06-2014 11-2013 01-2014 04-2014 06-2014
50
Μήνας δειγματοληψίας Ερσθρός μσς Μήνας δειγματοληψίας
40
Λιπίδια (%)
30
20
10
0
11-2013 01-2014 04-2014 06-2014
Μήνας δειγματοληψίας
ρήκα 3: Απνηειέζκαηα ιηπηδίσλ ζην ήπαξ, ζην ιεπθφ θαη ηνλ εξπζξφ κπ (*P<0,05 ζε ζχγθξηζε
κε ηελ πξψηε δεηγκαηνιεςία).
Σα επίπεδα ηςκ θζπανχκ μλέςκ δίκμκηαζ ζημκ Πίκαηα 1. διακηζηέξ δζαθμνέξ παναηδνήεδηακ
ηονίςξ ζημκ ενοενυ ιο ιε ηα MUFA κα πανμοζζάγμοκ αφλδζδ απυ ημκ Νμέιανζμ έςξ ηδκ άκμζλδ,
εκχ ηα PUFA ακηίεεηα ιεζχεδηακ.
59
HydroMedit 2014, November 13-15, Volos, Greece
11/13
11/13
11/13
1/14
4/14
6/14
1/14
4/14
6/14
1/14
4/14
6/14
ς3 8.2 9.5 11. 8.8 7.3 7.4 7.4 7.7 9.7 9.4 8.9 8.2
8 7 2 6 4 1 8 6 8 2 5 3
ς6 15. 16. 14. 13. 17. 17. 17. 16. 21. 19. 16. 16.
3 9 7 8 8 7 5 8 7 9 9 6
SFA 28. 29. 29. 30. 25. 27. 29. 26. 23. 23. 25. 26.
1 2 2 0 7 4 2 9 8 3 0 3
MUFA 38. 38. 38. 35. 43. 42. 42. 41. 38. 42. 45. 45.
3 2 0 8 4 1 6 4 3 1 1 0
PUFA 23. 26. 25. 22. 25. 25. 25 24. 31. 29. 25. 24.
6 5 9 7 1 1 6 5 3 9 8
διείςζδ: SFA: ημνεζιέκα θζπανά μλέα, MUFA: ιμκμαηυνεζηα θζπανά μλέα, PUFA: πμθοαηυνεζηα
θζπανά μλέα.
4. πδήηεζε
Απυ ηζξ ηφνζεξ πδβέξ εκένβεζαξ, ηονίςξ ημ βθοημβυκμ ηαζ ηα θζπίδζα πανμοζίαζακ επμπζηυ πνυηοπμ.
Ζ ιείςζδ ημο βθοημβυκμο ζημοξ ιήκεξ ημο πεζιχκα ηαζ ηδξ άκμζλδξ δείπκεζ ιζα ελάνηδζδ ηςκ ζζηχκ
ζε εκένβεζα απυ ηδκ μλείδςζδ ηςκ οδαηακενάηςκ. Έπεζ ακαθενεεί υηζ δ πανμοζία ημο βθοημβυκμο
εεςνείηαζ ζδζαίηενα ζδιακηζηή, ηαζ ανίζηεηαζ ηονίςξ ζοζζςνεοιέκμ ζημ ήπαν ηςκ ζπεφςκ, ημ μπμίμ
εκςιέκμ ιε βθμαμοθίκεξ απμηεθεί απμηαιζεοιέκδ ηαφζζιδ έκςζδ. Σμ πμζμζηυ ημο ζημοξ ιοξ είκαζ
ηαηά πμθφ ιζηνυηενμ εηείκμο ημο ήπαημξ. Πνέπεζ κα ζδιεζςεεί υηζ ζημοξ πενζζζυηενμοξ απυ ημοξ
ιεθεηδεέκηεξ ζπεφεξ δ ζοζζςνεοεείζα πμζυηδηα ημο δπαηζημφ βθοημβυκμο απμηεθεί ηδκ ηεθεοηαία
δζαεέζζιδ πδβή εκένβεζαξ ηαζ δ απμοζία ημο ζοκήεςξ πνμδζαβνάθεζ ιδ ακηζζηνεπηέξ ζοκέπεζεξ αοημφ
(Kieffer et al. 1998, Παπμοηζυβθμο 2008).
Σα θζπίδζα απμηεθμφκ ιζα ζδζαίηενα εηενμβεκή μιάδα ιαηνμιμνίςκ ηαζ θεζημονβμφκ ςξ ζδιακηζηή
πδβή ιεηααμθζηήξ εκένβεζαξ (Thorgaard & Disney 1990). Οζ ιεηνήζεζξ ηαηά ημ ιήκα Ηακμοάνζμ ηαζ
ανπέξ Απνζθίμο, πνζκ ηδκ έκανλδ ηδξ ακαπαναβςβζηήξ πενζυδμο ζδιεζχκμοκ ιέβζζηδ ηζιή, ηυζμ ζημ
θεοηυ υζμ ηαζ ζημκ ενοενυ ιο, εκχ ηαηά ημ ηέθμξ ηδξ ακαπαναβςβήξ ημ πμζμζηυ ειθακίγεζ πηςηζηή
ηάζδ. Σα απμηεθέζιαηα αοηά ζοιθςκμφκ ιε ακάθμβεξ ιεθέηεξ πμο έπμοκ δζελαπεεί ηαζ οπμδδθχκμοκ
ιζα δοκαιζηή ακαηαηακμιή ηδξ απμεδηεοιέκδξ ιεηααμθζηήξ εκένβεζαξ ηαηά ηδ δζάνηεζα ημο
αζμθμβζημφ ηφηθμο ηςκ ζπεφςκ. Γεκζηά, ημ ήπαν θεζημονβεί ςξ αναπφπνμκδ απμεήηδ θζπζδίςκ ηαζ
ζοκεπχξ εκένβεζαξ, βζα ημ ζχια ηςκ γχςκ. Σα απμεέιαηα αοηά αολάκμκηαζ ηαζ ζοζζςνεφμκηαζ ζημκ
ζζηυ αοηυ, θίβμ δζάζηδια πνζκ ηδκ έκανλδ ηδξ ακαπαναβςβζηήξ πενζυδμο, απυ υπμο εα
ηζκδημπμζδεμφκ ζηδ ζοκέπεζα πνμξ ηζξ βμκάδεξ (Alamansa 2001).
Οζ πνςηεΐκεξ πανυθμ πμο εηπνμζςπμφκ ημ ορδθυηενμ πμζμζηυ ηςκ μνβακζηχκ εκχζεςκ ημο
ζχιαημξ ηςκ ρανζχκ (Παπμοηζυβθμο 2008) ηαζ απακηχκηαζ ζε υθα ηα ηφηηανα ηαζ ζημ αίια ημοξ δεκ
έπμοκ δείλεζ ζδιακηζηέξ δζαθμνέξ ζημ επμπζηυ ημοξ πνυηοπμ.
5. Βηβιηνγξαθία
Νήηαξ (2004). Γζαηνμθή Αβνμηζηχκ Εχςκ – Υδιζηέξ Ακαθφζεζξ, Σιήια Δηδυζεςκ ΣΔΗ
Θεζζαθμκίηδξ.
Παπμοηζυβθμο .Δ. (2008) Γζαηνμθή ζπεφςκ. ηαιμφθδ Α.Δ. Αεήκα ζεθ. 489.
Almansa E. (2001). Lipid and fatty acid composition of female gilthead seabream during their
reproductive cycle: effects of a diet lacking n-3 HUFA. J. Fish Biol. 59: 267–286.
60
HydroMedit 2014, November 13-15, Volos, Greece
AOAC (1995). Official methods of analysis of the Association of Official Analytical Chemists
International. Association of Official Analytical Chemists, Arlington, VA, USA, 16 th ed.
Aristizabal E.O. (2007). Energy investment in the annual reproduction cycle of female red porgy,
Pagrus pagrus (L.). Marine Biology 3: 713-724.
Bligh E.G. & Dyer W.J. (1959) A rapid method of total lipid extraction and purification. Canadian
Journal of Biochemistry and Physiology, 37: 911-917.
Cotrina CP & Christiansen HE (1994). El comportamiento reproductive del besugo (Pagrus pagrus)
en el ecosistema costero bonaerense. Rev. invest Dearr Pesq 9:25-58
Froese R. & Pauly D. Editors. (2014). FishBase. World Wide Web electronic publication.
www.fishbase.org, version (06/2014).
Hanson S.W.F. and Olley J. (1963). Application of the Bligh and Dyer method of lipid extraction to
tissue homogenates. Biochemical Journal 89: 101-102.
Karayannakidis P.D., Zotos A., Petridis D., Taylor K.D.A. (2008). Physicochemical changes of
sardines (Sardina pilchardus) at -18μC and functional properties of kamaboko gels enhanced with
Ca2+ ions and MTGase. Journal of Food Process Engineering 31: 372-397.
Kieffer J., Alsop D., Wood C. (1998). A respirometric analysis of fuel use during aerobic swimming
at different temperatures in rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 201 (Pt 22): 3123–33.
Kokokiris L., Le Menn F., Kentouri M., Kagara M., Fostier A. (2001). Seasonal cycle of gonadal
development and serum levels of vitellogenin of the red porgy, Pagrus pagrus (Teleostei: Sparidae)
Marine Biology 139: 549-559.
Seifter S., Dayton D., Novic B., Muntwyler E. (1950). The estimation of glycogen with the anthrone
reagent. Archives of Biochemistry and Biophysics 50: 191-200.
Smith L.S. & Bell G.R. (1964). Athechnique for prolonged blood sampling in free swimming salmon.
Journal of the fisheries research board of Canada 21(4): 711.
Thorgaard G.H. & Disney J.E. (1990). Methods fish Biol. (Schreck, C. B. & Moyle C.B) 171–190
(American Fisheries Society) pp.
Tyler CR & Sumpter JP (1996). Oocyte growth and development in teleosts. Rev Fish Biology
Fisheries 6: 287–318.
61
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
In July 2013, a study comparing two injectable bivalent (anti-Vibrio-Photobacterium) commercial
vaccines in field conditions in sea bass was launched, in collaboration with a farm in NE Kefalonia.
This study aims to assess the efficacy in the field and after experimental infections of two injectable
bivalent (anti-Vibrio-Photobacterium) vaccines commercially available in Greece, against the diseases
caused by the pathogens Vibrio anguillarum O1 and Photobacterium damsela subsp. piscicida, in sea
bass. From the results of the experimental infections that show % cumulative mortality and standard
deviation, and the RPS value, seems that the oil-adjuvanted vaccine AlphaJect 2000 confers greater
protection compared to the fish vaccinated with the aqueous vaccine AquaVac and to non-vaccinated
fish (controls).
Key words: Dicentrarchus labrax, Vibrio anguillarum O1, Photobacterium damsela subsp. piscicida.
Πεξίιεςε
Σμκ Ημφθζμ 2013 λεηίκδζε ιεθέηδ ζφβηνζζδξ δφμ εκέζζιςκ δζδφκαιςκ (anti-Vibrio-Photobacterium)
ειπμνζηχκ ειαμθίςκ ζε ζοκεήηεξ εηηνμθήξ θααναηζμφ, ζε ζοκενβαζία ιε ιμκάδα ζπεομηαθθζένβεζαξ
ζηδκ ΒΑ Κεθαθμκζά. Ζ πανμφζα ιεθέηδ έπεζ ζηυπμ κα αλζμθμβήζεζ ηδκ απμηεθεζιαηζηυηδηα, ζημ
πεδίμ ηαζ ζημ ενβαζηήνζμ ιε πεζναιαηζηέξ ιμθφκζεζξ, δφμ εκέζζιςκ δζδφκαιςκ (anti-Vibrio-
Photobacterium) ειπμνζηά δζαεέζζιςκ ειαμθίςκ ζηδκ Δθθάδα, έκακηζ ηςκ αζεεκεζχκ πμο
πνμηαθμφκηαζ, απυ ημοξ παεμβυκμοξ πανάβμκηεξ Vibrio anguillarum O1 ηαζ Photobacterium damsela
subsp. piscicida, ζημ θαανάηζ. Απυ ηα απμηεθέζιαηα ηςκ πεζναιαηζηχκ ιμθφκζεςκ υπμο δίκμκηαζ δ
% αενμζζηζηή εκδζζιυηδηα ηαζ δ ηοπζηή απυηθζζδ, ηαεχξ ηαζ δ ηζιή RPS, θαίκεηαζ υηζ ημ εθαζχδεξ
ειαυθζμ ΑlphaJect 2000, πανέπεζ ιεβαθφηενδ πνμζηαζία ζηα ράνζα πμο ειαμθζάζεδηακ ιε αοηυ, ζε
ζπέζδ ιε ηα ράνζα πμο ειαμθζάζηδηακ ιε ημ οδαημδζαθοηυ ειαυθζμ Αquavac ηαζ ζε ζπέζδ ιε ηα
ακειαμθίαζηα ράνζα (ιάνηονεξ).
Λέξειρ κλειδιά: Dicentrarchus labrax, Vibrio anguillarum O1, Photobacterium damsela subsp.
piscicida.
*οββναθέαξ επζημζκςκίαξ: πίκμξ Δοεφιζμξ (e.spinos@marine aegean.gr)
1. Δηζαγσγή
Ζ εκηαηζημπμίδζδ ηδξ εηηνμθήξ οδνυαζςκ μνβακζζιχκ έπεζ μδδβήζεζ ζηδκ ειθάκζζδ
ζμβεκχκ ααηηδνζαηχκ ηαζ παναζζηζηχκ αζεεκεζχκ ηςκ ρανζχκ (Athanassopoulou & Bitchava 2010).
Οζ πζμ ζδιακηζηέξ ααηηδνζαηέξ αζεέκεζεξ είκαζ δ δμκαηίςζδ ηαζ δ θςημααηηδνζδίαζδ
62
HydroMedit 2014, November 13-15, Volos, Greece
63
HydroMedit 2014, November 13-15, Volos, Greece
3. Απνηειέζκαηα
ημκ Πίκαηα 1, πανμοζζάγμκηαζ μ ανζειυξ ηςκ ζπεφςκ ηαζ μζ μιάδεξ πμο ζοιιεηείπακ
ζηζξ πεζναιαηζηέξ ιμθφκζεζξ, μ ανζειυξ ηςκ κεηνχκ ρανζχκ, δ % εκδζζιυηδηα ηαζ μζ ηζιέξ RPS ακά
πείναια. ηζξ βναθζηέξ παναζηάζεζξ ζημ πήια 1 δίκεηαζ δ % αενμζζηζηή εκδζζιυηδηα ηαζ δ ηοπζηή
απυηθζζδ ηςκ έλζ πεζναιάηςκ πμο δζελήπεδηακ. ε υθεξ ηζξ πενζπηχζεζξ, ημ ειαυθζμ AlphaJect 2000
θαίκεηαζ υηζ πανέπεζ ιεβαθφηενδ πνμζηαζία ακελάνηδηα απυ ημκ παεμβυκμ πανάβμκηα πμο
πνδζζιμπμζείηαζ ηαζ ηδκ ααηηδνζαηή πίεζδ πμο εθανιυγεηαζ ζηα ράνζα ζε ζφβηνζζδ ιε ηα ράνζα πμο
ειαμθζάζηδηακ ιε ημ ειαυθζμ AquaVac.
20/12/2013
Control 60 26 40 -
PHOTOBACTERIUM
ηα ράνζα πμο πέεακακ απυ ηδκ πεζναιαηζηή ιυθοκζδ, ηα ζοιπηχιαηα πμο
παναηδνήεδηακ ήηακ ενοενυηδηα ημο ζηυιαημξ, έθηδ ζημ ζχια ηαζ ενοενυηδηα ηαζ πνμμδεοηζηή
αθθμίςζδ ημο μοναίμο πηενοβίμο. Δζςηενζηά, ηα ράνζα πμο πέεακακ απυ δμκαηίςζδ είπακ δζυβηςζδ
ηςκ μνβάκςκ ηαζ αζιμνναβίεξ εκχ πανυιμζα δζυβηςζδ ηαζ πενζζηαζζαηά οπυθεοηα μγίδζα
παναηδνήεδηακ ζημκ ζπθήκα ηςκ ρανζχκ πμο πέεακακ απυ θςημααηηδνζδίαζδ (παζηενέθθςζδ). Σα
ιδ ειαμθζαζιέκα ράνζα ήηακ ζε πμθφ πεζνυηενδ ηαηάζηαζδ (αθθμζχζεζξ ζηα πηενφβζα ηαζ ηονίςξ
ζημ μοναίμ) απυ υ,ηζ ηα ειαμθζαζιέκα ζε υθεξ ηζξ πενζπηχζεζξ. Απυ ηδκ ανπή ιέπνζ ημ ηέθμξ ηδξ
ιεθέηδξ δεκ παναηδνήεδηακ ζοιπηχιαηα δμκαηίςζδξ ή θςημααηηδνζδίαζδξ (παζηενέθθςζδξ) ζηα
ράνζα ηδξ οπυ ιεθέηδ ιμκάδαξ ζπεομηαθθζένβεζαξ ζημ θοζζηυ πενζαάθθμκ.
64
HydroMedit 2014, November 13-15, Volos, Greece
ρήκα 1. Αζξνηζηηθή % ζλεζηκφηεηα θαη ηππηθή απφθιηζε γηα θάζε πεηξακαηηθή κφιπλζε.
4. πδήηεζε
ηδ εαθαζζμηαθθζένβεζα ζηδκ Δθθάδα, πνμηεζιέκμο κα ιεζςεεί δ εκδζζιυηδηα ζε
εηηνεθυιεκα ράνζα πμο πνμηαθείηαζ ηονίςξ απυ ηα παεμβυκα ααηηήνζα V. anguillarum ηαζ Ρ.
damsela subsp . piscicida, εα πνέπεζ κα εθανιυγεηαζ ειαμθζαζιυξ ιε ειαάπηζζδ ηςκ ιζηνχκ ρανζχκ
ηαζ εκδμπενζημκασηά (ip) ζε ιεβαθφηενα ράνζα. Ακ ηαζ οπάνπμοκ πνμδβμφιεκεξ ιεθέηεξ ζπεηζηά ιε
ηδκ απμηεθεζιαηζηυηδηα ηδξ πνμζηαζίαξ πμο επζηοβπάκεηαζ ιεηά απυ ειαμθζαζιυ ιε ιμκμζεεκή
ειαυθζα έκακηζ ημο V. anguillarum (Viale etal. 2006 & Galeotti etal. 2013) ή έκακηζ ημο Ρ. damsela
subsp. piscicida (Magarinos etal. 1994a & 1994b), οπάνπμοκ θίβεξ πθδνμθμνίεξ ζπεηζηά ιε ηδκ
απμηεθεζιαηζηυηδηα ηδξ πνμζηαζίαξ, υηακ ηα ράνζα ειαμθζάγμκηαζ ιε δζδφκαια ειαυθζα ηαηά ηςκ
δφμ παεμβυκςκ. Ζ πνμζηαζία ιεηά ημκ ειαμθζαζιυ ηαηά ημο V. anguillarum θένεηαζ κα είκαζ
απμηεθεζιαηζηή (Αεακαζμπμφθμο & Bitchava 2010 & Galeotti etal. 2013). ε ακηίεεζδ, δ πνμζηαζία
ιεηά ημκ ειαμθζαζιυ έκακηζ ημο Ρ. damsela subsp. piscicida είκαζ αιθίαμθδ (Nakai etal. 1992 & Le
Breton 1999).
Πανμιμίςξ, δ πανμφζα ιεθέηδ έδεζλε υηζ δ πνμζηαζία πμο επζηοβπάκεηαζ απυ αοηά ηα
δζδφκαια ειαυθζα έκακηζ ιμθφκζεςκ απυ ημ V. anguillarum O1 ήηακ ορδθή ηαζ ιαηνάξ δζάνηεζαξ
(αηυιδ ηαζ 30 εαδμιάδεξ ιεηά ημκ ειαμθζαζιυ – 7,5 ιήκεξ) ιε ημ ειαυθζμ AlphaJect 2000 (πμο
πενζέπεζ εθαζχδεξ ακμζμεκζζποηζηυ) κα είκαζ πάκημηε ηαθφηενμ ζε ζφβηνζζδ ιε ημ ειαυθζμ AquaVac
(οδαηζηυ, πςνίξ ακμζμεκζζποηζηυ). Σα πμζμζηά ζπεηζηήξ επζαίςζδξ πμο οπμθμβίζηδηακ βζα ημ
ειαυθζμ AlphaJect 2000 ήηακ πάκημηε ορδθά εηηυξ ηςκ πενζπηχζεςκ υπμο εθανιυζηδηε οπεναμθζηή
ααηηδνζαηή πίεζδ (εκδζζιυηδηα 100% ζημοξ ιάνηονεξ). ε υηζ αθμνά ηζξ ιμθφκζεζξ ιε ημ P. damsela
subsp. piscicida, ηαζ πάθζ ημ ειαυθζμ AlphaJect 2000 οπήνλε πάκημηε ηαθφηενμ ζε ζφβηνζζδ ιε ημ
ειαυθζμ AquaVac. Γεηαεκκζά (19) εαδμιάδεξ ιεηά ημκ ειαμθζαζιυ (πενίπμο 5 ιήκεξ) ηαζ ιε ιεζαίαξ
έκηαζδξ ααηηδνζαηή πίεζδ (40% εκδζζιυηδηα ζημοξ ιάνηονεξ), οπμθμβίζηδηακ πμζμζηά ζπεηζηήξ
επζαίςζδξ 62,5 ηαζ 37,5 βζα ημ ειαυθζμ AlphaJect 2000 ηαζ AquaVac, ακηίζημζπα. Πανυθα αοηά,
65
HydroMedit 2014, November 13-15, Volos, Greece
παναηδνήεδηε ιία ηάζδ ιείςζδξ ημο απμηεθέζιαημξ ημο ειαμθζαζιμφ ηαζ βζα ηα δφμ ειαυθζα ιε ηδ
πάνμδμ ημο πνυκμο. Γοζηοπχξ, οπάνπεζ ιυκμ έκα επζζηδιμκζηυ άνενμ πμο δζενεφκδζε ημ ίδζμ
δζδφκαιμ ειαυθζμ Vibrio-Pasteurella, ιε ακμζμεκζζποηζηυ ή πςνίξ (Gravingen etal. 1998). Ακ ηαζ δεκ
ιπμνεί κα βίκεζ απεοεείαξ ζφβηνζζδ ιεηαλφ ηςκ δφμ ιεθεηχκ ελαζηίαξ ημο πνςημηυθθμο ηςκ
ειαμθίςκ πμο πνδζζιμπμζήεδηακ, ημ ιαηνμπνυκζμ απμηέθεζια πάκς ζηδ πνμζηαζία ηςκ ρανζχκ
έκακηζ ηδξ δμκαηίςζδξ είκαζ πανυιμζμ ηαζ ζηζξ δφμ ιεθέηεξ ιε ημ ειαυθζμ πμο πενζέπεζ
ακμζμεκζζποηζηυ κα δνα ηαθφηενα.
οιπεναζιαηζηά, θαίκεηαζ υηζ ημ δζδφκαιμ (anti-Vibrio – Pasteurella) ιε εθαζχδεξ
ακμζμεκζζποηζηυ ειαυθζμ AlphaJect 2000 πανέπεζ ιεβαθφηενδ πνμζηαζία ζηα ράνζα πμο
ειαμθζάζηδηακ ιε αοηυ, ζε ζπέζδ ιε ηα ράνζα πμο ειαμθζάζηδηακ ιε ημ δζδφκαιμ (anti-Vibrio –
Pasteurella) οδαημδζαθοηυ ειαυθζμ AquaVac, ακελανηήηςξ ημο παεμβυκμο πμο πνδζζιμπμζείηαζ βζα
ηδκ πεζναιαηζηή ιυθοκζδ ηαζ ηδ ααηηδνζαηή πίεζδ.
Δπραξηζηίεο
Θα εέθαιε κα εοπανζζηήζμοιε ημ Πακεπζζηήιζμ Αζβαίμο βζα ηδκ ακάεεζδ ηαζ ηδ
πνδιαημδυηδζδ ηδξ ιεθέηδξ, ηζξ εηαζνείεξ Aquavet Α.Δ. ηαζ Pharmaq Α.Δ. βζα ηδ πνδιαημδυηδζδ ηδξ
ιεθέηδξ, ηδ δζάεεζδ ηςκ ειαμθίςκ ηαζ ημοξ ειαμθζαζιμφξ, ηαεχξ ηαζ ηδκ εηαζνεία
Ηπεομηαθθζενβδηζηή Δνφζζμο ΔΠΔ βζα ηδκ εθανιμβή ηςκ πεζναιάηςκ ζηδ ιμκάδα ηδξ ηαζ ηδκ
πνμιήεεζα ηςκ ρανζχκ πμο πνεζάζηδηακ βζα ηα πεζνάιαηα.
Βηβιηνγξαθία
Athanassopoulou, F. & Bitchava, K. (2010). Main pathological conditions in Mediterranean marine
finfish culture. In: ―Recent Advances in Aquaculture Research‖, ed. Koumoundouros G.,
pp. 149-201, Transworld Research Network, Kerala, India.
Bakopoulos, V., Adams, A. & Richards, R.H. (1995). Some biochemical properties and antibiotic
sensitivities of Pasteurella piscicida isolated i n Greece and comparison with strains from
Japan, France and Italy. Journal of Fish Diseases 18, 1-7.
Bakopoulos, V., Volpatti, D., Gusmani, L., Galeotti, M., Adams, A. & Dimitriadis G.J. (2003).
Vaccination trials of sea bass, Dicentrarchus labrax (L.), against Photobacterium damsela
subsp. piscicida, using novel vaccine mixtures. Journal of Fish Diseases 26(2), 77-90.
Galeotti, M., Romano, N., Volpatti, D., Bulfona, C., Brunetti, A.,Tiscar, P. G., Mosca, F., Bertoni, F.,
Marchetti, M.G. & Abelli, L. (2013). Innovative vaccination protocol against vibriosis in
Dicentrarchus labrax (L.) juveniles: Improvement of immune parameters and protection to
challenge. Vaccine 31, 1224-1230.
Gravningen K, Thorarinsson R, Johansen LH, Nissen B, Rikardsen KS, Greger E, & Vigneulle M.
(1998) Bivalent vaccines for sea bass (Dicentrarchus labrax) against vibriosis and
pasteurellosis. Journal of Applied Ichthyology 14, 159–162.
Hjeltneset B., Andersen K. & Ellingsen H.M. (1989). Vaccination against Vibrio salmonicida; the
effect of different routes of administration and of revaccination. Aquaculture 83, 1-6.
Kusuda R. & Hmaguchi M. (1987). A comparative study on efficacy of immersion and a combination
of immersion and oral vaccination methods against pseudotuberculosis in yellowtail.
Nippon Suisan Gakkaishi 53(6), 1005-1008.
Le Breton, A.D. (1999). Mediterranean finfish pathologies: present status and new developments in
prophylactic met hods.Bulletin of the European Association of Fish Pathologists 19, 250–
253.
Magarinos B., Noya M., Romalde J.L., Perez G. & Toranzo A.E. (1994a). Influence of fish size and
vaccine formulation on the protection of gilthead seabream against Pasteurella piscicida.
Bulletin of the European Association of Fish Pathologists 14, 120–122.
Magarinos B., Romalde J.L., Santos Y., Casal J.F., Barja J.L. & Toranzo A.E. (1994b). Vaccination
trials on gilthead sea bream (Sparus aurata) against Pasteurella piscicida. Aquaculture 120,
201–208.
Nakai, T., Fujiie, N., Muroga, K., Arimoto, M., Mizuta, Y. & Matsuoka, S. (1992). Pasteurella
piscicida infection in hatchery reared juvenile stripped jack. Gyobyo Kenkyu 27, 103–108.
Sorensen U.B. & Larsen J.L. (1986). Serotyping of Vibrio anguillarum. Applied & Environmental
Microbiology 51(3), 593-597.
Thornton J.C., Garduno R.A. & Kay W.W. (1994). The development of live vaccines for furunculosis
lacking the A-layer and O-antigen of Aeromonas salmonicida. Journal of Fish Diseases
17(3), 195-204.
66
HydroMedit 2014, November 13-15, Volos, Greece
Toranzo, A. E. & Barja, J. L. (1990). A review of the taxonomy and seroepizootiology of Vibrio
anguillarum, with special reference to aquaculture in the northwest of Spain. Disease of
Aquatic Organisms 9, 73.
Viale, I., Cubadda, C., Angelucci, G. & Salati F. (2006) Immunization of European Sea Bass,
Dicentrarchus labrax L. 1758, Fingerlings with a Commercial Vaccine Against Vibriosis.
Journal of Applied Aquaculture, 18(3), 53-67
Woo, P.T.K. & Bruno, D.W. (1999). Fish Diseases and Disorders, Vol. 3, Viral, Bacterial and Fungal
infections, CAB International, Wallingford, Oxon, p.523.
67
HydroMedit 2014, November 13-15, Volos, Greece
Exadactylos A.
ABSTACT
Lymphocystis disease virus is a member of Iridiviridae family and it has been reported in more than
125 fish species. It is a widely spread disease and its main sign is the appearance of small white to
grey nodular lesions. The transmission of this virus has not been completely elucidated, while
horizontal transmission is accepted. In the present study LCDV was detected in fertilized eggs and
larvae from asymptomatic gilthead seabream hatchery broodstock, where disease was previously
reported, by LAMP. Ten samplings were carried out in total; one egg sampling 2 days pre-hatching
and nine larvae samplings 2, 6, 10, 14, 18, 22, 26, 30, 34 days post-hatching. Ten samples were
examined in each sampling disinfecting them by dipping in active iodine 50mg/l for 10 min. LCDV
was detected in eggs and larvae with prevalence of 70% and 80-100%, respectively, indicating its
potential vertical transmission. Disinfection by dipping in active iodine did not alter prevalence
possibly indicating intra-ovum transmission. Finally, feeding intake probably did not affect the virus
transmission since prevalence remained at high levels before and after live food was provided.
Keywords: Lymphocystis Disease Virus, gilthead seabream eggs and larvae, vertical transmission,
Loop-mediated isothermal amplification (LAMP)
*Corresponding author: Golomazou Eleni (egolom@uth.gr)
Α
ΑΝΗΥΝΔΤΖ ΣΟΤ ΗΟΤ ΣΖ ΛΔΜΦΟΚΤΣΖ Δ ΑΤΓΑ ΚΑΗ ΛΑΡΒΔ
ΣΗΠΟΤΡΑ
Αξακπαηδή-Εηάκνπ Γ., Γθνινκάδνπ Δ.*, Γθάθαο Γ., Μαιαλδξάθεο Δ.Δ., Παλαγησηάθε Π.,
Δμαδάθηπινο Α.
Πεξίιεςε
Ο ζυξ ηδξ θειθμηφζηδξ ακήηεζ ζηδκ μζημβέκεζα Iridoviridae ηαζ έπεζ ακζπκεοηεί ζε πενζζζυηενα απυ
125 είδδ ρανζχκ. Ζ αζεέκεζα έπεζ ιεβάθδ βεςβναθζηή ελάπθςζδ ηαζ παναηηδνίγεηαζ απυ ημ
ζπδιαηζζιυ ιζηνχκ μγζδίςκ. Ο ηνυπμξ ιεηάδμζδξ ημο ζμφ δεκ έπεζ αηυια απμζαθζκζζηεί εκχ ιυκμ δ
μνζγυκηζα ιεηάδμζδ ημο ζμφ ιέπνζ ζήιενα έπεζ επζαεααζςεεί. ημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ δ
ακίπκεοζδ ημο ζμφ ηδξ θειθμηφζηδξ ζε αοβά ηαζ θάναεξ ηζζπμφναξ πνμενπυιεκα απυ
αζοιπηςιαηζημφξ βεκκήημνεξ. Γμκζιμπμζδιέκα αοβά ηαζ θάναεξ ηζζπμφναξ απυ ζπεομβεκκδηζηυ
ζηαειυ ιε ζζημνζηυ ζημκ ζυ ηδξ θειθμηφζηδξ ελεηάζηδηακ ιε ζημπυ ηδκ ακίπκεοζδ ημο
ζοβηεηνζιέκμο ζμφ ιε ηδκ ηεπκζηή LAMP. Πναβιαημπμζήεδηακ ζοκμθζηά δέηα δεζβιαημθδρίεξ. Μία
δεζβιαημθδρία αοβχκ 2 διένεξ πνζκ ηδκ εηηυθαρδ ηαζ εκκζά δεζβιαημθδρίεξ θαναχκ 2, 6, 10, 14, 18,
22, 26, 30 ηαζ 34 διένεξ ιεηά ηδκ εηηυθαρδ. ε ηάεε δεζβιαημθδρία θαιαάκμκηακ 10 δείβιαηα, ζηα
μπμία βζκυηακ απμθφιακζδ ιε δζάθοια ζςδίμο 50mg/l βζα 10΄. φιθςκα ιε ηα απμηεθέζιαηα μ ζυξ
ακζπκεφηδηε ηυζμ ζηα αοβά υζμ ηαζ ζηζξ θάναεξ ζε πμζμζηά πνμζαμθήξ 70% ηαζ 80-100%
ακηίζημζπα, εκζζπφμκηαξ ηδκ πζεακυηδηα ηδξ ηάεεηδξ ιεηάδμζδξ ημο ζμφ. Ζ απμθφιακζδ ιε δζάθοια
ζςδίμο δεκ επδνέαζε ηδκ ιεηάδμζδ ημο ζμφ βεβμκυξ πμο οπμδεζηκφεζ υηζ έβζκε πζεακυκ ιέζς ημο
ειανφμο. Σέθμξ, δ γςκηακή ηνμθή πζεακυκ δεκ επδνέαζε ηδ ιεηάδμζδ ημο ζμφ αθμφ ηα πμζμζηά
πνμζαμθήξ πανέιεζκακ ορδθά πνζκ ηαζ ιεηά ηδ πμνήβδζδ ηδξ.
68
HydroMedit 2014, November 13-15, Volos, Greece
Λέμεηο θιεηδηά: ιεκθνθύζηε, απγά θαη ιάξβεο ηζηπνύξαο, θάζεηε κεηάδνζε, Loop-mediated isothermal
amplification (LAMP)
*οββναθέαξ επζημζκςκίαξ: Γημθμιάγμο Δθέκδ (egolom@uth.gr)
1.Δηζαγσγή
Ο ζυξ ηδξ θειθμηφζηδξ ακήηεζ ζηδκ μζημβέκεζα Iridoviridae ηαζ παναηηδνίγεηαζ απυ ημ
ζπδιαηζζιυ ιζηνχκ μγζδίςκ (Alonso et al. 2005) ζηδκ ελςηενζηή επζθάκεζα ημο ζχιαημξ ηαζ
ζπακζυηενα ζηα εζςηενζηά υνβακα (Cano et al. 2009). Έπεζ ακζπκεοηεί ζε πενζζζυηενα απυ 125 είδδ
ρανζχκ (Noga 2010). Πμθθέξ θμνέξ, ηα ράνζα πμο έπμοκ πνμζαθδεεί απυ ημκ ζυ, ιπμνμφκ κα
ακαννχζμοκ, ιε ιζηνή ζοκμθζηά εκδζζιυηδηα πνμηαθχκηαξ υιςξ ζδιακηζηή ηαεοζηένδζδ ζηδκ
ακάπηολδ. Χζηυζμ δ φπανλδ ημο παεμβυκμο πανάβμκηα ζε ζοκδοαζιυ ιε ηδκ ηαηαπυκδζδ πμο
οθίζηακηαζ ηα ράνζα ελαζηίαξ ηςκ εκηαηζηχκ ζοκεδηχκ εηηνμθήξ ιπμνεί κα αολήζμοκ ημ πμζμζηυ
εκδζζιυηδηαξ (Roberts 2012). Ζ μνζγυκηζα ιεηάδμζδ ημο ζμφ έπεζ ιέπνζ ζήιενα επζαεααζςεεί (Bowser
et al. 1999, Wolf 1988), εκχ ηάεεηδ ιεηάδμζδ ιέζς ηδξ επζθάκεζαξ ημο αοβμφ έπεζ ακαθενεεί ιυκμ
ζε ιία πενίπηςζδ (Cano et al. 2013). Ζ ιμθοζιαηζηή ζηακυηδηα ημο ζμφ ζημ κενυ δζανηεί πενίπμο ιία
εαδμιάδα (Noga 2010) ηαζ μ πνυκμξ επχαζδξ ιπμνεί κα δζανηέζεζ ιεβάθμ πνμκζηυ δζάζηδια
ακάθμβα ιε ηδ εενιμηναζία ημο κενμφ (Roberts 2012). Ζ δζάβκςζδ βίκεηαζ ιε ανηεηέξ ηεπκζηέξ, υπςξ
δ ηοηηανμηαθθζένβεζα, δ ακάπηολδ πμθφηθςκςκ ακηζζςιάηςκ ηαζ ακμζμαπμηφπςζδ, μ in situ
οανζδζζιυξ ηαζ δ ιέεμδμξ ηδξ πμζμηζηήξ PCR (Wenbin et al. 2010). Δλαζηίαξ ηδξ ειπμνζηήξ αλίαξ
ηςκ ρανζχκ πμο πνμζαάθθμκηαζ απυ ημκ ζυ, οπάνπεζ δ ακαβηαζυηδηα ηδξ έβηαζνδξ ηαζ αλζυπζζηδξ
ακίπκεοζήξ ημο ζμφ πνμηεζιέκμο κα εθανιμζημφκ πνμθδπηζηέξ δζαπεζνζζηζηέξ πναηηζηέξ ιεζχκμκηαξ
ηζξ δοζιεκείξ μζημκμιζηέξ επζπηχζεζξ ζηδκ εκηαηζηή εηηνμθή ηδξ ηζζπμφναξ. ημπυξ ηδξ πανμφζαξ
ενβαζίαξ ήηακ δ ακίπκεοζδ ημο ζμφ ηδξ θειθμηφζηδξ ζε αοβά ηαζ θάναεξ ηζζπμφναξ πνμενπυιεκα απυ
αζοιπηςιαηζημφξ βεκκήημνεξ.
3.Απνηειέζκαηα
ημ βνάθδια 1 πανμοζζάγεηαζ ημ πμζμζηυ πνμζαμθήξ απυ ημκ ζυ ηδξ θειθμηφζηδξ υπςξ
οπμθμβίζηδηε απυ ηα 100 δείβιαηα πμο ελεηάζηδηακ. πςξ πνμηφπηεζ, μ ζυξ ακζπκεφηδηε ηυζμ ζηα
αοβά υζμ ηαζ ζηζξ θάναεξ ζε πμζμζηά πνμζαμθήξ 70% ηαζ 80-100% ακηίζημζπα. ηα πμζμζηά
πνμζαμθήξ πμο οπμθμβίζηδηακ δεκ παναηδνήεδηακ ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ. Δπίζδξ, ζηα
ιμθοζιέκα δείβιαηα ηζζπμφναξ επζαεααζχεδηε δ φπανλδ ημο ζμφ εκχ ζηα δείβιαηα ημο είδμοξ D.
macrophthalmus δεκ ακζπκεφηδηε μ ζυξ.
69
HydroMedit 2014, November 13-15, Volos, Greece
120%
100%
ποςοςτό προςβολήσ
80%
60%
40%
20%
0%
-2 2 6 10 14 18 22 26 30 34
ημζρεσ μετά την εκκόλαψη
Δηθφλα 1. Πνζνζηφ πξνζβνιήο απφ ηνλ ηφ ηεο ιεκθνθχζηεο γηα φιεο ηηο
δεηγκαηνιεςίεο, 2 εκέξεο
πξηλ ηελ εθθφιαςε θαη 2, 6, 10, 14, 18, 22, 26, 30, 34 εκέξεο κεηά ηελ εθθφιαςε.
4.πδήηεζε
Ζ θειθμηφζηδ είκαζ ιία απυ ηζξ πζμ ζοπκά παναηδνμφιεκεξ ζμβεκείξ αζεέκεζεξ πνμηαθχκηαξ
ζδιακηζηέξ εκδζζιυηδηεξ ζηδκ εκηαηζηή εηηνμθή ηδξ ηζζπμφναξ. Ο ηνυπμξ ιεηάδμζδξ ημο ζμφ δεκ
έπεζ αηυια απμζαθζκζζηεί. Ζ ιεηάδμζδ ημο ιέζς ημο δένιαημξ ηςκ αναβπίςκ ηαζ ημο πεπηζημφ
ζςθήκα είκαζ επζαεααζςιέκδ (Wolf 1988, Bowser et al. 1999) πςνίξ υιςξ κα έπεζ δζενεοκδεεί
ζοζηδιαηζηά ημ εκδεπυιεκμ ηδξ ηάεεηδξ ιεηάδμζδξ ημο ζμφ. φιθςκα ιε ημοξ Cano et al. (2013) μ
ζυξ ηδξ θειθμηφζηδξ ιπμνεί κα ιεηαδμεεί απυ ηθζκζηά οβζείξ βεκκήημνεξ μζ μπμίμζ είκαζ
αζοιπηςιαηζημί θμνείξ ηαζ δ ιεηάδμζδ βίκεηαζ ιυκμ ιέζς ηδξ επζθάκεζαξ ημο αοβμφ υπςξ ηαζ ζηζξ
πενζπηχζεζξ άθθςκ ζχκ (Brock & Bullis 2001). Ζ ηάεεηδ ιεηάδμζδ έπεζ επζαεααζςεεί ζε ζμβεκείξ
αζεέκεζεξ ρανζχκ (Bootland et al. 1991, Breuil et al. 2002, Georgiadis et al. 2001, MacAllister et al.
1993, Mulcahy & Pascho 1985, Mushiake et al. 1994, Nylund et al. 2007). ηζξ πενζπηχζεζξ αοηέξ μ
ιμθοζιαηζηυξ πανάβμκηαξ ιπμνεί κα εκημπίγεηαζ ιέζα ή έλς απυ ημοξ βαιέηεξ ή ημ έιανομ. Δπίζδξ,
μ νυθμξ ηςκ εδθοηχκ ηαζ ηςκ ανζεκζηχκ δεκ έπεζ δζεοηνζκζζηεί ηαζ δ ιεηάδμζδ ζε πμθθέξ
πενζπηχζεζξ είκαζ πζεακυ κα βίκεηαζ ηυζμ ιέζς ημο ςανίμο υζμ ηαζ ιέζς ημο ζπενιαημγςανίμο
(Brock & Bullis 2001).
Απυ ηα απμηεθέζιαηα ηδξ πανμφζαξ ένεοκαξ πνμέηορε υηζ μ ζυξ ηδξ θειθμηφζηδξ
ακζπκεφηδηε ηυζμ ζηα αοβά υζμ ηαζ ζηζξ θάναεξ πμο ελεηάζηδηακ. Αοηυ ζε ζοκδοαζιυ ιε ημ βεβμκυξ
υηζ ηα δείβιαηα πνμένπμκηακ απυ αζοιπηςιαηζημφξ βεκκήημνεξ ηαζ ιε ημ υηζ δεκ οπήνπε εκενβή
θμίιςλδ ηάηα ηδκ πενίμδμ δεζβιαημθδρίαξ πζεακμθμβμφκ ηδκ ηάεεηδ ιεηάδμζδ ημο ζμφ. Ζ
απμθφιακζδ ιε δζάθοια ζςδίμο δεκ πενζυνζζε ηδ ιεηάδμζδ ημο ζμφ, βεβμκυξ πμο οπμδεζηκφεζ υηζ
έβζκε πζεακυκ ιέζς ημο ειανφμο, ζε ακηίεεζδ ιε ημοξ Cano et al. (2013), ζφιθςκα ιε ημοξ μπμίμο δ
ιεηάδμζδ ημο ζμφ βίκεηαζ ιέζς ηδξ επζθάκεζαξ ημο αοβμφ. Δπίζδξ ημ ζηάδζμ πμνήβδζδξ ηδξ γςκηακήξ
ηνμθήξ ηνίκεηαζ ζδζαίηενα ζδιακηζηυ αθμφ ιέζς αοηήξ είκαζ πζεακυ κα ιεηαδμεεί μ ζυξ. ηδκ
πανμφζα ένεοκα ηα πμζμζηά πνμζαμθήξ πανέιεζκα ορδθά πνζκ ηαζ ιεηά ηδ πμνήβδζδ γςκηακήξ
ηνμθήξ, βεβμκυξ πμο οπμδεζηκφεζ υηζ δ γςκηακή ηνμθή πζεακυκ δεκ επδνέαζε ηδ ιεηάδμζδ ημο ζμφ.
Ο έθεβπμξ ηδξ αζεέκεζαξ πμο μθείθεηαζ ζημκ ζυ ηδξ θειθμηφζηδξ ααζίγεηαζ ζε πνμθδπηζηέξ
δζαπεζνζζηζηέξ πναηηζηέξ πμο ζπεηίγμκηαζ ιε ηδκ επζθμβή ηαζ ηδκ εηηνμθή ηςκ βεκκδηυνςκ, ηδ
ζοθθμβή ηαζ δζαηήνδζδ ηςκ βαιεηχκ, ηδκ εηηυθαρδ ηςκ αοβχκ ηαζ ηδ δζαπείνζζδ ηςκ θαναχκ
70
HydroMedit 2014, November 13-15, Volos, Greece
(Brock & Bullis 2001). Απαναίηδηδ πνμτπυεεζδ βζα ηδκ εθανιμβή ημοξ είκαζ δ εθανιμβή
δζαβκςζηζηχκ ηεπκζηχκ πμο ελαζθαθίγμοκ έβηαζνδ ηαζ αλζυπζζηδ δζάβκςζδ πνζκ ηδκ έλανζδ ηδξ
αζεέκεζαξ ιεζχκμκηαξ ηζξ δοζιεκείξ μζημκμιζηέξ επζπηχζεζξ ζηδκ εκηαηζηή εηηνμθή ηδξ ηζζπμφναξ.
Βηβιηνγξαθία
Alonso M.C., Cano I., Garcia-Rosado E., Castro D., Lamas J., Barja J.L., Borrego J.J. (2005).
Isolation of lymphocystis disease virus from sole, Solea senegalensis Kaup, and blackspot
sea bream, Pagellus bogaraveo. Journal of Fish Diseases 28, 221–228.
Bootland, L.M., Dobos, R., Stevenson, R.M.W. (1991). The IPNV carrier state and demonstration of
verticaltransmission in experimentally infected brook trout. Diseases of Aquatic Organisms
10, 13–21.
Bowser P.R., Wooster G.A., Getchell R.G. (1999). Transmission of walleye dermal sarcoma and
lymphocystis via the waterborne exposure. Journal of Aquatic Animal Health 11, 158–161.
Breuil G., Pepin J.F.P., Boscher S., Thiery R. (2002). Experimental vertical transmission of nodavirus
from broodfish to eggs and larvae of the sea bass, Dicentrarchus labrax (L.). Journal of Fish
Diseases 25, 697–702.
Brock J.A. & Bullis R. (2001) Disease prevention and control for gametes and embryos of fish and
marine shrimp. Aquaculture 197, 137–159.
Cano I., Ferro P., Alonso M.C., Sarasquete C., Garcia-Rosado E., Borrego J.J.,Castro D. (2009).
Application of in situ detection techniques to determine the systemic condition of
lymphocystis disease virus infection in cultured gilt-head seabream, Sparus aurata L. Journal
of Fish Diseases 32, 143–150.
Cano I., Valverde E.J., Garcia-Rosado E., Alonso M.C., Lopez-Jimena B., Ortiz-Delgado J.B.,
Borrego J.J., Sarasquete C., Castro D. (2013). Transmission of lymphocystis disease virus to
cultured gilthead seabream, Sparus aurata L., larvae Journal of Fish Diseases 2013 36, 569–
576.
Georgiadis M.P., Hedrick R.P., Carpenter T.E. & Gardner I.A. (2001). Factors influencing
transmission, onset and severity of outbreaks due to white sturgeon iridovirus in a
commercial hatchery. Aquaculture 194, 21–35.
Li Q., Yue Z., Liu H., Liang C., Zheng X., Zhao Y., Chen X., Xiao X., Chen C. (2010). Development
and evaluation of a loop-mediated isothermal amplification assay for rapid detection of
lymphocystis disease virus. Journal of Virological Methods 163, 378–384.
MacAllister P.E., Schill W.B., Owens W.J. & Hodge D.L. (1993). Determining the prevalence of
infectious pancreatic necrosis virus in asymptomatic brook trout Salvelinus fontinalis: a study
of clinical samples and processing methods. Diseases of Aquatic Organisms 15, 157–162.
Moretti A., Fernandez-Criado M.P., Cittolin G., Guidastri R. (1999). Manual on Hatchery Production
of Seabass and Gilthead Seabream, Vol. 1. Food and Agriculture Organization of the United
Nations (FAO), Rome.
Mulcahy D., Pascho R.J. (1985). Vertical transmission of infectious haematopoietic necrosis virus in
sockeye salmon, Oncorhynchus nerka (Walbaum): isolation of the virus from dead eggs and
fry. Journal of Fish Diseases 8, 393–396.
Mushiake K., Nishizawa T., Nakai T., Furusawa I. & Muroga K. (1994). Control of VNN in stripped
jack: selection of spawners based on the detection of SJNNV gene by polymerase chain
reaction (PCR). Fish Pathology 29, 177–182.
Noga E.J. (2010). Problem 40. Lymphocystis. In Fish disease: diagnosis and treatment. 2nd edition.
Wiley-Blackwell. Ames, Iowa. pp 171–173.
Nylund A., Plarre H., Karlsen M., Fridell F., Ottem K.F., Bratland A. & Saether P.A. (2007).
Transmission of infectious salmon anaemia virus (ISAV) in farmed populations of Atlantic
salmon (Salmo salar). Archives of Virology 152, 151–179.
Ren W., Renault T., Cai Y., Wang C. (2010). Development of a loop-mediated isothermal
amplification assay for rapid and sensitive detection of ostreid herpesvirus 1 DNA. Journal of
Virological Methods 170, 30–36.
Roberts H.E. (2012). Fish: Lymphocystis. In Clinical Veterinary Advisor: Birds and Exotic Pets
Elsevier Saunders, Missouri. pp 32-33.
Wenbin Z., Yongqin L., Xiuzhen S., Jing X., Xiaoqian T. (2010). Detection of lymphocystis disease
virus in Japanese flounder Paralichthys olivaceus and other marine teleosts from northern
China. Chinese Journal of Oceanology and Limnology 28, 1213-1220.
Wolf K. (1988). Fish Viruses and Fish Viral Diseases. Cornell University Press, Ithaca, NY.
71
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
The aim of this work was to carry out a preliminary investigation of Volatile Organic Compounds
(VOCs) produced during aerobic storage of gutted sea bream and sea bass at 2oC, using SPME-
GC/MS, in order to reveal any potential Chemical Spoilage Indices (CSIs) of Greek aquacultured fish
spoilage/freshness. TVB-N (Total Volatile Base Nitrogen) was also determined. The fish products and
fish juice model systems inoculated with spoilage microbiota isolated from sea bream were also used
for the study. VOCs such as 3-methylbutanal, 2-methyl-1-butanol, 2-ethyl-1-hexanol, ethyl acetate,
ethyl propionate and ethyl isobutyrate were attributed to microbial origin according to the results of
the model system substrates experiment and also exhibited desirable profiles at both products.
Therefore from this study, those VOCs can be considered as potential CSIs of gutted sea bream and
sea bass. This study can be the first step for designing bio-sensors for on-pack freshness assessment
and shelf life determination.
Keywords: volatiles, sea bream, sea bass, spoilage, SPME- GC/MS
* Corresponding author. Ioannis S. Boziaris (boziaris@uth.gr)
Πεξίιεςε
ημπυξ ηδξ ιεθέηδξ ήηακ δ δζενεφκδζδ ηδξ πνήζδξ ηςκ πηδηζηχκ ιεηααμθζηχκ ιζηνμαζαηήξ
πνμέθεοζδξ πμο πανάβμκηαζ ηαηά ηδ δζάνηεζα ηδξ ζοκηήνδζδξ απεκηενςιέκδξ ηζζπμφναξ ηαζ
θααναηζμφ ζοζηεοαζιέκςκ ζε ζοκεήηεξ αένα ζημοξ 2μC, ζακ πδιζημί δείηηεξ αθθμίςζδξ/κςπυηδηαξ.
Οζ πηδηζημί ιεηααμθίηεξ αθμνμφζακ ηθαζζζημφξ δείηηεξ υπςξ ημ Οθζηυ Πηδηζηυ Βαζζηυ Άγςημ
(ΟΠΒΑ), ηαεχξ ηαζ πηδηζηχκ μοζζχκ πμο πνμζδζμνίζηδηακ ιε SPME (Solid Phase MicroExtraction)
ζε ζοκδοαζιυ ιε αένζα πνςιαημβναθία-θαζιαημζημπία ιάγαξ (GC/MS). Ζ ιεθέηδ
πναβιαημπμζήεδηε ζε πναβιαηζηά πνμσυκηα αθθά ηαζ ζε ιμκηέθα οπμζηνχιαηα ηα μπμία
πνμζμιμζάγμοκ ημ αθίεοια εκμθεαθιζζιέκα ιε ημοξ αθθμζςβυκμοξ ιζηνμμνβακζζιμφξ. Απυ ηδκ
ιεθέηδ πνμέηορε υηζ δ μ ηθαζζζηυξ δείηηδξ ΟΠΒΑ είκαζ ακεπανηήξ ηαζ ιπμνεί κα πνδζζιμπμζδεεί
ιυκμ ςξ ηνζηήνζμ απμδμπήξ/απυννζρδξ ηςκ πνμσυκηςκ ηαζ υπζ ςξ δείηηδξ κςπυηδηαξ. Ζ 3-ιεεοθ-
αμοηακάθδ, 2-ιεεοθ-1-αμοηακυθδ, 2-αζεοθ-1-ελακυθδ, μλζηυξ αζεοθεζηέναξ, πνμπζμκζηυξ
αζεοθεζηέναξ ηαζ μ ζζμαμοηονζηυξ αζεοθεζηέναξ απμηεθμφκ πζεακμφξ πδιζημφξ δείηηεξ κςπυηδηαξ
ηαζ βζα ηα δφμ πνμσυκηα. Πνάβιαηζ, μζ ακςηένς ιεηααμθίηεξ απμηεθμφκ απμηθεζζηζηά ιεηααμθζηά
πνμσυκηα ηςκ αθθμζςβυκςκ ιζηνμμνβακζζιχκ υπςξ έδεζλακ ηαζ μζ ιεηνήζεζξ ζηα ιμκηέθα
οπμζηνχιαηα. Ζ ιεθέηδ αοηή ιπμνεί κα έπεζ ζδιακηζηή πναηηζηή εθανιμβή ζηδ αζμιδπακία
ηνμθίιςκ δζυηζ απμηεθεί ηδ αάζδ βζα ηδκ ακάπηολδ αζμαζζεδηήνςκ μζ μπμίμζ εα ακζπκεφμοκ ημοξ
ιζηνμαζαημφξ ιεηααμθίηεξ ζημ εζςηενζηυ ηδξ ζοζηεοαζίαξ ηαζ εα ημοξ ζοζπεηίγμοκ ιε ηδκ πμζυηδηα
ημο πνμσυκημξ ηαζ ημκ εκαπμιείκακηα ειπμνζηυ πνυκμ γςήξ.
Λέξειρ κλειδιά: πηεηηθνί κεηαβνιίηεο, ηζηπνύξα, ιαβξάθη, αιινίσζε, SPME- GC/MS
*πγγξαθέαο επηθνηλσλίαο: Μπμγζάνδξ Ηςάκκδξ . (boziaris@uth.gr)
72
HydroMedit 2014, November 13-15, Volos, Greece
1. Δηζαγσγή
3. Απνηειέζκαηα
Ο ειπμνζηυξ πνυκμξ γςήξ ηςκ δφμ πνμσυκηςκ ήηακ 9 διένεξ. Σα Pseudomonas spp.
απμηέθεζακ ημκ ηονίανπμ αθθμζςβυκμ ιζηνμμνβακζζιυ (ΔΑΜ) ηαζ ζηζξ δφμ πενζπηχζεζξ (Δζηυκα 1).
Οζ ηζιέξ ημο ΟΠΒΑ άνπζζακ ακ αολάκμκηαζ απυ ημ ιέζμ ηαζ πνμξ ημ ηέθμξ ημο ειπμνζημφ πνυκμο
γςήξ ηαζ ήηακ πανυιμζεξ ηαζ βζα ηα δφμ πνμσυκηα (Δζηυκα 2).
10
10 τσιπούρα λαβράκι
8 8
6
log cfu/g
6
log cfu/g
4 4
2 2
0 0
0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14
Χπόνορ ζςνηήπηζηρ (ημέπερ) Χπόνορ ζςνηήπηζηρ (ημέπερ)
Δηθφλα 1. Μεηαβνιέο ησλ πιεζπζκψλ TVC (●), Pseudomonas spp. (○), H2S producing bacteria
(■), Enterobacteriaceae (□), Brochothrix thermosphacta () and LAB (▲) θαηά ηε δηάξθεηα
ζπληήξεζεο απεληεξσκέλεο ηζηπνχξαο θαη ιαβξαθηνχ ζηνπο 2oC. Ζ θάζεηε δηαθεθνκκέλε
γξακκή αληηζηνηρεί ζηελ νξγαλνιεπηηθή απφξξηςε ησλ πξντφλησλ.
73
HydroMedit 2014, November 13-15, Volos, Greece
40 ηζιπούπα
Δηθφλα 2. Μεηαβνιέο ΟΠΒΑ θαηά ηε δηάξθεηα ηεο ζπληήξεζεο απεληεξσκέλεο ηζηπνχξαο θαη
ιαβξαθηνχ ζηνπο 2oC. Ζ θάζεηε δηαθεθνκκέλε γξακκή αληηζηνηρεί ζηελ νξγαλνιεπηηθή
απφξξηςε ησλ πξντφλησλ.
2.0
5
1.0
0.0 0
0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14
ημέπερ
ημέπερ
0.5 1.0
0.0 0.0
0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14
ημέπερ ημέπερ
74
HydroMedit 2014, November 13-15, Volos, Greece
2-αιθςλ-1-εξανόλη, ηζιπούπα
10
8
area x 10-6
6
4
2
0
0 2 4 6 8 10 12 14
ημέπερ
2-αιθςλ-1-εξανόλη, λαβπάκι
40
area x 10-6 30
20
10
0
0 2 4 6 8 10 12 14
ημέπερ
60 10
40
20 5
0 0
0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14
ημέπερ ημέπερ
πποπιονικόρ πποπιονικόρ
5.0 αιθςλεζηέπαρ, ηζιπούπα 0.3 αιθςλεζηέπαρ, λαβπάκι
area x 10-6
area x 10-6
0.2
0.1
0.0 0.0
0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14
ημέπερ ημέπερ
Δηθφλα 3. ρεηηθέο κεηαβνιέο ηεο ζπγθέληξσζεο εζηέξσλ θαηά ηε δηάξθεηα ζπληήξεζεο
απεληεξσκέλεο ηζηπνχξαο θαη ιαβξαθηνχ ζηνπο 2oC.
75
HydroMedit 2014, November 13-15, Volos, Greece
Πίλαθαο 1. Πηεηηθνί κεηαβνιίηεο απφ ηε δξάζε ησλ Pseudomonas spp., Shewanella spp. θαη
νμπγαιαθηηθψλ βαθηεξίσλ ζε ζηείξα κνληέια ππνζηξψκαηα απφ ηρζπνδσκφ θαηά ηε
ζπληήξεζή ηνπο ππφ αεξφβηεο ζπλζήθεο ζε ρακειέο ζεξκνθξαζίεο (ςχμεο).
4. πδήηεζε
Ζ αθθμίςζδ βίκεηαζ ακηζθδπηή ελαζηίαξ ηςκ αθθαβχκ ζηα μνβακμθδπηζηά παναηηδνζζηζηά
ηςκ αθζεοηζηχκ πνμσυκηςκ. Οοζίεξ μζ μπμίεξ πανάβμκηαζ ηονίςξ απυ ιζηνμαζαηή δναζηδνζυηδηα
υπςξ είκαζ ημ ΟΠΒΑ, ηνζιεεοθαιίιδ, μζ αζμβεκείξ αιίκεξ η.ά. έπμοκ πνμηαεεί ςξ δείηηεξ αθθμίςζδξ.
Πανυθα αοηά μζ μοζίεξ αοηέξ έπμοκ απμδεζπεεί ιδ ζηακμπμζδηζηέξ βζα ηδ πνήζδ ημοξ ςξ πδιζημί
δείηηεξ αθθμίςζδξ ζηδκ ηζζπμφνα (Parlapani et al. 2014a). Δπζπθέμκ, ημ ΟΠΒΑ απμδείπεδηε ιδ
ζηακμπμζδηζηυξ δείηηδξ αθθμίςζδξ ζηδκ απεκηενςιέκδ ηζζπμφνα ηαζ ζημ απεκηενςιέκμ θαανάηζ.
Ζ ακαγήηδζδ πζμ αλζυπζζηςκ δεζηηχκ απυ δζάθμνμοξ ενεοκδηέξ αθθά ηαζ απυ ηδκ πανμφζα
ιεθέηδ ακέδεζλε ανηεηέξ μοζίεξ μζ μπμίεξ εα ιπμνμφζακ κα πνδζζιμπμζδεμφκ ςξ πδιζημί δείηηεξ
αθθμίςζδξ ιζηνμαζαηήξ πνμέθεοζδξ ζηα αθζεοηζηά πνμσυκηα. Γζάθμνεξ μοζίεξ έπμοκ ακαθενεεί ςξ
πζεακμί πνήζζιμζ πδιζημί δείηηεξ ηαηά ηδκ αθθμίςζδ ηςκ αθζεοιάηςκ ζηδ αζαθζμβναθία. Χζηυζμ, δ
πανμφζα ιεθέηδ ηαεχξ ηαζ δ ζπεηζηή δδιμζίεοζδ πμο αθμνά θζθέηα ζπεφμξ ηζζπμφναξ (Parlapani et
al. 2014a) είκαζ μζ πνχηεξ ιεθέηεξ πνμζδζμνζζιμφ πηδηζηχκ ιεηααμθζηχκ βζα πνήζδ ςξ πδιζημί
δείηηεξ αθθμίςζδξ/κςπυηδηαξ ζε αθζεοηζηά πνμσυκηα ηδξ εθθδκζηήξ οδαημηαθθζένβεζαξ. Ζ 3-ιεεοθ-
αμοηακάθδ ανέεδηε κα απμηεθεί πζεακυ πδιζηυ δείηηδ κςπυηδηαξ/αθθμίςζδξ ιζηνμαζαηήξ
πνμέθεοζδξ ηαζ ζηα θζθέηα ηζζπμφναξ (Parlapani et al. 2014a). Ζ μοζία αοηή ηαεχξ ηαζ δ 2-ιεεοθ-
αμοηακάθδ ανέεδηακ ςξ πνμσυκηα ιεηααμθζζιμφ ηςκ μλοβαθαηηζηχκ ααηηδνίςκ ζηδκ πανμφζα
ιεθέηδ. Πνάβιαηζ, μζ Joffraud et al. (2001) ακαθένμοκ ηζξ δφμ μοζίεξ ςξ πνμσυκηα ιεηααμθζζιμφ ηςκ
Carnobacterium ηαηά ηδκ αθθμίςζδ αθζεοηζηχκ πνμσυκηςκ. Δπζπθέμκ, δ παναβςβή ηδξ 2-αζεοθ-1-
ελακυθδ έπεζ ζοκδεεεί ηονίςξ ιε ιζηνμαζαηή δναζηδνζυηδηα. Πνάβιαηζ, δ μοζία αοηή ακζπκεφεδηε
ζηα ιμκηέθα ιε ηα μλοβαθαηηζηά ααηηήνζα. Δπζπθέμκ, δ παναβςβή ηςκ αζεοθεζηένςκ ζπεηίγεηαζ ιε
ηδ ιεηααμθζηή δναζηδνζυηδηα ηςκ Pseudomonas spp, υπςξ πνμέηορε απυ ηδκ πανμφζα αθθά ηαζ απυ
άθθεξ ακαθμνέξ (Casaburi et al. 2014). θεξ μζ παναπάκς μοζίεξ αοηέξ ανέεδηε κα πανάβμκηαζ θυβς
ιζηνμαζαηήξ δναζηδνζυηδηαξ ηαζ κα πανμοζζάγμοκ αφλδζδ ηαζ ζηα δφμ πνμσυκηα ηαζ ζηα ιμκηέθα
ηαηά ηδ δζάνηεζα ηδξ ζοκηήνδζδξ.
Ζ ιεθέηδ αοηή εα έπεζ ζδιακηζηή πναηηζηή εθανιμβή ζηδ αζμιδπακία ηνμθίιςκ δζυηζ
απμηεθεί ηδ αάζδ βζα ηδκ ακάπηολδ αζμαζζεδηήνςκ μζ μπμίμζ εα ακζπκεφμοκ ημοξ ιζηνμαζαημφξ
ιεηααμθίηεξ ζημ εζςηενζηυ ηδξ ζοζηεοαζίαξ ηαζ εα ημοξ ζοζπεηίγμοκ ιε ηδκ πμζυηδηα ημο πνμσυκημξ
ηαζ ημκ εκαπμιείκακηα ειπμνζηυ πνυκμ γςήξ.
76
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
Casaburi A., Piombino P., Nychas G.-J., Villani F., Ercolini D. (2014). Bacterial populations and the
volatilome associated to meat spoilage. Food Microbiology, DOI: 10.1016/j.fm.2014.02.002
Dalgaard P. (2003). Spoilage of seafood. In: ‗Encyclopedia of food science and nutrition‘, Caballero
B., Trugo L., Finglas P. (eds). London: Academic Press., pp. 2462-2472.
Gram L., Huss H.H. (1996). Microbiological spoilage of fish and fish products. International Journal
of Food Microbiology 33, 121-137.
Joffraud J.J., Leroi F., Roy C., Berdague J.L. (2001). Characterisation of volatile compounds
produced by bacteria isolated from the spoilage flora of cold-smoked salmon. International Journal
of Food Microbiology 66, 175-181.
Parlapani F.F., Mallouchos A., Haroutounian S.A., Boziaris I.S. (2014a). Microbiological spoilage
and investigation of volatiles profile during storage of sea bream fillets under various conditions.
International Journal of Food Microbiology 189, 153-163.
Parlapani F.F., Kormas Ar.K., Boziaris I.S. (2014b). Microbiological changes, shelf life and
identification of initial and spoilage microbiota of sea bream fillets stored under various conditions
using 16S rRNA gene analysis. Journal of the Science of Food and Agriculture (accepted).
77
HydroMedit 2014, November 13-15, Volos, Greece
Apostolou K.1*, Neofytou C.1, Aifanti S.1, Katsoulas N.2, Kittas C.2, Hatziioannou M.1
1
Department of Ichthyology & Aquatic Environment, School of Agricultural Sciences, University of
Thessaly, Fytoko Street, 38 445, Nea Ionia Magnesia, Greece
2
Agriculture Crop Production and Rural Environment, School of Agricultural Sciences, University of
Thessaly, Fytoko Street, 38 445, Nea Ionia Magnesia, Greece
ABSTRACT
This paper presents the results that arise from the operation of the experimental snail farming station
of the Department of Ichthyology & Aquatic Environment of the University of Thessaly. A net-
covered greenhouse of 300 m2 was established in the yard of the School of Agricultural Sciences
(Volos, Greece). The maintenance of the appropriate humidity is assured via a mist propagation
system with watering, of high and low pressure. The aim of this experiment was twofold: to determine
whether the appropriate climatic conditions for snail rearing can be maintained within the net house in
two different seasons, and to estimate certain technical characteristics, like the electric wire fence as
well as the substrate of the establishment. New born snails Cornu aspersum which came from wild
breeders were used for the experiment. The first experiment took place during the summer and lasted
for a month (9/8/2011 until 6/9/2011). The Temperature inside the net house ranged from 15°C –
25°C and the Relative Humidity was in a very good level (82,95 ± 17.2). During the second
experimental period which took place in October, for a month as well (7/10/11 until 11/11/11), the
Relative Humidity inside the net-covered greenhouse was high, while the average air temperature was
lower inside (12,62 °C) compared to the surrounding environment (14,8°C). The summer was
associated with a high mortality rate for snails (58,2%), mainly due to the snails' escapes owing to
technical problems. However, the mortality rate decreased significantly in the fall (18%) and the
increase in snails' biomass was higher in the fall (28,96%) compared to the summer (16,5%).
Πεξίιεςε
ηδκ ενβαζία πανμοζζάγμκηαζ ηα απμηεθέζιαηα απυ ηδκ θεζημονβία ημο πεζναιαηζημφ ζηαειμφ
εηηνμθήξ ζαθζβηανζχκ ημο Σιήιαημξ Γεςπμκίαξ Ηπεομθμβίαξ ηαζ Τδάηζκμο Πενζαάθθμκημξ ημο
Πακεπζζηδιίμο Θεζζαθίαξ. Πνυηεζηαζ βζα έκα δζπηομηήπζμ, επζθάκεζαξ 300 m2, πμο είκαζ
εβηαηεζηδιέκμ ζημκ πνμαφθζμ πχνμ ηδξ πμθή Γεςπμκζηχκ Δπζζηδιχκ (Βυθμξ, Δθθάδα). Ζ
δζαηήνδζδ ηδξ απαζημφιεκδξ οβναζίαξ επζηοβπάκεηαζ ιε ζφζηδια οδνμκέθςζδξ, ορδθήξ ηαζ
παιδθήξ πίεζδξ ιε ρεηαζιυ κενμφ. ηυπμξ ημο πεζνάιαημξ ήηακ κα δζαπζζηςεεί ακ ζημ δζπηομηήπζμ
είκαζ δοκαηυκ κα δζαηδνδεμφκ ηθζιαηζηέξ ζοκεήηεξ ηαηάθθδθεξ βζα ηδκ πάποκζδ ηςκ ζαθζβηανζχκ
ζε δφμ δζαθμνεηζηέξ επμπέξ ηαεχξ ηαζ κα αλζμθμβδεμφκ μνζζιέκα ηεπκζηά παναηηδνζζηζηά ηδξ
εβηαηάζηαζδξ υπςξ δ διεηηνμθυνα πενίθναλδ ηαζ ημ οπυζηνςια. Γζα ηζξ ακάβηεξ ημο πεζνάιαημξ
πνδζζιμπμζδεήηακ κεμβέκκδηα ζαθζβηάνζα (βυκμξ) ημο είδμοξ Cornu aspersum πμο πνμήθεακ απυ
αβνίμοξ βεκκήημνεξ. Ζ πνχηδ πεζναιαηζηή εηηνμθή πναβιαημπμζήεδηε ημ Καθμηαίνζ ηαζ δζήνηδζε
78
HydroMedit 2014, November 13-15, Volos, Greece
έκα ιήκα (9/8/2011 έςξ 6 /9/2011). Ζ εενιμηναζία ζημ εζςηενζηυ ηδξ εβηαηάζηαζδξ ηοιάκεδηε
ιεηαλφ 15°C - 25°C ηαζ δ ζπεηζηή οβναζία ημο αένα ηοιάκεδηε ζε πμθφ ηαθά επίπεδα (82,95 ±
17.2). Καηά ηδ δεφηενδ πεζναιαηζηή πενίμδζμ, πμο πναβιαημπμζήεδηε ημκ Οηηχανζμ ηαζ δζήνηδζε
επίζδξ έκακ ιήκα (7/10/11 έςξ 11/11/11) δ ζπεηζηή οβναζία ημο αένα εκηυξ ημο δζπηομηδπίμο ήηακ
ορδθή εκχ δ ιέζδ εενιμηναζία ημο αένα ήηακ παιδθυηενδ ζημ εζςηενζηυ (12,62 °C) ζε ζπέζδ ιε
ημκ πενζαάθθμκηα πχνμ (14,8°C). Σμ Καθμηαίνζ ηαηαβνάθδηε ορδθυ πμζμζηυ εκδζζιυηδηαξ ηςκ
ζαθζβηανζχκ (58,2%) ηονίςξ ελαζηίαξ ηδξ δζαθοβήξ ημοξ θυβς ηεπκζηχκ πνμαθδιάηςκ. Σμ
Φεζκυπςνμ ιεζχεδηε ζδιακηζηά δ εκδζζιυηδηα (18%). Ζ αφλδζδ ηδξ αζμιάγαξ ηςκ ζαθζβηανζχκ
ήηακ ιεβαθφηενδ ημ Φεζκυπςνμ (28,96%), ζε ζπέζδ ιε ημ ηαθμηαίνζ (16,5%).
Λέξειρ κλειδιά: αιηγθαξνηξνθία, θιηκαηνινγηθέο ζπλζήθεο, δηρηπνθήπην.
*οββναθέαξ επζημζκςκίαξ: Απμζηυθμο Κςκζηακηίκμξ (apostolou@uth.gr )
1. ΔΗΑΓΧΓΖ
Ζ πανμφζα ιεθέηδ απμηεθεί ηδκ πνχηδ ιεθέηδ επίδναζδξ ημο δνμζζζιμφ ιε ελάηιζζδ ζημ
ιζηνμηθίια ημο δζπηομηδπίμο ηαζ ζηδκ αφλδζδ ηςκ εηηνεθυιεκςκ ζαθζβηανζχκ, ηαεχξ πανυιμζεξ
ένεοκεξ έπμοκ βίκεζ ιυκμ ζε γχα πμο ιεβαθχκμοκ ζε πθήνςξ εθεβπυιεκεξ ζοκεήηεξ ζημ ενβαζηήνζμ
(Lazaridou - Dimitriadou et al. 1998, Dupont-Nivet et al. 2000). ηδκ ενβαζία ηςκ Καηζμφθα ηαζ ζοκ.
(2013), έβζκε έθεβπμξ ηδξ εενιμηναζίαξ ηαζ ζπεηζηήξ οβναζίαξ ημο αένα ηςκ δζπηομηδπίμο ηαζ
δμηζιή ημο ζε πναβιαηζηέξ ζοκεήηεξ ηαηά ηδ δζάνηεζα ημο ηαθμηαζνζμφ. ηυπμξ ημο πεζνάιαημξ
αοημφ ήηακ κα δζαπζζηςεεί ακ ζημ δζπηομηήπζμ είκαζ δοκαηυκ κα δζαηδνδεμφκ ηθζιαηζηέξ ζοκεήηεξ
ηαηάθθδθεξ βζα ηδκ πάποκζδ ηςκ ζαθζβηανζχκ ημο είδμοξ Cornu aspersum ηαζ κα ζοβηνζεμφκ δφμ
πενζυδμζ εηηνμθήξ (Καθμηαίνζ - Φεζκυπςνμ). Πανάθθδθα αλζμθμβήεδηακ μνζζιέκα ηεπκζηά
παναηηδνζζηζηά ηδξ εβηαηάζηαζδξ, υπςξ δ θεζημονβία ηςκ δθεηηνμθυνςκ ηαζ δ απμηεθεζιαηζηυηδηα
ημο ελμπθζζιμφ (οπυζηνςια, ηαηαθφβζα, ηαΐζηνεξ).
79
HydroMedit 2014, November 13-15, Volos, Greece
ζφζηδια θεζημονβμφζε ζε διενήζζα αάζδ (απυ ηζξ 10:00 π. ι. έςξ ηζξ 19:00 ι. ι.) βζα 2 sec/min. Γζα
ηδκ ηαηαβναθή ηςκ ααζμηζηχκ ζοκεδηχκ πνδζζιμπμζήεδηακ: αζζεδηήναξ εενιμηναζίαξ ηαζ οβναζίαξ
ημο αένα (Δ+Δ Ακεξηθήο), οδαημζηεβέξ ηαηαβναθζηυ εενιμηναζίαξ ηαζ ζπεηζηήξ οβναζίαξ (ONSET,
Ακεξηθήο) ιε πενζμπή ιέηνδζδξ απυ 0,5 m/s έςξ 40 m/s, αζζεδηήναξ δθζαηήξ αηηζκμαμθίαξ
(DECAGON, Ακεξηθήο) ηαζ αζζεδηήναξ ηαπφηδηαξ ακέιμο (THIES CLIMA Γεξκαλίαο). Ζ πενζμπή
ιέηνδζδξ ηδξ εενιμηναζίαξ ήηακ απυ -40°C έςξ 70°C ιε αηνίαεζα ιέηνδζδξ 0,2°C. Ζ πενζμπή
ιέηνδζδξ ηδξ ζπεηζηήξ οβναζίαξ ηοιαίκμκηακ απυ 0 – 100% ιε αηνίαεζα ιέηνδζδξ 2,5%. Οζ
ιεηνήζεζξ παίνκμκηακ ηάεε 10 min απυ αζζεδηήνεξ πμο οπήνπακ ιέζα ηαζ έλς απυ ημ δζπηομηήπζμ,
εκχ βζα ηδκ επελενβαζία πνδζζιμπμζήεδηε θμβζζιζηυ, ζοιααηυ ιε ημοξ ιεηεςνμθμβζημφξ ζηαειμφξ
HOBO Warre BHW-PC.
Ζ πνχηδ πενίμδμξ εηηνμθήξ ζαθζβηανζχκ δζήνηδζε έκα ιήκα (9/8/2011 έςξ 6 /9/2011). ημ
εζςηενζηυ ημο δζπηομηδπίμο ηαηαζηεοάζηδηακ ιζηνυηενα δζαιενίζιαηα, δζαζηάζεςκ 2,5 m x 2,5 m,
ζηδκ πενίιεηνμ ηςκ μπμίςκ ημπμεεηήεδηε δθεηηνμθυνμξ πενίθναλδ παιδθήξ ηάζδξ (14V
ηδηνθαηαζθεπή) ηαζ ανίζηεηαζ ζημ πάκς ιένμξ ηδξ ζήηαξ πμο πνδζζιμπμζήεδηε βζα ηδκ ηαηαζηεοή
ηςκ δζαιενζζιάηςκ. Ζ δεφηενδ πενίμδμξ εηηνμθήξ δζήνηδζε επίζδξ έκακ ιήκα (7/10/11 έςξ
11/11/11). Γζα αοηήκ ηδκ πενίμδμ ηαηαζηεοάζηδηακ δφμ κέα δζαιενίζιαηα δζαζηάζεςκ 2,9m × 2,9m,
ιε ζήηα φρμοξ 0,55m, πμο δζέεεηε εκζςιαηςιέκα ακμλείδςηα δθεηηνμθυνα ζφνιαηα (DIATEX
Γαιιίαο). Ο βυκμξ ηαζ ζηζξ δφμ πενζυδμοξ εηηνμθήξ πνμήθεε απυ άβνζμοξ βεκκήημνεξ ημο είδμοξ
Cornu aspersum (ζοκ. Helix aspersa) πμο ζοθθέπεδηακ απυ ηδκ Κνήηδ ηδκ άκμζλδ, εβηθζιαηζζηήηακ
ηαζ ακαπανάπεδηακ ζημ ενβαζηήνζμ ζε εθεβπυιεκεξ ζοκεήηεξ (εενιμηναζία 20°C ηαζ θςημπενίμδμξ
12 h θςξ / 12 h ζημηάδζ). Ζ ηνμθή πμο πνδζζιμπμζήεδηε ήηακ ειπμνζηυ ζζηδνέζζμ (μνκζεμηνμθή
πνχηδξ δθζηίαξ), ακαιειζβιέκδ ιε ακεναηζηυ αζαέζηζμ. Καεδιενζκά βζκυηακ δ ηαηαιέηνδζδ ηαζ
απμιάηνοκζδ ηςκ κεηνχκ ζαθζβηανζχκ, ηάεε δφμ διένεξ βζκυηακ πνμζεήηδ ζζηδνεζίμο ηαζ ιία θμνά
ηδκ εαδμιάδα γοβίγμκηακ δ ζοκμθζηή αζμιάγα ηςκ ζαθζβηανζχκ.
3. ΑΠΟΣΔΛΔΜΑΣΑ – ΤΕΖΣΖΖ
Πίκαηαξ 3. Καηαβεβναιιέκεξ πενζααθθμκηζηέξ ζοκεήηεξ (Μέζμξ υνμξ ηαζ ηοπζηή απυηθζζδ) εκηυξ
ηαζ εηηυξ δζπηομηδπίμο.
80
HydroMedit 2014, November 13-15, Volos, Greece
ηδκ πνχηδ πενίμδμ ημο πεζνάιαημξ (Αφβμοζημξ) παναηδνήεδηε ορδθυ πμζμζηυ εκδζζιυηδηαξ ημο
βυκμο ηςκ ζαθζβηανζχκ, πμο έθηαζε ζημ 58,17%. Απυ ηα γχα πμο ζοκμθζηά εεςνήεδηακ κεηνά, έκα
ιεβάθμ πμζμζηυ (50%) δζέθοβε θυβς ηαημηεπκζχκ ζηδκ ηαηαζηεοή ηςκ δζαπςνζζηζηχκ ηςκ
δζαιενζζιάηςκ, ή θυβς πνμαθήιαημξ ζηδκ ηάζδ ηςκ δθεηηνμθυνςκ ζονιάηςκ. Ο νοειυξ αφλδζδξ
ηςκ ζαθζβηανζχκ (ζοκμθζηή αζμιάγα) ήηακ παιδθυξ (16,5% ζε έκα ιήκα). ηδ δεφηενδ πενίμδμ
εηηνμθήξ (Οηηχανζμξ) δ αφλδζδ ημο βυκμο ηοιάκεδηε ζε ηαθφηενα επίπεδα (28,96%), ηαζ αοηυ
μθείθεηαζ ζηζξ ηαθφηενεξ ζοκεήηεξ πμο επζηναημφζακ ηζξ 10 πνχηεξ διένεξ ημο πεζνάιαημξ ηαζ μζ
απχθεζεξ ηςκ ζαθζβηανζχκ ιεζχεδηακ ηαηά πμθφ ζε ζπέζδ ιε ηδκ πνχηδ πενίμδμ (18%) (Πίκαηαξ 2).
ε αοηυ ζοκέααθε δ αεθηζςιέκδ ηαηαζηεοή ηςκ δζαιενζζιάηςκ ηαζ δ πενίθναλδ πενζιεηνζηά, δ
μπμία εηιδδέκζζε ηδ δζαθοβή ηςκ γχςκ. οβηνίκμκηαξ ηα απμηεθέζιαηα ηδξ πανμφζαξ ενβαζίαξ ιε
παθαζυηενςκ ιεθεηχκ (Γεζπμημπμφθμο 2008, Lazaridou - Dimitriadou et al 1998, Begg & Mcinness
2003), ακαιεκυηακ έκαξ ιεβαθφηενμξ νοειυξ αφλδζδ ηςκ γχςκ. ζμκ αθμνά ηδκ δναζηδνζυηδηα ηςκ
εηηνεθυιεκςκ ζαθζβηανζχκ ηοιάκεδηε ζε ζηακμπμζδηζηά επίπεδα ζηδ δζάνηεζα ημο ηαθμηαζνζμφ, εκχ
ημ θεζκυπςνμ παναηδνήεδηε ζηαδζαηή ιείςζδ ηδξ ηζκδηζηυηδηαξ ηςκ γχςκ πμο ακάβεηαζ ζηδκ
πηχζδ ηδξ εενιμηναζίαξ.
ΒΗBΛΗΟΓΡΑΦΗΑ
Γεζπμημπμφθμο Α. (2008) Καηαβναθή ημο ζηαδίμο ημο βεκκδηζημφ ζοζηήιαημξ ηςκ ζαθζβηανζχκ
Helix aspersa (Cornu aspersum) (F1 βεκζά) πμο πνμένπμκηαζ απυ ιμκάδα εηηνμθήξ. Μεηαπηοπζαηή
Γζαηνζαή, Π.Θ. ζεθ. 76 – 78.
Καηζμφθαξ Ν., Απμζηυθμο Κ., Υαηγδσςάκκμο Μ., Ατθακηή ., Νεμθφημο Υ., Κίηηαξ Κ. (2013)
Μεθέηδ ζοζηήιαημξ δνμζζζιμφ ιε ηεπκίηδ μιίπθδ ζε δζπηομηήπζμ πάποκζδξ ζαθζβηανζχκ. Πναηηζηά
8μο Δεκζημφ οκεδνίμο Γεςνβζηήξ Μδπακζηήξ, ζεθ. 466 – 470.
Οζημκυιμο . (2013) Γζενεφκδζδ Σςκ Πνμμπηζηχκ Σςκ Δθθδκζηχκ αθζβηανζχκ ηδκ Αβμνά Σδξ
Δονςπασηήξ Έκςζδξ, Πηοπζαηή ενβαζία, Π.Θ.
Bailey S.E.R. (1981) Circannual and Circadian Rhythms in the Snail Helix aspersa Miiller and the
Photoperiodic Control of Annual Activity and Reproduction. Journal of Comparative Physiology,
142:89-94.
Begg S., Mcinness P. (2003) Farming Edible Snails - Lessons from Italy. Publication No. 03/137,
Printed by Union Offset Printing, Canberra, Australia: 1-13.
81
HydroMedit 2014, November 13-15, Volos, Greece
Boynd P.J, Osborne N.N., Walker R.J. (1986) Localization of a substance P-like material in the
central and peripheral nervous system of the snail Helix aspersa . Hystochemistry and cell biology,
84:97-103.
Dupont-Nivet M., Coste V., Coinon P., Bonnet J.C.and Blanc J.M. (2000). Rearing density effect on
the production performance of the edible snail Helix aspersa Müller in indoor rearing. INRA, EDP
Sciences,Ann. Zootech., 49: 447–456.
Jess S., Marks R.J. (1998) Effect of temperature and photoperiod on growth and reproduction of Helix
aspersa var. maxima. The Journal of Agricultural Science, 130:367-372.
Iglesias J., Santos M., Castillejo J. (1996). Annual Activity Cycles of the Land Snail Helix aspersa
(Muller) in Natural Populations in North-Western Spain. Journal of Molluscan studies, 62: 495-505.
Lazaridou-Dimitriadou M, Alpoyanni E., Baka M., Brouziotis T., Kifonidis N., Mihaloudi E., Sioula
D. and Vellis G. (1998). Gowth, mortality and fecundity in successive generations of Helix aspersa
Muller cultured indoors and crowding effects on fast-, medium-and slow-gowing snails of the same
clutch. Journal of Molluscan Studies, 64: 67–74.
Milinsk M.C, Padrea R.G., Hayashib C., Oliveiraa C.C., Visentainera J.V., Evela΄ zio de Souzaa N.,
Matsushita M. (2006) Effects of feed protein and lipid contents on fatty acid profile of snail (Helix
aspersa maxima) meat. Journal of Food Composition and Analysis, 19:212–216.
Murphy B. (2001) Breeding and Growing Snails Commercially in Australia. A report for the Rural
Industries Research and Development Corporation. RIRDC Publication No. 00-188.
Pivovarov A.S, Sharma R., Walker R.J. (1995) Inhibitory action of SKPYMR Famide on
acetylcholine receptors of Helix aspersa neurons: role of second messengers. General Pharmacology,
26:495– 505.
82
HydroMedit 2014, November 13-15, Volos, Greece
1
Institute of Marine Biological Resources and Inland Waters, Hellenic Centre for Marine Research,
Athens, Greece
2
Department of Fisheries and Aquaculture Technology, Technological Educational Institute of West
Greece, 30200, Messolonghi, Greece
3
Department of Ichthyology and Aquatic Environment, School of Agricultural Sciences, University of
Thessaly, Fytokou Street, 38445, Nea Ionia Magnesia, Volos, Greece
ABSTRACT
With global food security becoming an ever increasing concern, sustainable aquaculture sets to
become the most rapidly increasing food production system worldwide. However the sustainability of
the aquaculture sector is under heated discussion. The argument is whether aquaculture could
potentially provide a sufficient - in terms of quality and quantity - alternative source of protein in a
sustainable way. The adoption of environmentally friendly production strategies like Integrated Multi-
trophic Aquaculture (IMTA), Recirculating aquaculture systems (RAS) and fish-polyculture methods
and through the combination of extensive and intensive aquaculture the sector exhibits a promising
potential of an environmentally friendly and sustainable direction.
Key words: Sustainability, global, fish, food, environment.
*Corresponding author: Klaoudatos Dimitris (dklaoudatos@hcmr.gr)
Introduction
Sustainability of the aquaculture sector has recently been brought into question for 2 reasons:
(a) the interaction of aquaculture with the coastal environment and (b) the use of fish meal and fish oil
for feeds, using as raw material wild fish. Fish meal is a component of most aquaculture feeds used as
a diet for cultured aquatic species and its use to feed aquatic animals of higher market value has
prompted the question of whether aquaculture is actually reducing pressure on wild stocks or just
transferring one biomass into another. It is generally recognised that the world‘s oceans are being
overfished and for a number of species, aquaculture is perhaps the only way of supplying increasing
demand to take the pressure off the fishing of wild stocks. The last 15 years, global capture fisheries
production show stable trends while aquaculture productions shows still positive trends (Fig. 1).
83
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1. Recent trends of global capture fisheries and aquaculture production (source: FAO
Yearbooks)
With global food security becoming an increasing concern, sustainable aquaculture will
probably remain the most rapidly increasing food production system worldwide (Butterworth, 2009).
At the same time, however,the increasing demand for aquaculture feeds can no longer be based on
capture fisheries landings. It makes no sense economically as depleted fish stocks result in higher
prices. Furthermore carnivorous fish which are grown with a fisheries-based diet may contain high
levels of pollutants which can reach the consumer through the food chain (for example
polychlorinated biphenyl's and organochlorine pesticides; Hites et al., 2004). Currently plant protein
supplements are used to some extent in all aquaculture feeds. Soybean meal is subjected to rigorous
research for its suitability in aquaculture feeds (Krogdahl et al., 2003; Robinson et al., 2000; Sugiura
et al., 2001; Day & Gonzalez, 2003). In addition the culture of seaweed as an on-site feed source for
marine grazers has the potential to decrease feed costs. Many types of seaweed have the potential to
be incorporated into artificial feeds for all aquatic animals including finfish (Pereira et al., 2010) as
partial replacement for fish meal, as well as a significant source of protein, carbohydrates, vitamins
and trace elements.
Fish farming offers a solution to the problem of food scarcity, offering animal protein
employing a method with small environmental footprint. The current trend is to increase the use of
plant protein in aquaculture feed, but this practice needs to be accompanied by extensive research on
nutrition (Purchase & Brown, 2000) in order to achieve food conversion rates similar to the standard
feeds as well as the reduction of feed wastes (Hardy, 2000). Aquaculture has an impact on the
surrounding environment and ecosystem in various ways. Aquaculture generates significant amounts
of waste, composed of uneaten feed, faeces, and both organic and inorganic elements such as nitrogen
molecules (NHX, NOx), and phosphorus (Wallace, 1993; Karakassis et al., 2005; Klaoudatos et al.,
2006). It has been documented that in several cases, pollution from aquaculture may result in oxygen
deficiency, generation of hydrogen sulphides and harmful plankton blooms especially at strata close to
the sea bottom below the aquaculture farms. Waste solids can form sediments, for example below the
cages, which can alter the benthic ecosystem with consequences to the ecology of the aquatic body
(Karakassis et al., 1999; Pusceddu et al., 2007; Russell et al., 2011). In turn, this increase in nutrients
84
HydroMedit 2014, November 13-15, Volos, Greece
entering the water body can result in eutrophication (Mpeza et al., 2013), a condition characterised by
massive growth of algae and aquatic plants, leading to oxygen reduction in the surrounding waters. At
the same time, however, research results have shown that the sea bottom disturbance does not extend
more than 25-50 m from the outer boundaries of the cages. Fish communities cannot thrive in low
oxygen concentration, and algal blooms have a significant impact on the recreational value associated
with reduced water clarity, foul odours and toxicity (Turner et al., 1999; Pillay, 2004). The use of
pesticides, antifoulants, antibiotics and disinfectants has adverse consequences to aquatic life in the
water body. The end result of aquaculture development with little concern for sustainability leads to
poor economic returns. In that sense, fish farming needs to maintain a wealthy relationship with the
aquatic ecosystem and, as an agricultural activity, is a typical example illustrating the relationship
between the well-being of fish and human communities and the environment (Naylor et al., 2003).
The possible accidental escape of farmed animals can have detrimental consequences for the thriving
of the local fish populations. Transmission of pathogens, alteration of the local fish fauna species
composition, competition of the introduced fish for food and spawning grounds as well as possible
genetic pollution of the local stock with genetic material not relevant to the particular local ecosystem,
are among the well-constituted negative impacts of accidentally or even intentionally released farmed
fish (Naylor et al., 2001a; Kelso & Mangel, 2005; Krkosek et al., 2007).
Integrated Multi-trophic Aquaculture (IMTA; Fig. 2)) is a production strategy, which, through
the combined culture of different commercial species, has sufficient potential to achieve total respect
for the environment where waste is converted into usable assets, while consumables are kept to a
minimum, thus contributing to sustain the activity in the best possible manner. It is set to head the so-
called Turquoise Revolution as it involves integrating the ideas of the ―green revolution‖ (the
increased world agricultural production, particularly in food, from 1940 and 1970) with that of the
85
HydroMedit 2014, November 13-15, Volos, Greece
―blue revolution‖ (the growth of aquaculture experienced since the nineties). In some countries with a
highly developed aquaculture, IMTA generates an added value to marine culture since its products
have access to labelling that certifies to consumers that the fish, crustacean, mollusc or alga has been
reared with systems that have a low, zero or even a positive impact on the environment (Guerrero &
Cremades, 2012).
Unlike polyculture which includes species that all share the same biological and chemical
processes which could potentially lead to significant shifts in the ecosystem, the multi-trophic
approach combines cultured organisms that extract either dissolved inorganic nutrients (seaweeds) or
particulate organic matter (shellfish) and, hence, the biological and chemical processes at work are
balancing each other. Moreover, the different types of aquaculture are integrated, i.e. operating in
proximity to each other, but not necessarily right at the same location (Chopin, 2006). The dual
objective of sustainable aquaculture, i.e., to produce food while sustaining natural resources, is
achieved only when production systems with a minimum ecological impact are used. Recirculating
aquaculture systems (RAS) provide the opportunity to reduce water usage and to improve waste
management and nutrient recycling. RAS are closed-loop facilities that retain, treat and reuse the
water within the system making intensive fish production compatible with environmental
sustainability. In addition, RAS systems allow aquaculture activities to be installed and operate in
remote areas not connected to the shoreline, thus eliminating conflicts for the use of space.. However
the potential accumulation of substances in the water as a consequence of reduced water refreshment
rates may pose new challenges requiring a deeper understanding of the interaction between the fish
and the system (Martins et al., 2010). With increasing farm size and potentially higher nutrient
86
HydroMedit 2014, November 13-15, Volos, Greece
release, an understanding of the carrying capacity and ecosystem processes are important. In the last
10 years there has been a shift toward viewing waste nutrients as a resource that can be recycled
through plants in a range of aquaculture situations from land-based freshwater to open-ocean culture.
Although world aquaculture is an obvious potential solution for providing the needed precious protein
for an increasing human population, and despite the availability of scientific knowledge to support a
sustainable expansion of the aquaculture production, the future steps of the aquaculture sector towards
an environmentally friendly and sustainable direction remain to be seen.
References
Butterworth, A. (2009). Integrated Multi-Trophic Aquaculture systems incorporating abalone and
seaweeds. Nuffield Australia Project No. 0914.
Chopin, T. (2006). Integrated Multi-Trophic Aquaculture. What it is, and why you should care….. and
don‘t confuse it with polyculture. Northern Aquaculture Page 4.
Chopin, T., Buschmann A.H., Halling C. (2001). Integrating seaweeds into marine aquaculture
systems: a key toward sustainability. Journal of Phycology, 37 (6): 975–986.
Day, O., González P. ( 2003). Soybean protein concentrate as a protein source for turbot
Scophthalmus maximus L. Aquaculture Nutrition, 6: 221-228.
Diab, S., Cochaba M., Mires D., Avnimelech Y. (1992). Combined intensive–extensive (CIE) pond
system, A: inorganic nitrogen transformations. Aquaculture, 101: 33–39.
Guerrero, S., Cremades J. (2012). Integrated multi-trophic aquaculture a sustainable, pioneering
alternative for marine cultures in Galicia. Regional Government of Galicia Regional Council
of the Rural and Regional Maritime Environment Marine Research Centre. Vilanova de
Arousa (Pontevedra). 58p.
Gunasekera, R.M. Turoczy N.J., De Silva S.S., Gavine F., Gooley G.J. (2002). An evaluation of the
suitability of selected waste products in feeds for three fish species. Journal of Aquatic Food
Product Technology, 11: 57- 78.
Hites, R.A., Foran J.A., Carpenter D.O., Hamilton M.C., Knuth B.A., Schwager S.J. (2004). Global
assessment of organic contaminants in farmed salmon. Science, 303: 226-229.
Karakassis, I., Hatziyanni E., Tsapakis M., Plaiti W. (1999). Benthic recovery following cessation of
fish farming: a series of successes and catastrophes. Marine Ecology Progress Series, 184:
205–218.
Karakassis, I., Pitta P., Krom M.D. (2005). Contribution of fish farming to the nutrient loading of the
Mediterranean. Scientia Marina, 69: 313-321.
Kelso, D., Mangel M. (2005). Fugitive Salmon: Assessing the Risks of Escaped Fish from Net-Pen
Aquaculture. Bioscience, 55(5): 427-437.
Klaoudatos, S.D., Klaoudatos D.S., Smith J., Bogdanos K., Papageorgiou E. 2006. Assessment of site
specific benthic impact of floating cage farming in the eastern Hios Island, Eastern Aegean
Sea, Greece. Journal of Experimental Marine Biology and Ecology, 338: 96-111.
Kotzamanis, Y., Alexis M., Andriopoulou A., Castritsi-Cathariou I., Fotis F. (2001). Utilization of
waste material resulting from trout processing in gilthead bream (Sparus aurata L.) diets.
Aquaculture Research, 32 (1): 288-295.
Krkosek, M., Ford J.S., Morton A., Lele S., Myers R.A., Mark A.L. (2007). Declining Wild Salmon
Populations in Relation to Parasites from Farm Salmon. Science, 318:1772-1775.
Krogdahl, A., Bakke-McKellep A., Baeverfjord G. (2003). Effects of graded levels of standard
soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in
Atlantic salmon (Salmo salar L.). Aquaculture Nutrition, 9: 361-371.
Marttinez-Cordova, L.R., Lopez-Elias J.A., Leyva-Miranda G., Armenta-Ayon L., Martinez-Porchas
M. (2001). Bioremediation and reuse of shrimp aquaculture effluents to farm whiteleg
shrimp, Litopenaeus vannamei: a first approach. Aquaculture Research, 42 (10): 1415-1423.
Martinez-Porchas, M., Martinez-Cordova L.R., Porchas-Cornejo M.A., Lopez-Elias J.A. (2010).
Shrimp polyculture: a potentially profitable, sustainable, but uncommon aquacultural
practice. Reviews in Aquaculture, 2(2): 73–85.
Martins, C.I.M., Edinga E.H., Verdegema M.C.J., Heinsbroeka L.T.N., Schneiderc O., Blanchetond
87
HydroMedit 2014, November 13-15, Volos, Greece
J.P., Roque d‘Orbcasteld E., Verretha J.A.J. (2010). New developments in recirculating
aquaculture systems in Europe: A perspective on environmental sustainability. Aquacultural
Engineering, 43:(3) 83-93.
Mpeza, P., Mavraganis T., Nathanailides C. (2013). Dispersal and Variability of Chemical and
Biological Indices of Aquaculture Pollution in Igoumenitsa Bay (NW Greece). Annual
Review & Research in Biology, 3(4): 873-880.
Naylor, R.L., Williams S.L., Strong D.R. (2001)a. Aquaculture: A Gateway for Exotic Species.
Science, 294(5547): 1655-1656.
Naylor, R.L., Goldburg R.J., Primavera J., Kautsky N., Beveridge M.C.M., Clay J., Folke C.,
Lubchenco J., Mooney H., Troell M. (2001)b. Effects of Aquaculture on World Fish
Supplies. Ecology, 8: 14.
Naylor, R.L., Eagle J., Smith W. (2003). Salmon Aquaculture in the Pacific Northwest: a global
industry with local impacts. Environment, 45: 18-39.
Pereira, R., Abreu M.H., Valente L., Rema P., Sousa-Pinto I. (2010). Production of seaweeds in
integrated multi-trophic aquaculture for application as ingredients in fish feed. 20th Seaweed
Symposium, Ensenada, Mexico, p. 86.
Pillay, T.V.R. (2004). Aquaculture and the environment 2nd ed. Fishing New Books, Oxford. 212pp.
Purchase, C.F., Brown J.A. (2000). Inter-population differences in growth rates and food conversion
efficiencies of young Grand Banks and Gulf of Maine Atlantic cod (Gadus morhua L.).
Canadian Journal of Fisheries and Aquatic Sciences, 57: 2223-2229.
Pusceddu, A., Fraschetti S., Mirto S., Holmer M., Danovaro R. (2007). Effects of intensive
mariculture on sediment biochemistry. Ecological Applications, 17(5): 1366–1378.
Robinson, E.H., Li M.H., Manning B.B. (2000). Evaluation of various concentrations of dietary
protein and animal protein for pond-raised channel catfish (Ictalurus punctatus) fed to
satiation or at a restricted rate. Journal of the World Aquaculture Society, 31: 503-510.
Russell, M., Robinson C.D., Walsham P., Webster L., Moffat C.F. (2011). Persistent organic
pollutants and trace metals in sediments close to Scottish marine fish farms. Aquaculture,
319(1-2): 262-271.
Serrano, M., Barreda M., Blanes M.A. (2008). Investigating the presence of organochlorine pesticides
and polychlorinated biphenyls in wild and farmed gilthead sea bream (Sparus aurata) from
the Western Mediterranean sea. Marine Pollution Bulletin, 56: 963-972.
Staudenmann J., Junge-Berberovic R. (2003). The Otelfingen Aquaculture Project: Recycling of
Nutrients from Waste Water in a Temperate Climate. Journal of Applied Aquaculture,
13(1/2): 67-101.
Stickney, R.R., Mcvey J.P. (2002). Responsible Marine Aquaculture. CABI Publishing, New York.
Stokstad, E. (2007). Panel Urges Environmental Controls on Offshore Aquaculture. Science, 315:
175.
Sugiura, S. H., Gabaudan J., Dong F.M., Hardy R.W. (2001). Dietary microbial phytase
supplementation and the utilization of phosphorus, trace minerals and protein by rainbow
trout (Oncorhynchus mykiss (Walbaum) fed soybean meal-based diets. Aquaculture
Research, 32(7): 583-592.
Turner, R.K., Georgiou S., Gren I., Wulff I.F., Barrett S., Söderqvist T., Bateman I.J., Folke C.,
Langaas S., Zylicz T., Mäler K., Markowska A. (1999). Managing nutrient fluxes and
pollution in the baltic: An interdisciplinary simulation study. Ecological Economics, 30(2):
333-52.
Wallace, J. (1993). Environmental considerations. pp.127-144. In: Heen, K., Monahan, R.L., Utter, F.
(eds), Salmon aquaculture. Fishing News, Oxford, UK.
88
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
Mussel farming as an aquaculture activity based on the natural primary productivity, faces risks
similar to those of the agriculture sector. Consequently, much theoretical risk research has been
applied to aquaculture as in agriculture, livestock, forestry, conservation and its management. Mussel
farming, as a niche and vulnerable primary production sector, seems to be a high risk activity so it
does not appear very promising for bankers. Because of this fact, financial viability of the venture
depends heavily on EU funding schemes for assets in order to share the investment risk. In addition,
farmers use personal deposits and resort to alternative activities to complement their cash flow when
in need. For the time being, no insurance policy exists for this sector. As a consequence, there is no
support to compensate for losses, rendering the business vulnerable to operational risks. A thorough
mussel farming risk assessment was carried out to delineate all aspects needed by private companies,
banks, or the government to formulate a valid plan for operational risk management of the sector
1. Introduction
Modern Mediterranean aquaculture developed considerably during the last 30 years passing
from early pilot stages to maturation at the beginning of the new century. Marine farming in Greece
has been based mainly on Mediterranean mussels (Mytilus galloprovincialis) regarding marine
shellfish, and on seabream (Spaurus aurata) and seabass (Dicentrarchus labrax) regarding marine fish
species (Theodorou 2002; Theodrou et al. 2011).
However successful the industry has been so far on research and development issues, little or no effort
has been attributed yet to the risk assessment and moreover to the risk management of the sector.
Bivalve shellfish farming as an activity based on the natural primary productivity, faces risks similar
to those of the agriculture sector. Consequently, much theoretical risk research has been applied to
aquaculture as in agriculture (Huirne et al. 2000; 2007), livestock (Meuwissen et al. 2001), forestry
(Stordal et al. 2007), conservation and its management (Greiner et al. 2009). Nevertheless, limited
studies have so far focused on risk perceptions strategies of the aquaculturists (Theodorou &
Tzovenis 2004; Bergfjord 2009; 2013, Le Grel & Le Bihan 2009, Le & Cheong 2010, Ahsan & Roth
2010, Ahsan 2011, Le Bihan & Padro 2009, Le Bihan et al. 2010;2013, Zagmutt et al. 2013). For this
purpose a study was conducted to explore the mussel farmers‘ perceptions of risk and risk
management, to examine relationships between farm and farmer characteristics, and highlight the
prevailing risk perceptions and strategies (Theodorou et al., 2010b). The present study to fill up this
―knowledge gap‖ was structured as an exploratory research on risk source priorities and their
management options associated with the mussel farming business. In this context, a conceptual
framework for the marine shellfish aquaculture industry of Greece was developed to be used as a tool
by the sector‘s decision makers (Theodorou et al., 2010a).
89
HydroMedit 2014, November 13-15, Volos, Greece
The profitability of the Mediterranean mussel farming depends on a combination of factors including
natural productivity, technical practices, production costs and product pricing. In an effort to analyse
the financial risks of the mussel farming in Greece, we examined the profitability of the different farm
sizes (1 to 6 ha) under the present situation of the local market and the modern production practices.
Assuming that the farms use the widely accepted long-line technique, it was demonstrated that small
farm sizes less than 3 ha are not viable financially. Moreover, the cost of new establishments or the
modernization of the existing ones was affordable only if larger enterprise structures could be
adopted. Consequently, the past EU and/or public support (up to 45% of the total cost of the fixed
assets) has been critical for the development of the industry. The initial investments were a high risk
opportunity as the variability of the production due to the extensive nature of the business increased
the financial risk and consequently there was a limited interest from the banking sector to support
these type of operations (Theodorou et al. 2014).
90
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1. A generalized overview of the adapted AS/NZS ISO 31000:2009 Risk Management
Standard showing the relations between the added principles (a) for the effective and mandatory risk
management framework development (b) to the existing process (c) of the earlier version of AS/NSZ
2431:2004.
Taking in account that the majority of the Greek mussel farms are rather small (1-3 ha), we concluded
that for financial sustainability the sector needs to be restructured. A suggested ―cluster management‖
of small scale mussel farms might enable the producers to work together, improving production,
develop sufficient economy of scale and knowledge to participate in modern chains, increase ability to
join certification schemes, and improve reliability of production and reduce risks.
The future of the industry in organizing the producers in larger schemes, hinges on the
industrialization of the production methods and the scale-up of production units in order to reduce
average production costs and enhance the marketability of the product.
91
HydroMedit 2014, November 13-15, Volos, Greece
This is in accordance with the guidelines of the proposed ―new national growth model and strategy
developmental model‖ by McKinsey & Company (2012) which suggested that the scaling up of the
Greek enterprises is necessity to solve the competitive disharmony of the country.
The severity and consequences of site closures to shellfish commercial harvesting, a protection
measure for public health against toxicity inflicted by harmful algal blooms, has been evaluated for
the Mediterranean mussel farming in Greece. Estimations were carried out in a semi-quantitative
manner at the farm level. Results showed that financial losses depended on the season and duration of
the harvest ban. Since the product becomes marketable from late spring to early autumn, site-closures
longer than 6 weeks within that period could be catastrophic for a farm. Consequences include yield
losses due to extended stocking of ready to harvest mussels in the farm, and ex-farm price reduction
due to oversupply after the harvest ban (Theodorou et al., 2012). Moreover, mussel seed collection
and placement within the farm is delayed due to lack of space as the bulk of mussels remain un-
harvested putting in danger next season‘s production. Proposed strategies to minimise losses
consisting of differential handling of the marketable mussels and of extraordinary spatial extension of
farm facilities due to harvest bans caused by HABs were discussed (Theodorou et al., 2012; 2015).
At the the time that research carried out, no insurance policy existed for this sector rendering the
business vulnerable to operational risks (Theodorou et al., 2011). Recently (2012) limited
compensation was available through the European Fisheries Fund only in cases of mussel harvesting
losses due to human health protection. The situation seems to be significantly improved as the article
57 of the EU Regulation 508/2014 through the European Maritime & Fisheries Fund takes into
account the insurance compensation of the animal stock losses due to natural disasters, weather
impacts, water quality and diseases.
The present exploratory effort was carried out to delineate the major indicative aspects needed by
private companies, banks, or the government to formulate a valid plan for operational risk
management of the sector. Meanwhile, special programs, providing training in labor and
environmental safety procedures, may improve the risk management of the farms and thus decrease
losses.
References
Ahsan D.A., Roth E. (2010). Farmers‘ perceived risks and risk management strategies in an emerging
mussel aquaculture industry in Denmark. Marine Resource Economics 25, 309-323.
Ahsan D.A. (2011). 'Farmers' motivations, risk perceptions and risk management strategies in a
developing economy: Bangladesh experience'. Journal Risk Research 14 (3), 325- 349.
Bergfjord J.O. (2009). Risk perception and risk management in Norwegian aquaculture. Journal Risk
Research 12 (1), 91 – 104.
Bergfjord O. J. (2013). Farming and risk attitude. Emirates Journal Food & Agriculture. 25 (7), 555-
561.
Crawford C. (2003). Qualitative risk assessment of the effects of shellfish farming on the
environment in Tasmania, Australia. Ocean & Coastal Management 46, 47–58.Greiner R.,
Patterson L., Miller O. (2009). Motivations, risk perceptions and adoption of conservation
practices by farmers. Agricultural Systems 99,86–104.
EU Regulation No 508/2014 (2014). Regulation of the European Parliament and the Council of 15
May 2014 on the European Maritime and Fisheries Fund and repealing Council Regulations
(EC) No 2328/2003, (EC) No 861/2006, (EC) No 1198/2006 and (EC) No 791/2007 and
Regulation (EU) No 1255/2011 of the European Parliament and of the Council. Official
Journal of the European Union. 20.5.2014, L 140/66.
Huirne R.B.M., Meuwissen M.P.M., Hardaker J.B., Anderson J.R. (2000). Risk and risk
management in agriculture: an overview and empirical results. International . Journal. Risk
Assessment & Management 1 (1/2), 125–136.
Huirne R.B.M., Meuwissen M.P.M., Van Asseldonk M.A.P.M. (2007). Importance of whole-farm
risk management in agriculture. In: Handbook of Operations Research in Natural Resources,
Springer Publ. p.7-15.
Le T.C., Cheong F. (2010). Perceptions of risk and risk management in Vietnamese catfish farming:
an empirical study. Aquaculture. Economics & Management 14, 282-314.
Le Grel L., Le Bihan V. (2009). Oyster farming and externalities: The experience of the Bay of
Bourgneuf. Aquaculture. Economics & Management 13:112-123.
92
HydroMedit 2014, November 13-15, Volos, Greece
Le Bihan V., Pardo S. (2010). The limits of Risks Hedging in aquaculture: The case of shellfish
farming in France. Proceedings of the Fifteenth Biennial Conference of the International
Institute of Fisheries Economics & Trade, July 13-16, 2010, Montpellier, France: Economics
of Fish Resources and Aquatic Ecosystems: Balancing Uses, Balancing Costs. Compiled by
Ann L. Shriver. International Institute of Fisheries Economics & Trade, Corvallis, Oregon,
USA, 2010.
Le Bihan V., Pardo S., Guillotreau P. ( 2010). Risk Perceptions and Risk Management Strategies in
French Oyster Farming. Working Document Lemna 210/35, 18pp.
Le Bihan V., Pardo S., Guillotreau P. (2013). Risk perception and risk management strategies of
oyster farmers. Marine Resource Economics. 28 (3), 285-304
.Meuwissen M.P.M., Huirne R.B.M., Hardaker J.B. (2001). Risk and risk management: an empirical
analysis of Dutch livestock farmers. Livestock Production Science 69 (1), 43–53.
McKinsey & Company. 2012. Greece 10 Years Ahead: Defining Greece‘s new growth model and
strategy — Executive summary. Athens. 70pp.
Regulation EU(2014). No 508/2014 of the European Parliament and the Council of 15 May 2014 on
the European Maritime and Fisheries Fund and repealing Council Regulations (EC) No
2328/2003, (EC) No 861/2006, (EC) No 1198/2006 and (EC) No 791/2007 and Regulation
(EU) No 1255/2011 of the European Parliament and of the Council. Official Journal of the
European Union. 20.5.2014, L 140/66
Standards Australia and New Zealand. (2004). Standard AS/NZS 4360:2004. Risk Management.
Third Edition, Standards Australia/Standards New Zealand, Sydney, Australia, Wellington,
New Zealand. www.standards.com.au.
Standards Australia and New Zealand. (2009). Joint Australian New Zealand International Standard
AS/NZS ISO 31000:2009. Risk management—Principles and guidelines. 26 pp.
Størdal S., Lien G., Hardaker J.B. (2007). Perceived risk sources and strategies to cope with risk
among forest owners with and without off-property work in eastern Norway, Scandinavian.
Journal Forest Research 22 (5), 443- 453.
Theodorou J.A. (2002). Current & Future Technological Trends of European Seabass-Seabream
Culture. In: Aquaculture Grow-out Systems. Lee C., (Ed.) 11-15 Feb 2001, Aquaculture
Interchange Program, University of Hawaii, Honolulu, USA, Reviews in Fisheries Science
10(3-4), 529-543.
Σheodorou J., Σzovenis I. (2004). Aquaculture Insurance. In: Encyclopedia of Actuarial Sciences. J.
Teugels J., Sundt B. (Eds). J.Willey & Sons Publications.
Theodorou J.A., Viaene J, Sorgeloos P., Tzovenis I.(2011). Production and Marketing Trends of the
cultured Mediterranean mussel Mytilus galloprovincialis L. 1819, in Greece. Journal of
Shellfish Research 30 (3), 859–874.
Theodorou J.A., Tzovenis I., Sorgeloos P. , Viaene J. (2010a). Conceptual Framework for Risk
Analysis of the Greek Shellfish Aquaculture AquaMedit 2010 – Book of Abstracts of the 5th
International Congress on Aquaculture, Fisheries Technology and Environmental Management
25 - 27 November 2010, Aquaculture & Fisheries Department, T.E.I. of Messolongi, Greece.
Theodorou J.A., Tzovenis I., Sorgeloos P., Viaene J. (2010b). Risk Perceptions and Risk Management
Strategies of the Greek Mussel Farmers. Proceedings of the Fifteenth Biennial Conference of
the International Institute of Fisheries Economics & Trade, July 13-16, 2010, Montpellier,
France: Economics of Fish Resources and Aquatic Ecosystems: Balancing Uses, Balancing
Costs. Compiled by Ann L. Shriver. International Institute of Fisheries Economics & Trade,
Corvallis, Oregon, USA.
Theodorou J.A., Viaene J, Sorgeloos P., Tzovenis I. (2010c). Risk factors affecting the financial
sustainability of the capture based aquaculture systems: the case of the Greek Mussel farming.
AquaMedit 2010 – Book of Abstracts of the 5th International Congress on Aquaculture,
Fisheries Technology and Environmental Management 25 - 27 November 2010, Aquaculture
& Fisheries Department, T.E.I. of Messolongi, Greece.
Theodorou J.A., Tzovenis I., Sorgeloos P. , Viaene J. (2012). Risk Management of Farmed Mussel
Harvest Bans Due to HAB Incidents in Greece. Proceedings of the 14th International
Conference on Harmful Algae. International Society for the Study of Harmful Algae and
Intergovernmental Oceanographic Commission of UNESCO.
Theodorou J.A., Tzovenis I., Sorgeloos P., Viaene J. (2014). Risk factors affecting the profitability of
the Mediterranean mussel Mytilus galloprovincialis Lamarck 1819, farming in Greece.
Journal of Shellfish Research (In Press).
93
HydroMedit 2014, November 13-15, Volos, Greece
Theodorou J.A., Tzovenis I., Sorgeloos P., Viaene J. (2015). Semi-Quantitative Risk Assessment of
the effects of HAB closures on the shellfish farming in Greece. Journal of Shellfish Research
(Submitted).
Theodorou J.A., Le Bihan V., Pardo S., Tzovenis I., Sorgeloos P., Viaene J. (2011). Risk Perceptions
and Risk Management Strategies of the European Bivalve Producers. In: Aquaculture Europe
2011-‗Mediterranean Aquaculture 2020‘, Organized by the European Aquaculture Society,
October 18-21, Rhodes, Greece.
Zagmutt F.J., Sempier S.H., Hanson T.R. (2013). Disease Spread Models to Estimate Highly
Uncertain Emerging Diseases Losses for Animal Agriculture Insurance Policies: An
Application to the U.S. Farm-Raised Catfish Industry. Risk Analysis 33(10), 1924-1937.
94
HydroMedit 2014, November 13-15, Volos, Greece
Nikouli E.1*,Mente E.1, Makridis P.2, Kormas, A.K.1, Koufostathi, E1., Grundvig
H.3, Ribeiro L.4, Pousão-Ferreira P.4, Hugo Quental-Ferreira, H.4, Araújo,
R.4,Gausen M.5, Hovden N.5, Colt J.6, Bergheim A.7
1 Department of Ichthyology & Aquatic Environment, School of Agricultural Sciences, University of
Thessaly, Fytoko Street, 38 445, Nea Ionia Magnesia, Greece
2Department of Biology, School of Natural Sciences, University of Patras, University campus, 26504,
Rio, Greece
3TeknologiskInstitutt as, P.O.Box 141 Økern, NO-0509 Oslo, Norway
4InstitutoPortugues do Mare da Atmosfera (IPMA), Av. 5 de Outubro, s/n 8700-305 Olhao, Portugal
5Oxsea Vision AS, Oslo,Norway
6National Marine Fisheries Service, 2725 Montlake Blvd East, Seattle, WA 98112, USA
7International Research Institute of Stavanger,Stavanger, Norway
ABSTRACT
Low levels of dissolved oxygen can be influenced by numerous factors such as temperature, salinity,
water exchange rate and can create additional problems in fish rearing in aquaculture. The effects of
reduced dissolved oxygen levels on reared fish vary from reduced appetite, reduced feed utilization, to
decreased immune system and to high fish mortalities. Aeration can be utilized both as an emergency
tool as well as on more regular basis especially in critical periods when it is known by experience that
related problems commonly occur. The type of aeration, dimensioning of the devices, avoidance of
total gas super-saturation and economic issues are important factors that have to be taken under
consideration. The AirX project developsand tests a new technology, a new air diffuser based system
for control of dissolved oxygen levels in aquaculture. The aeration concept, patented by OxseaVision
(OSV), is designed for use in large rearing units, including earth ponds, sea cages, tanks and
raceways. The majority of the technical development and lab-scale tests took place in Norway while
verification and field trials were performed in the Mediterranean region, more specifically in Portugal
and Greece.
Keywords: air diffusion system, aquaculture.
*
Corresponding author: Eleni Nikouli (elnikoul@uth.gr)
1. Introduction
Oxygen deficiency can constitute a challenge in aquaculture, especially when water temperatures are
high. This challenge manifests itself in decreased appetites, low-level feed utilisation, slow growth
rates, increased stress among the farmed stock, and higher production costs. The factors resulting in
oxygen deficiency typically coincide during summer and early autumn – at a time when the stocking
densities are normally quite high. This can result in prolonged periods with low oxygen levels, making
it necessary for the farmer to alter husbandry practices in order to reduce the need for oxygen.
For cultured red sea bream (Pagrus major) it has been shown that a minimum of dissolved oxygen
required is 5.7 mg/L and decrease below this level may cause increased mortalities. In cages for cold-
water fish species, such as Atlantic salmon, long-term DO concentrations below 70 – 80% of
saturation (< 7mg/L) will significantly reduce the growth and feed utilization even at low temperature
(Bergheim et al., 2002).Sea bass generally tolerates O2 deficit rather well; acute hypoxia is found to be
1.9 mg/L for 4 hrs while chronic hypoxia is stated 4.3 mg/L lasting for 15 days (Terova et al., 2008).
Both acute and chronic hypoxia caused significantly increased number of HIF-1a mRNA (HIF:
hypoxia-inducible factor) in liver tissue.Thetmeyer et al. (1999) observed less appetite/growth rate but
unaffected feed utilization of sea bass with initial weight of 40-86 g at constant 40% O2 saturation
lasting for 1 month (22°C, 37 ppt) but no effects of oscillating O 2 concentration between 40 and 86%.
As growth was correlated with feed intake, the reduced growth under moderate hypoxic or oscillating
oxygen conditions is primarily due to reduced appetite and not a consequence of a decrease in feed
conversion efficiency. Sea bream is ―more sensitive to low oxygen than sea bass‖ (Ökte, 2002), but no
exact figures describing hypoxia in sea bream are available in the literature.In an experiment with
aeration in four fish cages with red seabream, where micro-bubble generators were placed at 7 m
95
HydroMedit 2014, November 13-15, Volos, Greece
depth for more than five months, no negative effects were reported for the fish (Endo et al., 2008).
Use of micro-bubble aeration has been shown to improve the environment in aquaculture farms not
only in area over the diffuser but 5 m below the aerator as well (Endo et al., 2008; Maeda et al., 2002).
EU‘s AirX project develops and tests a new technology that provides small bubbles and uses air to
control dissolved oxygen levels in earth ponds and sea cages in aquaculture.
There are two main methods utilized for aeration: air can be supplied into a flow of water (―air-in-
water‖), or water can be supplied into a flow of air (―water-in-air‖). The first one is hydraulic type and
the second one air diffusion type (gravity aerators, subsurface aerators and surface aerators).In the
case of ponds, there is a considerable amount of studies which took into account the problem of
oxygenation, the technology present at the time (most studies done before year 2000) and focused on
the use of paddle-wheels which appeared as the most economically feasible solution. As an alternative
approach to avoid problems with oxygenation possibly increasing the self-pollution of the farm low
stocking density has been suggested.
In the case of fish cages, the problem of low oxygen levels has been generally overlooked and very
few studies are available. There is a general trend in the industry to believe that such problem can only
be detected in bad locations for cages. Further research is needed especially in the case of cages,
where the problem of reduced oxygen has been underestimated. Aeration in cages seems as a solid
alternative, better than addition of oxygen, as the transport of oxygen containers is always feasible and
can be economically difficult to justify.There might be a risk of critical super-saturation of gases and
development of gas bubble disease in cages and ponds aerated by submerged diffusers. The risk of
harmful gas conditions is dependent on type of aerator, aeration depth, depth layer of the fish stock,
and several other factors. However, the chance of harmful gas levels is low under normal operation of
aerators in fish ponds and cages. Compared with existing aeration devices the AirX diffuser has the
ability to efficiently distribute gas over a large volume. The completed AirX system will consist of a
diffuse hose grid system that releases gas at an equal pressure, thus results in an homogenous
distribution of gas, a compressor that provides air under pressure to the system and an automatic
system that ensures that the desired amount of air is dosed according to the needs of the system. The
system provides small bubbles that efficiently transfer oxygen into the water in a homogeneous way
and can provide direct diffusion towards areas where extra oxygen addition is most needed (Figures 1
and 2).
96
HydroMedit 2014, November 13-15, Volos, Greece
The purpose of aeration or oxygenation in aquaculture systems is either to remove gases, such as
carbon dioxide (CO2) and nitrogen (N2), or to increase the concentration of dissolved oxygen in the
water.Tests have shown that AirX is able to add oxygen in an efficient and homogenous manner
throughout the water volume. The diffusers system is also designed to direct diffusion towards areas
in the rearing unit where oxygenation is mostly needed.
Dissolved oxygen is the most important parameter of water treatment in aquaculture facilities and the
supply requirements approach the mass rate of elimination addition to feed per day (Colt et al,. 1991).
In open sea fish cage the major source of dissolved oxygen is water flowing through the cage as a
result of external currents and the movements of the cage (Beveridge, 1987). In many cases have been
reported at both marine and fresh water facilities problems by reducing the oxygen availability (Inoue,
1972; Kils, 1979). Low concentrations of dissolved oxygen have also indicated problems in
Mediterranean aquacultures producing sea bass and sea bream (Bergheim et al., 2006).Dallavia et al.
(1998) has concluded that when dissolved oxygen decreased due to increased temperatures and the
metabolic rate increases, the farmer can only respond by increasing oxygenation/water exchange rate
or by decreasing fish stock density.AirX system contributes to possible benefits for both the fish and
the environment.
Acknowledgments
The present study was funded by the EU 7th Framework Programme, (project number FP7-
315412).
References
Colt, J., K. Orwicz, & G. Bouck. 1991. Water quality considerations and criteria for high
density fish culture with supplemental oxygen. American Fisheries Society Symposium 10,
372-385.
Bergheim, A., Gausen, M., Næss, A., Fjermedal, A.B., Hølland, P.M. & Å. Molversmyr.
2002. Effects of oxygen deficit in post-smolt salmon. Trial I. Report RF – Rogaland
Research, 2002/307. 25 pp.
Bergheim, A., Gausen, M., Næss, A., Hølland, Per M., Krogedal, P. & V. Crampton. 2006.
A newly developed oxygen injection system for cage farms. Aquacultural Engineering,
34,40-46.
Beveridge, M.C.M. 1987. Problems. In: Beveridge M. (Ed.), Cage Aquaculture. Fishing
News Books, London, pp.198 – 249.
Dalla Via, G.J., Villani, P., Gasteiger, E. & H. Niederstätter. 1998 Oxygen consumption in
sea bass fingerling Dicentrarchuslabrax exposed to acute salinity and temperature changes:
metabolic basis for maximum stocking density estimations. Aquaculture, 169: 303–313.
Endo, A., Srithongouthai, S., Naskiki, H., Teshiba, I., Iwasaki, T., Hama, D. & H. Tsutsumi.
2008. DO-increasing effects of a microscopic bubble generating system in a fish farm.
Marine Pollution Bulletin 57, 78-85.
97
HydroMedit 2014, November 13-15, Volos, Greece
Inoue, H. 1972. On water exchange in a net cage stocked with the fish, Hamachi. Bulletin of
the Japanese Society for the Science of Fish, 38, 167-176
Maeda, K., Matsuo, K., Yamahara, Y., Onari, H., Watanabe, K., Ishikawa, N. &Shimose, T.
2002.The hydraulic effect of microbubble generator at oyster farm.Proceedings of Annual
Conference of the Japan Society of Civil Engineers, JSCE 2(56), 384-385.
Kils U. 1979. Oxygen regime and artificial aeration of net cages.Meeresforsch. 27, 236-243.
Ökte, E. 2002. Grow-out of Sea bream Sparusaurata in Turkey, particularly in a land-based
farm with recirculation system in Canakkale: better use of water, nutrients and space.
Turkish Journal of Fisheries and Aquatic Sciences, 2, 83-87.
Terova, G., Rimoldi, S., Corá, S., Bernardini, G., Gornati, R. & M. Saroglia. 2008. Acute
and chronic hypoxia affects HIF-1a mRNA levels in sea bass (Dicentrarchuslabrax).
Aquaculture, 279 (1-2), 191-198.
Thetmeyer, H., Waller, U., Black, K.D., Inselmann, S. & H. Rosenthal. 1999. Growth of
European sea bass (Dicentrarchuslabrax) under hypoxic and oscillating oxygen conditions.
Aquaculture, 174 (3-4), 355-367.
98
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT:
Fish farms are able to produce high amount of quality food for human consumption. On the other
hand, heavy metal pollution in aquatic ecosystems can be a serious problem in this study the contents
of As, Cd, Hg and Pb in the edible tissue of culture breed Dicentrarchus labrax (Seabass) and Sparus
aurata (Seabream) that are commercially available in the Turkey‘s fish markets were analyzed using
ICP-MS. None of the heavy metal contents in the fish muscle tissue exceeded the threshold levels
which were suggested by Food and Agriculture Organization and by the Turkish Food Codex and
based on calculated element intake rates, there were no risk for humans to consume these farm fishes.
Key words: Aquaculture, heavy metal seabass, seabream
*
Corresponding author: Halim Aytekin Ergül (halim.ergul@gmail.com)
1. Introduction
Aquaculture currently provides a considerable proportion of edible fish which is expected to
increase in future decades in order to meet the needs of the growing human population (Duarte et al.,
2009). Seafood consumption by humans is important because of its high nutritional quality, valuable
proteins, vitamins and mineral content. However, marine environments can be contaminated with
toxins, particularly in coastal waters that receive industrial and domestic discharges. Through
atmospheric deposition, sewage outfalls, urban storm water, agricultural and industrial runoff, heavy
metals may enter marine and pond fish culture areas and subsequently pose a human health risk.
Thus, in this study the contents of As, Cd, Hg and Pb in edible tissue of culture breed Dicentrarchus
labrax (Seabass) and Sparus aurata (Seabream) that are commercially available in the Turkey‘s fish
markets were analysed. The aims of this study are to determine and compare the contents of some
toxic elements in the edible tissue of culture breed fish over a year.
Table 1: Sampling dates, muscle tissue dry weight ratios and total lengths of cultured fish that
purchased from the primary fish markets in Kocaeli Province
Muscle Dry
Common Sampling Total Lenght
Species Weight
Name Date (cm)
Ratio (%)
Dec-11 32.3 ± 0.3 26.5
Dicentrarchus labrax Seabass
Jan-13 31.0 ± 0.5 26.6
Dec-11 29.2 ± 0.3 28.7
Sparus aurata Seabream
Jan-13 25.9 ± 1.8 28.4
Ten individuals per fish species were filleted using porcelain knives to avoid any metal
contamination. Dissected muscle tissues were homogenized; fifty grams of samples were freeze dried
until constant dry weight and homogenized. 0.5 g dried samples were digested for 30 minutes with
99
HydroMedit 2014, November 13-15, Volos, Greece
mixture of HNO3, HCl and H2O2 in a microwave digestion system. Digested samples and analytical
blanks that were prepared in the same acid matrix were analyzed with ICP-MS which equipped with
auto sampler and diluter. In order to validate the method for accuracy and precision, standard
reference material (SRM-NIST 2977 Mussel Tissue) was analyzed for the corresponding elements.
Table 2. Element contents (dry weight ± standart deviation) in cultured fish species harvested
from Aegean Sea.
D. labrax S. aurata
Elements
Dec - 2011 Jan - 2013 Dec - 2011 Jan - 2013
As (mg kg-1) 2.53 ± 0.08 0.89 ± 0.06 1.67 ± 0.07 1.17 ± 0.18
Cd (mg kg-1) 0.01 ± 0.01 0.01 ± 0.01 0.01 ± 0.01 0.01 ± 0.01
-1
Hg (mg kg ) 0.25 ± 0.01 0.11 ± 0.00 0.18 ± 0.01 0.05 ± 0.01
Pb (mg kg-1) 0.03 ± 0.01 0.01 ± 0.02 BDL 0.03 ± 0.04
BDL: Below detection limit
Although below recommended values it is noteworthy that these fish species include non-
essential elements. The highest As content was determined in D. labrax (i.e., 2.53 mg kg-1) in
December 2011 in the present study. In a previous study As was found in lower content (i.e., average
0.37 mg kg-1 - wet weight) in cultured D. labrax (Ersoy et al., 2006) from Mediterranean Sea. On the
other hand, higher As contents (i.e., average 4.9 mg kg-1) was reported in cultured S. aurata
(Minganti et al., 2010) from Mediterranean Sea. Fish, those analyzed in the present study, contains an
average of 0.07 mg kg-1 inorganic As and could be consumed without restriction according to EPA
(2000). Because approximately 80% of As in fish muscle is estimated to be in the form of
arsenobetaine (Larsen and Francesconi, 2003), while inorganic As remain below the recommended
level by Turkish Food Codeks (2011) and FAO (1983).
Cadmium contents in the present study were less then 0.01 mg kg-1 for both species. In a
previous study slightly higher Cd content was determined (i.e., 0.012 mg kg-1) in S. aurata in a fish
farm from Adriatic Sea (Creti et al., 2010).
While the highest Hg levels were determined in D. labrax (i.e. 0.25 mg kg-1) the lowest were
determined in S. aurata (i.e 0.05 mg kg-1). In a previous study, while average Hg content was as 0.04
mg kg-1 in D. labrax in a fish farm from Canary Island (Hardisson et al., 2012). In another study 0.12
mg kg-1 average total Hg content was reported in S. aurata in a fish farm from Mediterranean Sea
(Minganti et al., 2010). All Hg contents reported from other studies were lower than the results in the
present study.
Pb values varied between BDL and 0.03 mg kg-1 in the present study. In previous studies
higher Pb contents were determined (i.e. 0.16 mg kg-1) in S. aurata in a fish farm from Adriatic Sea
(Cretì et al. 2010) and in cultured D. labrax (i.e. 0.28 mg kg-1 - wet weight) (Ersoy et al. 2006) from
Mediterranean Sea (Table 2).
Beside of atmospheric and riverine born inputs, food pellets, precipitated and/or resuspended
sediment, and cage materials and equipment including sea vessels can be sources of these toxic
elements in the muscle tissue of fish samples. On the other hand, because of lack of studies on metal
contents of artificial food from fish farms, it is difficult to estimate sources of non-essential elements.
Though there are some surface sediment studies below the fish farms in the region (Basaran et al.,
2010; Kalantzi et al., 2013) it is also difficult to say presence of toxic elements in the muscle tissue of
farm fishes, originated from sediments.
100
HydroMedit 2014, November 13-15, Volos, Greece
Generally, none of measured elements exceed threshold levels or recommended values for
consumption in fish. However, some toxic elements (i.e. As, Cd, Hg, and Pb) were determined in all
samples and it is suggested that monitoring of these elements can be useful for studies in the future.
Also in the future studies element measurements in food pellets and nearby surface sediments can be
supply valuable information for evaluate the results.
Acknowledgements
This study was funded by the Kocaeli University Scientific Research Projects Unit (Grant
No: KOU-BAPB 2011/115).
References
Basaran A.K., Aksu, M., Egemen, O. (2010). Impacts of the fish farms on the water column nutrient
concentrations and accumulation of heavy metals in the sediments in the eastern Aegean Sea
(Turkey). Environmental Monitoring and Assessment 162, 439-451.
Creti, P. Trinchella, F., Scudiero, R. (2010). Heavy metal bioaccumulation and metallothionein
content in tissues of the sea bream Sparus aurata from three different fish farming systems.
Environmental Monitoring and Assessment 165, 321-329.
Duarte, C.M. Holmer, M., Olsen, Y., Soto, D., Marba, N., Guiu, J., Black, K., Karakassis, I. (2009).
Will the Oceans Help Feed Humanity? Bioscience 59, 967-976.
EPA (2000). Guidance for Assessing Chemical Contaminant Data for Use in Fish Advisories Volume
2 Risk Assessment and Fish Consumption Limits Third Edition, in: Water, O.o.S.a.T.O.o.
(Ed.), United States Environmental Protection Agency. United States Environmental
Protection Agency, Washington, p. 383.
Ersoy, B. Yanar, Y., Kucukgulmez, A., Celik, M. (2006). Effects of four cooking methods on the
heavy metal concentrations of sea bass fillets (Dicentrarchus labrax Linne, 1785). Food
Chemistry 99, 748-751.
FAO (1983). Compilation of legal limits for hazardous substances in fish and fishery products, Roma.
Hardisson A., Rubio, C., Gutierrez, A., Jalili, A., Hernandez-Sanchez, C., Lozano, G., Revert, C.,
Hernandez-Armas, J., 2012. Total Mercury in Aquaculture Fish. Pol. J. Environ. Stud. 21,
1203-1209.
Kalantzi I., Shimmield, T.M., Pergantis, S.A., Papageorgiou, N., Black, K.D., Karakassis, I. (2013).
Heavy metals, trace elements and sediment geochemistry at four Mediterranean fish farms.
Science of The Total Environment 444, 128-137.
Larsen E.H., Francesconi, K.A. (2003). Arsenic concentrations correlate with salinity for fish taken
from the North Sea and Baltic waters. Journal of the Marine Biological Association of the
United Kingdom 83, 283-284.
Minganti V., Drava, G., De Pellegrini, R., Siccardi, C. (2010). Trace elements in farmed and wild
gilthead seabream, Sparus aurata. Marine Pollution Bulletin 60, 2022-2025.
TFC (2011). Decleration on Maximum Limits of Contaminants in Food, 29.12.2011 ed. Turkish
Republic Official Gazette, Ankara, Turkey.
101
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
The effect of feeding Spirulina platensis on the growth and haematological parameters of the
Nile catfish; Clarias gariepinus exposed to food shortage stress were investigated. S.
platensis was added to the basal diet at 0.0, 1.25, 2.5 and 5.0 g Spirulina /kg diet and fed for
two months to the Nile catfish. Our results showed that the final fish weight, weight gain and
specific growth rate of C. gariepinus fed on the experimental diets were not significantly
different (p > 0.05). The fish fed on Spirulina diets exhibited higher RBCs counts, WBCs
counts, haemoglobin and haematocrit levels as compared with stressed fish and control. The
feeding dietary Spirulina resulted in significant decreases in mean cell volume, mean cell
haemoglobin and neutrophils, while, the mean cell haemoglobin concentration was not
affected. The platelets and monocytes were increased with Spirulina levels increase. A
significant decrease in eosinophils and small lymphocytes were observed in the fish treated
with Spirulina, however, the large lymphocytes were increased. The percentage of altered
erythrocytes of fish treated with Spirulina was significantly decreased in comparison to
stressed fish and control. We can conclude that Spirulina supplementation is promising for
improving the hametological parameters in Clarias gariepinus, as immun-inducer and
growth factor in food ingredients for fish feeding.
Keywords: Spirulina platensis, Clarias gariepinus, growth performance, haematology.
1- INTRODUCTION
Marine macro- and microalgae were receiving increasing attention as a possible protein
source for fish diets, particularly in tropical developing countries, because of their high
protein content and production rate (Venkataraman et al., 1980). Microalgal species are of
great value because of their high bioactive materials content, including polyunsaturated fatty
acids, α- carotene and other pigments (antioxidants) (Bhat and Madyastha, 2000). The use of
algae as a feed additive might help in effective utilization of artificial diets in cultured fish
(Mustafa and Nakagawa, 1995). Spirulina is a freshwater blue-green filamentous alga, and
has been one of the most widely used microalgal species in aquafeeds due to its high
contents of proteins, vitamins, essential amino acids, minerals, essential fatty acids and
antioxidant pigments such as carotenoids (Nakagawa and Montgomery, 2007). α-carotene in
Spirulina firmly maintains the mucous membrane and thereby prevents the entry of toxic
elements into the body (Henrikson, 1994). Chlorophyll in Spirulina acts as a cleaning and
detoxifying factor against toxic substances (Henrikson, 1994). Growth studies with
Spirulina, have confirmed that it improves carcass quality (Liao et al., 1990), encourages
growth (Mustafa et al., 1994a). Therefore, it has been used as a nutrient for fish larvae (Lu
102
HydroMedit 2014, November 13-15, Volos, Greece
and Takeuchi, 2004; Lu et al., 2002) and as an ingredient in fish diet for juveniles and adults
common carp (Palmegiano et al., 2008). Tilapia fed solely on raw Spirulina could maintain
normal reproduction from parents to progeny throughout three generations (Lu and
Takeuchi, 2004). It has been verified that larval tilapia fed solely on raw Spirulina cultivated
in photo-bioreactors can grow normally from the onset of exogenous feeding without any
nutrient supplements (Lu et al., 2002). The addition of small amounts of algae to fish feed
exerted pronounced effects on growth, lipid metabolism, body composition and disease
resistance (Mustafa et al., 1994b). As well as, haematological studies in fish have diagnostic
as well as economic significance. In recent years fish haematology has become an
increasingly important tool of fisheries biologists and research ichthyologists (Mekkawy et
al., 2011; Sayed et al., 2013; Sayed et al., 2007). Hence, S. platensis may have potential to be
used as a natural feed supplement for increasing fish growth. Therefore, the main objective
of the present study is to investigate the effect of diets containing S. platensis on the growth
and some haematological parameters of Clarias gariepinus.
2- MATERIALS AND METHODS
2.1. Algal Culture
The culture of Spirulina platensis (Gomont) was isolated from agriculture faculty farm in
Assiut University (Egypt) and identified according to (Prescott, 1978). S. platensis was
grown in Zarrouk's medium (Zarrouk, 1966) at pH 9 and incubated at 30 o C under
continuous illumination fluorescent light of 48.4 ιmole.m-2.s-1. The alga was cultivated in
50 L photobioreactors using a unialgal semi-continuous culture (Morist et al., 2001). To
determine the algal biomass, a 100 mL aliquot of the algae suspension was filtered through
Whatman (GF/A) glass fiber (0.45 m), and the obtained pellet was then oven-dried at 85oC
for 4h and weighed. Chlorophyll-a and carotenoids were extracted in methanol (80 %) and
determined according to (Marker, 1972). Phycobiliproteins contents of S. platensis were
determined according to the method described by (Bennet and Bogorad, 1973). Total
proteins in S. platensis were determined according to (Lowry et al., 1951). For the
determination of total carbohydrates, the anthrone sulfuric acid method was used (Badour,
1959). Total lipids in S. platensis were determined by the sulfophosphovanilin method (SPV)
(Drevon and Schmitt, 1964) (Table 2).
2.2. Fish sample collection and pre-experimental adaptation
Nightly six healthy fishes of the Nile catfish; Clarias gariepinus (490 ± 17.8 g) in weight
were caught from the fish farm of Faculty of Agriculture, Assiut University, Egypt in April
2013. Fishes immediately transported to the Fish Biology laboratory in the Department of
Zoology, Faculty of Science, Assiut University. The experimental fishes were reared in
aerated glass tanks (100 L capacity) and acclimatized for two weeks before being used in the
experimental study. The experimental fish fed commercial pellets at a rate of 5 % of wet
weight twice daily to help the fish adapt to their new environment before the experiment.
Feces and residual food were aspirated regularly. The water temperature, pH, dissolved
oxygen (DO) concentrations and electrical conductivity (EC) were measured daily (25.2 ±
0.08 ºC, pH: 6.8 ±11, DO: 6.5± 0.89 mg L-1 and EC: 260 ± 0.2 ιmho.cm-1).
2.3. Experimental setup
The adapted fishes were exposed to food shortage stress (feed at 2% of body wet weight
daily) for two months (May and June 2013). This experiment was done under the same
conditions of the adaption period. After that, fishes were weighed and classified randomly
into 4 groups according to the concentrations of Spirulina. Each group was contained three
replicates (8 fish/ 100 L tank). Then, fishes were exposed to different concentrations of
Spirulina within food (0.0 (control), 1.25, 2.5 or 5.0 g Spirulina /kg diet). The exposure was
103
HydroMedit 2014, November 13-15, Volos, Greece
for two months and experimental fish were fed on commercial pellets (5 % of wet weight
twice daily) with changing all the tap water every day.
2.4. Diet preparation
Isolated Spirulina culture was added to the basal diet which represented in Table (1) to
represent various concentrations as 0.0 (control), 1.25, 2.5 or 5.0 g Spirulina/kg diet. The
nutritional composition of Spirulina platensis was shown in Table (2). Each concentration of
Spirulina was suspended in 100 ml distilled water and added to the ingredients of the
experimental diet, and blended for 40 min at least to make a paste of each diet. The pastes
were separately passed through a grinder, and pelleted (1 mm diameter) in a paste extruder.
The diets were air-dried and stored in plastic bags in a refrigerator (-2 o C) for further use.
Water quality such as temperature, dissolved oxygen pH and electrical conductivity were
measured every 20 day during the experiment.
2.5. Growth parameters
Fishes were weighed at the beginning and end of the experiment. Growth was calculated as
the difference between the wet weights at the beginning of the experiment and on the day of
calculation. Percentage weight gain PWG (%) was calculated as (Final mean body weight/
Initial mean body weight) x 100 (Tacon, 1990). Specific growth rate (SGR) was calculated
as (Wt1 – Wto)/t1 x 100, where Wto and Wt1 are the weights of the fish at the beginning and
end of each sampling period and t1 is the period between samplings in days (Hevrory et al.,
2005). The survival rate was calculated as (No of fishes remaining at the end of the
experiment/ No of fishes at the beginning of the experiment) x 100 (Ai et al., 2006).
2.6. Hematological parameters
Blood samples were taken from the caudal vein into heparinzed tubes. The concentration of
Hb and blood cells count was immediately estimated. Other samples of blood were
centrifuged at 5000 rpm for 10 min and serum samples were stored in polyethylene
Eppendorf test tubes at -20 °C until serum analysis. The RBC‘s, WBC‘s, blood Platelets,
Haematocrit (HCT), Hemoglobin (Hb) were determined by using automated technical
analyzer (Mindray Bc-2800). Mean corpuscular volume (MCV), mean corpuscular
hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) were
calculated using the formulae mentioned by (Dacie and Lewis, 1991). MCHC (g/dl) = Hb/
HCT x 100, MCH (pg ( = Hb/ RBC's x 10, MCV (ιm³) = HCT/ RBC's x 10. Differential
WBC's were counted using blood smears stained with Giemsa satin according to (Tavares-
Dias and Moraes, 2003)
2.7. Erythrocytes alterations
Blood smears were obtained by the caudal incision on clean grease free microscopic slides
after exposure. The smears were fixed in absolute methanol for 10 min after drying at room
temperature. Slides were stained with haematoxylin and eosin. It was followed by
dehydration in ascending grades of alcohol (30, 50, 70, and 90%, absolute). Finally the slides
were cleared in xylene and permanently mounted by DPX (Pascoe and Gatehouse, 1986).
Many slides were selected on the basis of staining quality, then coded, randomized and
scored blindly. In each group 10,000 cells (a minimum of 1000 per slide) were examined
(Al-Sabti and Metcalfe, 1995) at 40× objective and 10× eyepiece for morphologically altered
erythrocytes in separate studies. The morphologically altered erythrocytes were described
according to (Mekkawy et al., 2011).
2.8. Statistical analysis
Statistical analyses were performed on the data obtained from completely randomized design
with three replications after two months of the experimental period. One-way ANOVA was
used to test the effect of the dietary treatment. Duncan Multiple Range test was also applied
104
HydroMedit 2014, November 13-15, Volos, Greece
to compare the means when a significant difference (p < 0.05) was detected by ANOVA. All
the statistical analyses were done using SPSS program version 10 (SPSS, Richmond, VA,
USA).
Ethical statement
All experiments were carried out in accordance with the Egyptian laws and University
guidelines for the care of experimental animals. All procedures of the current experiment
have been approved by the Committee of the Faculty of Science of Assiut University, Egypt.
3- RESULTS
3.1. The physico-chemical characteristics of the water
The water quality was measured every 20 day during the experiment (Table 3). Water
temperature ranged between 28.6 and 29.1o C at twenty day and first day of the experiment,
respectively. With respect to the dissolved oxygen and electrical conductivity, the maximum
value was recorded at the forty day. The pH value was tented to weakly alkaline.
3.2. Nutritional composition of Spirulina platensis and Growth performance
Nutritional composition of Spirulina platensis was shown in Table (2). Spirulina platensis
were contained high percentage of total proteins (43.4 %), total carbohydrates (28.1 %), total
lipids (5.02 %), chlorophyll-a (0.68 %), carotenoids (0.65 %) and phycobiliproteins (18.43
%).
The effects of Spirulina diets on the growth parameters for Clarias gariepinus throughout the
experimental periods are given in Table (4). The final fish weight ranged from 471 g to 535
g for the fishes exposed to food shortage stress (after stress) and 2.5 g Spirulina/kg diet,
respectively; and was not significantly lower in fish fed after stress than all Spirulina diets (p
> 0.05). Also, the weight gain and specific growth rate of Clarias gariepinus fed on the
experimental diets was not significantly different (p > 0.05). Furthermore, fish survival was
not statistically different among dietary treatments, and its range was 91.7-100% (Table 4).
3.3. Hematological parameters
Fishes were fed on Spirulina diets exhibited significant increasing in RBCs counts and their
ranges were 2.98-3.8 × 106/ιL for the fishes fed after stress and 5 g Spirulina/kg diet,
respectively (p < 0.05; Table 5). The high counts of WBCs were obtained at 5g/kg diet
(12.03 × 105/ιL). Dietary Spirulina significantly affected the haemoglobin of fishes and
varied from 7.51 to 9.83 mg/dl for the fishes fed after stress and 1.25 g Spirulina/kg diet,
respectively. Haematocrit tended to increase with increasing dietary Spirulina levels than the
control fish (p < 0.05). Mean cell volume ranged between 100.1 and 116.2 ιm³ for the fishes
fed 5 g Spirulina/kg diet and the control fish, respectively. The highest level of mean cell
haemoglobin was found in control diet; however, there were no differences in mean cell
haemoglobin concentration of the fishes fed Spirulina diets. Platelets were significantly
increased than the control fish with increasing Spirulina levels in fish diet (p < 0.05) and the
high value was recorded at 5 g Spirulina/kg diet. The number of neutrophils was decreased
with the Spirulina levels while monocytes increased in comparison with control fish (Table
5). The highest number of neutrophils and monocytes were recorded in fish fed after stress.
The fish were fed 1.25 g Spirulina/kg diet displayed high number of basophils. Generally
eosinophils were significantly decreased with Spirulina levels (p < 0.05).
The control diet produced the highest percentage of small lymphocytes, which decreased
with the increase of Spirulina levels in fish diet (p < 0.05). Fish fed 5 g Spirulina/kg diet had
a significantly (p < 0.05) higher number of large lymphocytes compared to the control fish
(Table 4).
105
HydroMedit 2014, November 13-15, Volos, Greece
106
HydroMedit 2014, November 13-15, Volos, Greece
lymphocytes. Our study indicated that, the percentage of altered erythrocytes of fish treated
with Spirulina was significantly decreased in comparison to fish fed after stress and the
control diet. The improvement of the erythrocytes alterations was recorded after treatment
with quince leaf extract in the same species after UV radiation (Sayed et al., 2013). In the
present study the increase in altered cell frequencies appeared more clearly in fishes exposed
to food shortage stress. The alterations in fish erythrocytes were observed in hypoxic
condition (Sawhney and Johal, 2000), factors that induce apoptosis of blood cells like
radiations , 4-nonylphenol (Mekkawy et al., 2011), and UVA (Sayed et al., 2013). In
conclusion, the present study showed hematology profile for the Clarias gariepinus species
after two months of food shortage stress in comparison with control and Spirulina diets.
Also, the Spirulina feeding improved the hametological parameters in all exposed groups
compared with stressed and control groups. Finally we recommend with using Spirulina as
immun-inducer and growth factor in food ingredients for fish feeding in fish culture.
REFERENCES
Abd El-Ghany, N.A., Abd Alla, H.M.L., 2008. A trial for treatment of ichthyophonosis in
cultured Oreochromis niloticus using Fucus and neem plants, 8th International Symposium
on Tilapia in Aquaculture, Cairo, Egypt.
Ai, Q., Mai, K., Tan, B., Xu, W., Duan, Q., Ma, H., Zhang, L., 2006. Replacement of fish
meal by meat and bone meal in diets for large yellow croaker, Pseudosciaena crocea.
Aquaculture 260, 255-263.
Al-Sabti, K., Metcalfe, C.D., 1995. Fish micronuclei for assessing genotoxicity in water.
Mutation Resarch, 121-135.
Badour, S.S.A., 1959. AnalytischoChemische unter suchung des kalimangels bei Chlorella in
vergleich mit anderen manget zamstanden, Goettingen, Germany.
Bennet, A., Bogorad, L., 1973. Complementary chromatic adaptation in filamentous blue-
green algae. Cell Biology 58, 419-435.
Bhat, V.B., Madyastha, K.M., 2000. C-phycocyanin: a potent peroxyl radical scavenger in
vivo and in vitro. Biochemical and Biophysical Research Communications 275, 20-25.
Bhujel, R.C., 2000. A rewiew of strategies for the management of Nile tilapia (Oreochromis
niloticus) broodfish in seed production systems, especially hapa-based systems. Aquaculture
181, 37-59.
Dacie, S., Lewis, S., 1991. Practical Haematology, Seventh ed, London. 13
Dernekbasi, S., H., Una, I., Karayucel, A.I., Aral, O., 2010. Effect of dietary
supplementation of differentrates of Spirulina (Spirulina platensis) on growth and feed
conversion in guppy (Poecilia reticulata Peters, 1860). Journal of Animal and Veterinary
Advances 9, 1395-1399.
Drevon, B., Schmitt, J.M., 1964. La reaction sulfophosphovanillique dans l‘ét.ude des lipides
seriques. Bulletin Trau. Society Pharmaceuticals Lyon 8, 173-178.
Henrikson, R., 1994. Microalga Spirulina Super Alimento del Futuro Ronore Enterprises,
Urano, Barcelona, Spain.
Hevrory, E.M., Espe, M., Waagbo, R., Sandnes, K., Ruud, M., Hemre, G., 2005. Nutrition
utilization in Atlantic salmon (Salmo salar) fed increased level of fish rotein hydrolyses
during a period of fast growth. Aquaculture Nutrition 11, 301-313.
James, R., Sampath, K., Thangarathinam, R., Vasudevan, I., 2006. Effect of dietary Spirulina
level on growth, fertility, coloration and leucocyte count in red swordtail, Xiphophorus
helleri. Israeli Journal of Aquaculture Bamidgeh 58, 97–104.
107
HydroMedit 2014, November 13-15, Volos, Greece
Liao, W.L., Takeuchi, T., Watanabe, T., Yamaguchi, K., 1990. Effect of dietary Spirulina
supplementation on extractive nitrogenous constituents and sensory test of cultured striped
jack flesh. Journal of Tokyo University of Fisheries 77, 241–246.
Lowry, D.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with
the folin phenol reagent. Journal of Biological Chemistry 193, 265-275.
Lu, J., Takeuchi, T., 2004. Spawning and egg quality of tilapia Oreochromis niloticus fed
solely on raw Spirulina throughout three generations. Aquaculture 234, 625-640.
Lu, J., Yoshizaki, G., Sakai, K., Takeuchi, T., 2002. Acceptability of raw Spirulina platensis
by larval tilapia Oreochromis niloticus. Fisheries Science 68, 51-58.
Marker, A.F.H., 1972. The use of acetone and methanol in the estimation of chlorophyll in
the presence of Phaeophytin. Freshwater Biology 2, 361-385.
Mekkawy, I.A., Mahmoud, U.M., Sayed, A.H., 2011. Effects of 4-nonylphenol on blood
cells of the African catfish Clarias gariepinus (Burchell, 1822). Tissue and Cell 43, 223–
229.
Miller, O., 1993. Laboratory for clinical. Rio de Janeiro, Atheneu.
Moe, P.P., 2011. Effect of Diet Containing Spirulina platensis on the Growth and
Haematology of Nile Tilapia, Oreochromis niloticus (Linnaeus, 1758). Universities Research
Journal 4, 63-77.
Morist, A., Montesinos, J.L., Cusido, J.A., Godia, F., 2001. Recovery and treatment of
Spirulina platensis cells cultured in a continuous photobioreactor to be used as food. Process
Biochemistry 37, 535–547.
Mustafa, M.G., Nakagawa, H., 1995. A review: dietary benefits of algae as an additive in
fish feed. Israeli Journal of Aquaculture Bamidgeh 47, 155–162.
Mustafa, M.G., Takeda, T., Umino, T., Wakamatsuand, S., Nakagawa, H., 1994b. Effects of
Ascophyllum and Spirulina meal as feed additives on growth performance and feed
utilization of red sea bream, Pagrus major. Journal of the Faculty of Applied Biological
Science 33, 125-132.
Mustafa, M.G., Umino, T., Nakagawa, H., 1994a. . . 10, 1994a. The effect of Spirulina
feeding on muscle protein deposition in red sea bream, Pagrus major. Journal of Applied
Ichthyology 10, 141-145.
Nakagawa, H., Montgomery, W.L., 2007. Algae. In: Dietary supplements for the health and
quality of cultured fish. CABI North American Office Cambridge, USA.
Nakono, T., Yamaguchi, T., Sato, M., Iwama, G.K., 2003. Biological Effects of Carotenoids
in Fish, Effective Utilization of Marine Food Resource, Songkhla, Thailand, pp. 1-15.
Olvera-Novoa, M., Domnguez-Cen, L., Olivera-Castillo, L., Martnez-Palacios, C.A., 1998.
Effect ofthe use of the microalga Spirulina maxima as fish meal replacement in diets for
tilapia, Oreochromis mossambicus (Peters), fry. Aquaculture Research 29, 709-715. 14
Palmegiano, G.B., Gai, F., Dapra, F., Gasco, L., Pazzaglia, M., G., P.P., 2008. Effects of
Spirulina and plant oil on the growth and lipid traits of white sturgeon (Acipenser
transmontanus) fingerlings. Aquaculture Research 39, 587-595.
Pascoe, S., Gatehouse, D., 1986. The use of a simple haematoxylin and eosin staining
procedure to demonstrate micronuclei within rodent bone marrow. Mutation Resarch 164,
237-243.
Prescott, G.W., 1978. How to Know Freshwater Algae. WM.C. Brown Company, Dubuque,
Iowa, USA.
Sawhney, A.K., Johal, M.S., 2000. Erythrocyte alterations induced by malathion in Channa
punctatus (Bloch). Bulletin of Environmental Contamination and Toxicology 64, 398–405.
108
HydroMedit 2014, November 13-15, Volos, Greece
Sayed, A.H., Abdel-Tawab, H.S., Abdel Hakeem, S.S., Mekkawy, I.A., 2013. The protective
role of quince leaf extract against the adverse impacts of ultraviolet-A radiation on some
tissues of Clarias gariepinus (Burchell, 1822). Journal of Photochemistry and Photobiology
B: Biology 119, 9-14.
Sayed, A.H., Ibrahim, A.T., Mekkawy, I.A.A., Mahmoud, U.M., 2007. Acute effects of
Ultraviolet-A radiation on African Catfish Clarias gariepinus (Burchell, 1822). Journal of
Photochemistry and Photobiology B: Biology 89, 170-174.
Sunmonu, T.O., Oloyede, O.B., 2008. Haematological response of African Catfish (Clarias
gariepinus) and rat to Crude oil exposure. The Internet Journal of Haematology 4, 3-6.
Tacon, A.G.J., 1990. Standard methods for the nutrition and feeding of farmed fish and
shrimp. Argent laboratories press, Washington DC., USA.
Tavares-Dias, M., Moraes, F.R., 2003. Hematological evaluation of Tilapia rendalli
Boulenger, 1896 (Osteichthyes: Cichlidae) captured in a fee fishing farm from Franca, S?o
Paulo, Brasil (in Portuguese). Biosc J. 19, 103-110.
Teimouri, M., Amirkolaie, A.K., Yeganeh, S., 2013. Effect of Spirulina platensis Meal as a
Feed Supplement on Growth Performance and Pigmentation of Rainbow Trout
(Oncorhynchus mykiss). World Journal of Fish and Marine Sciences 5, 194-202.
Ungsethaphand, T., Peerapornpisal, Y., Whangchai, N., Sardsud, U., 2010. Effect of feeding
Spirulina platensis on growth and carcass composition of hybrid red tilapia (Oreochromis
mossambicus × O. niloticus). Maejo international journal of science and technology 4, 331-
336.
Venkataraman, L.V., Nigam, B.P., Ramanatham, P.K., 1980. Rural oriented fresh water
cultivation and production of algae in India, in: Shelef, G., Soede, C.J. (Eds.), Algae
Biomass. Elsevier, Amsterdam, pp. 81-95.
Vonshak, A., 1997. Spirulina platensis (Arthospira): Physiology, Cell Biology and
Biotechnology. Taylor and Francis, London.
Zarrouk, C., 1966. Contribution à l‘étude d‘une cyanophycée. Influence de divers facteurs
physiques et chimiques sur la croissance et la photosynthè se de Spirulina maxima Geilter.
Universite´ de Paris, Paris, France.
109
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
One of the most critical issues that threatens the sustainability and further growth of aquaculture
production is its dependency on fishmeal that is included in industrially compounded aquafeeds.
Global annual production is being static for the last 15 years, with its price being steadily increased,
and many sustainability issues have arisen. Insects could be an alternative solution to partially satisfy
the nutritional needs of the cultured fish, provided that their growth and the quality of their edible
flesh would not be negatively affected. Many insect species are rich sources of animal proteins, with a
―good‖ profile of amino acids, while they are also rich in lipids-energy. The aim of the present study
was to assess the suitability of prepupae of the black soldier fly Hermetia illucens as a feedstuff of the
diet of gilthead seabream (Sparus aurata) partially replacing fishmeal (FM). A total number of 240
juveniles of 1.47 ± 0.22g initial mean weight were transferred to 12 saltwater aquaria within a closed
recirculation system. They were divided into 4 dietary treatments that were fed twice a day for 10
weeks four isoenergetic (20.3 Mj/Kg) and isonitrogenous (46%) diets differing in the inclusion level
of a meal produced by dried prepupae of H. illucens: FM diet contained only fishmeal and used as a
control diet, while in diets FPM10, FPM20 and FPM30 the fishmeal protein level was substituted by
fly prepupae meal at 10%, 20% and 30%, respectively. Fly prepupae meal resulted in similar values of
FCR, protein efficiency ratio and protein retention with the fish feeding on fishmeal. Fish fed the FM
diet had the significantly higher feed consumption than the rest groups that led to a significantly
higher weight gain. Fish fed the FM diet had also the highest SGR, but not significantly higher than
the rest fish groups. The partial replacement of FM up to 30% by H. illucens prepupae meal in the diet
of seabream does not significantly reduces fish growth rate.
Key words: seabream, Sparus aurata, fishmeal, insects, Hermetia illucens, nutrition.
*Corresponding author: Karapanagiotidis Ioannis T. (ikarapan@uth.gr).
Introduction
One of the most critical issues that threatens the sustainability and further growth of aquaculture
production is its dependency on fishmeal (FM) that is included in industrially compounded aquafeeds.
Particularly, the intensive production of carnivorous species such as gilthead seabream is heavily
dependent on continuing supplies of high quality FM. FM global annual production is around 6
million tonnes being static for the last 15 years, with its price being steadily increased since 2000
(Tacon & Metian 2008). Over the last two decades, research findings revealed that significant
reductions of the inclusions levels of FM in feeds for most carnivorous species can be achieved by
partially replacing it with plant proteins without leading to detrimental effects on fish growth (Bell &
Wagboo 2008). However, FM cannot be fully replaced by plant proteins in aquafeeds of most cultured
European farmed fish species because this results in loss of fish growth performance due to reduced
levels of essential amino acids, the presence of several anti-nutritional factors and reduced palatability
of plant feedstuffs (reviewed by Bell & Wagboo 2008). Moreover, plant feedstuffs can also reduce
nutrient bioavailability in fish body resulting in nutrient loss to the aquatic environment, which in turn
produces an undesirable disturbance to the balance of organisms present in the aquatic environment
(Gatlin et al. 2007). FM will continue to make an important contribution to aquaculture production as
its high protein value makes it a key material in aquafeeds. In the future, this marine resource will be
110
HydroMedit 2014, November 13-15, Volos, Greece
used as sparingly as possible and will become a strategic ingredient in special diets targeting at the
critical stages of the life cycle of farmed fish, especially the carnivorous ones (Tacon & Metian 2008).
If the production of farmed fish is to contribute in global fish availability it is essential for the sector
to continue searching for suitable raw alternatives to FM that are both economically viable and
environmentally friendly for aquafeed production. An ideal viable alternative feedstuff to FM in
aquafeeds should possess certain characteristics including wide availability, competitive price, plus
ease of handling, shipping, storage and use in feed production. Furthermore, it should possess certain
nutritional characteristics, such as low levels of fibre, starch, especially non-soluble carbohydrates and
antinutrients, a relatively high protein content, favorable amino acid profile, high nutrient digestibility
and reasonable palatability.
Insects could be an alternative solution to partially satisfy the nutritional needs of the cultured fish,
assuming that their growth and the quality of their edible flesh would not be negatively affected. They
are rich sources of animal proteins, with a ―good‖ profile of amino acids, and consist a rich source of
lipids-energy (Sánchez-Muros et al. 2014). Insects are also considered as a natural diet of fish (Hill &
Watson 2007). Apparently, the availability of insects in adequate quantities as well as suitable
manufacture technology for mass production is currently a threshold (Monentcham et al. 2010).
Studies up to date using insect meals in fish diets have shown equivocal results as regards the fish
growth rate and nutrient utilization among the several insect and fish species used (Sánchez-Muros et
al. 2014). The larvae of black soldier (Hermetia illucens) have also been evaluated as feed in various
fish species, including channel catfish and tilapia (Oreochromis sp.) without exerting any significant
effect on fish growth though (Bondari and Sheppard 1981). In rainbow trout (Oncorhynchus mykiss) it
has been shown that the growth of fish fed enriched H. illucens diets was not significantly different
from fish fed a fishmeal-based control diet (Sealey et al. 2011). The aim of the current study was to
assess the suitability of incorporating meal from prepupae of the fly H. illucens in the diet of gilthead
seabream (Sparus aurata) substituting fishmeal.
111
HydroMedit 2014, November 13-15, Volos, Greece
as significant at P < 0.05. ANOVA was performed using SPSS 18.0 (2009; SPSS, Inc., Chicago, IL,
USA).
Studies with insects as feedstuffs for cultured fish are limited, though an increased research interest
came out recently (Sánchez-Muros et al. 2014). St-Hilaire et al. (2007) tested the H. illucens prepupae
meal as well as prepupae of the house fly (Musca domestica) in the diet of rainbow trout
(Oncorhynchus mykiss) and reported that a 25% replacement of FM can be achieved, while higher
inclusion levels resulted in fish growth reduction and deterioration of feed utilization. Bondari &
Sheppard (1987) working with two freshwater fish species, catfish (I. punctatus) and blue tilapia (O.
112
HydroMedit 2014, November 13-15, Volos, Greece
aureus) reported that H. illucens can successfully replace 100% the fishmeal in diets with low
fishmeal inclusion (10%). To our knowledge, the present study is the first trial of assessing the
suitability of H. illucens prepupae meal in the diet of gilthead seabream. Our results suggest that an up
to 30% replacement of fishmeal by H. illucens can be achieved without exerting significantly negative
effects on fish growth and feed utilization by fish. The significantly higher weight gain by fish fed the
FM diet is mainly due to the higher feed consumption, which is probably due to the higher palatability
of FM compared to H. illucens prepupae meal. Additional experimental work is required is required
so to enlighten the suitability of H. illucens as well as of other insect species as feedstuffs for cultured
fish. The nutritional value of insects makes them a promising and valuable feed alternative that could
replace, at least in part, fishmeal in aquafeeds. However, apart from the effect of these diets on fish
growth and feed utilisation, future studies should also focus on the economic sustainability of insect-
based diets, in comparison with the currently used FM.
Acknowledgments
The authors express their thanks to ―DIAS Aquaculture‖ for provision of fingerlings, to ―Biomar
Hellenic‖ for provision of feedstuffs as well as to Mr. L. Papadimitropoulos for his assistance with
fish culture.
Table 2. Growth performance, feed utilization and body nutrient composition of S. aurata
feeding on the fishmeal and fly prepupae meal based diets.
FM FPM10 FPM20 FPM30
Survival (%) 80.0 ± 10.0 81.7 ± 7.6 80.0 ± 10.0 76.4 ± 7.6
Final weight (g) 17.59 ± 1.96a 11.54 ± 1.52b 10.35 ± 2.82b 11.01 ± 1.38b
Weight gain (g) 16.12 ± 1.96a 10.07 ± 1.52b 8.88 ± 2.83b 9.53 ± 1.39b
Total consumption (g) 17.92 ± 1.51a 12.83 ± 0.75b 11.52 ± 1.72b 11.59 ± 1.25b
SGR (%/δι.) 3.54 ± 0.16 2.93 ± 0.20 2.75 ± 0.42 2.86 ± 0.18
FCR 1.12 ± 0.05 1.30 ± 0.30 1.36 ± 0.30 1.22 ± 0.04
PER 1.98 ± 0.09 1.78 ± 0.36 1.70 ± 0.33 1.80 ± 0.09
Protein retention (%) 32.06 ± 1.29 28.40 ± 6.74 27.21 ± 6.71 27.03 ± 2.18
References
AOAC (1995) Association of Official Analytical Chemists. Official methods of analysis of the
Association of Official Analytical Chemists International, (16th edition) AOAC, Arlington,
VA, USA.
Bell J.G., Wagboo R. (2008). Safe and Nutritious Aquaculture Produce: Benefits and Risks of
Alternative Sustainable Aquafeeds. In: Aquaculture in the Ecosystem, Holmer M., Black K.,
Duarte C.M., Marba N. and Karakassis I. (eds.), Springer Science + Business Media B.V.,
pp. 185-226.
Bondari K., Sheppard D.C. (1987). Soldier fly Hermetia illucens L., as feed for channel catfish,
Ictalurus punctatus (Rafinesque), and blue tilapia, Oreochromis aureus (Steindachner).
Aquaculture and Fisheries Management 18, 209-220.
FAO (2014). The State of World Fisheries and Aquaculture 2014. Food and Agriculture Organization
of the United Nations, Rome, 223 pp.
Gatlin D.M., Barrows F.T., Brown P., Dabrowski K., Gaylord T.G., Hardy R.W., Herman E., Hu G.,
Krogdahl A., Nelson R., Overturf K., Rust M., Sealey W., Skonberg D., Souza E.J., Stone D.,
Wilson R., Wurtele E. (2007). Expanding the utilization of sustainable plant products in
aquafeeds: a review. Aquaculture Research 38, 551–579.
Monentcham S.E, Pouomogne V., Kestemont P. (2010) Influence of dietary protein levels on growth
performance and body composition of African fingerlings, Heterotis niloticus (Cuvier, 1829).
Aquaculture Nutrition 16, 144–162.
113
HydroMedit 2014, November 13-15, Volos, Greece
St-Hilaire S., Sheppard C., Tomberlin J.K., Irving S., Newton L., McGuire M.A., Mosley E.E., Hardy
R., Sealey W. (2007). Fly prepupae as a feedstuff for rainbow trout (Oncorhynchus mykiss).
Journal of the World Aquaculture Society 38, 59–67.
Tacon A.G.J., Metian M. (2008). Global overview on the use of fish meal and fish oil in industrially
compounded aquafeeds: Trends and future prospects. Aquaculture 285, 146–158.
Sánchez-Muros S.M., Barroso F.G., Manzano-Agugliaro F. (2014). Insect meal as renewable source
of food for animal feeding: a review. Journal of Cleaner Production 65, 16-27.
Bondari K., Sheppard D.C. (1981). Soldier fly larvae as feed in commercial fish production.
Aquaculture 24, 103-109.
Sealey W.M., Gaylord T.G., Barrows F.T., Tomberlin J.K., McGuire M.A., Ross C., St-Hilaire S.
(2011). Sensory analysis of rainbow trout, Oncorhynchus mykiss, fed enriched black soldier
fly prepupae, Hermetia illucens. J. World Aquaculture Society 42, 34-45.
114
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
The current study provides a review on the application of High-Throughput sequencing technologies in
aquaculture, focusing on the complexities of sex determination in farmed fish with sexual dimorphism.
Sex-associated Single Nucleotide Polymorphisms (SNPs) in three important farmed species, the Nile
tilapia (Oreochromis niloticus), the Atlantic halibut (Hippoglossus hippoglossus) and the European sea
bass (Dicentrarchus labrax) have been identified by applying Restriction-site Associated DNA
sequencing (RAD-seq) and double digest Restriction-site Associated DNA sequencing (ddRAD-seq).
The above platforms can be used for rapid discovery of thousands of SNPs by sequencing flanking
regions of restriction enzymes cleavage sites at high depth. The first SNP-based linkage maps for the
above species were constructed (> 3,000 SNPs). Evidence for the location of QTLs involved in sex
determination is provided.
Key words: High-Throughput sequencing, QTL mapping, linkage analysis, genomic selection
1. Introduction
Peterson et al. (2012) elaborated on the RAD-seq platform by using a double digest (dd) with
two restriction enzymes and eliminating the shearing step (ddRAD-seq). This, combined with the
usage of a combinatorial multiplex indexing (primers with different coding), allowed several hundred
individuals to be pooled in a single sequencing lane.
The aim of the current study was the analysis of the genetics of sex determination of farmed
fish with sexual dimorphism, using RAD and ddRAD sequencing. Three different species of farmed
fish with sex-determining systems of varying complexity were studied. Both full-sibs and more
distantly related specimens of Atlantic halibut (Hippoglossus hippoglossus), Nile tilapia (Oreochromis
niloticus) and European sea bass (Dicentrarchus labrax) were used for this study. Males are preferred
in Nile tilapia (faster growth; monosex culture prevents reproduction during ongrowing), while in
Atlantic halibut and European sea bass the females are preferred due to superior growth and later
maturation.
115
HydroMedit 2014, November 13-15, Volos, Greece
The RAD - ddRAD library preparation protocol followed essentially the methodology
originally described in Baird et al. (2008) and Peterson et al. (2012). The RAD specific P1 and P2
paired-end adapters and library amplification PCR primer sequences used in this study are detailed in
Baxter et al. (2011). Single Nucleotide Polymorphisms were identified from the resulting Illumina
reads (Firuge 1).
Three different species of farmed fish with sex-determining systems of varying complexity
were studied. Both full-sibs and more distantly related specimens of Atlantic halibut (Hippoglossus
hippoglossus), Nile tilapia (Oreochromis niloticus) and European sea bass (Dicentrarchus labrax)
were used.
3. Results
A linkage map was constructed based on 5,703 Single Nucleotide Polymorphism (SNP)
markers consisting of 24 linkage groups, which corresponds to the expected number of chromosomal
pairs. The first evidence concerning the location of the sex-determining region of Atlantic halibut is
provided in this study (linkage group 13; Palaiokostas et al. 2013a).
116
HydroMedit 2014, November 13-15, Volos, Greece
In the case of Nile tilapia both novel sex-determining regions and fine mapping of the major
sex-determining region are presented. We constructed a linkage map with 3,802 polymorphic SNP
markers, which corresponded to 1,646 discrete map positions, and identified a major sex-determining
region on linkage group 1 explaining nearly 96% of the phenotypic variance. This sex-determining
region was mapped in a 2 cM interval, corresponding to approximately 1.2 Mb in the O. niloticus
draft genome (Palaiokostas et al. 2013b). Additional QTL mapping on families with skewed sex
provided evidence for a QTL in LG 20 (LOD = 4.87) being implicated in sex reversal of genotypic
females (Palaiokostas et al., submitted).
The first SNP-based linkage map for European sea bass was constructed, consisting of 5,097
SNPs grouped into 24 linkage groups. Indications for putative sex-determining QTL, significant at the
genome-wide threshold, are provided in linkage groups 13, 19 and 21. Evidence concerning the
absence of major sex-determining genes was provided.
4. Discussion
The current study has attempted to elaborate and provide new insight into the complexities of
the genetics of sex determination in three farmed fish species by using High-Throughput Sequencing.
RAD-seq and ddRAD-seq by combining control over the fragments that result from the digestion(s)
with deep sequencing, allow the detection of reproducible SNPs in the magnitude of thousands
(McCormack et al 2012).
The above techniques have been successfully used in this study to map sex-determining
regions in three farmed fish species. In addition the results of the current study have practical
applications as well, towards the production of mono-sex stocks of those species for the aquaculture
industry through MAS (Marker-Assisted Selection). Especially in farmed species with limited
genomic resources, RAD-seq and ddRAD-seq offer an excellent and economic way for conducting
large-scale QTL studies (for sex determination or other traits) that would have been unrealistic in
terms of cost for most research groups in the recent past.
Acknowledgements
The authors acknowledge the support of the MASTS pooling initiative (The Marine Alliance for
Science and Technology for Scotland), a University of Stirling PhD scholarship and a KTN
BioSciences SPARK award (04054). The sea bass project was funded by INRA-IFREMER. MASTS
is funded by the Scottish Funding Council (grant reference HR09011) and contributing institutions.
References
Baird, N.A., Etter, P.D., Atwood, T.S., Currey, M.C., Shiver, A.L., Lewis, Z.A., Selker, E.U., Cresko,
W.A., Johnson, E.A. 2008. Rapid SNP discovery and genetic mapping using sequenced RAD
markers. PloS ONE 3:e3376.
Baxter SW, Davey JW, Johnston JS, Shelton AM, Heckel DG, Jiggins CD, Blaxter ML. 2011.
Linkage mapping and comparative genomics using next-generation RAD sequencing of a non-
model organism. PLoS One 6: e19315.
117
HydroMedit 2014, November 13-15, Volos, Greece
Davey, J.W., Hohenlohe, P.A., Etter, P.D., Boone, J.Q., Catchen, J.M., Blaxter, M.L. 2011. Genome-
wide genetic marker discovery and genotyping using next-generation sequencing. Nat Rev Genet
17;12(7):499-510.
McCormack JE, Hird SM, Zellmer AJ, Carstens BC, Brumfield RT. 2012. Applications of next-
generation sequencing to phylogeography and phylogenetics. Mol Phylogenet Evol 66(2):526-538.
Hohenhohe, P.A., Bassham, S., Etter, P.D., Stiffler, N., Johnson, E.A., Cresko, W.A. 2010. Population
genomics of parallel adaptation in threespine stickleback using sequenced RAD tags. PLoS One
6:e1000862.
Palaiokostas, C., Bekaert, M., Khan, M.G.Q., Taggart, J.B., Gharbi, K., MacAndrew, B.J., Penman,
D.J. A novel sex-determining QTL in Nile tilapia (Oreochromis niloticus). Submitted
Palaiokostas, C., Bekaert, M., Davie, A., Cowan, M.E., Oral, M., Taggart, J.B., Gharbi, K.,
McAndrew, B.J., Penman, D.J., Migaud, H. 2013a. Mapping the sex-determination locus in the
Atlantic halibut (Hippoglossus hippoglossus) using RAD sequencing. BMC Genomics 14:556.
Palaiokostas C, Bekaert M, Khan MGQ, Taggart JB, Gharbi K, et al. 2013b. Mapping and validation
of the major sex-determining region in Nile tilapia (Oreochromis niloticus L.) using RAD
sequencing. PLoS One 8(7): e68389. doi:10.1371/journal.pone.0068389.
Peterson, B.K., Weber, J.N., Kay, E.H., Fisher, H.S., Hoekstra, H.E. 2012. Double Digest RADseq:
An inexpensive method for de novo SNP discovery and genotyping in model and non-model
species. PloS One 7(5): e37135. doi: 10.1371/journal.pone.0037135.
Sundquist, A., Ronaghi, M., Tang, H., Pevzner, P., Batzoglou, S. 2007. Whole-genome sequencing
and assembly with high-throughput, short-read technologies. PLos One 2(5): e484.
doi:10.1371/journal.pone.0000484.
118
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
ENVIRONMENTAL
MANAGEMENT
119
HydroMedit 2014, November 13-15, Volos, Greece
1
Laboratory for Local & Insular Development, Department of Environment, School of the
Environment, University of the Aegean, "Xenia" Building, University Hill, 81100, Mytilene, Lesvos
island, Greece
ABSTRACT
A new EU Directive, entering into force in August 2014, establishes a framework for maritime spatial
planning, aimed at promoting the sustainable growth of maritime economies, the sustainable
development of marine areas and the sustainable use of marine resources, using an ecosystem based
approach. To implement this EU policy and use MSPs as management tools there is a need for
practically applicable models and frameworks that can help decision makers and administration to
design robust plans for coastal activities, especially in islands, and direct limited financial resources
towards these activities where expected returns are the greatest. The method described here allows the
estimation of sustainability level in an area and the footprint of the activities (driving forces) in this
area, especially for marine fish farming in islands. For the purposes of the method developed (based
on UNEP‘s DPSR), the evaluation of the activities examines the performance per production unit, that
relates to the added value, the employment created at the area, water use, energy use, waste
production, and, the scale of the examined human activity compared to the carrying capacity of the
host area. Then a priority-setting method gives as results analytically rigorous and well-structured
decisions. With the assessment of the contribution of each human activity we can propose appropriate
policies for the sustainable development of an area and discover the best sites to establish an activity
and to minimise any possible conflicts between them (marine aquaculture here), and existing and
future users of the area.
1. Introduction
The high and rapidly increasing demand for maritime space for different purposes, as well as
the multiple pressures on coastal resources, require an integrated planning and management approach.
Such an approach has been developed in the Integrated Maritime Policy for the European Union
(IMP). The objective of the IMP is to support the sustainable development of seas and oceans and to
develop coordinated, coherent and transparent decision making in relation to the Union's sectoral
policies affecting the oceans, seas, islands, coastal and outermost regions and maritime sectors,
including through sea basin strategies or macro-regional strategies, whilst achieving good
environmental status as set out in Directive 2008/56/EC.
120
HydroMedit 2014, November 13-15, Volos, Greece
Blue Growth is the contribution of the EU‘s Integrated Maritime Policy to achieving the
goals of the Europe 2020 strategy for smart, sustainable and inclusive growth, and has identified five
(5) specific areas with a particular potential for growth where targeted action could provide an
additional stimulus: maritime, coastal and cruise tourism, blue energy, marine mineral resources,
aquaculture, and, blue biotechnology. The IMP identifies maritime spatial planning as a crosscutting
policy tool enabling public authorities and stakeholders to apply a coordinated, integrated and trans-
boundary approach. The application of an ecosystem-based approach will contribute to promoting the
sustainable development and growth of the maritime and coastal economies and the sustainable use of
marine and coastal resources (Chatziefstathiou & Spilanis, 2013).
However, plans for shared seas should be compatible to avoid conflicts and support cross-
border cooperation and investments. Common principles agreed at EU level can ensure that national,
regional and local maritime spatial plans are coherent. An effective spatial planning is an essential
condition in order to guarantee a long-lasting development without depleting the sea and therefore
ensuring a sustainable use of marine resources for future generations. The issue is particularly
important today, because the European Commission is launching the Action Plan for the Adriatic and
Ionian macro-region (EUSAIR), which will contribute to the definition of the development strategies
of the region and to the destination of resources and projects.
The Council Conclusions at the end of the Greek Presidency of the Council of the EU
(January 2014 - June 2014) on the Integrated Maritime Policy and its achievements and future
developments of the Maritime Agenda for Growth and Jobs stressed that an innovative and dynamic
agenda for maritime affairs can unlock the sustainable growth and job-creating potential of the blue
economy and contribute to Europe‘s economic recovery, while Blue Growth and the integrated
approach to maritime affairs can maximise the sustainable use of seas and coasts, ensuring at the same
time the health of their ecosystems.
The agreement of the co-legislators on a Directive for Maritime Spatial Planning, will
provide legal certainty for maritime investments and help manage the cumulative impacts of maritime
activities on the environment, activities that can be an essential source of innovation, sustainable
growth and employment for European regions. The sustainable growth of coastal and maritime
tourism, Europe‘s largest maritime activity, is essential to the wealth and well-being of coastal and
insular regions and Europe‘s economy, as well as the role of sustainable aquaculture in meeting the
EU demand for seafood while reducing pressure on wild fish stocks.
Usually not all the desired or available activities can assigned in a given area and a spatial
plan must prioritise them and assign these that have the maximum contribution to the sustainable
development of this area. Priority-setting task always involves trade-offs due to political, social,
cultural, financial, legal & technological constraints. In multi-stakeholder and multi-objective settings
the decision-making process is complex. The task is often made harder by incomplete or inaccurate
121
HydroMedit 2014, November 13-15, Volos, Greece
datasets. Decision makers will aim to adopt a procedure that is analytically robust, auditable,
transparent and understandable (Chatziefstathiou & Spilanis, 2006).
This method, developed by the Laboratory for Local & Insular Development (University of
the Aegean, Department of Environment), allows the estimation of sustainability level in a given
region (the islands) and the footprint of the activities (driving forces) in this area. The method has
been adapted to measure the contribution of marine fish farming to sustainable development of a
region (Aegean sea islands), letting us to proceed to faster implementation of ―Blue Growth‖ initiative
in Greece. The sustainability analysis calls for consensual setting of a "band of equilibrium" for a list
of indicators making possible to evaluate the sustainability of present situation in the target region and
to determine what is desirable and what is unacceptable (Spilanis et al., 2005).
The questionnaire had a set of questions about the value of the proposed indicators and also
on the factors that affect the performance and the sustainability of each installation separately - and
not the company or group of companies in total - so, if the company had more fish farms in the study
area (islands of Aegean sea) they had to complete one questionnaire for each one site. Totally, 31
questionnaires were sent by fax and e-mail to farms and finally 20 from them were answered. These
20 questionnaires relate to 80% of the fish farms at Aegean Sea and cover more than 90% of
production.
122
HydroMedit 2014, November 13-15, Volos, Greece
The quantitative and qualitative analysis of the answers gave us meaningful results, which
are briefly presented here by the following two (2) graphs (Graph of the Performance of Each
Assessed Aegean Fish Farm, and, Graph of the Total Performance of the Aegean Fish Farms),
showing that we have two different
group of farms, the one with
relatively worst socio-economic
status, but their total performance
considered satisfactory.
(Chatziefstathiou et al, 2012). Having
these data as a starting point we can
repeat the survey after a period of
time and estimate if their
development drives them to a more
sustainable status. Our initial research
determined that 14 factors should be
measured when the Status (State) of
an island region is estimated. These
measured with different indicators,
from which 9 indicators give the state
of economy, 11 indicators state of
society, and 19 indicators the state of
the environment. These indicators
were supplemented with a more
specialised series of indicators for use to productive aquatic ecosystems. According to the applied
theory, the evaluation of any human activity (Pressure) can be based on two criteria: 1) Performance
per unit of production, linked to economic performance (value added), employment generated per
unit, and the environmental burden (e.g. water consumption, energy, waste generation per unit), 2)
Scale of activity compared with the carrying capacity of the area. Marine aquaculture as a competitor
for the same limited resources should be judged on the basis of the efficiency of resource utilize, as
well as the environmental compatibility, as it has today an important role to play in rural development
and in reversing decline in fishing communities (Burbridge et al., 2001).
Common criteria should be used for evaluating all economic activities, and to include socio-
economic and environmental costs & benefits is a must. Our research concluded with the selection of
indicators for better measurement of the impact of marine fish farms, supplementing and adjusting the
existing ETNA‘s methodology (Spilanis et al, 2005; Chatziefstathiou et al, 2006). The 2 additional
environmental indicators cover the case in which at the study area there is activities that are taking
place in marine environment: a) Π20 - Recording appearance of alien species, cultivation or
farming of alien species, helps to estimate the pressure on marine ecosystems (e.g. from lessepsian
immigrants), and the threat that consists human activities for the biodiversity, by type of ecosystem,
and for the different ecosystems of the island, and, b) Π21 - quality of marine waters (marine
environment), helps to estimate the quality of marine waters, which is particularly important in the
case of marine fish farming, since it is the environment in which the production takes place, and is
highly influenced by them, while at the same time the farms influence them back.
According to the MSP Directive Member States shall take into consideration relevant interactions of
activities and uses. Possible activities and uses and interests may include aquaculture areas, fishing
areas, installations and infrastructures for the exploration-exploitation-extraction of oil, of gas and
other energy resources, of minerals and aggregates, and for the production of energy from renewable
sources, maritime transport routes and traffic flows, military training areas, nature and species
123
HydroMedit 2014, November 13-15, Volos, Greece
conservation sites and protected areas, raw material extraction areas, scientific research, submarine
cable & pipeline routes, tourism, and, underwater cultural heritage.
Also, mentioned that: <<(19) The main purpose of maritime spatial planning is to promote
sustainable development and to identify the utilisation of maritime space for different sea uses as well
as to manage spatial uses and conflicts in marine areas. Maritime spatial planning also aims at
identifying and encouraging multipurpose uses, in accordance with the relevant national policies and
legislation. In order to achieve that purpose, Member States need at least to ensure that the planning
process or processes result in a comprehensive planning identifying the different uses of maritime
space and taking into consideration long-term changes due to climate change.>>, and for that reason
states: <<(24) With a view to ensuring that maritime spatial plans are based on reliable data and to
avoid additional administrative burdens, it is essential that Member States make use of the best
available data and information by encouraging the relevant stakeholders to share information and by
making use of existing instruments and tools for data collection, such as those developed in the
context of Marine Knowledge 2020 initiative and Directive 2007/2/EC of the European Parliament
and of the Council.>>.
With our research a simple system is proposed that can monitor the ‗progress‘ of each local
society by calculating a number of indicators that can measure the state (S) and its change over time as
pressure (P) comes from mariculture (DF). This approach reflects the fact that SD has a different
content for different societies and comparisons can be misleading (Katranidis et al., 2003). Advantage
of this approach is that compares similar states of sustainability for the same society and yields
meaningful results (Chatziefstathiou et al., 2006).
Resources constraint is one of the major causes for conflicts between existing and future
users of an area, especially in the island regions, where the eligible areas for new development are
limited. For that reasons it is need to introduce a requirement for priority setting, which can be defined
as the task of selecting a subset of issues, policies or projects towards which limited resources will be
directed. The priority-setting task always involves trade-offs due to political, social, cultural, financial,
legal and technological constraints. The outcome of a priority-setting task can be the ranking or
scoring of each option‘s performance, or it can be the allocation of a fixed resource, often money,
amongst the alternative options. The ATS model (Hajkowicz & McDonald, 2006) emerged from the
need to ensure environmental priority-setting decisions were analytically rigorous and well structured.
Its primarily role is to guide the selection and weighting of evaluative criteria. Under the ATS model,
shown graphically below, environmental problems related to highly valued assets (asset value)
causing a large amount of damage (threat) but easily fixed (solvability) would be considered high
priority. Investment in these problems is likely to deliver greater public benefit and have the minimum
conflicts. Conversely, problem acting on low value asset, with low severity and hard or expensive to
solve would be low priority.
124
HydroMedit 2014, November 13-15, Volos, Greece
provide insights. Group clarification about the nature of different threats can lead to revisions.
ATS model adopted because shares much in common with the pressure state response (PSR)
framework, which is near to our method for measuring the sustainability, based to the DPSR
framework. When faced with a complex assemblage of data, managers can apply the model we
develop to help them select criteria for priority setting in a structured manner. Quality of judgements
on which projects or locations receive investment, and therefore which do not, will partly dictate the
success or failure of policy. Another key factor determining success is the ability to implement the
projects once selected. There is a need for practically applicable models and guidelines that can help
decision makers resolve trade-offs and direct limited resources towards projects or regions where the
expected returns are greatest. Priorities are dependent on people‘s preferences. Feedback from
decision makers can provide some insights but invariably carries bias. The decision procedure may
have worked well, but if it did not select a decision maker‘s un-stated preferences it may be evaluated
poorly. Different concepts of decision procedure apply to different fields of decision-making, e.g.
financial, environmental, and social. Hereafter we can identify some basic principles (Hajkowicz &
McDonald, 2006).
A sound decision procedure should be: a) Transparent. The reasons behind a particular
decision should be clear to all interested parties. This will require explicit statement of assumptions,
data and value preferences. b) Repeatable. With the same assumptions, input data and value
preferences the decision procedure should always yield an identical, or at least similar, result
regardless of who applies it and when. c) Involve comprehensive use of information. It should not be
possible to identify additional information that could have been used at low cost and within reasonable
time frames. d) Consistent with the decision maker‘s preferences. The decision maker will invariably
have preferences for some decision objectives over others. The procedure should reflect these
preferences in its final selection of options. e) Consistent with social, moral and legal obligations.
Decisions are never made in a policy, legal or social vacuum. There will generally exist social norms,
standards and legal obligations that set additional constraints around the selection of actions
(Hajkowicz & McDonald, 2006; Chatziefstathiou & Spilanis, 2006).
Meeting these requirements does not necessarily guarantee a ‗good‘ decision outcome. However, there
would be an expectation that decisions performing well on these criteria will typically lead to better
outcomes than others. Analysts developing decision procedures can use the requirements of
procedural rationality to design appropriate policy frameworks and tools and to minimise conflicts and
negative local reactions. The initial ATS model has been developed with this purpose - it aims to
improve procedural rationality. If applied appropriately, the structured approach to setting priorities in
e-ATS model will improve the procedural rationality of decisions.
The system of measurement is relatively simple, relying mainly on published or easily accessible data,
and this method could be used as tool capable in determining also the inappropriate sites for projects
in areas that initially had been considered suitable for development. Monitoring practices will ensure
that the established activities will not lead in dew time to deviation from the sustainability‘s targets,
and at the end of each policy period evaluation practices will determine whether the overall state of
the Sustainable Development of the area had been improved (Chatziefstathiou & Spilanis, 2012). To
diversify the activities we can proper assess the contribution of each activity and select the most
desirables. In the case that this is aquaculture, we can propose the policy on which we must continue
examine the possibility of establishing new or expanding existing farms, in a way that will support the
sustainable development of the given area (Chatziefstathiou & Spilanis, 2013).
References
Burbridge P., Hendrick V., Roth E., Rosenthal H. (2001): Social and economic policy issues relevant
to marine aquaculture. Journal of Applied Ichthyology, 17 (2001), 194 - 206
125
HydroMedit 2014, November 13-15, Volos, Greece
Chatziefstathiou M., Spilanis I. (2006). Combining a Method for Evaluating the Contribution of
Human Activities to the Sustainable Development of Islands and a Priority-setting Method to
Examine If and Where can Aquaculture Established in a Given Island. AquaMedit 2006, 3rd
International Congress on Aquaculture, Fisheries Technology & Environmental
Management, November 2006, GR.
Chatziefstathiou M., Spilanis I. (2013). Towards the Implementation of European Union's new
Integrated Maritime Policy in Greece: Blue Growth through Marine Aquaculture for the
Sustainable Development of the Islands. 6th "Water & Fish" International Conference, 12 -
14 June, University of Belgrade, Faculty of Agriculture, Belgrade, Serbia.
Chatziefstathiou M., Spilanis I., Koutsoubas D., Klaoudatos S. (2012). Assessment of the
Contribution of Marine Aquaculture to the Sustainable Development of Island Regions.
AQUA 2012 - Securing Our Future. 1 - 5 September, Prague, Czech Republic.
Chatziefstathiou M., Spilanis I., Vayanni H. (2006): Developing a Method to Evaluate the
Contribution of Different Human Activities to the Sustainable Development of Islands: Case
Study on Marine Aquaculture. Sustainable Management and Development of Mountainous &
Island Areas. International Conference. 29/9/2006 - 1/10/2006, Naxos
Hajkowicz S., McDonald G. (2006). The Assets, Threats & Solvability (ATS) Model for Setting
Environmental Priorities. Journal of Environmental Policy & Planning, Vol. 8, No. 1, March
2006, 87–102
Katranidis S., Nitsi E., Vakrou A. (2003): Social Acceptability of Aquaculture Development in
Coastal Areas: The Case of two Greek Islands. Coastal Management, 31: 37-53 2003
Spilanis I., Kizos T., Kondili J., Koulouri M., Vakoufaris H. (2005): Sustainability measurement in
islands: The case of South Aegean islands, Greece. International Conference on Biodiversity
Conservation & Sustainable Development in Mountain Areas of Europe, Ioannina, 20-
24/9/05
126
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT:
Results of the field experiments regarding to the consecutive plankton blooms which were observed
through end of March to middle of April, 2014 in Izmit Bay (the Marmara Sea) are presented. The
first sampling carried out on March 31, 2014 while the second one was realized on 14 April, 2014.
Water samples were taken from a station on the North coast of the bay. Nitrite (NO 2), Nitrate (NO3),
Ammonia (NH3), Silica (SiO2) and Orthophosphate (o-PO4) analysis were done via
spectrophotometrical methods. Plankton quantifying were done via Nageotte counting chamber using
inverted and light microscopes. In the first bloom Prorcentrum micans was the unique species (i.e.,
10,770,000 individual/L) while in the second one, Noctiluca scintillans was dominant (i.e., 55.6%,
620,000 individual/L) among 7 different species‘. Based on the results it is thought that nitrogen and
phosphorus increasing triggered excessive plankton abundance while sufficient amount silica already
presented. Plankton abundance generally increased from West to East direction on the Northern coast
of the bay. Untreated wastewater inputs and current regime can be responsible for the blooms of
plankton and their distributions in Izmit Bay.
Key words: Red-tide, Plankton bloom, Izmit Bay, Marmara Sea, Nutrient
*
Corresponding author: Halim Aytekin Ergül (halim.ergul@kocaeli.edu.tr, halim.ergul@gmail.com)
1. Introduction
Izmit Bay is a semi-enclosed coastal ecosystem located in the most industrialized area of the Marmara
region. There are 1.5 million inhabitants living in Kocaeli Province surrounding Izmit Bay. Industrial
activities have been increasing rapidly since the 1980s around the bay and it receives a considerable
amount of domestic and industrial discharge from its drainage basin. It is reported that Izmit Bay
which is a part of the Marmara Sea, seriously affected by eutrophication (Morkoç et al., 2001; Okay et
al., 2001) and recently a plankton bloom occurred in the region (Ergül et al., 2010). In this study, it
was aimed to report two consecutive plankton blooms accompanied with mucilage formation in
March and April 2014 from Izmit Bay.
127
HydroMedit 2014, November 13-15, Volos, Greece
plankton chamber were used for pre-identification under an inverted microscope while plankton were
alive. Then samples were fixed using 4% formaldehyde solution for better identification and
quantifying. Before counting procedure, the samples were centrifuged at 800 rpm for 15 minutes,
supernatant were removed and residues were used for quantifying via Nageotte counting chamber
under a light microscope. Results were given as individual per liter.
Table 1. Plankton species distributions and abundance in the surface water of Izmit Bay on
March 31 and April 14, 2004
NO2-N, NO3-N, NH3-N, SiO2 and o-PO4-P concentrations of the samples were given in Table 2 and
Figure 3. Measured values represent relatively increased nitrite, ammonia and reactive phosphate
concentrations in the second bloom. It should be noted that plankton diversity was higher in second
bloom than the first one.
Figure 2. Interpolated maps of plankton distributions a) in the first (March 31, 2014) and b) in
the second bloom (April 14, 2014) in Izmit Bay. In the first bloom Prorcentrum micans was the
unique species, while in the second one, Noctiluca scintillans was dominant. These maps were
plotted based on surface water observations throughout the bay.
128
HydroMedit 2014, November 13-15, Volos, Greece
Table 2. NO2-N, NO3-N, NH3-N, SiO2 and o-PO4-P concentrations and standard deviations in
surface water samples from Northern-East coast of Izmit Bay on March 31 and April 14, 2004
In terms of Si/N ratio, diatom growth is limited by dissolved silica when the ratio is less than 1 in
marine waters (Redfield et al., 1963). Although, much lower Si/N values (i.e., 0.17 on March 31 and
0.10 on April 14, 2014) were determined in both blooms, relatively higher SiO2 concentrations were
also measured (Table 2). Based on these results it is thought that increase in both nitrogen and
phosphorus, triggered excessive plankton abundance while sufficient amount silica has already
presented in the bay. Since NH3 concentrations were relatively high, low NO3/DIN (dissolved
inorganic nitrogen) ratios were calculated. Comparison with a previous study (Aktan et al., 2005)
showed that total nitrogen and o-PO4 concentrations significantly increased in the present study (i.e.,
15 and 1018 folds respectively). In another study (Ergül et al., 2010), which reported red-tide in the
Izmit Bay, lower o-PO4 concentrations were determined (i.e., 0.6 mg/L). On the other hand, in the
same study, 55 x 108 individual/L P. micans was reported from the surface water of Izmit Bay.
129
HydroMedit 2014, November 13-15, Volos, Greece
6 0.08
12x10
12000000 12.00
0.07
10x10 6
10000000 10.00
0.06
8x10 6
8000000
0.05 8.00
6x10 6
6000000 0.04 6.00
6
0.03
4x10
4000000 4.00
0.02
2x10 6
2000000 2.00
0.01
0 0 0.00
Total plankton NO2-N NO3-N PO4-P SiO2 NH3-N NO3/DIN
0.014
0.012
0.010
0.008
0.006
0.004
0.002
0.000
NO3/DIN
Plankton abundance generally increased from West to East direction on the Northern coast of the bay
(Figure 2). It is known that current velocities in Izmit Bay decreases from West to East (Balkis, 2003)
and treated or untreated wastewaters were mainly discharged from North coast of the bay (Ergül et al.,
2013). Thus, it is thought that untreated wastewater inputs and current regime can be responsible for
the plankton blooms and their distributions in Izmit Bay.
Acknowledgements
This study was funded by the Kocaeli University Scientific Research Projects Unit (Grant No: KOU-
BAPB 2009/040). The authors wish thank to Mr. Burhan Özkara for his help during sampling.
130
HydroMedit 2014, November 13-15, Volos, Greece
References
Aktan, Y., Tüfekçi, V., Tüfekçi, H., Aykulu, G., 2005. Distribution patterns, biomass estimates and
diversity of phytoplankton in İzmit Bay (Turkey). Estuarine, Coastal and Shelf Science 64,
372-384.
Balkis, N., 2003. The effect of Marmara (Izmit) Earthquake on the chemical oceanography of Izmit
Bay, Turkey. Marine Pollution Bulletin 46, 865-878.
Ergül, H.A., Belivermiş, M., Kılıç, Ö., Topcuoğlu, S., Çotuk, Y., 2013. Natural and artificial
radionuclide activity concentrations in surface sediments of Izmit Bay, Turkey. J. Environ.
Radioact. 126, 125-132.
Ergül, H.A., Küçük, A., Terzi, M., 2010. A Study on the Red Tide of Izmit Bay-June 2010, in: Ozturk,
B. (Ed.), Marmara Denizi 2010, Istanbul, pp. 464-468.
Morkoç, E., Okay, O.S., Tolun, L., Tüfekçi, V., Tüfekçi, H., Legoviç, T., 2001. Towards a clean İzmit
Bay. Environment International 26, 157-161.
Okay, O.S., Tolun, L., Telli-Karakoc, F., Tufekci, V., Tufekci, H., Morkoc, E., 2001. Izmit Bay
(Turkey) ecosystem after Marmara earthquake and subseqnent refinery fire: the long-term
data. Marine Pollution Bulletin 42, 361-369.
Redfield, A.C., Ketchum, B.H., Richards, F.A., 1963. The influence of organisms on the composition
of seawater, in: Hill, M.N. (Ed.), The Sea, 2. John Wiley & Sons, New York, pp. 26-77.
131
HydroMedit 2014, November 13-15, Volos, Greece
Kuzminova N. S.
Department of ichthyology, Institute of Biology of the Southern Seas, 299011, Nakhimov av. 2,
Sevastopol, Russia
ABSTRACT
The complex state of mass specie of Black Sea fish, high body pickarel Spicara flexuosa catched in
bays with different level and character of pollution was studied. Population (size and weight) and
morphophysiological (hepatosomatic, gonadosomatic indexes) characteristics of fish were higher in
cleaner waters – Karantinnaya and Balaklavskaya bays.
1. Introduction
In the past decade, scientific information on the status of the Black Sea waters and their
inhabitants is very contradictory. In this regard, it is interesting and necessary to investigate the state
of one of the last links of the food chain – fish- for a long period.
The main part of fish in the Black Sea coastal catches is presented by red mullet, horse
mackerel, scorpion fish and high body pickerel (Oven et al., 2008; data of Sevastopol inspection of
protection and reproduction of fish stocks and the fishing regulation). The first two species are
commercial. High body pickerel is secondary food-fish which means that it contributes little to natural
resources depletion; it is caught together with herring, anchovy (Probatov & Moskvin, 1940).
Recently horse mackerel, red mullet and high body pickarel accounts 9 to 15%, 27 to 42% and 6,9 to
16,7% respectively of all the species in catches in the bottom snares installed by Institute of Biology
of the Southern Seas.
High body pickarel - mass specie of coastal areas of the Black and Mediterranean Seas,
eastern site of the Atlantic Ocean, desalted waters of the lower reaches of rivers are not frequented by
this specie. It matures at a young age, but spawning as a whole is typical for 3-4 years old creatures.
Spawning takes place in the coastal zones of the Black Sea: coast of the Crimea, the Caucasus,
Bulgaria and Romania. Eggs are spawned on the algae and bottom. Fecundity of fish of 8-16 cm long
is from 6075 to 63127 eggs. Distinctive characteristics of S. flexuosa are protoginia and sexual
dimorphism. High body pickarel in the Black Sea mainly feeds on small coastal planktonic and
benthic invertebrates (polychaetes, molluscs), algae, some small fish and fish eggs. In the
Mediterranean Sea it feeds mainly crustaceans and their larvae, sometimes sponges, shellfish larvae,
rarely foraminifera. The longevity of females is much shorter than that of males (Probatov &
Moskvin, 1940; Svetovidov, 1964; Salekhova, 1979; Oven et al., 2000).
The aim of this paper is to monitor the modern state of high body pickarel Spicara flexuosa
Rafinesque caught in Sevastopol bays with different levels of pollution; hence two purposes of
research we have put: to analyze the size-mass and morphophysiological parameters of fish in the
period 2008 - 2012.
132
HydroMedit 2014, November 13-15, Volos, Greece
133
HydroMedit 2014, November 13-15, Volos, Greece
also: the values of the most of antioxidant enzymes activity in the sexual organs of Black Sea fish in
the 2000s were more than 2 times as high as those indices in 1990s. This is the result of adaptation to
the existence conditions in the contaminated environment for a long period, which makes normal
development of sexual products and the ability of reproduction possible (Rudneva & Kuzʹ-minova,
2011).
4. Conclusion
On the basis of complex data obtained it can be concluded that the main population and
morphophysiological characteristics of high body pickarel were higher in more cleaner waters –
Karantinnaya and Balaklavskaya bays.
References
Alemov S.V. (2010). Long-term changes of macrozoobenthos of Balaklavskaya bay. Scientific notes
of Ternopol national unіversity of V. Gnatiuk name. Serіes of Biology. Special issue:
Hydroecology 3 (44), 6−9 [in Russian].
Boltachev A.R., Karpova E.P. (2012). The species composition of icthyofauna of the coastal area of
Sevastopol. Marine ecological journal 2 (11), 10−27 [in Russian].
Eremeev V.N., Mironov O.G., Alemov S.V., Burdiyan N.V., Shadrina T.V., Tikhonova E.A., Volkov
N.G., Istomina M.I. (2008). Preliminary results of the assessment of oil pollution of the
Kerch strait after the ships accident in 11 of November of 2007. Marine ecologіcal journal 3
(7), 15−24 [in Russian].
Kovrigina N.P., Popov M.A. (2006). The dynamic of hydro-chemical indexes and thermohaline
characteristics of the waters of Balaklavskaya bay. In: Abstracts of reports international of
intern. conf., dedicated to 135th anniversary of the IBSS «Problems of biological
oceanography of the XXI century». Sevastopol, Ukraine, рр. 97 [in Russian].
Kopitov Y.P., Minkina N.I., Samyshev E.Z. (2010). The level of contamination of water and
sediments of Sevastopol Bay (the Black Sea). In: Control systems of environment: Scientific
works. Sevastopol. National Academy of Sciences of Ukraine, Marine Hydrophysical
Institute, pp.199−208 [in Russian].
Kuzminova N.S., Lebed D.A., Zav'yalov A.V. (2010). Population, morphophysiological and
biochemical parameters of high body pickerel Spicara flexuosa (Rafinesque) in the modern
period. In: Materials of V Intern. scient.-pract. conf. «Man and Animals». Astrakhan. pp.
71−77 [in Russian].
Kuzminova N.S., Skuratovskaya E.N. (2008). Sex and age- features of stability of marine scorpion
fish Scorpaena porcus L. in relation to anthropogenic factor. In: Control systems of
environment. Tools, information technologies and monitoring: Scientific works. Sevastopol.
National Academy of Sciences of Ukraine, Marine Hydrophysical Institute, pp. 414−420 [in
Russian].
Kuzminova N.S. (2011 a). Population characteristics of Black Sea horse mackerel in the modern
period. In: Scientific papers devoted 90th anniversary of the Novorossiysk Marine Biological
Station of prof. V.M. Arnoldi name «The state of the shelf of Black and Azov seas ecosystem
under anthropogenic influence». Krasnodar. pp. 93−100 [in Russian].
Kuzminova N.S. (2011 b). Population characteristics of high body pickarel Spicara flexuosa in the
modern period. In: Scientific works «Actual problems of modern biology and human health».
Nikolaev national university of V.O. Suhomlinskiy name. Nikolaev. 11, рр. 149−154 [in
Russian].
Kuzminova N.S., Skuratovskaya E.N. (2011). State of shore rockling Gaidropsarus mediterraneus
(L.) (Gadiidae), inhabiting Sevastopol bays with different levels of pollution. Ribne
gospodarstvo of Ukraine 1 (72), 3−9 [in Russian].
Kuzminova N., Rudneva I., Salekhova L., Shevchenko N., Oven L. (2011). State of Black Scorpion
fish (Scorpaena porcus L., 1758) inhabited coastal area of Sevastopol region (Black Sea) in
1998-2008. Turkish J. of Fisheries and Aquatic Sciences 11(1), 101–111.
Kuzminova N.S. (2012 a). The current state of young mass commercial species of fish in the coastal
zone of the Black Sea. Vestnik of Zaporozskogo national university. Bіologіcal sciences 3,
57−65 [in Russian].
Kuzminova N.S. (2012 b). The index of spleen of mass species of fish from the Black Sea bays with
different levels of pollution. In: Materials of Russian conf. of young scientists and
international experts, dedicated 90th anniversary of the construction of the first scientific ship
134
HydroMedit 2014, November 13-15, Volos, Greece
135
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1. Sampling sites of high body pickarel Spicara flexuosa in Sevastopol bays (Sevastopol,
Ukraine, Black Sea).
Table 1. Size, weight and morphophysiological indices of high body pickarel from different
Sevastopol bays in 2008 – 2012.
Karantinnaya bay Alexandrovskaya bay Balaklavskaya bay
Age Parameter
female male female male female male
SL, sm 9.8±0.1 9.0±.016* 9.4±0.32 8.5±0.14 – –
136
HydroMedit 2014, November 13-15, Volos, Greece
137
HydroMedit 2014, November 13-15, Volos, Greece
UNDERWATER TRAILS:
INNOVATIVE ACTIVITY IN SITHONIA (CHALKIDIKI, GREECE)
Skoufas G.1*, Tsirika A.2
1.
Department of Fisheries Technology and Aquacultures, Α.Σ.Δ.Η.Th., N. Miltiadi 1, 63200, Nea
Moudania, Greece
2.
School of Agriculture, Faculty of Agriculture, Forestry and Natural Environment, A.U.Th.,
University Campus, 54124, Thessaloniki, Greece
ABSTRACT
Underwater trails constitute an innovative approach in the field of recreational diving (SCUBA diving
and snorkeling). Their establishment, although it has taken place both in the tropics and in temperate
regions, is the first implementation of such an action in Greece and especially in the Municipality of
Sithonia (Chalkidiki). The development of the underwater trails was based on the selection of a route
accessible to all levels of diving training. Across each trail, ten sites of biological interest are marked.
The creation of underwater trails aims at the enhancement of diving tourism, providing diving safety
and contributing to environmental awareness.
ΚΑΣΑΓΤΣΗΚΔ ΓΗΑΓΡΟΜΔ:
ΚΑΗΝΟΣΟΜΟ ΓΡΑΖ ΣΟΝ ΓΖΜΟ ΗΘΧΝΗΑ (ΥΑΛΚΗΓΗΚΖ, ΔΛΛΑΓΑ)
ημφθαξ Γ.1*, Σζζνίηα Α.2
1.
Σιήια Σεπκμθμβίαξ Αθζείαξ ηαζ Τδαημηαθθζενβεζχκ, Α.Σ.Δ.Η.Θ., Ν. Μζθηζάδδ 1, 63200, Νέα
Μμοδακζά, Δθθάδα
2.
Σιήια Γεςπμκίαξ, πμθή Γεςπμκίαξ, Γαζμθμβίαξ ηαζ Φοζζημφ Πενζαάθθμκημξ, Α.Π.Θ.,
Πακεπζζηδιζμφπμθδ, 54124, Θεζζαθμκίηδ, Δθθάδα
Πενίθδρδ
Σα ηαηαδοηζηά ιμκμπάηζα απμηεθμφκ ιία ηαζκμηυιμ πνμζέββζζδ ζημκ πχνμ ηδξ ηαηάδοζδξ ακαροπήξ
(SCUBA diving ηαζ snorkeling). Ζ εθανιμβή ημοξ, ακ ηαζ έπεζ θάαεζ πχνα ηυζμ ζε ηνμπζηέξ
εάθαζζεξ υζμ ηαζ ζε εφηναηεξ πενζμπέξ, είκαζ πνςημπυνα βζα ηδκ Δθθάδα ηαζ εζδζηυηενα βζα ημκ
Γήιμ ζεςκίαξ (Υαθηζδζηή). Ζ δδιζμονβία ημο ηαηαδοηζημφ ιμκμπαηζμφ ααζίζηδηε ζηδκ επζθμβή
ιίαξ δζαδνμιήξ, πνμζζηήξ ζε υθα ηα ηαηαδοηζηά επίπεδα εηπαίδεοζδξ, ηαηά ιήημξ ηδξ μπμίαξ
επζθέβμκηαζ δέηα ζδιεία αζμθμβζημφ εκδζαθένμκημξ ζηα μπμία έβζκε ζήιακζδ. Ζ δδιζμονβία ηςκ
ηαηαδοηζηχκ ιμκμπαηζχκ απμζημπεί ζηδκ ακάπηολδ ημο ηαηαδοηζημφ ημονζζιμφ, πανέπμκηαξ
ηαηαδοηζηή αζθάθεζα ηαζ ζοιαάθθμκηαξ ζηδκ πενζααθθμκηζηή εοαζζεδημπμίδζδ.
1. Δζζαβςβή
138
HydroMedit 2014, November 13-15, Volos, Greece
Τπάνπμοκ πμθθέξ πνμηάζεζξ ηαζ ζπέδζα ζπεηζηά ιε ημκ ηνυπμ αλζμπμίδζδξ ηδξ πανάηηζαξ γχκδξ ζε
ζοκάνηδζδ ιε ημκ ηαηαδοηζηυ ημονζζιυ. Ο ηαηαδοηζηυξ ημονζζιυξ εα πνέπεζ κα είκαζ ιζα
ηαεμδδβμφιεκδ δνάζδ, ηυζμ βζα ηδκ απμθοβή αηοπδιάηςκ ηςκ πνδζηχκ, υζμ ηαζ βζα ηδκ απμθοβή
ηοπυκ ηαηαζηνμθχκ ημο θοζζημφ οπμεαθάζζζμο πθμφημο ηαζ ηδξ πμθζηζζηζηήξ ηθδνμκμιζάξ. Ζ πνήζδ
ηςκ ηαηαδοηζηχκ δζαδνμιχκ ή ηαηαδοηζηχκ ιμκμπαηζχκ ιπμνεί κα έπεζ ςξ πνήζηεξ ηυζμ ημοξ δφηεξ
πμο ηάκμοκ αοηυκμιδ ηαηάδοζδ (SCUBA diving) υζμ ηαζ αοημφξ πμο πναβιαημπμζμφκ εθεφεενδ
ηαηάδοζδ (snorkelers) (Plathong et al. 2000). Ζ εθανιμβή ηδξ παναπάκς δνάζδξ ζηδκ αοηυκμιδ
ηαηάδοζδ ηαζ ημκ ηαηαδοηζηυ ημονζζιυ έπεζ ςξ απμηέθεζια ηδκ μνεμθμβζηή ηαζ αεζθυνμ δζαπείνζζδ
ηδξ αζμπμζηζθυηδηαξ ηαζ ημο οπμεαθάζζζμο πθμφημο (Delgado 2011). Πανάθθδθα, δ ηαεμδδβμφιεκδ
ηαηάδοζδ ιέζς ηςκ ηαηαδοηζηχκ δζαδνμιχκ πανμοζζάγεζ έκα δζηηυ υθεθμξ: πενζμνίγεζ ηοπυκ
ηαηαζηνμθέξ ζημ θοζζηυ πενζαάθθμκ απυ ημοξ δφηεξ, εκχ πανέπεζ βκχζεζξ ημο οπμεαθάζζζμο
πενζαάθθμκημξ ηαηεοεφκμκηαξ ηδκ πνμζμπή ηςκ οπμανφπζςκ επζζηεπηχκ ζε ζοβηεηνζιέκα αζμθμβζηά
ή πμθζηζζιζηά ζημζπεία (Rangel et al. 2014).
Ακ παναθθδθζζημφκ ηα ηαηαδοηζηά ιμκμπάηζα ιε ηζξ πενζαίεξ δζαδνμιέξ (π.π. ιμκμπάηζα ζημ αμοκυ ή
ζημ δάζμξ), ιπμνεί ηακείξ κα δζαπζζηχζεζ υηζ πθέμκ υθμ ηαζ ιεβαθφηενμ πμζμζηυ ηςκ επζζηεπηχκ
επζθέβεζ ηζξ ηαεμνζζιέκεξ δζαδνμιέξ ζηζξ πενζαίεξ επζζηέρεζξ ημο. Σα ηίκδηνα ηδξ επζθμβήξ ηςκ
πνμηαεμνζζιέκςκ δζαδνμιχκ απυ ημοξ επζζηέπηεξ ιπμνεί κα είκαζ πμθοπμίηζθα, υπςξ βζα
πανάδεζβια: μζ επζζηέπηεξ ζε έκα πχνμ παναιέκμοκ ζοβηεκηνςιέκμζ, είκαζ ζπεηζηά εφημθα κα
δζαπεζνζζηεί ηακείξ ηδ θένμοζα ζηακυηδηαξ ιζαξ πενζμπήξ, μ επζζηέπηδξ κμζχεεζ αζθάθεζα ηαζ πμθθά
άθθα. Δπζπθέμκ, μζ πνμηαεμνζζιέκεξ γχκεξ επίζηερδξ είκαζ πνςηανπζηήξ ζδιαζίαξ, εζδζηά ζε
δζαπεζνζζηζηά πνμβνάιιαηα πνμζηαηεουιεκςκ πενζμπχκ (Davis & Tisdell 1996).
Έκα απυ ηα ζδιακηζηυηενα ζημζπεία ζηδκ αοηυκμιδ ηαηάδοζδ (SCUBA diving), αθθά ηαζ ζηδκ
εθεφεενδ (snorkeling) είκαζ δ πνμηαηαδοηζηή εκδιένςζδ (briefing). Ζ πνμηαηαδοηζηή εκδιένςζδ
απμηεθεί έκα πμθφηζιμ ενβαθείμ ηυζμ ζηδ δζελαβςβή αζθαθχκ ηαηαδφζεςκ, υζμ ηαζ ζηδκ αθθαβή ηδξ
ζοιπενζθμνάξ ηςκ δοηχκ, έκακηζ ηδξ οπμεαθάζζζαξ αζμπμζηζθυηδηαξ (Barker & Roberts 2004;
Krieger & Cladwick 2013).
ημπυξ ηδξ πανμφζαξ ιεθέηδξ είκαζ δ εθανιμβή βζα πνχηδ θμνά ζηδκ Δθθάδα εκυξ πζθμηζημφ
ζπεδίμο ηαηαδοηζηχκ ιμκμπαηζχκ. Σμ εκδζαθένμκ πμο πανμοζζάγεζ δ παναπάκς ιεθέηδ έβηεζηαζ ζημ
βεβμκυξ υηζ δζενεοκάηε πανάθθδθα δ εθανιμζιέκδ πνήζδ ηςκ ηαηαδοηζηχκ ιμκμπαηζχκ ηυζμ ζηδκ
αοημηαεμδδβμφιεκδ οπμανφπζα πενζήβδζδ, υζμ ηαζ ζηδκ πνμηαηαδοηζηή εκδιένςζδ (briefing).
Ζ ακάβηδ οθμπμίδζδξ ημο ζοβηεηνζιέκμο ένβμο ζημκ δήιμ ζεςκίαξ (Υαθηζδζηή, Δθθάδα) πνμέηορε
απυ ηδκ ζδζαίηενα ακαπηοζζυιεκδ δναζηδνζυηδηα ζηδκ πενζμπή ηδξ ηαηάδοζδξ ακαροπήξ. Δκδεζηηζηά
ακαθένεηαζ υηζ, ζηδκ εονφηενδ πενζμπή δζηαζμδμζίαξ ημο δήιμο ζεςκίαξ, δναζηδνζμπμζμφκηαζ
πενζζζυηενα απυ 5 ηαηαδοηζηά ηέκηνα. Γζα ηδκ οθμπμίδζδ ημο ζοβηεηνζιέκμο ένβμο επζθέπεδηακ
ηέζζενζξ (4) ηαηαδοηζηέξ δζαδνμιέξ: ιία δοηζηά ηδξ πενζμκήζμο, ζημκ Σμνςκαίμ Κυθπμ, ζηδ κήζμ
Κέθοθμ (Μανιανάξ), ιία ζηδκ ακαημθζηή πθεονά, ζημκ ζββζηζηυ Κυθπμ, ζηδκ πενζμπή ημο Αβίμο
Νζημθάμο, ηαζ δφμ ζημ κυηζμ άηνμ, ζηζξ πενζμπέξ Ένζηα ηαζ Νέιεζδ, μζ μπμίεξ βεςβναθζηά
ανίζημκηαζ ακάιεζα ζημ Πυνημ Κμοθυ ηαζ ζημ Καθαιίηζζ.
139
HydroMedit 2014, November 13-15, Volos, Greece
Σα παναηηδνζζηζηά ηςκ επζθεβιέκςκ πενζμπχκ πανμοζζάγμκηαζ ζημκ αηυθμοεμ πίκαηα (Πίκαηαξ 1).
Γζα ηδκ επζθμβή ηςκ ηαηαδοηζηχκ δζαδνμιχκ δζελήπεδζακ ιία ζεζνά απυ δζενεοκδηζηέξ ηαηαδφζεζξ.
ημ πθαίζζμ ηδξ πνχηδξ πζθμηζηήξ εθανιμβήξ ηςκ ηαηαδοηζηχκ δζαδνμιχκ, επζθέπεδηακ πενζμπέξ μζ
μπμίεξ πανμοζζάγμοκ δζαθμνεηζηά παναηηδνζζηζηά (Πίκαηαξ 1). ε ηάεε ηαηαδοηζηή δζαδνμιή
επζθέπεδηακ δέηα επζιένμοξ ζδιεία αζμθμβζημφ εκδζαθένμκημξ, ηα μπμία ηαζ ζδιάκεδηακ ζε πνχηδ
θάζδ, εκχ ζε δεφηενδ θάζδ πνμαθέπεηαζ δ ημπμεέηδζδ ηςκ ηαηαδοηζηχκ πζκαηίδςκ (ηα ζδιεία ηδξ
ηάεε ηαηαδοηζηήξ δζαδνμιήξ πανμοζζάγμκηαζ ζημκ Πίκαηα 2). Συζμ ηαηά ηδ δζάνηεζα ηδξ
οθμπμίδζδξ, υζμ ηαζ ζηδκ ηεθζηή θάζδ ηδξ οθμπμίδζδξ, πνμαθέπεηαζ δ θςημβνάθδζδ ηαζ δ
αζκηεμζηυπδζδ ηυζμ ηδξ ζοκμθζηήξ δζαδνμιήξ, υζμ ηαζ ηςκ επζιένμοξ ζημζπείςκ ηδξ
αζμπμζηζθυηδηαξ.
3. Απμηεθέζιαηα
Με βκχιμκα ηα ααζμηζηά ηαζ ηα αζμηζηά ζημζπεία έβζκε δ επζθμβή 4 ηαηαδοηζηχκ δζαδνμιχκ ζηδ
ζεςκία Υαθηζδζηήξ, δοηζηά ηαζ ακαημθζηά ηδξ πενζμκήζμο. Γζα ηάεε ιία απυ ηζξ ηαηαδοηζηέξ
δζαδνμιέξ επζθέπεδηακ δέηα (10) ζδιεία, ηα μπμία πανμοζζάγμοκ αζμθμβζηυ εκδζαθένμκ ηαζ ηα μπμία
πανμοζζάγμκηαζ ζημκ Πίκαηα 2.
Σμ ηνίημ ζηέθμξ ηδξ οθμπμίδζδξ ηδξ δνάζδξ πενζθαιαάκεζ ηδκ πνμηαηαδοηζηή εκδιένςζδ (briefing).
Ζ πνμηαηαδοηζηή εκδιένςζδ ιπμνεί κα πενζθαιαάκεζ δφμ ζημζπεία, ηα μπμία ιε ηδ ζεζνά ημοξ κα
απεοεφκμκηαζ ζε δφμ μιάδεξ πνδζηχκ. Ζ πνχηδ αθμνά ζηα ηαηαδοηζηά ηέκηνα, ηαζ ζηδκ πνμηεζιέκδ
πενίπηςζδ ζηυπζιδ είκαζ δ πανμοζίαζδ κα είκαζ ζε δθεηηνμκζηή ιμνθή αθμφ εα θαιαάκεζ πχνα ζηζξ
εβηαηαζηάζεζξ ημο ηαηαδοηζημφ ηέκηνμο ηαζ εα οπάνπεζ έκα εηηεκέζηενμ ηείιεκμ. Πανάθθδθα υιςξ,
εα πνέπεζ κα θδθεεί οπυρδ ηαζ δ πενίπηςζδ ηςκ δοηχκ πμο εα επζζηεθεμφκ ηδκ ηαηαδοηζηή πενζμπή
ιε ζδζςηζηή πνςημαμοθία. Θα έπεζ βίκεζ πνυαθερδ κα οπάνπμοκ πθαζηζημπμζδιέκα θφθθα (slates), ηα
140
HydroMedit 2014, November 13-15, Volos, Greece
μπμία εα δίκμοκ πθδνμθμνίεξ ζημκ οπμανφπζμ πενζδβδηή βζα ηάεε ζδιείμ ηδξ πνμηεζκυιεκδξ
ηαηαδοηζηήξ δζαδνμιήξ.
Paracentrotus lividus
4. ογήηδζδ
Ζ αοηυκμιδ ηαηάδοζδ είκαζ έκαξ ζδζαίηενα ακαπηοζζυιεκμξ ημιέαξ ημο πανάηηζμο ημονζζιμφ, ηαζ
πθέμκ βζα πμθθέξ πχνεξ μ ηαηαδοηζηυξ ημονζζιυξ απμηεθεί έκα ζδιακηζηυ πμζμζηυ ημο αηαεάνζζημο
εεκζημφ εζζμδήιαημξ (Musa & Dimmock 2012). Ζ εκίζποζδ ημο ηαηαδοηζημφ ημονζζιμφ,
πνμτπμεέηεζ δφμ ααζζηά ζημζπεία: ημ πνχημ ζημζπείμ αθμνά ζηδ δδιζμονβία εκυξ εεζιμεεηδιέκμο
πθαζζίμο θεζημονβίαξ, ζημ μπμίμ εα δίκεηαζ ζδζαίηενδ έιθαζδ ζηδκ αζθάθεζα, ηαζ ημ δεφηενμ
ζδιακηζηυ ζημζπείμ αθμνά ζηδκ πνμαμθή ημο ηαηαδοηζημφ πνμσυκημξ, ημ μπμίμ ιπμνεί κα
πανμοζζάγεζ ζημζπεία αζμθμβζημφ, πμθζηζζηζημφ ή άθθμο εκδζαθένμκημξ (ππ. βεςθμβζημφ). ηδκ
οθμπμίδζδ ηαζ δζάεεζδ εκυξ ηαηαδοηζημφ πνμσυκημξ, ζδζαίηενμ εκδζαθένμκ πανμοζζάγεζ ημ
δδιμβναθζηυ πνμθίθ ηδξ μιάδαξ ζηδκ μπμία απεοεφκεηαζ ημ ένβμ (Davis & Tisdell, 1996; Musa et al.
2010). Γεκζηά, ημ ηαηαδοηζηυ πνμσυκ εα πνέπεζ κα απεοεφκεηαζ ζε υζμ ημ δοκαηυ πενζζζυηενμοξ
πνήζηεξ ηαζ εονφηενμ αβμναζηζηυ ημζκυ. Μέζα ζε αοηυ ημ πθαίζζμ ζδεχκ, βζα ηδκ οθμπμίδζδ ημο
ζοβηεηνζιέκμο ένβμο πνμηάεδηε ημ ιέβζζημ αάεμξ ηςκ 18 ιέηνςκ, ημ μπμίμ ακηζζημζπεί ζημ πνχημ
επίπεδμ εηπαίδεοζδξ δοηχκ ακαροπήξ (Open Water SCUBA Diver, PADI). ηδκ πανμφζα ιεθέηδ
δυεδηε επίζδξ έιθαζδ ζηδκ πνμαμθή ηςκ βκςζηχκ αβκχζηςκ, δδθαδή ζε ιμνθέξ οπμεαθάζζζςκ
μνβακζζιχκ, μζ μπμίμζ ακ ηαζ είκαζ μζηείμζ ζημοξ δφηεξ, εκημφημζξ αοημί βκςνίγμοκ εθάπζζηα βζα ηδ
αζμθμβία ημοξ ή βεκζηυηενα ηδ θοζζηή ημοξ ζζημνία. Χξ εκδεζηηζηυ πανάδεζβια ακαθένεηαζ δ
141
HydroMedit 2014, November 13-15, Volos, Greece
πενίπηςζδ ημο πθςνμθφημοξ Codium bursa, ημ μπμίμ πμθφ ζοπκά ακαθένεηαζ θακεαζιέκα απυ ημοξ
δφηεξ ακαροπήξ ςξ ζπυββμξ.
Μία εκδζαθένμοζα πνμζέββζζδ ζημκ πχνμ ημο ηαηαδοηζημφ ημονζζιμφ είκαζ δ δδιζμονβία
ηαηαδοηζηχκ ιμκμπαηζχκ ή δζαδνμιχκ, ηα μπμία εα είκαζ πνμζζηά είηε ιε αοηυκμιδ ηαηάδοζδ
(SCUBA diving) είηε ιε εθεφεενδ ηαηάδοζδ (snorkeling) (Plathong et al. 2000; Wegner et al. 2006;
Rangel et al. 2014). Σμ ζοβηεηνζιέκμ ζπέδζμ δδιζμονβίαξ ηαηαδοηζηχκ ιμκμπαηζχκ ζημκ Γήιμ
ζεςκίαξ απμηεθεί ιία ηαζκμηυιμ δνάζδ πμο εθανιυγεηαζ βζα πνχηδ θμνά ζηδκ Δθθάδα. Σμ ένβμ, ακ
ηαζ ζε πζθμηζηή θάζδ, είκαζ δοκαηυ κα ακαααειίζεζ ζδιακηζηά ηζξ πνμζθενυιεκεξ ηαηαδοηζηέξ
οπδνεζίεξ ηαζ κα αμδεήζεζ ζηδκ ακάπηολδ ημο ηαηαδοηζημφ ημονζζιμφ. Πανάθθδθα, δ δδιζμονβία
ηαηαδοηζηχκ ιμκμπαηζχκ απμηεθεί ιία ζδιακηζηή πνμζέββζζδ ζηδκ πενζααθθμκηζηή εηπαίδεοζδ ηαζ
ζηδκ πενζααθθμκηζηή εοαζζεδημπμίδζδ. Αλίγεζ κα πνμηαεεί δ δδιζμονβία εκυξ δζηηφμο ηαηαδοηζηχκ
ιμκμπαηζχκ ηα μπμία εα ακαδείλμοκ ηδκ οπμανφπζα αζμπμζηζθυηδηα. Μία άθθδ εκδζαθένμοζα
πνμμπηζηή ηςκ ηαηαδοηζηχκ ιμκμπαηζχκ είκαζ πςξ εα ιπμνμφζακ κα απμηεθέζμοκ ηζξ πνυδνμιεξ
ιμνθέξ ηςκ Πενζμπχκ Ονβακςιέκδξ Ακάπηολδξ Καηαδοηζηχκ Πάνηςκ (Π.Ο.Α.Κ.Π.), υπςξ αοηέξ
μνίγμκηαζ ζημκ Νυιμ 3409 (Φ.Δ.Κ. 273/2005).
Δοπανζζηίεξ
Ζ οθμπμίδζδ ημο ένβμο πνδιαημδμηήεδηε απυ ημκ Γήιμ ζεςκίαξ (Υαθηζδζηή), ιε ακάδμπμ ημο
ένβμο ηδκ ΑΜΒΗΟ Α.Δ. Οζ ζοββναθείξ εα ήεεθακ κα εοπανζζηήζμοκ ζδζαίηενα ημκ δήιανπμ η.
Ηςάκκδ Σγίηγζμ βζα ημ αιένζζημ εκδζαθένμκ πμο επέδεζλε. Σμ ηεπκζηυ ηιήια ηδξ δνάζδξ
οπμζηδνίπηδηε απυ ηδκ ηαηαδοηζηή μιάδα Northern Greece Underwater Explorers (NGUE).
Βζαθζμβναθία
Άνενμ ζε πενζμδζηυ:
Barker N.H.L., Roberts C. M. (2004). Scuba diver behaviour and the management of diving impacts
on coral reefs. Biological Conservation, 120, 481-489.
Davis D., Tisdell C. (1996) Economic Management of Recreational Scuba Diving and the
Environment. Journal of Environmental Management , 48, 229-248.
Goffredo S., Picinetti C., Zaccanti F. (2004). Volunteers in Marine Conservation Monitoring: a study
of the distribution of seahorse carried out in collaboration with recreational scuba divers.
Conservation Biology, 18(6), 1492-1503.
Krieger J.R., Chadwick N.E. (2013) Recreational diving impacts and the use of pre-dive briefings as a
management strategy on Florida coral reefs. Journal of Coastal Conservation 17, 179-189.
Mola F, Shafaei F, Mohamed B. (2012). Tourism and the environment: issues of concern and
sustainability of southern part of the Caspian Sea Coastal Areas. Journal of Sustainable
Development 5(3), 2-15
Musa G., Seng W. T., Thirumoorthi, Abessi M. (2010). The influence of SCUBA dives's personality,
experience and demographic profile n their underwater behavior. Tourism in Marine
Environments, 7(1), 1-14.
Musa G., Dimmock K. (2012). SCUBA Diving tourism introduction to special issue. Tourism in
Marine Environments 8(1/2), 1-5.
Plathong S., Inglis G.J., Huber M.E. (2000). Effects of self-guided snorkeling trails on corals in
tropical marine park. Conservation Biology, 14, 1821–1830.
142
HydroMedit 2014, November 13-15, Volos, Greece
Rangel M.O., Pita C.B., Concalves J.M.S., Oliveira F., Costa C., Erzini K. (2014) Deloping self-
guided scuba dive routes in the Algarve (Portugal) analysing visitors' perceptions. Marine
Policy 45, 194-203.
Wegner E. Tonioli F.C., Cabral D.Q. (2006). Underwater Trails: a new possibility of marine tourism.
Journal of Coastal Research, Special issue 39, 990-993
Leeworthy V.R, Bowker JM, Hospital J, Stone E. Projected participation in marine recreation: 2005 &
2010. National Survey on Recreation and the Environment. Coastal and Ocean Resource
Economics. Maryland: NOAA National Ocean Service, Silver Spring; 2005.
Πναηηζηά ζε ζοκέδνζα:
Delgado J.P (2011).The impact on and opportunities arising from tourism to submerged sites.
UNESCO Scientific Colloquium on Factors Impacting the Underwater Cultural Heritage
Proceedings pp 54-57.
143
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
The European standards for fish sampling in lakes determined the sampling protocols and
methodology developed in the course of fish and fishery monitoring for Prespa lakes. The sampling
procedure was based on stratified random sampling. The sampled area has been divided in strata (3
strata for Greater Prespa Lake) and random sampling is performed within each depth stratum. The
specially designed multi mesh size gillnets are 30 m long and 1, 5 m deep. The gillnets are composed
of 12 different mesh size nets varying from 5-55 mm. Sampling was developed in period between 1 st–
15th September, when there are no fish to spawn and epilimnium temperature usually exceeds 15 oC.
The requirements of the WFD in relation to fish communities were considered in relation to assessing
status, surveillance monitoring and measuring ‗sustainable reproductive successes and proposals are
made on WFD assessments of species composition, abundance and age classes.
Key words: fish sampling, European standards, monitoring, Nordic nets
Corresponding author: Spase Shumka (sprespa@gmail.com)
1. Introduction
The Prespa Lakes Basin is a high altitude system (850-2600 m) with a catchment area of over
2.500 km2; it covers parts of the territories of Albania, the Former Yugoslav Republic of Macedonia
and Greece. The basin is home to nearly 30.000 people with the majority residing in the Former
Yugoslav Republic of Macedonia. The Region has little industry and the main source of income is
agriculture which is estimated to employ about 75% of the work-force.
The ecosystem and the biodiversity of the Region are worth special mention. The geography, soil
types and climate coupled with the relatively low human population and impact in the basin has
resulted in high species diversity with significant proportion of endemic species.
The Region has been recognized as a European and Global Hotspot of Biodiversity, not only because
of the sheer number of species and habitats present, but also due to their quality, such as rarity and
conservation significance. The most striking feature of the Prespa Lake Watersheds‘ Biodiversity is its
enormous richness and heterogeneity.
Twenty-three fish taxa have been identified in the Prespa Lakes. Thirteen of these are introduced, and
9 of the remaining 10 (native) are endemic to the Prespa Lakes. At first sight, the proportion of
endemism in the fish populations of the Prespa Lakes seems remarkable. It should be mentioned
however, that, according to Crivelli et al. (1997), the taxonomic position of a number of taxa
occurring in the Prespa Lakes remains doubtful. At present, only the barbel Barbus prespensis would
appear to be undoubtedly endemic to both lakes, Micro and Macro Prespa (Dupont & Lambert, 1986;
Economidis, 1989; Catsadorakis et al., 1996; Crivelli et al., 1996). Prespa barbel presents species with
some economic importance in the Prespa watershed, with medium interest for fisheries (Kapedani &
Hartmann 2009).
144
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1 Sub basins considered for fish sampling and Relative and absolute fish species composition
represented in the total catch at the Albanian Part of Lake Prespa during the sampling campaign in
October 2013
According to Economidis (1992) only two endemic species are classified as ―Endangered‖ (Barbus
prespensis and Salmo peristericus), which is an important criterion used for identification of priority
species for conservation of animals in Prespa Region. Both species are listed as ―Vulnerable‖ species
on the IUCN Red List of Threatened Animals (Globally threatened species and Regional-European
threatened species). Further, Prespa barbel is represented in Prespa Lakes in three countries (the
Former Yugoslav Republic of Macedonia, Albania, Greece) which is important for transboundary
collaboration, unlike the Pelister stream trout (Salmo peristericus) that can be only found in the
adjacent rivers of Prespa basin (River Braychinska and its tributaries, Aghios Germanos stream, and
others) (Crivelli et al., 2008).
Out of determined 11 native and 12 introduced fish species. In this lake 9 fish species are endemics: A.
prespensis Karaman, 1924, A. belvica Karaman, 1924, B. prespensis Karaman, 1924, C. prespensis
Karaman, 1924, C. meridionalis Karaman, 1924, P. prespensis Karaman, 1924, R. prespensis
Karaman, 1924, S. peristericus Karaman, 1938, and S. prespensis Fowler, 1977.
The European standard for gillnet fishing (EN 14757) was developed primarily in shallow north
European lakes (Appelberg et al. 1995) and further to that unification of the sampling protocols (CEN
standards) was a very important step for the comparability of lake fish data (Achleinter, 2012).
Fish data were collected during the period of 16-28 October 2013 using benthic gillnets following
the Norden gillnet standardized protocol (CEN, 2005). Random samplings were performed in different
145
HydroMedit 2014, November 13-15, Volos, Greece
depth strata and respectively 0-3, 3-6 and 6-12 m during the period considered without reproducing
species in the lakes area.
The random sampling and the number of nets set in each stratum has been guided by the CEN, 2005
document and in relation to lakes depth and area, it was divided in two sub basins. In each sub basin
there has been set 32 nets as it is shown in the Figure 1. In total there has been set 64 benthic gillnets.
The set of gillnets was organized in evening, and along with that the water temperature, transparency
and coordinates are measured. The benthic multi-mesh gillnets were 30 m long and 1.5 m high, and
composed of 12 different panels with mesh sizes ranging between 5 and 55 mm knot to knot in a
geometric row. The captured fish were identified to species level, counted and weighed in grams.
Catch per unit effort (CPUE) was calculated for each net/night as a measure of relative abundance.
CPUE was calculated by dividing the total number of species collected in each net by the number of
hours of fishing. The CPUE for all nets in different strata site were averaged to compute the average
CPUE for each site for each net. A literature review considered past studies with analytical
approaches to the assessment of freshwater fish communities, particularly those relevant to the
requirements of CSBL and the WFD
Out of determined 11 native and 12 introduced fish species, during our fish campaining
were recorded the following fish species: A. prespensis, A. belvica, B. prespensis, C.
prespensis, C. meridionalis,P. prespensis, R. prespensis, Salmo peristericus, Squalius
prespensis C. carpio, C. gibelio, L. gibosus, R. amarus, P. parcva and T. tinca. Other species
Anguilla Anguilla, Ctenopharyngodon idella, Gambusia holbrooki, Hypophthalmichthys
militrix, Salmo letnica, Silurus glanis, Prabramis pekinensis, Onchorynchus mykiss listed in
various sources were not part of recorded assemblage.
.
146
HydroMedit 2014, November 13-15, Volos, Greece
Figure 3. CPUE expressed in biomass (g/m2) in percentage per species of total catch per sub-
basin (BPUE) at Albanian Part of Lake Prespa during the sampling campaign in October
2013.
In both sub basins, SB1 and SB2 bitterling is representing a dominant species in terms of number of
individuals particularly at the depth strata 0-3 and 3-6 m with 51% of total number of individuals. The
second most present species in terms of numbers from the alien‘s one is stone moroko that for entire
sampled area represents 15%.
Differences between two sampled sub-basins are only present in the biomass/m2 where dominant
species for SB1, bleak and bitterling are presented with almost the same biomass as bitterling in the
SB2. As for the third dominant species native roach, both SB are showing similar values. Regarding
the following figure which is expressing the catch per unit effort in numbers of individuals per square
meter of net, the actual recorded differences are only in the values of Prespa spirlin and carp.
147
HydroMedit 2014, November 13-15, Volos, Greece
Figure 3. CPUE expressed in number of individuals/m2 in percentage per species of total catch per
sub-basin (NPUE) at Albanian Part of Lake Prespa during the sampling campaign in October 2013
Bleak is endemic to Prespa Lake. It is the most commercial one and shows stability in Lake Prespa.
This species is major prey of fish eating birds and is also a target species of fishermen and local
people. Thanks to its life-history strategy it can cope with such high predation mortality. On both
sides of the lake it is the dominant economic resource in terms of fishery. Based on the data from this
sampling campaign presence of bleak (from 4% at the depth strata 0-3 m and 13% at the depth strata
6-12 m) comparing with previous records (Crivelli et alt., 2006) reveals better species status in entire
stock on Albanian side of the Lake.
The most valuable commercial fish in Lake Prespa is carp. It‘s the most important commercial species
at the transboundary area. Other sensitive species Prespa barbell and Prespa nase are also less
distributed with hypotheses that it is indicative of a failure in the reproduction or development due to
water quality and water oscillation with direct impact on species spawning grounds as riverine and
gravel habitats.
The Prespa sprilin shows a tendency of satisfied presence. In case of an accelerated eutrophication
obviously this species will face unpredictable problems due to the fact that primary this species is
generally a riverine species with adaptations to this standing water body where it spawns also.
Bitterling and stone moroko are introduced species and there are with no commercial value. Both
species have a negative impact on native species (e.g. Prespa spirlin), that need to be tested. This
species is much more numerous in Micro Prespa than in Macro Prespa, especially from the beginning
of this century.
Following the increased presence of alien species in terms of number of individuals of bitterling, stone
moroko, pumpkinseed etc, the role as aliens in relation to natives in Prespa Lakes is poorly
understood. The WFD status class has been discussed with a number of people and it seems to be
general agreement that the presence of one or more established alien species is certainly not ‗natural‘
and is likely to affect the WFD status class in a detrimental way. The pumpkinseed in the data is well
present and based on experiences and personal communication with local fisherman it has increased in
Prespa Lake. During this and previous MMGN surveys it was evident from the local fishermen that
148
HydroMedit 2014, November 13-15, Volos, Greece
caught specimens of this species were thrown back in to the lake and according to their endurance
they survive almost all. Other recorded species like tench seems to not establish stable populations in
Prespa Lake. During this sampling campaign this species was caught only at Albanian side.
Being an intensive agricultural area Prespa Lakes watershed presence of additional nutrient load as
well as other agrochemicals, combined with lake‘s habitats disruption and high fishing pressure are
representing the main threats to the fish biodiversity. In addition presence of the high number of alien
fish species and fish eating predatory birds leads towards intervention as in the local strategies for
biodiversity protection as well in the legislative part in the countries shearing the lake.
4. Conclusions
The present monitoring survey and data collected serve as a proof for the usefulness of applying
standardized lake fish parameters to assess the ecological status of lakes and support the development
of integrated monitoring of entire lake. Further to that following European experiences development
and setting ecological quality based on different metrics.
Based on very specific conditions of the Lakes Prespa with significant events of water level
oscillations there are needed additional studies in order to determine the response of the fish fauna
(particularity spawning) to the alteration of hydromorphology.
The number of benthic gill nets used to sample all species, following the current delineation in two
sub basins in the lakes was significantly relevant with lake area. For the future monitoring we propose
use of 32 nets in three depth state that is in full line with EU standard.
Use of both native endemic species Barbus prespensis and Chondrostoma prespensis as indicators for
the water quality due to particular spawning requirements along with fishes as entire component is
serving a very good indicator for assessment of water under the WFD.
References
Achleitner, D., Gassner, H., Luger, M. 82012): Comparison of three standardised fish sampling
methods in 14 alpine lakes in Austria. Fisheries Management and Ecology, Volume 19, Issue 4, pages
352–361
Appelberg M., Berger H.-M., Hesthagen T., Kleiven E., Kurkilahti M., Raitaniemi J. (1995):
Development and intercalibration of methods in Nordic freshwater fish monitoring. Water, Air and
Soil Pollution 85, 401–406.
Catsadorakis, G., M. Malakou & A.J. Crivelli (1996). The Prespa barbel Barbus prespensis, Karaman
1924 in the Prespa lakes basin, north-western Greece. Tour du Valat, Arles, 79 pp. (also in Greek
language)
CEN (2003). Water Quality – Sampling of fish with electricity. European standard. Ref. No. EN
14011.
CEN 2005a Water quality—guidance on the scope and selection of fish sampling methods. Brussels.
CEN
CEN 2005b Water quality—sampling of fish with multi-mesh gill nets. Brussels. CEN.
Dupont, F., Lambert, A., (1986). Etude des communaut´es de monog`enes Dactylogyridae parasites de
Cyprinidae du LacMikri Prespa (Nord de la Gr`ece). Description de trois nouvelles esp`eces chez un
Barbus end´emique: Barbus cyclolepis prespensis Karaman, 1924. Ann. Parasitol. Hum. Comp. 61:
597–616.
Economidis, P. S. 1989. Distribution pattern of the genus Barbus (Pisces, Cyprinidae) in the
freshwaters of Greece. Trav. Mus. Hist. nat. ‗Grigore Antipa‘ 30: 223–229.
EU Water Framework Directive, (2000). Directive of the European parliament and of the council
2000/60/EC establishing a framework for community action in the field of water policy. Official
Journal of the European Communities 22.12.2000 L 327/1
Crivelli, A. (2010). Pilot Application of the Transboundary Monitoring System for the Prespa Park:
Fish and Fisheries Monitoring, Final report, Society for the Protection of Prespa – Tour du Valat,
Agios Germanos
Economidis, P. S. (2005). Barbatula pindus, a new species of stone loach from Greece (Teleostei:
Balitoridae). Ichthyological Exploration of Freshwaters 16(1), 67–74.
149
HydroMedit 2014, November 13-15, Volos, Greece
Freyhof, J. (2010). Threatened freshwater fishes and mollusks of the Balkans, Potential impacts of the
hydropower projects. ECA Watch Austria & Euronatur, 81 pp.
Kapedani, R., Hartmann, W. 2009. "Aspects of Institutional Set-up for Transboundary Fisheries
Management in the Prespa Lakes, and Livelihoods and Fisheries in the Prespa Lakes Basin".
Consultant Report. 1-30.
Kottelat, M. and Freyhof, J. (2007). Handbook of European Freshwater Fishes. Kottelat Cornol,
Switzerland and Freyhof, Berlin.
150
HydroMedit 2014, November 13-15, Volos, Greece
Cu AND Zn CONTENT IN WILD SEA BREAM AND SEA BASS FROM THE
PAGASITIKOS GULF (EASTERN MEDITERRANEAN)
Abstract
This study deals with the copper (Cu) and zinc (Zn) content in muscle tissue of Sparus aurata and
Dicentrarchus labrax, fished in the Pagasitikos Gulf. The metal content in biological tissues (muscle,
gills and liver) were determined using the USEPA Method 3052. Determinations of Cu were carried
out using a graphite furnace atomic absorption spectrometer (GF AAS), while for Zn these were
carried out with a flame atomic absorption spectrometer (Flame AAS). Statistical analysis revealed
significant differences in metal content among tissues for both studied species. Heavy metal contents
were found to be substantially higher in the liver of sea bream and sea bass. Furthermore, the
estimated daily intake of Cu and Zn was calculated and an assessment of the health risk to consumers
was made. The results showed that heavy metal contents in the edible part (muscle) of fish caught in
the Pagasitikos Gulf did not exceed permissible limits and therefore their consumption should be
considered safe for human health.
Key words: Copper, Zinc, Sparus aurata, Dicentrarchus labrax, Eastern Mediterranean
*Corresponding author: Nikolaou Marina (maze55@live.com)
1. Introduction
Aquatic environmental quality, and how humans may be affecting this, is an area which has
received increasing attention in recent years. Heavy metals pollution has begun to grow at an alarming
rate and now constitutes a significant global problem (Malik et al. 2010). Heavy metals cannot
degrade, and they are continuously deposited and incorporated into water, sediments, and aquatic
organisms (Linnik & Zubenko 2000). Anthropogenic activities, such as increased population,
urbanisation, industrialisation and agricultural practices, have further aggravated this problem (Gupta
et al. 2009).Various metals are naturally present in the aquatic environment via geochemical processes
and anthropogenic industrial sources, where these can be accumulated along the food chain (Castritsi-
Catharios et al. 2014). Accumulation of trace elements in aquatic organisms is one of the most striking
effects of pollution in aquatic system.
Fish are widely used as bio-indicators of marine pollution by metals (Evans et al. 1993).
According to the mechanisms of absorption, regulation, storage and excretion of trace metals, the
various fish tissues used for analyses, present varying bioaccumulation rates and due to their different
roles in the above processes, their analysis lead to results with special interest and interpretation
(Catsiki & Strogyloudi 1999).
The city of Volos, its port and industrial area, results in the Pagasitikos Gulf having
toxicological significance of anthropogenic contaminants. Food production, packaging facilities,
wood units, and metal processing plants, including a cement plant, are the area‘s predominant
activities (Tsangaris et al. 2013, Giannakopoulou & Neofitou 2014). The metals that have been
examined in this study are used in industrial activities and also exist in the background shale of the
Gulf (Salomons & Förstner 1984). Although Cu and Zn are essential minerals for humans, overdosing
on these beneficial elements can also cause health problems (Gale et al. 2004).
The purpose of this study was to examine the content of Cu and Zn in different tissues of
wild Sparus aurata and Dicentrarchus labrax collected from Pagasitikos Gulf and to assess whether
the edible parts of these fish are acceptable for human consumption.
151
HydroMedit 2014, November 13-15, Volos, Greece
and fork length (FL), accurate to 0.1 cm, and total weight (TW) to the nearest 0.01 g were recorded (S.
aurata: n = 5, TW = 395.10 - 478.23 g, TL = 27.00 - 30.20 cm & D. labrax: n = 5, TW = 439.85-
513.04 g, TL = 33.40 - 38.10 cm).
Metals content were determined using USEPA Method 3052 (1996) for microwave-assisted
acid digestion of siliceous and organically based matrices. All samples of fish tissues were
homogenised and stored in a dry environment until digestion. For total dissolution, 9 ml of
concentrated HNO3 were added to 0.5 g of biological tissue in acid-cleaned Teflon vessels. The
vessels were sealed and placed in a closed, high-pressure microwave system (Multiwave 3000, Anton
Paar, Austria). After digestion, the samples were diluted with ultra-pure water in 50 ml volumetric
flasks and stored in polypropylene sample bottles at 4 ºC until further analysis.
Quantitative determinations of Cu were carried out with a graphite furnace atomic absorption
spectrometer (GF AAS), while for Zn they were carried out with a flame atomic absorption
spectrometer (Flame AAS), using standard addition methods.
The estimation of human health risk from consumption of wild fish from the Pagasitikos Gulf
was assessed according to Onsanit et al. (2010). The human health risk was assessed and then
comparisons of mean metal contents with internationally established food safety standards for edible
fish tissues were made.
One-way ANOVA was used to determine differences in metal contents among the tissues for
both studied species.
3. Results
Figure 1 shows the results for copper and zinc content in all tissues separately for each
species. In all cases, the maximum contents of heavy metals appeared in the liver of both species. For
sea bream, the maximum contents of Cu and Zn were 23.08 and 65.20 mg kg−1, respectively. For sea
bass
Figure 1. Mean±SD contents of Cu and Zn in muscle, liver and gills of sea bream and sea bass
(mg kg-1 dry wt).
these contents were 64.30 and 95.44 mg kg−1. Furthermore, the lowest mean contents of Cu and Zn
was detected in the muscle of both species studied. The lowest mean contents of Cu and Zn in sea
152
HydroMedit 2014, November 13-15, Volos, Greece
bream were 3.04 and 17.18 mg kg-1, respectively. For sea bass these contents were 7.46 mg kg-1 and
21.29 mg kg-1.
One-way ANOVA showed significant differences in heavy metals content among the tissues
for both studied species (p<0.001).
For an average consumer in Greece, the estimated daily intake of Cu and Zn from the
consumption of wild sea bream and sea bass was lower than the Allowed Daily Intake (ADI) and the
Reference Doses (RfD) of these metals (JECFA 2003, Ikem & Egilla 2008, Onsanit et al. 2010,
USEPA 2012). In all cases, the hazard quotient (HQ) for both studied species was less than 1 (Table
1).
Table 1: Daily intake of Cu and Zn (κg kg-1 bw d-1) by consumers through consumption of wild fish
in the Pagasitikos Gulf. (EDI: Estimated Daily Intake, ADI: Allowed Daily Intake, (RfD) Reference
Doses, HQ: Hazard Quotient).
4. Disscussion
Comparing the mean contents of Cu and Zn in the tissues of the two species fished in the
same location, higher contents of the metals were observed in D. labrax. Levels of heavy metals in the
environment, size (weight - length) of individuals and stage of development are all considered to be
important factors affecting the content of metals in aquatic organisms. Type of fish also seems to be a
very important factor for the accumulation of elements in fish tissues. This could be due to differences
in physiology between the two species (Kalantzi et al. 2013).
In all cases maximum contents of heavy metals were detected in liver tissue of sea bream and
sea bass. The accumulation of elements in different fish tissues depends on the function of each tissue,
the uptake route, the physiology of the fish species and behavioural factors such as habitat use and
feeding habits, as well as the degree of contamination (Alam et al. 2002). Metals and trace elements
chiefly accumulate in metabolically active tissues (Saha et al. 2006, Adhikari et al. 2009). The liver
has been shown to be the main storage tissue for metals. It is well known that a great deal of
metallothionein induction occurs in the liver tissue of fish (Alam et al. 2002, Cogun et al. 2006,
Ferreira et al. 2008). The differences between metal contents in the different tissues may be a result of
their differing capacity to induce metal-binding proteins such as metallothioneins (Canli & Atli 2003).
In assessing health risks for human consumption of these fish, a comparison with limits for
Cu and Zn in edible parts of fish which have been established by various national or international
authorities showed that both species had lower contents than the values set for safety standards.
Furthermore, a comparison of estimated daily intake (EDI) with allowed daily intake and reference
doses (RfD) demonstrates that there is no obvious risk for human health from Cu and Zn through
consumption of S. aurata and D. labrax caught in this area of Greece.
In all cases the contents of the metals in the muscle tissue of both studied species were lower
than the maximum limits allowed for food (Kalantzi et al. 2013).
References
Adhikari S., Ghosh L., Rai S.P., Ayyappan S. (2009). Metal concentrations in water, sediment, and
fish from sewage fed aquaculture ponds of Kolkata, India. Environmental Monitoring and
Assessment 159, 217-230.
153
HydroMedit 2014, November 13-15, Volos, Greece
Alam M.G.M., Tanaka A., Allinson G., Laurenson L.J.B., Stagnitti F., Snow E.T. (2002). A
comparison of trace element concentrations in cultured and wild carp (Cyprinus carpio) of
Lake Kasumigaura, Japan. Ecotoxicological Environmental Safety 53, 348-354.
Canli M., Atli G. (2003). The relationships between heavy metal (Cd, Cr, Cu, Fe, Pb, Zn) levels and
the size of six Mediterranean fish species. Environmental Pollution 121, 129-136.
Castritsi-Catharios J., Neofitou N., Vorloou A.A. (2014). Comparison of heavy metals concentrations
in fish samples from three fish farms (Eastern Mediterranean) utilizing antifouling paints.
Toxicological and Environmental Chemistry, DOI: 10.1080/02772248.2014.943226 (in
press).
Catsiki V.A., Strogyloudi E. (1999). Survey of metal levels in common fish species from Greek
waters. Science of the Total Environment 238, 387-400.
Cogun H.Y., Yuzereroglu T.A., Firat O., Gok G., Kargin F. (2006). Metal concentrations in fish
species from the Northeast Mediterranean Sea. Environmental Monitoring and Assessment
121, 431-438.
Evans D.W., Dodoo D.K., Hanson P.J. (1993). Trace elements concentrations in fish livers.
Implications of variations with fish size in pollution monitoring. Marine Pollution Bulletin 6,
329-334.
Ferreira M., Caetano M., Costa J., Pousão-Ferreira P., Vale C., Reis-Henriques M.A. (2008). Metal
accumulation and oxidative stress responses in cultured and wild, white sea bream from
Northwest Atlantic. Science of the Total Environment 407, 638-646.
Gale N.L., Adams C.D., Wixson B.G., Loftin K.A., Huang Y.W. (2004). Lead, zinc, copper, and
cadmium in fish and sediments from the Big River and Flat River Creek of Missouri's Old
Lead Belt. Environmental Geochemistry and Health 26, 37-49.
Giannakopoulou L., Neofitou C. (2014). Heavy metal concentrations in Mullus barbatus and Pagellus
erythrinus in relation to body size, gender, and seasonality. Environmental Science and
Pollution Research 21, 7140-7153.
Gupta A., Rai D.K., Pandey R.S., Sharma B. (2009). Analysis of some heavy metals in the riverine
water, sediments and fish from river Ganges at Allahabad. Environmental Monitoring and
Assessment 157, 449-458.
Ikem A., Egilla J. (2008). Trace element content of fish feed and bluegill sunfish (Lepomis
macrochirus) from aquaculture and wild source in Missouri. Food Chemistry 110, 301-309.
Joint Food and Agriculture Organization/World Health Organization Expert Committee on Food
Additives (JECFA) (2003). Summary and Conclusions of the 61st Meeting of the Joint FAO/
WHO Expert Committee of Food Additives. JECFA/61/Sc, Rome, Italy, 10, 1-22.
Kalantzi I., Black K.D., Pergantis S.A., Shimmield T.M., Papageorgiou N., Sevastou K., Karakassis I.
(2013). Metals and other elements in tissues of wild fish from fish farms and comparison
with farmed species in sites with oxic and anoxic sediments. Food Chemistry 141, 680-694.
Linnik P.M., Zubenko I.B. (2000). Role of bottom sediments in the secondary pollution of aquatic
environments by heavy metal compounds. Lakes and Reservoirs: Research and Management
5, 11-21.
Malik N., Biswas A.K., Qureshi T.A., Borana K., Virha R. (2010). Bioaccumulation of heavymetals
in fish tissues of a freshwater lake of Bhopal. Environmental Monitoring and Assessment
160, 267–267.
Onsanit S., Ke C., Wang X., Wang K.J., Wang W.X. (2010). Trace elements in two marine fish
cultured in fish cages in Fujian province, China. Environmental Pollution 158, 1334-1342.
Saha M., Sarkar S.K., Bhattacharya B. (2006). Interspecific variation in heavy metal body
concentrations in biota of Sunderban mangrove wetland, northeast India. Environment
International 32, 203-207.
Salomons W., Förstner U. (1984). Metals in the hydrocycle. Springer Berlin Heidelberg, New York,
pp 352.
Tsangaris C., Kaberi H., Catsiki V.A. (2013). Metal levels in sediments and transplanted mussels in
Pagasitikos Gulf (Aegean Sea, Eastern Meditteranean). Environmental Monitoring and
Assessment 185, 6077-6087.
United States Environmental Protection Agency (USEPA) (1996). Method 3052: microwave assisted
acid digestion of silicious and organically based matrices, physical/ chemical methods.
USEPA, Washington, DC.
United States Environmental Protection Agency (USEPA) (2012). Fish Tissue Screening Levels. U.S.
EPA, Region 3, Philadelphia, PA.
154
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
Khalkaie River is located in the northern part of Iran enters international Anzali wetland, Iran. In this
study, the effects of trout farm effluents on the water quality parameters and self-purification in
Khalkai River were investigated. Four trout farms and eight stations were selected. Physicochemical
characteristics and nutrients of water were monitored monthly in a five-month period. All the
parameters showed fluctuations at different stations. BOD, COD, nitrite and nitrate of water had
significant differences between farm and control stations (p<0.05). Temperature, phosphate and
dissolved oxygen showed significant monthly differences (p< 0.05). These results were due to the
effects of trout farms and the self-purification of river. These factors have had changes during
different months, which the main reason of that are changing environmental conditions and severity of
rainbow trout farms activities.
Keywords: aquaculture, biochemical oxygen demand, chemical oxygen demand, Khalkaie River,
nitrate, phosphate, self-purification.
1. INTRODUCTION
In recent years, construction of fish farms along rivers has increased the discharging of effluent from
fish farms into streams, causing a loss of balance in the water ecosystems (Sani, 1997). Aquaculture
effluents enter rivers and streams without any purification process. Papatryphon et al, 2005 and
Sindilariu and Alabaster found that there was for every ton of fish produced, 150-300 kg unused food
and 250-300 kg stool is discharged into the water system (Philips & Ross, 1985). Salmon farm
effluent consists mainly of three pollutants; 1: suspended solids (fish faeces and food residues); 2:
dissolved substance by the fish is released to the environment that contains more organic carbon and
soluble nitrogen compounds (ammonium and urea) and 3: residual chemicals from drug therapy,
antibiotics and various fungicides. The first two categories cause chemical disturbances in the water
(Camargo and Pulatsu, 2007). Khalkai River located in Masal city is one of the branches of Anzali
wetland which is important due to its entry into this international lagoon. The construction of fish
farms besides Khalkai River is common and every year the establishment of new farms is growingly
increased. Thus, regarding the importance of Khalkai River whether from environmental point of view
or in terms of its role and impact on the local and national economy, the impact of rainbow trout farm
effluents on Khalkai River can be specified and water quality of river can be assessed by measuring
some physicochemical properties of water in different areas of the river and comparing them in
different locations of those rainbow trout farms.
155
HydroMedit 2014, November 13-15, Volos, Greece
measure BOD in the sampling station, the water samples were taken to the lab by Winkler bottles and
reagents manganese sulfate, alkali iodide and sulfuric acid were added to stabilize the dissolved
oxygen. In order to measure other parameters (COD, NO 3, NO2 and or PO4) the water were taken in
polyethylene containers and the samples were then transported to the laboratory in the possible
shortest time. Measurement of COD and BOD5 was conducted by using standard method (standard
method, 1996). Measurement of dissolved oxygen was conducted by using Winkler method (Standard
method, 2005) and TDS by TDS-meter (Hughes, 1978; Tarzwell, 1965). Measuring NO 2, NO3 and
PO4 were performed by spectrophotometric method by adding appropriate chromogenic reagents
(Jenway UV.Vis-610, 5 England) (standard method, 1996). Data analyzed using the SPSS software
version 17. In this software, non-parametric Kruskal-Wallis test and Mann Whitney test were used to
study the significant difference s of physico-chemical data and between the scrutiny of study stations.
Comparison of the calculated data and drawing graphs were done with Excel software packages.
Figure1. Location of sampling stations and trout farms on the Khalkaie River.
3. Results
Mean values of water physicochemical parameters of Khalkai River for each station in five month are
given in Table 1. Mean minimum control and farm temperature at in the month of May and June have
been 14.15 and17.05°C, respectively, and the maximum in control and farm temperature in August
have been19 and 20 °C, respectively. The Analysis showed that there was a significant difference in
control and farm temperatures between stations and different seasons (p < 0.05). One of the most
important hydrochemical parameters of water is DO which decreased in the most critical conditions in
summer following the increase in temperature sand high levels of BOD 5.The analysis showed there
were not significant differences between stations and between different seasons (P>0.05). The
minimum control and farm BOD is 3.66 and 7.41 mg/l, respectively, and the maximum in control and
farm BOD is 8.52 and 16.14, respectively. The analysis showed significant differences between
stations during the study period (P<0.05). The minimum in control and farm COD is 5.56 and 12.24
mg/l, respectively, and the maximum in control and farm COD is 13.82 and 23.04 mg/l, respectively.
Based on the results, COD had significant difference between the control stations (P<0.05).
During the study of phosphate in each season, it was shown that the minimum amount of control and
farm phosphate in May was 0.05 and 0.02 mg/l, respectively and maximum in control and farm
phosphate at December was 0.011 and 0.16, respectively. The results analyses is revealed that there
was a significant difference in incoming PO4 among different seasons (P<0.05).The minimum in
control and farm NO3 is 5.08 and 5.37 mg/l, respectively, and the maximum in control and farm NO3
is 9.71 and 10.31, respectively. NO3 between farm and control stations have had a significant
difference (P<0.05). Also, studying NO3 in different seasons showed that the minimum amount of
control and farm NO3 in July has been 7.34 and 7.50 mg/l, respectively, and the maximum in control
156
HydroMedit 2014, November 13-15, Volos, Greece
and farm NO3 was in August which have been 8.21 and 8.65 mg/l, respectively. Analysis of the results
showed that there were not significant differences in NO3 between different seasons (P>0.05). Also,
studying NO2 in different seasons showed that the minimum amount of control NO2 was in May and
its maximum amount was in July, also the minimum farm NO2 in June and its maximum in August.
Analysis of the results showed that there were not significant differences in nitrate between different
seasons (P>0.05). The TDS analysis showed no significant difference among stations during the
study, and between different seasons (P>0.05). In revision of the two parameters EC and pH, the
analysis showed there were not significant difference among stations and among different seasons
during the study (P>0.05).
Table 1: Water quality parameters of Khalkai River during study period (Mean ± Standard error)
157
HydroMedit 2014, November 13-15, Volos, Greece
18
16
14
12
10
BOD
8
6
4
2
0
entrance
Seasons out
25
20
15
temprature
10
entrance
Seasons out
0.2
0.15
NO2
0.1
0.05 entrance
out
0
Seasons
30
25
20
COD
15
10
5
0 entrance
out
Seasons
158
HydroMedit 2014, November 13-15, Volos, Greece
9
8.5
8
NO3 7.5
entrance
7
out
6.5
Seasons
0.2
0.15
PO4
0.1
entrance
0.05
out
0
Septem…
June
May
July
August
Seasons
Fig.2. Analysis results of parameters temperature, COD, BOD, PO 4, NO3 and NO2 in different
seasons
4. Discussion
An important factor that determines the water quality in streams is BOD 5, which the average amount
of BOD5 in survey stations was in the range of 3.67-16.15 mg/l during the study period. This
parameter at the surveyed stations had raise and fall, so that there was less amount of DO in
downstream stations of each farm than its upstream ones, and there was more amount of BOD 5 in
those areas than the upstream ones. Numerous scientific studies were performed regarding the effluent
amount and composition of fish farms and their environmental impacts on aquatic ecosystems in the
world (Esmaili,Sari, 2004; Kazemzade Khajui.et al, 2002; Bergheim and Brinker, 2003). Phosphate
level in surface natural waters based one existing resources and environmental standards, have been
expressed a maximum of 0.1mg/L (EPA, 1996).According to the values obtained in the survey
stations, there were significant differences between different months ,and the stations after the fish
farms are not in good conditions. Nitrite should not be more 0.51 mg/L than in terms of environmental
standard (McNeely and Neiman is, 1979). In the survey performed in all stations, nitrite levels are in a
desirable condition except Station2. Nitrate has been reported less than 1 mg/L in surface waters based
on environmental standards (EPA, 1996). In the present study, nitrate have shown a significant
differences in the stations before and after the fish farms, and nitrite levels are in an undesirable
condition in all stations. Also, it was determined that the nutrients have been decreasing, so that in
summer by increased rate of farm activities and increased flow rate of river water and increased
temperature, impacts of farms effluents on the river ecosystem severely increased. Also, studies
conducted by The Fisheries organization of Mazandaran province in2005, Ghane Sasan Saraie (2004)
and Boaventura et al.,(1997) confirmed producing significant amounts of nutrients from the fish
farms. In the present study, there was a significant difference in temperature between different
months, but no significant differences between stations observed. It can also be inferred that
temperature is increasing in the stations that are affected by the fish farm effluents, however, this
temperature difference is not too noticeable. Sani (1998) also concluded the trend of changes in
dissolved oxygen in Dohezar River follows monthly changes and subsequent change in water
temperature. The results from COD level indicate significant changes of index in survey stations, so
that reaches its highest amount with rate of 23.04 mg/L in station 8 which is affected by the fish farm
159
HydroMedit 2014, November 13-15, Volos, Greece
effluents from upstream farms, that can be ensured from the waste water impact of the fish farms on
COD of Khalkai River water. Trojanaowski (1990) showed that increased temperature in summer
accelerates the mineralization process and COD increases.
Kelly.et al (1998) conducted studies on inland waters in America showed that waters with electrical
conductivity 500-150 µS/cm have mixed fishery value and outside this range indicates that they are
not suitable for specific groups of fisheries and invertebrates. EC higher than this range and its
significant changes in studied places can indicate the arrival of another pollution source, especially
industrial pollutants to the river. In the present study, this factor did not show a significant difference
between different stations within the study period. So, EC of the studied area at Khalkai River is in a
normal range and this area has fisheries and environmental capabilities. Regarding what expressed, it
can be inferred that wastewater output of rainbow trout farms at Khalkai River have impact on water
quality parameters and the results of their impacts on some basic parameters such as BOD, COD,
NO3, NO2 and PO4 were clear. It must be noted that activity of each farm alone have not a reasonable
impact on the water quality parameters but all activities of fish farms in the studied area in a process
have resulted in differences of water quality. The study of self-purification trend of the river also
demonstrates its high capacity in self-purification, but also the fish farms effluent is discussed as a
major problem of water quality in the studied area, especially in hot seasons. Since organic nutritional
value of handy food is more than concentrated food, so it is better to use good-quality concentrated
food in feed fish of all fields, and given that the effluents of all the farms and also sewages of villages
located in the border of the river directly enters into the river ecosystem, so it is better all these units
to use systems equipped with effluent and sewage treatment plant. Now it seems that the specified
distances between the farms in Khalkaie River have no scientific basis, therefore it is necessary to
prevent dispersed works by supplementary studies and by creating complexes of fish production until
the river is given more opportunity for self-purification. Finally, with proper management of fish
farms and determining the right distance between fish farms based on the self-purification rate of the
river which have scientific basis, we can make sustainable fisheries exploitation without being
worried about the natural landscapes of Khalkaie River ecosystem.
References
Bergheim A., Brinker A. (2003). Effluent treatment for flow through systems and European
Environmental Regulations. Aquacultural Engineering 27, 61-77.
Boaventura, R., A. M. J. Pedro Coimbra, E. Lencastre (1997). Trout farm effluents :
Characterization and impact on the receivingstreams; Environmental Pollution. 95:379-387.
Camargo J., Gonzalo C. (2007). Physicochemical and biological changes downstream from a trout
farm outlet: Comparing 1986 and 2006 sampling surveys.
Journal of Limnetica 26, 405-414.
Environmental Protection Agency (1996). Quality criteria for waters,Washington D.C.
Esmaili Sari, A. (2004). Hydrochemistry: foundations of aquaculture; Tehran, Aslani publications.
Esmaili Sari, A. (2000). Principles of Water Quality Management in aquaculture; Tehran: Iranian
Fisheries Research Institute.
Hughes, B. D. (1978). The influence of factors other than pullotion on the value of Shannon,s
diversity index for benthic macroinvertebrates in streams. Water. Res. 12: 359-364.
Ghane Sasan Saraie. A. (2004). Identifying the population structure of Chafrood River macrobenthos
in Gilan province regarding some water quality parameters (in the scope of Or man Malal village);
M.S Thesis;Teacher Training University; P98.
Kazemzade Khajui A., Ismaili Sari A., Ghasempouri M. (2012). The pollution investigation
resulting from trout farms at HarazRiver .Iran Marine Science and Technology Journal .Summer 81.
p8.
Kelly, T. R., J. Herida, and J. Mothes (1998). Sampling of the Mackinaw River in central Illinois
for physicochemical and bacterial indicators of pollution. Transaction of Illinois State Academy of
Science, 91, 145-154.
McNeely, R. N. and V. P. Neimanis (1979).Water quality sourcebook, A guide to waterquality
parameter, water quality branch.OTAWA, Canada.
Naderi Jelodar M., Esmaili Sari A., Ahmadi M., SaifAbadi J., Abdoli A. (2006). The pollution
investigation resulting from rainbow trout farms on the water quality parameters of Haraz River.
Environmental Sciences. 4(2), 18.
Papatryphon, E., Petit, J., Hayo, V., Kaushik, S.J., and Claver, K. (2005). Nutrient-balance
modelling as a tool for environmental management in aquaculture: The case of trout farming in
France. Environmental Management, 35 (2), 161-174.
160
HydroMedit 2014, November 13-15, Volos, Greece
Philips M. G. and Ross, L. (1985) The environmental impact of salmonid cage culture on inland
fisheries. Journal of fish biology 27, 123-137.
Pulatsu S., Rad F., Kaksal G., Aydin F., Karasu Benli A., Topçu A. (2004). The impact of rainbow
trout farm effluents on water quality of Karasu stream, Turkey. Turkish Journal of Fisheries and
Aquatic Sciences 4, 9-15.
Sani H. A. (1997) The survey on pollution from trout farms on Dohezar River ecosystem and its self
purification, MS Thesis, Faculty of natural resources, Tehran University, p.95.
Tarzwell, C. M. (1965). Biological problems in water pollution: Third Seminar. 1962. U.S. Pub.
Health Serv. Div. Water Supply and Pollut. Control, Cincinnati.
Trojanowski, J. (1990). Various forms of phosphorus in bottom sediments of selected coastal lakes.
Pol. Arch. Hydrobiol. 37(3): 341-359.
161
HydroMedit 2014, November 13-15, Volos, Greece
Samanta P.1, Pal S.2, Mukherjee A.K.3, Senapati T.4 Ghosh A.R.1*
1
Ecotoxicology Lab, Department of Environmental Science, The University of Burdwan, Golapbag,
Burdwan, West Bengal 713104, India
2
Department of Environmental Science, Aghorekamini Prakashchandra Mahavidyalaya, Subhasnagar,
Bengai, Hooghly, West Bengal 712611, India
3
P.G. Department of Conservation Biology, Durgapur Government College, Durgapur,West Bengal
713214, India
4
School of Basic and Applied Sciences, Poornima University, Jaipur, Rajasthan 302022, India
Abstract
Freshwater teleostean fishes Anabas testudineus, Heteropneustes fossilis and Oreochromis niloticus
were exposed to almix (66.67 mg/l) for a period of 30 days to investigate the toxicological responses
on acetylcholinesterase (AChE), oxidative and antioxidant enzymes. AChE activity was increased
significantly (p< 0.05) in muscle, brain and spinal cord in all test fishes, highest in muscle of H.
fossilis but lowest in spinal cord of A. testudineus. Significant increased lipid peroxidation (LPO)
level in all tissues was observed after almix intoxication, maximum in liver of O. niloticus and
minimum in brain of H. fossilis. Catalase (CAT) activity was increased significantly in all fish tissues
after almix exposure while glutathione-S-transferase (GST) showed significant reduced activity in
liver, in particular, maximum in liver of H. fossilis. Protein content in all concerned tissues was
significantly declined and highest reduction was observed in muscle of A. testudineus while lowest in
liver of H. fossilis. So, the present study is able to shed light on the changes in acetylcholinesterase
activity, oxidative parameters and antioxidant enzyme profile under long-term exposure of almix and
these responses can be used as indicators of herbicidal contamination.
Keywords: Almix, Antioxidant enzymes, Teleostean fishes
*Corresponding author: Apurba Ratan Ghosh (apurbaghosh2010@gmail.com)
1. Introduction
Bioaccumulation and non-biodegradable nature of the pollutants may pose a serious threat to
the non-target aquatic organisms and ultimately cause health risk to human beings (Binelli & Provini
2004). These surface water contaminants from industrial processes or agricultural runoff are the major
contributors of aquatic system at local, regional, national, even at global levels (Palus et al. 1999;
Cerejeira et al. 2003). Almix® 20WP (a third generation herbicide) attacks and destroys the broad leaf
weeds and sedges by stifling the growth of rice crop. It is a combination of 10% metsulfuron methyl,
10% chlorimuron ethyl and 80% adjuvants (Safety Data Sheet 2012).
Fishes are recognized as sentinel organisms for ecotoxicological studies because they are
continuously exposed to different types of toxic chemicals coming from different anthropogenic
sources. They also play a significant role in evaluating the potential risk associated with
contamination in aquatic environment (Lakra & Nagpure 2009) and can predict an early detection of
aquatic contamination (van der Oost et al. 2003). Fishes possess a defensive mechanism to counteract
the impact of oxidative stress posed by environmental contaminants such as herbicides, heavy metals
and insecticides. These create imbalance between pro-oxidants and antioxidants ratio, leading to
generation of reactive oxygen species (ROS) such as hydrogen peroxide (H 2O2), superoxide anion (O2-
) and hydroxyl radical (OH·) which have recently come into focus in the field of ecotoxicology
(Facerney et al. 2001; Monteiro et al. 2006). ROS reacts with biological macromolecules at
supramolecular levels having gained potency and leads to enzyme inactivation, lipid peroxidation
(LPO), DNA damage and even cell death (Peña-Llopis et al. 2003). Catalase, an enzymatic
antioxidant, catalyzes H2O2 produced by dismutation of superoxide anions into less toxic water and
oxygen molecules (Lushchak et al. 2001). Glutathione-S-transferases, a phase II biotransformation
enzyme, catalyze the conjugation of glutathione into a variety of compounds which are involved in
transportation and elimination of reactive compounds (Sies 1993). The Lipid peroxidation (LPO) is a
secondary LPO product and regarded as an indicator of biochemical toxicity of environmental
contaminants (Draper et al. 1993). AChE activity also has been selected as biomarker of pesticidal
toxicity in fish by different authors (Moraes et al. 2007) and hence plays a vital role in physiological
functioning of fish (Dutta & Arends 2003). Here, three Indian air-breathing food teleosts viz., Anabas
testudineus (Bloch), Heteropneustes fossilis (Bloch) and Oreochromis niloticus (Linnaeus) were
162
HydroMedit 2014, November 13-15, Volos, Greece
selected for toxicity testing of almix and its effect on aceylcholinesterase activity, oxidative
parameters and antioxidant enzyme levels in these fishes.
163
HydroMedit 2014, November 13-15, Volos, Greece
Paired t test: * p< 0.05 ** p< 0.01. Data are reported as mean ± SEM (n = 9).
Table 2 Analysis of lipid peroxidation (unit/mg protein/min) in control and almix-treated fishes
Tissues A. testudineus H. fossilis O. niloticus
Paired t test: * p< 0.05 ** p< 0.01. Data are reported as mean ± SEM (n = 9).
164
HydroMedit 2014, November 13-15, Volos, Greece
Decreased GST activity in liver may be due to the failure of detoxification phenomenon of herbicide
and development of oxidative stress. The result was also in agreement with Ballesteros et al. (2009b)
who observed decreased GST in gills, liver, and muscle of Jenynsia multidentata exposed to
endosulfan and with Menezes et al. (2011) who observed reduced GST level in liver of R. quelen
exposed to Roundup. Reduced GST activity here indicated that almix caused damage to the
antioxidant defence system as well as in detoxification process of teleostean fishes. So it may be used
as a biomarker of almix toxicity.
Paired t test: * p< 0.05 ** p< 0.01. Data are reported as mean ± SEM (n = 9).
Paired t test: * p< 0.05 ** p< 0.01. Data are reported as mean ± SEM (n = 9).
Paired t test: * p< 0.05 ** p< 0.01. Data are reported as mean ± SEM (n = 9).
4. Conclusion
Present study discloses that commercial herbicide almix causes changes in AChE activity,
oxidative stress parameters, and antioxidant defence mechanism in three freshwater teleosts, A.
testudineus, H. fossilis, and O. niloticus. The altered activity of AChE, LPO, CAT and GST in
different fish tissues indicated perturbation in internal integrity of biochemical and/or physiological
processes by almix-induced free radical toxicity and the responses displayed by these fish species
could be considered as bioindicators of herbicide toxicity in aquatic ecosystem. Finally, from an
165
HydroMedit 2014, November 13-15, Volos, Greece
ecotoxicological view point, use of this herbicide in agriculture and aquatic bodies must be handled
very carefully and monitored judicially.
Acknowledgements
The authors would like to thank Department of Science & Technology, Govt. of India for the
financial assistance. We would also like to thank the Head, Department of Environmental Science,
The University of Burdwan, Burdwan, West Bengal, India for providing the laboratory facilities
during the course of research. We do also like to acknowledge Dr Sukriti Ghosal, Principal, MUC
Women‘s College, Burdwan and Part-time Faculty of Dept. of English, The University of Burdwan
for necessary editing the English language of the manuscript.
References
Aebi H. (1974). Catalase in vitro. Methods in Enzymology 105, 121-126.
Ahmad I., Hamid T., Fatima M., Chand H.S., Jain S.K., Athar M., Raisuddin S. (2000). Induction of
hepatic antioxidants in freshwater catfish (Channa punctatus bloch) is a biomarker of paper
mill effluent exposure. Biochimica et Biophysica Acta 1523(1), 37-48.
Ballesteros M.L., Wunderlin D.A., Bistoni M.A. (2009b). Oxidative stress responses in different
organs of Jenynsia multidentata exposed to endosulfan.
Ecotoxicology and Environmental Safety 72(1), 199-205.
Ballesteros S., Reales J.M., Mayas J., Heller M.A. (2008). Selective attention modulates visual and
haptic repetition priming: Effects on ageing and Alzheimer‘s disease. Experimental Brain
Research 189(4), 473-483.
Binelli A., Provini A. (2004). Risk for human health of some POPs due to fish from Lake Iseo.
Ecotoxicology and Environmental Safety 58(1), 139-145.
Cerejeira M.J., Vianab P., Batistaa S., Pereiraa T., Silvaa E., Valerio M.J., Silvaa A., Ferreirab M.,
Silva-Fernandes A.M. (2003). Pesticides in Portuguese surface and ground waters. Water
Research 37(5), 1055-1063.
David M., Mushiger S.B., Shivakumar R., Philip G.H. (2004). Response of Cyprinus carpio (Linn.) to
sublethal concentration of cypermethrin: alterations in protein metabolic profiles.
Chemosphere 56(4), 347-352.
Draper H.H., Squires E.J., Mahmoodi H., Wu J., Agarwal S., Hadley M. (1993). A comparative
evaluation of thiobarbituric acid methods for the determination of malondialdehyde in
biological materials. Free Radical Biology and Medicine 15(4), 353-363.
Dutta H.M., Arends D.A. (2003). Effects of endosulfan on brain acetylcholinesterase activity in
juvenile bluegill sunfish. Environmental Research 91(3), 157-162.
Ellman G.L., Courtney K.D., Andres Jr.V. (1961). A new and rapid colorimetric determination of
acetylcholinesterase activity. Biochemical Pharmacology 7(2), 88-95.
Facerney C.R.D., Devaux A., Lafaurie M., Girard J.P., Bailly B., Rahmani R. (2001). Cadmium
induces apoptosis and genotoxicity in rainbow trout hepatocytes through generation of
reactive oxygen species. Aquatic Toxicology 53(1), 65-76.
Ferna´ndez-Vega C., Sancho E., Ferrando M.D., Andreu E. (2002). Thiobencarb-induced changes in
acetylcholinesterase activity of the fish Anguilla anguilla.
Pesticide Biochemistry and Physiology 72(1), 55-63.
Fonseca M.B., Glusczak L., Moraes B.S., Menezes C.C., Pretto A., Tierno M.A., Zanella
R., Gonçalves F.F., Loro V.L. (2008). 2,4-D herbicide effects on acetylcholinesterase
activity and metabolic parameters of piava freshwater fish (Leporinus obtusidens).
Ecotoxicology and Environmental Safety 69(3), 416-420.
Habig W.H., Pabst M.J., Jakoby W.B. (1974). Glutathione S-transferases. The first enzymatic step in
mercapturic acid formation. Journal of Biological Chemistry 249(22), 7130-7139.
Jabeen A.A., Bindhuja M.D., Revati K. (2008). Biochemical changes induced by rice herbicide
ALMIX20 WP (Metsulfuron-methyl 10%+Chlorimuron-ethyl 10%) on fresh water fish,
Cyprinus carpio. Journal of Experimental Zoology, India 11(1), 179-183.
Lakra W.S., Nagpure N.S. (2009). Genotoxicological studies in fishes: A review. Indian
Journal of Animal Sciences 79(1), 93-98.
Li W., Yin D., Zhou Y., Hu S., Wang L. (2003). 3,4-Dichloroaniline induced oxidative stress in liver
of crucian carp (Carassius auratus). Ecotoxicology and Environmental Safety 56(2), 251-
255.
Lowry D.H., Rosenbrough N.J., Farr A.L., Randall R.J. (1951). Protein measurement with folin
phenol reagent. Journal of Biological Chemistry 193, 265-275.
166
HydroMedit 2014, November 13-15, Volos, Greece
Lushchak V.I., Lushchak L.P., Mota A.A., Hermes-Lima M. (2001). Oxidative stress and antioxidant
defenses in goldfish Carassius auratus during anoxia and reoxygenation. American Journal
of Physiology 280(1), R100-R107.
Menezes C.C., Fonseca M.B., Loro V.L., Santi A., Cattaneo R., Clasen B., Pretto A., Morsch V.M.
(2011). Roundup effects on oxidative stress parameters and recovery pattern of Rhamdia
quelen. Archives of Environmental Contamination and Toxicology 60(4), 665-671.
Miron D., Crestani M., Schetinger M.R., Morsch V.M., Baldisserotto B., Tierno M.A., Moraes G.,
Vieira V.L.P. (2005). Effects of the herbicides clomazone, quinclorac, and metsulfuron
methyl on acetylcholinesterase activity in the silver catfish (Rhamdia quelen)
(Heptapteridae). Ecotoxicology and Environmental Safety 61(3), 398-403.
Monteiro D.A., Almeida J.A., Rantin F.T., Kalinin A.L. (2006). Oxidative stress biomarkers in
the freshwater characid fish Brycon cephalus, exposed to organophosphon
insecticide Folisuper 600 (Methyl parathion). Comparative Biochemistry and
Physiology 143(2), 141-149.
Moraes B.S., Loro V.L., Fonseca M.B., Menezes C.C., Marcehsan E., Reimche G.B., Aliva L.A.D.
(2009a). Toxicological and metabolic parameters of the teleost fish (Leporinus obtusidens) in
response to commercial herbicides containing clomazone and propanil. Ecotoxicology and
Environmental Safety 95(2), 57-62.
Moraes B.S., Loro V.L., Glusczak L., Pretto A., Menezes C., Marchezan E., de Oliveira Machado S.
(2007). Effects of four rice herbicides on some metabolic and toxicology parameters of
teleost fish (Leporinus obtusidens). Chemosphere 68(8), 1597-1601.
Ohkawa H., Ohishi N., Yagi K. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric
acid reaction. Analytical Biochemistry 95(2), 351-358.
Palus J., Dziubattowska E., Rydzynski K. (1999). DNA damage detected by the comet assay in the
white blood cells of workers in a wooden furniture plant. Mutation Research 444(1), 61-74.
Peixoto F., Alves-Fernandes D., Santos D., Fontaı´nhas-Fernandes A. (2006). Toxicological effects of
oxyfluorfen on oxidative stress enzymes in tilapia Oreochromis niloticus.
Pesticide Biochemistry and Physiology 85(2), 91-96.
Peña-Llopis S., Ferrando M.D., Peña J.B. (2003). Fish tolerance to organophosphate-
induced oxidative stress is dependent on the glutathione metabolism and enhanced
by N-acetylcysteine. Aquatic Toxicology 65(4), 337-360.
Safety Data Sheet (2012). DuPont™ Almix® 20 WP. Version 2.1, Revision Date 27.07.2012 (Ref.
130000029001).
Samanta P., Pal S., Mukherjee A.K., Senapati T., Ghosh A.R. (2013). Evaluation of enzymatic
activities in liver of three teleostean fishes exposed to commercial herbicide, Almix 20 WP.
Proceedings of the Zoological Society, doi:10.1007/s12595-013-0086-z
Sies H. (1999). Glutathione and its role in cellular functions. Free Radical Biology and Medicine
27(9&10), 916-921.
van der Oost R., Beyer J., Vermeulen N.P.E. (2003). Fish bioaccumulation and biomarkers in
environmental risk assessment: a review. Environmental Toxicology and Pharmacology 13(2), 57-149.
167
HydroMedit 2014, November 13-15, Volos, Greece
Kole D.1, Pal S.2, Mukherjee A.K.3, Samanta P.1, Ghosh A.R.1*
1
Ecotoxicology Laboratory, Department of Environmental Science, The University of Burdwan,
Golapbag, Burdwan, West Bengal 713104, India
2
Department of Environmental Science, Aghorekamini Prakashchandra Mahavidyalaya, Subhasnagar,
Bengai, Hooghly, West Bengal 712611, India
3
P.G. Department of Conservation Biology, Durgapur Government College, Durgapur,West Bengal
713214, India
Abstract
Present study investigated the effects on glutathione-S-transferase (GST), alkaline phosphatase (ALP),
alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in one perch, Anabas
testudineus (Bloch) of chromium at two concentrations (25% i.e., 15.45 mg/l and 50% i.e., 30.90
mg/l) of sublethal concentration (LC50 61.80 mg/l for 96 hours) for a chronic exposure of 30 days
under laboratory condition. The result of different tissues were compared under two different
concentrations. GST activity was significantly decreased (p < 0.01) in liver at both the concentrations.
The mean value of ALP in intestine and kidney was significantly increased (p < 0.01) under 25% but
significantly reduced (p < 0.05) at 50% concentration. But in liver ALP level was significantly
decreased (p < 0.05) in both the concentrations. ALT level in gill, liver and heart was significantly
increased (p < 0.01) under 25% concentration but reduced significantly (p < 0.05) at 50% while in
case of muscle it was increased significantly. AST activity was significantly increased (p < 0.01) in all
the tissues at 25% but significantly decreased (p < 0.01) at 50% concentration. These results revealed
that different sublethal concentrations of chromium may cause different enzymatic activities in ALP,
ALT and AST in freshwater fishes. So, these enzymes may be considered as biomarkars in view of
ecotoxicological monitoring as in case of chromium toxicity.
Keywords: Chromium, Sublethal concentration, GST, ALP, ALT, AST, Anabas testudineus (Bloch)
*Corresponding author: Apurba Ratan Ghosh (apurbaghosh2010@gmail.com)
Introduction
Metal pollution in the aquatic environment gradually becomes a potential threat to non-target
aquatic organisms especially in fish due to their bioaccumulative and non-biodegradable properties.
Different sources of heavy metals like industrial, agricultural, and anthropogenic activities are causing
hazardous effects to metabolic, physiological and biochemical systems of fishes (Heath 1987;
Dethloff et al. 1999; Atli & Canli 2007) at high concentration. It is very unstable in water. Cr among
other deleterious heavy metals is considered as potent toxicant to fish as well as other aquatic life even
at low concentration showing effects at physiological, histological, biochemical, enzymatic and
genetic levesl (Heath 1987). Adverse toxic effects of Cr on biochemical toxicity, immune response
and non-specific immunity, genotoxicity in different fish species have also been reported by various
researchers (Prabakaran et al. 2007; Maples & Bain 2004; Lemos et al. 2001; Sastry & Sunita 1983).
Among the enzymes, glutathione-S-transferases (GST) is very important enzymatic antioxidant,
which are involved in transportation and elimination of reactive compounds (Livingstone 2003; Sies
1993). Alkaline phosphatase is a polyfunctional enzyme and plays a vital role in mineralization of the
skeleton of aquatic animals (Lan et al. 1995; Zikic et al. 2001). Aminotransferases [alanine
aminotransferases (ALT) and aspartate aminotransferase (AST)] are the most significant enzymes
involved in transamination for synthesis and deamination of amino acids Zikic et al. (2001). These
enzymatic studies under toxicosis of heavy metals are very few in number (Frasco et al. 2007) but this
can be identified as enzymatic probes of biomarkers. Therefore, the aim of the present study is to
evaluate the different enzymatic responses at two different concentrations in different tissues, so as to
compare the level of damage at particular concentration of chromium under long term exposure.
168
HydroMedit 2014, November 13-15, Volos, Greece
groups (II &III) were intoxicated with two sublethal concentrations of hexavalent chromium
(K2Cr2O7), i.e., 25% and 50% of LC50 value [61.80 mg/l for 96 h (Kumar et al. 2012)] respectively for
a period of 30 days. Doses were applied on every alternate day and all aquaria were maintained very
carefully.
Tissue Sampling and Biochemical Evaluation: After completion of the experiment i.e., 30 days,
fishes from each group of control and chromium treated were weighed and desired tissues of gill,
stomach, intestine, liver, kidney, brain, spinal cord, heart, and white muscle, for respective enzymes
were taken and washed quickly in 0.75% saline solution, dried with filter paper, packed in teflon tubes
and stored at -80oC for biochemical analysis. The following enzymes viz., glutathione-S-transferase
activity was determined according to the method of Habig et al. (1974), and alkaline phosphatase
(Merck cat. # 1730PDLFT.0045), alanine aminotransferase (Erba cat. # FBCEM0047) and aspartate
aminotransferase (Erba cat. # FBCEM0045) activities were measured by Bergmeyer et al. (1976) for
the present study along with protein content was estimated by the Folin-Phenol reaction methods as
described by Lowry et al. (1951). All assays were run in triplicate. Finally, the results were
statistically analysed by using SPSS package (Version 16) for these specific enzymes.
Results
Glutathione-S-transferase activity
A significant reduction in GST activity in liver of A. testudineus at both the concentrations
were recorded (Figure 1) maximum reduction was from 10.231±0.760 to 3.829±0.336 at 25% in
compare to 50% concentration.
Alkaline phosphatase activity
Alkaline phosphatase activity in intestine, liver and kidney of A. testudineus varied
significantly (p< 0.01) at both the concentrations (Figure 2). In liver, it was reduced significantly at
both the concentrations but maximum in 50%. In case of intestine and kidney, it was increased at 25%
concentration from 7.881±0.546 to 16.871±0.603 and 11.647±0.440 to 30.88±1.708 unit/mg protein
respectively but at 50% it was declined from 7.881±0.546 to 3.562±0.882 and 11.647±0.440 to
6.310±0.540 unit/mg protein respectively.
Alanine aminotransferase activity
Alanine aminotransferase activity in all the tissues of A. testudineus was significantly
different at both the Cr concentrations (Figure 3). Gill showed enhanced ALT activity from
16.981±0.957 to 48.332±1.137 at 25% concentration but was reduced at 50% from 16.981±0.957 to
9.645±1.765 unit/mg protein. In case of liver, it was raised from 41.354±1.853 to 75.149±1.498 at
25% but reduced in gill at 50%. In case of muscle, ALT activity was significantly raised at both the
concentrations and was highest at 50% from 19.661±0.892 to 56.440±1.423 and lowest at 25% while
in heart it was elevated significantly from 21.330±0.859 to 34.654±1.573 at 25% but declined at 50%
concentration.
Aspartate aminotransferase (AST) activity
AST activity in liver, muscle, gill and heart of A. testudineus was increased significantly (p<
0.01) at 25% but significantly reduced (p < 0.01) at 50% (Figure 4). In case of gill, AST activity was
raised significantly from 71.515±0.787 to 659.216±9.218 at 25% concentration but reduced from
71.515±0.787 to 50.24±5.452 at 50%. Liver showed increased AST activity from 94.923±2.969 to
978.972±12.087 at 25% while reduced from 94.923±2.969 to 63.89±3.842 at 50%. AST activity in
case of muscle and heart was significantly raised from 62.784±2.014 to 564.324±10.568 and
57.818±1.299 to 390.847±7.744 at 25% respectively but at 50% it was reduced significantly (p< 0.01)
from 62.784±2.014 to 31.923±9.494 and 57.818±1.299 to 42.058±3.950 unit/mg protein respectively.
Discussion
Glutathione-S-transferase, an anti-oxidant enzyme plays a vital role in catalyzing the
conjugation of a wide variety of electrophilic substrates to reduce glutathione to protect the cell
against effects of xenobiotics Ferrari et al. (2007). The elevation or reduction of GST activity in fish
tissues is considered as beneficial for handling a stress condition. In the present work, fishes exposed
to chromium in the laboratory condition showed significant decreased activity of GST in liver which
suggest a failure of detoxification and the occurrence of oxidative stress. Reduction of GST activity in
the hepatic tissue may occur because liver is one of the first organs exposed to metals.
Alkaline phosphatise
Alkaline phosphatase is considered as an important biomarker because of its adaptive cellular
response to the cytotoxic and genotoxic pollutants Lohner et al. (2001). These results showed the
highest enhanced ALP activity in kidney and lowest in intestine at 25% concentration while highest
reduction in liver but less in kidney at 50% concentration. Kidney showed maximum enhancement in
169
HydroMedit 2014, November 13-15, Volos, Greece
enzyme activity in comparison to liver and intestine due to strategic role played by the organs to
compensate the toxic effects of chromium and proper management of their metabolic wastes. Similar
results were reported by Borges et al. (2007); Das & Mukherjee (2003); El-Sayed & Saad (2008). In
liver tissue, ALP activity decreased at both the concentrations and may be taken as an index of hepatic
parenchymal damage and hepatocytic necrosis. Similar results were reported by Sastry & Subhadra
(1985) in cadmium exposed to Heteropneustes fossilis.
Alanine aminotransferase
Aminotransferase is sensitive indicator of even minor cellular damage and considered as
indicator of stress based tissue impairment (Palanivelu et al. 2005). In the present study, the highest
enhanced ALT activity was observed in muscle at 50% and comparatively less in heart at 25%; but
maximum reduction of ALT was observed in gill followed by heart and liver (24.39%) at 50%
concentration. Increased ALT activities indicated degenerative changes in tissue system by disrupting
the physiological and biochemical processes caused mainly due to leakage of enzyme from liver
cytosol into the blood stream. Gill tissue at 25% seemed to be mostly affected by chromium poisoning
and this may be due to direct exposure of the heavy metal followed by muscle at 50% concentration
due to catabolism of protein molecules to meet the high energy demand for carbohydrate and its
precursors. The results were also in agreement with observations reported by Jee et al. (2005); Begum
(2004) & Gill et al. (1991); although, some results were disagreed with the findings of Li et al. (2009)
& Okechukwu & Auta (2007) who reported the decreased ALT activity in rainbow trout exposed to
carbamazepine and in Clarias gariepinus exposed to lambda-cyhalothrin. In the present study,
maximum elevation of ALT activity was occurred in liver at 50% concentration; this was also agreed
by De Smet & Blust (2001) in cadmium exposed to Cyprinus carpio.
Aspartate aminotransferase
Aspartate aminotransferase plays a vital role in transamination process whose induction,
thereby, enabling carbohydrate and protein metabolism by the inter-conversion of strategic compound
like α-ketoglutarate and alanine to pyruvic and glutamic acid (Gabriel & George 2005; Salah El-Deen
& Rogers 1993). AST is considered as an enzymatic biomarker and its changes due to xenobiotic
exposure identify damages in the tissues/organs in fish (Philip & Rajarsee, 1996). The results showed
the highest enhanced activity of AST in liver and low in heart at 25% concentration but maximum
reduction was observed in muscle followed by heart at 50% concentration. These findings were also
similar with the observation of Yildirim et al. (2006) who reported increased activity of AST in gill,
liver and kidney of Oreochromis niloticus exposed to deltamithrin for four days and with Jee et al.
(2005) who also found similar results in Korean rockfish (Sebastes schlegeli) exposed to
cypermethrin. In the present study, exposure of A. testudineus to chromium at the 25% concentration
showed enhanced activity of AST enzyme in liver, gill, muscle and heart tissue indicating serious
tissue damage as well as an augmentation of stress condition and subsequently efficient utilization of
amino acids for metabolic processes for meeting the fluctuating energy demand to keep both the
glycolytic pathway and TCA cycles at equilibrium levels. Present study showed higher liver AST
activity in comparison to other tissues of test fishes at both the concentrations suggested that hepatic
damage may be due to hypofunction of liver activity and their leakage into the body fluid.
Acknowledgements
The authors would like to thank Department of Science & Technology, Govt. of India for the
financial assistance. We would also like to thank the Head, Department of Environmental Science,
The University of Burdwan, Burdwan, West Bengal, India for providing the laboratory facilities
during the course of research.
References
Atli G., Canli M. (2007). Enzymatic responses to metal exposures in a freshwater fish
Oreochoromis niloticus. Comparative Biochemistry and Physiology Part C: Toxicology
and Pharmacology 145, 282–287.
Begum G. (2004). Carbofuran insecticide induced biochemical alterations in liver and muscle
tissues of fish Clarias batrachus (Linn) and recovery response. Aquatic Toxicology 66(1), 83-92.
Bergmeyer H.U., Bowers Jr. G.N., Hörder M., Moss D.W. (1976). Provisional
recommendations on IFCC Methods for the measurement of catalytic concentrations of enzymes. Part
2. IFCC method for aspartat aminotransferase. Clinica Chimica Acta 70, 19-42.
Borges A. (2007). Changes in hematological and serum biochemical values in Jundiá
Rhamdia quelen due to sub-lethal toxicity of cipermethrin. Chemosphere 69, 920-926.
170
HydroMedit 2014, November 13-15, Volos, Greece
Das B.K., Mukherjee M.D. (2003). Toxicity of cypermethrin in Labeo rohito fingerlings:
biochemical enzymatic and haematological consequences. Comparative Biochemistry and Physiology
Part C: Toxicology and Pharmacology134, 109-121.
De Lemos C.T., Rodel P.M., Terra N.R., Erdtman B. (2001). Evaluation of basal
micronucleus frequency and hexavalent chromium effects in fish erythrocytes. Environmental
Toxicology and Chemistry. 20(6), 1320–1324.
De Smet H., Blust R. (2001). Stress responses and changes in protein metabolism in carp
Cyprinus carpio during cadmium exposure. Ecotoxicology and Environmental Safety 48, 255–262.
Dethloff G., Schlenk D., Hamm J., Bailey H. (1999). Alterations in physiological parameters
of rainbow trout (Oncorhynchus mykiss) with exposure to copper and copper– zinc mixtures.
Ecotoxicology and Environmental Safety 42, 253– 264.
El-Deen S., Magdy A., Rogers W.A. (1993). Changes in total protein and transaminase
activities of the grass carp exposed to diquat. Journal of Aquatic Animal Health 5, 280–286
El-Sayed Y.S., Saad T.T. (2008). Sub-acute intoxication of a deltamethrin-based preparation
(Butox 5% EC) in monosex Nile tilapia, Oreochromis niloticus L. Basic Clin. Toxicology and
Applied Pharmacology 102, 293-299.
Ferrari A., Venturino A., Peche´n de D‘Angelo A.M. (2007). Effects of carbaryl and
azinphos methyl on juvenile rainbow trout (Oncorhynchus mykiss) detoxifying enzymes. Pesticide
Biochemistry and Physiology 88, 134–142.
Frasco M.F., Colletier J.P., Weik M., Carvalho F., Guilhermino L., Stojan J., Fournier D.
(2007). Mechanisms of cholinesterase inhibition by inorganic mercury. European Journal of
Biochemistry 274, 1849–1861.
Habig W.H., Pabst M.J., Jakoby W.B. (1974). Glutathione S-transferases. The first
enzymatic step in mercapturic acid formation. Journal of Biological Chemistry 249 (22), 7130-7139.
Gabriel U.U., George A.D.I. (2005). Plasma enzymes in C. gariepinus exposed to chronic
levels of roundup (glyphosate). Environment and Ecology 23, 271–276.
Gill T.S., Teware H., Pande J. (1991). In vivo and in vitro effects of cadmium on selected
enzymes in different organs of the fish Barbus conchonius Ham. (Rosy Barb). Comparative
Biochemistry and Physiology Part C: Toxicology and Pharmacology 100, 501–505.
Heath A.G. (1987). Water Pollution and Fish Physiology. CRC, Boca Raton, FL, USA, pp.
245.
Jung-Hoon J., Fatima M., Ju-Chan K. (2005). Responses of cypermethrin-induced stress in
haematological parameters of Korean rockfish, Sebastes schlegeli (Hilgendorf). Aquaculture Research
36, 898–905.
Kumar P., Kumar R., Nagpure N.S.,Nautiyal P., Dabas A., Kushwaha B., Lakra W.S.
(2012). Genotoxic and Mutagenic Assessment of Hexavalent Chromium in Fish FollowingIn Vivo
Chronic Exposure. Human and Ecological Risk Assessment 18, 855–870.
Lan W.G., Wong M.K., Chen N., Sin Y.M. (1995). Effect of combined copper, zinc,
chromium, and selenium by orthogonal array design on alkaline phosphatase activity in liver of the
red sea bream, Chrysophrys major. Aquaculture 131, 219–230.
Livingstone D.R. (2003). Oxidative stress in aquatic organisms in relation to pollution and
aquaculture. Revue de Médecine Vétérinaire 154, 427–430.
Lohner T.W., Robin J., Reash V., Ellen W., Jana F. (2001). Assessment of tolerant sunfish
populations (Lepomis spp.) inhabiting selenium-laden coal ash effluent. 2. Tissue biochemistry
evaluation. Ecotoxicology and Environ mrntal Safety 50, 217–224.
Lowry O.H., Rosebrough N.J., Farr A.L., Randall R.J. (1951). Protein measurement with
folin phenol reagent. The Journal of Biological Chemistry 193, 265–275.
Maples N.L., Bain L.J. (2004). Trivalent chromium alters gene expression in the mummichog
(Fundulus heteroclitus). Environmental Toxicology and Chemistry 23(3), 626–631.
Okechukwu E.O., Auta J. (2007). The effects of sub-lethal doses of Lambda-cyhalothrin on
some biochemical characteristics of the African catfish, Clarias gariepinus. Journal of Biological
Science 7(8), 1473–1477.
Palanivelu V., Vijayavel K., Balasubramanian S.E., Balasubramanian M.P. (2005). Influence
of insecticidal derivative (Cartap Hydrochloride) from the marine polychaete on certain enzyme
systems of the freshwater fish Oreochromis mossambicus. Journal of Environmental Biology 26, 191–
196.
Philip G.H., Rajarsee B.H. (1996). Action of cypermetrhin on tissue transamination during
nitrogen metabolism in Cyprinus carpio. Ecotoxicology and Environmental Safety 34(2), 174–179.
171
HydroMedit 2014, November 13-15, Volos, Greece
Prabakaran M., Binuramesh C., Steinhagen D., Dinakaran M.R. (2007). Immune response in
the tilapia,Oreochromis mossambicus on exposure to tannery effluent. Ecotoxicology and
Environmental Safety 68(3), 372–8.
Sastry K. V., Subhadra K. (1985). In vivo effects of cadmium on some enzyme activities in
tissues of the freshwatercatfish, Heteropneustes fossilis. Environmental Research 36 (1), 32 – 45.
Sastry K.V., Sunita K.M. (1983). Enzymological and biochemical changes produced by
chronic chromium exposure in a Teleost fish, Channa punctatus. Toxicology Letters 16, 9–15.
Sies H. (1993). Strategies of antioxidant defenses. Europian Journal of Biochemistry 215,
213–219.
Yildirim M.Z., Benli K.C., Selvi M., Ozkul A., Erko F., Kocak O. (2006). Acute toxicity
behavioural changes and histopathological effects of deltamethrin on tissues (gills, liver, brain, spleen,
kidney, muscle, skin) of Nile Tilapia (Oreochromis niloticus) fingerlings. Environmental Toxicology
21, 614-620.
Zhi-Hua L., Vladimir Z., Josef V., Roman G., Jana M., Tomas R. (2009). Physiological
condition status and muscle based biomakers in rainbow trout after long exposure to carbamazopine.
Journal of Applied Toxicology 30, 197–203.
Zikic R.V., Stajn S., Pavlovic Z., Ognjanovic B.I., Saicic Z.S. (2001). Activities of
superoxide dismutase and catalase in erytrocyte and plasma transaminases of goldfish (Carassius
auratus gibelio Bloch.) exposed to cadmium. Physiological Research 50,105–111.
Figure 1. GST activity (unit/mg protein/min) in liver of Anabas testudineus under control and
treated conditions.
172
HydroMedit 2014, November 13-15, Volos, Greece
Figure 2. ALP activity (unit/mg protein) in intestine, liver and kidney of Anabas testudineus
under control and treated conditions.
Figure 3. ALT activity (unit/mg protein) in gill, liver, muscle and heart of Anabas testudineus
under control and treated conditions.
173
HydroMedit 2014, November 13-15, Volos, Greece
Figure 4. AST activity (unit/mg protein) in gill, liver, muscle and heart of Anabas testudineus
under control and treated conditions.
174
HydroMedit 2014, November 13-15, Volos, Greece
Tsioli S.*1, Papathanasiou V.1, Katsaros C.2, Exadactylos A.3, Orfanidis S.1
1
Benthic Ecology & Technology Laboratory, Fisheries Research Institute (Hellenic
Agricultural Organization-DEMETER), 64007, Nea Peramos, Kavala, Greece
2
Department of Botany, Faculty of Biology, National and Kapodistrian University of Athens, 15784,
Athens, Greece
3
Department of Ichthyology & Aquatic Environment, School of Agricultural Sciences, University of
Thessaly, Fytokou 38, 38446, Volos, Greece
ABSTRACT
The tolerance of Cymodocea nodosa photosynthetic activity to salinity was studied to understand key
mechanisms of its physiology in the Kavala Gulf, Northern Aegean. Shoots of the plant were placed
in Plexiglas aquariums with different salinities (5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60) for 20
days. The effective quantum yield (ΓF/Fm') was measured every fourth day and the chlorophyll-a
(Chl-a) leaf content was estimated at the end of the experiment. The experiment was conducted in a
constant temperature chamber (21-22 μC) with controlled lighting conditions (70-90 ιmol photons m-2
s-1, 14 hours light). The results reveal that the species has rather euryhaline characteristics and high
physiological plasticity, with both ΓF/Fm' and leaf Chl-a yielding lower values in extreme salinities
(<15, >45). The results are in agreement with the literature and explain the presence in coastal waters
and absence in the lagoons of Eastern Macedonia and Thrace. They also provide insight on possible
future changes in its distribution due to climate change in the region.
Key words: Effective quantum yield, chlorophyll-a, Kavala Gulf
*Corresponding author: Soultana Tsioli (stsioli@inale.gr)
Πεξίιεςε
Μεθεηήεδηακ ηα υνζα ακμπήξ ηδξ θςημζοκεεηζηήξ δναζηδνζυηδηαξ ημο είδμοξ Cymodocea nodosa
ζηζξ ιεηααμθέξ ηδξ αθαηυηδηαξ, ςξ ιζα πνμζπάεεζα ηαηακυδζδξ ααζζηχκ ιδπακζζιχκ ηδξ
μζημθοζζμθμβίαξ ημο πθδεοζιμφ ημο είδμοξ ζηδ εαθάζζζα πενζμπή ημο Κυθπμο ηδξ Κααάθαξ, Βυνεζμ
Αζβαίμ. Βθαζημί ημο θοημφ ημπμεεηήεδηακ ζε εκοδνεία Plexiglas δζαθμνεηζηχκ αθαημηήηςκ (5, 10,
15, 20, 25, 30, 35, 40, 45, 50, 55, 60) βζα 20 ιένεξ, ηαηά ηδ δζάνηεζα ηςκ μπμίςκ ιεηνμφκηακ δ
εκενβυξ θςημκζαηή ημοξ απυδμζδ (ΓF/Fm'), εκχ ζημ ηέθμξ ημο πεζνάιαημξ ιεηνήεδηε δ
πενζεηηζηυηδηα ηςκ θφθθςκ ζε πθςνμθφθθδ-α (Chl-a). Σμ πείναια δζελήπεδ ζε εάθαιμ ηαθθζένβεζαξ
ζηαεενήξ εενιμηναζίαξ (21-22 μC) ηαζ θςηζζιμφ (70-90 ιmol θςημκίςκ m-2 s-1, 14 χνεξ θςξ). Σα
απμηεθέζιαηα ηδξ ενβαζίαξ έδεζλακ υηζ ημ είδμξ έπεζ ιάθθμκ εονφαθα (euryhaline) παναηηδνζζηζηά
ηαζ ορδθή θοζζμθμβζηή πθαζηζηυηδηα ιε ιείςζδ ηδξ ΓF/Fm' ηαζ ηδξ Chl-α ηςκ θφθθςκ ζηζξ αηναίεξ
αθαηυηδηεξ (<15, >45). Σα απμηεθέζιαηα είκαζ ζε ζοιθςκία ιε ηδ δζεεκή αζαθζμβναθία ηαζ ελδβμφκ
ηδ ζδιενζκή ελάπθςζδ ημο είδμοξ ζηζξ αηηέξ, αθθά υπζ ζηζξ θζικμεάθαζζεξ ηδξ Ακαημθζηήξ
175
HydroMedit 2014, November 13-15, Volos, Greece
Μαηεδμκίαξ & Θνάηδξ, εκχ δίκμοκ ηδ δοκαηυηδηα πνυβκςζδξ ηςκ πζεακχκ ιεθθμκηζηχκ ιεηααμθχκ
ηδξ ηαηακμιήξ ελαζηίαξ ηςκ ηθζιαηζηχκ αθθαβχκ ζηδκ εονφηενδ πενζμπή.
Λέξειρ κλειδιά: Δλεξγόο θσηνληαθή απόδνζε, ρισξνθύιιε-α, Κόιπνο Καβάιαο
*οββναθέαξ Δπζημζκςκίαξ: Σζζχθδ μοθηάκα (stsioli@inale.gr)
1. ΔΗΑΓΧΓΖ
Σα εαθάζζζα αββεζυζπενια ή θακενυβαια εεςνμφκηαζ μνβακζζιμί «ηθεζδζά» ζε πμθθά
αααεή πενζαάθθμκηα, υπςξ είκαζ ηα ιεηαααηζηά ηαζ πανάηηζα φδαηα, βζαηί δδιζμονβμφκ ζφκεεηα,
ιςζασημφ ηφπμο, ορδθήξ μζημθμβζηήξ ηαζ μζημκμιζηήξ ζδιαζίαξ εκδζαζηήιαηα (Costanza et al. 1997,
Heck et al. 2003, Bloomfield & Gillanders 2005).
ηα εαθάζζζα πενζαάθθμκηα, δ αθαηυηδηα εεςνείηαζ έκαξ ηαηά πνμζέββζζδ ζηαεενυξ
πανάβμκηαξ, βεβμκυξ πμο ελδβεί βζαηί ηα οδνυαζα αββεζυζπενια είκαζ, ζε βεκζηέξ βναιιέξ, ζηεκυαθα
είδδ (den Hartog & Kuo 2006). Χζηυζμ, επεζδή μζ ηζιέξ ηδξ αθαηυηδηαξ ζηα αααεή πανάηηζα ηαζ
ιεηαααηζηά φδαηα ηδξ οδνμβείμο είκαζ ζδζαίηενα εοιεηάαθδηεξ, ηα είδδ ηςκ βεκχκ Cymodocea,
Zostera ηαζ Ruppia πμο επζηναημφκ παναηηδνίγμκηαζ απυ ορδθή θαζκμηοπζηή πθαζηζηυηδηα
(phenotypic plasticity) (Hemminga & Duarte 2000) ηαζ δοκαηυηδηεξ ειθάκζζδξ ημπζηχκ βεκεηζηχκ
δμιχκ (Alberto et al. 2005). Σα είδδ αοηά εηηυξ ηςκ θοζζμθμβζηχκ αθθαβχκ ελαζηίαξ ηδξ
επμπζηυηδηαξ ηαζ ηςκ νεοιάηςκ, ιπμνεί κα δέπμκηαζ ηδκ επίδναζδ ορδθχκ ιεηααμθχκ ηδξ
αθαηυηδηαξ πμο μθείθμκηαζ είηε ζε έιιεζεξ (ηθζιαηζηέξ αθθαβέξ) είηε ζε άιεζεξ (απυννζρδ θοιάηςκ
άθιδξ απυ ιμκάδεξ αθαθάηςζδξ) ακενςπμβεκείξ δναζηδνζυηδηεξ (Fernandez-Torquemada et al.
2009, Gacia et al. 2007, Koch et al. 2013). Αοηέξ μζ αθθαβέξ, ιυκεξ ημοξ ή ζοκδοαζηζηά, ιπμνμφκ κα
μδδβήζμοκ ζε ηαηαπυκδζδ (stress), επδνεάγμκηαξ ηδ αζςζζιυηδηα ηςκ εαθάζζζςκ θζααδζχκ (Waycott
et al. 2009). Με ζημπυ ηδκ αεζθμνζηή πνμζηαζία ημοξ ζηζξ ζδιενζκέξ ηαζ ιεθθμκηζηέξ
πενζααθθμκηζηέξ ζοκεήηεξ, δδιζμονβείηαζ δ ακάβηδ πεναζηένς ιεθέηδξ ηδξ μζημ-θοζζμθμβίαξ ηςκ
εαθάζζζςκ αββεζμζπένιςκ ζηζξ πενζααθθμκηζηέξ ηαηαπμκήζεζξ πμο πνμηαθμφκ αοημί μζ πανάβμκηεξ.
H Cymodocea nodosa είκαζ έκα είδμξ ιε ζδιακηζηή ελάπθςζδ ζηδ Μεζυβεζμ Θάθαζζα ηαζ
ζηζξ Κακάνζεξ Νήζμοξ (Mascaró et al. 2009) ηαζ ακαπηφζζεηαζ ζε πμθθέξ πενζμπέξ ηδξ πχναξ, ηονίςξ
ζε αιιχδεζξ πνμθοθαβιέκεξ πενζμπέξ, π.π. ηθεζζημί ηυθπμζ, ή πενζμπέξ ιε ιέηνζμ οδνμδοκαιζζιυ,
υπμο ηαζ ζπδιαηίγεζ ιςζασημφ ηφπμο θζαάδζα (Orfanidis et al. 2005). Δπίζδξ, έπεζ εονεία ελάπθςζδ
ζε ζοκεήηεξ αολακυιεκδξ θοζζηήξ (ηθίζδ αθαηυηδηαξ: Nikolaidou et al. 2005) ηαζ ακενςπμβεκμφξ
(ηθίζδ νφπακζδξ: Orfanidis et al. 2010, Malea & Kevrekidis 2013, Papathanasiou, 2013)
ηαηαπυκδζδξ.
ημπυξ ηδξ πανμφζαξ ιεθέηδξ είκαζ μ πνμζδζμνζζιυξ ηςκ μνίςκ ακμπήξ ηδξ θςημζοκεεηζηήξ
δναζηδνζυηδηαξ ημο θακενυβαιμο Cymodocea nodosa ζε ζπέζδ ιε ηδκ ααζμηζηή πανάιεηνμ
αθαηυηδηα, ςξ ιζα πνμζπάεεζα ηαηακυδζδξ ααζζηχκ ιδπακζζιχκ ηδξ θοζζμθμβίαξ ημο πθδεοζιμφ
ημο είδμοξ ζηδ εαθάζζζα πενζμπή ημο Κυθπμο ηδξ Κααάθαξ, Βυνεζμ Αζβαίμ. Χξ πανάιεηνμξ
απυηνζζδξ πνδζζιμπμζήεδηε δ εκενβυξ θςημκζαηή απυδμζδ ηςκ αθαζηχκ, δ μπμία ααζίγεηαζ ζημ
θεμνζζιυ ηδξ πθςνμθφθθδξ-α (Ralph et al. 1995).
2. ΤΛΗΚΑ – ΜΔΘΟΓΟΗ
2.1 οθθμβή, εβηθζιαηζζιυξ θοηχκ: Πναβιαημπμζήεδηε ζοθθμβή αθαζηχκ Cymodocea
nodosa αάεμοξ 3 ιέηνςκ απυ ημ Αηνςηήνζμ Βναζίδαξ (νιμξ Δθεοεενχκ, Κυθπμξ Κααάθαξ) ζηζξ
31/05/2013. Αημθμφεδζε ημπμεέηδζδ ημοξ ζε εκοδνείμ Plexiglas 6 lt ενεπηζημφ ιέζμο (ΘΜ) ηαζ
ιεηαθμνά ζε εάθαιμ ηαθθζένβεζαξ ζηαεενήξ εενιμηναζίαξ (21-22μC) ηαζ θςηζζιμφ (60 ιmol
θςημκίςκ m-2 s-1, 14 χνεξ θςηυξ) ιε ζημπυ ημκ εβηθζιαηζζιυ βζα ιζα εαδμιάδα. Σμ ΘΜ
δδιζμονβήεδηε απυ ηδκ πνμζεήηδ αθαηζμφ εκοδνείςκ (Münster Meersalz) ζε απζμκζζιέκμ (ζηήθδ
νδηίκδξ) κενυ φδνεοζδξ ηαζ ενεπηζηχκ αθάηςκ. Ζ αθαηυηδηα ημο ΘΜ ήηακ 33,5 ηαζ δ ζοβηέκηνςζδ
αγχημο ηαζ θςζθυνμο 0,3 ιmol/lt N-ΝΟ3 ηαζ 0,02 ιmol/lt P-PO4, ακηίζημζπα.
2.2 Πείναια, ιέηνδζδ θςημζοκεεηζηήξ δναζηδνζυηδηαξ: Μεηά ημκ εβηθζιαηζζιυ (06-06-
2013), ηα θοηά ημπμεεηήεδηακ ζε εκοδνεία 3 θίηνςκ απυ Plexiglas ζπήιαημξ μνεμβςκίμο
παναθθδθεπζπέδμο, ηαεέκα απυ ηα μπμία πενζείπε 3 δεζιίδεξ ημο θοημφ Cymodocea nodosa ηαζ 1
θίηνμ ΘΜ, υιμζμ ιε αοηυ ηδξ θάζδξ εβηθζιαηζζιμφ. Σμ πείναια δζελήπεδ ζε εάθαιμ ηαθθζένβεζαξ
ζηαεενήξ εενιμηναζίαξ, 21-22μ C. Οζ ζοκεήηεξ - αθαηυηδηεξ πμο ιεθεηήεδηακ πνμζδζμνίζηδηακ ιε
θμνδηυ αθαηυιεηνμ (WTW) ηαζ ήηακ μζ ελήξ: 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60.
Μεθεηήεδηακ 6 δεζιίδεξ (επακαθήρεζξ, replicates) βζα ηάεε ζοκεήηδ πεζνάιαημξ. Σμ πείναια
δζήνηδζε 20 διένεξ. Γζα ηζξ ζοκεήηεξ θςηζζιμφ πνδζζιμπμζήεδηακ ζςθδκμεζδείξ θαιπηήνεξ
θεμνζζιμφ 110 cm πμο ελαζθάθζγακ 70-90 ιmol θςημκίςκ m-2 s-1 ζηδκ επζθάκεζα ηςκ δμπείςκ
ηαθθζένβεζαξ, 14 χνεξ ηδκ διένα. Ζ αθθαβή ΘΜ πναβιαημπμζμφκηακ ηάεε δφμ (2) ιένεξ ηαζ δ
ιέηνδζδ ηδξ εκενβμφξ θςημκζαηήξ απυδμζδξ (ΓF/F m') ζημ κευηενμ θφθθμ, πενίπμο 2 εη. απυ ημκ
176
HydroMedit 2014, November 13-15, Volos, Greece
ιίζπμ, ηάεε ηέζζενζξ (4) ιένεξ, ιε ηδ πνήζδ οπμανφπζμο θεμνζυιεηνμο (Underwater Diving-PAM,
Walz, GmbH, Effeltrich, Germany). ημ ηέθμξ ημο πεζνάιαημξ ηναηήεδηακ δείβιαηα ζηδκ ηαηάρολδ
(-20μC) βζα ακάθοζδ πενζεηηζηυηδηαξ ζε πθςνμθφθθδ–α (Chl-α) ζημ θφθθμ ιέηνδζδξ ηδξ ΓF/Fm'.
2.3 Ακάθοζδ πενζεηηζηυηδηαξ θφθθμο ζε πθςνμθφθθδ-α: Γζα ηδκ ακάθοζδ ηδξ
ζοβηέκηνςζδξ ηδξ πθςνμθφθθδξ ζηα θφθθα ηδξ C. nodosa αημθμοεήεδηε δ ιέεμδμξ ηςκ Granger &
Lizumi (2001)
2.4 ηαηζζηζηή ακάθοζδ: Ζ ζηαηζζηζηή επελενβαζία ηςκ δεδμιέκςκ πναβιαημπμζήεδηε ιε
ιμκηέθα ιζηηχκ επζδνάζεςκ (mixed effects models) ζε πενζαάθθμκ R.
3. ΑΠΟΣΔΛΔΜΑΣΑ
ημ πήια 1α δίκμκηαζ μζ ιέζεξ ηζιέξ ηςκ ηζιχκ ηδξ εκενβμφξ θςημκζαηήξ απυδμζδξ
(ΓF/Fm') πμο ιεηνήεδηακ ηαευθδ ηδ δζάνηεζα ημο πεζνάιαημξ ζηζξ δζαθμνεηζηέξ αθαηυηδηεξ. Δκχ μζ
ορδθυηενεξ ιέζεξ ηζιέξ ΓF/Fm' ιεηνήεδηακ ζηζξ αθαηυηδηεξ απυ 25 ιέπνζ 50 (0,734-0,720), μζ
παιδθυηενεξ ιέζεξ ηζιέξ ιεηνήεδηακ ζηζξ αθαηυηδηεξ 5 (0,432) ηαζ 60 (0,515). Με αάζδ ημ ζπήια 1
α, ηα θοηά ζηδκ αθαηυηδηα 5 δείπκμοκ κα ηαηαπμκήεδηακ ακεπακυνεςηα ζηδ δζάνηεζα ημο
πεζνάιαημξ, ιε απμηέθεζια ηδ δναιαηζηή ιείςζδ ηδξ ΓF/Fm´ ζημ ηέθμξ ημο πεζνάιαημξ. Μάθζζηα
δφμ απυ ημοξ 6 αθαζημφξ δεκ άκηελακ ιέπνζ ημ ηέθμξ ημο πεζνάιαημξ ηαζ απμιαηνφκεδηακ απυ ηα
εκοδνεία. Ακηίεεηα, υζμκ αθμνά ζημοξ αθαζημφξ ζηζξ αθαηυηδηεξ 55 ηαζ 60, εκχ ζηδκ ανπή δ
ΓF/Fm´ επδνεάγεηαζ ανκδηζηά, ζηδ ζοκέπεζα θαίκεηαζ κα επακαηάιπηεζ, πςνίξ ςζηυζμ κα
επακένπεηαζ ζηα ανπζηά επίπεδα (πήια 1β, διένεξ 16, 20). φιθςκα ιε ηδ ζηαηζζηζηή ακάθοζδ (δεκ
δίκεηαζ) οπάνπεζ ζηαηζζηζηά ζδιακηζηή δζαθμνμπμίδζδ ακάιεζα ζηζξ αθαηυηδηεξ πμο ελεηάζηδηακ ςξ
πνμξ ηδκ 5, εηηυξ απυ ηδκ αθαηυηδηα 60 (p<0,05).
ημ πήια 1δ δίκμκηαζ μζ ιέζεξ ηζιέξ ηδξ πενζεηηζηυηδηαξ ημο θφθθμο ζε Chl-α ζηζξ
δζαθμνεηζηέξ αθαηυηδηεξ. Δκχ μζ ορδθυηενεξ ιέζεξ ηζιέξ Chl-α ιεηνήεδηακ ζηζξ αθαηυηδηεξ 25 (3,94
ιg/g) ηαζ 35 (3,96 ιg/g), μζ παιδθυηενεξ ιέζεξ ηζιέξ ιεηνήεδηακ ζηζξ αθαηυηδηεξ 5 (1,2 ιg/g) ηαζ 60
(1,4 ιg/g. ηδκ αθαηυηδηα 5 δ Chl-α ιεηνήεδηε ιυκμ ζε 4 αθαζημφξ (αθ. παναπάκς). φιθςκα ιε
ηδ ζηαηζζηζηή ακάθοζδ (δεκ δίκεηαζ) οπάνπεζ ζηαηζζηζηά ζδιακηζηή δζαθμνμπμίδζδ ακάιεζα ζηζξ
αθαηυηδηεξ πμο ελεηάζηδηακ ςξ πνμξ ηδκ 5 (p<0,05).
ρήκα 1: α) Μέζε ηηκή ΓF/F m' (± ηππηθφ ζθάικα-Σ, n=42) γηα θάζε πεηξακαηηθή ζπλζήθε, β)
Γηαθχκαλζε ηηκψλ ΓF/Fm' (Μέζε Σηκή ± Σ, n=6) αλά εκέξα κέηξεζεο γηα ηηο αιαηφηεηεο 5-30,
γ) Γηαθχκαλζε ηηκψλ ΓF/Fm' (ΜΣ ± Σ, n=6) αλά εκέξα κέηξεζεο γηα ηηο αιαηφηεηεο 35-60 θαη
177
HydroMedit 2014, November 13-15, Volos, Greece
δ) Μέζε ηηκή ρισξνθχιιεο-α ζηα θχιια (± Σ, n=4-6) ζην ηέινο ηνπ πεηξάκαηνο γηα θάζε
πεηξακαηηθή ζπλζήθε.
4. ΤΕΖΣΖΖ
Σα απμηεθέζιαηα ηδξ ενβαζίαξ έδεζλακ υηζ ημ είδμξ C. nodosa έπεζ ιάθθμκ εονφαθα
(euryhaline) παναηηδνζζηζηά, πανμοζζάγμκηαξ ιείςζδ ηδξ ΓF/Fm' ηαζ ηδξ Chl-α ηςκ θφθθςκ ιυκμ
ζηζξ αηναίεξ αθαηυηδηεξ (<15, >45). Πανυιμζα απμηεθέζιαηα ανέεδηακ ηαζ απυ άθθμοξ ζοββναθείξ.
Γζα πανάδεζβια, μζ Pagès et al. (2010) πμο ιεθέηδζακ ηδκ επίδναζδ ηδξ αθαηυηδηαξ ζηδκ C. nodosa
ζε πείναια ιζηνυημζιμο βζα 17 ιένεξ ζοιπέναζκακ, υηζ άκηελε ζηδκ 44 πςνίξ ειθακή αθάαδ, αθθά δ
αζςζζιυηδηα ιεζχεδηε ζηζξ 54 ηαζ 62. Οζ Sandoval-Gil et al. (2012) ιεθέηδζακ ηδκ επίδναζδ ηδξ
αθαηυηδηαξ ζηδ θςημζφκεεζδ, ηδκ ακάπηολδ ηαζ ηδκ επζαίςζδ ηδξ C. nodosa ζε πείναια
ιεζυημζιμο βζα 47 ιένεξ. Σα απμηεθέζιαηά ημοξ έδεζλακ ιέηνζα, αθθά ειθακή ιείςζδ ηδξ
θςημζοκεεηζηήξ δναζηδνζυηδηαξ (12-17%) ζε υθεξ ηζξ ορδθέξ αθαηυηδηεξ (39-43). φιθςκα ιε ημοξ
Caye & Meinesz (1986), δ ακάπηολδ ηςκ ζπενιάηςκ είκαζ ιεβαθφηενδ ιεηαλφ ηςκ αθαημηήηςκ 15
ηαζ 20, έκα εφνμξ αθαημηήηςκ πμο ζηδ Μεζυβεζμ ζοκδοάγεηαζ ιε βθοηά κενά ή πενζπηχζεζξ
ηαηαζβίδςκ. Οζ ζοβηεηνζιέκμζ ζοββναθείξ πνμηείκμοκ υηζ μ πνμκζζιυξ ηδξ θφηνςζδξ ηαζ δ ηαηακμιή
C. nodosa ζηδκ δοηζηή Μεζυβεζμ πενζμνίγμκηαζ απυ ηδκ ορδθή αθαηυηδηα.
Απυ ηα παναπάκς θαίκεηαζ υηζ δ C. nodosa έπεζ ορδθή θοζζμθμβζηή πθαζηζηυηδηα ηαζ
ζηακυηδηα κα ακαπηφζζεηαζ ζε πανάηηζα μζημζοζηήιαηα ιε εονεία αθθά υπζ αηναία επίπεδα
αθαημηήηςκ. Σμ βεβμκυξ αοηυ ιάθθμκ ελδβεί ηδκ εονεία ελάπθςζδ ημο είδμοξ ιυκμ ζηζξ αηηέξ ηαζ υπζ
ζηζξ πανάηηζεξ θζικμεάθαζζεξ ηδξ Πενζθένεζαξ Ακαημθζηήξ Μαηεδμκίαξ & Θνάηδξ, μζ αθαηυηδηεξ
ηςκ μπμίςκ ηοιαίκμκηαζ ιεηαλφ 18 ηαζ 60 (Nikolaidou et al. 2005, Orfanidis et al. 2008). οκεπχξ, δ
αφλδζδ ηδξ αθαηυηδηαξ, ζε ζοκδοαζιυ ιε ηδκ ακφρςζδ ηδξ ζηάειδξ ηδξ εάθαζζαξ ηαζ ηδξ ιείςζδξ
ηςκ βθοηχκ κενχκ, ελαζηίαξ ηςκ ηθζιαηζηχκ αθθαβχκ, ιπμνεί κα ζοιαάθθεζ ηαηά πενίπηςζδ ζηδκ
αθθαβή ηδξ ζδιενζκήξ ηαηακμιήξ (αθ. Short & Neckles, 1999). Γζα πανάδεζβια, εκχ ιάθθμκ εα
αμδεήζεζ ζηδκ οπένααζδ ημο ζδιενζκμφ «θνάβιαημξ» ελάπθςζδξ ημο είδμοξ ζημκ πενζμνζζιέκμ
(restricted type) ηφπμ θζικμεαθαζζχκ ηδξ πενζμπήξ, θαίκεηαζ υηζ εα πενζμνίζεζ ηδκ ακαπαναβςβή ηαζ
ηδκ ηαηακμιή αοημφ ημο είδμοξ ζε άθθεξ θζικμεάθαζζεξ ηδξ Μεζμβείμο ηαζ ηδξ Δθθάδαξ ιε
πενζζζυηενμ εαθάζζζα (leaky type) παναηηδνζζηζηά.
οιπεναζιαηζηά, δ πεζναιαηζηή ιεθέηδ ηδξ θςημζοκεεηζηήξ δναζηδνζυηδηαξ αθαζηχκ ημο
είδμοξ C. nodosa, δ μπμία ααζίζηδηε ζοκδοαζηζηά ζε ζφβπνμκεξ (θεμνζζιυξ ηδξ πθςνμθφθθδξ) ηαζ
ηθαζζζηέξ (ζοβηέκηνςζδ πθςνμθφθθδξ) ιεευδμοξ ηδξ θοζζμθμβίαξ ηςκ θοηχκ, έδεζλε υηζ ιπμνεί κα
αλζμπμζδεεί ζηδκ ηαηακυδζδ ηδξ οπάνπμοζαξ ηαζ ιεθθμκηζηήξ ηαηακμιήξ ημο είδμοξ ζηδκ εονφηενδ
πενζμπή ηδξ Ακαημθζηήξ Μαηεδμκίαξ & Θνάηδξ.
ΒΗΒΛΗΟΓΡΑΦΗΑ
Alberto F., Gouveia L., Arnaud‐Haond S., Pérez‐Lloréns J. L., Duarte C. M., Serrao E. A. (2005).
Within‐population spatial genetic structure, neighbourhood size and clonal subrange in the
seagrass Cymodocea nodosa. Molecular Ecology 14, 2669-2681.
Bloomfield A. L., Gillanders B. M. (2005). Fish and invertebrate assemblages in seagrass, mangrove,
saltmarsh, and nonvegetated habitats. Estuaries 28, 63-77.
Costanza R., D'Arge R., De Groot R., Farber S., Grasso M., Hannon B., Limburg K., Naeem S.,
O'Neill R.V., Paruelo J., Raskin R.G., Sutton P., Van Den Belt M. (1997). The value of the
world's ecosystem services and natural capital. Nature 387, 253-260.
den Hartog C., Kuo J. (2006). Taxonomy and biogeography of seagrasses. In ‗Seagrasses: Biology,
Ecology and Conservation‘ Larkum A. W. D., Orth R. J., Duarte C. M. (eds.), p. 1-23.
Fernández-Torquemada Y., Gónzalez-Correa J.M., Loya A., Ferrero L.M., Díaz- Valdés M., Sánchez-
Lizaso J.L. (2009). Dispersion of brine discharge from a seawater reverse osmosis
desalination plants. Desalination and Water Treatment 5, 137-145.
Gacia E., Invers O., Manzanera M., Ballesteros E., Romero J. (2007). Impact of the brine from a
desalination plant on a shallow seagrass (Posidonia oceanica) meadow. Estuarine, Coastal
and Shelf Science 72, 579-590.
178
HydroMedit 2014, November 13-15, Volos, Greece
Granger S., Lizumi H. (2001). Water quality measurement methods for seagrass habitat. Global
seagrass research methods. Short F. T., Coles R. G., Short C. A. Amsterdam, Elsevier, 402-
404.
Heck Jr. K. L., Hays G., Orth R. J. (2003). Critical evaluation of the nursery role hypothesis for
seagrass meadows. Marine Ecology Progress Series 253, 123-136.
Hemminga M.A., Duarte, C.M. (2000). Seagrass Ecology. Cambridge University Press, Cambridge,
UK, p. 298.
Koch M., Bowes G., Ross C., Zhang X. (2013). Climate change and ocean acidification effects on
seagrasses and marine macroalgae. Global Change Biology 19, 103–132.
Malea P., Kevrekidis T. (2013). Trace element (Al, As, B, Ba, Cr, Mo, Ni, Se, Sr, Tl, U and V)
distribution and seasonality in compartments of the seagrass Cymodocea nodosa. Science of
the Total Environment 463–464, 611–623.
Mascaró O., Oliva O., Pérez M., Romero J. (2009). Spatial variability in ecological attributes of the
seagrass Cymodocea nodosa. Botanica Marina 52, 429-438.
Nicolaidou A., Reizopoulou S., Koutsoubas D., Orfanidis S., Kevrekidis Th. (2005). Biological
components of Greek lagoonal ecosystems: an overview. Mediterranean Marine Science 6,
31-50.
Orfanidis S., Panayotidis P., Siakavara A. (2005). Benthic macrophytes: main trends in diversity and
distribution. In ‗State of the Hellenic Environment‘, Chapter VI. Biota of the sea bed,
Papathanassiou E., Zenetos A. (Eds), pp. 226-235 HCMR Publication.
Orfanidis S., Pinna M., Sabetta L., Stamatis N., Nakou K. (2008). Variation of structural and
functional metrics in macrophyte communities within two habitats of eastern Mediterranean
coastal lagoons: natural versus human effects. Aquatic Conservation: Marine and Freshwater
Ecosystems 18, S45-S61.
Orfanidis S.,Papathanasiou V.,Gounaris S., Theodosiou T. (2010). Size distribution approaches for
monitoring and conservation of coastal Cymodocea habitats. Aquatic Conservation: Marine
and Freshwater Ecosystems 20, 177-188.
Pagès J. F., Pérez M., Romero J. (2010). Sensitivity of the seagrass Cymodocea nodosa to hypersaline
conditions: A microcosm approach. Journal of Experimental Marine Biology and Ecology
386, 34-38.
Papathanasiou V. (2013). Cymodocea nodosa as a bioindicator of coastal habitat quality: an
integrative approach from organism to community scale. School of Marine Science and
Engineering. Plymouth, University of Plymouth. PhD.
Ralph P. J., Burchett M. D. (1995). Photosynthetic responses of the seagrass Halophila ovalis (R. Br.)
Hook. f. to high irradiance stress, using chlorophyll a fluorescence. Aquatic Botany 51(1-2),
55-66.
Sandoval-Gil J. M., Marín-Guirao L., Ruiz J. M. (2012). The effect of salinity increase on the
photosynthesis, growth and survival of the Mediterranean seagrass Cymodocea nodosa.
Estuarine, Coastal and Shelf Science 115, 260-271.
Schwinning S., Weiner J. (1998). Mechanisms determining the degree of size asymmetry in
competition among plants. Oecologia 113, 447-455.
Short F. T., Neckles H. A. (1999). The effects of global climate change on seagrasses. Aquatic Botany
63, 169-196.
179
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
This research aims to study the socio-economical benefits of a protected area especially the economic
influence on the local finances. Specifically, the survey was conducted in a Protected Area that is part
of the new Lake Karla. For this reason a survey of 200 respondents randomly selected residents of
Volos city was carried out with the use of a contracted questionnaire. The questionnaire was designed
to reflect residents‘ attitudes for the benefits which were resulted by membership of the lake in a
special protected status Principal Components Analysis was used as a tool for measuring different
public perceptions and preferences with regard to benefits of Lake Karla. We have extracted three
factors explaining 54.2 % of the fluctuation of the total variance. The main conclusion of the research
is that the restored lake is a unique opportunity for sustainable development of alternative forms of
tourism which will bring substantial economic benefits.
Πεξίιεςε
Ζ πανμφζα ένεοκα είπε ςξ ζηυπμ ηδκ απμηφπςζδ ηςκ ςθεθεζχκ πμο εα πνμηφρμοκ απυ ηδκ
ακαζφζηαζδ ηδξ θίικδξ Κάνθα. Γζα ηδκ οθμπμίδζδ ηςκ ζηυπςκ ηδξ ένεοκαξ δζελήπεδ πνςημβεκήξ
ένεοκα ιε ηδ πνήζδ δμιδιέκμο ενςηδιαημθμβίμο ζε έκα δείβια 200 ηαημίηςκ ημο Γδιμηζημφ
Γζαιενίζιαημξ ημο Βυθμο. Σμ ενςηδιαημθυβζμ είπε ςξ ζηυπμ ηδ δζενεφκδζδ ηςκ απυρεςκ ηςκ
πμθζηχκ βζα ηζξ εζδζηά πνμζηαηεουιεκεξ πενζμπέξ αθθά ηαζ ηδκ έκηαλδ ηδξ εονφηενδξ πενζμπήξ ηδξ
θίικδξ Κάνθα ζε εζδζηυ ηαεεζηχξ πνμζηαζίαξ. Γζα ηδκ ελαβςβή ηςκ παναβυκηςκ πμο απμηοπχκμοκ
ηα παναπάκς μθέθδ εθανιυζηδηε Ακάθοζδ Κονίςκ οκζζηςζχκ (PCA), ιε ηδ αμήεεζα ιζαξ
πμθοεειαηζηήξ ενχηδζδξ ιε 39 εέιαηα. Ζ ακάθοζδ έδςζε ηνεζξ πανάβμκηεξ πμο ελδβμφκ ημ 54,2 %
ηδξ ζοκμθζηήξ ιεηααθδηυηδηαξ. φιθςκα ιε ηα απμηεθέζιαηα, δ ακαζφζηαζδ ηδξ θίικδ, απμηεθεί
ιζα ιμκαδζηή εοηαζνία βνήβμνδξ αθθά ηαζ αζχζζιδξ ακάπηολδξ εκαθθαηηζηχκ ιμνθχκ ημονζζιμφ
πμο εα απμθένεζ ζδιακηζηά ημζκςκζημμζημκμιζηά μθέθδ.
1.Δηζαγσγή
O εεζιυξ ηςκ πνμζηαηεοιέκςκ πενζμπχκ απμηέθεζε, παβημζιίςξ, έκα απυ ηα
ααζζηά «ενβαθεία» πμθζηζηήξ βζα ηδ δζαηήνδζδ ημο θοζζημφ πενζαάθθμκημξ. Σαοηυπνμκα, δ ίδνοζδ
ιζαξ πνμζηαηεουιεκδξ πενζμπήξ ζημπεφεζ, εηηυξ απυ ηδκ πνμζηαζία ημο θοζζημφ πενζαάθθμκημξ, ηαζ
ζηδκ πανμπή εοηαζνζχκ οπαίενζαξ ακαροπήξ ηαζ πενζααθθμκηζηήξ εηπαίδεοζδξ αθθά ηαζ ηζκήηνςκ
180
HydroMedit 2014, November 13-15, Volos, Greece
ηυκςζδξ ηαζ εκίζποζδξ ημο ημζκςκζημμζημκμιζημφ ζζημφ, ζδίςξ ηςκ μνεζκχκ ημζκςκζχκ ηαζ άνζδξ
ηςκ ημζκςκζηχκ απμηθεζζιχκ. Οζ πνμζδμηίεξ ηςκ ημπζηχκ ημζκςκζχκ απυ ημ εεζιυ είκαζ αολδιέκεξ
ηαζ εζηζάγμκηαζ ζε έκα ζδιακηζηυ ανζειυ ημζκςκζημμζημκμιζηχκ ςθεθεζχκ, ζδζαίηενα ζήιενα πμο δ
μζημκμιζηή ηνίζδ έπεζ ςξ απμηέθεζια ηδ ζοκεπή ζοννίηκςζδ ηςκ εζζμδδιάηςκ ηαζ ηδκ αφλδζδ ηδξ
ακενβίαξ.
Ζ δζενεφκδζδ ηςκ ςθεθεζχκ πμο πδβάγμοκ απυ ηδκ φπανλδ ιζαξ εζδζηά πνμζηαηεουιεκδξ
πενζμπήξ απμηέθεζε ακηζηείιεκμ πμθθχκ ενεοκχκ (Costanza 2000; Heal 2000; Constanza and Farber
2002; de Groot et al. 2002; Ferber et al 2002). Έπεζ δζαπζζηςεεί υηζ φπανλδ ιζαξ πνμζηαηεουιεκδξ
πενζμπήξ ζοκδέεηαζ ιε μθέθδ ηυζμ ζε ημπζηυ (Smith 2001; Ngugi 2002; Saayman et al. 2009) υζμ ηαζ
ζε εεκζηυ επίπεδμ (Oberholzer et all. 2009) πμο ζοκδέμκηαζ ιε ηδκ αφλδζδ ηδξ παναβςβήξ, ηδκ
εκίζποζδ ημο εζζμδήιαημξ ηςκ ημπζηχκ ημζκςκζηχκ ηαζ ηδξ απαζπυθδζδξ ηαζ ηδκ ημονζζηζηή
ακάπηολδ.
ηδ πχνα ιαξ έπμοκ πναβιαημπμζδεεί πανυιμζεξ ένεοκεξ πμο ζημπυ ηδκ απμηφπςζδ ηςκ
ζηάζεςκ ηςκ πμθζηχκ απέκακηζ ζημ εεζιυ ηςκ πνμζηαηεουιεκςκ πενζμπχκ (Dimitrakopoulos et all.
2010), ημκ εκημπζζιυ ηαζ ηδ ζηζαβνάθδζδ ηςκ ςθεθεζχκ πμο μζ πμθίηεξ ακαιέκμοκ απυ ηδ
δδιζμονβία ιζαξ εζδζηά πνμζηαηεουιεκδξ πενζμπήξ (Μαζημνμβζάκκδ ηαζ ζοκ 2012) ηαζ ηδκ
μζημκμιζηή απμηίιδζδ ηςκ ςθεθεζχκ πμο πνμένπμκηαζ απυ ηδκ φπανλή ημοξ (Κoutseris 2001). Οζ δφμ
ηεθεοηαίεξ ενβαζίεξ ακαθένμκηαζ ζηδ Λίικδ Κάνθα.
ημπυξ ηδξ πανμφζαξ ένεοκαξ ήηακ δ δζενεφκδζδ ηαζ μ πνμζδζμνζζιυξ ηςκ ςθεθεζχκ
(ημζκςκζηχκ, πενζααθθμκηζηχκ, ακαπηολζαηχκ ηαζ μζημκμιζηχκ), πμο ζφιθςκα ιε ημοξ ηαημίημοξ εα
πνμηφρμοκ βζα ηδκ πενζμπή απυ ηδκ ακαζφζηαζδ ηδξ θίικδξ Κάνθα ηαζ ηδκ έκηαλδ ηδξ εονφηενδξ
πενζμπήξ ζε εζδζηυ ηαεεζηχξ πνμζηαζίαξ.
Ζ ακαβκχνζζδ ηςκ παναβυκηςκ, μζ μπμίμζ πενζβνάθμοκ ηζξ ιεηααθδηέξ πμο πενζηθείμοκ, έβζκε
ιε πενζζηνμθή ηςκ παναβυκηςκ ιε ηδ ιέεμδμ ηδξ μνεμβςκζηήξ πενζζηνμθήξ ή ιέεμδμ ηδξ
πενζζηνμθήξ ηδξ ιέβζζηδ δζαηφιακζδξ (Varimax). Αοηυ ζδιαίκεζ υηζ μζ πανάβμκηεξ (ζοκζζηχζεξ-
components) πμο ελήπεδζακ είκαζ βναιιζηά αζοζπέηζζημζ (Υνζζημδμφθμο η.ά., 2002). Ζ
181
HydroMedit 2014, November 13-15, Volos, Greece
ζοβηεηνζιέκδ ιέεμδμξ πνμηείκεηαζ απυ ημκ Kaiser ηαζ είκαζ δ πθέμκ πνδζζιμπμζμφιεκδ. Γζα ημκ
ηαεμνζζιυ ηςκ παναβυκηςκ πμο ελήπεδζακ δεκ πνδζζιμπμζήεδηε ημ ηνζηήνζμ ηδξ ζδζμηζιήξ αθθά μ
ανζειυξ επζθέπεδηε ιε αάζδ ηδ ζοιαμθή ημο επυιεκμο πανάβμκηα ζηδκ ελδβμφιεκδ δζαηφιακζδ.
3. Απνηειέζκαηα
ημκ Πίκαηα 1 δίκμκηαζ ηα ααζζηά ημζκςκζημμζημκμιζηά παναηηδνζζηζηά ημο δείβιαημξ.
182
HydroMedit 2014, November 13-15, Volos, Greece
4. πδήηεζε
Ζ πανμφζα ένεοκα είπε ςξ ζηυπμ ημκ εκημπζζιυ ηςκ εζδζηχκ ημζκςκζηχκ ηαζ
μζημκμιζηχκ ςθεθεζχκ πμο εα πνμηφρμοκ απυ ηδκ έκηαλδ ηδξ εονφηενδξ πενζμπήξ ζε εζδζηυ
ηαεεζηχξ πνμζηαζίαξ, αθθά ηαζ κα δζενεοκήζεζ ηζξ απυρεζξ ηςκ πμθζηχκ βζα ηζξ επζδνάζεζξ αοημφ ημο
εζδζημφ ηαεεζηχημξ ζηδκ εονφηενδ πενζμπή ηδξ θίικδξ Κάνθαξ ηαζ εζδζηυηενα ζηζξ ημπζηέξ ημζκςκίεξ.
Οζ ηάημζημζ πνμζδμημφκ ζε κέεξ εοηαζνίεξ ζηα ήδδ οπάνπμκηα επαββέθιαηα ιέζα απυ εκαθθαηηζηέξ
ιμνθέξ ημονζζιμφ, ζηδκ πνμζέθηοζδ ημονζζηχκ, ιαεδηχκ ηαζ ενεοκδηχκ ζημκ ηαζκμφνζμ αοηυκ
αζυημπμ. Οζ ακενχπζκεξ δναζηδνζυηδηεξ ζε ζζμννμπία ιε ημ θοζζηυ πενζαάθθμκ αθθά ηαζ ιε ηδκ
πνμαμθή ηδξ πανάδμζδξ, ηδξ πμθζηζζηζηήξ ηθδνμκμιζάξ ηαζ ηδκ ακάδεζλδ ημο θζικαίμο πμθζηζζιμφ
ηδξ πενζμπήξ, εα έπμοκ ςξ απμηέθεζια ηδκ άκμδμ ημο αζμηζημφ επζπέδμο ημο ημπζημφ πθδεοζιμφ.
Βηβιηνγξαθία
Costanza R. (2000). Social goals and the valuation of ecosystem services. Ecosystems 3(1): 4-10.
Costanza R. and S. Farber (2002). Introduction to the special issue on the dynamics and value of
ecosystem services: integrating economic and ecological perspectives. Ecological Economic 42
(3): 367-373.
De Groot R.S., M.A. Wilson and R.M.J. Boumans (2002). A typology for the classification,
description and valuation of ecosystem functions, goods and services. Ecological Economics
41 (3): 393-408.
Ferber, S.C., R. Costanza and M.A. Wilson (2002). Economic and ecological concepts for valuing
ecosystem services. Ecological Economics 41 (3): 375-392.
Oberholzer S, M. Saayman A. Saayman and E. Slabbert (2009). The Socio – Economic Impact of
Africa‘s Oldest Marine Park. Proceedings of CMT2009, the 6 th International Congress and
Marine Tourism, 23 – 26 June 2009.
Ngugi,I. (2002). Economic impacts of marine protected areas: A case study of the Mambasa Marine
Park.
Saayman M. Saayman A. and Ferreira M. (2009). The socio – economic impact of the Karoo National
Park in http:// www.koedoe.co.za.
183
HydroMedit 2014, November 13-15, Volos, Greece
Dimitrakopoylos G.P., Jones N., Iosifides T., Florokapi I., Lasda O., Palioyras F. and Evangelinos
K.I. (2010). Local attitudes on protected areas: Evidence from three Natura 2000 wetland sites
in Greece. Journal of Environmental Management, 91, 1847 – 1854.
Koutseris E. (2001). One ex post evaluation of the application contingent valuation method: The case
of the former lake Karla, Greece.
Μαζημνμβζάκκδ Δ., Κμηζίνδ Ε., Υαηζζςάκκμο Μ., Κάβηαθμο Η., Μαηζζχνδ . (2012)
Κμζκςκζημμζημκμιζηά μθέθδ απυ ηδκ πνμζηαηεουιεκδ πενζμπή ηδξ Λίικδξ Κάνθα. Πναηηζηά
10μο Πακεθθήκζμο οιπμζίμο Χηεακμβναθίαξ & Αθζείαξ 07-11 Μαΐμο 2012.
Εαθίδδξ Γ.Υ., Ξ. Γδιδηνζάδδξ ηαζ . Υαηγδβζακκάηδξ (ζοκημκζζηέξ έηδμζδξ). 1995α. Ο ζδευηοπμξ
ηδξ ηέςξ Λίικδξ Κάνθαξ ςξ αάζδ αλζμθυβδζδξ ηςκ πνμηαεεζζχκ θφζεςκ ηαηαζηεοήξ ημο
μιχκοιμο ηαιζεοηήνα. Δθθδκζηυ Κέκηνμ Βζμηυπςκ-Τβνμηυπςκ (ΔΚΒΤ). Θένιδ. 91 ζεθ.
Hair J. F. Jr., Anderson, R. E., Tatham, R. C & Black, W. C. (1995): Multivariate Analysis With
Readings.4th ed., Englewood Cliffs, N.J.: Prentice Hall.
Sharma S. (1996). Applied Multivariate Techniques. USA: John Willey & Sons, Inc.
Churchill, G. (1995): Marketing Research: Methodological Foundations, 6th ed. Forth Worth: Dryden
Press.
Heal G. (2000). Valuing ecosystem services. Ecosystem 3 (1) 24-30.
184
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
The central urban runoff pipe outlet of the city of Chania is located in the west side of the city, on the
coastal area of Koum Kapi, close to a beach used for swimming by the public. Throughout the 2012-
14 period, water samples were collected from the central urban runoff pipe outlet, in the framework of
ARCHIMEDES project. Seawater samples were also collected from the coastal area of Koum Kapi,
5m, 15m and 30m away from the urban runoff pipe outlet. During this research period, the total and
fecal coliforms, E. coli and enterococcus were measured. The high level of the pollution load
measured in the urban runoff pipe outlet, was reduced by 90-97% in a vertical distance of 5m from the
pipe outlet and at 0.7m depth. A diffusion model - based on additional data obtained from pollution
diffusion measurements at each side of the pipe - could support decision makers to prevent future
coastal water pollution.
ΕΠΙΒΑΡΤΝΗ ΠΑΡΑΚΣΙΩΝ ΤΔΑΣΩΝ ΑΠΟ ΣΟΝ ΑΓΩΓΟ ΟΜΒΡΙΩΝ ΣΗ ΠΟΛΗ ΣΩΝ ΧΑΝΙΩΝ
Πεξίιεςε
Ζ εηνμή ημο ηεκηνζημφ αβςβμφ υιανζςκ ηδξ πυθδξ ηςκ Υακίςκ ανίζηεηαζ ζηδκ δοηζηή πθεονά ηδξ
αηηήξ Κμοι-Καπί ιεηαλφ «ηαηά πανάδμζδ» ζδιείςκ ημθφιαδζδξ ηαημίηςκ ηδξ πενζμπήξ ηαζ
επζζηεπηχκ ηδξ παθζάξ πυθδξ. Σδκ πενίμδμ 2012-2014, ζηα πθαίζζα ημο οπμένβμο ΑΡΥΗΜΖΓΖ,
πναβιαημπμζήεδηακ δεζβιαημθδρίεξ απυ ηδκ εηνμή ημο αβςβμφ ηαζ ηδκ εαθάζζζα πενζμπή, ζε
δζάθμνεξ απμζηάζεζξ απυ ημκ αβςβυ. Πνμζδζμνίζηδηε δ ζοβηέκηνςζδ ηςκ ιζηνμαζμθμβζηχκ δεζηηχκ:
μθζηά ηαζ ημπνακχδδ ημθμααηηήνζα, E. coli, ηαζ εκηενυημηημξ. Σμ ιζηνμαζμθμβζηυ θμνηίμ πμο
απμαάθθεηαζ ιέζς ημο αβςβμφ είκαζ ζδζαίηενα ζδιακηζηυ αθθά δ αναίςζδ πμο παναηδνήεδηε ζηδκ
εαθάζζζα πενζμπή έθηαζε ζημ 90-97% ζηδκ ζζμααεή 0,7 ι ηαζ ζε απυζηαζδ ιεβαθφηενδ ηςκ 5 ι απυ
ηδκ έλμδμ ημο αβςβμφ. Ζ εθανιμβή ηςκ απμηεθεζιάηςκ ζε ηαηάθθδθμ ιμκηέθμ δζάποζδξ νφπςκ
ιπμνεί κα απμηεθέζεζ ενβαθείμ πνυαθερδξ ηδξ επζαάνοκζδξ πανάηηζςκ πενζμπχκ απυ πνυεεζδ ή
αηφπδια ιέζς ηςκ αβςβχκ υιανζςκ.
1. Δηζαγσγή
Οζ αβςβμί υιανζςκ αζηζηχκ πενζμπχκ ζοκδέμκηαζ ζοπκά ιε ηδκ επζαάνοκζδ ηςκ πανάηηζςκ
πενζμπχκ εηθυνηζζδξ ηαζ ηδκ οπμαάειζζδ ηδξ πμζυηδηαξ ηςκ κενχκ ημθφιαδζδξ ηδξ πενζμπήξ ηαεχξ
ιπμνμφκ κα ιεηαθένμοκ πδιζηυ ηαζ αζμθμβζηυ νοπμβυκμ θμνηίμ άβκςζηδξ ζοβηέκηνςζδξ (Parker
185
HydroMedit 2014, November 13-15, Volos, Greece
etal, 2010, Jeng etal, 2005). Οζ πανάβμκηεξ πμο ζοιαάθθμοκ ζηδκ δδιζμονβία αοημφ ημο νοπμβυκμο
θμνηίμο είκαζ, ιεηαλφ άθθςκ, δ δζάανςζδ ημο εδάθμοξ, ηα λεπθφιαηα ηςκ αηαεανζζχκ ηςκ δνυιςκ,
δ ζοζζχνεοζδ ηαζ ημ λέπθοια ηδξ αηιμζθαζνζηήξ ζηυκδξ ηαζ ηα ηαηαηνδικίζιαηα (Nazahiyah etal,
2007), ιε απμηέθεζια κα εκημπίγεηαζ μνβακζηυ θμνηίμ, αανέα ιέηαθθα, ενεπηζηά ζοζηαηζηά,
θοημθάνιαηα, θίπδ, έθαζα, οδνμβμκάκεναηεξ ηαζ ααηηήνζα (Gnecco etal 2005, Bedan etal 2009).
ζμκ αθμνά ημ ιζηνμαζμθμβζηυ θμνηίμ, αοηυ απμηεθεί ζδιακηζηυ νφπμ ηςκ αζηζηχκ απμννμχκ
ηαεχξ ζοπκά ζοκακηάηαζ ανηεηά ιεβάθμξ ανζειυξ απμζηζχκ παεμβυκςκ ιζηνμμνβακζζιχκ, ιεηαλφ
ηςκ μπμίςκ είκαζ ηαζ ηα μθζηά ηαζ ημπνακχδδ ημθμααηηήνζα, E.coli ηαζ εκηενυημηημξ, (Jeng etal,
2005). Ζ πανμοζία ιζηνμαζμθμβζημφ θμνηίμο ζηζξ αζηζηέξ απμννμέξ, ηζξ ηαεζζηά ελαζνεηζηά
επζηίκδοκεξ βζα ηδ δδιυζζα οβεία, αθμφ έπεζ ακαθενεεί υηζ μνζζιέκεξ θμνέξ δ ζοβηέκηνςζή ηςκ
ιζηνμαζαηχκ απμζηζχκ ιπμνεί κα θηάζεζ εηείκδ ηςκ απμζηζχκ πμο πενζέπμκηαζ ζε αναζςιέκα
αηαηένβαζηα απυαθδηα (Qureshi etal 1979).
Ζ πανμφζα ιεθέηδ είπε ζημπυ ηδκ εηηίιδζδ ημο νοπμβυκμο θμνηίμο πμο ιπμνεί κα ιεηαθενεεί
ιέζς ημο ηεκηνζημφ αβςβμφ υιανζςκ ηδξ πυθδξ ηςκ Υακίςκ ζημ ζδιείμ εηθυνηζζδξ ημο ζηδκ
εαθάζζζα πενζμπή ημο Κμοι Καπί ηαζ ημο ααειμφ επζαάνοκζδξ ηςκ κενχκ ημθφιαδζδξ ζηδκ πενζμπή
βφνς απυ ημ ζδιείμ εηθυνηζζδξ. Σα απμηεθέζιαηα πμο πανμοζζάγμκηαζ αθμνμφκ ηδκ δζάποζδ ημο
ιζηνμαζμθμβζημφ θμνηίμο ηαεχξ ανέεδηε κα έπεζ ζοκεπή πανμοζία ηαζ ορδθή ζοβηέκηνςζδ ζηα
δείβιαηα πμο ζοβηεκηνχεδηακ απυ ηδκ πενζμπή ιεθέηδξ ηαζ εοκμεί ηδκ ιεθέηδ ημο ααειμφ ιείςζδξ
ημο νοπμβυκμο θμνηίμο ακάθμβα ιε ηδκ απυζηαζδ απυ ημ ζδιείμ εηθυνηζζδξ.
Ζ εαθάζζζα πενζμπή ημο ηυθπμο Κμοι Καπί ανίζηεηαζ ζημ δοηζηυ άηνμ ηδξ παθζάξ πυθδξ ηςκ
Υακίςκ ηαζ απμηεθεί ακέηαεεκ ζδιείμ ημθφιαδζδξ βζα ημοξ ηαημίημοξ ηδξ πενζμπήξ αθθά ηαζ ημοξ
επζζηέπηεξ (Δζηυκα 1 ζδιεία 2,3). Ζ δζάανςζδ ηδξ αηηήξ απυ ημκ ζοπκά έκημκμ ηοιαηζζιυ αθθάγεζ
ηδκ ιμνθή ηδξ παναθίαξ ηαζ δεκ επζηνέπεζ ηδκ δζαηήνδζδ αιιχδμοξ ηιήιαημξ ζε υθμ ημ ιήημξ ηδξ
παναθίαξ πανά ιυκμ ζημ ηεκηνζηυ ζδιείμ ημο ηυθπμο ηαζ ζε απυζηαζδ 500 ι πενίπμο κμηζυηενα απυ
ημ ζδιείμ εηνμήξ ημο αβςβμφ υιανζςκ (Δζηυκα 1 ζδιείμ 3). Ζ πενζμπή έπεζ ακμζηηυ ιέηςπμ ιε ημκ
ηυθπμ ηςκ Υακίςκ πςνίξ ειπυδζα ή ένβα πνμζηαζίαξ απυ ηδκ ιακία ηςκ ηοιάηςκ.
Ο αβςβυξ υιανζςκ οδάηςκ πμο εηαάθεζ ζηδκ εαθάζζζα πενζμπή ημο Κμοι Καπί ζοβηεκηνχκεζ
ημκ ιεβαθφηενμ υβημ ηςκ αζηζηχκ απμννμχκ ηδξ πυθδξ ηςκ Υακίςκ (Δζηυκα 1 ζδιείμ 1). Ο
ζοκμθζηυξ υβημξ ηςκ υιανζςκ οδάηςκ πμο ιεηαθένμκηαζ εηδζίςξ ιέζς ημο ζοβηεηνζιέκμο αβςβμφ
οπμθμβίγμκηαζ, ηαηά ιέζμ υνμ, ζηα 350*10 3m3 ιε ηαηακμιή πμο ελανηάηαζ άιεζα απυ ημ εηήζζμ φρμξ
ανμπήξ ηαζ ηδκ έκηαζδ ηςκ ηαζνζηχκ θαζκμιέκςκ. Δπζπθέμκ, ιεβάθμ ιένμξ ηδξ λδνήξ πενζυδμο,
εηηζιάηαζ υηζ απμννέμοκ πενίπμο 60 m3 διενδζίςξ, ζοπκά ζδζαίηενα ορδθμφ, νοπμβυκμο θμνηίμο.
186
HydroMedit 2014, November 13-15, Volos, Greece
60μ
Β
2
30μ
15μ
5μ
1
Δηθφλα 1. Ζ παξαιία Κνπκ Καπί. Ζ εθξνή ηνπ αγσγνχ βξίζθεηαη ζην ζεκείν 1. Σα ζεκεία
θνιχκβεζεο ησλ θαηνίθσλ ηεο πεξηνρήο είλαη ηα ζεκεία 2 θαη 3. Μπξνζηά απφ ηελ εθξνή ηνπ
αγσγνχ (ζεκείν 1) θαίλεηαη ην πιέγκα ησλ ζεκείσλ δεηγκαηνιεςίαο ζηα 5κ, 15κ, 30κ.
Σα δείβιαηα κενμφ ιεηαθενυηακ ιε θμνδηυ ροβείμ (4 oC) ζημ Δνβαζηήνζμ βζα ημκ πνμζδζμνζζιυ
ημο ιζηνμαζμθμβζημφ θμνηίμο (APHA, 1998). Οζ ιζηνμαζμθμβζηέξ ακαθφζεζξ έβζκακ ιε ηδκ ιέεμδμ
ηδξ δζήεδζδξ κενμφ ζε απμζηεζνςιέκα θίθηνα ηοηηανίκδξ 47mm/0.45por (Gelman GN 66191) ηαζ
ηδκ επχαζδ ημοξ ζε ηαηάθθδθα οπμζηνχιαηα (IDG, 2002). Γζα μθζηά ηαζ ημπνακχδδ ημθμααηηήνζα
πνδζζιμπμζήεδηε οπυζηνςια Membrane Lauryl Sulphate Broth (Lab Μ 82), βζα E. coli οπυζηνςια
Harlequin TBGA (HAL 003) ηαζ βζα εκηενυημηημ Slanetz & Bartle Medium (LAB 166). Σα ηνοαθία
ημπμεεηήεδηακ ζε εαθάιμοξ επχαζδξ 37μC ή 44μC ακηίζημζπα βζα 24 ή 48. Μεηά ημκ ηαηάθθδθμ
πνυκμ επχαζδξ έβζκε ηαηαιέηνδζδ ηςκ απμζηζχκ μθζηχκ ηαζ ημπνακςδχκ ημθμααηηδνίςκ, E.coli ηαζ
εκηενμηυηηςκ. Γζα κα είκαζ εθζηηή δ ηαηαιέηνδζδ ηςκ απμζηζχκ ζηα δείβιαηα απυ ηδκ εηνμή ημο
αβςβμφ απαζηήεδηε αναίςζδ ημο δείβιαημξ ιέπνζ ηαζ 1:1000.
3. Απνηειέζκαηα - πδήηεζε
Ζ ακάθοζδ ηςκ δεζβιάηςκ κενμφ απυ απυζηαζδ 5 (αάεμξ 0,7ι), 15 (αάεμξ 1,0ι), ηαζ 30ι (αάεμξ
1,5ι), απυ ηδκ έλμδμ ημο αβςβμφ (Πίκαηαξ 1) έδεζλε ηδκ ιείςζδ ηςκ ηζιχκ ηςκ ιζηνμαζμθμβζηχκ
δεζηηχκ ηαηά 98-99,5% ζε απυζηαζδ ιεβαθφηενδ ηςκ 5 ι. Με αάζδ αοηυ ημ πμζμζηυ ιείςζδξ
επζθέπεδηε δ απυζηαζδ ηςκ 5 ι απυ ηδκ μπμία θήθεδηακ δείβιαηα κενμφ ηαε υθδ ηδκ δζάνηεζα ημο
έημοξ πενζθαιαάκμκηαξ οβνή ηαζ λδνή πενίμδμ.
Πίλαθαο 1. Μείσζε ηνπ κηθξνβηνινγηθνχ θνξηίνπ αλάινγα κε ηελ απφζηαζε απφ ηνλ αγσγφ
φκβξησλ ζηελ
187
HydroMedit 2014, November 13-15, Volos, Greece
Σα απμηεθέζιαηα ηςκ ακαθφζεςκ ζηα δείβιαηα ημο αβςβμφ υιανζςκ οδάηςκ έδεζλακ ηδκ ορδθή
ζοβηέκηνςζδ υθςκ ηςκ ιζηνμαζμθμβζηχκ δεζηηχκ ηαηά ηδκ 3εηία οθμπμίδζδξ ηδξ ένεοκαξ (πήια 1).
Ζ ζοβηέκηνςζδ απμζηζχκ βζα ηα μθζηά ημθμααηηήνζα ηοιάκεδηε ιεηαλφ 9.000 – 1.200.000
cfu/100ml εκχ βζα ηα ημπνακχδδ ημθμααηηήνζα ήηακ ιεηαλφ 11.000 - 630.000 cfu/100ml. Ακάθμβα
ορδθή ήηακ ηαζ δ ζοβηέκηνςζδ απμζηζχκ Δ. coli 4.000 – 460.000 cfu/100ml ηαζ εκηενμηυηημο 450 –
217.000 cfu/100ml. Σμ βεβμκυξ υηζ μζ ηζιέξ ηςκ δεζηηχκ είκαζ ζδζαίηενα ορδθέξ, ζε ζοκδοαζιυ ιε ηδκ
ζοκεπή πανμοζία ημο ιζηνμαζμθμβζημφ θμνηίμο ηυζμ ηδκ οβνή υζμ ηαζ ηδκ λδνή πενίμδμ ημο έημοξ,
μδδβμφκ ζημ ζοιπέναζια υηζ δεκ είκαζ ιυκμ μζ ζοκήεεζξ νοπμβυκεξ αζηίεξ υπςξ μζ απμννμέξ ηςκ
δνυιςκ ηαζ δ έηπθοζδ ηςκ γςζηχκ αηαεανζζχκ (Nazahiyah etal, 2007) πμο δδιζμονβμφκ αοηυ ημ
απμηέθεζια. Ακαιέκεηαζ υηζ οπάνπμοκ ζδιεζαηέξ εηθμνηίζεζξ νοπμβυκμο θμνηίμο είηε αηοπήιαηα
θυβς αθααχκ ημο ηεκηνζημφ δζηηφμο αζηζηχκ θοιάηςκ υπςξ ζοκέαδ ζε δεζβιαημθδρία πμο
πναβιαημπμζήεδηε ζε δζάθμνα ζδιεία ημο αβςβμφ ηαηά ιήημξ ηδξ πυθδξ.
Ζ αναίςζδ ημο νοπμβυκμο θμνηίμο ζηδκ πανάηηζα πενζμπή ηαζ ζε απυζηαζδ 5 ι απυ ηδκ έλμδμ
ημο αβςβμφ πανυηζ ηοιάκεδηε ιεηαλφ 90% ηαζ 97% ακάθμβα ιε ημκ ιζηνμαζμθμβζηυ δείηηδ (πήια
1), παναιέκεζ υιςξ ορδθυ βζα ηα ηνζηήνζα πμο αθμνμφκ ηδκ πμζυηδηα ηςκ κενχκ ημθφιαδζδξ. Οζ
ζοβηεκηνχζεζξ απμζηζχκ μθζηχκ ηαζ ημπνακςδχκ ημθμααηηδνίςκ ηοιάκεδηακ απυ 100 cfu/100ml
έςξ 39.800 cfu/100ml ηαζ 72 cfu/100ml έςξ 32.600 cfu/100ml ακηίζημζπα. Τρδθέξ επίζδξ ήηακ μζ
ζοβηεκηνχζεζξ απμζηζχκ Δ. coli πμο ηοιάκεδηακ απυ 12 cfu/100ml έςξ 30.00 cfu/100ml υπςξ ηαζ
εκηενμηυηημο πμο ηοιάκεδηακ απυ 8 cfu/100ml έςξ 12.000 cfu/100ml. Λαιαάκμκηαξ οπυρδ ηα
ζζπφμκηα υνζα ηςκ ιζηνμαζμθμβζηχκ δεζηηχκ βζα ηα κενά ημθφιαδζδξ (ππ εκηενυημηημξ <100
cfu/100ml), μζ ηζιέξ πμο ιεηνήεδηακ απμηνέπμοκ ηάεε ηέημζα πνήζδ ζηδκ πενζμπή ημο ζδιείμο
δεζβιαημθδρίαξ. Ζ δζάποζδ υιςξ ημο νοπμβυκμο θμνηίμο ηαζ δ αναίςζδ ημο ζηδκ εονφηενδ
εαθάζζζα πενζμπή εθαπζζημπμζεί ηδκ ζοβηέκηνςζδ ηςκ ιζηνμαζμθμβζηχκ δεζηηχκ ζε απυζηαζδ
ιεβαθφηενδ ηςκ 30 ι (Πίκαηαξ 1). Ζ δζάποζδ αοηή ημο νοπμβυκμο θμνηίμο είκαζ ζδζαίηενα ζδιακηζηή
πνμξ ηδκ ανζζηενή πθεονά (Δζηυκα 1 ζδιείμ 2) πμο πνδζζιμπμζείηαζ ηαζ ςξ παναθία ημθφιαδζδξ απυ
ημοξ ηαημίημοξ ηδξ πενζμπήξ εκχ δεκ θάκδηε κα επδνεάγεζ ηδκ παναθία δελζά ημο αβςβμφ δ μπμία
απέπεζ 500 ι πενίπμο (Δζηυκα 1 ζδιείμ 3).
100.000 75
10.000
50
1.000
100
25
10
1 0
3/2/2012
14/2/2012
21/3/2012
6/4/2012
25/4/2012
28/5/2012
25/6/2012
21/9/2012
28/11/2012
21/1/2013
2/4/2013
22/5/2013
8/7/2013
4/9/2013
15/1/2014
18/2/2014
27/3/2014
12/5/2014
12
12
13
13
13
12
12
12
12
12
12
13
13
14
14
14
14
2
01
20
20
20
20
20
20
20
20
20
20
20
20
20
20
20
20
20
/2
2/
4/
4/
7/
9/
/
/
/2
/3
/4
/5
/6
/9
/1
/5
/1
/2
/3
/5
1
3/
6/
2/
8/
4/
/1
14
21
25
28
25
21
21
22
15
18
27
12
28
188
HydroMedit 2014, November 13-15, Volos, Greece
Κοπρανώδη κολοβακηήρια (cfu/100ml) Θάλαζζα 5μ από αγωγό Εκροή αγωγού Κοπρανώδη κολοβακηήρια
1.000.000 (% μείωζη ζσγκένηρωζης 5μ από αγωγό)
100
100.000
10.000 75
1.000
50
100
25
10
1
0
3/2/2012
6/4/2012
2/4/2013
8/7/2013
4/9/2013
14/2/2012
21/3/2012
25/4/2012
28/5/2012
25/6/2012
21/9/2012
28/11/2012
21/1/2013
22/5/2013
15/1/2014
18/2/2014
27/3/2014
12/5/2014
2
12
13
13
13
12
12
4
12
01
01
01
01
01
01
01
01
01
01
01
20
20
20
20
20
20
20
2
/2
/2
/2
/2
/2
/2
/2
/2
/2
/2
2/
4/
4/
7/
9/
/
1/
/2
/3
/4
/5
/6
/9
/1
/5
/1
/2
/3
/5
3/
6/
2/
8/
4/
/1
14
21
25
28
25
21
21
22
15
18
27
12
28
E coli (cfu/100ml) Θάλαζζα 5μ από αγωγό Εκροή αγωγού E coli
1.000.000 (% μείωζη ζσγκένηρωζης 5μ από αγωγό)
100
100.000
75
10.000
1.000
50
100
25
10
1 0
28/11/2012
6/4/2012
25/4/2012
28/5/2012
25/6/2012
21/9/2012
21/1/2013
2/4/2013
22/5/2013
8/7/2013
4/9/2013
15/1/2014
18/2/2014
27/3/2014
12/5/2014
12
13
13
13
12
12
12
12
4
12
01
01
01
01
01
01
20
20
20
20
20
20
20
20
20
/2
/2
/2
/2
/2
/2
4/
4/
7/
9/
/
1/
/4
/5
/6
/9
/1
/5
/1
/2
/3
/5
6/
2/
8/
4/
/1
25
28
25
21
21
22
15
18
27
12
28
100.000
75
10.000
1.000 50
100
25
10
0
1
28/11/2012
3/2/2012
14/2/2012
21/3/2012
6/4/2012
25/4/2012
28/5/2012
25/6/2012
21/9/2012
21/1/2013
2/4/2013
22/5/2013
8/7/2013
4/9/2013
15/1/2014
18/2/2014
27/3/2014
12/5/2014
12
12
13
13
13
12
2
4
01
01
01
01
01
01
01
01
01
01
01
01
20
20
20
20
20
20
/2
/2
/2
/2
/2
/2
/2
/2
/2
/2
/2
/2
2/
4/
4/
7/
9/
1/
/2
/3
/4
/5
/6
/9
/1
/5
/1
/2
/3
/5
3/
6/
2/
8/
4/
/1
14
21
25
28
25
21
21
22
15
18
27
12
28
ρήκα 1. Μεηαβνιή ηεο ζπγθέληξσζεο νιηθψλ θαη θνπξαλσδψλ θνινβαθηεξηδίσλ, E. coli θαη
εληεξνθφθθσλ ζην λεξφ ηνπ θεληξηθνχ αγσγνχ φκβξησλ ηεο πφιεο ησλ Υαλίσλ θαη ζηελ
ζάιαζζα ζε απφζηαζε 5 κ απφ ηνλ αγσγφ ηελ πεξίνδν Φεβξνπάξηνο 2012-Μάηνο 2014.
πςξ θαίκεηαζ ζηα απμηεθέζιαηα ημο Πίκαηα 1 ημ ιζηνμαζμθμβζηυ θμνηίμο ανζζηενά ηαζ δελζά ημο
αβςβμφ ζε αάεμξ 1,5 ι ηαζ ζε απυζηαζδ 30 ι είκαζ εθάπζζημ ηαζ εκηυξ ηςκ ηνζηδνίςκ πμζυηδηαξ ηςκ
κενχκ ημθφιαδζδξ.
189
HydroMedit 2014, November 13-15, Volos, Greece
Δπραξηζηίεο
Σμ ένβμ οθμπμζείηαζ ζημ πθαίζζμ ημο Δπζπεζνδζζαημφ Πνμβνάιιαημξ "Δηπαίδεοζδ ηαζ Γζα Βίμο
Μάεδζδ", Πνάλδ Ανπζιήδδξ ΗΗΗ ηαζ ζοβπνδιαημδμηείηαζ απυ ηδκ Δονςπασηή Έκςζδ (Δονςπασηυ
Κμζκςκζηυ Σαιείμ) ηαζ απυ εεκζημφξ πυνμοξ (Δεκζηυ ηναηδβζηυ Πθαίζζμ Ακαθμνάξ 2007-2013).
Βιβλιογραφία.
APHA, (1998). Standard methods: for the examination of water and wastewater. 20 th Edition,
Washington DC.
Bedan Erik S., John C. Clausen. (2009) Stormwater Runoff Quality and Quantity from Traditional and
Low Impact Development Watersheds, Journal of the American Water Resources Association
45, (4)998-1008.
Gnecco I., C. Berretta, L.G. Lanza, P. La Barbera, 2005, Storm water pollution in the urban
environment of Genoa, Italy, Atmospheric Research 77, 60– 73.
Hueiwang A.C.J., A.J. Englande, R. M. Bakeer, H.B.Bradford. (2005). Impact of urban stormwater
runoff on estuarine environmental quality. Estuarine, Coastal and Shelf Science 63, 513-526.
IDG. (2002). The Microbiology Manual LAB M. pp 98.
Nazahiyah R., Z. Yusop, I. Abustan. (2007) Stormwater quality and pollution loading from an urban
residential catchment in Johor, Malaysia, Water Science and Technology 56(7) :1-9
Parker J.K., D. McIntyre, R.T. Noble. (2010) Characterizing fecal contamination in stormwater runoff
in coastal North Carolina, USA. Water Research 44,4186-4194.
Qureshi A. A., Dutka B.J. (1979) Microbiological Studies on the Quality of Urban Stormwater Runoff
in Southern Ontario, Canada, Water Research 13, 977-985.
190
HydroMedit 2014, November 13-15, Volos, Greece
Hellenic Centre for Marine Research, Institute for Marine Biological Resources and Inland Waters,
46.7 km Athens-Sounion, 19013 Anavyssos Attikis, Greece
ABSTRACT
The study of the chemical quality of the Vistonis lagoon and lake complex was carried out
during 2007-2009 within a research project funded by the Ministry of Agricultural Development and
Food. The study was based on the analysis of water samples taken from 13 selected locations in the
lake, the lagoon and the coastline in front of the complex. The results have shown that apart from
nitrates, the rest nitrogen nutrients show less or equal concentration values with past reports regarding
their annual average values. The phosphates have shown a reduction in relation to the past. The
sulfides which are toxic for the aquatic organisms, show elevated values. The results of the
concentration distributions of nutrients show that (a) there is a general positive trend in the
improvement of the water quality obviously due to the urban liquid waste management and the control
of the river waters which supply the complex, (b) they show that there exist 2 bottom depressions
within the lake which can act as morphological formation able to concentrate nutrients and which
have never been before reported, (c) except from the rivers which provide organic matter to the
complex there have been recognised at least 2 or 3 coastal underwater gushes which require further
study as to what they contribute to the lake water in terms of nutrients and (d) the complex of brackish
water lagoons shows physico-chemical similarities with the lake or the open sea depending on the
season.
ΠΔΡΗΛΖΦΖ
Ζ ιεθέηδ ηδξ πδιζηήξ πμζυηδηαξ ημο ζοιπθέβιαημξ ηδξ Βζζηςκίδαξ έβζκε ηδ πενίμδμ 2007-
2009 ζηα πθαίζζα ενεοκδηζημφ ένβμο πμο πνδιαημδμηήεδηε απυ ημ Τπμονβείμ Αβνμηζηήξ Ακάπηολδξ
ηαζ Σνμθίιςκ. Ζ ιεθέηδ ααζίζηδηε ζε δείβιαηα κενμφ πμο εθήθεδζακ απυ 13 ζηαειμφξ ζηδ θίικδ,
ηζξ θζικμεάθαζζεξ ηαζ ηδκ αηημβναιιή ημο ζοιπθέβιαημξ Βζζηςκίδαξ. Σα απμηεθέζιαηα έδεζλακ υηζ
εηηυξ ηςκ κζηνςδχκ, ηα οπυθμζπα αγςημφπα ενεπηζηά είηε ιεζχεδηακ ζε ζπέζδ ιε παθαζυηενεξ
ιεηνήζεζξ (1985) είηε πανέιεζκακ ζε πανυιμζα επίπεδα ςξ πνμξ ηζξ εηήζζεξ ιέζεξ ηζιέξ. Δπίζδξ ηαζ
ηα θςζθμνζηά άθαηα πανμοζίαζακ ιείςζδ ζε ζπέζδ ιε παθαζυηενεξ ηζιέξ. Οζ ηζιέξ ηςκ εεζςδχκ,
πμο είκαζ ημλζηά βζα ημοξ μνβακζζιμφξ, είκαζ αολδιέκεξ. Σα απμηεθέζιαηα ηςκ ηαηακμιχκ δείπκμοκ
υηζ: (α) οπάνπεζ βεκζηή αεθηίςζδ ςξ πνμξ ημ πανεθευκ πνμθακχξ θυβς ηςκ ένβςκ δζαπείνζζδξ
191
HydroMedit 2014, November 13-15, Volos, Greece
αζηζηχκ απμαθήηςκ ηαζ ηςκ πανειαάζεςκ ζηδ νμή ηςκ πμηαιχκ, (α) παναηδνμφκηαζ 2 θεηάκεξ
ζοζζχνεοζδξ ιέζα ζηδ θίικδ πμο δεκ έπμοκ ακαθενεεί πνμδβμοιέκςξ, (β) εηηυξ ηςκ 3 πμηαιχκ πμο
είκαζ μθεαθιμθακέξ υηζ ζοκεζζθένμοκ ζημ μνβακζηή θμνηίμ πμο δέπεηαζ ημ ζφζηδια, οπάνπμοκ ηαζ 2
έςξ 3 αθακείξ πδβέξ νφπςκ (ίζςξ οπυβεζεξ ακααθφζεζξ πμο πνήζμοκ επζηυπμο δζενεφκδζδξ) πμο
επίζδξ ζοκεζζθένμοκ ζε μνβακζηυ θμνηίμ ηαζ (δ) ημ ζφιπθεβια ηςκ οθάθιονςκ θζικμεαθαζζχκ πμο
πανειαάθθεηαζ ιεηαλφ ηδξ θίικδξ ηαζ ηδξ εάθαζζαξ, ακάθμβα ηδκ επμπή ηαζ ηζξ ζοκεήηεξ
ζοιπενζθένεηαζ θοζζημπδιζηά υπςξ δ θίικδ ή δ ακμζπηή εάθαζζα.
1. Δηζαγσγή
192
HydroMedit 2014, November 13-15, Volos, Greece
3. Απνηειέζκαηα
193
HydroMedit 2014, November 13-15, Volos, Greece
4. πδήηεζε
Ζ εενιμηναζία ηςκ ηθεζζηχκ ζοζηδιάηςκ ηαζ υπςξ ηςκ πανάηηζςκ ηαζ ηςκ θζικμεαθαζζχκ
επδνεάγεηαζ ζδιακηζηά απυ ηα βεςβναθζηά παναηηδνζζηζηά ηδξ πενζμπήξ. Ζ θίικδ Βζζηςκίδα επίζδξ
επδνεάγεηαζ ηαζ απυ ηζξ εζζνμέξ εαθαζζζκμφ κενμφ ζημ κυηζμ ηιήια ηδξ ηαζ ηδ νμή πμηαιχκ πμο
πνμένπμκηαζ απυ εηηεκείξ μνεζκέξ θεηάκεξ απμννμήξ ιε απμηέθεζια ημοθάπζζημκ ηαηά ηδ πεζιενζκή
πενίμδμ κα ζοκεζζθένμοκ ζδιακηζηά ζηδκ απχθεζα εενιυηδηαξ απυ ηδ θίικδ. ηδκ πενζμπή ηδξ
Βζζηςκίδαξ, είκαζ βκςζηυ απυ παθαζμηένα υηζ ηα κενά δεκ πάβςκακ ηαηά ηδ δζάνηεζα ηδξ πεζιενζκήξ
πενζυδμο (Κμοζμονήξ ηαζ ζο. 1985). Χζηυζμ ηα ηεθεοηαία πνυκζα, θυβς ηςκ ηθζιαηζηχκ αθθαβχκ
οπήνλακ πενζπηχζεζξ ιαγζηήξ εκδζζιυηδηαξ ρανζχκ θυβς ημο παβχιαημξ ηςκ κενχκ πμο ιάθζζηα
απμγδιζχεδηακ απυ ημκ μνβακζζιυ ΔΛΓΑ. Ζ πνμζθμνά κενμφ απυ ημοξ πμηαιμφξ πμο νέμοκ ζηδ
θίικδ Βζζηςκίδα αθθά ηαζ δ ακηίεεηδ δνάζδ ηδξ εζζνμήξ εαθαζζζκμφ κενμφ πμο είκαζ επμπζαηά
ζδιακηζηέξ είκαζ μζ ηφνζεξ δοκάιεζξ πμο επδνεάγμοκ ηαζ ηαεμνίγμοκ ηδκ αθαηυηδηα ζηδ θίικδ, ζηζξ
θζικμεάθαζζεξ ηαζ ηδκ αηηή. ε παθαζυηενεξ ιεθέηεξ, έπμοκ ιεηνδεεί ηζιέξ έςξ ηαζ 28-32‰ ζημ
εζςηενζηυ ηδξ θίικδξ ηαζ ζηδκ κυηζα θεηάκδ αοηήξ, ςξ απμηέθεζια ηδξ εζζνμήξ εαθαζζζκμφ κενμφ
ηαηά ημοξ εενζκμφξ ιήκεξ (Κμοζμονήξ ηαζ ζοκ. 1985). ήιενα υπςξ ιεηά απυ ηδκ ζδιακηζηή
αθθμίςζδ ηδξ νμήξ ηςκ πμηαιχκ ηαζ ηδ ζοκεπή νμή ημοξ θυβς ηδξ βεςνβζηήξ εηιεηάθθεοζδξ βφνς
απυ ηδ θίικδ, μζ ηζιέξ αθαηυηδηαξ ιέζα ζηδ θίικδ δεκ λεπενκμφκ ημ 8‰ αηυια ηαζ ζημοξ ζηαειμφξ
ηδ κυηζαξ θεηάκδξ. Τθίζηαηαζ δδθαδή αθθμίςζδ ημο οδνμθμβζημφ ηαεεζηχημξ ηα ηεθεοηαία 20
πνυκζα. Ζ μλφηδηα ζπεηίγεηαζ ιε ηζξ πδιζηέξ δζενβαζίεξ πμο θαιαάκμοκ πχνα ζημ κενυ. Οζ ηζιέξ
μλφηδηαξ έπμοκ ηοιακεεί ζημ πανεθευκ ιεηαλφ 7,9 έςξ ηαζ 9,9 (Κμοζμονήξ ηαζ ζοκ. 1985, Φχηδξ
ηαζ ζοκ. 1976, Κζθζηίδδξ ηαζ ζοκ. 1984, Οογμφκδξ & Γζακκαημπμφθμο 1983, Ouzounis &
Yiannakopoulou 1984). Οζ ηζιέξ αοηέξ δζηαζμθμβμφκηαζ δζυηζ ηα παθαζυηενα πνυκζα δ θίικδ
Βζζηςκίδα απμηεθμφζε ημκ απμδέηηδ ακεπελένβαζηςκ θοιάηςκ απυ ηζξ βφνς πενζμπέξ ηαζ ηδκ πυθδ
ηδξ Ξάκεδξ. Ζ ζδιενζκή ηαηακμιή ηδξ ιέζδξ μλφηδηαξ ιέζα ζηδ θίικδ Βζζηςκίδα είκαζ ιεηαλφ 8,0
ηαζ 9,0 δδθαδή ιπμνεί κα εεςνδεεί ςξ ακαιεκυιεκδ ηαζ θοζζηή βζα κενά αοηήξ ηδξ αθαηυηδηαξ. Σμ
θςξ είκαζ ιζα θοζζηή πανάιεηνμξ ζδζαίηενα ζδιακηζηή βζα ηδκ ακάπηολδ ηςκ θοηχκ ηαζ επαηυθμοεα
ηςκ γχςκ ζε οδαηζηά ζοζηήιαηα ηαεχξ έηζζ ζηδνίγεηαζ δ ηνμθζηή αθοζίδα ηαζ εζζένπεηαζ
πνςημβεκήξ εκένβεζα ζε αοηή. ε παθζυηενεξ ιεθέηεξ έπμοκ ιεηνδεεί ηζιέξ δζαθάκεζαξ ιέζα ζηδ
θίικδ Βζζηςκίδα 25-100 cm εκχ ακηίεεηα ηαηά ηδκ πανμφζα ιεθέηδ ιεηνήεδηακ ορδθυηενεξ ηζιέξ,
40 έςξ ηαζ 140 cm θακενχκμκηαξ υηζ μζ ζοκεήηεξ ζηδ θίικδ έπμοκ αεθηζςεεί ζπεηζηά. Σμ δζαθοιέκμ
μλοβυκμ ζε ηθεζζηά ζοζηήιαηαείκαζ δοκαηυκ κα πανμοζζάζμοκ ορδθά πμζμζηά ημνεζιμφ θυβς ηδξ
έκημκδξ θςημζφκεεζδξ ηαζ ηονίςξ ζηα επζθακεζαηά κενά. Καηά ηδ εενζκή πενίμδμ ημ δζαθοιέκμ
μλοβυκμ ηαηακαθχκεηαζ ημκηά ζημκ ποειέκα θυβς ηςκ πδιζηχκ ακηζδνάζεςκ απμζφκεεζδξ ηδξ
μνβακζηήξ φθδξ ηαζ έηζζ ακαιέκεηαζ ιείςζδ ηδξ ζοβηέκηνςζδξ (Κμοζμονήξ ηαζ ζοκ. 1985).
Παθαζυηενεξ ένεοκεξ έδεζλακ υηζ ηα κενά ηδξ θίικδξ Βζζηςκίδαξ δεκ είκαζ ηαθά μλοβμκςιέκα ηδ
εενζκή ηαζ ηδ θεζκμπςνζκή πενίμδμ (Κμοζμονήξ ηαζ ζοκ. 1985) εκχ είπακ ιεηνδεεί ηαζ ακμλζηέξ
ζοκεήηεξ (ηάης ηςκ 2 mg/l). ε βεκζηέξ βναιιέξ είπακ ιεηνδεεί ηζιέξ απυ 3 έςξ ηαζ 14 mg/l. Αοηυ ημ
πνμθίθ δεκ παναηδνήεδηε ζηδ θίικδ Βζζηςκίδα ζηα πθαίζζα ηδξ πανμφζαξ ιεθέηδξ. θεξ μζ ηζιέξ
πανμοζζάγμκηαζ ανηεηά ορδθέξ εζδζηά ζηζξ πενζμπέξ πμο εζζνέμοκ βθοηά κενά (αυνεζα ηαζ ακαημθζηή
αηηή).
Σα αιιςκζαηά άθαηα (Δζη. 2) πανμοζζάγμκηαζ αολδιέκα ηαηά ηδκ εενζκή πενίμδμ ζηδ θίικδ
Βζζηςκίδα ηαζ ζδζαίηενα παιδθά ηαηά ηδκ οπυθμζπδ πνμκζηή πενίμδμ ημο έημοξ. ε παθαζυηενεξ
ιεθέηεξ ιεηνήεδηακ ιέζεξ ηζιέξ αιιςκζαηχκ πενί ημ 1,5 mg/l (Κμοζμονήξ ηαζ ζοκ. 1985) εκχ
ζήιενα ιεηνήεδηακ ζδιακηζηά παιδθυηενεξ ηζιέξ ιε ιέζδ ηα 0,1163 mg/l. Οζ δζαθμνέξ αοηέξ πνέπεζ
194
HydroMedit 2014, November 13-15, Volos, Greece
κα μθείθμκηαζ ζηα ένβα αλζμπμίδζδξ ηδξ θίικδξ ιε ηδκ πενζθενεζαηή αφθαηα ηαζ ηδ νφειζζδ ηδξ νμήξ
ηςκ πμηαιχκ πμο εζζνέμοκ ζηδ θίικδ βζα άνδεοζδ ιε απμηέθεζια κα ιδκ θηάκεζ ζηδ θίικδ δ
ιεβαθφηενδ πμζυηδηα αγςημφπςκ εκχζεςκ. Σα κζηνχδδ (Δζη.3) είκαζ ημλζηά βζα ημοξ οδνυαζμοξ
μνβακζζιμφξ ηαζ απμηεθμφκ έκακ επζπθέμκ θυβμ βζα ηδ εκδζζιυηδηα ημοξ ζε πενζπηχζεζξ ιμθοζιέκςκ
κενχκ. ε παθζυηενεξ ιεθέηεξ ιέζα ζηδ θίικδ Βζζηςκίδα ιεηνήεδηακ ηζιέξ απυ 0,0017 έςξ 0,10 mg/l
(Κμοζμονήξ ηαζ ζοκ. 1985) εκχ ζήιενα ιεηνήεδηακ ιέζεξ ιδκζαίεξ ηζιέξ απυ 0,03 έςξ 0,15 mg/l ιε
ζοκμθζηή ιέζδ ηζιή 0,056 mg/l. Οζ ορδθυηενεξ ηζιέξ ειθακίγμκηαζ ηδ εενζκή πενίμδμ πμο θυβς ηδξ
ορδθήξ εενιμηναζίαξ έπμοιε ιαγζηή απμζφκεεζδ ηδξ μνβακζηήξ φθδξ ηυζμ ζηδκ αηηή (πανυπεζα
θοηά) υζμ ηαζ εκηυξ ηδξ θίικδξ ηαζ πανάθθδθδ ηαηακάθςζδ ημο μλοβυκμο ιε απμηέθεζια κα
ζοζζςνεφμκηαζ ηα κζηνχδδ. Πανυιμζμ πνμθίθ ηδξ ζοβηέκηνςζδξ κζηνςδχκ πανμοζζάγεηαζ ηαζ ζηζξ
θζικμεάθαζζεξ ηαζ ηδκ αηημβναιιή ημο Βζζηςκζημφ ηυθπμο. Πνμθακχξ δ βεζημκία ιε ηα κενά ηδξ
ακμζηηήξ εάθαζζαξ ηαζ μζ πζμ ηαθέξ ζοκεήηεξ ακακέςζδξ ηςκ κενχκ ζηζξ δφμ αοηέξ πενζμπέξ
επζηνέπεζ ηδκ δζαηήνδζδ ηαθφηενμο πδιζημφ πενζαάθθμκημξ ηαζ ηδκ δζαηήνδζδ ηςκ κζηνςδχκ ζε
παιδθυηενα επίπεδα απυ αοηά ηδξ θίικδξ. Σμ κενυ ηδξ θίικδξ πανμοζζάγεζ ζπεηζηά ορδθέξ ηζιέξ
κζηνζηχκ (Δζη.4) έςξ 1,3 mg/l ιε ιέζδ ηζιή 0,395 mg/l. ε παθαζυηενεξ ιεθέηεξ είπακ ιεηνδεεί
ακάθμβεξ ηζιέξ ιε ιέβζζηδ έςξ 1,46 mg/l ηαζ ιέζδ ηζιή έςξ 2,2 mg/l (Κμοζμονήξ ηαζ ζοκ. 1985). Ο
Φοηζάκμξ (1975 ζημ Κμοζμονήξ ηαζ ζοκ. 1985) ιέηνδζε ηζιέξ 0,170-0,350 mg/l ιε ιέζδ ηζιή ηα 0,27
mg/l. Ζ Γζακκαημπμφθμο (1989) ιέηνδζε βζα ηδκ ίδζα πενίμδμ ηζιέξ ιεηαλφ 0,01 ηαζ 1,2 mg/l. Δίκαζ
πνμθακέξ υηζ μζ ηζιέξ κζηνζηχκ δεκ πανμοζίαζακ αθθαβή ηα ηεθεοηαία 20 πνυκζα. Ο ηφηθμξ ηςκ
θςζθμνζηχκ αθάηςκ (Δζη.5) επδνεάγεηαζ ανηεηά απυ ηδκ πανμοζία μλοβυκμο ζημ κενυ. Με
επάνηεζα μλοβυκμο δεζιεφεηαζ εκχ ιε έθθεζρδ μλοβυκμο επακαδζαθοημπμζείηαζ ζημ κενυ.
Παθαζυηενεξ ιεηνήζεζξ έδεζλακ υηζ ηα θςζθμνζηά άθαηα ζηδ θίικδ Βζζηςκίδα ηοιαίκμκηακ ιεηαλφ
0,04 ηαζ 0,23 mg/l εκχ ηαηά πενίπηςζδ – ηονίςξ ιεηά απυ επεζζυδζα αολδιέκδξ νμήξ κενχκ ζηδ
θίικδ ππ. ανμπυπηςζδ – ιεηνήεδηακ ηζιέξ έςξ ηαζ 1,4 mg/l (Κμοζμονήξ ηαζ ζοκ. 1985). Ο Φοηζάκμξ
(1985 ζημ Κμοζμονήξ ηαζ ζοκ. 1985) ιέηνδζε ιέζεξ ηζιέξ 0,157 mg/l ιε παιδθυηενεξ αοηέξ ημκηά
ζηδκ έλμδμ ηδξ θίικδξ πνμξ ηδ εάθαζζα ηαζ ορδθυηενεξ ηζξ ηζιέξ ζηζξ εηαμθέξ ηςκ πμηαιχκ ιέζα
ζηδ θίικδ. Ζ Γζακκαημπμφθμο (1989) ιέηνδζε ηζιέξ ιεηαλφ 0,044 ηαζ 0,500 mg/l. Σα εεζχδδ άθαηα
είκαζ εκχζεζξ ημο εείμο πμο πνμένπμκηαζ απυ ηδκ παναβςβή οδνυεεζμο θυβς ηδξ απμζφκεεζδξ ηδξ
μνβακζηήξ φθδξ πάζδξ θφζεςξ ιέζα ζημ κενυ. Δπίζδξ πανάβεηαζ ζε ιεβάθεξ πμζυηδηεξ υηακ έπμοιε
ιαγζηή εακάηςζδ ημο πθδεοζιμφ ημο θοημπθαβηημφ εζδζηά ιεηά απυ επεζζυδζμ άκεδζδξ ημο κενμφ
(water bloom) ή υηακ οπάνπεζ ναβδαία ακαζηνμθή ημο πενζαάθθμκημξ ηδξ θίικδξ ππ δ εζζνμή
εαθαζζζκμφ κενμφ απυ ηα κυηζα πμο επίζδξ ιπμνεί κα πνμηαθέζεζ εακάηςζδ ημο πθαβηημφ βθοημφ
κενμφ ηδξ θίικδξ ηαζ ηδ ιαγζηή ηαείγδζδ αολδιέκςκ πμζμηήηςκ μνβακζηήξ φθδξ. Σμ οδνυεεζμ ηαζ ηα
εεζχδδ ζυκηα είκαζ ελαζνεηζηά ημλζηά βζα ημοξ οδνυαζμοξ μνβακζζιμφξ. ε παθζυηενεξ ιεθέηεξ ζηδ
θίικδ Βζζηςκίδα ιεηνήεδηακ ηζιέξ πμο ηοιαίκμκηακ ιεηαλφ 0,07 ηαζ 0,790 mg/l (Κμοζμονήξ ηαζ
ζοκ. 1985). ηδκ πανμφζα ιεθέηδ ιεηνήεδηακ ηζιέξ εεζςδχκ (Δζ.7) απυ 0 έςξ ηαζ 0,280 mg/l ιε ιέζδ
εηήζζα ηζιή 0,080 mg/l. Οζ ιεβαθφηενεξ ηζιέξ πανμοζζάγμκηαζ ζηδκ ανπή ημο ηαθμηαζνζμφ ηαζ
πνμθακχξ ζοκδέμκηαζ ιε ηδκ αολδιέκδ απμζφκεεζδ ηδξ μνβακζηήξ φθδξ. Ζ ζοβηέκηνςζδ ηςκ
εεζςδχκ αθάηςκ ζηζξ θζικμεάθαζζεξ ηοιάκεδηε ιεηαλφ 0 ηαζ 0,050 mg/l ιε ιέζδ εηήζζα ηζιή 0,017
mg/l.
Δπραξηζηίεο
195
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
Aggelides, P.B.,, & Kotsovinos, N.E., 2001. Management of agricultural run-offs pollution: the case
of lake Vistonis. Proceedings of the Ecological Protection of the Planet earth I, volume I,
103-111
ΔΛ.ΚΔ.Θ.Δ. (1985). Αλζμπμίδζδ ηαζ πνμζηαζία ηςκ εζςηενζηχκ οδάηςκ ηδξ πχναξ: ΗΗΗ. Λίικδ
Βζζηςκίδα. Σεπκζηή Έηεεζδ 3, 47 ζεθ.
Κζθζηίδδξ, ., Καιανζακυξ, Α., Φχηδξ, Γ., Κμοζμονήξ Θ., Καναιακθήξ, Κ., & Οογμφκδξ, Κ., 1984.
Οζημθμβζηή ένεοκα ζηζξ θίικεξ ηδξ Βμνείμο Δθθάδμξ: Αβίμο Βαζζθείμο, Γμσνάκδξ ηαζ
Βζζηςκίδαξ. Δπζζηδιμκζηή Έηεεζδ, Ανζζημηέθεζμ Πακεπζζηήιζμ Θεζζαθμκίηδξ,
Κηδκζαηνζηυ Σιήια
Κμοζμονήξ, Θ., Γζαπμφθδξ, Α., & Φχηδξ, Γ., 1985. Αλζμπμίδζδ ηαζ πνμζηαζία ηςκ εζςηενζηχκ
οδάηςκ ηδξ πχναξ. ΗΗΗ. Λίικδ Βζζηςκίδα. Σεπκ. Έηεεζδ Νμ 3, Δθθδκζηυ Κέκηνμ Θαθαζζίςκ
Δνεοκχκ, ζεθ. 47
Κμοηνάηδξ, Δ., & ίκδξ, Α., 1997. φκεεζδ πθδεοζιχκ ηςκ ηεθάθςκ (Mugilidae) ζηδ θζικμεάθαζζα
ημο Πυνημ-Λάβμξ ηαζ ηδ θίικδ Βζζηςκίδα. Πναηηζηά 5μο Πακεθθήκζμο οιπμζίμο
Χηεακμβναθίαξ ηαζ Αθζείαξ, ηυιμξ ΗΗ, Κααάθα, 15-18 Απνζθίμο 1997, 269-273
Κμοηνάηδξ, Δ., Σζίηθδναξ, Α., & ίκδξ, Α., 2000. Δπμπζαηέξ δζαηοιάκζεζξ ζηδκ αθεμκία ηαζ
ζφκεεζδ ηδξ ζπεομπακίδαξ ζηδκ θζικμεάθαζζαξ ημο Πυνημ-Λάβμξ. Πναηηζηά 6με
Πακεθθήκζμο οιπμζίμο Χηεακμβναθίαξ ηαζ Αθζείαξ, Υίμξ, 23-26 Μαΐμο 2000, 157-161
Koutrakis, E.T., Tsikliras, A.C., & Sinis, A.I., 2005. Temporal variability of the ichthyofauna in a
northern Aegean coastal lagoon (Greece). Influence of environmental factors. Hydrobiologia,
543, 245-257
Οογμφκδξ, Κ., & Γζακκαημπμφθμο, Σ., 1983. Ρφπακζδ ηδξ θίικδξ Βζζηςκίδαξ απυ ηα αζηζηά θφιαηα
ηαζ απμννίιιαηα ηδξ πυθδξ ηδξ Ξάκεδξ. Πναηηζηά Ζ' Πακεθθ. οκεδνίμο έκςζδξ Δθθήκςκ
Υδιζηχκ, ζεθ. 4
Ouzounis, K., & Yiannakopoulos, T., 1984. Some physic-chemical characteristics of Vistonis lake
(North Greece). Thalassographica, 7, 61-72
Φχηδξ, Γ., Κμοζμονήξ, Θ., ηαζ Κνζάνδξ, Ν., 1976. Πνυδνμιμξ ιεθέηδ επί ημο ιμθοζιαηζημφ
φδνςπμξ ημο ηοπνίκμο ηαζ ηζκχκ παναβυκηςκ ηδξ θίικδξ Βζζηςκίδαξ. Κηδκζαηνζηά Νέα, 5(4-
5), 97-107
196
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
Every year large quantities of bisphenol-A are channeled to the environment. Σhis compound acts as
an endocrine disrupter and modifies the action of endogenous estrogen in organisms exposed to it.
Since Artemia franciscana is a well established test animal for acute toxicity tests, the aim of this
study was to examine the effect of BPA on sex differentiation of the strain A. franciscana and on the
growth of the F1 generation. The results showed variation in sex, as the ratio Male / Female in
controls was 0.92:1, while in all treatments with BPA more males were found than females, with the
ratio Male / Female to reach the value 2:1 at the concentration of 35 ppm. In addition, the
measurement of the length of the F1 generation nauplii showed inhibition of growth when the parental
generation was exposed to BPA concentrations higher than 10 ppm.
Πεξίιεςε
Κάεε πνυκμ δζμπεηεφμκηαζ ζημ πενζαάθθμκ ιεβάθεξ πμζυηδηεξ δζζθαζκυθδξ-Α. Έπεζ δζαπζζηςεεί υηζ δ
έκςζδ αοηή δνα ςξ εκδμηνζκζηυξ δζαηανάηηδξ ηαζ ηνμπμπμζεί ηδ δνάζδ ηςκ εκδμβεκχκ μζζηνμβυκςκ
ζημοξ μνβακζζιμφξ πμο έπμοκ εηηεεεί ζε αοηήκ. Γεδμιέκμο υηζ δ Artemia franciscana είκαζ ζδακζηυ
γχμ βζα πεζνάιαηα μλείαξ ημλζηυηδηαξ, ζημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ κα ιεθεηδεεί δ επίδναζδ
ηδξ ΒΡΑ ζηδ θοθεηζηή δζαθμνμπμίδζδ ημο ζηεθέπμοξ A. franciscana ηαζ ζηδκ ακάπηολδ ηδξ F1
197
HydroMedit 2014, November 13-15, Volos, Greece
βεκζάξ πμο πνμέηορε απυ ηα άημια πμο είπακ εηηεεεί ζηδ ΒΡΑ. Απυ ηα πεζνάιαηα παναηδνήεδηε
δζαθμνμπμίδζδ ζημ θφθμ ηαεχξ δ ακαθμβία Ανζεκζηά/Θδθοηά ζημοξ ιάνηονεξ ήηακ 0,92:1, εκχ ζε
υθεξ ηζξ επελενβαζίεξ ιε ΒΡΑ ηα ανζεκζηά ήηακ πενζζζυηενα απυ ηα εδθοηά, ιε ηδκ ακαθμβία
Ανζεκζηά/Θδθοηά κα θηάκεζ κα ζζμφηαζ ιε 2:1 ιεηά απυ έηεεζδ ζε ζοβηέκηνςζδ 35 ppm. Δπίζδξ,
απυ ηδ ιεθέηδ ημο ιήημοξ ηςκ καοπθίςκ ηδξ F1 βεκζάξ, πνμέηορε ακαζημθή ηδξ ακάπηολήξ ημοξ υηακ
δ παηνζηή βεκζά είπε εηηεεεί ζε ζοβηεκηνχζεζξ ΒΡΑ πάκς απυ 10 ppm
Δηζαγσγή
198
HydroMedit 2014, November 13-15, Volos, Greece
Απνηειέζκαηα
Πίλαθαο 1. Απνηειέζκαηα αλαινγίαο θχινπ θαη ζλεζηκφηεηαο κεηά απφ έθζεζε ηνπ ζηειέρνπο
A. franciscana ζε δηαθνξεηηθέο ζπγθεληξψζεηο ΒΡΑ.
Μάνηονεξ 23 25 0,92:1 2 4
3 ppm 26 23 1,13:1 1 2
5 ppm 26 24 1,08:1 0 0
8 ppm 24 21 1,14:1 5 10
10 ppm 30 16 1,88:1 4 8
15 ppm 24 17 1,41:1 9 18
20 ppm 21 15 1,40:1 14 28
25 ppm 20 13 1,54:1 13 26
35 ppm 20 10 2,00:1 20 40
Ζ ακαθμβία θφθμο ηαζ δ εκδζζιυηδηα ηδξ παηνζηήξ βεκζάξ ημο ζηεθέπμοξ A. franciscana
πανμοζζάγμκηαζ ζημκ Πίκαηα 1.
Σα απμηεθέζιαηα απυ ηδ ιέηνδζδ ημο ιήημοξ ηςκ καοπθίςκ 2 δξ βεκζάξ ηαζ απυ ηδ
ζηαηζζηζηή ημοξ επελενβαζία δίκμκηαζ ζημ πήια 1 ηαζ ζημκ Πίκαηα 2, ακηίζημζπα.
199
HydroMedit 2014, November 13-15, Volos, Greece
ρήκα 1. Μήθνο ησλ λαχπιησλ ηεο F1 γεληάο πνπ πξνήιζαλ απφ γνλείο πνπ είραλ εθηεζεί ζε
δηαθνξεηηθέο ζπγθεληξψζεηο ΒΡΑ
Πίλαθαο 2. Απνηειέζκαηα κήθνπο ησλ λαππιίσλ (F1) πνπ πξνέθπςαλ απφ γνλείο πνπ είραλ
εθηεζεί ζε δηαθνξεηηθέο ζπγθεληξψζεηο ΒΡΑ. Οη ηηκέο ηνπ κήθνπο ησλ λαππιίσλ πνπ είραλ
ζηαηηζηηθά ζεκαληηθή δηαθνξά ζε ζρέζε κε ηνπο κάξηπξεο παξνπζηάδνληαη κε θίηξηλν ρξψκα
24 h 48 h 72 h
ηαηζζηζηά ζδιακηζηή δζαθμνά ζε επίπεδμ *P<0,05 ή **P<0,005. AVG (Average) = Μέζδ ηζιή
μθζημφ ιήημοξ, SD (Standard Deviation) = Σοπζηή Απυηθζζδ.
200
HydroMedit 2014, November 13-15, Volos, Greece
πδήηεζε
Απυ ηδ ιέηνδζδ ημο ιήημοξ ηςκ καοπθίςκ ηδξ F1 βεκζάξ, ανέεδηε ακαζημθή ζηδκ ακάπηολή
ημοξ ζε ζπέζδ ιε ημ ιάνηονα ηαζ ζηζξ ηνεζξ πνμκζηέξ ζηζβιέξ πμο ιεθεηήεδηακ. Σμ ιήημξ ηςκ
καοπθίςκ ήηακ ιζηνυηενμ υζμ ιεβαθφηενδ ήηακ δ ζοβηέκηνςζδ ηδξ ΒΡΑ πμο είπε εηηεεεί δ παηνζηή
βεκζά. Απυ ηδ ζηαηζζηζηή ακάθοζδ ANOVA πνμέηορε υηζ ζημοξ απυβμκμοξ ηςκ αηυιςκ πμο είπακ
εηηεεεί ζε ζοβηεκηνχζεζξ ΒΡΑ 10 ppm ηαζ πάκς, ημ ιήημξ δζέθενε ζηαηζζηζηά ζδιακηζηά (P<0,05)
ζε ζπέζδ ιε ημ ιήημξ ηςκ ιανηφνςκ (Πίκαηαξ 2). Ζ παναηήνδζδ αοηή ζοιθςκεί ιε ηα
απμηεθέζιαηα ηδξ πνμδβμφιεκδξ ένεοκαξ πμο είπε βίκεζ απυ ημοξ Castritsi-Catharios et al. (2013) βζα
ηδκ επίδναζδ ηδξ ΒΡΑ ζημ ζηέθεπμξ A. franciscana, υπμο απμδείπεδηε δ ακαζηαθηζηή ηδξ δνάζδ
ζηδκ ηαπφηδηα ακάπηολδξ ηαζ ημ ιέβεεμξ καοπθίςκ ζηαδ. ΗΗ-ΗΗΗ πμο είπακ εηηεεεί. Δπίζδξ, δ
ακαζημθή ηδξ ακάπηολδξ ημο ζηεθέπμοξ A. franciscana ιεηά απυ έηεεζή ημο ζε ημλζηά έπεζ
ακαθενεεί ηαζ ζηδκ ενβαζία ηςκ Castritsi-Catharios et al. (2014), υηακ ιεθέηδζακ ηδκ επίδναζδ ηςκ
οθαθμπνςιάηςκ ζηδκ ηαπφηδηα ακάπηολδξ ηςκ καοπθίςκ. Απυ αοηυ ζοιπεναίκμοιε υηζ μζ ημλζηέξ
μοζίεξ δνμοκ ακαζηαθηζηά ζηδκ ακάπηολδ ημο ζοβηεηνζιέκμο μνβακζζιμφ ηαζ δ πνμηαθμφιεκδ
ακαζημθή είκαζ ακάθμβδ ιε ηδ ζοβηέκηνςζδ ηδξ ημλζηήξ μοζίαξ αηυιδ ηαζ ζε οπμεακάηζεξ
ζοβηεκηνχζεζξ. Δπεζδή δ ανηέιζα απμηεθεί μνβακζζιυ οπυδεζβια βζα ηα ηανηζκμεζδή εα ιπμνμφζε κα
αζηζμθμβδεεί ζημ άιεζμ ιέθθμκ ημ θαζκυιεκμ ημο κακζζιμφ ηςκ ηανηζκμεζδχκ ζε νοπαζιέκμοξ
οδάηζκμοξ μζηυημπμοξ.
Βηβιηνγξαθία
Castritsi-Catharios J., Alambritis G., Miliou H., Cotou E., Zouganelis D.G. (2014). Comparative
Toxicity of ―Tin Free‖ Self-Polishing Copolymer Antifouling Paints and Their Inhibitory
Effects on Larval Development of a Not-Target Organism. Materials Sciences and
Applications 5, 158-169.
Castritsi-Catharios J., Syriou V., Miliou H., Zouganelis D.G. (2013). Toxicity effects of bisphenol A
to the nauplii of the brine shrimp Artemia franciscana. Journal of Biological Research-
Thessaloniki 19, 38-45.
Cousins I.T., Staples C.A., Klecka G.M., Mackay D. (2002). A Multimedia Assessment of the
Environmental Fate of Bisphenol A. Human and Ecological Risk Assessment 8(5), 1107-
1135.
Crain A.D., Eriksen M., Iguchi T., Jobling S., Laufer H., LeBlanc G.A., Guillette LJ.Jr. (2007). An
ecological assessment of Bisphenol A: Evidence from comparative biology. Reproductive
Toxicology 24, 225-239.
Fan J., Guo H., Liu G., Peng P. (2006). Simple and sensitive fluorimetric method for determination of
environmental hormone bisphenol A based on its inhibitory effect on the redox reaction
between peroxyl radical and rhodamine 6G. Analytica Chimica Acta 585, 134-138.
MacRae T.H., Bagshaw J.C., Warner A.H. (1988). Biochemical and cell biology of Artemia. CRC
Press Inc, Boca Raton, FL.
201
HydroMedit 2014, November 13-15, Volos, Greece
Monje L., Varayoud J., Munoz-de-Toro M., Luque E.H. Ramos J.G. (2009). Neonatal exposure to
bisphenol A alters estrogen – dependent mechanisms governing sexual behavior in the adult
female rat. Reproductive Toxicology 28(4), 435-442.
Staples C.A., Dorn P.B., Klecka G.M., O‘ Block S.T., Harris L.R. (1998). A review of the
environmental fate, effects, and exposures of bisphenol A. Chemosphere 36(10), 2149-2173.
Staples C.A., Woodburn K., Caspers N., Hall T., Kleka G. (2002). A Weight of Evidence Approach to
the Aquatic Hazard Assessment of Bisphenol A. Human and Ecological Risk Assessment
8(5), 1083-1105.
Tsai W.T. (2006). Human health risk on environmental exposure to bisphenol-A: a review. Journal of
Environmental Science and Health C 24, 225-255.
Warner A.H., MacRae T.H., Bagshaw J.C. (1989). Cell and molecular biology of Artemia
development. Plenum Press, NY.
202
HydroMedit 2014, November 13-15, Volos, Greece
Department of Fishery and Aquaculture Technology, TEI of Western Greece, Nea Ktiria, 30200,
Mesolonghi
ABSTRACT
The present study examined temporal changes on the technical and spatial features of marine
aquaculture farms for two Mediterranean countries (Greece, Turkey), for the period 2002-2011 based
on available historical images from Google earth (free software).The cages type and dimensions as
well as their sites (geographic coordinates) that provided by the satellite images, were examined. The
pattern of changes of the technical and the spatial features of cages were differed between the two
countries during the period 2002-2005 and 2006-2011. In Greece, the spatial features of fish farms
seem to remain stable whereas in Turkey there is relocation of fish farms which associated by longer
distance from the shore and increase of the available rearing volume. In both countries the changes of
the technical features of cages refer to the usage of cyclical cages.
Key words: Aquaculture, farm, type of cages, spatial features, cages technical features, satellite
image
Πεξίιεςε
ηδκ πανμφζα ιεθέηδ ελέηαζηδηακ μζ δζαπνμκζηέξ αθθαβέξ ζηα ηεπκζηά ηαζ πςνζηά παναηηδνζζηζηά
ηςκ εαθάζζζςκ ιμκάδςκ οδαημηαθθζένβεζαξ βζα δφμ πχνεξ ηδξ Μεζμβείμο (Δθθάδα, Σμονηία), βζα
ηδκ πενίμδμ 2002-2011 ιε αάζδ ηζξ δζαεέζζιεξ ζζημνζηέξ απεζημκίζεζξ απυ ημ Google earth
(εθεφεενμ θμβζζιζηυ). Ο ηφπμξ ηθςαχκ ηαζ μζ δζαζηάζεζξ ημοξ, ηαεχξ ηαζ δ πενζμπή εβηαηάζηαζδξ
(βεςβναθζηέξ ζοκηεηαβιέκεξ), πμο πανέπμκηαζ απυ ηζξ δμνοθμνζηέξ εζηυκεξ, ελεηάζηδηακ. Σμ
πνυηοπμ ηςκ αθθαβχκ ηςκ ηεπκζηχκ ηαζ ηςκ πςνζηχκ παναηηδνζζηζηχκ ηςκ ηθςαχκ δζέθενε ιεηαλφ
ηςκ δφμ πςνχκ ηαηά ηζξ πενίμδμοξ 2002-2005 ηαζ 2006-2011. ηδκ Δθθάδα, ηα πςνζηά
παναηηδνζζηζηά ηςκ ιμκάδςκ θαίκεηαζ κα παναιέκμοκ ζηαεενά, εκχ ζηδκ Σμονηία παναηδνμφκηαζ
εηηεηαιεκεξ ιεηεβηαηάζηαζεζξ ιμκάδςκ πμο ζοκδέμκηαζ ιε ιεβαθφηενδ απυζηαζδ απυ ηδκ αηηή ηαζ
ιε αφλδζδ ημο δζαεέζζιμο υβημο εηηνμθήξ. Καζ ζηζξ δφμ πχνεξ μζ αθθαβέξ ηςκ ηεπκζηχκ
παναηηδνζζηζηχκ ηςκ ηθςαχκ αθμνμφκ ζηδ πνήζδ ηςκ ηοηθζηχκ ηθμοαχκ.
203
HydroMedit 2014, November 13-15, Volos, Greece
1.Δηζαγσγή
3. Απνηειέζκαηα
Απυ ηζξ δζαεέζζιεξ απεζημκίζεζξ ηδξ πενζυδμο 2002-2011, ζηδ πενζμπή ιεθέηδξ
ηαηαβνάθδηακ 393 εέζεζξ ιμκάδςκ υπμο βζα έζης ηαζ ζε ιζα απεζηυκζζδ, ηαηά ηδκ πενίμδμ ιεθέηδξ,
ακαβκςνίζεδηε ιμκάδα εηηνμθήξ. Οζ εέζεζξ αοηέξ αθμνμφκ ζε 245 ζηα πςνζηά φδαηα ηδξ Δθθάδαξ,
138 ηδξ Σμονηίαξ, ηαζ απυ 5 εέζεζξ ζηα πςνζηά φδαηα ηδξ Αθαακίαξ ηαζ ηδξ Μάθηαξ. ε αοηέξ ηζξ
204
HydroMedit 2014, November 13-15, Volos, Greece
εέζεζξ ζοκμθζηά ηαηαβνάθδηακ 767 απεζημκίζεζξ, μζ μπμίεξ αθμνμφκ ζε δζάθμνεξ πνμκζηέξ ζηζβιέξ
ηαηά ηδκ πενίμδμ ιεθέηδξ. Οζ 181 (46.0%) εέζεζξ αθμνμφκ ζε ιζα απεζηυκζζδ ηαζ μζ 212 (53.9%) ζε
πενζζζυηενεξ απυ ιία απεζημκίζεζξ ακά εέζδ ιμκάδμξ. ε 178 (23.3%) εέζεζξ ιμκάδςκ δ πνμκζηή
δζαθμνά ιεηαλφ ηςκ αηναίςκ απεζημκίζεςκ είκαζ ιεβαθφηενδ ηςκ 7 εηχκ ή ιεβαθφηενδ ηςκ 5 εηχκ
εάκ αοηή εκηάζζεηαζ ζημ πνμκζηυ δζάζηδια ιεηά ημ 2005 (Πίκαηαξ Η).
Ζ ακάθοζδ ηςκ απεζημκίζεςκ ιε ηθςαμφξ, ζε μιάδεξ ζφκεεζδξ ηφπμο ηαζ δζαζηάζεςκ
ηθςαχκ (cluster analysis) έδεζλε μηηχ μιάδεξ ιε δζαθμνεηζηή ζφκεεζδ ηθςαχκ (π2;P<0.05). ηδ
μιάδα 1 ημ 90% ηςκ ηθςαχκ αθμνά ηοηθζημφξ ηθςαμφξ δζαιέηνμο 10-20m (51,8%) ηαζ 20-40 m
(39.0%), ζηδ μιάδα 2 ημ 89% ηςκ ηθςαχκ αθμνά ζε ηοηθζημφξ ηθςαμφξ δζαιέηνμο 10-20 m, ζηδκ
μιάδα 3 ημ 85.7% ηςκ ηθςαχκ αθμνά ζε ηεηνάβςκμοξ ηθςαμφξ 5-10m (32,1%) ηαζ 10-16m (53.6%),
ζηδκ μιάδα 4 ημ 81.5% ηςκ ηθςαχκ αθμνά ζε ηεηνάβςκμοξ ηθςαμφξ 5-10m, ζηδκ μιάδα 5 ημ 91%
ηςκ ηθςαχκ αθμνά ζε ηοηθζημφξ ηθςαμφξ δζαιέηνμο 20-40m, ζηδκ μιάδα 6 ημ 93.2% ηςκ ηθςαχκ
αθμνά ζε ηοηθζημφξ ηθςαμφξ 10-20m (49.1%) ηαζ ηεηνάβςκμοξ 5-10m (44.1%), ζηδκ μιάδα 7 ημ
88,3% ηςκ ηθςαχκ αθμνά ζε ηοηθζημφξ ηθςαμφξ 5-10 (38.4%) ηαζ 10-20m (49.9%) ηαζ ζηδκ μιαδα
8 ημ 89.4% ηςκ ηθςαχκ αθμνά ζε ηοηθζημφξ ηθςαμφξ 40-60m (Πίκαηαξ ΗΗ).
Ζ ιέζδ επζθάκεζα είκαζ 5.09 ζην ηαζ ηοιαίκεηαζ απυ 3.44 ζην (μιάδα 4)-13.3 ζην (μιάδα 8).
Ο ιέζμξ υβημξ εηηνμθήξ είκαζ 86.67x103 m3 ηαζ ηοιαίκεηαζ απυ 33.3 x103 m3 (μιάδα 4)-399 x103 m3
(μιάδα 8). Ο ιέζμξ ανζειυξ είκαζ 43.7 ηθςαμί ηαζ ηοιαίκεηαζ απυ 7.42 (μιάδα 8) – 80.5 ηθςαμί
(μιάδα 4). ηαηζζηζηά ζδιακηζηέξ δζαθμνέξ παναηδνήεδηακ ιεηαλφ ηςκ μιάδςκ ζηδκ ιέζδ
επζθάκεζα (ANOVA; p<0.05; ηαζ Tukey t-test: μιάδα 4≤7=3≤2=6<1=5≤8), ζημκ ιέζμ υβημ εηηνμθήξ
(ANOVA; p<0.05; ηαζ Tukey t-test: μιάδα 4<2=3=6=7<1=5<8) ηαζ ζημκ ιέζμ ανζειυ ηθςαχκ
(ANOVA; p<0.05; ηαζ Tukey t-test: μιάδα 8<5≤1=2<3=7≤6=4) (Πίκαηαξ ΗΗ). ημ ζφκμθμ ηςκ
ιμκάδςκ, μ υβημξ εηηνμθήξ (V) πανμοζζάγεζ ζζπονή βναιιζηή ζπέζδ ιε ηδκ επζθάκεζα ηςκ ηθςαχκ S
(V=20.02*S-11.84;R2=0.90;SE estimate=41.08;P<0.05).
Πίλαθαο Η. Αξηζκφο απεηθνλίζεσλ (FG) κε (FG1)ή ρσξίο θισβνχο (FG0), ζχλνιν ζέζεσλ
κνλάδσλ κε απεηθνλίζεηο κε θισβνχο (n), κε κηα απεηθφληζε (n1), κε πεξηζζφηεξεο απφ κία
απεηθφληζε (n>1) θαη αξηζκφο ζέζεσλ κνλάδσλ φπνπ νη αθξαίεο ρξνληθά απεηθνλίζεηο έρνπλ
ρξνληθή δηαθνξά κεγαιχηεξε ησλ 7 εηψλ ή 5 (φηαλ ε πξψηε απεηθφληζε εληάζζεηαη ζηελ
πεξίνδν κεηά 2003-2005) (nd)
Απεζημκίζεζξ (FG) Ανζειυξ εέζεςκ ιμκάδςκ
Μάθηα 3 13 16 5 0 5 4
Αθαακία 2 11 13 5 0 5 5
205
HydroMedit 2014, November 13-15, Volos, Greece
Πίλαθαο ΗΗ. χλζεζε νκάδσλ κνλάδσλ αλά ηχπν θαη δηαζηάζεηο θισβνχ (%) θαη Μέζεο ηηκέο
ησλ ηερληθψλ ραξαθηεξηζηηθψλ ησλ νκάδσλ κνλάδσλ ηρζπνθαιιηέξγεηαο (n: αξηζκφο κνλάδσλ,
CG: κέζνο αξηζκφο θισβψλ, S: κέζε επηθάλεηα θισβψλ κνλάδαο, V: κέζνο φγθνο εθηξνθήο
θισβψλ κνλάδαο θαη αξηζκφο απεηθνλίζεσλ ζέζεσλ κνλάδσλ κε θισβνχο (FG 1). Οη ίδηνη
εθζέηεο αλά ζηήιε δειψλνπλ κε ζηαηηζηηθή δηάθνξα (ANOVA;Σukey t-test, P>0.05), ζηελ
παξέλζεζε ε ηππηθή απφθιηζε.
Γζαζηάζεζξ (m)
μιάδα 5-10 10-20 20-40 40-60 5-10 10-16 S (x103 m2) V (x103 m3) CG FG1
2 0.9 89.0 1.5 0.2 6.7 1.7 4.46(2.8)α 71.2(50.1)α 26.6(18.3)β 194
4 5.3 11.9 0.6 0.0 81.5 0.6 3.44(4.0)α 33.3(43.5)α 80.5(110.1)α 133
Σμ πνυηοπμ ιεηααμθχκ ηςκ ιμκάδςκ πανμοζίαζε δζαθμνέξ ιεηαλφ Δθθάδαξ ηαζ Σμονηίαξ
2
(π =42.02;df=1;p<0.05). Γζα ηδκ Δθθάδα ημ ιεβαθφηενμ πμζμζηυ ηςκ ιμκάδςκ δεκ άθθαλε (43%), ή
άθθαλε ηεπκζηά παναηηδνζζηζηά (31%). Σμ 6% ηςκ ιμκάδςκ δζαθφεδηε ηαζ ημ 20 % αθμνά ζε
εβηαηάζηαζδ ιμκάδμξ ζε κέα εέζδ. Ακηίεεηα, ζηδκ Σμονηία ημ 47% ηςκ ιμκάδςκ δζαθφεδηε ηαζ ημ
34% αθμνά ζε εβηαηάζηαζδ ιμκάδμξ ζε κέα εέζδ (πήια 1Α). Ζ εθάπζζηδ απυζηαζδ απυ ηδκ αηηή
πανμοζζάγεζ δζαθμνέξ ιεηαλφ ημο ηφπμο ιεηααμθχκ ηςκ ιμκάδςκ ιεηαλφ ηςκ δφμ πςνχκ
(ANOVA;P<0.05), εκυζς μζ δζαθμνέξ αοηέξ εζηζάγμκηαζ ζηδκ απυζηαζδ απυ ηδκ αηηή ηςκ ιμκάδςκ
πμο εβηαηαζημφκηαζ ζε κέα εέζδ (πήια 1Β).
Ακ ηαζ δεκ ηαηαβνάθμκηαζ δζαθμνέξ ζημκ ζοκμθζηυ υβημ εηηνμθήξ ιεηαλφ ηςκ πενζυδςκ
2002-2005 ηαζ 2006-2011 βζα ηδκ Δθθάδα (t-test; P>0.05), o μπμίμξ εηηζιάηαζ ζηα 18219±3705x103
m3 ηαζ 17330±2967x103 m3 βζα ηζξ δφμ πενζυδμοξ ακηίζημζπα, εκημφημζξ δζαθμνέξ παναηδνμφκηαζ ζημ
ζοκμθζηυ υβημ εηηνμθήξ ακά μιάδα ζφκεεζδξ ηθςαχκ ηςκ ιμκάδςκ (ANOVA;P<0.05). Οζ δζαθμνέξ
εζηζάγμκηαζ ζηδκ αφλδζδ ημο ζοκμθζημφ υβημο εηηνμθήξ ηδξ μιάδαξ 2 ηαζ ιείςζδ ημο υβημο
εηηνμθήξ ηςκ μιάδςκ 1, 3 ηαζ 6 (Tukey t-test; P<0.05) (πήια 2). Απυ ηδκ άθθδ, βζα ηδκ Σμονηία βζα
ηζξ ακηίζημζπεξ πενζυδμοξ μ ζοκμθζηυξ υβημξ εηηνμθήξ αολάκεζ απυ 9103±1715x103 m3 ζε
15145±3224x103 m3 (t-test; P>0.05), δ μπμία ζοκμδεφεηαζ απυ δζαθμνέξ ζημ ζοκμθζηυ υβημ εηηνμθήξ
ακά μιάδα ζφκεεζδξ ηθςαχκ ηςκ ιμκάδςκ (ANOVA;P<0.05). Οζ δζαθμνέξ εζηζάγμκηαζ ζηδκ αφλδζδ
ημο ζοκμθζημφ υβημο εηηνμθήξ ηςκ μιάδςκ ζφκεεζδξ ιμκάδμξ 1,5 ηαζ 8 ηαζ ιείςζδ ημο υβημο
εηηνμθήξ ηςκ μιάδςκ 4, 6 ηαζ 7 (Tukey t-test; P<0.05) (πήια 2).
206
HydroMedit 2014, November 13-15, Volos, Greece
πδήηεζε
ημ ζφκμθμ ημοξ μζ ιμκάδεξ ζπεομηαθθζένβεζαξ ζηδκ Δθθάδα είκαζ εβηαηεζηδιέκεξ ζηδκ
πανάηηζα γχκδ ηαζ ζοκαενμίγμκηαζ ζε 24 πςνζηέξ μιάδεξ, εκχ μζ ιμκάδεξ ηδξ Σμονηίαξ ζε 5 πςνζηέξ
μιάδεξ. Ζ εζηυκα αοηή πένακ ηςκ πζεακχκ αέθηζζηςκ ζοκεδηχκ εηηνμθήξ, είκαζ ηαζ απμηέθεζια
αεθηζζημπμίδζδξ ηδξ απυδμζδξ ηςκ επζπεζνήζεςκ, αθμφ ακαιέκεηαζ ιείςζδ θεζημονβζηχκ ελυδςκ
ιέζς ηςκ ζοκαενμίζεςκ αθθά ηαζ ηςκ ελυδςκ δζακμιήξ ηαζ πανάθθδθδ ιείςζδ ημο νίζημο
ηαηαζηνμθχκ ιε επζθμβή πνμζηαηεουιεκςκ εέζεςκ (Πέηνμο, 2013). Πανυθδ ηδκ ειθακζζδ ιζαξ
πμζηζθίαξ ηεπκζηχκ παναηηδνζζηζηχκ ιμκάδςκ δ μπμία δεκ δζαθμνμπμίεζηαζ πςνζηά (Πέηνμο, 2013),
αοηή οπμζηδνίγεζ ηαηά ηφνζμ θυβμ ηδκ εηηνμθή ηζζπμφναξ ηαζ θααναηζμφ (FAO, 2014). Δλαίνεζδ
απμηεθμφκ μζ ιμκάδεξ ιε
ηοηθζημφξ ηθςαμφξ
δζαιέηνμο 40-60m
(Πίκαηαξ ΗΗ: μιάδα 8) πμο
πνδζζιμπμζμφκηαζ ηαηά
ηφνζμ θυβμ βζα πάποκζδ
ηυκμο (Trujillo et al., 2012).
ρήκα 1. Α) Πνζνζηφ
ηχπνπ κεηαβνιήο
ηερληθψλ
ραξαθηεξηζηηθψλ
κνλάδαο ηελ πεξίνδν
2006-2011 ζε ζρέζε κε ηελ
πεξίνδν 2002-2005 (C: Όρη
κεηαβνιή, CH: αιιαγή
νκάδαο ζχλζεζεο θισβψλ,
E: δηάιπζε θαη Η:
εγθαηάζηαζε κνλάδαο)
θαη Β κέζε απφζηαζε
ειάρηζηεο απφζηαζεο απφ
ηελ αθηή αλά ηχπν κεηαβνιήο ζηελ Διιάδα (GR) θαη Σνπξθία (TR). Οη κπάξεο ππνδειψλνπλ ην
δηπιάζην ηνπ ζηαζεξνχ ζθάικαηνο.
Οζ ιεηααμθέξ ηεπκζηχκ παναηηδνζζηζηχκ ηςκ ιμκάδςκ ιεηαλφ ηςκ πενζυδςκ 2002-2005 ηαζ
2006-2011 ζηζξ δφμ πχνεξ πανμοζζάγμοκ δζαθμνμπμίδζδ. ηδκ Δθθάδα βζα ημ ιεβαθφηενμ πμζμζηυ
ηςκ ιμκάδςκ δε επεζ επέθεεζ ιεηααμθή ή έπεζ αθθάλεζ μιάδα (ηάζδ πνμξ ηοηθζημφξ ηθςαμφξ
δζαιέηνμο 10-20m), πςνίξ αθθαβέξ ζημκ ηεθζηυ δζαεέζζιμ υβημ εηηνμθήξ ηαζ ηδ πςνμεέηδζδ ηςκ
ιμκάδςκ ζε ζπέζδ ιε ηδκ αηηή. ηδκ Σμονηία, απυ ηδκ άθθδ, ημ ιεβαθφηενμ πμζμζηυ ηςκ
ιεηααμθχκ αθμνά ζε δζάθοζδ ιμκάδμξ ηαζ εβηαηάζηαζδ, ιε αθθαβέξ ηςκ ηεπκζηχκ παναηηδνζζηζηχκ
ηςκ ιμκάδςκ (ηάζδ πνμξ ηοηθζημφξ ηθςαμφξ δζαιέηνμο 20-40m), εβηαηάζηαζδ ζε ιεβαθφηενεξ
απμζηάζεζξ απμ ηδκ αηηή ηαζ αφλδζδ ημο υβημο εηηνμθήξ (πήια 1 Α,Β).
Ζ αθθαβή ζηδκ Σμονηία ελδβείηαζ απυ ηδκ εθανιμβή κμιμεεζίαξ ιε έκανλδ εθανιμβήξ ηα
ιέζα ημο 2007, βζα ηδκ πνμζηαζία απυ ηδ νφπακζδ πμο πνμηαθείηαζ απυ ηδκ εηηνμθή ζπεφςκ ζε
ηθεζζημφξ ηυθπμοξ, ιε ηδ δναζηδνζυηδηα ηδξ οδαημηαθθζένβεζαξ κα εεςνείηαζ πανάβμκηαξ
εοηνμθζζιμφ ηαζ κα εθέβπεηαζ απυ ηδκ ημονηζηή κμιμεεζία (Yücel – Gier et al., 2009). φιθςκα ιε
αοηήκ εάκ μζ ιμκάδεξ εηηνμθήξ ανίζημκηαζ ήδδ ζε πενζμπέξ ορδθήξ επζηζκδοκυηδηαξ, εα πνέπεζ κα
ακαζηέθθμοκ ηδ θεζημονβία ημοξ εκηυξ εκυξ έημοξ ηαζ δεκ εα επζηνέπεηαζ ηαιία κέα εβηαηάζηαζδ
εαθάζζζαξ οδαημηαθθζένβεζαξ, ζηδκ πενζμπή αοηή, μδδβχκηαξ έηζζ, είηε ζε δζάθοζδ είηε ζε
ιεηεβηαηάζηαζδ ημοξ ζε απμζηάζεζξ ιεβαθφηενεξ ημο 1km απυ ηδκ αηηή.
Απυ δζαεέζζια ζημζπεία (FAO, 2014) βζα ηζξ δφμ παναπάκς πενζυδμοξ ζηδκ Δθθάδα δ
παναβςβή έπεζ αολδεεί ηαηά 42% ηαζ ζηδκ Σμονηία βζα ηδκ ίδζα πενίμδμ ηαηά 82%. Οζ παναπάκς
207
HydroMedit 2014, November 13-15, Volos, Greece
ιεηααμθέξ ζηα ηεπκζηά παναηηδνζζηζηά ζοκμδεφμκηαζ απυ αφλδζδ ημο δζαεέζζιμο υβημο εηηνμθήξ
ζηδκ Σμονηία ηαηά 66% (ζπήια 2) βεβμκυξ πμο δζηαζμθμβεί ηδκ αολδζδ ηδξ παναβςβήξ δ μπμία
ηαηαβνάθεηαζ ηζξ ακηίζημζπεξ πενζυδμοξ.
Γζα ηδκ Δθθάδα, παναηδνείηαζ ιζα ακακηζζημζπία ηςκ ιεηααμθχκ ηςκ δφμ πενζυδςκ ζηα
ηεπκζηά παναηηδνζζηζηά ηςκ ιμκάδςκ ηαζ ημ δζαεέζζιμ υβημ εηηνμθήξ (μ μπμίμξ δεκ πανμοζζάγεζ
ιεηααμθέξ) ιε ηδκ αφλδζδ ηαηά 42% ηδξ παναβςβήξ. Ζ ακακηζζημζπία αοηή ηαηά έκα ιένμξ ηδξ
ιπμνεί κα αθμνά ζημ θάεμξ εηηίιδζδξ ημο δζαεέζζιμο υβημο εηηνμθήξ ημ μπμίμ ακενπεηαζ ζημ 20%
ηδξ ιέζδξ ηζιήξ. Απυ ηδκ άθθδ, εκδεπυιεκμ απμηεθεί επίζδξ ημ βεβμκυξ υηζ ηα ζημζπεία παναβςβήξ
ημο FAO βζα ηδκ πνχηδ πενίμδμ (2002-2005) κα βίκμκηακ ααζδ ηδξ ζοκμθζηήξ δοκαιζηυηδηαξ ηςκ
ιμκάδςκ υπςξ αοηή ηαηαβνάθεηαζ ζηδκ άδεζα θεζημονβίαξ ηαζ υπζ ηδξ πναβιαηζηήξ (πνμζςπζηή
επζημζκςκία ιε οδαημηαθθζενβδηέξ).
ρήκα 2. Όγθνο εθηξνθήο ζηηο πεξηφδνπο 2002-2005 θαη 2006-2011 αλά νκάδα ζχλζεζεο
θισβψλ κνλάδνο θαη ζχλνιν ζηελ Διιάδα (GR) θαη Σνπξθία (TR). Οη κπάξεο ππνδειψλνπλ ην
δηπιάζην ηνπ ζηαζεξνχ ζθάικαηνο, θαη ηα βέιε ηηο νκάδεο φπνπ παξαηεξείηαη ζηαηηζηηθή
δηαθνξά.
Σέθμξ, δεκ πνέπεζ κα αβκμδεεί ημ βεβμκυξ υηζ ηα δζαεέζζια ζημζπεία βζα ηδκ Δθθάδα πμο
πνδζζιμπμζμφκηαζ βζα ηδ ιεθέηδ ηςκ ιεηααμθχκ, αθμνμφκ ηονίςξ ζηζξ πενζμπέξ ηδξ αβζάδαξ ηαζ ηδξ
Κεθαθμκζάξ (ζημζπεία δεκ θαίκμκηαζ ζηδκ πανμφζα), ηαζ ζοκεπχξ δεκ εκζςιαηχκμοκ ηζξ ιεβάθεξ
ζπεομηαθθζενβδηζηέξ ζοκαενμίζεζξ ιμκάδςκ ηδξ Δθθάδαξ (Δοαμζημφ, Δπζκάδςκ κήζςκ, Ανβμθζημφ
ηαζ ανςκζημφ ηυθπμο) (Πέηνμο, 2013), πνμαάθθμκηαξ ημ εκδεπυιεκμ μζ παναπάκς ιεηααμθέξ κα
δζέπμκηαζ απυ πςνζημφξ πενζμνζζιμφξ.
Βιβλιογραφία
Πζτρου Χ. (2013). Μελζτθ τθσ χωρικισ κατανομισ και τεχνικά χαρακτθριςτικά των μονάδων τθσ
Μεςογειακισ ιχκυοκαλλιζργειασ μζςω διακζςιμων δορυφορικϊν απεικονίςεων του
TM
λογιςμικοφ Google earth . Μεταπτυχιακι εργαςία, Παν/μιο Θεςςαλίασ, ςελ 81.
Clarke P., Jennifer A.,Melendez R., Bader M., Morenoff J. (2010). Using Google Earth to conduct a
neighborhood audit:Reliability of a virtual audit instrument. Health & Place 16,1224–1229.
Dempster, T., Sanchez-Jerez, P., Bayle-Sempere, J. T., Gimenez- Casalduero, F., Valle, C. (2002).
Attraction of wild fish to sea-cage fish farms in the south-western Mediterranean Sea:
spatial and short-term temporal variability. Mar. Ecol. Prog. Ser. 242, 237–252.
Dimitriou, E., Katselis, G., Moutopoulos, D., Akovitiotis C., Koutsikopoulos C. (2007). Possible
influence of reared gilthead sea bream (Sparus aurata, L.) on wild stocks in the area of the
Messolonghi lagoon (Ionian Sea, Greece). Aquaculture Research38,398-408.
208
HydroMedit 2014, November 13-15, Volos, Greece
209
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
Pagasitikos Gulf is located in central Greece and it is a sensitive marine ecosystem, which is
inevitably exposed to pollution due to its proximity to the city of Volos and its use as a port and
industrial area. The aim of this study was to examine the concentration levels of metals in the body
tissue of two fish species and to determine whether metal concentration levels could be affected by
season. Heavy metals‘ concentrations were measured for a benthic (Mullus barbatus) and a
benthopelagic fish species (Pagellus erythrinus). Both species are commercial and therefore, heavy
metal examination on their bodies is important for human consumption. Fish samples were collected
monthly from September 2009 until August 2010. Chromium (Cr), Copper (Cu) and Zinc (Zn)
concentrations were measured. Cadmium (Cd) concentration was determined in muscle samples for
the risk analysis assessment. The maximum safe consumption (MSC) was also calculated daily,
depending on mean concentrations of Cr, Cu, Zn and Cd in the muscle of both species (39 samples).
The results of this study demonstrated significant differences for both Cu and Zn concentrations in M.
barbatus. Seasonality showed also statistical significance for all metal concentrations in P.
erythrinus tissues (Kruskal-Wallis, df=3; P<0.05). Highest heavy metal concentrations were recorded
in M. barbatus samples for both autumn and winter measurements, while P. erythrinus highest heavy
metal concentrations were noted in spring. Both species showed lowest metal concentrations in
summer.The risk analysis showed no danger for human consumption.
Keywords: Pagasitikos Gulf, Mullus barbatus, Pagellus erythinus, seasonality, metals.
*Corresponding author: Loukia Giannakopoulou (logianna@apae.uth.gr)
Πεξίιεςε
Ο Παβαζδηζηυξ Κυθπμξ ανίζηεηαζ ζηδκ ηεκηνζηή Δθθάδα ηαζ είκαζ έκα εοαίζεδημ μζημζφζηδια πμο
ακαπυθεοηηα εηηίεεηαζ ζηδ νφπακζδ ελαζηίαξ ηδξ εββφηδηαξ ιε ηδκ πυθδ ημο Βυθμο ηαζ ηδ πνήζδ ηδξ
ςξ θζιάκζ, αθθά ηαζ ηδξ αζμιδπακζηήξ πενζμπήξ ημο. ημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ κα
ζοζπεηζζεεί δ επμπζηυηδηα ιε ηζξ ζοβηεκηνχζεζξ ηςκ αανέςκ ιεηάθθςκ ζε έκα αεκεζηυ (Mullus
barbatus), ηαζ ζε έκα αεκεμπεθαβζηυ είδμξ (Pagellus erythrinus). Δίκαζ δφμ ειπμνζηά είδδ, επμιέκςξ,
είδδ ορδθήξ επζηζκδοκυηδηαξ βζα ημκ άκενςπμ. Σα δείβιαηα ζοθθέπεδηακ ζε ιδκζαία αάζδ απυ ημ
επηέιανζμ ημο 2009 ιέπνζ ηαζ ημκ Αφβμοζημ ημο 2010, ηαθφπημκηαξ έκα πθήνεξ διενμθμβζαηυ έημξ.
Οζ ζοβηεκηνχζεζξ ημο πνςιίμο (Cr), ημο παθημφ (Cu) ηαζ ημο ρεοδανβφνμο (Zn) ιεηνήεδηακ ζε έκα
ζφκμθμ 159 δεζβιάηςκ. Ζ ιέβζζηδ αζθαθήξ διενήζζα ηαηακάθςζδ οπμθμβίζηδηε ζε 39 δείβιαηα
ιουξ. Οζ ζοβηεκηνχζεζξ ημο ηαδιίμο (Cd) ακζπκεφεδηακ ζηα δείβιαηα ιουξ βζα κα πνδζζιμπμζδεμφκ
ζηδκ ακάθοζδ ηζκδφκμο. Ζ ζηαηζζηζηή επελενβαζία έδεζλε υηζ μζ ζοβηεκηνχζεζξ ημο Cu ηαζ ημο Zn
επδνεάγμκηαζ άιεζα απυ ηδκ επμπή, υζμκ αθμνά ηδκ ημοηζμιμφνα, εκχ δ επμπή είκαζ ζδιακηζηή βζα
υθεξ ηζξ ζοβηεκηνχζεζξ ηςκ αανέςκ ιεηάθθςκ ζημ θοενίκζ (Kruskal-Wallis, df=3, P<0,05).
Αολδιέκεξ ζοβηεκηνχζεζξ παναηδνήεδηακ ημ θεζκυπςνμ ηαζ ημ πεζιχκα ζηδκ ημοηζμιμφνα, εκχ ηδκ
άκμζλδ ήηακ αολδιέκεξ μζ ζοβηεκηνχζεζξ ζημ θοενίκζ. Υαιδθυηενεξ ήηακ μζ ζοβηεκηνχζεζξ ημο
ηαθμηαζνζμφ ηαζ ζηα δφμ είδδ. Ζ ηαηακάθςζδ ζπεφςκ απμδείπεδηε αζθαθήξ βζα ημκ άκενςπμ.
Λέξειρ κλειδιά: Παγαζεηηθόο θόιπνο, Mullus barbatus, Pagellus erythrinus, επνρηθόηεηα, κέηαιια.
210
HydroMedit 2014, November 13-15, Volos, Greece
1. Δηζαγσγή
Ζ πανμοζία ηςκ αανέςκ ιεηάθθςκ ζηα οδάηζκα μζημζοζηήιαηα ηνίκεηαζ ζδζαζηένςξ
ζδιακηζηή, ελαζηίαξ ηδξ ιεβάθδξ δζεζζδοηζηήξ ημοξ ζηακυηδηαξ, αθθά ηαζ ημο βεβμκυημξ υηζ ιπμνμφκ
κα ζοζζςνεφμκηαζ ζηδκ ηνμθζηή αθοζίδα (Erdogrul & Erbilir 2007). Καηακαθχκμοκ πθδεχνα
ηνμθζηχκ ακηζηεζιέκςκ, ιε απμηέθεζια ηδ ιεβαθφηενδ ζοζζχνεοζδ ιεηάθθςκ ζημκ μνβακζζιυ ημοξ,
ζε ζοκδοαζιυ πάκηα ιε ημοξ ιδπακζζιμφξ ζοζζχνεοζδξ πμο θένμοκ μζ ίδζμζ μζ μνβακζζιμί.
Δπμιέκςξ απμηεθμφκ ημοξ ηαηαθθδθυηενμοξ μνβακζζιμφξ βζα ηδκ ελαβςβή ζοιπεναζιάηςκ ηδξ
ηαηάζηαζδξ εκυξ εαθάζζζμο μζημζοζηήιαημξ (Alibalic et al. 2007).
Σα αανέα ιέηαθθα εζζνέμοκ ζημοξ ζπεείξ ιέζς ημο επζεδθίμο ηςκ αναβπίςκ, ημο δένιαημξ,
αθθά ηαζ ιέζς ημο πεπηζημφ ζοζηήιαημξ ηαηά ηδκ ηαηάπμζδ ηδξ ηνμθήξ (Bordajandi et al. 2003). Ζ
ημλζηυηδηα ηςκ ιεηάθθςκ πμζηίθθεζ απυ επζδνάζεζξ ζημοξ ζπεείξ ηυζμ ζηδκ ακαπαναβςβή ηαζ ηδκ
ακάπηολδ (Bervoets & Blust 2003), υζμ ηαζ ζηδ εκδζζιυηδηά ημοξ, αηυιδ ιέπνζ ηαζ ηδκ μθζηή
απχθεζα ηάπμζςκ πθδεοζιχκ (Greig et al. 2010). Ο έθεβπμξ ηςκ ζοβηεκηνχζεχκ ημοξ έπεζ άιεζδ
ζπέζδ ιε ηδ δδιυζζα οβεία, βζαηί ηα αανέα ιέηαθθα έπμοκ ηδκ ζηακυηδηα κα πνμηαθμφκ
ιμνθμθμβζηέξ δοζιμνθίεξ, κεονμθοζζμθμβζηέξ δζαηαναπέξ, ηεναημβεκέζεζξ ηαζ ηανηζκμβεκέζεζξ (Idris
et al. 2007).
211
HydroMedit 2014, November 13-15, Volos, Greece
3. Απνηειέζκαηα
Ζ επμπζηυηδηα ηνίκεηαζ ςξ έκαξ απυ ημοξ πζμ ζδιακηζημφξ πανάβμκηεξ βζα ηδ ζοβηέκηνςζδ
ηςκ αανέςκ ιεηάθθςκ. Ζ ζηαηζζηζηή επελενβαζία απέδεζλε υηζ μζ ζοβηεκηνχζεζξ ημο Cu ηαζ ημο Zn
επδνεάγμκηαζ άιεζα απυ ηδκ επμπή, υζμκ αθμνά ηα άημια ηδξ ημοηζμιμφναξ (Kruskal-Wallis, df=3,
P<0,05), εκχ, βζα ηα άημια ημο P. erythrinus, δ επμπζηυηδηα ηνίεδηε ζδιακηζηή βζα υθεξ ηζξ
ζοβηεκηνχζεζξ υθςκ ηςκ ιεηάθθςκ (Kruskal-Wallis, df=3, P<0,05).
Δζδζηυηενα, ζηαηζζηζηχξ ζδιακηζηέξ δζαθμνέξ πανμοζζάζηδηακ ακάιεζα ζηζξ ηζιέξ ημο
θεζκμπχνμο ηαζ ημο πεζιχκα (π. 1) ζημ M. barbatus (Mann-Whitney test, P<0,05). Διθακχξ, μζ
ιεβαθφηενεξ ζοβηεκηνχζεζξ πανμοζζάζηδηακ ηαηά ηδ δζάνηεζα ημο πεζιχκα ηαζ εζδζηά ημ ιήκα
Γεηέιανζμ. Οζ ηζιέξ ημο Γεηειανίμο ήηακ ανηεηά ορδθυηενεξ ζε ζπέζδ ιε ηζξ ζοβηεκηνχζεζξ ημο
Οηηςανίμο ηαζ ημο Νμειανίμο. Υαιδθυηενεξ ήηακ μζ ηζιέξ ημοξ ιήκεξ Ηακμοάνζμ ηαζ Φεανμοάνζμ.
ζμκ αθμνά ηζξ ζοβηεκηνχζεζξ ημο Cr ζηα άημια ημο είδμοξ P. erythrinus, απμδείπεδηε υηζ
μζ ζοβηεκηνχζεζξ πμο ειθάκζζε ημ είδμξ (π. 1) είκαζ ζηαηζζηζηά ζδιακηζηέξ (Kruskal–Wallis,
P<0,05) ακάιεζα ζηδκ πενίμδμ ηδξ άκμζλδξ ηαζ ηζξ οπυθμζπεξ πενζμπέξ. Δπζπνυζεεηα, μζ
δζαθμνμπμζήζεζξ πμο ειθακίζηδηακ ζηζξ ηζιέξ ημο Cr ημο είδμοξ ειθακίζηδηακ ακάιεζα ζε ιήκεξ
(π. 1) δζαθμνεηζηχκ επμπχκ (Mann-Whitney test, P<0,05). Οζ δζαθμνέξ εζηζάζηδηακ ηαηά ηφνζμ
θυβμ ακάιεζα ζημοξ θεζκμπςνζκμφξ ηαζ πεζιενζκμφξ ιήκεξ ζε ζοκάνηδζδ ιε ηζξ ηζιέξ πμο επέδεζλε ημ
είδμξ ηαηά ηδ δζάνηεζα ηςκ ακμζλζάηζηςκ ιδκχκ. Σμ πεζιχκα ειθακίζηδηακ μζ παιδθυηενεξ
ζοβηεκηνχζεζξ ηαζ ζοβηεηνζιέκα ημ Γεηέιανζμ ιε ορδθυηενεξ ηζιέξ ημκ ιήκα Απνίθζμ (π. 1).
Οζ ζοβηεκηνχζεζξ ημο Cu βζα ημ είδμξ M. barbatus (π. 2), πανμοζίαζακ ηζξ ορδθυηενεξ
ηζιέξ ημοξ ημ πεζιχκα ηαζ ηδκ άκμζλδ, μζ μπμίεξ ηοιάκεδηακ πενίπμο ζηα ίδζα επίπεδα. Οζ
ζοβηεκηνχζεζξ ημο Cu ζημ είδμξ M. barbatus (π. 2), πανμοζίαζακ ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ
212
HydroMedit 2014, November 13-15, Volos, Greece
ακάιεζα ζηζξ ηζιέξ ημο ηαθμηαζνζμφ ηαζ ηςκ οπμθμίπςκ επμπχκ (Mann-Whitney test, P<0,05).
ηαηζζηζηά ζδιακηζηέξ δζαθμνέξ ιέζα ζημ θεζκυπςνμ πανμοζζάζηδηακ ακάιεζα ζημκ Οηηχανδ ηαζ
ημ Νμέιανδ, εκχ ιέζα ζημ πεζιχκα ακάιεζα ζημ Γεηέιανδ ηαζ ημκ Ηακμοάνζμ ή ημ Φεανμοάνζμ
(Mann-Whitney test, P<0,05). Δκηυξ ημο ηαθμηαζνζμφ, ζδιακηζηέξ δζαθμνέξ πανμοζζάζηδηακ ζηζξ
ηζιέξ ηςκ ζοβηεκηνχζεςκ ζημοξ ιήκεξ Ημφκζμ ηαζ Ημφθζμ (π. 2).
Οζ ζοβηεκηνχζεζξ ημο Cu βζα ημ είδμξ P. erythrinus (π. 2), πανμοζίαζακ ζηαηζζηζηά
ζδιακηζηέξ δζαθμνέξ ακάιεζα ζηζξ ηζιέξ ημο ηαθμηαζνζμφ ηαζ ζηζξ ηζιέξ ηςκ οπμθμίπςκ επμπχκ
(Mann-Whitney test, P<0,05). Τπήνλε ιζα ακμδζηή ηάζδ ηςκ ηζιχκ ιέπνζ ηδκ άκμζλδ ηαζ ιζα απυημιδ
πηχζδ ημοξ ημ ηαθμηαίνζ. Οζ ζοβηεκηνχζεζξ ημο Cu ημο Μαΐμο, ημο Ημοκίμο ηαζ ημο Ημοθίμο, είκαζ μζ
ζοβηεκηνχζεζξ πμο πανμοζίαζακ ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ (Mann-Whitney test, P<0,05)
ζοβηνίκμκηαξ ηζξ ηζιέξ ημοξ ιε ζοβηεκηνχζεζξ άθθςκ ιδκχκ (π. 2). Μέζα ζηδκ ίδζα επμπή, δζαθμνέξ
ειθάκζζακ μζ ζοβηεκηνχζεζξ ημο Μανηίμο ηαζ ημο Απνζθίμο, ιε ηζξ ζοβηεκηνχζεζξ ημο Μαΐμο, πμο
πανμοζίαζακ ιζα απυημιδ πηχζδ ηςκ επζπέδςκ ημοξ.
Πανάθθδθα, ζδιακηζηέξ δζαθμνέξ ακζπκεφεδηακ ακάιεζα ζε ιήκεξ ηδξ ίδζαξ επμπήξ ηαζ ζηζξ
ζοβηεκηνχζεζξ ημο Zn (π. 3) ημο M. barbatus. Δζδζηυηενα, ηδκ πενίμδμ Οηηςανίμο-Νμειανίμο,
αθθά ηαζ ακάιεζα ζηζξ ζοβηεκηνχζεζξ ημο Ημοθίμο ιε ηζξ ζοβηεκηνχζεζξ Ημοκίμο ηαζ Αοβμφζημο
(Mann-Whitney test, P<0,05).
ρήκα 3. πγθεληξψζεηο Cu (mg/Kg μεξνχ βάξνπο) αλά είδνο, επνρή θαη δεηγκαηνιεςία.
Οζ ζοβηεκηνχζεζξ ημο Zn ήηακ αολδιέκεξ ημ θεζκυπςνμ ηαζ ζηα δφμ είδδ. Οζ ζοβηεκηνχζεζξ
ημο M. barbatus ειθάκζζακ ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ ακάιεζα ζηζξ ζοβηεκηνχζεζξ ημο είδμοξ
ηαηά ηδκ πενίμδμ ημο ηαθμηαζνζμφ (π. 3), ζε ζπέζδ ιε ηζξ ζοβηεκηνχζεζξ πμο ακζπκεφεδηακ ημ
θεζκυπςνμ, ημ πεζιχκα ηαζ ηδκ άκμζλδ (Mann-Whitney test, P<0,05). Γζα ημ θοενίκζ, παιδθυηενεξ
ήηακ μζ ηζιέξ ημο ηαθμηαζνζμφ (π. 3). διακηζηέξ δζαθμνέξ ειθάκζζακ μζ ζοβηεκηνχζεζξ ημο P.
erythrinus ηςκ ιδκχκ Ηακμοανίμο, Μανηίμο, Απνζθίμο, ιε ηζξ ζοβηεκηνχζεζξ ημο Zn ηαηά ημοξ ιήκεξ
Μάζμ, Ημφκζμ ηαζ Ημφθζμ (Mann – Whitney test, P<0,05).
ρήκα 3. πγθεληξψζεηο Zn (mg/Kg μεξνχ βάξνπο) αλά είδνο, επνρή θαη δεηγκαηνιεςία.
213
HydroMedit 2014, November 13-15, Volos, Greece
Ζ Μέβζζηδ Αζθαθήξ Ζιενήζζα Καηακάθςζδ ημο είδμοξ M. barbatus (εδχδζιμ ιένμξ) ήηακ
άκς ηςκ 150 g βζα ηζξ βοκαίηεξ (ΜΑΖΚ, ζε g οβνμφ αάνμοξ επί ηαεδιενζκήξ), ηαζ δεκ οπενέααζκε ηα
200 g βζα ημοξ άκηνεξ (Cr: 12515g, Cu: 10496, Zn: 1771g, Cd: 155g ζηζξ βοκαίηεξ ηαζ Cr: 16686g,
Cu: 13994, Zn: 2362g, Cd: 207g ζημοξ άκηνεξ). Δπζπνυζεεηα, δ ΜΑΖΚ βζα ηα ανχζζια ιένδ ημο P.
erythrinus οπενααίκεζ ηα 160g βζα ηζξ βοκαίηεξ ηαζ ηα 220g βζα ημοξ άκηνεξ (Cr: 9799g, Cu: 13900,
Zn: 3810g, Cd: 166g ζηζξ βοκαίηεξ ηαζ, Cr: 13065g, Cu: 18533, Zn: 5079g, Cd: 221g ζημοξ άκηνεξ).
4. πδήηεζε
Ζ πανμφζα ενβαζία δζενεφκδζε εάκ ηνία ιέηαθθα δείπκμοκ πανυιμζα ηάζδ ζοζζχνεοζδξ
ακά επμπή αθθά ηαζ ηζξ δζαθμνμπμζήζεζξ πμο ιπμνεί κα οπάνπμοκ ιέζα ζηδκ ίδζα επμπή, ζε δφμ είδδ
ιε δζαθμνεηζηέξ ζοκήεεζεξ ζηδκ πενζμπή ημο Παβαζδηζημφ Κυθπμο. Σα δεδμιέκα απμδεζηκφμοκ υηζ δ
δεζβιαημθδρία ήηακ ζδιακηζηή βζα ηδ δζακμιή ηςκ ιεηάθθςκ ζηα δζαθμνεηζηά είδδ. Αοηυ ζοιααίκεζ
ελαζηίαξ ηςκ δζαθμνμπμζήζεςκ πμο οπάνπμοκ ακάιεζα ζημκ ηφηθμ ακάπηολδξ ηςκ εζδχκ ή ηςκ
ακαπαναβςβζηχκ ηφηθςκ, αθθά ηαζ ηςκ ιεηααμθχκ ηδξ εενιμηναζίαξ ημο κενμφ ακάιεζα ζηζξ
επμπέξ (Dural et al. 2010). Ζ επμπζηή ιεηααθδηυηδηα είκαζ ζδιακηζηυξ πανάβμκηαξ, δζυηζ ιπμνεί κα
επδνεάζεζ ηα επίπεδα ζοζζχνεοζδξ ηςκ ιεηάθθςκ ζημοξ ζζημφξ ηςκ ζπεφςκ (Phillips 1980).
Σέθμξ, ηα δεδμιέκα απμδεζηκφμοκ υηζ οπήνπακ παιδθέξ ζοβηεκηνχζεζξ Cr, Cu, Zn ηαζ Cd
ζηα δείβιαηα ιουξ ηςκ παναπάκς εζδχκ. Αοηυ ζδιαίκεζ υηζ ηα ράνζα είκαζ ιζα αζθαθήξ ηνμθή βζα
ημκ άκενςπμ. Οζ ζοβηεκηνχζεζξ ηςκ αανέςκ ιεηάθθςκ ζηα ανχζζια ιένδ ηςκ εζδχκ M. barbatus ηαζ
P. erythrinus δεκ έδεζλακ εκδεπυιεκμ νίζημ ζηδκ ηαηακάθςζή ημοξ απυ ημκ άκενςπμ.
Δπραξηζηίεο
Ζ πανμφζα ενβαζία είκαζ ιένμξ ηδξ δζδαηημνζηήξ δζαηνζαήξ ηδξ Λμοηίαξ Γζακκαημπμφθμο.
Οζ ζοββναθείξ εέθμοκ κα εηθνάζμοκ ηζξ εοπανζζηίεξ ημοξ ζε υζμοξ ζοκέααθακ ζηδκ οθμπμίδζδ ηαζ
μθμηθήνςζδ ηδξ ένεοκαξ αοηήξ.
Βηβιηνγξαθία
Alibabic V., Vahcic N., Bajramovic M. (2007) Bioaccumulation of metals in fish of salmonidae
family and the impact on fish meat quality. Environmental Monitoring and Assessment, 131,
349-364.
Bervoets L., Blust R. (2003) Metal concentrations in water, sediment and gudgeon (Gobio gobio)
from a pollution gradient: relationship with fish condition factor. Environmental Pollution,
126, 9-19.
Bordajandi L.R., Gómez G., Fernández M.A., Abad E., Rivera J., González M.J. (2003) Study on
PCBs, PCDD/Fs, organochlorine pesticides, heavy metals and arsenic content in freshwater
fish species from the River Turia (Spain). Chemosphere, 53, 163–171.
Dural M., Genc E., Yemenicioglu S. and Sangun M.K. (2010). Accumulation of Some Heavy Metals
Seasonally in Hysterotylacium aduncum (Nematoda) and Its Host Red Sea Bream, Pagellus
erythrinus (Sparidae) from Gulf of Iskenderun (North-Eastern Mediterranean). Bulletin of
Environmental Contamination and Toxicology, 84 (1), 125-131. doi:DOI 10.1007/s00128-
009-9904-4.
Erdogrul O., Erbilir F (2007) Heavy metal and trace elements in various fish samples from Sir Dam
Lake, Kahramanmaras, Turkey. Environmental Monitoring and Assessment, 130, 373-379.
Greig H.S., Niyogi D.K., Hogsden K.L., Jellyman P.G., Harding J.S. (2010) Heavy metals:
confounding factors in the response of New Zealand freshwater fish assemblages to natural
and anthropogenic acidity. Science of the Total Environment, 408, 3240-3250.
Idris A.M., Eltayeb M.A.H., Potgieter-Vemaak S.S., Van Grieken R., Potgieter J.H. (2007)
Assessment of heavy metals pollution in Sudanese harbours along the Red Sea Coast.
Microchemical Journal, 87, 104-112.
Metian M., Warnau M., Chouvelon T., Pedraza F., Rodriguez y Baena A.M., Bustamante P. (2013)
Trace element bioaccumulation in reef fish from New Caledonia: Influence of trophic groups
and risk assessment for consumers. Marine Environmental Research, (87-88), 26-36.
Phillips D.J.H. (1980). Introduction to seasonal variation. In ―Quantitative aquatic biological
indicators‖, Applied Science Publishers Ltd (eds), UK, p. 91-160.
Tsangaris C., Kaberi H., Catsiki V.A. (2013) Metal levels in sediments and transplanted mussels in
Pagasitikos Gulf (Aegean Sea, Eastern Meditteranean). Environmental Monitoring and
Assessment, 185(7), 6077-87, DOI: 10.1007/s10661-012-300z.
WHO (2003) Joint FAO/WHO Expert Committee on Food Additives and Contaminants, Sixty-First
Meeting. Summary and Conclusions, ftp://ftp.fao.org/es/esn/jecfa/jecfa61sc.pdf.
214
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
FISHERIES
TECHNOLOGY
215
HydroMedit 2014, November 13-15, Volos, Greece
Joksimović A.1*, Đurović M.1, Marković O.1, Ikica Z.1, Pešić A.1
1
Institute of Marine Biology, University of Montenegro, Dobrota bb, P.Box 69, 85 330, Kotor,
Montenegro
ABSTRACT
The European Union has started a research of benthic communities in 1994 within the
framework of MEDITS programme (MEDIterranean Trawl Survey). Sampling is performed according
to the standardised protocol, annually, during the spring-summer period. Montenegro and Albania,
although not EU member countries, also participate in the MEDITS surveys. In Montenegrin waters,
ten haul positions were chosen based on the depth strata. The results of the MEDITS 2013 has shown
a decrease in total biomass compared to the results of 2012. In 2013, the biomass index of all
demersal resources along the Montenegrin coast was estimated at 623.82 kg/km 2. As the total area
amounts to 5000 km2, the total biomass thus can be estimated at 3119.12 tons. In 2012, the biomass
index was 847.79 kg/km2, and total biomass in the 5000 km2 area was 4238.93 tons. The noticeable
reduction in trawl resource biomass in 2013 can likely be considered as the result of natural
fluctuations in biomass caused by available food resources in the sea, temperature fluctuations and
other hydrographic factors. The fact that the contribution of Montenegrin fleet in total catch of
demersal resources within GFCM GSA 18 (2013) was 1%, implies that the biomass reduction is not
connected to the fishing effort (F) intensity, which (in Montenegro) has remained fairly constant for a
long time.
1. Introduction
The European Union started a detailed study of Mediterranean benthic resources in 1994
within the MEDITS programme (MEDIterranean Trawl Survey), which includes the trawling areas on
continental shelf and continental slope. The sampling is done according to the standardised protocol,
annually, during spring and summer seasons. Montenegro and Albania, although not the EU member
countries, participate in the MEDITS surveys within the framework of FAO AdriaMed project
(Scientific support to development of sustainable fisheries in the Adriatic Sea) (Vrgoĉ et al., 2004). In
this way, important data on trawl resources within the GSA 18 are collected, which is important for
GFCM reports and also for the biomass estimation and sustainable trawling in the Adriatic Sea.
Montenegro has actively participated in the MEDITS surveys since 2004.
According to the current MEDITS protocol (Instruction manual, Version 6, 2012), the
sampling can be done in the period between 30 minutes after sunrise to 30 minutes before sunset. The
hauls last for 30 minutes, except on haul positions with depths greater than 200 m, where hauls last for
1 hour (due to the extra time required to the trawl to drop and settle along the sea bottom). There are
216
HydroMedit 2014, November 13-15, Volos, Greece
10 haul positions in Montenegro (Fig. 1). Of those 10, seven are on the continental shelf area (at
depths less than 200 m), where the majority of Montenegrin trawling activity occurs.
Cod-end mesh size for MEDITS survey is 10 mm, which is important for scientific purposes,
as it allows for estimation of spawning areas of the economically important species, as well as for
collecting a greater number of species for a more realistic demersal resource estimation. For target
species, number of individuals, length frequency distribution, sex (including gonad maturity stages)
and total weight of the individuals are recorded on board. MEDITS scale is used for gonad maturity
stage determination (MEDITS Survey, Instruction Manual, Version 6.1, 2012). Total length of
sampled fish and mantle length of cephalopods was measured using the fish measuring board with a
1-mm accuracy, and the cephalopthorax of crustaceans was measured with calliper, with a 0.1-mm
accuracy. The weights were measured using electronic hand-held scales Bonso electronic 393 (max.
15 kg, accuracy of 0.02 kg). At certain haul positions, data on depth, temperature and sea water
salinity were recorded using the ―Star-Oddi‖ DST CTD probe. Species were determined using
determination keys for fish (Šoljan, 1965; Whitehead et al., 1989; Jardas, 1996), cephalopods (Roper
et al., 1984; Nesis, 1987; Jereb & Roper, 2005) and crustaceans (Fisher et al., 1987). All data
collected were analysed using the ATrIS software (Adriamed TRawl Infromation System, Gramolini,
2005), developed within the framework of the FAO AdriaMed project. Abundance, biomass and
length frequency distributions were estimated using the swept-area method, considering random
stratified sampling (Souplet, 1996), and the estimation results are given as N/km2 and kg/km2,
respectively.
The study of demersal resources within the framework of MEDITS survey in 2013 has
shown the reduction in total biomass in comparison to the results from 2012. In 2013, the total
biomass index of demersal resources was estimated at 623.82 kg/km 2. Considering that the total study
area was 5000 km2, the total biomass can be estimated to 3119.12 tons. In 2012, the biomass index
was 847.79 kg/km2, which amounts to a total estimated biomass of 4238.93 tons (GFCM, 2013),
based on the 5000 km2 survey area. The classification of faunistic categories and subcategories was
defined according to the MEDITS protocol. The species are shown according to the main faunistic
groups: A – Fish, B – Crustaceans, C – Cephalopods, D – Other commercial species – edible, E –
Noncomercial species – edible, V – Plants, G – Portions or products of animal species. A total of 151
species were recorded during the survey, which when divided according to categories come up to: A –
70, B – 17, C – 19, D – 8, E – 33, V – 3, G – 1. Table 1 gives the overview of the 25 species with the
highest abundance index (N/km2) in the survey area, while table 2 shows the 25 species with the
highest biomass index (kg/km2).
217
HydroMedit 2014, November 13-15, Volos, Greece
Table 1. Species with the highest abundance index (N/km2) (MEDITS, 2013)
Table 2. Species with the highest biomass index (kg/km2) (MEDITS, 2013)
218
HydroMedit 2014, November 13-15, Volos, Greece
The analysis of tables 1 and 2 shows that the shortfin squid, Illex coindetii, had highest
values of both abundance and biomass indices among the demersal species in Montenegro. Red mullet
(Mullus barbatus), hake (Merluccius merluccius), Mediterranean horse mackerel (Trachurus
mediterraneus), red pandora (Pagellus erythrinus), rays (Raja spp.), John Dory (Zeus faber),
blackbellied angler fish (Lophius budegassa) and bogue (Boops boops) have high biomass indices.
Most of the listed species have had a small decrease in biomass from 2012, and I. coindetii, T.
mediterraneus, Z. faber and L. budegassa actually had a biomass increase in 2013. All species in
question are common in trawl catches, and the decrease in biomass should not have a pronounced
financial effect in relevant subjects in the fishery sector, as in 2012 a large percent of the biomass
(around 20%) was made of non-commercial species picarel (Spicara flexuosa and S. smaris).
Comparison of biomass of the most important commercial species in 2012 and 2013 shows only a
modest decrease in biomass.
A parallel comparison of the biomass of commercial species between 2012 and 2013 (Fig. 2)
shows a reduction in biomass in M. barbatus, M. merluccius, Engraulis encrasicolus and
Parapenaeus longirostris, while an increase in biomass was evidenced for I. coindetii, P. erythrinus,
L. budegassa and Z. faber.
219
HydroMedit 2014, November 13-15, Volos, Greece
100
80 2012
60
40 2013
20
0
8% 0% 0% A - Fish
1%
18% B - Crustaceans
C - Cephalopods
1%
D - Other commercial
species (edible)
E - Noncommercial species
(edible)
72% V - Plants
4. Conclucions
The Adriatic Sea and its fisheries resources represent a shared resource of five countries
situated along the Adriatic coast. Therefore, international scientific research and studies and scientific
cooperation have a very important role towards the creation of fishery activity, especially considering
that available data point to the reduction of biomass, especially along the western Adriatic coast.
The evidenced reduction in biomass of trawl resources in 2013 can, in all likelihood, be tied
to the natural biomass fluctuations caused by the available amount of food in the sea, temperature
fluctuations and other hydrographic factors. The fact that the Montenegrin trawling fleet is responsible
for 1-2% of total trawl catches in the GSA 18 (GFCM, 2013) implies that the biomass reduction is not
caused by fishing effort intensity (F), which has remained fairly unchanged for a long time in
Montenegro.
220
HydroMedit 2014, November 13-15, Volos, Greece
Based on this joint research, biomass index and length frequency distribution of populations,
especially those of commercial interest, it is possible to point to the existence of certain trends, mostly
negative ones, and to make correct decisions towards the joint resource preservation.
References
AdriaMed (2007). AtrIS – Adriamed Trawl Information System. Software version 2.1. FAO–MiPAF
Scientific Cooperation to Support Responsible Fisheries in the Adriatic Sea.
GCP/RER/010/ITA.
Gramolini, R., P. Mannini, N. Milone and V. Zeuli, (2005). AdriaMed Trawl Survey Information
System (AtrIS): User Manual. FAO-MiPAF Scitenic Cooperation to Support Responsabile
Fisheries in the Adriatic Sea. GCP/RER/010/ITA/TD17. AdriaMed Technical Documents,
17: 141 pp.
GFCM Technical document XXXVII/2013/2.35 pp.
MEDITS (2012): Instruction manual, Version 6.1. 99 pp.
Jardas I. (1999). Jadranska ihtiofauna. Školska knjiga. Zagreb, 538s str.
Jereb, P. & C. F. E. Roper (eds). (2005). Cephalopods of the world. An annotated and illustrated
catalogue of Cephalopod species known to date. Volume 1. Chambered nautiluses and
sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepidariidae, Idiosepiidae and Spirulidae). FAO
Species Catalogue for Fishery Purposes. No. 4, Vol. 1. FAO, Rome, 262 pp.
Fisher, W., Schneider, M., Bauchot, M.L. (eds.) (1987) Fishes FAO d‘identification des espèces pour
les besoins de la pêche. Mediterranée et mer Noire. Vol. I – II., Rome, FAO. 1-2: 760 pp.
Roper, C. F. E., Sweeney, M. J., Nauen, C. E. (1984): FAO species catalogue. Vol.. 3. Caphalopods of
the world. An annotated and illustrated catalogue of species of interest to fisheries. FAO
Fisheries Synopsis, No. 25, Volume 3. 277 pp.
Nessis, K. N. (1987). Cephalopods of the world. Squids, cuttlefishes, octopuses, and allies. T.H.F.
Publications, Neptune City, N.J., USA. 351 pp..
Souplet, A., (1996). Calculation of abudance indices and lenght frequencies in the MEDITS survey.
In: J.A. Bertrand et. al. (Editors). Campagne internationale de chalutage demersal en
Mediterranee (MEDITS). Campagne 1995. Vol. III Raport final de contract CEE-IFREMER-
IEO-SIBM-NCMR, 68. pp.
Vrgoĉ, N., Arneri, E., Jukić-Peladić, S., Krstulović-Šifner, S., Mannini, P., Marĉeta, B., Osmani, K.,
Piccineti, C. And Ungaro, N. (2004). Review of current knowledge on shared demersal
stocks of the Adriatic Sea. FAO-MiPAF Scientific Cooperation to Support Responsible
Fisheries in the Adriatic Sea. GCP/RER/010/ITA/TD-12. AdriaMed Technical Documents,
12:91 pp.
Whitehead, P. J. P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (Eds), (1989). Fishes of
the North-eastern Atlantic and the Mediterranean. UNESCO, Richard Clay Ltd, Bungay
(United Kingdom). Vols. I - III: 1473p.
Šoljan, T., (1948). Ribe Jadrana, Fauna i Flora Jadrana, 1, Nakladni izavod Hrvatske: 437 str.
221
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
The potential habitats of the most important commercial species and vessel monitoring system data
(VMS) from trawlers were modeled in order to identify fishing grounds. The data for the analysis
were collected during research activities conducted by HCMR since 1985. In this work, sixteen target
species from trawlers were studied. The methodology is based on: (a) the assessment of the
probability of species presence using Generalized Additive Model (GAM), (b) the estimation of a
threshold of species presence using the Receiver Operating Characteristic analysis (ROC), (c) the
combination of presence/absence model and the estimated fishing effort from trawlers using VMS
data, (d) the identification of the main fishing grounds using Hot Spot analysis. The results revealed
that the most important fishing grounds are identified in the Northern part of the Aegean Sea, in
Euvoikos, Saronikos and Patraikos gulf and in the islands of Chios and Dodecanese.
Key words: VMS, GAM, fishing effort, Hot Spot analysis, bottom trawl
*Corresponding author: Maina Irida (imaina@hcmr.gr)
1. Introduction
Commercial fishing vessels with total length greater than 15 meters are obligated to be
equipped with VMS, which provides data to the fisheries authorities of fishing vessel‘s location,
direction and speed at a two-hour interval (EC No2244/2003). Recently, VMS data have become
available, allowing the analysis of spatial distribution of fishing effort for bottom trawlers and purse
seiners The data were analyzed according to methodology proposed by Kavadas & Maina and the
spatial distribution of fishing effort for bottom trawlers were used for this approach (Kavadas &
Maina, 2012).
In this work the following sixteen commercial species were studied: Merluccius merlucius,
Mullus barbatus, Mullus surmuletus, Galeus melastomus, Parapenaeus longirostris, Pagellus
erythrinus, Lophius budegasa, Illex coindetii, Aristeus antennatus, Aristaeomorpha foliacea, Eledone
cirrhosa, Eledone moschata, Nephrops norvegicus, Octopus vulgaris, Trachurus mediterraneus and
Trachurus trachurus. To overcome the scarcity problem of information, a new approach was devised
to define the potential fishing grounds that are based on habitat modeling (probability of presence) of
each particular species and the high deployed fishing effort of trawlers. In this approach, all available
datasets stored on HCMR databank from surveys at sea (MEDITS, National sampling) and onboard
samplings were used (Kavadas et al., 2013).
The objective of this study is to model the potential habitats (probability of presence) for the
above species, to define a threshold for species presence, to combine the fishing effort from trawlers
with the probability of presence and to identify hot spot areas which can be considered as the most
important fishing grounds for the species under investigation. The potential fishing grounds of the
above species also was also investigated.
222
HydroMedit 2014, November 13-15, Volos, Greece
a set of explanatory variables (Hastie & Tibshirani, 1990, Guisan et al., 2002, Elith & Burgman,
2002). Analysis of estimated goodness of fit statistics and diagnostic graphs, used for the working
data set. In the analysis, the level of deviance explained (0– 100%; the higher the better), R2 (0-1, the
higher the better), Un-Biased Risk Estimator (UBRE score; the lower the better) and Q-Q plots led to
the selection of the model that fitted best the response data. The presence/absence data was modeled
using a binomial error distribution and a logit link function, expressed in R formula syntax, using the
MGET tool (Wood and Augustin, 2002, Roberts et al., 2010). The degree of smoothing of each
parameter was chosen based on the observed data and the minimization of UBRE score (Craven and
Wahba, 1979, Wood, 2006).
To evaluate the predictive performance of the final presence/absence model the following
statistics are used: (a) ROC plots, (b) the area under the ROC curve (AUC) and the threshold value,
(Deleo, 1993, Fielding & Bell, 1997, Guisan & Zimmerman, 2000, Sing et al., 2005). For binary
classification, a threshold value used to determine whether a given value of the response variable
should be classified as positive or negative. The presence/absence model typically outputs predictions
along a continual range (e.g. between 0 and 1). Response values less than the threshold are classified
as negative and those greater than or equal to the threshold are classified as positive. The threshold is
evaluated by the MGET tool for the point of the ROC curve that is closest to the point of the perfect
classification (the upper left corner of the ROC plot) (Roberts et al., 2010).
Potential habitats, i.e. areas in which the species was classified as presence, were used to
combine probability of presence with fishing effort distribution maps. The product of fishing effort
from trawlers × probability of presence for each species was considered to represent the potential
fishing grounds of a particular species. Trawlers‘ fishing effort was estimated by VMS data and was
expressed as days at sea multiplied by vessels Gross Tonnage. It was assumed that every vessel visits
a fishing rectangle (5x5 km) more than once a day, thereby a weighted value is given in each rectangle
depending on the number of visits it receives within 24 hours (Kavadas & Maina, 2012, Maina et al.,
2013).
A Getis-Ord Gi statistic was applied to the product of fishing effort and probability of species
presence values, in order to identify statistically significant Hot and Cold Spots. The Hot Spot
Analysis calculates the Getis-Ord Gi statistic for each feature (cell value) in a weighted set of features.
The Getis-Ord Gi statistic shows whether features with high values or features with low values tend to
be clustered in the study area. This tool works by looking at each feature within the context of
neighboring features. If a feature's value is high, and the values for all of neighboring features are also
high, can be considered as a hot spot. The local sum for a feature and its neighbors is compared
proportionally to the sum of all features; when the local sum is much different than the expected local
sum, and that difference is too large to be the result of random chance, a statistically significant Z
score is the result (Getis & Ord, 1992, Mitchell, 2005). For statistically significant positive Z Scores
(Hot Spots), the larger the Z score is, the more intense the clustering of high values. Areas that
classified as Hot Spots are aggregated in a single output in order to identify the importance of the
fishing grounds by the total number of species that appears in the Hellenic Seas.
3. Results
The results revealed that the best GAM fit for the species under investigation, taking into
consideration all statistical measures and diagnostic plots, is a combination of presence/absence data
as a response variable and depth, longitude and latitude as explanatory variables. The maps produced
during the implementation process are presented in Figures 1, 2.
Figure 1 presents the maps for the entire steps of the process for Mullus barbatus as an
example. By the combination of the (a) probability of presence for each species with the (b) fishing
effort from trawlers derived two outputs. The first output is the (c) product between the two layers and
the second is the (d) Hot Spots areas that derived after the implementation of Getis-Ord Gi statistic to
the product output.
223
HydroMedit 2014, November 13-15, Volos, Greece
Figure 2 shows a combination of the Hot Spots for all species. The areas with the highest
number of trawling species are the Northern part of the Aegean Sea (Thermaikos, Sigitikos and
Kavala gulf), the Northern part of Euvoikos and Patraikos gulf and Chios Island. Other important
fishing grounds found in Thracian Sea, Northern part of Euvoikos, Saronikos gulf, Dodecanese and
Outer Part of Patraikos gulf.
Outputs
224
HydroMedit 2014, November 13-15, Volos, Greece
4. Discussion
The proposed methodology consist an innovative approach for the identification of the most
important fishing grounds for bottom trawlers. This method may be very useful in sampling design
and also to the investigation of important fishing grounds for other fishing gears (purse seiners, small
scale fisheries etc.). In case that this methodology enriched by additional data (juveniles etc.) may
constitute a useful tool for management purposes in order to avoid fishing activity in space and time in
areas characterized as spawning grounds.
Furthermore, some methodological improvements for the models could be the evaluation and
redefinition of the presence/absence threshold that produced by ROC analysis by testing the
abundance observations, which are possibly not included to the presence variation of the model and
also fitting the remaining variation in abundance where the species are present. This can be also
modeled by GAM and finally could derive more accurate results for the spatial distribution of species
abundance.
Acknowledgements
This work is part of the on-going researches within the MAREA project ―Stock units:
Identification of distinct biological units (stock units) for different fish and shellfish species and
among different GFCM-GSA‖ (STOCKMED; www.mareaproject.net) and also within the ARISTEIA
ΗΗ project ―Ecosystem effect of fisheries Discards‖ (ECODISC).
References
Craven P., Wahba G. (1979). Smoothing noisy data with spline functions Numerische Mathematik, 31
p. 377
Deleo, J.M. (1993). Receiver operating characteristic laboratory (ROCLAB): software for developing
decision strategies that ac- count for uncertainty. In: Proceedings of the Second International
Symposium on Uncertainty Modeling and Analysis, pp. 318–25. College Park, MD: IEEE
Computer Society Press
Elith, J. & Burgman, M.A. (2002). Predictions and their validation: rare plants in the Central
Highlands, Victoria, Australia. In: Predicting Species Occurrences: Issues of Scale and
Accuracy (eds Scott, J.M., Heglund, P.J., Morrison, M., Raphael, M., Haufler, J. & Wall, B.).
Island Press, Covello, CA, pp. 303–314.
225
HydroMedit 2014, November 13-15, Volos, Greece
226
HydroMedit 2014, November 13-15, Volos, Greece
Pešić, A. *, Đurović M., Ikica Z., Joksimović A., Marković O. and Mandić, M.
Laboratory of Ichthyology and Marine Fishery, Institut of Marine Biology, University of Montenegro,
P.O. Box 69, 85 330 Kotor, Montenegro
ABSTRACT
The paper presents results of studies of biological characteristics of european anchovy, Engraulis
encrasicolus (Linnaeus, 1758), between two areas of Montenegrin teritorial waters, Boka Kotorska
Bay and open sea (South Adriatic Sea). Studies in Boka kotorska Bay were performed in the frame of
FAO AdriaMed Pilot study during years 2010 and 2011, while samples from the open sea were
collected during survey conducted in July 2010 in the frame of FAO AdriaMed and EU-MEDIAS
projects. A total of 1430 individuals were processed, 650 individuals from Boka Kotorska Bay and
780 individuals from the open sea. Total length of E. encrasicolus in Boka Kotorska Bay ranged from
7.6 to 13.6 cm, wheres at the open sea total length ranged from 10.5 to 18.3 cm. The length–weight
relationship of individuals from Boka Kotorska Bay is described by the equation W = 0.002 LT3.4394;
(r2 = 0.962), while for individuals from open sea is W = 0.0025 LT3.3644; (r2 = 0.932). Females were
more frequent in both studied areas, sex ratio was R=0.67 and R=0.52 respectively in Boka Kotorska
Bay and at open sea.
Key words: Engraulis encrasicolus, biological characteristics, Boka Kotorska Bay, open sea, South
Adriatic Sea
*
Coresponding author (pesica@ac.me)
Introduction
Anchovy, E. encrasicolus, is one of the most abundant and commercially most important fish
species in the Adriatic Sea. Montenegrin industrial fishing of small pelagic species, sardine and
anchovy, is still undeveloped due to lack of trained and experienced crew, high transparency of water
and strong currents in South Adriatic Sea. Anchovy and sardine are mainly caught through small-scale
fishery, mostly using beach seines with small mesh size in the Boka Kotorska Bay and small purse
seines in front of the Bay, targeting in high percentage of juvenile individuals. This type of fishing has
been traditional in the region for centuries. Boka Kotorska Bay is one of the most productive areas of
the Montenegrin coast and it seems to be a nursery ground for anchovy (Merker & Vujošević , 1972;
Mandić et al., 2011), sardine and other small pelagic fish species (Mandić et al., 2013).
The objective of this study was to gather and compare some information of the length-weight
relationship, length frequency distribution and sex ratio of anchovy from two ecologicaly different
areas of Montenegrin teritorial waters, Boka Kotorska Bay and open sea.
A total of 1430 individuals of anchovy were processed, 650 individuals from Boka Kotorska Bay and
780 individuals from the open sea (Figure 1). Samples from Boka Kotorska Bay were collected on a
monthly basis during 2010 and 2011, while samples from the open sea were collected during July and
227
HydroMedit 2014, November 13-15, Volos, Greece
August 2010. Fish total length and body weight were measured to the nearest 0.1 cm and nearest 0.01
g, respectively. The general power equation (W = a*LTb) was applied to estimate the length-weight
relationship, where a and b are constants whose values were estimated by the least square method.
Confidence intervals of 95% were calculated for the slope (b) to see if these were statistically different
from 3. Sex was assigned macroscopically and sex ratio (R) was calculated using the expression R = F
/ (F+M), where F is the number of females and M that of males.
Figure 2. Length frequency distribution of anchovy, E. encrasicolus, from Boka Kotorska Bay
and open sea
228
HydroMedit 2014, November 13-15, Volos, Greece
Differences in length distribution of anchovy in coastal areas and at open sea are explained
by the fact that adult anchovy lives and spawns in the open sea in deeper waters (Mužinić, 1956, 1972;
Regner, 1973; Sinovĉić, 1978), while junger individuals spend winter in coastal areas, usually bays,
where they conduct first spawning at length of 8-9 cm and afterwards migrate towards open sea
(Sinovĉić, 2000; Marano, 2001).
In length–weight relationship, the parameter b was higher than 3 for both investigated areas,
b = 3.439 for individuals from Boka Kotorska Bay, and b = 3.364 for anchovy from open sea (Figure
3). For the area of Boka Kotorska Bay Đurović (2012) reported b = 3.167 and b = 3.106, for period
2004-2005 and 2006-2007 respectively. Similar values are reported for closed area of Novigrad Sea,
central Adriatic, b = 3.19 (Sinovĉić, 1998) and bTOT = 3.211 (Sinovĉić & Zorica, 2006). The similarity
of values of parameter b could be explained by similar conditions in these areas, especially in terms of
eutrophication, since the amounts of nutrients are higher than in the open sea due to anthropogenic
influence.
Figure 3. Length-weight relationship of anchovy, E. encrasicolus, from Boka Kotorska Bay and
open sea
In both investigated areas females show predominance over males (Table 1). From 650
individuals processed from Boka Kotorska Bay, there were 404 females (62.15%), 199 males
(30.62%) and 47 individuals with unknown sex (7.23%). In the samples from the open sea there were
405 females (51.92%) and 375 males (48.08%). Sex ratio was R=0.67 and R=0.52 respectively for
Boka Kotorska Bay and open sea. Sex ratio of individuals in Boka Kotorska Bay was significantly
different from the expected value of 1:1 (ρ2=69.96, P < 0.05), while in the open sea there was no
significant difference from the expected value of 1:1 (ρ2=1.154, P >0.05). In the samples from Boka
Kotorska Bay females were predominant in all length classes, and unsexed individuals are present till
the length of 10.1 cm. Similar results, predominance of females, are reported for the same area in
period 2006-2007 (Đurović, 2012), as well as in central Adriatic (Sinovĉić, 2000; Sinovĉić & Zorica,
2006), Albanian waters (South Adriatic Sea; Kolitari, 2006) and North Adriatic (Varangolo, 1967). In
the samples from open sea results are quite different; in each length class till length of 13.8 cm males
were predominant, while over length of 13.8 cm females were predominant in each length class.
229
HydroMedit 2014, November 13-15, Volos, Greece
Predominance of males in length classes less then 13.8 cm could be explained by the fact that males
are predominant in the spawning period, and samplings of anchovy at the open sea were done during
the peak of spawning (July-August).
Boka Kotorska
Sex Open sea
Bay
N % N %
Unknown 47 7.23
This study provides some usual information about differences in some biological parameters
of anchovy in two ecologically different areas of Montenegrin territorial waters, Boka Kotorska Bay
and open sea. Since the open sea inhabits longer anchovy than Boka Kotorska Bay, exploitation of
those resources should be stimulated and fishing fleet should be developed. In this way pressure on
anchovy population in Boka Kotorska Bay would be decreased, and juvenile part of population
preserved.
References
230
HydroMedit 2014, November 13-15, Volos, Greece
(Montenegro). VI international conference ―Water and Fish‖, June, 12-14. 2013., Zemun, Serbia.
Conference proceedings, 197-204.
Regner, S. (1973). Neki podaci o veliĉini jaja brgljuna, Engraulis encrasicolius (L.), u
srednjem Jadranu. Ekologija, 8(1): 163-168.
Regner, S., Joksimović, A., Pešić, A. & Đurović, M. (2006). Anchovy 2005 DEPM in Serbia
and Montenegro waters. Data presented at AdriaMed Working Group on Shared Small Pelagic
Fisheries Resources, Ancona 15-19 May.
Sinovĉić, G. (1978). On the ecology of anchovy, Engraulis encrasicolus (L.) from the central
Adriatic. Acta Adriat. 19(2): 3-32.
Sinovĉić, G. (1998). The Population Dynamics of the Juvenile Anchovy, Engraulis
encrasicolus (L.) under the Estuarine Conditions (Novigrad Sea-Central Adriatic). Cah. Options
Mediterr. 35, 273-282.
Sinovĉić, G. & Zorica, B. (2006). Reproductive cycle and minimal length at sexual maturity
of Engraulis encrasicolus (L.) in the Zrmanja River estuary (Adriatic Sea, Croatia). Est. Coast. Shelf
Sci. 69, 439-448.
Sinovĉić, G. (2000). Anchovy, Engraulis encrasicolus (Linnaeus, 1758): biology, population
dynamics and fisheries case study. Acta Adriat. 41, 1-54.
Varagnolo, S. (1967). Osservazioni sulla riproduzione dell‘Engraulis encrasicolus,
L.(acciuga) dell‘alto Adriatico. Archivi di Oceanografia e Limnologia 15 (Suppl): 71-81.
231
HydroMedit 2014, November 13-15, Volos, Greece
Hellenic Centre for Marine Research, Institute of Marine Biological Resources and Inland Waters,
46.7 km Athens Sounio ave., P.O. Box 712, Anavyssos, 19013, Attiki, Greece
Abstract
Relative growth of several characteristics in the rose shrimp Parapenaeus longirostris were
studied for the first time in the Eastern Mediterranean Sea. According to the median values, the
morphometric characters of female and male individuals caught in the Aegean Sea were greater than
those from the Ionian Sea. A negative allometry of swimming morphological characters (uropod,
scaphocerite, telson) and of abdomen (related to the rapid locomotion, reproduction) was found in
both sexes and areas. In contrast to this, the growth of the third pereiopod (involved in walking
ability) in females from the Aegean Sea was positively allometric. Both sexes showed positive
allometry of rostrum length with size in both areas.
Key words: rose shrimp, relative growth, allometry, cephalothorax
*Corresponding author: Chatzispyrou Archontia (a.chatzispyrou@hcmr.gr)
1. Introduction
Parapenaeus longirostris is actually the target species of an important fishery of trawlers in
the Mediterranean. The deep-water rose shrimp, Parapenaeus longirostris, is one of the most
important species of crustacean landings in Greece (Kapiris et al. 2007; Sobrino et al. 2005). The
higher mean annual landings of P. longirostris were in the period 1990-2011 landed in the ports of
Peiraias and Thessaloniki, followed by the ports of Kavala, Alexandroupolis and Patra (ETANAL
data), while, according to EL.STAT. (Hellenic Statistical Authority) data the most important fishing
areas in Greece for P. longirostris are mainly in the Aegean Sea: 13 (Thermaikos Gulf), 14 (N.
Aegean Sea) and 18 (Kriti) (Mytilineou et al. 2001) An evaluation of the exploitation state of this
species in the Greek waters indicates a general over- or full-exploitation (Kapiris et al. 2007). In the
Mediterranean basin, the bathymetric distribution of the deep water rose shrimp ranges between 20
and 750 m, but the species is more common and abundant on sandy-muddy bottoms between 100 and
400 m (Politou et al. 2005). The knowledge on the exploitation state, spatial distribution and biology
of this important species in the Greek seas is incomplete and is an outcome of the experimental
surveys mainly carried out by the Hellenic Centre for Marine Research (Kapiris et al. 2002, 2012,
2013; Kapiris 2004; Politou et al. 2008) in the frame of European projects. Is worth noting that very
few studies on the morphometric characters of the species have been published.
The aim of this study is to present the intraspecific variation of the morphometric profile of
both sexes of P.longirostris, from the Ionian and Aegean Sea, and compare specimens of both areas to
investigate differences in the relative growth. Comparison to other shrimp species is not included,
since there is no available data for deep water rose shrimp characteristics from other areas. The
current study is a preliminary attempt of further investigation of the morphometric structure of the
deep sea rose shrimp, in relation to its swimming and feeding behavior.
The carapace length was considered as the independent variable for all relationships
performed. The relationship between all measurements versus CL was investigated for each area and
232
HydroMedit 2014, November 13-15, Volos, Greece
sex separately using the simple linear model: Y=a*Xb, where Y and X corresponded to the
morphological dimensions and a, b the regression constants. The relationships obtained were log
transformed to the form log10Y=log10a+blog10X. The log transformation is preferred in order to better
satisfy the assumptions of regression analysis (Sokal & Rohlf, 1981). The pattern of allometry for
each parameter was established by testing the slope (b) of the obtained regression equations against
isometry applying the Student‘s t-test. (Ho:b=1 or 3 for length-weight).The Mann–Whitney test was
applied as a nonparametric test to compare independent samples. The comparison of the appendages‘
slopes b and carapace length between sexes was carried out by ANCOVA (Zar, 1984).
3. Results
Carapace length (CL) ranged between 13 and 27 mm in males and 10 and 33 mm in females
individuals caught in the Aegean Sea. On the other point, carapace length of males and females caught
in the Ionian Sea were from 12 to 29 mm and from 10 to 31mm, respectively.
The median values of all the morphological characters of the specimens showed a difference
between the sexes (Mann-Whitney test, P>0.05 in all cases). Mean sizes of all females‘ appendages
were greater than those of males in both areas (Table 1). Both males and females specimens caught in
the Aegean Sea showed greater median values compared those of the Ionian Sea (Mann-Whitney test,
P>0.05).
The equation parameters representing the relative growth of each parameter in relation to
carapace length, after logarithmic transformation, for each sex in the Aegean and the Ionian Sea are
presented in Table 2. For all the variables regressions were statistically significant (ANOVA,
P<0.01).Correlation coefficient (r) and the type of allometry are also included, as a comparison of the
slopes of the regression lines. Females in the Ionian Sea showed higher correlation coefficients (r)
than those of males; In the Aegean Sea male and female shrimps had almost similar (r) values. For all
variables, except the telson, regressions were statistically significant (ANCOVA, P=0.005).
The allometry showed the same pattern for P.longirostris in both areas; the length of the
rostrum for both sexes was positively allometric and the length of the third pereiopod in females in the
Aegean Sea, while all other measurements indicated a significant negative allometry (b<1 or b<3 in
carapace length-weight relationship) in both sexes.
233
HydroMedit 2014, November 13-15, Volos, Greece
Table 1. Mean sizes (mm) of Parapenaeus longirostris measurements of male (M) and female (F)
specimens from the two study areas
Area
Measure Sex Aegean Ionian
Mean n Mean n
M 48,52 105 43,06 167
ABD
F 50,56 104 47,20 178
M 20,86 105 18,08 167
CL
F 24,04 105 20,78 178
M 34,53 80 28,41 147
P
F 41,62 89 34,27 153
M 14,39 80 12,01 140
R
F 18,42 82 14,83 144
M 22,35 103 19,48 157
S
F 24,25 103 21,39 169
M 13,66 74 12,32 125
T
F 16,02 69 13,74 132
M 19,81 100 17,94 160
U
F 21,63 102 19,33 165
M 4,39 105 3,4 167
W
F 6,84 104 5,19 178
Table 2. Allometry of the seven measured appendages in P. longirostris in the Aegean and Ionian
Sea
234
HydroMedit 2014, November 13-15, Volos, Greece
4. Discussion
The present work provides for the first time important information relating to certain
morphometric characters of the deep water rose shrimp in the Greek seas (Aegean and Ionian Seas).
The current study shows no extensive variation in morphometric aspects exist in the populations of P.
longirostris in Aegean and Ionian Seas.
A clear sexual dimorphism size appears to exist for P. longirostris females, which reach
larger dimensions than males, in both areas. Females weighted also more than males at the same
cephalothorax sizes. This has also been reported by Sobrino et al. (2005). The parameters of the CL-
W relationship estimated in this study are similar to those calculated by other authors in other
Mediterranean areas (Sobrino et al. 2005).
The relative growth between the sexes differs only slightly as indicated by morphometric
relationships from both areas. All the above observed morphological variations between sexes could
be attributed to the differences in growth pattern of males (much lower maximum carapace length and
lower Von Bertalanffy values) compared with females (Sobrino et al., 2005) and/or the life span
aspects of this species.
A negative allometry of all the swimming appendages (scaphocerite, uropod, telson)
observed in both sexes and regions, reflects the decreasing growth rate of these morphological
characters in relation to CL. The slightly higher slopes (b) of the regression lines for the
morphological swimming characters of the females would imply greater swimming ability compared
to the ability exhibited by males. Similarly, a negative allometry in the length of the abdomen
(directly related to overall metabolic process, primarily reproduction, rapid locomotion) was observed
in both sexes and areas. The reduction of the ability for rapid locomotion with increasing size is in
agreement with the above reduction of swimming ability.
The positive allometry in the third pereiopod length (directly related to walking ability and
cropping behavior when searching for food in the substratum, Sardà et al. 1995) in females caught in
the Aegean Sea was expected, since the swimming ability decreases, walking ability should increase.
Since the allometric growth pattern of the rostrum (an organ possibly related to mating and swimming
behavior, sexual segregation and feeding) was found similar between sexes and areas, a faster rostrum
growth rate than the carapace growth rate is indicated.
The present study improves the few existed data and fills knowledge gaps on deep water rose
shrimp biology and ecology in the Greek and international bibliography. In general, this study
suggests that there is no morphological variability of P. longirostris amongst both Greek Seas
(Aegean and Ionian Sea). Regardless of the more intense fishing pressure exercised in the Aegean Sea
variations in morphometric variables are not extensive between the studied populations in both studied
areas.
Studies of the population structure, including biology, growth rate of the total or body‘s
appendages, spawning season, of commercially important marine organisms as deep sea rose shrimp
are of great interest to evolutionary biologists and to fishery managers, and thus provide an initial
incentive for further investigation of this decapod in the whole Mediterranean.
235
HydroMedit 2014, November 13-15, Volos, Greece
References
References in Articles:
Kapiris K., Markovic O., Klaoudatos D., Djurovic M., (2013). Contribution to the biology and fishery
characteristics of Parapenaeus longirostris (Lucas, 1846) in the South Ionian and South
Adriatic Sea. Turkish Journal of Fisheries and Aquatic Sciences 13(4), 647-656.
Kapiris K. (2004). Feeding ecology of Parapenaeus longirostris (Lucas, 1846) (Decapoda: Penaeidae)
from the Ionian Sea (Central and Eastern Mediterranean Sea). Scientia Marina 68(2), 247-
256.
Politou C-Y., Maiorano P., D‘Onghia G. and Mytilineou Ch. (2005). Deep-water decapods crustacean
fauna of the Eastern Ionian Sea. Belgian Journal of Zoology 135, 235-241.
Politou C-Y., Tserpes G., Dokos J. (2008). Identification of deep-water pink shrimp abundance
distribution patterns and nursery grounds in the eastern Mediterranean by means of
generalized additive modeling. Hydrobiologia 612, 99-107.
Sardà F., Bas C., Lleonart J. (1995). Functional morphometry of Aristeus antennatus (Risso1816)
(Decapoda, Aristeidae). Crustaceana 68, 461–471
Sobrino I., Silva C., Sbrana M, Kapiris K. (2005). Biology and Fisheries of Deep Water Rose Shrimp
(Parapenaeus longirostris) in European Atlantic and Mediterranean waters. Crustaceana 78
(10): 1153-1184.
Conference Proceedings:
Kapiris K., Kavadas S., Maina I., Tserpes G., Kallianiotis A., Peristeraki P., Politou C-Y. (2012).
Spatial distribution of deep-water rose shrimp juveniles (Parapaenaeus longirostris) in the
Aegean and Ionian Sea using predictive habitat modeling. 12th International Congress on the
Zoogeography, Ecology and Evolution of Southeastern Europe and the Eastern
Mediterranean, Athens, 18-22/6/2012, Book of Abstracts, 74 p.
Kapiris K., Mytilineou Ch., Maiorano P., Kavadas S., Capezzuto F. (2002). Abundance and
bathymetrical distribution of Parapenaeus longirostris in the South Ionian Sea. Fourth
European Crustacean Conference, 22-26 July, Poland.
Mytilineou Ch., Politou C-Y., Kavadas S., Fourtouni A., Kapiris K., Dokos J. (2001). Crustacean
fishery in Hellas. Life histories, assessment and management of Crustacean fisheries. A
Coruna, Galicia, Spain. Book of abstracts 54.
Book Chapter:
Kapiris K., Mytilineou Ch., Politou C-Y., Kavadas S., Conides A. (2007). Research on shrimps‘
resources and fishery in Hellenic waters. In: C. Papaconstantinou, A. Zenetos, V.
Vassilopoulou, G. Tserpes (Eds.), HCMR Publications, Athens: 421-432.
Sokal RR., Rohlf F.J. (1981). Biometria, (Madrid: H. Blume Ediciones), 832 pp.
Zar JH (1984) Biostatistical analysis, 2nd ed. Prentice-Hall, Englewood Cliffs, pp 662.
236
HydroMedit 2014, November 13-15, Volos, Greece
1
Department of Food Science and Technology, Science and Research Branch, Islamic Azad
University, Tehran, Iran.
2
Department of Fisheries Science, Science and Research Branch, Islamic Azad University, Tehran,
Iran.
Abstract
Black mouth croaker (Atrobucca nibe) species is one of the most important white-flesh fish stock in
the Oman Sea. Kamabako gel samples with the addition of Iranian tragacanth gum (from
Astragalusverus) (TG), xanthan gum (XG), chitosan (CS) and whey protein concentrate (WPC) at 1%
(w/w) were prepared to evaluate their impacts as additives on the surimi, individually. Changes in the
textural characteristics, expressible moisture content (EMC), color and microstructure features of the
gels were determined. TG sample (555/50±29/698g), followed by WPC (503/00±8/16 g) showed the
highest breaking force among other surimi kamabako gels (P<0.05). Adding hydrocolloids improved
most parameters of texture profile analysis in comparison with control, except XG sample (P<0.05).
CS sample showed the lowest EMC (5/58±29/698%) than others (P<0.05). Whiteness was improved
significantly in TG sample (76.07±0.021) (P<0.05). Maximum and minimum number of polygonal
structures in the microstructure surimi kamabako gels were observed in TG (13371±63.5 per mm2)
and XG samples (7247±0.220 per mm2), respectively (P<0.05). Therefore TG at 1% could be a proper
additive for producing of the high quality surimi, while the weakest protein network and gel strength
were obtained in XG sample.
Key words: black mouth croaker, gelatin, hydrocolloids, surimi, texture
*Corresponding author: Seyed Ebrahim Hosseini (ebhoseini@srbiau.ac.ir)
1. Introduction
Surimi is an intermediate product, which made by the removal of soluble proteins, pigments,
lipids and other undesirable compounds of minced fish. Considering the high amount of myofibrillar
protein in surimi, it has a unique capability to gel formation. Hence, quality of surimi is directly
related to the gel-forming ability (Park, 1994; Benjakulet al., 2003a; Ramirez et al., 2011). Croakers
(Family Scianidae) are mainly fish species for the production of surimi in Southeast Asia (Park,
2005).
Additives to enhance the physical properties of surimi is common, however some of these
additives have a negative impact on flavor, texture and color features of surimi kamabako gel and
even may cause health problems (e.g. egg white and bovine plasma protein) (Rawdkuen & Benjakul,
2008; Balange & Benjakul, 2009). Using hydrocolloid as a food additive has been growing to enhance
the gel-forming ability of surimi gel (Montero et al., 2000; Rawdkuen & Benjakul, 2008; Benjakul et
al., 2003b) and may increase consumer acceptance of surimi-based products (Andrés-Bello et al.,
2012).
Several studies have investigated of gelling characteristics from different surimi fish by
adding chitosan (Benjakulet al., 2002; Amiza & Kang, 2013), xanthan gum (Montero et al., 2000;
Pérez-Mateos & Montero, 2000; Benjakulet al., 2003b; Santana et al., 2012) and whey protein
concentrate (Piyachomkwan & Penner, 1995; Weerasingheet al., 1996; Rawdkuen & Benjakul, 2008).
For instance, addition of whey protein concentrate was enhanced the textural properties and water
holding capacity of surimi kamabako gels from 6 tropical fish species (Rawdkuen & Benjakul, 2008).
Kataokaet al. (1998) found that addition of 1.5% chitosan improved the mechanical and functional
properties of walleye Pollock surimi gel. Benjakulet al. (2003b) showed an approximately 24%
increasing in breaking force of kamaboko surimi gel after addition of 1% prawn shell chitosan.
Tragacanth gum is recorded in the GRAS list as a high quality hydrocolloid and naturally obtained
from some Astragalus species (Imeson, 1992; Balaghiet al., 2010). Tragacanth gum recognized and
used as a stabilizer, emulsifier, thickener and gel agent in foodstuffs for thousands of years (Anderson,
1989; Imeson, 1992; Mayes, 2010). However, so far nobody has reported the effect of tragacanth gum
as an additive in surimi.
237
HydroMedit 2014, November 13-15, Volos, Greece
Generally, black mouth croaker (Atrobucca nibe) is abundant in the Oman Sea mid-water trawl
fishery efforts and has small size. The aim of this study was to evaluate the gelling characteristics of
surimi from black moth croaker which supplemented with xanthan gum, Iranian tragacanth gum,
chitosan and whey protein concentrate at 1% (w/w).
238
HydroMedit 2014, November 13-15, Volos, Greece
three pieces of the filter papers at the bottom. The standard weight (5 kg) was placed on the top of the
sample and maintained for 2 min. The sample was then removed and weighed again (Y in grams).
EMC was measured as follow:
(X − Y)
EMC (%) = × 100
X
2.6. Color evaluation
Color parameters of the gels were performed by a colorimeter (HunterLabcolourflex, USA).
L* (lightness), a* (redness/greenness) and b* (yellowness/ blueness) were measured and whiteness
was calculated as described by Park (1994) as follow:
Whiteness = 100 − [ 100 − L∗ 2 + a∗ 2 + b∗ 2 ]1/2
239
HydroMedit 2014, November 13-15, Volos, Greece
12
f f
10 a ca
ab ac
Deformation (mm)
8
ab
6 c ba
4
0
C TG XG CS WPC
600
500
Breaking force (g)
400
300
200
100
0
C TG XG CS WPC
Figure 1 Breaking force and deformation of kamaboko gels prepared from black mouth croaker
surimi using different hydrocolloids. C, control (without hydrocolloid); TG, 1% tragacanth
gum; CS, 1% chitosan; WPC, 1% whey protein concentrate and XG, 1% xanthan gum. Bars
indicate the standard deviation (n=3). Different letters represent significant differences
(P<0.05).
From the results, addition of xanthan gum decreased 62% breaking force and 68%
deformation of black mouth croaker surimi kamabako gel compared to the untreated sample.
Similarly, Montero et al. (2000) reported that addition of xanthan gum reduced breaking force,
deformation and textural parameters of cod surimi kamabako gel in comparison with control gel
sample. The negative impact of xanthan gum on gel-forming ability was in agreement with several
reports for surimi gel from other fish species comprising silver carp (Hasanpouret al., 2012) and blue
whiting (Pérez-Mateos & Montero, 2000). Large pores and cavities in the surimi kamabako gel
network are formed by xanthan gum due to the high molecular weight which was reflected lower
values of surimi kamabako gel strength (Pérez-Mateos & Montero, 2000; Montero et al., 2000).
In this study, chitosan and whey protein concentrate were both able to enhance the breaking force of
the surimi kamabako gel in comparison to control. This result was in agreement with Kataokaet al.
(1998) who indicated that the gel strength of walleye Pollock surimi kamabako gel was nearly
doubled by the addition of 1.5% chitosan. The same results stated the increasing of surimi kamabako
gel breaking force containing chitosan (Benjakulet al., 2003b; Kungsuwanet al., 2003). Chitosan has
been reported to play an important role in cross-linkings of gel protein network induced by
endogenous transglutaminase (TGase) (Benjakulet al., 2003b). Also, Rawdkuen & Benjakul (2008)
indicated that low quality surimi kamabako gels were enhanced to strong and elastic gel (AA grade)
by adding 0.5 to 2% WPC. Weerasingheet al. (1996) have demonstrated the WPC inhibitory effects
on serine and cysteine proteinase enzymes of surimi which improved surimi kamabako gel quality.
There is a lack of information about the effects of tragacanth gum on rheological-textural of surimi
kamabako gel to compare with results of this study. However, tragacanth gum can rapidly reduce
water in order to increase hydroxyl groups and hydrogen bonds with water molecules (Mayes, 2010).
Therefore, surimi kamabako gel strength will be enhanced due to decrease of surimi kamabako gel
water contents (Park et al., 2005).
3.2. Textural properties
The effect of various hydrocolloids on hardness, cohesiveness, chewiness and springiness of
surimi kamaboko gel samples are shown in Table 1. Hardness-1 of all samples was higher than
Hardness-2. Maximum and minimum hardness-1 and hardness-2 (maximum force in the first and
240
HydroMedit 2014, November 13-15, Volos, Greece
Table 1 Changes in textural parameters of kamaboko gels from black mouth croaker surimi
using different hydrocolloids. C, control (without hydrocolloid); TG, 1% tragacanth gum; CS,
1% chitosan; WPC, 1% whey protein concentrate and XG, 1% xanthan gum.
The results showed that TG sample had lower elasticity than CS and WPC samples (Tab 1).
The decreased elasticity of TG sample was concomitant with their lower deformation. The firm and
rigid gel assigned by the strong network generally losses its elasticity due to decrease the water-
protein interactions (Tanaka, 1981; Park et al., 2005).
The presence of xanthan gum produced very soft gel and thus a decrease in surimi kamabako
gel textural properties from different fish species were recorded (Montero et al., 2000; Ramirez et al.,
2011; Hasanpouret al., 2012). Santana et al. (2012) showed that addition of 0.5% xanthan gum was
able to decrease gel strength and hardness of threadfin bream surimi kamabako gel. Cohesiveness
values close to 1 refer to the tendency of recovery to its original structure after the first compression is
high (Munizaga & Canovas, 2004). In the present study, XG reduced cohesiveness value.
From the results, WPC and chitosan were able to give ideal textural properties, respectively.
Addition of 1% chitosan to grass carp surimi improved the hardness, springiness, cohesiveness,
chewiness, and adhesiveness of the surimi gel texture (Wu & Mao, 2009). The same trend was
observed in walleye Pollock surimi kamabako gel by adding 1.5% chitosan (Kataokaet al., 1998).
Textural parameters of black mouth croaker surimi kamabako gel were improved by adding
WPC (Tab 1). According to Rawdkuen & Benjakul (2008), proteolysis of surimi can be deferred by
addition of whey protein concentrate (0.5-3%), leading to increased gel textural properties. Also,
Benjakulet al. (2003c) reported that adding WPC into lizardfish surimi kamaboko gel inhibited the
degradation of myosin heavy chain band (proteolysis of myofibrillar proteins) and caused the high
quality gel.
3.3. Expressible moisture
The lowest expressible moisture content was found in CS sample (P<0.05) suggesting the
highest water holding capacity (Tab 2). Similarly, Mao & Wu (2009) reported that grass carp surimi
kamabako gel containing 1% chitosan exhibited lower expressible moisture content than control
sample, caused by increasing of chitosan-water interactions.
XG sample had the highest expressible moisture (P<0.05), indicating that gel network was
the lowest in water binding capacity in accordance with releasing more water from the protein
network (Niwa, 1992). It is noted that xanthan gum entrapped lower released water by the myofibrillar
protein (Montero et al., 2000; Hasanpouret al., 2012).
Inhibitory effect of WPC on myofibrillar proteins was reported by many investigators
(Kinoshita et al., 1990; Akazawaet al., 1993; Weerasingheet al., 1996; Benjakulet al., 2003c;
Rawdkuen & Benjakul, 2008). In this research, WPC decreased the expressible moisture contents.
Table 2 Expressible moisture and whiteness and of surimi kamabako gels from black mouth
croaker with various hydrocolloids.
241
HydroMedit 2014, November 13-15, Volos, Greece
3.4. Whiteness
Slight differences in whiteness were recorded in different gels (Tab 2). In this study lustrous
and translucent appearance of surimi kamabako gels were observed in CS sample (P<0.05). During
cooking of kamaboko gels, not only lipid oxidation products may cause a decreased whiteness of gels
but the Maillardnonenzymatic browning reaction may also affect the color of gels (Whistler & Daniel,
1985; Chaijanet al., 2004). However, chitosan showed a higher antioxidant capacity in surimi gel (No
et al., 2007; Wu & Mao; 2009) which can improved whiteness of surimi kamabako gel. Furthermore,
Mao & Wu (2007) reported that grass carp surimi gels with chitosan exhibited higher whiteness
(72.26) than the untreated sample (63.81) due to chitosan-chitosan interactions and protein-chitosan
cross-linking.
The lowest whiteness was found in gel containing WPC (P<0.05). Similarly, addition of WPC at
concentrations up to 3% (w/w) resulted in a decrease in whiteness of bigeye snapper, goatfish and
threadfin bream surimi gel, due to its natural light cream-colored (Rawdkuen & Benjakul, 2008).
3.5. Microstructure
Kamaboko gels SEM and results of analyzing the images with ImageJ program are presented
in Figure 2 and Table 3, respectively. Protein matrices of TG sample were observed denser and more
compact in comparison to others (Figure 2; P<0.05). Secondly, WPC sample had a stronger and
denser protein structure (Figure 2 and Tab 3). Conversely, the largest pores and maximum area of the
polygonal structures (111.9±5.40 ιm2) were illustrated in XG (Tab 3; P<0.05).
Figure 2 Microstructure of kamaboko gels from black mouth croaker using different
hydrocolloids (50× magnification). C, control (without hydrocolloid); TG, 1% tragacanth gum;
CS, 1% chitosan; WPC, 1% whey protein concentrate and XG, 1% xanthan gum.
The surface microstructure of black mouth croaker kamaboko gel containing tragacanth gum
associated the strong and rubbery gel texture due to increase in myofibrillar zones and small areas of
polygonal. Oujifardet al. (2012) explained the best texture of threadfin bream surimi gel, with 0.25
g/100g bambara groundnut protein isolate, as one with a finer and coarse structure. Luoet al. (2004)
showed similar results in Alaska pollocksurimi, with 10% soy protein isolate.
In this study, the strong correlations between the textural parameters of surimi kamabako gel
and microstructure attributes were observed. Whereas, XG sample allocated the lowest textural
properties (Figure 2 and Tab 1) in order to weak protein network qualified with a number of smaller
and larger polygonals in the microstructure (Figure 2 and Tab 2). Several investigators have explained
the changes in textural properties are mainly correlated with myofibrillar protein microstructure
242
HydroMedit 2014, November 13-15, Volos, Greece
(Taguchi et al., 1987; Sano et al., 1988,1990). Consistent with the results, Alvarez et al. (1999)
indicated that sardine surimi gel microstructure sample qualified with lower numbers of polygonals
and larger cavities showed lower textural quality. Xanthan gum tends to aggregate upon itself, thus
occupying large pores which would distort the myofibrillar protein matrix (Montero et al., 2000).
In this study, improvement of gel microstructure attributes were found in the sample
containing chitosan compared to control sample. It is recorded that stronger surimi kamabako gel
protein-protein networks were formed by adding chitosan (Martin-Sanchez et al. 2009). Similar
observation was made by Benjakulet al. (2000) and Kataoka (1998). Chitosan particles dispersed
uniformly in the gel protein matrix markedly due to cross-linking reaction induced by endogenous
TGase during heating of gel (Benjakulet al., 2000; Benjakulet al., 2003b). It was noted that chitosan
might work as the filler in the gel network and associated with myofibrillar proteins via some
electrostatic interactions (Muzzarelli, 1985).
From the microstructure results, kamaboko gel containing added WPC was more compact with
smaller clusters of aggregated protein than control and XG samples. Barbut & Foegeding (1993)
indicated that finer and denser gels are usually formed by an ordered association of protein molecules.
Similarly, Rawdkuen & Benjakul (2008) indicated that microstructure of kamaboko gels with WPC
(0.5-3%), especially when a higher amount is used, had a compact gel matrix and fine three-
dimendimensional network compared to control (without WPC).
Table 3 Parameters from SEM analysis of kamaboko gel samples from black mouth croaker using
different hydrocolloids. C, control (without hydrocolloid); TG, 1% tragacanth gum; CS, 1% chitosan;
WPC, 1% whey protein concentrate and XG, 1% xanthan gum.
4. Conclusion
The addition of tragacanth gum, whey protein concentrate and chitosan at concentration of
1% (w/w) increased the breaking force and deformation of black mouth croaker kamaboko gel,
respectively. The obtained results have shown that xanthan gum had a negative effect on the gel-
forming ability of the surimi kamabako gel. The ideal water holding capacity was found in the gel
sample added with chitosan followed by tragacanth gum sample (P<0.05). Among the different
treatments, WPC reduced the whiteness of surimi kamabako gel slightly due to its predominantly light
cream-colored in nature. Kamaboko gel added with tragacanth had denser and more ordered
myofibrillar structure than others. Further trials are necessary to to determine organoleptic effects of
adding the various hydrocolloids in the surimi.
References
Akazawa, H., Miyauchi, Y., Sakurada, K., Wasson, D.H., Reppond, K.D. (1993). Evaluation of
protease inhibitors in Pacific whiting surimi. Journal of Aquatic and Food Products
Technology, 2(3), 79-95.
Amiza, M.A., Kang, W.C. (2013). Effect of chitosan on gelling properties, lipid oxidation, and
microbial load of surimi gel made from African catfish (Clarias gariepinus). Food Research
International, 20(4), 1585-1594.
Anderson, D.M.W. (1989). Evidence for the safty of gum tragacanth and modern criteria for the
evaluation of food additives. Journal of Food Additives and Contaminants, 6, 1-12.
Andres-Bello, A., Iborra-Bernad, C., Garcia-Segovia, P., Martinez-Monzo, J. (2012). Effect of Konjac
Glucomannan (KGM) and Carboxymethylcellulose (CMC) on some Physico-Chemical and
Mechanical Properties of Restructured Gilthead Sea Bream (Sparus aurata) Products. Food
Bioprocess Technology, 5, 73-79.
Balaghi, S., Mohammadifar, M.A., Zargaraan, A. (2010). Physicochemical and rheological
characterization of gum tragacanth exudates from six species of Iranian Astragalus. Food
Biophysics, 5(1), 59-71.
243
HydroMedit 2014, November 13-15, Volos, Greece
Barbut, S., Foegeding, E.A. (1993). Ca2+-induced gelation of preheated whey protein isolate. Journal
of Food Science, 58, 867-871.
Benjakul, S., Chantarasuwan, C., Visessanguan, W. 2003a. Effect of medium temperature setting on
gelling characteristics of surimi from some tropical fish. Food Chemistry 82, 567-574.
Benjakul, S., Visessanguan, W., Phatchrat, S., Tanaka, M. (2003b). Chitosan affects transglutaminase-
induced surimi gelation. Food Biochemistry, 27, 53-66.
Benjakul, S., Leelapongwattana, K., Visessanguan, W. (2003c). Comparative study on proteolysis of
two species of bigeye snapper, Priacanthus macracanthus and Priacanthus tayenus. Journal
of the Science of Food and Agriculture, 83, 871-879.
Benjakul, S., Visessanguan, W., Srivilai, C. (2002). Porcine plasma protein as proteinase inhibitor in
bigeye snapper (Priacanthus tayenus) muscle and surimi. Journal of the Science of Food and
Agriculture, 81, 1039-1046.
Bourne, M.C. (2002). Texture, viscosity, and food. In M.C. Bourne (eds), Food texture and viscosity:
Concept and measurement. 2nd eds. Academic Press, San Diego, Calif, USA, p. 1-32.
Chaijan, M., Benjakul, S., Visessanguan, W., Faustman, C. (2004). Characteristics and gel properties
of muscles from sardine (Sardinella gibbosa) and mackerel (Rastrelliger kanagurta) caught
in Thailand. Food Research International, 37, 1021-1030.
Hasanpour, F., Hosseini, S.E., Motalebi, A.A., Darvish, F. (2012). Effects of Soy protein concentrate
and Xanthan gum on physical properties of Silver carp (Hypophthalmichthys molitrix)
surimi. Iranian Journal of Fisheries Science, 11(3), 518-530.
Hayes, J.E., Desmond, E.M., Troy, D.J., Buckley, D.J., Mehra, R. (2005). The effect of whey protein-
enriched fractions on the physical and sensory properties of frankfurters. Meat Science, 71,
238-243.
Imeson, A. (1992). Thickening and Gelling Agents for Food. 2nd edition. London, Chapman and Hall
Press, p. 169-195.
Kataoka, J., Ishizaki, S., Tanaka, M. (1998). Effects of chitosan on gelling properties of low quality
surimi. Journal Of Muscle Foods, 9, 209-220.
Kinoshita, M., Toyohara, H. Shimizu, Y. (1990). Purification and properties of a novel latent
proteinase showing myosin heavy chained grading activity from threadfin bream. Journal of
Biochemistry, 107, 587-591.
Kungsuwan, A., Ittipong, B., Jongrittiporn, S., Kongpan, O., Limsooksomboon, S., Limthongkun, C.
2003. Effect of Chitosan on Gelling Properties of Thai Catfish (Pangasius sutchi) Surimi.
Paper presented at the Advances in Seafood Byproduct. Alaska, p. 1-10.
Luo, Y.K., Kuwahara, R., Kaneniwa, M., Murata, Y., Yokoyama, M. (2004). Effect of soy protein
isolate on gel properties of Alaska Pollock and common carp surimi at different setting
conditions. Journal of Science and Food Agriculture, 84(7), 663-671.
Mao, L., Wu, T. (2007). Gelling properties and lipid oxidation of kamaboko gels from grass carp
(Ctenopharyngodon idellus) influenced by chitosan. Journal of Food Engineering, 82, 128-
134.
Martin-Sanchez, A.M., Navarro, C., Perez-Alvarez, J.A., Kuri, V. (2009). Alternatives for efficient
and sustainable production of surimi: A review. Comprehensive reviews in food science and
Food Safety, 8, 359-374.
Mayes, J.M. (2010). Gum Tragacanth. In A. Imeson (eds), Food stabilisers, thickeners and gelling
agents. Blackwell Publishing, p. 167-170.
Montero, P., Hurtado, J., Perez-Mateos, M. (2000). Microstructural behaviour and gelling
characteristics of myosystem protein gels interacting with hydrocolloids. Food
Hydrocolloids, 14, 455-461.
Munizaga, G.T., Canovas, G.V.B. (2004). Colour and textural parameters of pressurized and heat
treated surimi gels as affected by potato starch and egg white. Food Research International,
37, 767-775.
Muzzarelli, R.A.A. (1985). Chitin. In: G.O. Aapinall (eds), The Polysaccharides. Academic Press,
New York, p. 417-450.
Niwa, E. (1992). Chemistry of surimi gelation. In T.C. Lanier and C.M. Lee (eds), Surimi technology.
Marcel Dekker, New York, p. 389-427.
No, H.K., Meyers, S.P., Prinyawiwatkul, W., Xu, Z. (2007). Applications of Chitosan for
Improvement of Quality and Shelf Life of Foods: A Review. Journal of Food Science, 72(5),
87-100.
Oujifard, A., Benjakul, S., Ahmad, M., Seyfabadi, J. (2012). Effect of bambara groundnut protein
isolate on autolysis and gel properties of surimi from threadfin (Nemipterus bleeker). LWT-
Food Science and Technology, 47, 261-266.
244
HydroMedit 2014, November 13-15, Volos, Greece
Park, S.H., Cho, S.Y., Kimura, M., Nozawa, H., Seki, N. (2005). Effects of microbial
transglutaminase and starch on the thermal gelation of salted squid muscle paste. Fishries
Science, 71, 896-903.
Park, J.W. (1994). Functional protein additives in surimi gels. Journal of Food Science, 59(3), 525-
527.
Park, J.W. (2005). Surimi and Surimi Seafood. CRC Press, Boca Raton, Florida, p. 19-23.
Perez-Mateos, M., Montero, P. (2000). Contribution of hydrocolloids to gelling properties of blue
whiting muscle. European Food Research and Technology, 210, 383-390.
Piyachomkw,An K., Penner, M.H. (1995). Inhibition of Pacific whiting surimi-associated protease by
whey protein concentrate. Journal of Food Biochemistry, 18, 341-353.
Ramirez, J.A., Uresti, R.M., Velazquez, G., Vazquez, M. (2011). Food hydrocolloids as additives to
improve the mechanical and functional properties of fish products: A review. Food
Hydrocolloids, 25, 1842-1852.
Rawdkuen, S., Benjakul, S. (2008). Whey protein concentrate: Autolysis inhibition and effects on the
gel properties of surimi prepared from tropical fish. Food Chemistry, 106, 1077-1084.
Sano, T., Noguchi, S.F., Matsumoto, J.J., Tsuchiya, T. (1988). Dynamic viscoelastic behavior of
natural actomyosin and myosin during thermal gelation. Journal of Food Science, 53(3), 924-
928.
Sano, T., Noguchi, S.F., Matsumoto, J.J., Tsuchiya, T. (1990). Effect of ionic strength on dynamic
viscoelastic behavior of myosin during thermal gelation. Journal of Food Science, 55(1), 51-
54.
Santana, P., Huda, N., Yang, T.A. (2012). Gel characteristic of surimi powder added with
hydrocolloids. UMT 11th International Annual Symposium on Sustainability Science and
Management, Malaysia, p. 509-513.
Taguchi, T., Ishizaka, H., Tanaka, M., Nagashima, Y., Amano, Y. (1987). Protein-protein interaction
of fish myosin fragments. Journal of Food Science, 52 (4), 1103-1104.
Tanaka, T. (1981). Gels. American Journal of Science, 244, 124-138.
Weerasinghe, V.C., Morrissey, M.T., Chung, Y.C., An, H. (1996). Whey protein concentrate as a
proteinase inhibitor in Pacific whiting surimi. Journal of Food Science, 61, 367-371.
Whistler, R.L., Daniel, J.R. (1985). Carbohydrates. In O.R. Fennema (eds), Food Chemistry, 2nd edn.
Marcel Dekker, New York, p. 69-137.
Wu, T., Mao, L. (2009). Application of chitosan to maintain the quality of kamaboko gels nade from
grass carp (Ctenopharyngodon idellus) during storage. Journal of Food Processing and
Preservation, 33, 218-230.
245
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
The bogue, Boops boops (Linnaeus, 1758) is one of the commercially important species of the small-
scale fishery in Montenegrin waters. A total of 283 specimens of bogue were collected by gill net and
trammel net fishing between May 2013 and April 2014 in Boka Kotorska Bay (south Adriatic Sea).
Total length ranged from 12.2 to 30.3 cm, while weight varied between 15.97 and 117.83 g.
Female:male ratio was 2.6. A negative allometric growth was recorded for the all sampled specimen
as well as for the both sexes. The highest gonadosomatic index value was in winter when Fulton's
condition factor showed minimum value.
Key words: Boops boops, small-scale fishery, Boka Kotorska Bay, South Adriatic Sea
1. Introduction
One of the semi-pelagic species caught in Montenegrin territorial waters by vessels under 12
metres is bogue, Boops boops. During the sampling months, it was noted that bogue was mainly
caught by gill and trammel nets. Gillnets are the most common type of fishing gear used in small–
scale fisheries, followed closely by trammel nets. Out of the 70 vessels registered, 71% operate in
Boka Kotorska Bay (ports of Herceg Novi, Zelenika, Kotor and Tivat), the area where small–scale
fisheries, particularly those involving beach seines, have been present for centuries, and are part of the
cultural identity of the people from the region. Around 61%, are vessels with length overall below 6
m, and the rest (39%) are in the 6–12 m segment (Ikica et al., 2013).
Previous studies showed that significant quantities of bogue were caught by trawlers
(Kasalica et al., 2011) and the few existing references concerning the species are from trawl fishery.
The objective of this study was to gather some information of the length-weight relationship,
length frequency distribution, sex ratio, spawning period and condition of bogue caught by the small-
scale fishery in Boka Kotorska Bay.
A total of 283 B. boops specimens (179 females; 68 males; 36 undetermined) were collected
from monthly commercial catches using gill nets and trammel nets in the Boka Kotorska Bay,
southern Adriatic Sea from May 2013 to April 2014. Sampling was conducted in the framework of the
MORM-MONT national project (Monitoring of small-scale coastal fisheries and composition of fish
fry with the aim of conservation and management of marine fishery resources). Collected fish were
preserved with ice in a cooler box and immediately transported to the laboratory. Fish total length and
body weight were measured to the nearest 0.1 cm and nearest 0.01 g, respectively. The general power
equation (W = a*Lb) was applied to estimate the length-weight relationship, where a and b are
constants whose values were estimated by the least square method. The significant difference of b
values from 3, which represent isometric growth, was tested with the Student's t-test. Fulton‘s
condition factor (K=100W/TL3) (Fulton, 1904) was calculated for each specimen and for each season
246
HydroMedit 2014, November 13-15, Volos, Greece
(autumn, winter, spring and summer). Sex was assigned macroscopically. Gonads of all specimens
were dissected and weighed to the nearest 0.01 g to calculate the GSI (GSI = weight of gonads/weight
of fish x 100). This index was calculated for each of the analyzed specimen and, finally, a mean
seasonal index was estimated. Correlation between GSI and Fulton's condition factor was examined
using the Pearson's r coefficient. The sex ratio (female:male) was calculated and significant
differences from the expected ratio (1:1) were tested by means of π 2 test. Maturity stages were
recorded according to the MEDITS protocol: specimens were considered adult when classified as: 2b
(recovering), 2c (maturing), 3 (mature/spawner), 4a (spent) and 4b (resting), while immature/juvenile
ones were classified as 1 (immature virgin) and 2a (virgin developing) (ICES, 2008).
Of the 283 collected specimens, 24% were males, 63.25% were females and 12.75%
undetermined. Length frequency data for all collected specimen is presented in Figure 1. Total length
of the sampled fish ranged from 12.2 to 30.3 cm TL with the mean length of 17.35 cm TL. The body
weight ranged between 15.97 g and 117.83 g. The mean observed length of the commercial catch of
B. boops (17.35cm) was higher than that the value obtained in 2007-2008 (13.95 cm: Marković et al.,
2014) and almost the same with the value obtained in 2009-2010 (17.10 cm; Kasalica et al, 2011).
The lower value of the mean length in 2007/2008 could be explained by disappearance of larger fish
from the catch and different fishing area because that catch was caught in the Montenegrin territorial
waters and on continental shelf and significant quantities were caught by trawlers. The LFD of the
whole sample (pooled data) shows that the majority of catches consisted of individuals ranging in
length from 16.0 to 20.0 cm TL. The total length of females and males ranged from 12.2 to 30.3 cm
(17.48 cm ± 2.91), and from 12.6 to 21.2 cm (17.61 ± 1.43), respectively. Females were more frequent
at bigger size classes than males which is similar to what Mozara (2013) reports for the bogue in the
southeastern Adriatic Sea. Gordo (1992) observed that the relative percentages of females increase
with length class and he concluded that the bogue might be considered a rudimentary hermaphrodite
species in which the majority of males develop from bisexual gonads in the juvenile stage (primary
males) while a small proportion goes through sexual inversion (secondary males). Massaro (2012)
reported the opposite situation, the predominance of females at the smaller sizes and the high number
of males at larger sizes. So, we can conclude that variations of the sex ratio at different sizes are
related to unequal rates of growth and mortality.
The overall sex ratio during the study period was in favor of females (F/M=2.6). This ratio
was significantly different from the expected value of 1:1 (ρ2=49.88, P < 0.01). High ratio of females
in the catch may be caused by several factors related to the physiology and the ethology of the species,
such as the age, a tendency for slower growth or a higher mortality rates in males (Desbrosses, 1933)
as well as different catchability between two sexes.
247
HydroMedit 2014, November 13-15, Volos, Greece
25
20
Females
Males
Number 15
Undetermined
10
0
13 . 5
14 . 5
15 . 5
16 . 5
17 . 5
18 . 5
19 . 5
20 . 5
21 . 5
22 . 5
23 . 5
24 . 5
25 . 5
26 . 5
27 . 5
28 . 5
29 . 5
30 . 5
5
0.
2
4
5
6
7
8
9
1
2
3
4
5
6
7
8
9
-1
-1
-1
-1
-1
-1
-1
-1
-2
-2
-2
-2
-2
-2
-2
-2
-2
-2
-3
12
Figure 1. Length frequency distribution for Boops boops females, males and undetermined from the
Boka Kotorska Bay, South Adriatic Sea
250
200 Males
y = 0.0114x2.9005 Females
y = 0.0338x2.5247
Weight (g)
2
150 R = 0.9148
R2 = 0.9146
100
50 Females
M ales
0
10 15 20 25 30 35
Total length (cm)
Figure 2. Relationship between total length (TL) and body weight (W) in Boops boops (sexes
separated)
248
HydroMedit 2014, November 13-15, Volos, Greece
The gonadosomatic index was used to determine the reproductive period and according to
Tsikliras et al., (2013) it remains the best predictor of spawning period (i.e., onset and duration of
spawning). The GSI reached maximum values in winter period and minimum in summer and autumn
(Figure 3). Previous study on reproductive biology of bogue also observed that spawning activity
occurred in winter season in Montenegrin waters (max GSI values for both sexes were recorded in
February). (Kasalica et al., 2011). Both indices followed the same pattern. This time period is in line
with reports in the literature on the maturity cycle of bogue in eastern Mediterranean (Vidalis, 1950;
Hassan, 1990; Mozara, 2013) and eastern Atlantic (Gordo, 1995; Massaro, 2012). Alegria-Hernández
(1990) found that the almost the entire population of bogue is spent in June from the mid-Adriatic
Dalmatian channels which is in agreement with our findings of post-spawning specimen in the early
summer. The greatest number of specimen in stage 2c and stage 3 was in winter period as Massaro
(2012) found in central-east Atlantic.
5
4.5
4
3.5
3
GSI
2.5
2 Females
1.5 M ales
1
0.5
0
SPRING SUMMER AUTUMN WINTER
Season
Fulton's condition factor ranged from 0.8481 to 0.9094. Monthly changes of Fulton's
condition factor showed a seasonal cycle with a peak in spring and minimum value in winter when the
spawning begin. This factor and gonadosomatic index showed almost the same pattern, except in
winter where they showed high negative correlation (r = - 0.436) (Figure 4). Mozara (2013) also
found this negative correlation for bogue in southeastern Adriatic. Fulton's condition factor varied
between season, with the highest value in spring probably caused by an inflow of nutrition and food as
the sea temperatures increased. This high factor value could probably be attributed to ndividual
recruits in spring using energy from food for both gonad development and muscle development. The
condition factor normally decreases at the start of the spawning period due to very high metabolic
rates.
249
HydroMedit 2014, November 13-15, Volos, Greece
4.5 0.92
GSI 0.91
4
Figure 4. Fulton's condition factor and gonadosomatic index in bogue samples of the Boka Kotorska
Bay (south Adriatic Sea), during May 2013-April 2014
In conclusion, this study provides the some useful information which are important data for the
fisheries management.
References
Alegria-Hernández, V. (1990). Some aspects of reproductive biology of bogue (Boops boops L.,
Pisces Sparidae) from the Mid-Adriatic channels. Acta Adriatica., 31 (1/2): 301-313.
Desbrosses, P. (1933). Contribution a la biologie du rouget-barbet en Antlantique Nord (Contribution
to the biology of red mullet in the North Atlantic). Revue des Travaux de l'Office des Peches
Maritimes, 6 (3): 249-270.
Dulĉić, J., Glamuzina, B. (2006). Length–weight relationships for selected fish species from three
eastern Adriatic estuarine systems (Croatia). Journal of Applied Ichthyology, 22 (4), 254–
256.
El-Okda, N. I. (2008). Age and growth of Boops boops (L.) from Egyptian Mediterranean waters off
Alexandria. Egyptian Journal of Aquatic Biology & Fisheries. Vol 12, No 1:13-23.
Froese, R. (2006). Cube law, condition factor and weight-length relationships: History, meta-analysis
and recommendations. Journal of Applied Ichthyology, 22, 241-253.
Fulton, T. W. (1904). The rate of growth of fishes. Twenty-second Annual Report, Part III. Fisheries
Board of Scotland, Edinburgh, pp. 141–241.
Gordo, L. S. (1992). Contribuição para o conhecimento da biologia e do estado de exploração do stock
de boga (Boops boops Linné. 1758) da costa portuguesa. Faculdade de Ciências, Tese de
Doutoramento, Lisboa, pp. 361.
Gordo, L. S. (1995). On the sexual maturity of the bogue (Boops boops) (Teleostei, Sparidae) from the
Portuguese coast. Scientia Marina, 59 (3-4): 279-286.
Hassan, M. W. A. (1990). Comparative biological studies between two species of family Sparidae,
Boops boops and Boops salpa in Egyptian Mediterranean waters. M.Sc. Thesis, Faculty of
Science, Alexandria University, pp. 198.
ICES (2008). Report of Workshop on Maturity Ogive Estimation for Stock Assessment (WKMOG). 3
June 2008, Lisbon, Portugal, pp. 68.
Ikica Z., Djurović M., Joksimović A., Mandić M., Marković O., Pešić A. (2012). Small-scale fisheries
in Montenegro. In: AdriaMed. 2013. Report of the AdriaMed Technical meeting on Adriatic
Sea Small-scale Fisheries (Split, Croatia, 13th-14th November 2012). AdriaMed Technical
Documents, 33: 59-68.
Kasalica, O., Regner, S., Djurović, M. (2011). Some aspects of the biology of the bogue, Boops boops
(Linnaeus, 1758) in Montenegrin waters (south Adriatic Sea). Studia Marina, 25 (1): 59-72.
250
HydroMedit 2014, November 13-15, Volos, Greece
Livadas, R. J. (1989). The growth and maturity of bogue (Boops boops L.), family Sparidae, in waters
of Cyprus. F.A.O. Fisheries Report (412): 52-71.
Marković, O., Ikica, Z., Pešić, A., Joksimović, A., Djurović, M., Mandić, M. (2014). Length-weight
relationship and condition factors of the bogue, Boops boops (Linnaeus, 1758) in the south
Adriatic Sea (Montenegro). Natura Montenegrina 12 (3), in press.
Massaro, A. (2012). Reproductive biology of bogue Boops boops (Linnaeus, 1758) off Gran Canaria
(Canary Islands): a preliminary study. Phd in Sustainable Management of Fisheries
Resources. Faculty of Marine Science, Universidad de Las Palmas de Gran Canaria, pp. 33.
Mozara, R. (2013). Histological aspect of the reproductive cycle of bogue, Boops boops, (Linnaeus,
1758). Master in Mariculture. Department of Aquaculture, University of Dubrovnik, pp. 35.
Özaydin, O, Taskavak, E. (2006) Length-weight relationship for 47 fish species from Izmir Bay
(eastern Aegean Sea, Turkey). Acta Adriatica 47 (2): 211-216.
Petrakis, G., Stergiou, K. I. (1995). Weight-length relationships for 33 fish species in Greek waters.
Fisheries Research, 21: 465-469.
Šantić, M., Pallaoro, A., Jardas, I. (2006). Co-variation of gonadosomatic index and parameters of
length-weight relationships of Mediterranean horse mackerel, Trachurus mediterraneus
(Steindachner, 1868), in the eastern Adriatic Sea. Journal of Applied Ichthyology, 22 (3):
214-217.
Tsikliras, A. C., Stergiou, K. I., Froese, R. (2013). Editorial note on reproductive biology of fishes.
Acta Ichthyologica et Piscatoria., 43 (1): 1-5.
Vidalis, E. (1950). Contribution to the study of the biology of the bogue (Boops boops Lin.) in Greek
waters. Prak. Hell. Hidrobiol. Inst., 4 (1): 51-71.
251
HydroMedit 2014, November 13-15, Volos, Greece
Mehran Moslemi*,
The present study was carried out from September 2006-2007 during four seasons in Tonekabon
River. Brown trout fish was fished from 5 stations with electeroshocker instrument. Toally, 91
fish were studied that number of female, male and unidentified was 40, 41 and 10, respectively.
The age of fished fish varied from 1 to 3, and minimum and maximum of length in them were
41mm and 175mm, respectively. The identified preys present at fish stomaches were:
Ephemeropera, Diptera, Liponeura, Simolium, Hydropsyche, coleopteran, Trichoptera, Flying
insect, Spawn, Odonata, Oligochaeta, Plecoptera. In order to identify differences related to
feeding in different sizes, fish were divided to three classes. Consumption percent of
Hydropsyche and Liponeura had significant difference between three classes but the percentage
of consumption of Ephemeroptera, plecophera and Simolum did not show significant difference
between these three classes. Reproduction season of this fish is in fall (autumn). The maximum of
feeding intensity was in spring and minimum was in summer and autumn. Classes 1 and >1 year
old had higher feeding intensity than other classes (classes 2 and 3 years old). In general,
Plecoptera, Ephemeroptera and Simolium constituted primary preys, but subordinate preys were
consisted of Liponeura, Hydropsyche, dipteral, Trichoprera and Oligochaeta and also Coleoptera,
Oligochaeta, Odonatan, flying insects and spawn constituted casual preys for this fish. The
highest amount of prey for station 1, 2, 3, 4 and 5 were Simolium, Ephemeroptera, Simolium,
Simolium and Liponeura, respectively. In regard to glutting stomach index (GSI) the station 2
was the highest followed by station 1, that both of them were located on Se-Hezar river.
Introduction
Tonekabon river located at west part of Mazandaran because of physicochemical properties and
Benthic material have life diversity and this river is one of the most watery (Hig-dischange) river
in southern part of Mazandaran sea. This river is consisted of Do-Hezar, Se-Hezar and Valamrod
rivers and in addition to aqous animals, various species of fish belonging to Salmoidae,
Cyprinidae and Angailidae families live in it. Brown trout Salmo Trutta Fario is one of most
important species in Tonekabon river that inhabits in interface ( where these two river connect
each other) part of these river is considered as a native fish due to physicochemical properties and
ecological condition [3]. This species have economical value and specially is one of the most
popular for sportsman for angling [4, 8]. This thesis is on effort to identify feeding regim of this
species in Tonekabon river. As we know. Feeding is one of the most important necessities of an
organism. First –order necessities of an organism (growth, development and reproduction)
altogether conduct with consumed energy from food entered to body all of other energy-required
processes in fish body accompolish with food consumption [10]. In aquaculture, fish feeding is of
high importance, that everyone in encounter this issue in fishery industry for solving related
issues. At present research on studying fish distribution of fish species [2, 9]. Designing of a
logical ultimization method of commercial fish reserves is impossible without knowing a way that
fish search its food resources and also without knowing the connection between the fish and other
consumer of that food and the connection between predators [1, 6]. Understanding the type and
composition of food organisms consumed by other competitors, amount and way of food
consumption and linkage of feeding with time. Place and condition and some of other factors
allow researches to achive a complete and comprehensive perspective of the life of studied
252
HydroMedit 2014, November 13-15, Volos, Greece
organisms [5]. Information and results from this investigation can be used to a better
understanding of ecological condition of brown trout in the Tonekabon river.
First Do-Hezar and Se-Hezar rivers in Tonekabon were divided to 5 stations and then fishing
was conducted and these stations were investigated. Fishing was conduct using an electroshock
instrument with power 1.7 KM with direct current (DC) and voltage 300-400V. Immediately
after fishing, the fish were measured in regard to biometry properties, and then with cutting
gullet(in throat)and cutting gut in rectum part the digestion apparatus was taken out of body
and fixed in 70% alcohol.
The following information were collected and recorded in sampling process. Total length, fork
length, standard length, fish weight, stomach weight, gender determination, gonad weight, age
determination, measuring of gut length. The fixed stomatchs were taken out from alcohol and
rinsed with water and then placed in petridishes. The stomach was opened with and swallowed
preys were identified carefully (Nafisi 1992). The type and number of prey and also percentage
of prey groups recorded. The weight of stomach contents was also measured sexual maturity
index was calculated from following formula as:
The relative length of gut, i. e gut length to body length ration, was calculated. Also GSI
(Guttled stomach index) was calculated from following formula (Hynes 1970): GSI=stomach
contents weight/body weight
Results
The average percentage of preys fed by brown trout during perfect period is as below: The
frequency of primary, subordinate and casual preys for brown trout was calculated from the
below formula: Fp=Np*100/N1
That, if Fp has a value above 50 thus that prey is considered as primary prey, but if this value is
between 10-50 the prey is considered as subordinate prey and values below 10 are considered
as casual preys. Results from this investigation were analyzed using variance analysis test. The
amount of sexual maturity index in various seasons in male and female fish was calculated that
following table shows it.
Relative length of gut (RLG) in each of studied specimens was less than one that show the
carnivore nature of this fish. Guttled stomach index in males and females was compared in
different seasons as it has been shown in table 14. The maximum and minimum of guttled
stomach index in males was in spring and autumn, respectively. Also, the maximum and
minimum of guttled stomach index in females was in spring and summer, respectively.
Discussion
In order to better analysis of fish based on their age, fish were divided to three classes:
Class1: fish bellow one year old and one year old
Variance analysis test showed a significant difference between different classes for
consumption of hydropsyche, but this test did not show significant difference between different
253
HydroMedit 2014, November 13-15, Volos, Greece
classes for consumption percentage of ephemeroptera. The high sexual maturity index in
summer confirms that the spawning season in this fish is from mid-September to autumn.
The maximum of guttled stomach index is in spring and the minimum of this index occurs in
autumn and winter that these results are similar with Fasaic and Debeljal (1986) on brown trout
in bager lake and lepenica river [7]. Also the reason of decreased feeding in summer and
autumn (especially summer) compared to winter could be a high sexual maturity index in these
seasons (summer and autumn).
Results from feeding intensity between three classes 2 and 3. These finding confirm that brown
trout in early stages of age feed more than later stages. The weight of stomach contents in
smallest fish and larger classes have significant difference at 1% level, but the numbers of
organisms in this level have not any significant differences. This confirms that brown trout
catch larger prey if the prey size is increased.
Also it was found that the frequency of consumed organisms during different seasons based on
presence is changeable and this confirms that brown trout feed on most frequent and most well-
known prey. Presences of spawn in one of the samples also verify the selection factor based on
presence of prey. Furthermore consumption of flying insects by brown trout in summer show
that: first, this fish take some of its food (prey) at water level and second, feeding partially
varies with season and presence of food(prey)because these land-living insects are scarce in
other seasons [3, 8].
Table 1. average percentage of preys fed by brown trout during perfect period.
percentage Prey
Primary prey 34.14 Simolium
Primary prey 24.36 Ephemeroptera
Subordinate prey 16.40 Liponeura
Primary prey 11.68 Plecoptera
Subordinate prey 9.08 Hydropsyche
Subordinate prey 1.58 Diptera
Casual prey 0.78 Flying insecte
Casual prey 0.73 Cleoptera
Subordinate prey 0.53 Trichoptera
Casual prey 0.30 Oligochaeta
Casual prey 0.27 Odonata
Casual prey 0.14 Spawn
254
HydroMedit 2014, November 13-15, Volos, Greece
References
1. Alp, A., Kara, C. and Buyukcapar, H. m, 2005. Age, growth and diet composition of the Resident
Brown Trout, Salmo trutta macrostigma Dumeril 1858, in firniz stream of the River Ceyhan,
Turkey. Turk. J. vel. Anem. Sci. 29:285-295
2. Bud, I. L. and Vladau, V. V., 2009. The geographic isolation impact on evolation of some
morphophysiological features in the brown trout (Salmo trutta fario Linnaeus). AACL Bioflux,
1:31-49.
3. Demir, o., Gumus, E., kucuk, F., Gunlu, A. and Kepenek., 2010. Some repreactive features of
brown trout (Trout, Salmo trutta macrostigma Dumeril 1858) and its larval development under
culture condition. Pak. Vet. Journal, 30(4):223-226
4. Fochetti, R., Argano, R. AND Tierno De Figueroa, J, M., 2008. Feeding ecology of various age-
classes of brown trout in River Nera, Central Itally. Belg. j. zool. 138(2):128-131
5. Kara, C., Alp, A., Gurlek, M. E., 2011. Morphological variation of the trouts (Salmo trutta and
salmo platycephalus) in the rivers of Ceyhan, Seyhan and Euphrates, Turkey. Turkish journal
Fisheries and Aquatic Sciences, 11:77-85
6. Nafisi, Mahmoud, 1990. The hand book of identification of invertebrate in running waters, project
of bachelor, Tehran University, under supervision of Mohamadreza Ahmadi.
7. Ride ditmare, 1986. Fish and fishery, translated by Vosoghi G. and Ahmadi M., Markaz-e-
Daneshgahi publication, pp. 89-91.
8. Vosoghi, gholamhosein and Mostajir Behzad., 1990. Freshwater fish, Tehran University
publication.
9. Sajadi, Masoud, 1996. The investigation of feeding regime in stizostedion luciaperca, M. S. thesis,
Tehran University, under supervision Dr. Mohamad Reza Ahmadi.
10. Saidi, Ali asghar., 1990. Tonekabon River, fisheries Research centre, Mazandaran province.
255
HydroMedit 2014, November 13-15, Volos, Greece
1
Department of Ichthyology and Aquatic Environment, School of Agricultural Science, University of
Thessaly, Fitokou, 38446, Volos, Greece
Abstract
The population changes of total viable counts and spoilage microorganisms, such as Pseudomonas
spp., H2S producing bacteria (Shewanella), Enterobacteriaceae and Lactic Acid Bacteria was
investigated in sea bream fillets stored at 5μC under aerobic conditions. Σheir interaction with Yersinia
enterocolitica was also investigated in a model fish substrate (sea bream juice agar) in mono- and co-
cultures. In sea bream fillets Pseudomonas spp., reached populations as high as (8-9 logarithmic
cycles). In model fish substrate Pseudomonas spp. reached the higher population and exhibited the
highest growth rates in monoculture. The results in co-culture showed that Pseudomonas spp.
dominated against the other microorganisms. Lower populations observed for the pathogen
microorganism Yersinia enterocolitica. However, the specific growth rate and the maximum
population density of Yersinia enterocolitica were higher in co-cultures compared to monocultures,
showing that the co-culture with the spoilage microorganisms favors its growth.
Key words: Bacteria interaction, spoilage, specific spoilage organism, Yersinia enterocolitica, sea
bream
*Corresponding author: Christodoulou Christos-Elpidoforos (xelpsf@hotmail.com)
Πεξίιεςε
Ζ παναημθμφεδζδ ηςκ πθδεοζιζαηχκ ιεηααμθχκ ηδξ μθζηήξ ιζηνμαζαηήξ πθςνίδαξ ηαζ ηςκ
αθθμζςβυκςκ ιζηνμμνβακζζιχκ ηςκ ζπεφςκ [Pseudomonas spp., ααηηδνίςκ πμο πανάβμοκ οδνυεεζμ
(Shewanella), Enterobacteriaceae ηαζ μλοβαθαηηζηχκ ααηηδνίςκ] ιεθεηήεδηακ ζε θζθέηα ηζζπμφναξ
ζημοξ 5μC οπυ αενυαζεξ ζοκεήηεξ. Δπζπθέςκ δ αθθδθεπίδναζδ ημοξ ιε ημ ροπνυηνμθμ παεμβυκμ
ιζηνμμνβακζζιυ Yersinia enterocolitica ιεθεηήεδηακ ζε ιμκμηαθθζένβεζεξ ηαζ ζοβηαθθζένβεζεξ ζε
ιμκηέθμ οπυζηνςια, ημ μπμία απμηεθμφκηακ απυ γςιυ ηζζπμφναξ ηαζ άβαν. ηα θζθέηα, μ
ιζηνμμνβακζζιυξ πμο έθηαζε ζε ιεβαθφηενμοξ θμβανίειμοξ ηδξ ηάλδξ 8 ιε 9 log(cfu/g) ήηακ ηα
Pseudomonas spp. ηαζ απμηέθεζε ημκ επζηναηέζηενμ αθθμζςβυκμ ιζηνμμνβακζζιυ. ηα ιμκηέθα
οπμζηνχιαηα, ανπζηά ζηζξ ιμκμηαθθζένβεζεξ ηα Pseudomonas spp., πανά ημ βεβμκυξ πςξ δεκ είπε ημ
ιεβαθφηενμ εζδζηυ νοειυ αφλδζδξ, δ ηεθζηή ημο πθδεοζιζαηή ζοβηέκηνςζδ ήηακ ιεβαθφηενδ απυ
υθμοξ ημοξ άθθμοξ ιζηνμμνβακζζιμφξ. ηζξ ζοβηαθθζένβεζεξ θάκδηε υηζ ηα Pseudomonas spp.,
εοκμήεδηε απυ ηζξ αθθδθεπζδνάζεζξ ηαζ ήηακ μ ιζηνμμνβακζζιυξ πμο επζηνάηδζε έκακηζ ηςκ άθθςκ,
εκχ μ παεμβυκμξ ιζηνμμνβακζζιυξ Yersinia enterocolitica ζε υθεξ ηζξ πενζπηχζεζξ είπε ημκ
παιδθυηενμ πθδεοζιυ. Χζηυζμ μ εζδζηυξ νοειυξ αφλδζδξ ηαζ δ ηεθζηή πθδεοζιζαηή ζοβηέκηνςζδ
ηδξ Y.enterocolitica πήνακ ιεβαθφηενεξ ηζιέξ, ζε ζφβηνζζδ ιε ηζξ ηζιέξ υηακ ακαπηφπεδηε ζε
ιμκμηαθθζένβεζα ηαζ θάκδηε κα εοκμείηαζ απυ ηδκ ζοκφπανλδ ιε ημοξ αθθμζςβυκμοξ
ιζηνμμνβακζζιμφξ ηςκ ζπεφςκ.
Λέμεηο θιεηδηά: βαθηεξηαθή αιιειεπίδξαζε, αιινίσζε, εηδηθνί αιινησγόλνη κηθξννξγαληζκνί, Yersinia
enterocolitica, ηζηπνύξα
*οββναθέαξ επζημζκςκίαξ: Υνζζημδμφθμο Υνήζημξ- Δθπζδμθυνμξ ( xelpsf@hotmail.com)
256
HydroMedit 2014, November 13-15, Volos, Greece
1. Δηζαγσγή
Ο ηονζυηενμξ πανάβμκηαξ αθθμίςζδξ ηςκ ηνμθίιςκ, αθθά ηαζ πζμ ζοβηεηνζιέκα ηςκ κςπχκ
αθζεοηζηχκ πνμσυκηςκ, είκαζ δ ακάπηολδ ηςκ αθθμζςβυκςκ ιζηνμμνβακζζιχκ. Ζ ακάπηολδ ηςκ
ιζηνμμνβακζζιχκ οπμααειίγεζ ηονίςξ ηα μνβακμθδπηζηά παναηηδνζζηζηά θυβς ηζξ παναβςβήξ
ιεηααμθζηχκ μζ μπμίμζ ηαεζζημφκ ηνυθζια αηαηάθθδθα πνμξ ηαηακάθςζδ (Huis in‘t Veld 1996, Gram
& Dalgaard 2002). ηα αθζεοηζηά πνμσυκηα μζ ιζηνμμνβακζζιμί μζ μπμίμζ έπμοκ ηδκ ζηακυηδηα κα
επζαζχκμοκ ηαζ κα ακαπηφζζμκηαζ ζε ιεβάθμοξ πθδεοζιμφξ ηαζ μζ μπμίμζ είκαζ δ ηφνζα αζηία
απυννζρδξ ηςκ ζοβηεηνζιέκςκ ηνμθίιςκ, μκμιάγμκηαζ εζδζημί αθθμζςβυκμζ ιζηνμμνβακζζιμί (ΔΑΜ).
Καεμνζζηζηυ νυθμ ζηδκ ακάπηολδ ηςκ ΔΑΜ παίγμοκ μζ ζοκεήηεξ απμεήηεοζδξ ημο πνμσυκημξ (Gram
& Dalgaard 2002).
Σα ηνυθζια είκαζ πζεακυκ κα επζιμθοκεμφκ ηαζ ιε παεμβυκμοξ ιζηνμμνβακζζιμφξ. Ζ
Y.enterocolitica είκαζ έκα Gram ανκδηζηυ, πνμαζνεηζηά ακαενυαζμ ααηηήνζμ ανηεηά δζαδεδμιέκμ
ααηηήνζμ ζηδ θφζδ ηαζ ζηα οδάηζκα μζημζοζηήιαηα, ηαζ θυβς ημο ροπνυηνμθμο παναηηήνα έπεζ
παναηηδνζζηεί ςξ έκα δοκαιζηά ακαπηοζζυιεκμ παεμβυκμ ααηηήνζμ ζηα ηνυθζια ηαζ ζηα αθζεοηζηά
πνμσυκηα (Davies et al., 2001). Ζ ζοιπενζθμνά ηςκ παεμβυκςκ ιζηνμμνβακζζιχκ ελανηάηαζ απυ
δζάθμνμοξ εκδμβεκείξ (pΖ, aw, ηηθ) ηαζ ελςβεκείξ πανάβμκηεξ (εενιμηναζία, ζφζηαζδ αηιυζθαζναξ)
αθθά ηαζ απυ ημκ ακηαβςκζζιυ ηαζ αθθδθεπίδναζδ ιε ημοξ οπυθμζπμοξ ιζηνμμνβακζζιμφξ ημο
ηνμθίιμο (Jay, 1997).
ημπυξ ηδξ ζοβηεηνζιέκδξ ενβαζίαξ ήηακ δ ιεθέηδ ηδξ ζοιπενζθμνάξ ηδξ Y.enterocolitica
πανμοζία ηςκ αθθμζμβχκςκ ιζηνμμνβακζζιχκ ηςκ αθζεοηζηχκ πνμσυκηςκ.
257
HydroMedit 2014, November 13-15, Volos, Greece
ημ ιμκηέθμ οπυζηνςια, ζηζξ ιμκμηαθθζένβεζεξ ηςκ ιζηνμμνβακζζιχκ πνμέηορε πςξ υπςξ
ηαζ ζηα θζθέηα έηζζ ηαζ εδχ μ ηονζυηενμξ αθθμζςβυκμξ ιζηνμμνβακζζιυξ είκαζ ηα Pseudomonas spp.
(Γνάθδια 2α). Αλζμζδιείςημ είκαζ ημ βεβμκυξ πςξ πανά ημ υηζ ηα Pseudomonas spp. ζηζξ
ιμκμηαθθζένβεζεξ είπε ηζξ ιεβαθφηενεξ πθδεοζιζαηέξ ζοβηεκηνχζεζξ, δεκ πανμοζίαζε ημ ιεβαθφηενμ
νοειυ αφλδζδξ (Πίκαηαξ 2)
ηδ ζοβηαθθζένβεζα ηςκ ηνζχκ αθθμζςβυκςκ ιζηνμμνβακζζιχκ ιαγί ιε ημ παεμβυκμ,
δζαπζζηχεδηε πςξ, ηδ ιεβαθφηενδ ηεθζηή ζοβηέκηνςζδ πανμοζίαζε ηα Pseudomonas spp., εκχ δ
Y.enterocolitica πανμοζίαζε ηδ παιδθυηενδ ηεθζηή ζοβηέκηνςζδ (Γνάθδια 2α). Γζαπζζηχεδηε πςξ μ
εζδζηυξ νοειυξ αφλδζδξ, αθθά ηαζ μ ηεθζηυξ ιζηνμαζαηυξ πθδεοζιυξ ημο παεμβυκμο
ιζηνμμνβακζζιμφ Y.enterocolitica ήηακ ιεβαθφηενμξ απυ ημκ ακηίζημζπμ ηδξ ιμκμηαθθζένβεζαξ ημο,
βεβμκυξ πμο ιανηονά πςξ εοκμήεδηε απυ ηδκ αθθδθεπίδναζδ ιε ημοξ αθθμζςβυκμοξ
ιζηνμμνβακζζιμφξ ηςκ ζπεφςκ, πανυθμ αοηά πανμοζίαζε ηζξ παιδθυηενεξ πθδεοζιζαηέξ
ζοβηεκηνχζεζξ (Πίκαηαξ 2).
4. πδήηεζε
ηα θζθέηα ηζζπμφναξ, μ ηφνζμξ αθθμζςβυκμξ ιζηνμμνβακζζιυξ ήηακ ημ Pseudomonas spp.,
ημ μπμίμ ένπεηαζ ζε ζοιθςκία ιε πνμδβμφιεκεξ ιεθέηεξ ζπεηζηέξ ιε ηα αθζεφιαηα ηδξ Μεζμβείμο
πμο απμεδηεφμκηαζ οπυ ρφλδ ζε αενυαζεξ ζοκεήηεξ (Koutsoumanis & Nychas 1999, Parlapani et al.
2013). Καηά ηδκ ακάθοζδ ηαζ ηδ ιεθέηδ ηςκ απμηεθεζιάηςκ ζηα ιμκηέθα οπμζηνχιαηα,
δζαπζζηχεδηε πςξ ζηα δείβιαηα ηα μπμία ήηακ ζε ιμκμηαθθζένβεζα ηα Pseudomonas spp. είπε ηζξ
ιεβαθφηενεξ πθδεοζιζαηέξ ιεηααμθέξ. Καηά ηδ ζοβηαθθζένβεζα υθςκ ηςκ αθθμζςβυκςκ ηαζ ημο
παεμβυκμο ιζηνμμνβακζζιμφ ιαγί, θάκδηε πςξ ηαζ ζε εηείκδ ηδκ πενίπηςζδ ηα Pseudomonas spp.
απμηέθεζε ημκ ηονίανπμ ιζηνμμνβακζζιυ. Κάηζ ηέημζμ επζαεααζχκεηαζ ηαζ απυ ηδκ αζαθζμβναθία,
ηαεχξ ζε ιεθέηδ πμο πναβιαημπμζήεδηε απυ ηδ Gram et al. (2002) ακαθένεηαζ πςξ υηακ
ακαπηοπεμφκ ζε ζοβηαθθζένβεζα ηα Pseudomonas spp. ηαζ ημ Shewanella putrefaciens, ηα
Pseudomonas spp. έπεζ ηδλ ζηακυηδηα κα δεζιεφεζ ζίδδνμ ηαζ κα ακαζηέθθεζ ηδκ ακάπηολδ ημο
258
HydroMedit 2014, November 13-15, Volos, Greece
(α) (β)
Γξάθεκα 2. Γξαθηθή απεηθφληζε ηεο κεηαβνιήο ησλ πιεζπζκψλ ησλ Pseudomonas spp., Y.
enterocolitica, νμπγαιαθηηθψλ βαθηεξίσλ (LAB) θαη Shewanella, ζε κνλνθαιιηέξγεηα (α) θαη ζε
ζπγθαιιηέξγεηα (β), ζε κνληέιν ππφζηξσκα, ζηνπο 5 νC ζε ζπλζήθεο αέξα. Σν εθάζηνηε ζεκείν
απνηειεί ην κέζν φξν ηξηψλ επαλαιήςεσλ.
259
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
Baranyi, J., Roberts, T.A. (1994). A dynamic approach to predicting bacterial growth in food.
International Journal of Food Microbiology. 23, 277–294.
Dalgaard P. (1995). Qualitative and quantitative characterization of spoilage bacteria from packed
fish. International Journal of Food Microbiology, 26, 319-333
Davies A.R., Capell C., Jehanno D., Nychas G.J.E., Kirby R.M. (2001). Incidence of foodborne
pathogens on European fish. Food Control, 12, 67-71.
Douglas L.M., Schmidt R.H. (1991). Physiological evaluation of stimulated growth of Listeria
monocytogenes by Pseudomonas species in milk. Canadian Journal of Microbiology, 37,
594-599.
Gram L., Dalgaard P. (2002). Fish spoilage bacteria – problems and solutions. Current Opinion in
Biotechnology, 13, 262–266.
Gram L., Ravn L., Rasch M., Bruhn J.B., Christensen A.B., Givskov M. (2002). Food spoilage
interactions between food spoilage bacteria. International Journal of Food Microbiology, 78,
79– 97.
Jay J.M. (1997). Do background microorganisms play a role in the safety of fresh foods? Trends in
Food Science and Technology 8, 421-424.
Huis in‘t Veld J.H.J. (1996). Microbial and biochemical spoilage of foods: an overview. International
Journal of Food Microbiology, 33, 1-18.
Koutsoumanis K., Nychas G-J.E. (1999). Chemical and Sensory Changes Associated with Microbial
Flora of Mediterranean Boque (Boops boops) Stored Aerobically at 0, 3, 7, and 10°C.
Applied and Environmental Microbiology, 65, 698-706.
Parlapani F.F. Meziti A., Kormas K.Ar., Boziaris I.S. (2013). Indigenous and spoilage microbiota on
farmed sea bream stored in ice indentified by phenotypic and 16S rRNa gene analysis. Food
Microbiology 33, 85-89
Vermeiren L., Devlieghere F., Vandekinderen I., Debevere J. (2006). The interaction of the non-
bacteriocinogenic Lactobacillus sakei 10A and lactocin S producing Lactobacillus sakei 148
towards Listeria monocytogenes on a model cooked ham. Food Microbiology, 23, 511–518.
260
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
The aim of the present study was the evaluation of age and growth parameters in common pandora
(Pagellus erythrinus) in the Southern Aegean Sea. In total, 189 individuals were studied. Total length
(TL) ranged from 63 to 488 mm. The length-weight relationship was investigated and showed that the
species is characterized by slightly negative allometry (b=2.96). Ages were estimated by counting the
annual rings on otoliths, with specimens ranging in age from 0+ to 14 years (11 age classes). The
exponential growth model von Bertalanffy was fitted to the observed TL, as well as to the mean back-
calculated length values of each age class. The parameters of growth were estimated to be:
TL∞=545.8, k=0.098 year-1, t0=-1.802 years and TL∞=719.8, k=0.0583 year-1, t0=-1.718 years,
respectively. The estimates of the phi-prime Φ΄ for the Southern Aegean Sea were found to be close to
the estimates of other studies and especially, to those studies conducted in the West Mediterranean
and Eastern Atlantic.
Keywords: Pagellus erythrinus, otoliths, length – weight relationship, growth parameters, age
*
Corresponding author: Lampri Paraskevi Niki (lampri@hcmr.gr)
Πεξίιεςε
ημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ δ δζενεφκδζδ ηδξ δθζηίαξ ηαζ ηςκ παναιέηνςκ αφλδζδξ ζημ
θοενίκζ (Pagellus erythrinus) ζηδκ πενζμπή ημο Νυηζμο Αζβαίμο. Δλεηάζηδηακ ζοκμθζηά 189 άημια.
Σμ μθζηυ ιήημξ (TL) ηςκ αηυιςκ ηοιάκεδηε απυ 63 έςξ 488 mm. Ζ ζπέζδ αάνμοξ–ιήημοξ πμο
ελεηάζηδηε, έδεζλε υηζ ημ θοενίκζ πανμοζζάγεζ ζπεηζηά ιζηνή ανκδηζηή αθθμιεηνία (b=2,96). Απυ ηδκ
ακάβκςζδ ηςκ εηδζίςκ δαηηοθίςκ πνμζδζμνίζηδηακ ζοκμθζηά 11 δθζηζαηέξ ηθάζεζξ (ιέβζζηδ δθζηία
14 εηχκ). Σμ εηεεηζηυ ιμκηέθμ αφλδζδξ Von Bertalanffy εθανιυζηδηε βζα ηα παναηδνμφιεκα ηαζ ηα
ιέζα ακαδνμιζηά ιήηδ ηδξ ηάεε δθζηίαξ. Οζ πανάιεηνμζ αφλδζδξ οπμθμβίζηδηακ ςξ ελήξ:
TL∞=545,8, k=0.098 year-1, t0=-1,802 years ηαζ TL∞=719,8, k=0.0583 year-1, t0=-1,718 years,
ακηζζημίπςξ. Οζ ηζιέξ ημο ζοκηεθεζηή μθμηθήνςζδξ ηδξ αφλδζδξ Φ΄ βζα ημκ Νυηζμ Αζβαίμ ανέεδηακ
πανυιμζεξ ιε αοηέξ άθθςκ ιεθεηχκ, ζδζαίηενα ιε ηζξ ηζιέξ πμο οπμθμβίζηδηακ ζε Γοηζηή Μεζυβεζμ
ηαζ Ακαημθζηυ Αηθακηζηυ.
Λέλεζξ ηθεζδζά: Pagellus erythrinus, ςηυθζεμζ , ζπέζδ αάνμοξ-ιήημοξ, πανάιεηνμζ αφλδζδξ, δθζηία
*
οββναθέαξ επζημζκςκίαξ: Λάιπνδ Παναζηεοή Νίηδ (lampri@hcmr.gr)
1.Δηζαγσγή
Ζ ιεθέηδ ηςκ αζμθμβζηχκ παναηηδνζζηζηχκ ηςκ ειπμνζηχκ αεκεμπεθαβζηχκ ρανζχκ
ζοιαάθθεζ ζηδκ ζςζηυηενδ εηιεηάθθεοζδ ηςκ απμεειάηςκ ημοξ ηαζ ζηδκ εέζπζζδ απμδμηζηυηενςκ
261
HydroMedit 2014, November 13-15, Volos, Greece
δζαπεζνζζηζηχκ ιέηνςκ βζα ηδκ πνμζηαζία ημοξ (Caddy 1993). οβηεηνζιέκα, δ εηηίιδζδ ηδξ δθζηίαξ
ηςκ εζδχκ ηαζ δ πενζβναθή ηςκ πνμηφπςκ αφλδζήξ ημοξ είκαζ απαναίηδηα ζημζπεία βζα ηδκ ηαθφηενδ
δζαπείνζζδ ηςκ απμεειάηςκ ημοξ. Σμ θοενίκζ (Pagellus erythrinus) απμηεθεί έκα ζδιακηζηυ
αεκεμπεθαβζηυ είδμξ ειπμνζηήξ αλίαξ ιε εονεία βεςβναθζηή ελάπθςζδ απυ ηδ Μαφνδ Θάθαζζα, ζε
υθδ ηδ Μεζυβεζμ ηαζ ζηα ακαημθζηά πανάθζα ημο Αηθακηζημφ ςηεακμφ (Fischer et al. 1987). Ο
ζημπυξ ηδξ πανμφζαξ ένεοκαξ ήηακ δ ιεθέηδ ηδξ ζπέζδξ ιήημοξ-αάνμοξ ηαζ δ εηηίιδζδ ηδξ δθζηίαξ
ηαζ ηςκ παναιέηνςκ αφλδζδξ ημο θοενζκζμφ ζημ Νυηζμ Αζβαίμ Πέθαβμξ.
3. Απνηειέζκαηα
Ζ ζοκμθζηή ηαηά ιήημξ ζφκεεζδ ημο θοενζκζμφ ζημ Νυηζμ Αζβαίμ πανμοζζάγεηαζ ζημ πήια
1. Σμ εφνμξ ηζιχκ ημο μθζημφ ιήημοξ ηοιάκεδηε απυ 63 έςξ 488 mm, ιε ημ ιεβαθφηενμ πμζμζηυ
αηυιςκ κα ηαηακέιεηαζ ιεηαλφ ηςκ ηθάζεςκ 140–240 mm.
80
70
60
υχνότητα (Ν)
50
40
30
20
10
0
40
60
80
100
120
140
160
180
200
220
240
260
280
300
320
340
360
380
400
420
440
460
480
500
Ζ ζπέζδ αάνμοξ – ιήημοξ ηςκ αηυιςκ ημο θοενζκζμφ πενζβνάθεηαζ απυ ημ ιμκηέθμ εηεεηζηήξ
αφλδζδξ W=0.000015*TL2.96175, (R2 = 98.7272, N=189) (πήια 2).
262
HydroMedit 2014, November 13-15, Volos, Greece
1600
1200
W (g)
800
400
0
0 50 100 150 200 250 300 350 400 450 500
TL (mm)
ρέζε 2 : ρέζε βάξνπο –κήθνπο ηνπ ιπζξηληνχ (Pagellus erythrinus) ζην Νφηην Αηγαίν πέιαγνο.
οκμθζηά μ πνμζδζμνζζιυξ ηςκ δαηηοθίςκ ηαζ δ ακάβκςζδ ηδξ δθζηίαξ ήηακ δοκαηή ζε 185
ςηυθζεμοξ. Ακαβκςνίζηδηακ 11 δθζηζαηέξ ηθάζεζξ ζημ θοενίκζ ιε ηδκ δθζηία κα ηοιαίκεηαζ απυ 0+
έςξ 14 πνυκζα. Καευηζ δε ανέεδηακ άημια δθζηίαξ 10 – 13 πνμκχκ, μζ πανάιεηνμζ αφλδζδξ
οπμθμβίζηδηακ θαιαάκμκηαξ οπυρδ ηζξ δθζηίεξ 0 – 9 ή 0 – 14 πνμκχκ, ηυζμ βζα ηα παναηδνμφιεκα
ιήηδ υζμ ηαζ βζα ηα ιέζα ακαδνμιζηά. Οζ πανάιεηνμζ αφλδζδξ ιε αάζδ ημ ιμκηέθμ von Bertalanffy,
ηαεχξ ηαζ μζ ηζιέξ ημο ζοκηεθεζηή Φ΄ πανμοζζάγμκηαζ ζημκ Πίκαηα 1.
Πίλαθαο 1: Παξάκεηξνη αχμεζεο κε βάζε ην κνληέιν von Bertalanffy θαη ηηκέο Φ΄ γηα ην
ιπζξίλη (Pagellus erythrinus) ζην Nφηην Αηγαίν πέιαγνο.
Ζθζηία t0
Μέεμδμξ L∞ (mm) k (year-1) R2 Φ΄
(πνυκζα) (year)
4. πδήηεζε
Σα απμηεθέζιαηα ηδξ ζπέζδξ αάνμοξ–ιήημοξ έδεζλακ ιζα εθαθνχξ ανκδηζηή αθθμιεηνζηή
αφλδζδ (b<3) ζημ θοενίκζ ημο Νμηίμο Αζβαίμο, οπμδδθχκμκηαξ ιεβαθφηενδ αφλδζδ ηαηά ιήημξ απυ
υηζ ηαηά αάνμξ. Ζ ανκδηζηή αοηή αθθμιεηνία ένπεηαζ ζε ζοιθςκία ηαζ ιε άθθεξ ιεθέηεξ πμο
πναβιαημπμζήεδηακ ζηδκ πενζμπή ημο Αζβαίμο ηαζ ηδξ Μεζμβείμο, πανυθμ πμο ημ εφνμξ
παναηδνμφιεκςκ ιδηχκ ήηακ ανηεηά πενζμνζζιέκμ (Chasan et al. 2011, Metin et al. 2011).
Πανυιμζα ηζιή βζα ημκ ζοκηεθεζηή b, ιε αοηή ηδξ πανμφζαξ ενβαζίαξ, ανήηακ μζ Metin et al. (2011)
ζημκ Κυθπμ ηδξ ιφνκδξ. Ακηζεέηςξ, ζε ιεθέηεξ πμο πναβιαημπμίδζακ μζ Pajuelo & Lorenzo (1998)
ζηα Κακάνζα κδζζά ηαζ δ Μοηζθδκαίμο (1989) ζημκ Δοαμσηυ ηυθπμ, ιε πζμ ιεβάθμ εφνμξ
παναηδνμφιεκςκ ιδηχκ, ανέεδηε ζζμιεηνζηή αφλδζδ βζα ημ είδμξ, ακ ηαζ μζ ηζιέξ ημο ζοκηεθεζηή b
πθδζζάγμοκ ανηεηά ηδκ εονεεείζα ηζιή ηδξ πανμφζαξ ιεθέηδξ.
Πίλαθαο 2: Παξάκεηξνη ηεο ζρέζεο βάξνπο-κήθνπο (W=aLb) απφ άιιεο κειέηεο.
οββναθείξ Πενζμπή N Δφνμξ L (mm) a b
263
HydroMedit 2014, November 13-15, Volos, Greece
Κυθπμξ
*
διείςζδ: Σμ L∞ οπμθμβίζηδηε πνδζζιμπμζχκηαξ ημ ιεζμοναίμ ιήημξ ρανζμφ (FL) ζηδκ ζπέζδ
αάνμοξ-ιήημοξ.
ηδκ πανμφζα ένεοκα, πμο αθμνά δείβιαηα θοενζκζμφ απυ ημ Νυηζμ Αζβαίμ Πέθαβμξ,
ακαβκςνίζηδηακ 11 δθζηζαηέξ ηθάζεζξ ιε ηδ ιέβζζηδ δθζηία κα εηηζιάηαζ ζηα 14 πνυκζα, θυβς ηδξ
πανμοζίαξ εκυξ ιεβάθμο αηυιμο ιε ιήημξ 488mm TL. Πανυιμζα απμηεθέζιαηα έπμοκ ανεεεί βζα ημ
θοενίκζ ημο Δοαμσημφ ηυθπμο, υπμο δ Μοηζθδκαίμο (1989) ακαθένεζ υηζ ανήηε 12 δθζηζαηέξ μιάδεξ
ιε ιέβζζημ ηα 11 πνυκζα ζε άημια ιε ιήημξ απυ 42 έςξ 430 mm TL. ε άθθεξ ιεθέηεξ υιςξ πμο
αθμνμφκ ηδκ πενζμπή ηδξ Μεζμβείμο ηαζ υπμο ημ εφνμξ ιδηχκ πμο ελεηάζηδηε ήηακ πενζμνζζιέκμ,
ηαοημπμζήεδηακ θζβυηενεξ δθζηζαηέξ ηθάζεζξ. οβηεηνζιέκα, ζημκ Παβαζδηζηυ ηυθπμ
ακαβκςνίζηδηακ 9 δθζηζαηέξ ηθάζεζξ ιε ιέβζζηδ δθζηία ηα 8 πνυκζα (Chasan et al. 2011), ζημκ ηυθπμ
ηδξ ιφνκδξ 11 δθζηζαηέξ ηθάζεζξ ιε ιέβζζημ ηα 10 πνυκζα (Metin et al. 2011) ηαζ ζημ Κνδηζηυ
πέθαβμξ, φζηενα απυ ακάβκςζδ ηςκ θεπζχκ, 8 δθζηζαηέξ μιάδεξ ιε ιέβζζηδ δθζηία ηα 7 πνυκζα
(Somarakis & Machias 2002). Απυ ένεοκεξ ζηδκ πενζμπή ημο Ακαη. Αηθακηζημφ, ζηα ιεκ Κακάνζα
κδζζά ακαβκςνίζηδηακ 11 δθζηζαηέξ ηθάζεζξ ιε ιέβζζηδ δθζηία ηα 10 πνυκζα (Pajuelo & Lorenzo
1998), εκχ ζηδ εαθάζζζα πενζμπή κυηζα ηδξ Πμνημβαθίαξ δ ιέβζζηδ δθζηία ημο θοενζκζμφ ανέεδηε 21
πνυκζα (Coelho et al. 2010). Σα απμηεθέζιαηα ηςκ ενεοκχκ αοηχκ, ηα μπμία ααζίζηδηακ ζε άημια ιε
πανυιμζμ εφνμξ ιδηχκ ιε ηδξ πανμφζαξ ένεοκαξ, πανμοζίαζακ ζοιθςκία ιε ηα πνμακαθενεέκηα
απμηεθέζιαηα ιαξ.
Οζ ελζζχζεζξ von Bertalanffy πμο εθανιυζηδηακ βζα ηα παναηδνμφιεκα ηαζ ηα ακαδνμιζηά
ιήηδ, πνδζζιμπμζχκηαξ ηα άημια πμο ακήηακ ζηζξ δθζηίεξ 0+ έςξ 9 πνμκχκ, έδςζακ αζοιπηςηζηυ
ιήημξ πμο ειπίπηεζ ιέζα ζημ εφνμξ ηζιχκ πμο έπμοκ ανεεεί ζε άθθεξ ένεοκεξ ζηδ Μεζυβεζμ ηαζ ζημκ
Ακαημθζηυ Αηθακηζηυ βζα ηδκ αφλδζδ ημο θοενζκζμφ (Πίκαηαξ 3). Λαιαάκμκηαξ υιςξ οπυρδ ιαξ ηαζ
ηδκ δθζηία ηςκ 14 εηχκ, εηπνμζςπμφιεκδ απυ έκα ιμκαδζηυ άημιμ, πνμηφπημοκ αζοιπηςηζηά ιήηδ
ιε ανηεηά ιεβάθεξ ηζιέξ ζοβηνζηζηά ιε ηζξ πνμακαθενεείζεξ ηαζ ακηίζημζπμζ παιδθμί νοειμί αφλδζδξ
(k), υπςξ εα ακαιεκυηακ. Δίκαζ πνμθακέξ υηζ ημ ιμκαδζηυ αοηυ ιεβάθμ άημιμ ζοκεζζθένεζ ζδιακηζηά
ζηδκ δζεφνοκζδ ημο δθζηζαημφ εφνμοξ ηαζ ημο ιέβζζημο ιήημοξ ημο είδμοξ ζηδκ πενζμπή ημο Νμηίμο
Αζβαίμο, αθθά ηαζ ηδξ Μεζμβείμο ηαζ ημο Αηθακηζημφ.
Πίλαθαο 3: Παξάκεηξνη αχμεζεο ηεο εμίζσζεο Von Bertallanffy (k θαη L∞) θαη ηηκέο Φ΄ απφ
άιιεο εξγαζίεο.
Μέεμδμξ
οββναθείξ Πενζμπή L∞ k Φ΄
ακάβκςζδξ
Παβαζδηζηυξ
Chasan et al., 2011 Χηυθζεμζ 345 0,13 2,19
Κυθπμξ
Papaconstantinou et al.,
Λέπζα Ηυκζμ Πέθαβμξ 326* 0,18 2,28
1988
264
HydroMedit 2014, November 13-15, Volos, Greece
Pajuelo and Lorenzo, 1998 Χηυθζεμζ Κακάνζα Νδζζά 417 0,21 2,55
*
διείςζδ: Σμ L∞ οπμθμβίζηδηε πνδζζιμπμζχκηαξ ημ ιεζμοναίμ ιήημξ ρανζμφ (FL) ζηδκ ζπέζδ
αάνμοξ-ιήημοξ.
Οζ ηζιέξ ημο ζοκηεθεζηή Φ΄βζα ηα παναηδνμφιεκα ηαζ ηα ακαδνμιζηά ιήηδ ήηακ πανυιμζεξ
ιε ηζξ ηζιέξ απυ άθθεξ ιεθέηεξ βζα ημ θοενίκζ. Ο ζοκηεθεζηήξ Φ΄ ζημ Νυηζμ Αζβαίμ πανμοζίαζε
ανηεηά ορδθέξ ηζιέξ πμο πθδζζάγμοκ πενζζζυηενμ ηζξ ακηίζημζπεξ ηζιέξ πμο οπμθμβίζηδηακ ζηδ
Γοηζηή Μεζυβεζμ (Girardin 1981; Girardin & Quignard 1985) ηαζ ζημ Ακαη. Αηθακηζηυ (Pajuelo &
Lorenzo 1998; Coelho et al. 2010).
Ζ πανμφζα ενβαζία πανέπεζ κέεξ ζδιακηζηέξ πθδνμθμνίεξ ζπεηζηέξ ιε ηδκ εηηίιδζδ δθζηίαξ
ηαζ ηςκ παναιέηνςκ αφλδζδξ ημοξ θοενζκζμφ ζηδκ πενζμπή ημο Νμηίμο Αζβαίμο, ζημπεφμκηαξ ζηδκ
μοζζαζηζηυηενδ ηαηακυδζδ ηδξ αζμθμβίαξ ημο είδμοξ. Πεναζηένς υιςξ ένεοκεξ, μζ μπμίεξ εα
ζηδνίγμκηαζ ζε δεζβιαημθδρίεξ ηαε‘υθδ ηδ δζάνηεζα ημο έημοξ, είκαζ απαναίηδηεξ βζα κα εηηζιδεμφκ
ζςζηά ηα απμεέιαηα ημο είδμοξ ζηδκ εονφηενδ πενζμπή, αθθά ηαζ βζα κα εκημπζζημφκ πζεακέξ
αθθαβέξ ζηζξ παναιέηνμοξ αφλδζδξ ιε ηδκ πάνμδμ ηςκ πνυκςκ ςξ απμηέθεζια ηδξ ηθζιαηζηήξ
αθθαβήξ ηαζ ηδξ ακενχπζκδξ δναζηδνζυηδηαξ.
Βηβιηνγξαθηθέο αλαθνξέο
Andaloro, F., & Giarritta, P. S. (1985). Contribution to the knowledge of the age, growth and feeding
of pandora, Pagellus erythrinus (L. 1758) in the Sicilian Channel. 336, pp.85-87.
Bertalanffy, L. v. (1938). A quantitative theory of organic growth. Human Biology (10), 181-213.
Caddy, J. F. (1993). Some future perspectives for assessment and management of Mediterranean
fisheries. Scientia Marina (57), 121-130.
Chasan, E., Golomazou, E., Neofitou, C., Aifanti, S., & Kallianiotis, A. (2011). Preliminary results of
biology and population parameters of Common Pandora (Pagellus erythrinus L.1758) in
Pagasitikos Gulf. 4th International Symposium "Hydrobiology - Fisheries", (ζζ. 326-330).
Volos.
Coelho, R., Bentes, L., Correia, C., Gonçalves, J. M., Lino, P. G., & Monteiro, P. (2010). Life history
of the common pandora, Pagellus erythrinus (Linnaeus, 1758) (Actinopterygii: Sparidae)
from southern Portugal. Brazilian Journal of Oceanography , 58 (3), 233-245.
Fischer, W., Schneider, M., & Bauchot, M. L. (1987). Fishes FAO d' identification des
especesMediterranee et Mer Noire. FAO.
Girardin, M. (1981). Pagellus erythrinus (L., 1758) et Boops boops (L., 1758) (Pisces, Sparidae) du
Golfe du Lion. Ecobiologie. Prises commerciales et modeles de gestion. Ph. D. thesis.
University of Languedoc, France, p.295.
Girardin, M., & Quignard, J. P. (1985). Croissance de Pagellus erythrinus (Pisces: TeÂleÂosteÂens
Sparidae) dans le Golfe du Lion. Cybium , 9 (4), 359-374.
Livadas, R. J. (1989). A study of the biology and population dynamics of pandora (Pagellus
erythrinus L., 1758), Family Sparidae, in the Seas of Cyprus. 412, 58-75.
Metin, G., Ilkyaz, A. T., Soukan, O., & Kinacigil, H. T. (2011). Biological characteristics of the
common pandora, Pagellus erythrinus (Linnaeus, 1758), in the central Aegean Sea. Turkish
Journal of Zoology , 35 (3), 307-315.
Mytilineou, C. (1989). Données biologiques sur le pageot, Pagelus erythrinus, des côtes orientales de
la Grèce centrale. FAO Fish. Rep. , 412, 77-82.
Nikolsky, G. v. (1963). 1963. Academic. The ecology of fishes. , 352.
Pajuelo, J. G., & Lorenzo, J. M. (1998). Population biology of the common pandora Pagellus
erythrinus (Pisces: Sparidae) off the Canary Islands. Fisheries Research , 36, 75-86.
Papaconstantinou, C., Mytilineou, C., & T., P. (1988). Aspects of the life history and fishery of red
pandora, Pagellus erythrinus (Sparidae) off Western Greece. Cybium , 12 (4), 267-280.
Somarakis, S., & Machias, A. (2002). Age, growth, and bathymetric distribution of red pandora
(Pagellus erythrinus) on the Cretan shelf (eastern Mediterranean). Journal of the Marine
Biological Association of the United Kingdom, 82, 149-160.
265
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
In the present study, length-weight relationship and growth parameters of red mullet were studied
from samples collected in the Aegean and Ionian Seas. Six and seven age groups were recorded in the
Aegean and the Ionian Sea, respectively. Length-weight relationship was positive allometric in both
areas. Fish length and otolith radius linear relationship was used for the estimation of mean back
calculated lengths per age class. Von Bertallanfy growth parameters were calculated for observed and
back-calculated lengths per age class. Φ‟ values were similar in all cases. Differences were found in
length-weight relationship and growth parameters between the study areas.
Key words: Mullus barbatus, age, growth, otoliths
*Corresponding author: Archontia Cahtzispyrou (a.chatzispyrou@hcmr.gr)
Πεξίιεςε
ηδκ πανμφζα ενβαζία δ ζοζπέηζζδ αάνμοξ-ιήημοξ ηαζ μζ πανάιεηνμζ αφλδζδξ ελεηάζηδηακ βζα ηδκ
ημοηζμιμφνα ημο Αζβαίμο ηαζ Ημκίμο Πεθάβμοξ. Έλζ δθζηζαηέξ μιάδεξ πνμζδζμνίζηδηακ ζημ Αζβαίμ
ηαζ επηά ζημ Ηυκζμ Πέθαβμξ. Ζ ζπέζδ αάνμοξ-ιήημοξ ανέεδηε εεηζηά αθθμιεηνζηή ηαζ ζηζξ δομ
πενζμπέξ. Ζ βναιιζηή ζοζπέηζζδ ιεηαλφ ιήημοξ ρανζμφ ηαζ αηηίκαξ ςημθίεμο πνδζζιμπμζήεδηε βζα
ημκ οπμθμβζζιυ ηςκ ακαδνμιζηχκ ιδηχκ ακά δθζηία. Οζ πανάιεηνμζ αφλδζδξ εηηζιήεδηακ ιε αάζδ
ημ ιμκηέθμ Von Bertallanfy, ηυζμ βζα ηα παναηδνμφιεκα υζμ ηαζ βζα ηα ιέζα ακαδνμιζηά ιήηδ ακά
δθζηία ηαζ μζ ηζιέξ ημο ζοκηεθεζηή Φ‟ ήηακ ζε υθεξ ηζξ πενζπηχζεζξ πανυιμζεξ. Γζαθμνέξ
παναηδνήεδηακ ζηδ ζπέζδ αάνμοξ-ιήημοξ ηαζ ζηζξ παναιέηνμοξ αφλδζδξ ακάιεζα ζηζξ δομ
πενζμπέξ.
Λέξειρ κλειδιά: Mullus barbatus, πξνζδηνξηκόο ειηθίαο, αύμεζε, σηόιηζνη
*οββναθέαξ επζημζκςκίαξ: Ανπμκηία Υαηγδζπφνμο (a.chatzispyrou@hcmr.gr)
1. Δηζαγσγή
Ζ εηηίιδζδ ηδξ δθζηίαξ ζηα ράνζα είκαζ έκα ααζζηυ ζημζπείμ βζα ηδ ιεθέηδ ηδξ αζμθμβίαξ ηαζ
δοκαιζηήξ ηςκ πθδεοζιχκ ημοξ. Ζ ημοηζμιμφνα (Mullus barbatus) είκαζ έκα απυ ηα ζπμοδαζυηενα
ειπμνζηά αεκεμπεθαβζηά είδδ ηςκ εθθδκζηχκ εαθαζζχκ, αθθά ηαζ μθυηθδνδξ ηδξ Μεζμβείμο
(Tserpes et al., 2002; Ozbilgin et al., 2004). Πνμδβμφιεκεξ ιεθέηεξ ημο είδμοξ έπμοκ ακαδείλεζ
πθδνμθμνίεξ ζπεηζηά ιε ηδ αζμθμβία ηαζ αθζεία ηδξ ημοηζμιμφναξ ζηδ Μεζυβεζμ (π.π. Cherif et al.
2007, Sieli et al. 2011, Aydin & Karadurmus 2013). ηδκ Δθθάδα έπμοκ βίκεζ ενβαζίεξ βζα ηδκ
266
HydroMedit 2014, November 13-15, Volos, Greece
3. Απνηειέζκαηα
Σα ιήηδ ηςκ ρανζχκ πμο αθζεφηδηακ ζημ Αζβαίμ Πέθαβμξ ηοιάκεδηακ απυ 70 ιέπνζ 310
mm. Σα ιεβαθφηενα πμζμζηά (73%) ανέεδηακ ζηζξ ηθάζεζξ 120-170 mm. ημ Ηυκζμ Πέθαβμξ ηα ιήηδ
ηδξ ημοηζμιμφναξ ηοιάκεδηακ ιεηαλφ 50 ηαζ 310 mm ιε ιεβαθφηενμ πμζμζηυ ζηζξ ηθάζεζξ ιήημοξ
ιεηαλφ 130-160 mm (63%). Ο πνμζδζμνζζιυξ ηδξ δθζηίαξ ηδξ ημοηζμιμφναξ ζημ Αζβαίμ Πέθαβμξ
πναβιαημπμζήεδηε ζε 210 ράνζα, ιήημοξ 94 έςξ 227 mm. Πνμζδζμνίζηδηακ 6 δθζηζαηέξ ηθάζεζξ απυ
0+ έςξ 5+. ημ Ηυκζμ δ ακάβκςζδ πναβιαημπμζήεδηε ζε 130 ςηυθζεμοξ ιήημοξ 108-229 mm, υπμο
πνμζδζμνίζηδηακ 7 δθζηζαηέξ ηθάζεζξ, απυ 0+ έςξ 6+.
Σα ιμκηέθα ηδξ ζοζπέηζζδξ αάνμοξ-ιήημοξ βζα ηζξ δφμ πενζμπέξ ένεοκαξ, ηα μπμία
πνμέηορακ απυ ηδκ ελέηαζδ ηςκ αηυιςκ βζα ηα μπμία ιεθεηήεδηε ηαζ δ δθζηία, πανμοζζάγμκηαζ ζημ
πήια 1. Ζ ηαηά αάνμξ αφλδζδ ηδξ ημοηζμιμφναξ ζημ Αζβαίμ ηαζ ημ Ηυκζμ Πέθαβμξ πανμοζίαζε
εεηζηή αθθμιεηνία (b>3,0), βεβμκυξ πμο δδθχκεζ ιεβαθφηενδ αφλδζδ ηαηά αάνμξ ηςκ ρανζχκ ζε
ζπέζδ ιε ημ ιήημξ ημοξ. Σα ιμκηέθα ζοζπέηζζδξ αάνμοξ-ιήημοξ ηδξ ημοηζμιμφναξ δζέθενακ ηαζ ςξ
πνμξ ηδ ηθήζδ ηαζ ςξ πνμξ ηδ ημιή ηςκ βναιιχκ παθζκδνυιδζδξ (p<0.0001) ακάιεζα ζηζξ δομ
πενζμπέξ ιεθέηδξ.
267
HydroMedit 2014, November 13-15, Volos, Greece
200
WA = 0.000056TL3.139 WI = 0.000012TL3.425
R² = 99.39, N=123 R² = 98.57, N=84
150
ΑΗΓΑΗΟ
100
W
ΗΟΝΗΟ
50
0
50 100 150 200 250
TL
ρήκα 1. ρέζε βάξνπο-κήθνπο ηεο θνπηζνκνχξαο ζην Αηγαίν (Α) θαη Ηφλην (Η) Πέιαγνο
Πίλαθαο 1. Παξάκεηξνη αχμεζεο ηεο θνπηζνκνχξαο ζηηο δχν πεξηνρέο κειέηεο κε βάζε ην
κνληέιν Von Bertalanffy ( ± ηππηθφ ζθάικα)
Πενζμπ
L∞ (mm) k t0 R2 N Φ΄
ή
Παναηδνμφιεκα ΑΗΓΑΗ 0,17(±0,04 21
326,79(± 38,8) -1,78(±0,28) 91,55 2,26
ιήηδ Ο ) 0
Παναηδνμφιεκα 0,20(±0,03 13
ΗΟΝΗΟ 295,62(± 19,2) -1,74(±0,22) 95,03 2,25
ιήηδ ) 0
Μέζα
ΑΗΓΑΗ 0,34(±0,06
ακαδνμιζηά 244,161(± 13,9) -0,47(±0,18) 99,80 5 2,30
Ο )
ιήηδ
Μέζα
0,20(±0,03
ακαδνμιζηά ΗΟΝΗΟ 308,898(± 20,4) -0,94(±0,19) 99,85 6 2,28
)
ιήηδ
4. πδήηεζε
Οζ εηηζιχιεκεξ δθζηίεξ ζηδκ πανμφζα ενβαζία δζαθένμοκ ιεηαλφ Αζβαίμο ηαζ Ημκίμο
Πεθάβμοξ ηαηά ιζα δθζηζαηή ηθάζδ, μθεζθυιεκδ ζηδκ πανμοζία εκυξ ιυκμ αηυιμο, δθζηίαξ έλζ εηχκ
ηαζ ιήημοξ TL=228mm, ζημ Ηυκζμ Πέθαβμξ. Δπζπθέμκ δθζηίεξ απυ αοηέξ πμο ακαβκςνίζηδηακ ζηδκ
πανμφζα ιεθέηδ ακαιέκμκηαζ βζα ηδκ ημοηζμιμφνα, δεδμιέκμο υηζ δ ηαηά ιήημξ ζφκεεζδ ημο είδμοξ
268
HydroMedit 2014, November 13-15, Volos, Greece
πενζείπε ιεβαθφηενα άημια απυ αοηά πμο ελεηάζηδηακ βζα ηδκ εηηίιδζδ ηδξ δθζηίαξ ηαζ ζηζξ δομ
πενζμπέξ ένεοκαξ.
Σα απμηεθέζιαηα ηδξ πανμφζαξ ενβαζίαξ ζπεηζηά ιε ηδκ ζοζπέηζζδ αάνμοξ-ιήημοξ ηδξ
ημοηζμιμφναξ έδεζλακ εεηζηά αθθμιεηνζηή αφλδζδ ημ μπμίμ έπεζ παναηδνδεεί ηαζ ζε πνμδβμφιεκεξ
ιεθέηεξ βζα ηζξ ίδζεξ πενζμπέξ ένεοκαξ υπςξ ηαζ ζε άθθα ιένδ ηδξ Μεζμβείμο (Πίκαηαξ 2). Ζ ζπέζδ
αάνμοξ-ιήημοξ ανέεδηε κα δζαθένεζ ιεηαλφ Αζβαίμο ηαζ Ημκίμο Πεθάβμοξ. Ακηζεέηςξ, μζ Σζάιδξ ηαζ
ζοκ. (2006) δεκ ανήηακ δζαθμνέξ ιεηαλφ ηςκ πενζμπχκ.
οββναθείξ Πενζμπή b
Πανμφζα ιεθέηδ Αζβαίμ 3,14(±0,03)
Πανμφζα ιεθέηδ Ηυκζμ 3,42(±0,04)
Vassilopoulou & Papaconstantinou 1992 Αζβαίμ 3,18(±0,04)
Σζάιδξ ηαζ ζοκ. 2006 ανςκζηυξ 3,22
Σζάιδξ ηαζ ζοκ. 2006 Ν.Α. Ηυκζμ 3,18
Cherif et al. 2007 Σοκδζία 3,10
Aydin & Karadurmus 2013 Ακ. Μαφνδ Θάθαζζα 3,03
Οζ ηζιέξ ηςκ παναιέηνςκ αφλδζδξ ηαζ ημο ζοκηεθεζηή Φ΄ ηδξ πανμφζαξ ενβαζίαξ ήηακ
ημκηά ιε αοηέξ πμο έπμοκ ανεεεί βζα ημ είδμξ ζε πνμδβμφιεκεξ ιεθέηεξ ζε δζάθμνεξ πενζμπέξ ηδξ
Μεζμβείμο (Πίκαηαξ 3: δίκεηαζ ημ ηοπζηυ ζθάθια υπμο έπεζ ζοιπενζθδθεεί). Ανηεηά ορδθέξ ήηακ μζ
ηζιέξ ημο k ηαζ ημο Φ΄ πμο ανήηακ μζ Ozbilgin et al. (2004) ζημκ ηυθπμ ηδξ ιφνκδξ ηαζ μζ Vrantzas
et al (1992) ζημ ανςκζηυ ηυθπμ (Πίκαηαξ 3). Οζ ιζηνυηενεξ ηζιέξ k ηαζ Φ΄ ανέεδηε ζηδκ Ακ.
Μαφνδ Θάθαζζα ζφιθςκα ιε ημοξ Aydin & Karadurmus (2013).
Πίλαθαο 3. Παξάκεηξνη αχμεζεο (L∞ θαη k) θαη ζπληειεζηέο Φ΄ηεο θνπηζνκνχξαο απφ
πξνεγνχκελεο κειέηεο.
Μέεμδμξ
οββναθείξ Πενζμπή L∞ (cm) N k Φ΄
ακάβκςζδξ
Aydin & Karadurmus Ακ. Μαφνδ
Χηυθζεμζ 27,4 1435 0,14 2,02
2013 Θάθαζζα
Χηυθζεμζ εδθοηχκ
Vassilopoulou & Αζβαίμ 25,5* 369 0,21 2,14
Χηυθζεμζ
Papaconstantinou 1992 Αζβαίμ 22,7* 328 0,25 2,11
ανζεκζηχκ
Vrantzas et al 1992 Χηυθζεμζ ανςκζηυξ 23,5 ? 0,51 2,45
Σζάιδξ ηαζ ζοκ. 2006 Χηυθζεμζ ανςκζηυξ 27,9(± 1,69) 214 0,17(±0,02) 2,09
Σζάιδξ ηαζ ζοκ. 2006 Χηυθζεμζ Ν.Α. Ηυκζμ 29,5(± 2,04) 250 0,15(±0,02) 2,12
Sieli et al. 2011 Χηυθζεμζ εδθοηχκ ζηεθία 22,1(± 1,15) 595 0,38(±0,09) 2,27
*Οζ ηζιέξ αθμνμφκ ημ ιεζμοναίμ ιήημξ ηςκ ρανζχκ
Οζ δζαθμνέξ αοηέξ ζηδκ αφλδζδ πμο παναηδνμφκηαζ βζα ηδκ ημοηζμιμφνα ακάιεζα ζηζξ
δζάθμνεξ ιεθέηεξ ιπμνεί κα απμδμεμφκ ζηζξ δζαθμνεηζηέξ πενζααθθμκηζηέξ ζοκεήηεξ ηδξ ηάεε
πενζμπήξ ένεοκαξ, αθθά ηαζ ζε δζαθμνέξ ζηδ ζφκεεζδ ηςκ οπυ ελέηαζδ δεζβιάηςκ, δζαθμνέξ ζηδ
ιεεμδμθμβία ακάβκςζδξ ηαζ ενιδκείαξ ηςκ εηήζζςκ δαηηοθίςκ ηαεχξ ηαζ ζε αθθαβέξ ζημοξ
πθδεοζιμφξ θυβς ηθζιαηζηήξ αθθαβήξ. Γεδμιέκμο υηζ δ πανμφζα ιεθέηδ είκαζ ιζα πνμηαηανηηζηή
ενβαζία ζε ζπέζδ ιε ηδκ αφλδζδ ηδξ ημοηζμιμφναξ, πεναζηένς ένεοκα πμο εα ζηδνίγεηαζ ζε
δεζβιαημθδρίεξ απυ υθεξ ηζξ επμπέξ ημο έημοξ, ιε επανηή ανζειυ ηαζ απυ ηα δομ θφθα, ηαζ εα
ηαθφπηεζ υθμ ημ εφνμξ ιδηχκ ηςκ πθδεοζιχκ ημο είδμοξ, εα δχζμοκ ιζα πζμ μθμηθδνςιέκδ εζηυκα
βζα ηδκ αφλδζδ ηδξ ημοηζμιμφναξ, ζημζπείμ απαναίηδημ βζα ηδκ δζαπείνζζδ ηςκ απμεειάηςκ ηδξ.
269
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
Aydin M., Karadurmus U. (2013). An investigation on age, growth, and biological characteristics of
red mullet (Mullus barbatus ponticus, Essipov, 1927) in the Eastern Black Sea. Iranian
Journal of Fisheries Science. 12(2), 277-288.
Anastasopoulou K., Saborido-Rey F. (2011). Reproductive ecology of Mullus barbatus in E.
Mediterranean Sea.Conference ―Fish reproduction and Fisheries‖. Vigo, Spain (16-20 May).
Cherif M., Zarrad R., Gharbi H., Missaoui H., Jarboui O. (2007). Some biological parameters of the
red mullet Mullus barbatus L., 1758, from the Gulf of Tunis. ACTA ADRIAT. 48(2), 131-
144.
Κάνθμο-Ρήβα Κ., Ακαζημπμφθμο Η., Καθαβηζά Μ. (2007). Δπίδναζδ ηςκ παναιέηνςκ αφλδζδξ ηαζ
εκδζζιυηδηαξ ζηδκ εηηίιδζδ ηδξ ηαηάζηαζδξ ημο απμεέιαημξ ηδξ ημοηζμιμφναξ. 13μ
Πακεθθήκζμ οκέδνζμ Ηπεομθυβςκ, Μοηζθήκδ.
Ozbilgin H., Tosunoglu Z., Bilecenoglou M., Tokac A. (2004). Population parameters of Mullus
barbatus in Izmir Bay (Aegean Sea), using length frequency analysis. J.Appl.Ichthyol. 20,
231-233.
Sieli G., Badalucco C., Di Stefano G., Rizzo P., D‘Anna G., Fiorentino F. (2011). Biology of red
mullet Mullus barbatus (L., 1758), in the Gulf of Castellammare (NW Sicily, Mediterranean
Sea) subject to a trawling ban. J.Appl.Ichthyolo. 27, 1218-1225.
Σζάιδξ Δ., Μοηζθδκαίμο Υ., Κααααδάξ . (2006???). φβηνζζδ αζμθμβζηχκ παναηηδνζζηζηχκ ηδξ
ημοηζμιμφναξ (Mullus barbatus L., 1758) ζηζξ εηθμνηχζεζξ ιδπακυηναηαξ ημο ανςκζημφ
Κυθπμο ηαζ ημο Ν.Α. Ημκίμο Πεθάβμοξ. 8μ Πακεθθήκζμ οιπυζζμ Χηεακμβναθίαξ & Αθζείαξ.
Tserpes G., Fiorentino F., Levi D., Cau A., Murenu M., Zamboni A.D.A., Papaconstantinou C.
(2002). Distribution of Mullus barbatus and M.surmuletus (Osteichthyes: Perciformes) in the
Mediterranean continental shelf: implications for management. Sci. Mar. 66 (Suppl. 2), 39-
54.
Moutopoulos D.K., Stergiou K.I. (2002). Length-weight and length length relationships of fish species
form the Aegean Sea (Greece). J.Appl.Ichthyol. 18, 200-203.
Vassilopoulou V., Papaconstantinou C. (1993). Feeding habits of red mullet (Mullus barbatus) in a
gulf in Western Greece. Fisheries Research 16, 69-83.
Vassilopoulou V., Papaconstantinou C. (1992). Aspects of the biology and dynamics of red mullet
(Mullus barbatus) in the Aegean Sea. FAO Fish. Rep. 477, 115-126.
Vrantzas N., Kalagia M., Karlou C. (1992). Age, growth and state of stock of red mullet (Mullus
barbatus L., 1758) in the Saronikos gulf of Greece. FAO Fisheries Report No 477, 51-67.
Papaconstantinou C., Tsimenidis N., Daoulas Ch. 1981. Age, growth and reproduction of red
mullet (Mullus barbatus L., 1758) in the gulfs of Saronikos and Thermaikos.
THALASSOGRAPHICA. Vol. 4, No. 1, 39-66.
270
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
In this work, the results from the study of the otolith microstructure in picarel (Spicara smaris) are
presented. In total, 30 otoliths from individuals with a total length (TL) ranging from 50 to 163 mm,
collected during the biological sampling of DCF national program 2013-2014 in Argosaronikos Gulf,
were examined. The otoliths were embedded in epoxic resin. After grinding and polishing them, the
thin readable sections of otoliths were photographed in optical microscope and then, the daily rings
were counted with the use of an Image analysis software. The daily readings ranged from 119 to 536
days. The S-curve model was the most adequate to describe the length - age relationship, based on the
R2 value, the parameters of the model were found to be a=5.435 and b=-175.916. The annual rings
seem to be formed between January and April. The annual rings were present on otoliths of specimens
with TL greater than 123 mm. The area that corresponded to the annuli was consisted of daily rings
having very narrow distances between them.
Keywords: Spicara smaris, Aegean Sea, otoliths, microstructure, daily rings
Coresponding author: Denaxa Maria (denaxam@hcmr.gr)
Πεξίιεςε
ηδκ πανμφζα ενβαζία πανμοζζάγμκηαζ ηα απμηεθέζιαηα ηδξ ελέηαζδξ ηδξ ιζηνμδμιήξ ημο ςημθίεμο
ηδξ ιανίδαξ (Spicara smaris L.). Χηυθζεμζ απυ 30 άημια ιανίδαξ ιε εφνμξ μθζημφ ιήημοξ απυ 50 mm
έςξ 163 mm πνμενπυιεκα απυ ηδ αζμθμβζηή δεζβιαημθδρία ημο ΔΠΑΓ 2013-2014 ζημκ
Ανβμζανςκζηυ ηυθπμ, εβηθείζεδηακ ζε επμλζηή νδηίκδ ηαζ ηαηυπζκ ηνζρίιαημξ ηαζ θείακζδξ
πνμέηορακ θεπηέξ ηάεεηεξ ημιέξ μζ μπμίεξ θςημβναθήεδηακ ιε μπηζηυ ιζηνμζηυπζμ ηαζ
ακαβκχζηδηακ ιε ηδ πνήζδ θμβζζιζημφ επελενβαζίαξ εζηυκςκ. Ζ ακάβκςζδ ηαζ ηαηαιέηνδζδ ηςκ
διενδζίςκ αολδηζηχκ δαηηοθίςκ έδεζλε δαηηοθίμοξ πμο ακηζζημζπμφζακ ζε 119 έςξ 536 διένεξ. Σμ
ζζβιμεζδέξ ιμκηέθμ (S-Curve) επζθέπεδηε βζα ηδ ζπέζδ ιήημοξ-δθζηίαξ ιε α = 5,435 ηαζ α = -175,916
ςξ αοηυ πμο έδςζε ημ ηαθφηενμ R2. Ο εηήζζμξ δαηηφθζμξ, πμο ηαοημπμζήεδηε ςξ ιζα πενζμπή ιε
διενήζζμοξ δαηηοθίμοξ πμθφ ιζηνμφ πάπμοξ, παναηδνήεδηε ζε άημια ιε μθζηυ ιήημξ υπζ ιζηνυηενμ
απυ 123 mm ηαζ μ ζπδιαηζζιυξ ημο θαίκεηαζ κα βίκεηαζ ιεηαλφ Ηακμοανίμο ηαζ Απνζθίμο.
Λέμεηο θιεηδηά: Spicara smaris, Αγαίν Πέιαγνο, σηόιηζνη, κηθξνδνκή, εκεξήζηνη δαθηύιηνη.
*οββναθέαξ επζημζκςκίαξ: Γεκαλά Μανία (denaxam@hcmr.gr)
1. Δηζαγσγή
Ζ ιεθέηδ ηδξ ιζηνμδμιήξ ηςκ ςημθίεςκ ακαπηφπεδηε ζηζξ ανπέξ ηδξ δεηαεηίαξ ημο ΄70 ηαζ
ζήιενα πνδζζιμπμζείηαζ εονέςξ ζε πθδεχνα ιεθεηχκ ηςκ πνχηςκ ζηαδίςκ γςήξ, δθζηίαξ,
271
HydroMedit 2014, November 13-15, Volos, Greece
3. Απνηειέζκαηα
Ο ανζειυξ ηςκ διενδζίςκ δαηηοθίςκ πμο ηαηαιεηνήεδηακ ζημ ζφκμθμ ηςκ δεζβιάηςκ πμο
ιεθεηήεδηακ ηοιαίκμκηακ απυ 119 (ζε άημιμ μθζημφ ιήημοξ TL=50mm) έςξ 536 (ζε άημιμ μθζημφ
ιήημοξ ιήημξ TL= 163mm) (Πίκαηαξ 1). Ζ εθανιμβή ημο ιμκηέθμο S-Curve ιεηαλφ ημο ιήημοξ ηαζ
ημο ανζειμφ ηςκ διενδζίςκ δαηηοθίςκ ηδξ ιανίδαξ πανμοζζάγεηαζ ζημ πήια 1. Οζ ζοκηεθεζηέξ ημο
ιμκηέθμο ήηακ α = 5,435 ηαζ α = -175,916. Ζ πενζμπή πμο εεςνήεδηε υηζ ακηζπνμζςπεφεζ ημκ πνχημ
εηήζζμ δαηηφθζμ, πενζμπή ιε διενήζζμοξ δαηηφθζμοξ ιζηνμφ πάπμοξ, ήηακ ειθακήξ ζηζξ εζηυκεξ εκκέα
ημιχκ ςημθίεςκ, δ δε απυζηαζδ ηδξ πενζμπήξ αοηήξ απυ ηδκ πενζθένεζα ημο ςημθίεμο, ζοκέπζπηε ιε
αοηήκ πμο ιεηνήεδηε βζα ημοξ εηήζζμοξ δαηηοθίμοξ ζηζξ εζηυκεξ ηδξ ιαηνμδμιήξ ηςκ ςημθίεςκ
(Δζηυκεξ 2, 3). Ζ ιέζδ απυζηαζδ ιεηαλφ ηςκ διενδζίςκ δαηηοθίςκ ζηδκ πενζμπή ημο πνχημο
εηδζίμο δαηηοθίμο ήηακ ιζηνυηενδ (1,777±0,0337) απυ αοηή ζηζξ εηαηένςεεκ αοημφ πενζμπέξ
(2,913±0,081) (Δζηυκα 4).
272
HydroMedit 2014, November 13-15, Volos, Greece
Πίλαθαο 1. Μήθε ησλ αηφκσλ καξίδαο κε ηνλ αξηζκφ ησλ εκεξψλ πνπ αλαγλψζζεθαλ ζηνπο
σηνιίζνπο ηνπο θαη ηελ παξνπζία εηήζηνπ δαθηπιίνπ.
ΣL(mm) Αν. Ζιεν. Γαηηφθζμξ Μήκαξ ζπδιαηζζιμφ ΣL(mm) Αν. Ζιεν. Γαηηφθζμξ Μήκαξ ζπδιαηζζιμφ
50 119 ΥΗ 103 171 ΥΗ
51 125 ΥΗ 110 229 ΥΗ
57 144 ΥΗ 110 229 ΥΗ
65 173 ΥΗ 111 168 ΥΗ
67 131 ΥΗ 113 250 ΥΗ
68 131 ΥΗ 113 264 ΥΗ
70 149 ΥΗ 123 258 ΝΑΗ 2μξ-3μξ
75 150 ΥΗ 124 280 ΝΑΗ 2μξ-3μξ
80 192 ΥΗ 131 432 ΝΑΗ 1μξ-2μξ
82 201 ΥΗ 138 331 ΝΑΗ 3μξ-4μξ
85 190 ΥΗ 140 341 ΝΑΗ 2μξ-4μξ
90 206 ΥΗ 145 414 ΝΑΗ 2μξ-3μξ
90 190 ΥΗ 153* 314 ΝΑΗ 1μξ-2μξ
90 211 ΥΗ 158 317 ΝΑΗ 2μξ-3μξ
102 219 ΥΗ 163* 536 ΝΑΗ 1μξ-2μξ
Ο πνχημξ εηήζζμξ δαηηφθζμξ θάκδηε κα ζπδιαηίγεηαζ ιεηά απυ 180 (εθάπζζημ) έςξ 372 (ιέβζζημ)
διενδζίμοξ δαηηοθίμοξ, μζ μπμίμζ ακηζζημζπμφκ ιε αάζδ ημ ιμκηέθμ S-Curve ζε μθζηυ ιήημξ 86,3 ηαζ
142,9 mm ακηζζημίπςξ. Ο ζπδιαηζζιυξ ημο θαίκεηαζ κα βίκεηαζ ιεηαλφ Ηακμοανίμο ηαζ Απνζθίμο,
υπςξ ανέεδηε απυ ηδκ ακηίζηνμθδ ιέηνδζδ ηςκ διενδζίςκ δαηηοθίςκ απυ ηδκ διενμιδκία
ζφθθδρδξ. Με αάζδ ημ ιμκηέθμ, άημια πμο έπμοκ ζπδιαηίζεζ 365 διενήζζμοξ δαηηοθίμοξ, δδθ.
έπμοκ ζοιπθδνχζεζ έκα διενμθμβζαηυ έημξ, ακηζζημζπμφκ ζε μθζηυ ιήημξ 141,7 mm. Σα άημια ιε
μθζηυ ιήημξ 153 mm ηαζ 163 mm, ειθάκζζακ δφμ πενζμπέξ ιε ποηκμφξ διενδζίμοξ δαηηοθίμοξ, μζ
μπμίεξ εεςνήεδηε υηζ ακηζζημζπμφκ ζε δφμ εηδζίμοξ δαηηοθίμοξ.
170
150
130
TL
110
90
70
50
0 100 200 300 400 500 600
DAYS
ρήκα 1. Γξαθηθή παξάζηαζε ηεο ζρέζεο κήθνπο ζψκαηνο-ειηθίαο ηεο καξίδαο ζηνλ
Αξγνζαξσληθφ θφιπν.
273
HydroMedit 2014, November 13-15, Volos, Greece
4. πδήηεζε
Σα απμηεθέζιαηα ηδξ πανμφζαξ ενβαζίαξ απμηεθμφκ έκδεζλδ υηζ δ ιανίδα είκαζ είδμξ
ηαπείαξ αφλδζδξ. Σα ιήηδ ζπδιαηζζιμφ ημο πνχημο εηήζζμο δαηηοθίμο είκαζ ιεβαθφηενα απυ αοηά
πμο έπμοκ δδιμζζεοηεί ζε άθθεξ ενβαζίεξ. Οζ Vidalis & Tsimenidis (1996) ανήηακ κα ζπδιαηίγεηαζ
ζηα 81 mm ιεζμοναίμο ιήημοξ, μζ Dulcic et al. (2003) ζηα 63mm μθζημφ ιήημοξ μζ Osman & Abdel
Barr (2007) ζηα 104 mm μθζημφ ιήημζοξ. Οζ Tsangridis & Filippousis, (1991, 1992) ανήηακ ζηα 139
mm ιέζμο μθζημφ ιήημοξ, ημκ πνχημ εηήζζμ δαηηφθζμ ηαζ ζηα 159 mm ημκ δεφηενμ εηήζζμ δαηηφθζμ,
ιεηνήζεζξ πμο πνμζεββίγμοκ ηαζ εκζζπφμοκ ηα απμηεθέζιαηα ηδξ πανμφζαξ ενβαζίαξ. Οζ δζαθμνέξ ιε
ηζξ ηνεζξ πνχηεξ ιεθέηεξ ιπμνεί κα μθείθμκηαζ ζε δζαθμνεηζηή ακάβκςζδ ηςκ ςημθίεςκ, δεδμιέκμο
υηζ οπάνπμοκ δφμ ιε ηνείξ δαηηφθζμζ πνζκ ημκ πνχημ εεςνμφιεκμ απυ ηδκ πανμφζα ενβαζία εηήζζμ
δαηηφθζμ, μζ μπμίμζ υιςξ ιάθθμκ ακηζπνμζςπεφμοκ αθθαβέξ ημο ηφηθμο ηδξ γςήξ ηδξ ιανίδαξ (π.π.
ιεηαιυνθςζδ, αθθαβή εκδζαζηήιαημξ, δζαηνμθήξ). Άθθμζ θυβμζ ζημοξ μπμίμοξ ιπμνεί κα μθείθμκηαζ
αοηέξ μζ δζαθμνέξ είκαζ μζ πενζααθθμκηζημί πανάβμκηεξ ηδξ ηάεε πενζμπήξ ιεθέηδξ.
Ο πνχημξ εηήζζμξ δαηηφθζμξ, ζφιθςκα ιε ηδκ πανμφζα ενβαζία, θαίκεηαζ κα ζπδιαηίγεηαζ
ιεηαλφ Ηακμοανίμο ηαζ Απνζθίμο, εκχ μζ Vidalis & Tsimenidis (1996) ανίζημοκ κα ζπδιαηίγεηαζ
ιεηαλφ Μανηίμο ηαζ Ημοθίμο. Σα απμηεθέζιαηα ηδξ πανμφζαξ ενβαζίαξ πνέπεζ κα επζαεααζςεμφκ ηαζ
απυ ηδ ιεθέηδ ηδξ ιζηνμδμιήξ ηςκ ςημθίεςκ επί πθέμκ αηυιςκ. Ακ μζ εκδείλεζξ βζα ηδκ αφλδζδ ηαζ
ηδκ δθζηία, πμο ιαξ πανέπμοκ ηα απμηεθέζιαηα ηδξ πανμφζαξ ενβαζίαξ επζαεααζςεμφκ, ηυηε εα
έπμοιε ίζςξ ιία δζαθμνεηζηή εζηυκα ηδξ αζμθμβίαξ ηδξ ιανίδαξ, πμο εα ιαξ αμδεήζεζ ζηδκ
πνμζπάεεζα εηηίιδζδξ ηαζ δζαπείνζζδξ ηςκ απμεειάηςκ ηδξ.
Δπραξηζηίεο
Οζ ζοββναθείξ εέθμοκ κα εηθνάζμοκ ηζξ εοπανζζηίεξ ημοξ ζηδκ Π.Ν. Λάιπνδ ηαζ ζημκ Ν. Ξεκηίδδ βζα
ηδκ αμήεεζα πμο ημοξ πνμζέθενακ ζηδκ επζιέθεζα ημο ηεζιέκμο ηαζ ζηδκ επελενβαζία ηςκ εζηυκςκ .
Βηβιηνγξαθία
Campana, S.e., and C.M. Jones. (1992). Analysis of otolith microstructure data, p. 73-100. In D.K.
Stevenson and S.E. Campana [ed.] Otolith microstructure examination and analysis. Can.
Spec. Publ. Fish. Aquat. Sci. 117.
274
HydroMedit 2014, November 13-15, Volos, Greece
Dulcic, J., Pallaoro, A., Cetinic, P., Kraljevic, M., Soldo, A., Jardas, I. (2003), Age, growth and
mortality of picarel, Spicara smaris L. (Pisces: Centracanthidae), from the eastern Adriatic
(Croatian coast) J. Appl. Ichthyol. 19 10–14
Kavadas, S., Damalas, D., Tserpes, G., Georgakarakos, E., Papaconstantinou, C., Maravelias, C.,
2012. IMAS-Fish - Integrated Management System to support the sustainability of Greek
fisheries resources. A multidisciplinary web-based database management system:
implementation, capabilities, utilization and future prospects for fisheries stakeholders.
Mediterranean Marine Science 14(1): 109-118.
Morales-Nin, B. (1992). Determination of growth in bony fishes from otolith microstructure FAO
Fisheries Technical Paper. No. 322. Rome, FAO.. 51p.
Osman, A.M., Abdel Barr, M. 2007. Biological studies of spicara smaris (teleostei Centracanthidae) in
Egyptian mediterranean waters. Proceedings of the 8th International Conference on the
Mediterranean Coastal Environment, MEDCOAST, vol 1 (2007), pp. 649-658
Tsangridis, A.; Filippousis, N., (1991). Use of length–frequency data in the estimation of growth
parameters of three Mediterranean fish species: bogue (Boops boops L.), picarel (Spicara
smaris L.) and horse mackerel (Trachurus trachurus L.). Fish. Res. 12, 283–297.
Tsangridis, A.; Filippousis, N., (1992). Growthpattern of picarel Spicara smaris (L.)
(Centracanthidae), a protognyous species. Cybium 3, 233–243.
Vidalis, K., (1994). Biology and population dynamics of the picarel (Spicara smaris, L. 1758) on the
Cretan Continental Shelf. PhD Thesis, Department of Biology, University of Crete, Greece.
257 pp. (in Greek with English abstract).
Vidalis, K.; Tsimenidis, N., (1996). Age determination and growth of picarel (Spicara smaris L.) from
the Cretan continental shelf (Greece). Fish. Res. 28, 395–421.
Whitehead, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J. and Tortonese, E., (1986). Fishes of the
North-Eastern Atlantic and the Mediterranean. Vol. II. UNESCO, Paris: 517-1007.
275
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
For the last five years, large quantities of needlefishes are caught in Thermaikos Gulf every summer.
Anglers call them vasilozarganes because of their large size. Apart from the common genus Belone,
three species of the genus Tylosurus have been also reported in the Mediterranean sea: the subspecies
Tylosurus acus imperialis and two rare lessepsian immigrants, T. crocodilus and T. choram. The
systematic analyses of the individuals caught in Thermaikos Gulf resulted to the identification of the
genus Tylosurus, but species discrimination is difficult. The aim of the present work was the
identification of the large sized individuals caught in Thermaikos Gulf. For this reason, the PCR and
sequencing analysis of the mitochondrial 16S rRNA gene was used, in parallel with the morphometric
and meristic anlysis. The PCR product was 600 bp and the analyzed nucleotide sequence of the 16S
rRNA gene was 558 bp. All of the studied individuals revealed the same haplotype which revealed a
99% percentage of maximum identity with T. acus imperialis (as revealed in the BLAST engine).
Results of the morphometric (indexes between body length and length of fins) and meristic (number
of finrays) analysis, confirm and reinforce the existence of T. acus imperialis individuals.
Key words: Tylosurus, 16S rRNA gene, genetic identification, meristic analysis, morphometric
analysis
Πεξίιεςε
Σα ηεθεοηαία πέκηε έηδ, ηάεε ηαθμηαίνζ ζημ Θενιασηυ ηυθπμ αθζεφμκηαζ ζε ιεβάθεξ πμζυηδηεξ
γανβάκεξ, πμο μζ ρανάδεξ ηζξ απμηαθμφκ ααζζθμγανβάκεξ ελαζηίαξ ημο ιεβάθμο ιεβέεμοξ ημοξ. ηδ
Μεζυβεζμ, εηηυξ απυ ηζξ ημζκέξ γανβάκεξ ημο βέκμοξ Belone, έπεζ ακαθενεεί ηαζ δ πανμοζία ηνζχκ
εζδχκ ημο βέκμοξ Tylosurus: ημ οπμείδμξ Tylosurus acus imperialis ηαζ δφμ θεζερζακμί ιεηακάζηεξ ιε
ζπάκζα ειθάκζζδ, ηα είδδ T. crocνdilus ηαζ T. choram. Απυ ηδ ιμνθμθμβζηή ελέηαζδ αηυιςκ πμο
αθζεφηδηακ ζημ Θενιασηυ ηυθπμ πνμέηορε υηζ ακήημοκ ζημ βέκμξ Σylosurus, αθθά δ δζάηνζζδ ημο
είδμοξ δεκ είκαζ εφημθδ. ηυπμξ ηδξ πανμφζαξ ενβαζίαξ ήηακ δ ηαοημπμίδζδ ηςκ ααζζθμγανβακχκ
ημο Θενιασημφ ηυθπμο. Γζα ημ ζημπυ αοηυ, έβζκε πνήζδ ηδξ αθοζζδςηήξ ακηίδναζδξ πμθοιενάζδξ
(PCR) ηαζ ηδξ ακάθοζδξ πνςημδζάηαλδξ ημο 16S rRNA ιζημπμκδνζαημφ βμκζδίμο, εκχ πανάθθδθα
276
HydroMedit 2014, November 13-15, Volos, Greece
ακαθφεδηακ ιενζημί ιμνθμιεηνζημί (δείηηεξ ζςιαηζημφ ιήημοξ ηαζ ιήημοξ πηενοβίςκ) ηαζ
ιενζζηζημί (ανζειυξ αηηίκςκ ηςκ πηενοβίςκ) παναηηήνεξ ηςκ δεζβιάηςκ. Σμ πνμσυκ ηδξ αθοζζδςηήξ
ακηίδναζδξ πμθοιενάζδξ ήηακ πενίπμο 600 γεφβδ αάζεςκ ηαζ δ αημθμοεία ημο ιζημπμκδνζαημφ
βμκζδίμο 16S rRNA πμο ακαθφεδηε ήηακ 558 γεφβδ αάζεςκ. θα ηα άημια είπακ ημκ ίδζμ απθυηοπμ,
μ μπμίμξ έδςζε έκα πμζμζηυ ιέβζζηδξ μιμζυηδηαξ 99% ιε ηo οπμείδoξ T. acus imperialis (ιδπακή
ακαγήηδζδξ BLAST). Δπίζδξ, ηα απμηεθέζιαηα ηδξ ιμνθμιεηνζηήξ ηαζ ιενζζηζηήξ ακάθοζδξ
επζαεααίςζακ ηαζ εκίζποζακ ηδκ φπανλδ αηυιςκ ημο οπμείδμοξ T. acus imperialis.
Λέξειρ κλειδιά: Tylosurus, γνλίδην16S rRNA, γελεηηθή ηαπηνπνίεζε, κεξηζηηθή αλάιπζε, κνξθνκεηξηθή
αλάιπζε
1. Δηζαγσγή
Δηηυξ απυ ηζξ ημζκέξ γανβάκεξ ημο βέκμοξ Belone, ζηδ Μεζυβεζμ έπμοκ ακαθενεεί ηαζ ηνία
είδδ ημο βέκμοξ Tylosurus: ημ είδμξ Tylosurus acus (Lacepède 1803) ηαζ δφμ θεζερζακμί ιεηακάζηεξ,
ημ είδμξ Tylosurus crocνdilus (Péron & Lesueur 1821) ηαζ ημ είδμξ Tylosurus choram (Rüppell 1837)
ιε πμθφ ζπάκζα ειθάκζζδ (Collete & Parin 1986, Sinis 2005).
Tμ είδμξ T. acus ειθακίγεζ ζε δζάθμνεξ βεςβναθζηέξ πενζμπέξ οπμείδδ υπςξ ημ T. acus acus
(Lacepède 1803) ζημ Γοηζηυ Αηθακηζηυ, ημ T. acus rafale (Collete & Parin 1970) ζημ Κυθπμ ηδξ
Γμοζκέαξ, ημ T. acus melanotus (Bleeker 1850) ζημκ Ηκδζηυ ηαζ ζημ Γοηζηυ Δζνδκζηυ Χηεακυ, ημ T.
acus pacificus (Steindachner 1876) ζημκ Ακαημθζηυ Δζνδκζηυ Χηεακυ ηαζ ημ T. acus imperialis
(Rafinesque 1810) ζηδ Μεζυβεζμ.
ηυπμξ ηδξ πανμφζαξ ενβαζίαξ είκαζ δ ηαοημπμίδζδ αηυιςκ ημο βέκμοξ Tylosurus, ηα μπμία
αθζεφηδηακ ζημ Θενιασηυ ηυθπμ. Γζα ημ θυβμ αοηυ έβζκε βεκεηζηή ακάθοζδ ιε ηδ πνήζδ ηδξ
αθοζζδςηήξ ακηίδναζδξ πμθοιενάζδξ (PCR) ηαζ ηδξ ακάθοζδξ πνςημδζάηαλδξ ημο ιζημπμκδνζαημφ
βμκζδίμο ημ μπμίμ ηςδζημπμζεί βζα ημ 16S νζαμζςιζηυ RNA (16S rRNA). Πανάθθδθα δζεκενβήεδηε
ιμνθμιεηνζηή ηαζ ιενζζηζηή ακάθοζδ ηςκ δεζβιάηςκ.
Αθζεφηδηακ 112 άημια ημο βέκμοξ Tylosurus (Δζηυκα 1) απυ επαββεθιαηίεξ ρανάδεξ ζηδ
πενζμπή ημο Θενιασημφ ηυθπμο, απυ ημκ Ημφκζμ ημο 2013 έςξ ημκ Ημφκζμ ημο 2014.
277
HydroMedit 2014, November 13-15, Volos, Greece
ημ ζφκμθμ ηςκ αηυιςκ έβζκε ιμνθμιεηνζηή ηαζ ιενζζηζηή ακάθοζδ ηαζ ηαηαβνάθδηακ
δζάθμνα βκςνίζιαηα, υπςξ ή πανμοζία ή ιδ αναβπζαηχκ αηακεχκ ηαζ ηανίκαξ ζηδ αάζδ ημο μοναίμο
ιίζπμο. οβηεηνζιέκα ζε ηάεε άημιμ ιεηνήεδηακ μ ανζειυξ ηςκ αηηίκςκ ζημ ναπζαίμ (D) ηαζ εδνζηυ
(A) πηενφβζμ, ηαεχξ ηαζ ζηα εςναηζηά (P) ηαζ ημζθζαηά (V) πηενφβζα. Δπίζδξ, εθήθεδ ημ ιήημξ υθςκ
ηςκ πηενοβίςκ απυ ηδ αάζδ ιέπνζ ηδκ άηνδ ημο. Σέθμξ, εηηζιήεδηακ μζ δείηηεξ (πδθίηα) ιεηαλφ ημο
ζςιαηζημφ ιήημοξ (BL) ηαζ ημο ιήημοξ ημο εςναηζημφ (BL/P), ημζθζαημφ (BL/V), ναπζαίμο (BL/D)
ηαζ εδνζημφ πηενοβίμο (BL/A), ηαεχξ ηαζ ημ πδθίημ ιεηαλφ ζςιαηζημφ ιήημοξ ηαζ ιήημοξ ηεθαθήξ
(BL/HL).
Δηθφλα 1. Μνξθνινγία αηφκνπ ηνπ ππνείδνπο Tylosurus acus imperialis πνπ αιηεχηεθε ζην
Θεξκατθφ θφιπν.
3. Απνηειέζκαηα
ηα άημια πμο ιεθεηήεδηακ, ημ μθζηυ ιήημξ (TL) ηοιάκεδηε απυ 59,3 έςξ 111,6 cm. Οζ
ηζιέξ ηςκ δεζηηχκ πμο εηηζιήεδηακ έπμοκ ςξ αημθμφεςξ: ημ πδθίημ BL/P ηοιάκεδηε απυ 8,3 έςξ
278
HydroMedit 2014, November 13-15, Volos, Greece
10,8, ημ πδθίημ BL/V ηοιάκεδηε απυ 10,9 έςξ 17,7, ημ πδθίημ BL/D ηοιάκεδηε απυ 10,5 έςξ 15,3,
ημ πδθίημ BL/A ηοιάκεδηε απυ 9,3 έςξ 14,3 ηαζ ημ πδθίημ BL/HL ηοιάκεδηε απυ 2,0 έςξ 2,8.
Δπίζδξ, ζημ ναπζαίμ πηενφβζμ ιεηνήεδηακ απυ 23 έςξ 26 αηηίκεξ (ζοκήεςξ 24) ηαζ ζημ εδνζηυ
πηενφβζμ ιεηνήεδηακ απυ 21 έςξ 23 αηηίκεξ (ζοκήεςξ 22).
4. πδήηεζε
Ακαθμνζηά ιε ημ βέκμξ Tylosurus, έπεζ ακαθενεεί ημ οπμείδμξ T. acus imperialis βεκζηά ζηδ
Μεζυβεζμ (Bauchot 1987, Collete & Parin 1986) ηαζ εζδζηά ζηδκ πενζμπή ημο Αζβαίμο (Bauchot 1987,
Akyol & Kara 2011, Türker Çakır & Zengin 2013). Τπάνπεζ ιζα ακαθμνά απυ ημ Βυνεζμ Αζβαίμ ημο
είδμοξ T. crocνdilus (Sinis 2005), αθθά δζαηδνμφιε ιεβάθεξ επζθοθάλεζξ ηαεχξ δε ζοκμδεφεηαζ απυ
βεκεηζηή ακάθοζδ ηαζ δ ηεηιδνίςζδ ιε ηδ πνήζδ ιενζζηζηχκ ηαζ ιμνθμιεηνζηχκ παναηηδνζζηζηχκ
είκαζ εθθζπήξ ηαζ ακηζθαηζηή. Σμ είδμξ T. choram είκαζ θεζερζακυξ ιεηακάζηδξ πμο ειθακίζηδηε ζηδ
Μεζυβεζμ, αθθά δεκ οπάνπμοκ ακαθμνέξ ζημ Αζβαίμ ηαζ πενζμνίγεηαζ πνμξ ημ πανυκ ζηδκ
Νμηζμακαημθζηή Μεζυβεζμ (Bauchot 1987).
Σα απμηεθέζιαηα ηδξ βεκεηζηήξ ακάθοζδξ δδθχκμοκ υηζ ηα άημια ημο βέκμοξ Tylosurus πμο
αθζεφηδηακ ζημ Θενιασηυ Κυθπμ ακήημοκ ζημ οπμείδμξ T. acus imperialis. Σα απμηεθέζιαηα απυ ηδ
βεκεηζηή ακάθοζδ ζοιθςκμφκ ηαζ ιε αοηά πμο πνμηφπημοκ απυ ηδ ιμνθμθμβζηή ακάθοζδ ηςκ
αηυιςκ. Ακαθοηζηυηενα:
Tα άημια ηδξ πανμφζαξ ιεθέηδξ δε είκαζ πζεακυ κα ακήημοκ ζηα είδδ Belone belone ηαζ
Belone svetovidovi, ηαεχξ ηα ελεηαγυιεκα δείβιαηα δε δζέεεηακ αναβπζαηέξ άηακεεξ ηαζ
έθενακ ιζα ιζηνή επζιήηδ ιαφνδ ηανίκα ζηδ αάζδ ημο μοναίμο ιίζπμο, παναηηδνζζηζηά
βκςνίζιαηα ημο βέκμοξ Tylosurus. Δπίζδξ ηα άημια πμο ιεθεηήεδηακ ήηακ εοιεβέεδ, απυ 60
έςξ 106 εη. (SL), εκχ ηα άημια ημο είδμοξ B. belone ηοιαίκμκηαζ απυ 30 έςξ 60 εη. (SL) ηαζ
θηάκμοκ ιέπνζ ηα 90 εη. (SL) ηαζ ηα άημια ημο είδμοξ B. svetovidovi είκαζ αηυιδ ιζηνυηενμο
ιεβέεμοξ ηαεχξ δεκ λεπενκμφκ ηα 57 εη. (SL).
Tα άημια ηδξ πανμφζαξ ιεθέηδξ δε είκαζ πζεακυ κα ακήημοκ ζημ είδμξ T. choram ηαεχξ ηα
άημια αοημφ ημο είδμοξ δεκ λεπενκμφκ ηα 70 εη. SL, εκχ ηα δείβιαηα ιαξ θεάκμοκ ιέπνζ ημ
ιήημξ ηςκ 106,3 εη. SL. ημ είδμξ T. choram ηα εςναηζηά ηαζ ημζθζαηά πηενφβζα είκαζ ζπεηζηά
επζιήηδ, ηαζ ημ πδθίημ BL/P ηοιαίκεηαζ απυ 6,6 έςξ 8,3 εκχ ημ πδθίημ BL/V ηοιαίκεηαζ απυ
7,9 έςξ 10,6 (Collette 1984, Bauchot 1987). ηα δείβιαηα πμο ιεθεηήζαιε ημ πδθίημ BL/P
ηοιαίκεηαζ απυ 8,3 έςξ 10,8 ηαζ ημ πδθίημ BL/V ηοιαίκεηαζ απυ 10,9 έςξ 17,7, ηζιέξ
πανυιμζεξ ιε αοηέξ (BL/P = 8,0 - 12,4 ηαζ BL/V = 10,0 - 14) βζα ημ οπμείδμξ T. acus imperialis
(Collette 1984, Bauchot 1987). Δπίζδξ, ζημ είδμξ T. choram ημ ναπζαίμ ηαζ ημ εδνζηυ πηενφβζμ
είκαζ ζπεηζηά επζιήηδ ηαζ ζε ζπέζδ ιε ημ ιήημξ ημο ζχιαημξ (BL), ημ πδθίημ BL/D ηοιαίκεηαζ
απυ 5,4 έςξ 10,6 ηαζ ημ πδθίημ BL/A ηοιαίκεηαζ απυ 5,5 έςξ 8. ηα δείβιαηα ιαξ, ημ πδθίημ
BL/D ηοιαίκεηαζ απυ 10,5 έςξ 15,3 ηαζ ημ πδθίημ BL/A ηοιαίκεηαζ απυ 9,3 έςξ 14,3, ηζιέξ
πανυιμζεξ (BL/D = 10,5-13,3 ηαζ BL/A = 9,7-11,7) ιε αοηέξ βζα ημ οπμείδμξ T. acus imperialis
(Collette 1984, Bauchot 1987). Σέθμξ, ζημ είδμξ T. choram μζ αηηίκεξ ημο ναπζαίμο πηενοβίμο
ηοιαίκμκηαζ απυ 19 έςξ 24 ηαζ ημο εδνζημφ απυ 19 έςξ 22. Ακηίεεηα, ζημ οπμείδμξ T. acus
imperialis μζ αηηίκεξ ημο ναπζαίμο ηαζ ημο εδνζημφ πηενοβίμο είκαζ πενζζζυηενεξ (απυ 20 έςξ
26 ηαζ απυ 20 έςξ 24 ακηίζημζπα) (Tortonese 1970, Collette 1984, Collette & Parin 1986). ηα
δείβιαηα ιαξ ιεηνήεδηακ απυ 23 έςξ 26 αηηίκεξ (ζοκήεςξ 24) ζημ ναπζαίμ πηενφβζμ ηαζ απυ
21 έςξ 23 (ζοκήεςξ 22) ζημ εδνζηυ πηενφβζμ, ηζιέξ πανυιμζεξ ιε αοηέξ πμο ακαθένμκηαζ βζα
ημ οπμείδμξ T. acus imperialis.
Tα δείβιαηα ιαξ δε είκαζ πζεακυ κα ακήημοκ ζημ είδμξ T. crocνdilus. Δίκαζ παναηηδνζζηζηυ υηζ
ζημ ζοβηεηνζιέκμ είδμξ είκαζ ακεπηοβιέκμζ ηαζ μζ δφμ θμαμί ηδξ βμκάδαξ, ιε ηδ δελζά βμκάδα
κα είκαζ πζμ επζιήηδξ απυ ηδκ ανζζηενή (Collette 1984). ηα δείβιαηα πμο ιεθεηήζαιε ήηακ
ακεπηοβιέκμξ ιυκμ μ δελζυξ θμαυξ ηδξ βμκάδαξ ηαζ ζηα δφμ θφθα, παναηηδνζζηζηυ ημο
οπμείδμοξ T. acus imperialis (Collette 1984, Bauchot 1987). Δπίζδξ, ζημ είδμξ T. crocνdilus μζ
αηηίκεξ ημο ναπζαίμο πηενοβίμο ηοιαίκμκηαζ απυ 21 έςξ 23 ηαζ ημο εδνζημφ απυ 18 έςξ 22.
ηα δείβιαηα ιαξ ιεηνήεδηακ απυ 23 έςξ 26 αηηίκεξ (ζοκήεςξ 24) ζημ ναπζαίμ πηενφβζμ ηαζ
απυ 21 έςξ 23 (ζοκήεςξ 22) ζημ εδνζηυ, ηζιέξ πμο οπμδδθχκμοκ ημ οπμείδμξ T. acus
imperialis. Σέθμξ, ηα δφμ είδδ δζαθένμοκ ηαζ ζηα πδθίηα BL/D, BL/A, BL/P ηαζ BL/V. ημ
279
HydroMedit 2014, November 13-15, Volos, Greece
είδμξ T. crocodilus, ημ πδθίημ BL/D ηοιαίκεηαζ απυ 5,4 έςξ 10,6 ηαζ ημ πδθίημ BL/A
ηοιαίκεηαζ απυ 5,5 έςξ 8. Οζ ηζιέξ ηςκ δφμ πδθίηςκ ζηα δείβιαηά ιαξ (10,5 έςξ 15,3 βζα ημ
BL/D ηαζ 9,3 έςξ 14,3 βζα ημ BL/A) είκαζ πμθφ ιεβαθφηενεξ απυ ηζξ πνμακαθενεείζεξ βζα ημ
είδμξ T. crocodilus, ηαζ ακηζζημζπμφκ ζε αοηέξ πμο έπμοκ ακαθενεεί βζα ημ οπμείδμξ T. acus
imperialis. Δπίζδξ, ζημ είδμξ T. crocodilus μζ ηζιέξ ηςκ πδθίηςκ BL/P (απυ 6,6 έςξ 8,3) ηαζ
BL/V (απυ 7,3 έςξ 10,6) είκαζ πμθφ ιζηνυηενεξ απυ αοηέξ ζηα δείβιαηά ιαξ ηαζ μζ μπμίεξ
ακηζζημζπμφκ ζε αοηέξ πμο έπμοκ ακαθενεεί βζα ημ οπμείδμξ T. acus imperialis (Collette 1984,
Bauchot 1987).
οιπεναζιαηζηά θμζπυκ, θαιαάκμκηαξ οπυρδ ηα απμηεθέζιαηα ηδξ βεκεηζηήξ
ακάθοζδξ αθθά ηαζ αοηά ηδξ ακάθοζδξ ηςκ ιενζζηζηχκ ηαζ ιμνθμιεηνζηχκ βκςνζζιάηςκ,
ηαηαθήβμοιε ζημ ζοιπέναζια ηδξ πανμοζίαξ ημο οπμείδμοξ T. acus imperialis ζημ Θενιασηυ
Κυθπμ.
Βηβιηνγξαθία
Akyol O., Kara A. (2011). Occurrence of Tylosurus acus imperialis (Rafinesque, 1810) (Osteichthyes:
Belonidae) in the northern Aegean Sea. Journal of Applied Ichthyology 27, 1396.
Banford H.M., Bermingham E., Collette B.B. (2004). Molecular phylogenetics and biogeography of
transisthmian and amphi-Atlantic needlefishes (Belonidae: Strongylura and Tylosurus):
perspectives on New World marine speciation. Molecular Phylogenetics and Evolution 31,
833-851.
Bauchot M.-L. (1987). Poissons osseux. In: ''Fiches FAO d'identification pour les besoins de la pêche.
(rev. 1), Méditerranée et mer Noire. Zone de pêche 37. Vol. II.'', Fischer W., Bauchot M.L.,
Schneider M. (eds). Commission des Communautés Européennes and FAO Rome, p. 891-
1421.
Collette B.B. (1984). Belonidae. In: ''FAO species identification sheets for fishery purposes. Western
Indian Ocean; (Fishing Area 51)'', Fischer W., Bianchi G. (eds). Prepared and printed with
the support of the Danish International Development Agency (DANIDA). Food and
Agricultural Organization of the United Nations Rome, Vols 1-6, pag. var.
Collette B.B., Parin N.V. (1986). Belonidae. In: ''Fishes of the north-eastern Atlantic and the
Mediterranean'', Whitehead P.J.P., Bauchot M.-L., Hureau J.-C., Nielsen J., Tortonese E.
(eds). UNESCO Paris, Vol. 2., p. 604-609.
Hall T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95-98.
Hillis D.M., Moritz C., Mable B.K. (1996). Molecular Systematics. Sunderland, MA: Sinauer &
Associates Inc., pp. 655.
Lovejoy N.R. (2000). Reinterpreting recapitulation: systematics of needlefishes and their allies
(Teleostei: Beloniformes). Evolution 54(4), 1349-1362.
Palumbi S.R. (1996). Nucleic acids II: The polymerase chain reaction. In: "Molecular Systematics",
Hillis D.M., Moritz C., Mable B.K. (eds). Sunderland, MA: Sinauer & Associates Inc., p.
205247.
Sinis A. (2005). First record of Tylosurus crocodilus (Péron & Lesueur 1821) (Pisces: Belonidae) in
the Mediterranean (North Aegean Sea, Greece). Journal of Biological Research 4, 221-224.
Thompson J.D., Gibson T.J., Plewniak F., Jeanmougin F., Higgins D.G. (1997). The CLUSTAL X
windows interface: Flexible strategies for multiple alignment aided by quality analysis tool.
Nucleic Acids Research 25, 4876-4882.
280
HydroMedit 2014, November 13-15, Volos, Greece
Tortonese E. (1970). Fauna d‘Italia. Osteichthyes. Vol X. Calderini. Bologna, Italy, pp. 636
Türker Çakır D., Zengin K. (2013). Occurrence of Tylosurus acus imperialis (Rafinesque, 1810)
(Osteichthyes: Belonidae) in Edremit Bay (Northern Aegean Sea). Journal of Applied
Ichthyology 29, 671–672.
281
HydroMedit 2014, November 13-15, Volos, Greece
1
Hellenic Centre for Marine Research, Institute of Marine Biological Resources and Inland Waters,
19013, Anavissos, Attica, Greece
2
Fisheries Research Institute, 64007, N. Peramos, Kavala, Greece
ABSTRACT
Age and growth of European hake (Merluccius merluccius) in the Aegean and Ionian Sea were
studied within DCF Program in 2013. Length-frequency distribution, weight-length relationship and
length-otolith radius relationship were examined. Age was estimated by means of annual rings. 7 age
groups in the Aegean and 6 age groups in the Ionian Sea were identified for individuals with length
ranging between 71-730 mm and 116-680 mm, respectively. Von Bertalanffy growth parameters (L∞,
k, t0) were calculated for both areas and found to be statistically different (p<0.001). Back-calculated
lengths-at-age were resulted higher in Aegean than in Ionian Sea for all the age groups. Our results
defend the fast growth hypothesis of hake in the Mediterranean.
Πεξίιεςε
Ζ ιεθέηδ ηδξ δθζηίαξ ηαζ αφλδζδξ ημο εονςπασημφ ιπαηαθζάνμο (Merluccius merluccius) ζημ Αζβαίμ
ηαζ Ηυκζμ Πέθαβμξ, ααζίζηδηε ζε δείβιαηα απυ ημ Δεκζηυ Πνυβναιια οθθμβήξ Αθζεοηζηχκ
Γεδμιέκςκ ημο 2013. Μεθεηήεδηακ δ ηαηά ιήημξ ζφκεεζδ, δ ζπέζδ αάνμοξ-ιήημοξ, δ ζπέζδ ιήημοξ
ζχιαημξ-αηηίκαξ ςημθίεμο, δ δθζηία ιέζς ηδξ ακάβκςζδξ ηςκ εηδζίςκ δαηηοθίςκ ηαζ μζ πανάιεηνμζ
αφλδζδξ. Γζα άημια ιε ιήημξ 71-730 mm ηαζ 116-680 mm πνμζδζμνίζηδηακ 7 δθζηζαηέξ ηθάζεζξ ζημ
Αζβαίμ ηαζ 6 δθζηζαηέξ ηθάζεζξ ζημ Ηυκζμ, ακηίζημζπα. Γζα ηδ ιεθέηδ ηδξ αφλδζδξ οπμθμβίζηδηακ μζ
πανάιεηνμζ (L∞, k, t0) ημο εηεεηζημφ ιμκηέθμο von Bertalanffy ηαζ βζα ηζξ δφμ πενζμπέξ, μζ μπμίεξ
ανέεδηακ κα δζαθένμοκ ζηαηζζηζηά ζδιακηζηά (p<0.001). Σα οπμθμβζζιέκα ιέζα ακαδνμιζηά ιήηδ
ηάεε δθζηίαξ ήηακ ιεβαθφηενα ζημ Αζβαίμ απ‘ υηζ ζημ Ηυκζμ βζα υθεξ ηζξ δθζηίεξ. Σα απμηεθέζιαηα
ηδξ ενβαζίαξ εκζζπφμοκ ημ ιμκηέθμ βνήβμνδξ αφλδζδξ ημο ιπαηαθζάνμο ζηδ Μεζυβεζμ.
Λέμεηο θιεηδηά: Merluccius merluccius, ειηθία, σηόιηζνο, αύμεζε, Μεζόγεηνο
*οββναθέαξ επζημζκςκίαξ: Παηημφνα Φςηεζάκα (photianap@hcmr.gr)
1. Δηζαγσγή
Ο εονςπασηυξ ιπαηαθζάνμξ Merluccius merluccius, είκαζ έκα εονέςξ δζαδεδμιέκμ είδμξ ζηδ
Μεζυβεζμ ηαζ ημ κμηζμακαημθζηυ Αηθακηζηυ, πνςηανπζηήξ ζδιαζίαξ ηυζμ βζα ηα εαθάζζζα
μζημζοζηήιαηα υζμ ηαζ βζα ηδκ αθζεία ζηζξ εκ θυβς πενζμπέξ. Ζ εκηαηζηή αθίεοζδ ημο ιπαηαθζάνμο
απυ δζαθμνεηζηά αθζεοηζηά ενβαθεία ζηδ δοηζηή αθθά ηαζ ηδκ ακαημθζηή Μεζυβεζμ (Papaconstantinou
& Stergiou 1995; Belcari et al. 2006) πνμηαθεί έκημκδ ακδζοπία βζα ηδκ ηαηάζηαζδ ηςκ απμεειάηςκ
ημο είδμοξ, ηαεζζηχκηαξ αηυια ιεβαθφηενδ ηδκ ακάβηδ βζα ιεθέηδ ηςκ αζμθμβζηχκ παναιέηνςκ
282
HydroMedit 2014, November 13-15, Volos, Greece
υπςξ δ αφλδζδ ηαζ δ βεκκδηζηή ςνζιυηδηα (Morales-Nin et al. 2005). Πανά ηζξ πμθθέξ πνμζπάεεζεξ
πμο έπμοκ βίκεζ εδχ ηαζ ανηεηά πνυκζα βζα κα εηηζιδεεί δ δθζηία ημο ιπαηαθζάνμο, δ ενιδκεία ηςκ
πνμηφπςκ ιαηνμδμιήξ ηςκ ςημθίεςκ ημο είκαζ αιθζθεβυιεκδ ηαζ ααέααζδ υζμκ αθμνά ηδκ
αλζμπζζηία ημο πνμζδζμνζζιμφ ηδξ δθζηίαξ (Piñeiro et al. 2007; ICES 2010).
Ακηζηείιεκμ ηδξ πανμφζαξ ενβαζίαξ είκαζ δ ιεθέηδ ηδξ ζπέζδξ αάνμοξ-ιήημοξ, ηδξ δθζηίαξ
ηαζ ηδξ αφλδζδξ ημο ιπαηαθζάνμο ζημ Αζβαίμ ηαζ Ηυκζμ Πέθαβμξ, ζφιθςκα ιε ηζξ μδδβίεξ πμο
δυεδηακ βζα ηδ αεθηίςζδ ηδξ ακάβκςζδξ ηδξ δθζηίαξ ημο ιπαηαθζάνμο απυ δζεεκή επζζηδιμκζηή
μιάδα, θαιαάκμκηαξ οπυρδ ηα απμηεθέζιαηα εηηίιδζδξ ηδξ δθζηίαξ ζε άημια πμο ζοιιεηείπακ ζε
πεζνάιαηα ιανηανίζιαημξ (ICES 2010).
3. Απνηειέζκαηα
Ζ ηαηά ιήημξ ζφκεεζδ ημο ιπαηαθζάνμο ζημ Αζβαίμ ηαζ Ηυκζμ ηοιάκεδηε ιεηαλφ 100-779
mm ηαζ 60-819 mm, ακηίζημζπα. Σμ εφνμξ ιήημοξ πμο παναηδνήεδηε βζα ημ ιεβαθφηενμ ιένμξ ηςκ
αηυιςκ ηαζ ζηζξ δφμ πενζμπέξ ηοιάκεδηε ιεηαλφ 160-340 mm (πήια 1).
20.00%
Αφθονία (%)
15.00%
10.00%
5.00% Αιγαίο
0.00%
Ιόνιο
60 120 160 200 240 280 320 360 400 440 480 520 560 600 640 680 720 760 800
Κλάςεισ μήκουσ (mm)
ρήκα 1. Καηά κήθνο ζχλζεζε ηνπ επξσπατθνχ κπαθαιηάξνπ Merluccius merluccius ζην Αηγαίν
θαη Ηφλην Πέιαγνο (Δζληθφ Πξφγξακκα πιινγήο Αιηεπηηθψλ Γεδνκέλσλ 2013)
283
HydroMedit 2014, November 13-15, Volos, Greece
Ζ αφλδζδ ημο αάνμοξ ιε ημ μθζηυ ιήημξ ημο ιπαηαθζάνμο ζημ Αζβαίμ πενζβνάθεηαζ απυ ημ
ιμκηέθμ W=0.000002TL3.2691, (R2=0.9975, N=129) εκχ βζα ημκ ιπαηαθζάνμ ημο Ημκίμο απυ ημ
ιμκηέθμ W=0.000001TL3.2798, (R2=0.9968, N=140). Ζ ζφβηνζζδ ηςκ ζπέζεςκ ηςκ δφμ πενζμπχκ
έδεζλε υηζ δεκ οπάνπεζ ζηαηζζηζηά ζδιακηζηή δζαθμνά ιεηαλφ ηςκ ημιχκ (p=0.07) ηαζ ηςκ ηθίζεςκ
ημοξ (p=0.24) ηαζ βζ‘ αοηυ ημ θυβμ οπμθμβίζηδηε ιζα ημζκή ζοζπέηζζδ W=0.000001TL3.2744,
(R2=0.9971, N=265).
ημ Αζβαίμ Πέθαβμξ εηηζιήεδηακ 7 δθζηζαηέξ μιάδεξ απυ 0+ έςξ 6+ (0.5 έςξ 6.9 έηδ) εκχ
ζημ Ηυκζμ 6 δθζηζαηέξ μιάδεξ απυ 0+ έςξ 5+ (0.9 έςξ 5.9 έηδ).
Ζ ζπέζδ ιήημοξ ζχιαημξ-αηηίκαξ ςημθίεμο (TL=aRb) βζα ημ Αζβαίμ ήηακ TL=43.17R1.11
(R =99.05, Ν=290) εκχ βζα ημ Ηυκζμ TL=42.08R1.11 (R =98.87, Ν=144). Ζ ζφβηνζζδ ηςκ βναιιχκ
2 2
παθζκδνυιδζδξ ηςκ δφμ πενζμπχκ έδεζλε υηζ μζ δφμ εοεείεξ δε δζαθένμοκ ζδιακηζηά μφηε ςξ πνμξ ηζξ
ημιέξ (p=0.19) μφηε ςξ πνμξ ηζξ ηθίζεζξ (p=0.84) ηαζ βζ‘ αοηυ οπμθμβίζηδηε ιζα ημζκή ζοζπέηζζδ
TL=42.93R1.10 (R =99.00, Ν=435).
2
Οζ ηζιέξ ηςκ ιέζςκ ακαδνμιζηχκ ιδηχκ πμο οπμθμβίζηδηακ βζα ηάεε εηήζζμ δαηηφθζμ ηςκ
ςημθίεςκ απυ ηα δείβιαηα Αζβαίμο ηαζ Ημκίμο πεθάβμοξ πανμοζζάγμκηαζ ζημκ Πίκαηα 1. Οζ ηζιέξ
αοηέξ ήηακ ιεβαθφηενεξ βζα ηα άημια ημο Αζβαίμο απ‘ υηζ ημο Ημκίμο.
Πίλαθαο 1. Μέζα αλαδξνκηθά κήθε (TL, mm) θάζε ειηθίαο γηα ηνλ επξσπατθφ κπαθαιηάξν
(Merluccius merluccius) ζην Αηγαίν θαη Ηφλην Πέιαγνο
Ακαδνμιζηά ιήηδ
Ζθζηία Αζβαίμ Ηυκζμ
1 265.4 242.3
2 378.5 355.6
3 479.2 449.5
4 560.0 537.9
5 623.3 614.0
6 644.2
Πίλαθαο 2. Παξάκεηξνη αχμεζεο θαη ηηκέο Φ΄ γηα ην κνληέιν von Bertalanffy γηα ην Αηγαίν θαη
ην Ηφλην
Πενζμπή L∞ (mm) k t0 N R2 Φ΄
284
HydroMedit 2014, November 13-15, Volos, Greece
αημθμοεήεδηακ βζα ημκ πνμζδζμνζζιυ ηςκ «πεζιενζκχκ» δαηηοθίςκ. Ακαηνέπμκηαξ ζηδκ οπάνπμοζα
αζαθζμβναθία βζα ηδκ δθζηία ηαζ ηδκ αφλδζδ ημο εονςπασημφ ιπαηαθζάνμο, παναηδνεί ηακείξ ηδκ
αζοιθςκία πμο οπάνπεζ ζηδκ ενιδκεία ηςκ πνμηφπςκ ηςκ "εηδζίςκ" δαηηοθίςκ ηαζ ηαηά ζοκέπεζα
ζηζξ εηηζιήζεζξ ημο ιήημοξ ακά δθζηία (Piñeiro & Sainza 2003). Δζδζηυηενα βζα ηδ Μεζυβεζμ, ζε
ιπαηαθζάνμοξ απυ ηδ αυνεζα Σοννδκζηή εάθαζζα ακαθένμκηαζ 14 δθζηζαηέξ ηθάζεζξ ιε ιέβζζηδ
δθζηία ηα 13 έηδ βζα έκα άημιμ ιε μθζηυ ιήημξ 910 mm (Ligas et al. 2011). Οζ πανάιεηνμζ αφλδζδξ
πμο πνμζδζμνίζηδηακ ζηδκ εκ θυβς ενβαζία πθδζζάγμοκ ηδκ ηζιή L∞ πμο οπμθμβίζηδηε βζα ημ
δείβια ιπαηαθζάνμο απυ ημ Αζβαίμ εκχ δ ηζιή ημο k είκαζ ανηεηά ιζηνυηενδ, πθδζζέζηενδ ζ΄αοηή
πμο εηηζιήεδηε βζα ημοξ ιπαηαθζάνμοξ ημο Ημκίμο (Πίκαηαξ 3). Σμ ίδζμ ζζπφεζ ηαζ βζα ημ δείβια
ιπαηαθζάνμο πμο ιεθεηήεδηε ζημκ ηυθπμ ηδξ ιφνκδξ (Uçkun et al. 2006) ιε πμθφ ιζηνυ αοηή ηδ
θμνά νοειυ αφλδζδξ (Πίκαηαξ 3). Ζ ιεβαθφηενδ ηζιή ημο k πμο εηηζιήεδηε ζηδκ πανμφζα ενβαζία
βζα ημ Αζβαίμ ζπεηίγεηαζ ιε ημ υηζ ημ δείβια πμο ελεηάζηδηε πενζθάιαακε εθάπζζηα άημια ιε μθζηυ
ιήημξ άκς ηςκ 400 mm εκχ ζηα δείβιαηα πμο ακαθφεδηακ ζηζξ πνμακαθενεείζεξ ενβαζίεξ
ζοιιεηείπακ ανηεηά ιεβάθα άημια, ηα μπμία ζοκεζζθένμοκ ζηδ ιείςζδ ημο ιέζμο νοειμφ αφλδζδξ.
Σζιή k ακάθμβδ ιε αοηή πμο εηηζιήεδηε βζα ημ Αζβαίμ, οπμθμβίζηδηε απυ ημοξ García-Rodríguez ηαζ
Esteban (2002) βζα ημ ιπαηαθζάνμ ζηδ δοηζηή Μεζυβεζμ ιε ακάθοζδ ηςκ ηαηά ιήημξ ζοκεέζεςκ ηςκ
εηθμνηχζεςκ 1992-1998 ζε ζοκδοαζιυ ιε ακάβκςζδ ςημθίεςκ, εεςνχκηαξ υπςξ ηαζ ζηδκ πανμφζα
ιεθέηδ, υηζ ζημοξ ςημθίεμοξ ημο ιπαηαθζάνμο ζπδιαηίγμκηαζ 2 δαηηφθζμζ ακά έημξ. Πανάβμκηεξ
υπςξ μ ζπδιαηζζιυξ ρεοδμ-δαηηοθίςκ ηαζ δ παναηεηαιέκδ ακαπαναβςβζηή πενίμδμξ ζοκεζζθένμοκ
ζηζξ δζαθςκίεξ πμο ειθακίγμκηαζ ηαηά ηδκ ακάβκςζδ ηςκ ςημθίεςκ (Casey & Pereiro 1995).
Σα ιέζα ακαδνμιζηά ιήηδ ηάεε δθζηίαξ πμο οπμθμβίζηδηακ ζηδκ πανμφζα ενβαζία, είκαζ
ανηεηά ιεβαθφηενα απυ ηα ακηίζημζπα πμο πνμζδζμνίζηδηακ απυ ημοξ Ligas et al. (2011). Οζ ίδζμζ
ζοββναθείξ ακαθένμοκ πςξ δ εηηίιδζδ ηδξ δθζηίαξ ηαζ ηα ηνζηήνζα πμο πνδζζιμπμζμφκηαζ βζ αοηήκ,
επζηνέπμοκ ηδκ ακάβκςζδ ηςκ δαηηοθίςκ ζε ςημθίεμοξ αηυιςκ ιέπνζ 500 mm, εκχ πένακ αοημφ ημο
ιήημοξ δ δζαδζηαζία ακάβκςζδξ βίκεηαζ αδφκαηδ θυβς ηςκ πμθθχκ ρεοδμ-δαηηοθίςκ ηαζ ηδξ
ιείςζδξ ημο πάπμοξ ηςκ εηδζίςκ δαηηοθίςκ.
Πίλαθαο 3. Παξάκεηξνη αχμεζεο θαη ηηκέο Φ΄ γηα ην κνληέιν von Bertalanffy, απφ δηαθνξεηηθέο
εξγαζίεο
οββναθείξ L∞ (mm) k Φ'
García-Rodríguez ηαζ Esteban, 2002 1080.0 0.21 3.39
Piñeiro ηαζ Sainza, 2003 880.0 0.13 3.00
Uçkun et al., 2006 894.6 0.07 2.75
Ligas et al., 2011 907.0 0.13 3.03
Ο δείηηδξ Φ' παίνκεζ πανυιμζεξ ηζιέξ βζα ημοξ ιπαηαθζάνμοξ απυ Αζβαίμ ηαζ Ηυκζμ υηακ οπμθμβίγεηαζ
απυ ημ ιμκηέθμ von Bertalanffy ιε αάζδ είηε ηζξ παναηδνμφιεκεξ ηζιέξ μθζημφ ιήημοξ είηε αοηέξ πμο
εηηζιήεδηακ ιε ακάδνμιμ οπμθμβζζιυ (Πίκαηαξ 2). Οζ ηζιέξ ημο Φ' πμο έπμοκ οπμθμβζζηεί ζε
πνμδβμφιεκεξ ενβαζίεξ ιε αάζδ ηδκ ακάβκςζδ ςημθίεςκ ή ηδκ ακάθοζδ πενζμδζηχκ ηαηά ιήημξ
ζοκεέζεςκ ηςκ πθδεοζιχκ ημο ιπαηαθζάνμο είκαζ ζπεηζηά ιζηνυηενεξ, ιε ιμκαδζηή ελαίνεζδ ηδκ
ορδθυηενδ ηζιή πμο εηηζιήεδηε απυ ημοξ García-Rodríguez ηαζ Esteban (2002). Αλίγεζ κα ζδιεζςεεί
υηζ ορδθέξ ηζιέξ ηςκ παναιέηνςκ ηδξ ελζζςζδξ von Bertalanffy (L∞=899 mm, k=0.36 ηαζ Φ'=3.46)
οπμθμβίζηδηακ ηαζ ζηδκ πενίπηςζδ εηηίιδζδξ ηδξ δθζηίαξ αηυιςκ ηςκ μπμίςκ μζ ςηυθζεμζ είπακ
οπμζηεί πδιζηυ ιανηάνζζια ιε μλοηεηναηοηθίκδ, εέημκηαξ ζε αιθζζαήηδζδ ηα ηνζηήνζα πμο είπακ
δζαηοπςεεί πνμδβμοιέκςξ βζα ηδκ ενιδκεία ηδξ ιαηνμδμιήξ ηςκ ςημθίεςκ ημο ιπαηαθζάνμο (de
Pontual et al. 2006; Piñeiro et al. 2007). Ακάθμβα ζοιπενάζιαηα πνμέηορακ ιεηά απυ ζοιααηζηυ
ιανηάνζζια ιπαηαθζάνμο ζημκ ηυθπμ ηςκ Λευκηςκ ηαζ εηηίιδζδ ημο νοειμφ αφλδζδξ ημο ηαηά ημ
πνμκζηυ δζάζηδια ιεηαλφ ιανηανίζιαημξ ηαζ επακαζφθθδρδξ (Mellon-Duvall et al. 2010).
Βηβιηνγξαθία
Belcari P., Ligas A., Viva C. (2006). Age determination and growth of juveniles of the European
hake,
Merluccius merluccius (L., 1758), in the northern Tyrrhenian Sea (NW Mediterranean).
Fisheries Research 78, 211-217.
Casey J., Pereiro J. (1995). European hake (M. merluccius) in the North-east Atlantic. In: ―Hake:
Biology, Fisheries
and Markets‖,J. Alheit and T. Pitcher (eds). London: Chapman & Hall; p. 123-147.
García-Rodríguez M., Esteban A. (2002). How fast does hake grow? A study on the Mediterranean
hake
285
HydroMedit 2014, November 13-15, Volos, Greece
(Merluccius merluccius L.) comparing whole otoliths readings and length frequency
distributions data.
Scientia Marina 66, 145-156.
Georgiou K.A., Kapiris K. (2009). Preliminary study on the age and growth of the hake‘s (Merluccius
merluccius)
population in Pagasitikos Gulf. Proceedings of the 9 th Symposium on Oceanography and
Fisheries, vol. 2
(2009), pp. 856-861.
ICES (2010). Report of the Workshop on Age estimation of European hake (WKAEH), 9-13
November 2009,
Vigo, Spain. ICES CM 2009/ACOM:42. 68 pp.
Ligas A., Pierattini C., Viva C., Bertolini D., Belcari P. (2011). Age estimation and growth of
European hake
Merluccius merluccius (Linnaeus, 1758), in the northern Tyrrhenian sea. Atti Soc. tosc. Sci.
nat., Mem.,
Serie B, 118 pagg. 9-14, figg. 3, tabb. 4; doi: 10.2424/ASTSN.M.2011.16
Mellon-Duval C., de Pontual H., Métral L., Quemener L. (2010). Growth of European hake
(Merluccius
merluccius) in the Gulf of Lions based on conventional tagging. ICES Journal of Marine
Science 67, 62-70.
Morales-Nin B., Bjelland R.M., Moksness E. (2005). Otolith microstructure of a hatchery reared
European hake
(Merluccius merluccius). Fisheries Research 74, 300–305.
Moutopoulos D. K., Stergiou K. I. (2002). Length–weight and length–length relationships of fish
species from the
Aegean Sea (Greece). Journal of Applied Ichthyology 18, 200–203.
Özaydin O., Taşkavak E. (2006). Length-weight relationships for 47 fish species from Izmir Bay
(eastern Aegean
Sea, Turkey). Acta Adriatica 47, 211-216.
Papaconstantinou C., Stergiou K. (1995). Biology and fisheries of hake Merluccius merluccius L.,
1758, in the
eastern Mediterranean. In: ―Hake: Biology, Fisheries and Markets‖,J. Alheit and T.
Pitcher
(eds). London: Chapman & Hall, p. 149-180.
Pauly D., Munro J.L (1984). Once more the comparison of growth in fish and invertebrates. ICLARM
Fishbyte
2.21 pp.
Piñeiro C., and Sainza M. (2003). Age estimation, growth and maturity of the European hake
(Merluccius merluccius
Linnaeus, 1758) from Iberian Atlantic waters. ICES Journal of Marine Science 60, 1086–
1102.
Piñeiro C., Rey J., de Pontual H., Goñi R. (2007). Tag and recapture of European hake (Merluccius
merluccius L.)
off the Northwest Iberian Peninsula: First results support fast growth hypothesis. Fisheries
Research 88, 150-154.
Pontual H., Groisonb A.L., Piñeiro C., Bertignac M. (2006). Evidence of underestimation of
European hake growth
in the Bay of Biscay, and its relationship with bias in the agreed method of age estimation.
ICES Journal of Marine Science 63, 1674-1681.
Uçkun D., Taşkavak E., Toǧulga M. (2006). A preliminary study on otolith-total length relationship of
the common
hake (Merluccius merluccius L., 1758) in Izmir Bay, Aegean Sea. Pakistan Journal of
Biological Sciences
9, 1720-1725.
286
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
FISHERIES
ECONOMICS
287
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
The effects of climate change are numerous and diverse, often interlinked, causing severe impacts on
the economic and physical environment of the affected areas. Freshwater shortage and sea level rise
are highlighted as the priority risks of climate change in Mediterranean coastal region. This study
seeks to illustrate at a local level the impact that sea level rise may generate on the coastal
communities of Cyclades Islands in Greece in terms of value of lost land due to sea level rise. After
developing three different scenarios of sea level rise by 0.3 0.6 and 1 m in tandem with the use of
Geographic Information System (GIS) as a mapping tool the percentage of inundated area at different
islands was illustrated and the respective economic cost was calculated. Results revealed that in the
most possible case scenario of sea level rise by 0.6 m the total land loss value for the whole Cyclades
complex reaches 4 billion € (close to 2.2% GDP) with Naxos island being the most vulnerable.
Further research needs to take into consideration additional factors related to the impact assessment of
sea level rise in Cyclades in order to produce more robust results. The study was performed for all
Cyclades Islands (24 inhabited islands in total) from which Paros and Naxos islands were selected as
the most important in terms of economy.
Keywords: Paros Island Naxos Island Cyclades sea level rise climate change
1. Introduction
Over the recent decades CO2 emissions have considerably increased due to the intense use of
fossil fuels in industry being a prime factor responsible for global warming and global climate
changes. The latest Reports of the World Meteorological Organization (WMO) and the United
Nations Programme for the Environment (UNEP) indicate that between 1980 and 2005 the world
ambient temperature had increased between 1 and 1.5°C (Melloul and Collin 2009). One of the most
critical issues arisen from the ongoing global warming is the expected sea level rise and thus focus has
been put on the future sea level trends which inextricably affect coastal areas and islands. According
to the Intergovernmental Panel on Climate Change (IPCC) Fourth Assessment Report (AR4; IPCC
2007a) for water at 15°C, an increase by 1°C in a water column of 1000 m would heighten the water
column by 16 cm while the estimated global mean sea level rise will be between 18 and 59 cm by the
288
HydroMedit 2014, November 13-15, Volos, Greece
2090s. Nevertheless sea level rise and its expected impacts are not uniform around the globe since
there are many factors that influence the rates of sea level changes such as eustatic glacio-hydro-
isostatic and tectonic factors (Lambeck et al. 2004). Recent scenarios for 2100 (IPCC 2001ab) and
sea-level measurements (Church and White 2006) suggest an acceleration in sea-level rise. This
enhances the importance of a new simulation of the impact of rising sea level on the shoreline
position. Low lying coastal areas and their populations are primarily affected by sea level rise
consequences as more than 40% of the world‘s population (more than 2.8 billion people) live within
100 km of the coast (IOC/UNESCO IMO FAO UNDP 2011). Taking into consideration the
conversion of natural coastal landscapes to anthropogenic uses due to continuous population growth in
coastal areas the impacts of sea level rise aggravate the cost both in natural and economic resources of
these areas. The assessment of the vulnerability of coastal resources to the impacts of sea level rise is
delineated into both natural (natural system vulnerability) and socio-economic environment (socio-
economic system vulnerability; Travers et al. 2010). The prerequisite of the socioeconomic
vulnerability analysis relies on the efficient knowledge about natural response system to sea level rise
(Travers et al. 2010). Adaptation to these phenomena is mainly translated into cost assessment rather
than cost-benefit assessment (CBA) as decision makers are not for supporting ―inaction‖ but making
optimal actions that would ensure the safety of the area at risk (European Commission 2009). The
rates of sea level change in Mediterranean are a controversial issue. Carillo et al. (2012) stated that the
characteristics of Mediterranean Sea as a semi-closed basin connected to the Atlantic Ocean only
through the Strait of Gibraltar allow for differing from the global sea level trends. Applying statistical
techniques on satellite data Tsimplis et al. (2009) estimated an increase of sea level trend about 0.63
mm year-1 for the period 1993-2000 using tide gauge data whereas in another study by Tsimplis and
Baker (2000) identified an increase at a rate of 1.2-1.5 mm year-1 before 1960 and a decrease at a rate
of -1.3 mm/year between 1960 and 1998. As Travers et al. (2010) reported in Adriatic and Aegean
Seas the raise of average temperature will be greater than in Levantine basin raising the elevation rate
in the eastern part of Mediterranean basin at rate of +5 and +15 mm/year compared to less than +5
mm/year in the western part. The Aegean Sea is considered to be the most exposed area of the
Mediterranean Sea to sea level rise due to high water temperatures (Paulopoulos et al. 2002). The
impacts of sea level rise will be particularly strong on the majority of the Mediterranean coastal areas
as they housed 36% (EUROSTAT 2011) of the EU coastal regions‘ population in 2009 with a trend to
increase by 1.4% in 2025 (Goudert and Larid 2011) causing floods land loss salinisation of
groundwater and destruction of built property and infrastructure (Devoy 2007). Given the large and
growing concentration of population and economic activity in the coastal zone as well as the
importance of coastal ecosystems the potential impacts of sea-level change have evoked widespread
concern for more than two decades (Barth and Titus 1984; Milliman et al. 1989; Warrick et al. 1993).
The present study focuses on the Paros and Naxos Islands (belonging to the Cyclades
Archipelago Greece). The main aim of this study was to assess and visualize the percentage of the
inundation area after developing three different scenarios of sea level rise in the study area using GIS
as a tool. Valuation is based on the national figures for the values of urban and non-urban land for
taxation purposes. The objective of this paper is to identify the hotspots (areas of high risk) and
estimate the economic loss of land for each sea level rise scenario..
Study area
Cyclades (Fig. 1) is a complex of islands located in the central Aegean Sea (Greece; (Fig 1).
The natural environment of Cyclades is very rich as it hosts a great variety of ecosystems which
although they have limited size they host significant ecological features and protected areas that are
included in the NATURA 2000 Network. The main economic activities are include agriculture,
mining, fishing, small-scale-industry and tourism. Tourism has long played an important role in the
289
HydroMedit 2014, November 13-15, Volos, Greece
economic development of Cyclades characterizing them as one of the most significant tourism
destinations in Greece.
Figure 1. Map of the study area (with re the islands of Paros and Naxos)
Naxos Island is the largest island in Cyclades with an area of 429 km² and a population
18200 (census of 2001) and a density of 42 inhabitants/km². Paros Island is also one of the largest
islands of the Cyclades complex with an area of 196.3 km² a population of 6058 (census 2001) and a
density of 70 inhabitants/km². Both islands have significant mountainous terrain of 724-1000 m but
also extensive coastal plains with beautiful beaches with clear waters suitable for swimming and other
water-related activities. This combination makes these islands (also others in the region of Cyclades)
as a very attractive tourism destination.
Data analysis
3. Results
The basic results on land loss due to sea level rise are summarised in Table 1.
290
HydroMedit 2014, November 13-15, Volos, Greece
Table 1. Land loss per island and per scenario of sea level rise
The results on economics losses due to land losses are summarised in Table 2. The most
affected urban areas are located in the island of Naxos where land inundation ranges between 751104
m² and 1106370 m² with a respective cost between 892588985€ and 1341777155€. Paros is the
second most inundated island among the Cyclades region.
Table 2. Economic loss for each island due to inundation of urban area
Paros(with
308 078 491 430 700 263 322 763 659 € 514 856 049 € 733 644 328 €
Antiparos)
The results on economic losses due to land losses of non-urban areas are summarised in
Table 3.
Naxos 3 004 414 3 658 420 4 425 481 16 515 867 € 20 111 066 € 24 327 753 €
Paros(with
1 232 310 1 965 718 2 801 051 7 080 363 € 11 294 232 € 16 093 720 €
Antiparos)
Table 3 indicates that the islands of Naxos and Paros have the highest economic loss from the
inundation of non-urban areas due to sea level rise
291
HydroMedit 2014, November 13-15, Volos, Greece
4. Discussion
Sea-level change is one of the observed consequences of global warming and future sea-level
rise is inevitable in a warming world with the rates and geographical patterns of this rise remaining
uncertain (IPCC 2007a). Within coastal zones these climate-related changes can be expected to have a
range of impacts. Rising sea levels will increase the flood-risk and erosion along the coast but may
also impact freshwater availability or result in an accelerated loss of coastal eco-systems. A key
element in assessing these issues is the development of sea-level rise scenarios (or plausible futures).
Climate experts emphasise the importance of adapting to these potential effects of climate change by
developing and implementing coastal protection and adaptation strategies. Coastal environment
managers are increasingly concerned by the current rise in sea level and its possible acceleration
during the 21st century in relation to climate warming (IPCC 2001ab). This phenomenon coincides
with an unprecedented socio-economic development of the coastal fringe. In coming decades on-
going global warming will augment the probability of climate change. This may trigger alteration in
sea level rise magnitude and rate as well as increase the impact of enhancing factors as shown in on-
going global sea level rise as well as instances in sudden sea level rise situations over recent years.
Human use of the coast increased dramatically in the last century and it seems that this trend will
continue in the future (Nicholls et al. 2008ab). Coastal population growth in many low-lying areas has
led to the conversion of natural coastal landscapes to land for agricultural aquaculture industrial and
residential uses (Valiela 2006). The attractiveness of the coast has resulted in rapid expansion of
economic activity but has also degraded coastal ecosystems. Floods pose serious threats to coastal
areas around the world; they cause great financial losses in property and infrastructure and affect
many millions of people (Dasgupta et al. 2009; Nicholls 2004; Nicholls et al. 2008b).
Paros (with Antiparos) are located in the center of Cyclades Island complex with 13715 and
1215 inhabitants in 2011. Both islands are among the most affected regions by sea level rise as the
total economic loss ranges from 329844022 € (best case scenario) to 749738047 € (worst case
scenario; Table 4). Paros and Antiparos are highly visited islands with Antiparos to be a low-lying
small island attracting high-income tourists and expensive tourism investments during the last years in
contrast with Paros which is a traditional tourism destination mainly attracting mass tourism.
Antiparos will lose 2.1% of the total island area after applying the second sea level rise scenario of 0.6
m while Paros is less affected with 0.8% land loss (Fig.2).
Fig.2. Land losses (red) per sea level rise scenario (0.3 m 0.6 m 1 m) of Paros Island
Naxos is a large island with 20837 (2011) inhabitants with imposing mountainous volumes
and strong winds. The topography of the island is a representative example of the Aegean topography
characterised by hills and mountains covered by bushes and very limited flat fields. It is considered as
the most fertile island of Cyclades. Naxos is the most vulnerable island relative to the others; since it
risks losing a higher percentage of land (1.06%) for sea level rise of 0.60 m (Fig.3). Moreover it faces
the most severe economic cost as for the most possible scenario of sea level rise 0.6 m the economic
292
HydroMedit 2014, November 13-15, Volos, Greece
cost accounts for 1086889144€. Based on the above measurements, Klidos is the most affected urban
area as 15.54% of the land is inundated. The western part of Naxos is susceptible to future sea level
rise and especially the southern part of Naxos capital which also includes the airport.
Fig.2. Land losses (red) per sea level rise scenario (0.3 m 0.6 m 1 m) of Naxos Island.
5. Conclusion
The main effect of sea level rise is the loss of valuable (in many cases) land. At the same
time though this land may also produce added value when it is exploited for other reasons except
habitation. For example, a part of the coastline which is important for tourism exhibits both a urban
value and a touristic value. The present paper, due to the lack of credible data on the uses of the
coastline provides estimates on the building value of the land losses in the target area. However, we
this estimates as important because they provide a baseline estimate of the losses which, if the added
value for the exploitation of these lands is added, is expected to be higher.
References
Barth M.C., Titus J.G., (1984). Greenhouse effect and sea level rise: A challenge for this generation,
Van Nostrand Reinhold, New York
Carillo A., Sannino G., Artale V., Rutti P.M., Calmanti S., Dell‘Aquila A., (2012). Steric sea level rise
over the Mediterranean Sea: present climate and scenario simulations. Climate Dynamics 39
(9-10), 2167-2184,
Coudert E., Larid M., (2006). IMAGINE : un ensemble de méthodes et d‘outils pour contribuer à la
gestion intégrée des zones côtières en Méditerranée, Vertigo - la revue électronique en
sciences de l‘environnement, Dossier : Les littoraux et la gestion intégrée des zones côtières,
7 (3). (http://vertigo.revues.org/9059, 17 September 2012).
Dasgupta S., Laplante B., Meisner C., Wheeler D., Yan J., (2009). The impact of sea level rise on
developing countries: a comparative analysis. Climatic Change 93, 379–388
Devoy R.J.N., (2008). Coastal Vulnerability and the Implications of Sea-Level Rise for Ireland.
Journal of Coastal Research, 24 (2), 325-341.
EUROSTAT, (2011). Coastal regions. In: European Commission (ed) Eurostat regional year book
2011. Luxembourg: Publications Office of the European Union, Belgium.
IOC/UNESCO, IMO, FAO, UNDP, (2011) A Blueprint for Ocean and Coastal Sustainability.
IOC/UNESCO, Paris.
IPCC, (2001a). Climate change 2001: impacts, adaptations and vulnerability. In: McCarthy JJ,
Canziani OF, Leary NA, Dokken DJ, White KS (eds) Contribution of Working Group II to
the Third Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge
University Press, Cambridge.
IPCC, (2007a). Climate Change 2007: impacts, adaptation and vulnerability. Contribution of working
group II to the fourth assessment report of the intergovernmental panel on climate change.
Cambridge University Press, Cambridge.
293
HydroMedit 2014, November 13-15, Volos, Greece
IPCC, (2001b). Climate change 2001: impacts, adaptation and vulnerability. Contribution of the
working group to the 3rd assessment report of the intergovernmental Panel of Climate
Change. World Meteorological Organization, Genève. 124 pp.
Lambeck K., Anzidei M., Antonioli F., Benini A., Esposito A., (2004). Sea level in Roman time in the
Central Mediterranean and implications for recent change. Earth and Planetary Science
Letters 224, 563-575.
Melloul A, Collin M (2009). Key natural and anthropogenic parameters enhancing the effect of sea
level rise: The case of Israel‘s Mediterranean coast. Ocean & Coastal Management 52: 39-46.
Milliman J.D., Broadus J.M., Gable F., (1989). Environmental and economic implications of rising
sea level and subsiding deltas: The Nile and Bengal examples. Ambio 18: 340-345.
Nicholls R.J. (2004). Coastal flooding and wetland loss in the 21st century: changes under the SRES
climate and socio-economic scenarios. Global Environmental Changes 14:69–89.
Nicholls RJ, Hanson S, Herweijer C. Patmore N., Hallegatte S., Corfee-Morlot J., Chateau J., Muir-
Wood R. (2008a). Ranking port cities with high exposure and vulnerability to climate
extremes: exposure estimates. OECD environment working papers No. 1, ENV/WKP(2007).
OECD, Paris, France.
Nicholls R.J., Tol R.S.J., Vafeidis A.T. (2008b) Global estimates of the impact of a collapse
of the West Antarctic ice sheet: an application of FUND. Climatic Changes 91,171–191.
Paulopoulos K, Chalkias C, Karimbalis E, (2002). Potential impact of sea level rise on Mykonos,
Delos, Rinia islands, In: 6th Pan-Hellenic Geographical Conference (Volume III),
Thessaloniki, 3-6 October 2002, p. 469-476.
Travers A., Elrick C., Kay R., (2010). Background Paper: Climate Change in Coastal Zones of the
Mediterranean. Priority Actions Programme, Mediterranean Regional Activity Centre
(PAP/RAC), Coastal Zone Management Pty Ltd, Claremont, Australia.
Tsimplis M.N., Baker T.F., (2000) Sea level drop in the Mediterranean Sea: An indicator of deep-
water salinity and temperature changes? Geophysical Research Letters 12, 1731-1734.
Tsimplis M.N., Marcos M., Colin J., Somot S., Pascual A., Shaw A.G.P., (2009). Sea level variability
in the Mediterranean Sea during the 1990s on the basis of two 2D and one 3d model. Journal
of Marine Systems 78 (1), 109-123.
Valiela I., (2006) Global coastal change. Wiley-Blackwell, London.
Warrick RA, Barrow EM, Wigley TML (1993). Climate and sea level change: Observations,
projections, implications. Cambridge University Press, Cambridge.
294
HydroMedit 2014, November 13-15, Volos, Greece
2 Lab. of Animal Production Economics, School of Veterinary Medicine, Faculty of Health Sciences,
Aristotle University of Thessaloniki, University campus, 541 24 Thessaloniki, Greece
ABSTRACT
This study investigates the major factors that affect consumption in farmed fish. Using data from an
in-person field survey, the categorical regression analysis was employed in order to detect the most
significant factors which affect the consumption of farmed fish. The analysis identified that consumer
preference and price are the most significant factors that determines consumption frequency in farmed
fish. Socioeconomic factors are also playing a significant role regarding the consumption of farmed
fish. Therefore, this study facilitates the development of consumer profile that could provide the basis
of consumer-focused strategies aiming to improve consumer performance in the sector.
Keywords: Consumer‘s behavior, Categorical Regression with optimal scaling, farmed fish.
1. Introduction
Fish have always been considered as an important part of human diet and they have long been
recognized as a health-promoting food for human nutrition. Globally, fish provides about 4.3 billion
people with almost 15% of their average per capita intake of animal protein, with the global annual
per capita consumption of fish to stand at around 18.6kg, having doubled since the 1960s (FAO 2012).
Particularly, aquaculture is considered as the fastest growing primary production sector, representing
an annual growth rate of nearly 7% over the past decades. Furthermore, it is positioned to overtake
capture fisheries as a source of food fish (FAO 2009).
Greece‘s share in E.U.-28 in terms of value in aquaculture is 12.59%, dominating the third position
(CFP 2014). However, the Greek fisheries sector operates in the context of an increasingly market-
based economy, characterized by rapid changes in market and ultimate consumer demands.
Particularly, consumer expectations are good quality products derived from healthy animals raised in a
healthy environment, to be natural, fresh tasting and nutritious (Kennedy et al. 2004). Particularly, a
critical driver of consumer perceptions towards food quality and acceptance is better taste and
nutrition (Cardello et al. 2007).
Consumer perception is a key concept in order to better understand various aspects of consumer
behaviour (Maciel et al. 2013). Additionally, the prediction of consumer behaviour is strongly
affected by consumer attitude (Phillips et al., 2013). Previous studies have shown that although
consumer attitudes towards production procedure have a minor impact of buying behaviour, they can
be regarded as a potential that can be taken into consideration by creative marketing and product
development (Grunert 2006). Furthermore, the system of production, traceability and quality control
are of increased consumers‘ interest (Peniak et al. 2007).
Particularly, consumers‘ interest in health, longevity and food safety is the key driver in fish
consumption (Maciel et al. 2013). In the seafood market, consumers use experiences combined with a
reliance on retailers‘ reputation and knowledge in order to simulate information about credence
295
HydroMedit 2014, November 13-15, Volos, Greece
characteristics (Anderson 1995). According to previous studies, consumers claim to pay more
attention to fish resources state, the visual aspects of the product, fish origin, prices, product form, and
to the freshness when they purchase fish (Brecard et al. 2009).
The present study aims to establish which factors are most important in the consumption of farmed
fish. Therefore, the objective of the study is to detect the consumers‘ perceived attitudes towards
farmed fish and to analyse possible relationships between consumer characteristics and marketing
aspects of these products. This consumer segmentation could potentially identify both policy and
marketing improvements aiming to deliver an improved consumer value (Macharia et al. 2013).
The study was carried out in the capital of Greece, in Athens. The questionnaire used was simple and
consisted of twelve questions divided into two sections. The first section consisted of seven questions
covering consumers‘ preferences and attitudes towards farmed fish, namely, consumption preference:
Q1, respondents‘ choice criteria: Q2, such as price, quality, flavour, and availability, points of
purchase: Q3 (fish shops, fish mongers, super market), packaging importance: Q4, as well as product
form: Q5 (fresh, frozen, raw, scaled), processed kinds preferences: Q6 (fillets, smoked, canned, salted),
consumption frequency: Q7 (none, once per month, twice per month, once per week, twice per week,) .
Questions in the survey tool employed a five-point Likert scale, ranging from (1) none to (5) very
much.
The second section collected general information regarding the principal socioeconomic
characteristics of consumers, namely, monthly disposable income: Q8, educational level: Q9,
householder‟s age: Q10, gender: Q11 and profession: Q12. The data on the householder‘s age were
divided into five groups: a) 18 – 25, b) 26 – 35, c) 36 – 50, d) 51 - 65 and e) >65 years old. The
monthly disposable income data were divided into five groups: a) <700, b) 700 – 1.000 c) 1.001 –
1.500, d) 1.501 – 2.500 and e) >2.500 EURO. Furthermore, with respect to householder‘s profession,
data was split into six groups: a) private employees, b) public employees, c) freelance, d)
agriculturists, e) students and f) unemployed. Finally, the householder‘s educational level was
categorized as elementary, secondary or higher education.
In order to identify potential relationships between the variables of the questionnaire, the method of
categorical regression was chosen, known as regression with optimal scaling. The latter is a method
designed to maximise the relationship between the predictor and an outcome variable by adjusting
their scales (Cleophas 2013). It actually scales simultaneously nominal, ordinal and numerical
variables. Therefore, the prediction of the dependent variable is provided for any combination of the
296
HydroMedit 2014, November 13-15, Volos, Greece
independent variables (Shrestha 2009). The variables‘ categories are quantified aiming to maximise
the R2 regression coefficient between the dependent variable and the group of independent variables.
One major advantage of categorical regression is that the sample size need not necessarily be large
(Shrestha 2009). Additionally, it is particularly beneficial with lack of homogeneity in the scales of
the variables (Cleophas 2013).
Furthermore, in order to test model‘s colinearity, the Pratt‘s measures of relative importance and
tolerance were used. Low levels of tolerance indicate low variable‘s contribution to the estimation of
the model and can cause computational problems (Batzios et al. 2005).
3. Results
The statistical indices, calculated for the overall evaluation and validity of the applied categorical
regression model, resulted in relatively good values of multiple R and statistically significant F value
of the ANOVA test (level of significance: α=0.001). More specifically, the coefficient of multiple
determination was 0.742. This means that approximately 74% of the dependent variable‘s variance is
explained by the independent variables in the model.
Table 1 presents the most important results of the methodology applied, regarding the consumption
frequency of farmed fish. The estimated categorical regression model showed that the beta coefficient
of each of the independent variables was in accordance with the presence of the remaining
independent variables. Σhe deletion of an independent variable from the regression model, together
with the presence of the remaining independent variables, reduces the predictability of the model.
Consumption preference, processed kinds preferences: smoked, purchase point: Super markets and
price were the independent variables with the highest significant beta coefficients in the model and the
largest importance to the predictability of the model (23.4%, 17.3%, 10.9% and 10.7%, respectively).
Education and product form: scaled exhibited lower importance to the predictability of the above
model (10% and 8.4%, respectively). Cumulatively, these predictor variables exhibited the 80.7% of
the total importance. The tolerance values of the regression model were very high indicating lack of
multicollinearity (Table 1).
Table 1. Categorical regression model for farmed fish (Standardized coefficients, relative
importance and tolerance values)
Beta Standard
error
297
HydroMedit 2014, November 13-15, Volos, Greece
4. Discussion
In this study, a categorical regression analysis was implemented in an effort to identify the effect of
basic classification variables of consumers‘ socio-economic status and marketing aspects regarding
the consumption frequency of farmed fish. Results reveal that the main factors that were detected to
be the most important determinants of consumption frequency in farmed fish were consumer
preference, price, purchase point: supermarkets and processed kinds preferences: smoked.
Particularly, according to Table 1, the positive and significant effect of consumer preference and price
indicates that they are a prerequisite for improving the level of consumption frequency in farmed fish
and thus consumer performance in the sector. In this respect, higher levels of consumer performance
could be supported by the implementation of specific marketing strategies which focalized in meeting
consumer demand in conjunction with the implementation of competitive prices. This supports
findings from previous and recent studies that although noted a prejudice against conventional farmed
fish among Greek consumers, urban consumers seems to have overcome this habit (Batzios et al.
2003; Peniak et al. 2013).
Furthermore, the same result holds for the purchase point: supermarkets, which reflects the preference
purchase point for farmed fish. This indicates that supermarkets are important and significant purchase
points for farmed fish, contributing in higher levels of consumption and thus in improving consumer
performance. Previous studies have also provided evidence that there is a general trend of purchase
preference of farmed fish from supermarkets (Kaimakoudi et al. 2013).
Additionally, product form: scaled and education exhibited lower importance to the predictability of
the categorical regression model. Particularly, from the beta coefficients of these independent
298
HydroMedit 2014, November 13-15, Volos, Greece
variables, it is concluded that the impact of those variables to consumption frequency is positive. This
indicates that the product form: scaled is important and significant product form of farmed fish,
contributing in higher levels of consumption and thus in improving consumer performance. Moreover,
younger consumers and with a relatively higher educational level, exhibit higher farmed fish
consumption‘s levels. These support findings from previous and recent studies (Batzios et al. 2005;
Polymeros et al. 2014) where younger consumers and with a relatively higher educational level
exhibit higher sensitivity on marketing aspects of farmed fish. Potentially, they are usually better
informed about marketing issues.
Thus, in order to improve product‘s communication and consequently, increase the demand of farmed
fish, the adoption of a marketing strategy aiming to boost awareness and to promote the consumption
of aquaculture products, could reinforce the image of the sector as a whole. This is in accordance with
previous studies where it is clearly stated that the lack of awareness regarding aquaculture‘s risks and
benefits has caused an image problem within the European public (Schlag & Ystgaard, 2013).
Additionally, as it has been demonstrated by previous studies, consumers with the highest use of all
information sources about fish, demonstrated the highest intention and consequently consumption of
fish (Peniak et al. 2007).
Consequently, information programmes regarding aquaculture products‘ safety and quality attributes
should potentially be introduced, aiming at enhanced publicity for the Greek aquaculture sector in
general and thus could contribute in guiltlessness of the whole sector. Thus, as it has been proposed by
recent studies, a focus towards consumers‘ education in relation to health benefits of fish consumption
could provide a more efficient communication strategy (Maciel et al. 2013).
The study served to identify the specific marketing aspects and socio-economic characteristics of
farmed fish market. Therefore, the identification of this target market facilitates the adoption of a
suitable marketing mix for the firms involved in the aquaculture industry. The adoption of this
marketing mix serves to meet the requirements of the market more effectively.
These results show that a market segmentation strategy is probably needed so that aquaculture
production could take advantage of the significant potential for improving the demand in the near
future. For this reason, it is essential to consider potential marketing strategies designed to enhance
awareness and facilitate communication about the product. Therefore, a marketing strategy aiming to
increase public awareness could improve the customer value of the product, improving the image of
aquaculture products in the Greek market.
In conclusion, certain limitations should be acknowledged. Due to the snowballing procedure used in
this study, the collection of data with the questionnaire depended on the single-informant approach.
As a result, the findings should be interpreted with caution, even though single informants provide
information as reliable as that furnished by multiple informants. In addition, this study was limited at
local level. Potentially, gathered information by different sample areas could provide important and
specific information for designing targeted promotional campaigns. Therefore, generalisations of these
findings to markedly different contexts should be made cautiously in view of the competitive and
market differences that most likely exist between different areas and countries.
However, it may provide an opportunity for further research regarding the proposed model of farmed
fish consumption. Possible research avenues may pertain to a more detailed investigation of the
factors affecting farmed fish consumption under the implementation of other statistical analyses such
as cluster analysis, providing the critical comparison between them by confirming or rejecting the
results derived.
References
Anderson J. (1995). ‗Purchase Behaviour, Food Safety, and Quality Control in Seafood and
Aquaculture Marketing: Discussion‘ American Journal of Agricultural Economics 77 (5), 1319-1321
299
HydroMedit 2014, November 13-15, Volos, Greece
Batzios Ch., Angelidis P., Moutopoulos D., Anastasiadou Ch., Chrisopolitou V. (2003). Consumer
Attitude towards Shellfish in the Greek Market: A Pilot Study. Mediterranean Marine Science 4, 155
– 174.
Batzios Ch., Moutopoulos D., Arabatzis G., Siardos G. (2005). Understanding Consumer‘s Attitude
on Fish Quality and Marketing Aspects in the Greek Fish Market. Agricultural Economic Review 6
(1), 18-30.
Brécard, D., Hlaimi, B., Lucas, S., Perraudeau, Y. and Salladarré, F. (2009). Determinants of demand
for green products: An application to eco-label demand for fish in Europe. Ecological Economics
69,115–125
Cardello A., Schutz H., Lesher L. (2007). Consumer perceptions of foods processed by innovative and
emerging technologies: A conjoint analytic study. Innovative Food Science and Emerging
Technologies 8, 73–83
Cleophas Ton J. (2013). Optimal Scaling, A Wonderful Method for Analysing Clinical Trials with
Imperfect Data. Open Journal of Mathematical Modeling 1(1), 7-20
CFP (2014). Common Fisheries Policy, Facts and Figures, 2014 edition
FAO (2009). The State of World Fisheries and Aquaculture, 2008. Food and Agriculture Organization
of the United Nations, Rome, 2009. 176 p.
FAO (2012). The State of World Fisheries and Aquaculture. Food and Agriculture Organization of the
United Nations, Rome.
Grunert K. (2006). ‗Future trends and consumer lifestyles with regard to meat consumption‘. Meat
Science 74, 149–160
Kaimakoudi E., Polymeros K., Shinaraki M., Batzios Ch. (2013). Consumers‘ attitudes towards
fisheries products. Procedia Technology 8, 90 – 96.
Kennedy O.B., Stewart-Knox B.J., Mitchell P.C., Thurnham D.I. (2004). "Consumer perceptions of
poultry meat: a qualitative analysis", Nutrition & Food Science 34 (3), 122 – 129
Macharia J., Collins R., Sun T. (2013). ‗Value-based consumer segmentation: the key to sustainable
agri – food chains‘. British Food Journal 115 (9), 1313-1328
Maciel E., Savay-da-Silva L., Vasconcelos J., Sonati J., Galvao J., Lima L., Oetterer M. (2013).
‗Relationship between the price of fish and its quality attributes: a study within a community at the
University of Sao Paolo, Brazil‘. Food Science and Technology 33 (3), 451-456
Patton Q.M. (1990). Qualitative evaluation and research methods, Sage, California
Phillips, W., Asperin, A. and Wolfe, K. (2013). ‗Investigating the effect of country image and
subjective knowledge on attitudes and behaviours: U.S. Upper Midwesterners‘ intentions to consume
Korean Food and visit Korea‘. International Journal of Hospitality Management 32, 49-58
Pieniak Z., Verbeke W., Scholderer J., Brunso K., Olsen S. (2007). ‗European consumers‘ use of and
trust in information sources about fish‘. Food Quality and Preference 18, 1050–1063
Pieniak Z., Vanhonacker F., Verbeke W. (2013). ‗Consumer knowledge and use of information about
fish and aquaculture‘. Food Policy 40, 25-30
Polymeros K., Kaimakoudi E., Schinaraki M., Batzios Ch. (2014). Analysing consumers‘ perceived
differences in wild and farmed fish. British Food Journal. In press
Schlag A.,Ystgaard K. (2013). ‗Europeans and aquaculture: perceived differences between wild and
farmed fish‘. British Food Journal 115 (2), 209-222
Shrestha Lal Srijan. (2009). Categorical Regression Models with Optimal Scaling for Predicting
Indoor Air Pollution Concentrations inside Kitchens in Nepalese Households. Nepal Journal of
Science and Technology 10, 205-211
300
HydroMedit 2014, November 13-15, Volos, Greece
Pinello D.*1, Liontakis, A.2, Sintori, A.2, Tzouramani I.2 , Polymeros K1.
1
Department of Ichthyology and Aquatic Environment, University of Thessaly, Volos, Greece
2
Agricultural Economics and Policy Research Institute, ELGO, Demeter, Terma Alkamanos, P.C.
11528, Athens, Greece.
Abstract
This study explores the technical and scale efficiency of the small scale, coastal fisheries as
well as bottom trawlers in Greece. The issue of efficiency is explored using an input oriented data
envelopment analysis model. Moreover, the association of technical and scale efficiency scores with
several characteristics of the vessel as well as characteristics of the skipper were also explored.
Results indicate that small-scale vessels achieve a low average technical efficiency of 0.54 but much
higher scale efficiency (0.80). The results of the analysis also indicate that in coastal fisheries, smaller
vessels have the ability to better manage their resources. On the other hand, bottom trawlers achieve
high scale but also technical efficiency scores. One important finding of the analysis is that in coastal
fisheries, unlike trawlers, technical efficiency is positively correlated with the age and therefore the
experience of the skipper. In a looser context, it can be said that small scale coastal fisheries mainly
rely on skills, while bottom trawlers fisheries rely on science. Finally, this study suggests that there is
room for improvement in the efficiency of mainly small scale vessels, which will allow for the
achievement of the same level of output, but with reduced inputs.
Key words: small scale fishery, bottom-trawlers, technical efficiency, scale efficiency, DEA
*Corresponding author: Pinello Dario (dario.pinello@fao.org).
1. Introduction
Fisheries is an important economic activity in Greece. According to the Greek Fleet Register,
in 2012 the Greek fleet consists of 16,063 fishing vessels, with a combined gross tonnage of 79,678
GT and a total engine power of 462,429 kW. In particular, there were 13,918 fishing enterprises
operating in Greece offering employment to 27,558 people. An important and unique characteristic of
the Greek fishing fleet is that it consists mainly of small scale fishing vessels that exploit the extended
Greek coastline. Thus, the fishery sector can be separated into two categories, namely small scale
fisheries (coastal fisheries) and medium scale fisheries, mainly bottom trawlers and purse-seiners.
From a socioeconomic point of view, the two categories have distinct characteristics. Small scale
fishing vessels use polyvalent passive fishing gear and relay mainly on the work of the vessel owners.
On the other hand, bottom trawlers and purse seiners are characterized by high operating costs,
especially personnel costs. It is also important to emphasize that medium scale fisheries and in
particular bottom trawlers appear to have high productivity and profitability.
In the last decade, many studies explore efficiency in the European fishing fleet. Efficiency
in fisheries is about achieving the best possible outcome with the available resources (fish stock and
fishing inputs). Improvements in efficiency are desirable provided that a management structure exists
that prevents biological and economic overexploitation. If not, increased efficiency or the ability to
catch more fish for a given amount of fishing effort can be detrimental to sustainability (Grafton et al.,
2006). Efficiency is strictly related with the concept of overcapacity. Overcapacity equals the
difference between the maximum potential output that could be produced - given technology, desired
resource conditions, and full and efficient utilization of capital stock, other fixed and variable input -
and a desired optimum level of output (e.g. the maximum sustainable yield, or maximum economic
yield) (Pascoe et al., 2003).
Efficiency in fisheries is mainly explored in terms of the optimal combination of inputs to
achieve a given level of output using Data Envelopment Analysis (DEA). DEA is a non-parametric
approach of estimating efficiency. It was originally proposed by Charnes et al. (1978) and is based on
Farrell‘s model (Farrell, 1957). By solving a linear programming problem, it allows us to estimate
efficiency in multi-output situations without assuming an a priori functional form for frontier
production (Coelli, 1996). Pascoe et al. (2001) analysed the technical efficiency of the Dutch beam
trawl fleet over time. Lindebo et al. (2007) also investigated the efficiency of Danish North Sea
trawlers. Pascoe and Coglan (2002) and Pascoe et al. (2004) utilized DEA in order to investigate the
efficiency of the English Channel fisheries. Tingley et al. (2005) analyzed the technical efficiency for
three fishing segments (netters, potters and mobiles) in the English Channel. Finally, Eggert (2001)
301
HydroMedit 2014, November 13-15, Volos, Greece
investigated the technical efficiency in the Swedish trawl fishery for Norway Lobster. In the
Mediterranean region, Tsitsika and Maravelias (2008) and Tsitsika et al. (2009) investigated
efficiency of the purse seiners in Greece while Fousekis and Klonaris (2002) studied efficiency in
netters. In Sardinia, Madau et al. (2009) focused their analysis on the small-scale segment and Idda et
al. (2009) studied the TE for the small trawlers.
The present study explores the issue of efficiency of the Greek fishing fleet. The study
focuses in both small scale vessel and bottom trawlers, which allows for comparisons and helps
associate efficiency with specific characteristics of the two segment. For the purpose of the study,
efficiency was considered using economic capacity analysis (Herrero and Pascoe, 2002; Lindebo et
al., 2007), in which a data envelopment model (DEA) was used. Both the concepts of technical and
scale efficiency were considered.
302
HydroMedit 2014, November 13-15, Volos, Greece
Efficiency is then measured relative to this frontier, where all deviations from the frontier are assigned
to be inefficiency. Consider n DMUs producing m different output using h different inputs. Thus, Y is
an mxn matrix of outputs and X is an hxn matrix of inputs. Both matrices contain data for all n
DMUs. The Technical Efficiency (TE) measure can be formulated as follows:
min ζ,
subject to:
-yi + Yθ ≥ 0
(1)
ζxi – Xθ ≥ 0
ι≥0
and solved for each DMU in the sample. ζ, is DMU‘s index of technical efficiency, yi, and xi,
represent the output and input of DMU i respectively and Yθ and Xθ are the efficient projections on
the frontier. A measure of ζi = 1 indicates that the DMU is completely technically efficient. Thus, 1 -
ζ, measures how much DMU i's inputs can be proportionally reduced without any loss in output.
Model (1) implies that all vessels are operating under constant returns to scale (CRS).
However, the CRS assumption is only appropriate when all DMU‘s are operating at an optimal scale
(i.e one corresponding to the flat portion of the LRAC curve) (Coelli et al., 2002). Several factors like
imperfect competition and constraints on finance may cause a DMU not to operate at optimal scale.
The use of the CRS specification when not all DMU‘s are operating at the optimal scale will result in
measures of TE which are confounded by scale efficiencies (SE). Simply being technically efficient
(producing on the production frontier) does not maximize overall productivity, but instead maximizes
productivity only for a given input-output combination (Grafton et al, 2006). When the vessel is scale
efficient it also produces at the optimal input-output combination. This means that the vessel operates
under constant return to scale (CRS), and therefore one more unit of input-mix will effect in operating
under decreasing return to scale.
The use of the Variable Returns to Scale (VRS) specification will permit the calculation of
TE devoid of these SE effects. Banker, Charnes and Cooper (1984) suggested an extension of the CRS
DEA model to account for VRS situations.
The modified DEA model that accounts for VRS is as follows:
min ζ,
Subject to:
-yi + Yι ≥ 0
ζxi – Xι ≥ 0
(2)
NI΄ι = 1
ι≥0
The new constraint is NI΄ι = 1 where NΗ is a nx1 vector of ones. This constraint makes the
comparison of firms of similar size possible, by forming a convex hull of intersecting planes, so that
the data is enveloped more tightly. The technical efficiency measures under VRS will always be at
least as great as under the CRS assumption (Coelli et al., 2005). Scale efficiency can be calculated by
conducting both a CRS and a VRS DEA upon the same data. If there is a difference in the two TE
scores for a particular DMU, then this indicates that the DMU has scale inefficiency, and that the SE
score is equal to the ratio of CRS TE score to VRS TE score.
One shortcoming of this measure of scale efficiency is that the value does not indicate
whether the DMU is operating in an area of increasing or decreasing returns to scale. This can be
determined by running a modified DEA model where nonincreasing returns to scale (NIRS) are
imposed. In this model, the NI΄θ = 1 restriction is substituted by NI΄ι ≤ 1, to provide:
min ε,
Subject to:
-yi + Yι ≥ 0
ζxi – Xι ≥ 0
(3)
NI΄ι ≤ 1
ι≥0
The nature of the scale inefficiencies (i.e. due to increasing or decreasing returns to scale) for
a particular DMU can be determined by comparison of the NIRS TE score and the VRS TE score. If
they are unequal then decreasing returns to scale exist for that DMU, while if they are equal,
increasing returns to scale exist.
303
HydroMedit 2014, November 13-15, Volos, Greece
In this study, DEAP 2.1 software is used for the estimation of the efficiency scores.
Moreover, to deal with slacks, we use the multi-stage method (Coelli, 1996). According to the author,
the advantages of this method are that it identifies efficient projected points which have input and
output mixes which are as similar as possible to those of the inefficient points, and that it is also
invariant to units of measurement.
After the estimation of the above efficiency measures, a second stage statistical analysis is
performed to associate efficiency scores with several socio-economic variables. This set of variables
includes among others, education and age of the skipper, owner contribution to the vessel, length of
the vessel and gross cash flow. This analysis is performed with spearman correlation and Wilcoxon
rank-sum test (Mann–Whitney two-sample statistic). In order to perform the Mann-Witney test,
vessels are divided in two groups according to a specific characteristic (binary variable). Then, the
technical and the scale efficiency scores of the two groups are compared. The Mann-Whitney test is a
non-parametric analog to the independent samples t-test that does not require the assumption that the
dependent variable is normally distributed (Siegel and Castellan, 1988). As the distribution of the
efficiency scores reveals, the assumption of normal distribution is not rational in this study.
Data used in the analysis were collected through a sample survey using a well-structured
socio-economic questionnaire. Face to face interviews with 283 fishermen were conducted, 249 of
which were engaged in costal, small scale vessels with total length less than 12 meters and 34 in
bottom trawlers, with vessel length over 18 meters 1.
The variables used for the DEA analysis consist of one fixed input, which is the annual
depreciation cost and 4 variable inputs, namely annual personnel cost, fuel cost, running cost and
repair and maintenance cost. The output variable considered in the analysis is the annual revenues of
the vessels.
Energy costs refer to the annual cost of fuels for the engine while personnel costs refer to the
total cost of paid labour plus any unpaid labour of the owner. Maintenance and repair costs refer to the
annual costs of repairs for vessel, the engine as well as the fishing gear and running costs refer to all
other operation cost (e.g. bait and hooks) including the cost of lubricants and the commercial costs
(e.g. ice, boxes and packages). Other annual expenses of the vessels like dock expenses and book
keeping costs, were also included in the running costs. Annual revenues of the vessels were
determined through the value of the annual landings. Table 1 contains some descriptive statistics of
the main variables used in the DEA analysis for both the small scale vessels and for trawlers.
As far as the depreciation cost is concerned, it has been estimated according to the Perpetual
Inventory Method (PIM methodology) (IREPA et al., 2006). PIM proposes to determine the aggregate
value of the tangible capital goods used in the current year by aggregation of the value of all vintages
(year classes). Such aggregation can be based either on historical, current or constant prices. Once the
value of the capital goods in a given benchmark year has been determined, the capital value of each
subsequent year is calculated by adding investments of that year (gross capital formation), revaluing
the existing stock and subtracting value of capital goods taken out of operation. The annual
depreciation cost is then calculated, using proper depreciation schedule. The assumed depreciation
rates used for the different components of the vessel are 7% for hull, 25% for engine, 50% for
electronics and 35% for other equipment. The service lives are 25 years for hull, 10 years for engine, 5
years for electronics, 7 years for other equipment.
Table 1. Descriptive statistics of the input and output variables used in the analysis
Variable Small scale vessels Bottom trawlers
Mean value (€) St. deviation Mean value (€) St. deviation
Input variables
1
The data used in the analysis is part of a larger data set collected in the framework of the Greek National Fisheries Data
Collection Program 2013 (in application of the EC decision 93/2010). For the purpose of the analysis only data concerning
small scale fishing vessels and bottom trawlers were used.
304
HydroMedit 2014, November 13-15, Volos, Greece
Output variable
As mentioned by Tinkley et al (2005), the use of revenue as the output measure is not ideal,
as revenue is a function of prices as well as quantity. Consequently, price changes that affect the
output measure independent of input use may be interpreted as changes in technical efficiency. This is
particularly a problem for DEA, as there is the likelihood that price changes affecting all operators
would enter the random error component when using SPF. Further, assuming fishers seek to maximise
profit, a change in relative prices may result in a change in their fishing strategy. As a result, the
function is not truly a production function and the efficiency scores may represent a combination of
allocative as well as technical efficiency. However, the potential biases introduced into the analysis
from using revenue as the output measure are not likely to be large. Squires (1987) and Sharma and
Leung (1998) note that fishers base their fishing strategies on expected prices, the level of technology
and resource abundance. However, price expectations are not always accurate, information on the
variation in abundance of the stock across the fishery is generally not available, and catch composition
is governed largely by fishing gear that is not perfectly species selective.
Changing gears types is time consuming and usually needs to be done on shore rather than at
sea. Hence, the ability of fishers to respond to changes in relative prices by varying their fishing
activity is limited. Several recent studies (e.g. Holland and Sutinen, 2000) have suggested that fishing
activity is largely influenced by habit, with only relatively minor changes in effort allocations in
response to price in the short term.
Furthermore, we consider that the Greek small-scale and bottom trawlers fisheries are
operating in a situation of unbalance ratio between demand and supply, where cultural and economic
factors generate a high demand for seafood products leading to constantly high prices, not
significantly affected by the either landing volume or the season.
Finally, the use of inputs (and outputs) values rather than quantities is very common in
efficiency studies. As is recently proved by Portela (2013), and has been previously mentioned by
Fare et al. (1990) and Banker et al. (2007), when the assumption that fishermen face equal input prices
is hold, then values can be used in the place of quantities and still produce technical efficiency scores.
3. Results
Small-scale vessels
Table 2 provides the descriptive statistics of TE and SE scores for the small-scale vessels in
Greece. It also reports the number of vessels that work under constant, increasing and decreasing
returns to scale technology. On average, small-scale vessels have 0.54 TE scores and therefore,
assuming that they are technically efficient, they can proportionally decrease their inputs by 46% and
still produce the same amount of output. The standard deviation, the min and the max score of TE also
reveal that the results are characterised by high heterogeneity. According to Figure 1, many vessels
have very low efficiency, which suggests that there is room for improvement.
On the other hand, the average scale efficiency score is much higher (0.80). Therefore, on
average, small scale vessels operate close to the optimal scale of production. According to Table 2, the
vast majority of the vessels (72.7%) operate at increasing returns to scale, while 18.1 % operates at
decreasing returns to scale. This is a common finding in the relevant literature (e.g. Fousekis and
Klonaris, 2003; Garcia Del Hoyo et al., 2004; Esmaeili, 2006).
Table 2. Descriptive statistics of TE, SE and scale of operation for small scale vessels.
Variable Mean Standard CV Min Max
Deviation
305
HydroMedit 2014, November 13-15, Volos, Greece
150
40
30
100
Frequency
Frequency
20
50
10
0
0
0 .2 .4 .6 .8 1 0 .2 .4 .6 .8 1
te se
Table 3 provides the results of the Spearman correlation analysis among the efficiency scores
and several other continuous variables. Moreover, Table 4 provides the results of the Mann-Witney
test. These results suggest that the vessels with length less than 6 meters are more technically efficient.
To some extent this can be explained by the high level of flexibility that characterizes small vessels.
These vessels can easily adjust their cost determinants according to the seasonal or regional
productivity of the harvesting. This can be done for example using alternative fishing gear or moving
to a different fishing ground targeting different species or simply by decreasing the level of the
activity and operating only during the (potentially) more productive days.
A similar result was reported by Fousekis and Klonaris (2002), whose empirical results in the
investigation of the Greek trammel netters indicate that larger vessels tend to be less technically
efficient than smaller vessels. They also point out that the crew size plays an important role, since
larger vessels need larger crew. Thus, a large crew size may reduce the ability of a skipper to adjust
the level of other inputs (Fousekis and Klonaris, 2002). Furthermore, it is noteworthy that the small
vessels are generally capable of achieving higher selling prices than big vessels. This can be explained
by several factors, like the limited volume of landings, better marketing strategy, higher product
quality, or, more likely, a combination of these factors. In any case these vessels normally set their
selling strategy on direct sales, without any intermediate intervention. This seems to encourage
fishermen to focus on the product quality, which leads to high selling prices.
Table 3. Spearman correlations of TE and SE scores of the small-scale vessels with technical and
socioeconomic variables
TE SE
Length -0.29** 0.23**
Gt -0.28** 0.23**
revenues 0.25** 0.68**
Days at sea -0.10* 0.28**
Unpaid labour to total labour -0.17** 0.15**
** 0.05 level of significance,
* 0.10 level of significance
Table 4. Variables that define groups with different TE scores in the small-scale fishing segment
Variable that define groups Average TE Z score Result
0-6 m 0.70
Length class 4.87** Small vessels have higher TE
6-12m 0.50
basic 0.56
Skippers with basic education
Level of education 1.64*
perform better
advanced 0.51
306
HydroMedit 2014, November 13-15, Volos, Greece
Yes 0.69
Vessels registered in ―South Vessels in these regions have higher
-2.1**
Aegean‖ and ―Crete‖ SE
No 0.54
Yes 0.50
Vessels whose skipper is very young
Young skipper (less than 40) 1.65*
have less TE
No 0.56
Table 5. Variables that define groups with different TE scores in the small-scale fishing segment
Variable that define groups Average SE Z score Result
0-6 m 0.72
Length class -2.00* Small vessels have higher SE
6-12m 0.82
The results also reveal that TE is lower when the vessel is managed by a skipper younger
than 40 years of age. Moreover, the literacy level appears to have a weak negative effect on TE. One
possible explanation may lie in the fact that in small scale vessels, the outcome of the fishing activity
relies on the experience of the skipper rather than on his formal education or on the use of new
technologies (commonly associated with younger skippers). Furthermore, the experience of the
skipper plays a key role in the selection of the fishing gear, the fishing ground and the fishing day.
These results are not always supported by similar studies. For example, Ali et al. (1996) mention that
formal education is generally associated with increased efficiency as it broadens the producers‘ minds
and enables them to acquire and process relevant information. Moreover, according to Esmaeili
(2006) younger skippers are more efficient than others. Finally, Fousekis and Klonaris (2002),
exploring the efficiency of Greek netters, report that the ‗good skipper‘ is aged about 50, has a literacy
level higher than the primary, and comes from a fishermen family.
The analysis also detected that the vessels operating in the region of East Macedonia and
Thrace score lower TE than the vessels operating in others regions. On the contrary, vessels operating
in the Cyclades Islands and Crete have high TE scores. These regional differences in the TE scores
can be explained by differences in the composition of the catch or differences in the extent of
competition with the large scale vessels for the same fishing ground and/or the same markets. The
fishing grounds in the Cyclades Islands and Crete are characterized by rocky bottoms, while in the
region of East Macedonia and Thrace, sandy grounds are more common. Moreover a lower number of
large scale vessels operate in the Cyclades Islands and Crete.
The Spearman correlation analysis shows, as expected, that the vessels with smaller technical
characteristics (LOA and GT) have higher TE. These vessels are capable of producing the same unit
of output (revenues) with less input. There is also a positive correlation with the revenues generated
by the vessel. The reason may lie on the ability of vessels with higher turnover and cash availability to
invest on new and more efficient fishing gear. The number of days that the vessel spends at sea is
negatively correlated with TE. This could be explained by a more rational fishing strategy (i.e.
operation only under optimal conditions or a close proxy of them).
Finally, a positive correlation was detected between the TE and the presence of the owner
onboard the vessel. This factor was detected by the ratio of unpaid labour to total labour costs. In
general, owner-operated vessels are considered more efficient than others (Esmaeili, 2006; Sharma
and Leung, 1998).
As far as scale efficiency scores are concerned, they are negatively correlated with the length
and the capacity of the vessels, thus bigger vessels have lower SE scores than smaller vessels. This
result is in line with what has already been mentioned about the TE; for the Greek small scale fleet it
seems that the smaller the vessel the better the (overall) efficiency. A positive correlation was detected
with the unpaid labour, that indicates the presence onboard of the owner. This results is in line with
what detected for the TE.
307
HydroMedit 2014, November 13-15, Volos, Greece
Bottom trawlers
Table 6 provides the descriptive statistics of TE and SE scores for the Greek bottom trawlers.
The table also reports the number of the vessels that operate under constant, increasing and decreasing
returns to scale. On average, bottom trawlers TE scores are very high (0.83), indicating that, provided
that they are technically efficient, fishermen can reduce their inputs by 17% and still produce the same
amount of output. The descriptive statistics and the histogram (Figure 2) reveal that TE scores in the
case of bottom trawlers are more tightly clustered around the average, than in the case of the small-
scale vessels.
As far as scale efficiency is concerned, it is on average equal to 0.76. As expected, the 82%
of the vessels operates under increasing returns to scale, which means that the main reason for scale
inefficiencies is the sub-optimal size of the vessels.
DRS 0 vessels
Table 7 provides the results of the Spearman correlation analysis among the efficiency scores
and several other characteristics of the vessels and their skippers. Moreover, Table 7 provides the
results of the Mann-Whitney test. Unlike the small-scale vessels, the TE of bottom trawlers is not
associated with any technical (LOA and GT) as well social (age and literacy level of the skipper)
factor. This was expected since, unlike small-scale vessels, the majority of trawlers operate at a
similar TE level. Furthermore, from a technical point of view, this segment is more homogenous,
since all vessels use similar fishing gear and exhibit similar fishing behaviour. It is noteworthy that the
gross cash flow per vessel is positively correlated with the TE. This could be explained by the higher
cash availability which is associated to higher investments in fishing equipment and technology.
As far as scale efficiency is concerned, the results indicate that, unlike small-scale vessels,
the SE of trawlers is positively correlated with the technical characteristics of the vessels (LOA and
GT). Thus, it is more likely that large vessels produce at the optimal input-output combination
compare to smaller vessels. Finally, the SE is positively correlated with the gross cash flow. This
correlation can be explained by the higher cash availability which leads to investment in better fishing
equipment (gear and vessel).
15
15
10
10
Frequency
Frequency
5
5
0
0 .2 .4 .6 .8 1 0 .2 .4 .6 .8 1
te se
308
HydroMedit 2014, November 13-15, Volos, Greece
4. Discussion
In this analysis the technical and scale efficiency of the Greek fishing fleet was explored. The
analysis focused on small scale, coastal fisheries as well as bottom trawlers, indicating similarities and
differences among the two fleet segments. The issue of efficiency was explored using an input
oriented data envelopment analysis model. The data used in the analysis were collected through a
sample data survey and involve cost and revenue parameters. Four variable inputs were taken into
consideration, namely, fuel cost, personnel cost, repair and maintenance cost and other running costs.
Also, annual depreciation cost was used as a fixed input variable and annual revenues represent the
output of the fishing activity. Additional information regarding the characteristics of the vessel (length
and capacity) as well as characteristics of the skipper (age and education level) were also available
and tested for correlation with the technical and scale efficiency.
The results of the analysis indicate that small scale vessels achieve a small average technical
efficiency of 0.54 but much higher scale efficiency (0.80). The results of the analysis also indicate that
small vessels achieve higher technical and scale efficiency scores. This means that in coastal fisheries,
smaller vessels have the ability to better manage their resources.
On the other hand, the results of the analysis indicate that bottom trawlers achieve high scale
but also technical efficiency scores. The bottom trawlers fleet segment is more homogenous,
regarding the technical efficiency scores, regardless of the size of the vessel, though size is positively
correlated with high scale efficiency scores.
One important finding of the analysis is that technical efficiency is positively correlated with
the age and therefore the experience of the skipper, though age is negatively correlated with scale
efficiency. Education appears to have no effect on technical and scale efficiency of small scale
vessels. As far as trawlers are concerned, the characteristics of the skipper have no effect on technical
or scale efficiency.
Overall, the results of the analysis suggest that in small scale fisheries, efficiency relies
mainly on qualitative factors, like the experience of the skipper. On the other hand, the high efficiency
scores of the bottom trawlers are the result of the improved technology these vessels utilize. For
trawlers, qualitative factors, like the experience of the skipper, have no significant impact on
efficiency. In a looser context, it can be said that small scale coastal fisheries rely on skills, while
bottom trawlers fisheries rely on technology.
Furthermore, the results of the analysis, suggest that there is room for improvement in the
efficiency of mainly small scale vessels, which will allow for the achievement of the same level of
output, but with reduced inputs. This can be achieved reducing the level of activity of the segment by
decreasing the total number of operating vessels or decreasing the days at sea per vessel. The former
proposal being more practical. On the other hands, the bottom trawl fleet seems to have a more
balanced level of activity.
Acknowledgements
The research was funded by the Greek National Program of Data Collection for Fisheries
Sector, Part Socio Economic Variables, through the study, ―The socioeconomic Survey of Greek
Fisheries‖. The authors would like to thank Prof. K. Galanopoulos for his helpful and insightful
comments.
References
Ali, F., Parikh, A., Shah, M. K. (1996). Measurement of economic efficiency using the behavioral and
stochastic cost frontier approach. Journal of Policy Modelling, 18(3), 271-287.
Banker, R. D., Charnes, A., Cooper, W.W. (1984). Some models for estimating technical and scale
inefficiencies in data envelopment analysis. Management science, 30(9), 1078-1092.
Banker, R., Chang, H., Natarajan, R. (2007). Estimating dea technical and allocative inefficiency
using aggregate cost or revenue data. Journal of Productivity Analysis, 27:115-121.
Charnes, A., Cooper, W.W., Rhodes, E. (1978). Measuring the efficiency of decision making units.
European journal of operational research, 2(6), 429-444.
Coelli T. (1996). A guide to DEAP Version 2.1: a Data Envelopment Analysis (computer) program.
Department of Econometrics University of New England. CEPA Working Papers 96/08.
309
HydroMedit 2014, November 13-15, Volos, Greece
Coelli, T., Grifell-Tatje, E., Perelman, S. (2002). Capacity utilisation and profitability: A
decomposition of short-run profit efficiency. International Journal of Production Economics,
79(3), 261-278.
Coelli, T. J., Rao, D.S.P., O'Donnell, C.J., Battese, G.E. (2005). An introduction to efficiency and
productivity analysis. Springer.
Eggert, H. (2001). Technical efficiency in the Swedish trawl fishery for Norway lobster. In Working
Papers in Economics (Göteborg University, Department of Economics).
Esmaeili, A. (2006). Technical efficiency analysis for the Iranian fishery in the Persian Gulf. ICES
Journal of Marine Science, 63(9), 1759-1764.
FAO (1998). Report of the FAO technical working group on the management of fishing capacity. La
Joya, USA, 15-18, April.
Farrell, M. J. (1957). The measurement of productive efficiency. Journal of the Royal Statistics
Society, Series A, 120: 253-281.
Fare, R., Grosskopf, S., Lee, H. (1990). A nonparametric approach to expenditure constrained profit
maximization. American Journal of Agricultural Economics, 12(3):574-581.
Fousekis, P., Klonaris, S., 2003. Technical efficiency determinants for fisheries: a study of trammel
netters in Greece. Fisheries Research, 63: 85-95.
Garcia del Hoyo, J.J., Castilla Espino, D., Jimenez Toribio, R. (2004). Determination of technical
efficiency of fisheries by stochastic frontier models: a case on the Gulf of Cadiz (Spain). ICES
Journal of Marine Science, 61: 416-421.
Grafton, R. Q., Squires, D., Fox, K. J. (2000). Private property and economic efficiency: a study of a
common-pool resource. Journal of Law and Economics, 43: 679:714.
Grafton, R.Q., Kirkley, J., Kompas, T. Squires, D. (2006). Economics for Fisheries Management,
Ashgate, Hampshire, United Kingdom.
Herrero, I., Pascoe, S. (2002). Estimation of technical efficiency: a review of some of the stochastic
frontier and DEA software. Computers in Higher Education Economics Review, 15(1).
Holland, D. S., Sutinen, J. G. (2000). Location Choice in New England Trawl Fisheries: Old Habits
Die Hard. Land Economics, 76(1).
IREPA Onlus-Italy., IFREMER-France., FOI-Denmark., SEAFISH-United Kingdom., LEI BV-
Netherlands., FRAMIAN BV-Netherlands (2006). Evaluation of the capital value, investments
and capital costs in the Fisheries sector. No FISH/2005/03, October 2006.
Kirkley, J. E., Squires, D., Strand, I. E. (1995). Assessing technical efficiency in commercial fisheries:
the mid-Atlantic sea scallop fishery. American Journal of Agricultural Economics, 77: 686-697.
Kirkley, J. E., Squires, D., Strand, I. E. (1998). Characterizing managerial skill and technical
efficiency in a fishery. Journal of Productivity Analysis, 9: 145:160.
Kirkley, J., Morrison, C. J., Squires, D. (2002). Capacity and capacity utilization in common-pool
resource industries. Environmental and Resource Economics, 22: 71-97.
Kumbhakar, S.C., Lovell, C.A.K. (2000). Stochastic Frontier Analysis. Cambridge University Press,
Cambridge.
Lindebo, E., Hoff, A. Vestergaard N. (2007). Revenue-based capacity utilisation measures and
decomposition: The case of Danish North Sea trawlers. European Journal of Operational
Research 180:215-222
Maravelias, C.D., Tsitsika, E.V. (2008). Economic efficiency analysis and fleet capacity assessment in
Mediterranean fisheries. Fisheries Research, 93(1), 85-91.
Pascoe, S., Andersen, J.L., de Wilde, J.W. (2001). The impact of management regulation on the
technical efficiency of vessels in the Dutch beam trawl fishery. European Review of Agricultural
Economics, 49:16-33.
Pascoe, S., Coglan, L. (2002). The contribution of unmeasurable inputs to fisheries production: an
analysis of technical efficiency of fishing vessels in the English Channel. American Journal of
Agricultural Economics, 84(3), 585-597.
Pascoe, S., Ward, J., Kirkley, J. E., Greboval, D. F., Morrison, C. J. (2003). Measuring and assessing
capacity in fisheries: Issues and methods (Vol. 2). Food Agriculture Org.
Pascoe, S., Mardle, S., Tingley, D. (2004), Capacity appraisal in the English Channel fisheries. In
AdriaMed Seminar on Fishing Capacity: Definition, Measurement and Assessment (p. 67).
Portela, M. C. (2013). Value and quantity data in economic and technical efficiency measurement
(No. 03). Faculdade de Economia e Gestão, Universidade Católica Portuguesa (Porto).
Reid, C., Squires, D., Jeon, Y., Rodwell, L., Clarke, R. (2003). An analysis of fishing capacity in the
western and central Pacific Ocean tuna fishery and management implications. Marine Policy, 27:
449-469.
310
HydroMedit 2014, November 13-15, Volos, Greece
Sharma, K. R., Leung, P. (1998). Technical Efficiency of the Longline Fishery in Hawaii: An
Application of a Stochastic Production Frontier. Marine Resource Economics, 13:259-27.
Siegel, S. Castellan, N.J. (1988). Nonparametric Statistics for the Behavioural Sciences. New York:
McGraw-Hill.
Squires, D. (1987). Public regulation and the structure of production in multiproduct industries: an
application to the New England otter trawl industry. The Rand Journal of Economics, 232-247.
Tingley, D., Pascoe, S., Coglan, L. (2005). Factors affecting technical efficiency in fisheries:
stochastic production frontier versus data envelopment analysis approaches. Fisheries Research,
73:363-376
Tsitsika E.V, Maravelias, C.D, Wattage, P., Haralabous J. (2008), Fishing capacity and capacity
utilization of purse seiners using data envelopment analysis. Fisheries Science, 74:730–735
Vestergaard, N., Squires, D., Kirkley, J. (2003). Measuring capacity and capacity utilization in
fisheries: the case of the Danish gill-net fleet. Fisheries Research, 60: 357-368.
311
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
Scientific diving is a valuable tool for collecting data, which are useful in a wide range of disciplines
such as biology, archeology, geology, etc. For an effective and well-defined scientific diving and
in order to avoid any kind of problems both practical and theoretical, a legal framework to
regulate the characteristics of scientific diving is needed. Although recreational diving is now
experiencing a significant growth in Greece, however, scientific diving is not recognized by the
Greek legislation, only slightly, under legislation destined for other forms of diving.
Key words: Scientific diving, legislation.
*
Corresponding author: Longinidis Panagiotis (longinidis@gmail.com)
1.Faculté de Droit et Science Politique, Université Toulouse 1 Capitole, 2 rue Doyen Gabriel Marty,
F-31042 Toulouse cedex 9, France
2.Σιήια Σεπκμθμβίαξ Αθζείαξ ηαζ Τδαημηαθθζενβεζχκ, Α.Σ.Δ.Η.Θ., Ν. Μζθηζάδδ 1, 63200, Νέα
Μμοδακζά, Δθθάδα
Πενίθδρδ
Ζ επζζηδιμκζηή ηαηάδοζδ απμηεθεί έκα πμθφηζιμ ενβαθείμ βζα ηδ ζοθθμβή ηαζ ηδκ ηαηαβναθή
δεδμιέκςκ, ηα μπμία είκαζ δοκαηυ κα αλζμπμζδεμφκ ζε έκα εονφ θάζια επζζηδιχκ υπςξ είκαζ δ
Βζμθμβία, δ Ανπαζμθμβία, δ Γεςθμβία, η.ά. Γζα ιζα απμηεθεζιαηζηή ηαζ ζαθχξ μνζζιέκδ
επζζηδιμκζηή ηαηάδοζδ ηαζ πνμηεζιέκμο κα απμθεοπεμφκ πάζδξ θφζεςξ πνμαθήιαηα ηυζμ ζε
πναηηζηυ (αθ. ζπέζεζξ ιε δζμίηδζδ) υζμ ηαζ ζε εεςνδηζηυ επίπεδμ, ηαείζηαηαζ αοηυιαηα ακαβηαία δ
φπανλδ εκυξ κμιμεεηζημφ πθαζζίμο πμο κα νοειίγεζ ηα παναηηδνζζηζηά ηδξ επζζηδιμκζηήξ
ηαηάδοζδξ. Ακ ηαζ δ ηαηάδοζδ ακαροπήξ πθέμκ βκςνίγεζ ιία ζδιακηζηή ακάπηολδ ζηδκ Δθθάδα,
εκημφημζξ δ επζζηδιμκζηή ηαηάδοζδ δεκ ακαβκςνίγεηαζ άιεζα απυ ηδκ εθθδκζηή κμιμεεζία, πανά
ιυκμ απμζπαζιαηζηά, ζηα πθαίζζα κμιμεεηδιάηςκ πνμμνζζιέκςκ βζα άθθεξ ιμνθέξ ηαηάδοζδξ.
Λέλεζξ Κθεζδζά: Δπζζηδιμκζηή ηαηάδοζδ, κμιμεεζία.
*οββναθέαξ επζημζκςκίαξ: Λμββζκίδδξ Πακαβζχηδξ (longinidis@gmail.com)
1. Δηζαγσγή
Ζ επζζηδιμκζηή ηαηάδοζδ (βαθθζηά plongée scientifique, αββθζηά scientific diving) απμηεθεί εηείκμ
ημ είδμξ ηδξ εθεφεενδξ ηαηάδοζδξ πμο πναβιαημπμζείηαζ απυ αίηζα ηαεανά επζζηδιμκζηχκ
ακαγδηήζεςκ ηαζ είκαζ δοκαηυ κα επζπεζνδεεί είηε αημιζηά, είηε απυ ζφκμθμ δοηχκ, ιε ηδ πνήζδ ή υπζ
επζζηδιμκζηχκ μνβάκςκ ηαζ αμδεδιάηςκ (American Academy of Underwater Sciences, 2013).
ημπυξ ηδξ είκαζ δ παναημθμφεδζδ ηαζ ζοθθμβή επζζηδιμκζηχκ ηαζ ιυκμκ εονδιάηςκ, ηα μπμία
ζοκδέμκηαζ άιεζα ιε ημκ οπμεαθάζζζμ ηυζιμ ηαζ είκαζ δοκαηυ κα απμηηδεμφκ ηονίςξ ιε αοηυκ ημκ
ηνυπμ ηδξ ηαηάδοζδξ. Ονίγεηαζ δε ςξ πςνζζηυξ ηφπμξ ηαηάδοζδξ ηαεχξ δε δφκαηαζ κα πενζθδθεεί ζε
άθθμοξ ηφπμοξ αοηυκμιδξ ηαηάδοζδξ υπςξ ηδκ ηαηάδοζδ ακαροπήξ, ηδκ επαββεθιαηζηή ηαηάδοζδ ή
ηδκ ηαηάδοζδ βζα θυβμοξ πμο επζαάθθεζ δ αζθάθεζα ή ιία έηηαηηδ ακάβηδ (ΦΔΚ 273α'/2005. Νυιμξ
3409 ). Δίκαζ δε παναηηδνζζηζηυ υηζ, δ επζζηδιμκζηή ηαηάδοζδ είκαζ δοκαηυ κα ειπενζέπεζ ηαζ άθθμοξ
ηφπμοξ αημιζηήξ ηαηάδοζδξ ηαεχξ είκαζ πμθοδζάζηαηδ ηαζ αθμνά ζε ιία ζεζνά ηθάδςκ υπςξ δ
αζμθμβία, δ ανπαζμθμβία, δ θοζζηή ςηεακμβναθία, δ πδιζηή ςηεακμβναθία ηαζ δ βεςθμβία ηαζ είκαζ
δοκαηυ κα απαζηεί ηαζ εζδζηέξ βκχζεζξ, αοηέξ ηδξ ηαηάδοζδξ ηαη' επάββεθια (CMAS (xi), 2000),.
Ζ παναπάκς εκκμζμθμβζηή πνμζέββζζδ ηδξ επζζηδιμκζηήξ ηαηάδοζδξ ηνίκεηαζ ακαβηαία ζημκ ααειυ
πμο πνυηεζηαζ κα δζενεοκδεεί ημ εβπχνζμ κμιζηυ πθαίζζμ ζε ζοκάνηδζδ ιε ηδ δζεεκή οθζζηάιεκδ
ηαηάζηαζδ (Sayer et al., 2008).
312
HydroMedit 2014, November 13-15, Volos, Greece
3. Απνηειέζκαηα-πδήηεζε
3.1. Ηζρχνλ εζληθφ δίθαην
3.1.1. χληαγκα
Ζ ζοκηαβιαηζηή εειεθίςζδ ηδξ εθεφεενδξ ηαηάδοζδξ ηαζ ηδξ επζζηδιμκζηήξ ηαηάδοζδξ ςξ ηιήια
αοηήξ εδνάγεηαζ ζημ άνενμ 5 ημο οκηάβιαημξ, ημ μπμίμ ακαδεζηκφεζ ηδκ εθεφεενδ ακάπηολδ ηδξ
πνμζςπζηυηδηαξ ημο ηαεεκυξ, υηακ αοηή δεκ πνμζαάθεζ ηα δζηαζχιαηα ηςκ άθθςκ, εκχ επζπθέμκ
εθανιυγεηαζ εζδζηά βζα ηδκ επζζηδιμκζηή ηαηάδοζδ ημ άνενμ 16 , ημ μπμίμ οπμπνεχκεζ ηδκ
Πμθζηεία κα πνμάβεζ ηδκ επζζηήιδ ηαζ ηδκ ένεοκα, μζ μπμίεξ ιε ηδ ζεζνά ημοξ είκαζ εθεφεενεξ βζα ημοξ
πμθίηεξ ηαζ παίνμοκ ημκ ζεααζιυ ηαζ ηδκ πνμχεδζή ημοξ απυ ημ ηνάημξ. Άθθςζηε, δ επζζηδιμκζηή
ηαηάδοζδ ζοκδέεηαζ άιεζα ιε ημ άνενμ 22 , ημ μπμίμ εέηεζ ςξ ααζζηυ εειέθζμ ηςκ αημιζηχκ
δζηαζςιάηςκ ηδκ πνμζηαζία απυ ημ Κνάημξ ηδξ ενβαζίαξ ηαζ ηδκ οπμπνέςζδ ημο ηεθεοηαίμο κα
ιενζικά βζα ηδ δδιζμονβία ηςκ ηαηάθθδθςκ ζοκεδηχκ απαζπυθδζδξ ηςκ πμθζηχκ. Σμ φκηαβια
θμζπυκ, ημ μπμίμ ηαηζζπφεζ υθςκ ηςκ οπμθμίπςκ ααειίδςκ εεζιμεεηδιέκςκ κυιςκ ηαζ άθθςκ
κμιμεεηδιάηςκ, δείπκεζ ζαθχξ ηδκ εφκμζά ημο πνμξ ηδ δδιζμονβία εκυξ ζοιπαβμφξ κμιμεεηήιαημξ,
ημ μπμίμ εα πνέπεζ κα νοειίγεζ ηα γδηήιαηα ηδξ αοηυκμιδξ ηαηάδοζδξ ηαζ πζμ ζοβηεηνζιέκα ηδξ
επζζηδιμκζηήξ ηαηάδοζδξ.
3.1.2. Νφκνη
Μία πνχηδ ένεοκα ηςκ εεζπζζιέκςκ εθθδκζηχκ κυιςκ ζπεηζηά ιε ηζξ ηαηαδφζεζξ ιπμνεί εφημθα κα
ηαηαθήλεζ ζηδ δζαπίζηςζδ υηζ δ επζζηδιμκζηή ηαηάδοζδ, ςξ ηιήια ηδξ αοηυκμιδξ ηαηάδοζδξ,
μοδέπμηε έςξ ηχνα δεκ απαζπυθδζε ημκ Έθθδκα κμιμεέηδ, πανυθμ ημ εκδζαθένμκ πμο πανμοζζάγεζ
ημ γήηδια ζε εονςπασηυ ηαζ παβηυζιζμ επίπεδμ. Χζηυζμ, εα πνέπεζ κα ενεοκδεεί δ ζπεηζηή
κμιμεεζία πενί αοηυκμιςκ ηαηαδφζεςκ, δ μπμία mutatis mutandis δφκαηαζ κα εθανιμζηεί ζηδκ
πενίπηςζδ ηδξ επζζηδιμκζηήξ ηαηάδοζδξ, πμο μζ δφμ αοηέξ ηαοηίγμκηαζ ή ζοκακηζμφκηαζ.
Ζ αοηυκμιδ ηαηάδοζδ (scuba diving) θαίκεηαζ κα ακηζιεηςπίγεηαζ πνχηδ θμνά απυ ημκ Έθθδκα
κμιμεέηδ ιε ηδκ οπ'ανζει. 3131.1/9/1994 Τπμονβζηή απυθαζδ ημο Τπμονβμφ Διπμνζηή Ναοηζθίαξ
(ΦΔΚ 858/1994), δ μπμία αθμνά ζηδκ έβηνζζδ ημο Γεκζημφ Κακμκζζιμφ Λζιέκα, ανζει. 5 ηαζ ζημκ
μπμίμ νδηχξ μνίγεηαζ ςξ εναζζηέπκδξ πηοπζμφπμξ αοημδφηδξ, «απηόο πνπ έρεη εξαζηηερληθό πηπρίν
απηνδύηε από Διιεληθό ή αλαγλσξηζκέλν αιινδαπό θέληξν εθκάζεζεο ππνβξύρηαο θνιύκβεζεο κε
απηόλνκε θαηαδπηηθή ζπζθεπή παξνρήο αέξα». Δφημθα, θμζπυκ, ακηζθαιαάκεηαζ ηάπμζμξ υηζ
ακαθυβςξ, ημ εκ θυβς οπ'ανζει. 2§3 άνενμ ηδξ πνμηείιεκδξ Τπμονβζηήξ απυθαζδξ, εθανιυγεηαζ ηαζ
ζηδκ πενίπηςζδ ημο επζζηδιμκζημφ δφηδ. Απαναίηδηδ, θμζπυκ, πνμτπυεεζδ πνμηεζιέκμο κα εεςνδεεί
επζζηήιςκ δφηδξ μ εναζζηέπκδξ δφηδξ είκαζ δ απυηηδζδ απυ ημκ αοημδφηδ εκυξ πηοπίμο ζηακμφ κα
επζηνέπεζ ηδκ ηαηάδοζδ.
ημ πθαίζζμ πμο δ επζζηδιμκζηή ηαηάδοζδ ζοκδέεηαζ ζοπκά ιε ηδκ εηηέθεζδ εκυξ επαββέθιαημξ ή ηδ
ιενζηή άζηδζδ αοημφ, δ εέζπζζδ ηδξ επαββεθιαηζηήξ ηαηάδοζδξ ιε ηδκ έβηνζζδ ημο Γεκζημφ
Κακμκζζιμφ Λζιέκα αν. 10 (ΦΔΚ 978/1995) εα ιπμνμφζε κα ηφπεζ εθανιμβήξ ηαζ ζηδκ πενίπηςζδ
ηδξ επζζηδιμκζηήξ ηαηάδοζδξ, εθυζμκ αοηή πναβιαημπμζείηαζ ζοπκά απυ επαββεθιαηίεξ επζζηήιμκεξ
ηαζ ζημπεφεζ ζηδκ άζηδζδ ηςκ επαββεθιαηζηχκ ημοξ οπμπνεχζεςκ. Χζηυζμ, ιζα ζε αάεμξ ακάβκςζδ
ηδξ εκ θυβς Τπμονβζηήξ απυθαζδξ, ιαξ απμιαηνφκεζ απυ ημκ επζδζςηυιεκμ βζα ειάξ ζημπυ ιζαξ ηαζ
ζηδκ πανάβναθμ 1 ημο άνενμο 2 ανζειμφκηαζ απμηθεζζηζηά μζ ενβαζίεξ ημο επαββεθιαηία δφηδ:
«Κάζε εξγαζία, πνπ δηελεξγείηαη θάησ από ηελ επηθάλεηα ηεο ζάιαζζαο, όπσο επηζεώξεζε, επηζθεπή,
αλέιθπζε, δηάιπζε πινίνπ, πθαινθαζαξηζκόο ή άιιεο ζπλαθείο εξγαζίεο θαη ζρεηίδεηαη κε ηα πινία ή ηα
πισηά λαππεγήκαηα θαζώο θαη κε ηελ εθηέιεζε ιηκεληθώλ ή άιισλ ππνβξύρησλ έξγσλ».
Πανάθθδθα, δ πανάβναθμξ 5 ημο ίδζμο άνενμο ένπεηαζ κα αεααζχζεζ ημκ απμηθεζζιυ ημο επζζηήιμκα
δφηδ απυ ημκ δφηδ πμο ηαηαδφεηαζ βζα ηδκ άζηδζδ επαββέθιαημξ, μνίγμκηαξ ημκ ηεθεοηαίμ ςξ «ηνλ
εξγαδόκελν θαη' επάγγεικα θάησ από ηελ επηθάλεηα ηνπ λεξνύ θαη πθηζηακέλνπ πηέζεηο ίζεο ή
κεγαιύηεξεο ηεο αηκνζθαηξηθήο, κε νπνηνπδήπνηε ηύπνπ θαηαδπηηθή ζπζθεπή, απηόλνκε ή εμαξηώκελε
από ηελ επηθάλεηα, κέζα ζηα πιαίζηα ησλ πεξηνξηζκώλ ηνπ παξόληνο θαη ηνπο λόκνπο ηεο ηέρλεο θαη ηεο
επηζηήκεο». Ο επζζηήιςκ δφηδξ δεκ ενβάγεηαζ ηάης απυ ηδκ επζθάκεζα ημο κενμφ, πανά δ ηαηάδοζδ
δφκαηαζ - υπζ οπμπνεςηζηά - κα ζοιπθδνχκεζ ηδκ επζζηδιμκζηή ημο ένεοκα, πςνίξ αοηή κα απμηεθεί
ηδκ ηφνζα επαββεθιαηζηή ημο αζπμθία. Δπζπθέμκ, εκχ βζα ηδκ επαββεθιαηζηή ηαηάδοζδ πνμαθέπεηαζ
313
HydroMedit 2014, November 13-15, Volos, Greece
δ δζαδζηαζία απυηηδζδ άδεζαξ ηαηάδοζδξ απυ ηδ Λζιεκζηή Ανπή, δεκ έπεζ πνμαθεθεεί δ απυηηδζδ
ακηίζημζπδξ άδεζαξ βζα ημκ επζζηήιμκα δφηδ ιε απμηέθεζια αοηυξ κα αμοηάεζ ζε κμιζηυ ηεκυ ηαζ ζε
απμοζία κμιζηήξ ηάθορδξ. Χζηυζμ, ζπμοδαίμ γήηδια ηδξ εκ θυβς Τπμονβζηήξ απυθαζδξ πμο εα
ιπμνμφζε εκ δοκάιεζ κα απμηεθέζεζ ιεβάθμ ειπυδζμ ζηδκ επζζηδιμκζηή ηαηάδοζδ ηαζ ζοκδβμνεί
ζηδκ ακαβηαζυηδηα εζδζηήξ κμιμεεηζηήξ νφειζζδξ ηδξ επζζηδιμκζηήξ ηαηάδοζδξ απμηεθεί ημ άνενμ
11, ημ μπμίμ πνμαθέπεζ ηδ πμνήβδζδ εζδζηήξ άδεζαξ ηαηάδοζδξ απυ ηδ Λζιεκζηή Ανπή ζηδκ
επαββεθιαηζηή ηαηάδοζδ, δ απμοζία ηδξ μπμίαξ, ηαεζζηά πανάκμιδ ηδκ αοηυκμιδ ηαηάδοζδ βζα
επαββεθιαηζημφξ θυβμοξ.
Ζ ζπμοδαζυηενδ ελέθζλδ ζημ δίηαζμ πενί ηαηαδφζεςκ επήθεε ιε ημκ οπ‘ανζει. 3409/2005 κυιμ (ΦΔΚ
273.4/11/2005), μ μπμίμξ ζημ άνενμ 3, μνίγεζ ημκ μνβακζζιυ πζζημπμίδζδξ αοημδοηχκ, ζοκδέμκηάξ
ημκ ιε ημοξ δφηεξ ακαροπήξ ηαζ ηδκ ακηίζημζπδ εηπαίδεοζδ ηδκ μπμία αοημί μθείθμοκ κα θάαμοκ,
πνζκ πζζημπμζδεμφκ. Με ιία δζαζηαθηζηή ενιδκεία ημο πανυκημξ κμιμεεηήιαημξ ηαζ εθθείρεζ εζδζηήξ
κμιμεεζίαξ βζα ηδκ επζζηδιμκζηή ηαηάδοζδ, δφκαηαζ μ επζζηήιςκ δφηδξ κα οπαπεεί ζηδκ ηαηδβμνία
ημο πνμξ ακαροπή δφηδ, ηαεχξ αοηυξ ζίβμονα δεκ πναβιαημπμζεί ηζξ ενβαζίεξ υπςξ απανζειμφκηαζ
ζηδκ οπ‘ανζει. 3131.1/20/95 (ΦΔΚ 978/1995) Τπμονβζηή απυθαζδ. Χζηυζμ, ιία ηέημζα ενιδκεία
είκαζ πζεακυ κα ηαηαζηναηδβήζεζ ημκ επζδζςηυιεκμ ζημπυ ημο εκ θυβς κυιμο, μ μπμίμξ ίζςξ
ακηζιεηχπζγε κμιζηά δζαθμνεηζηά ημκ επζζηήιμκα δφηδ ζε ζπέζδ ιε ημκ δφηδ πνμξ ακαροπή.
φιθςκα θμζπυκ ιε ημκ εκ θυβς κυιμ, αηυια ηαζ ακ εεςνδεεί αιθζζαδημφιεκδ δ ελ επαβςβήξ
οπαβςβή ημο επζζηήιμκα δφηδ ζηδκ ηαηδβμνία ημο δφηδ ακαροπήξ, εεςνείηαζ αέααζδ δ ακάθμβδ
εθανιμβή ζηδκ επζζηδιμκζηή ηαηάδοζδ ημο άνενμο 11§1 ημο εκ θυβς κυιμο, ημ μπμίμ απαβμνεφεζ
ηζξ ηαηαδφζεζξ πάνζκ ακαροπήξ ιε ακαπκεοζηζηέξ ζοζηεοέξ ή άθθα οπμεαθάζζζα ιέζα α) ζε
πνμζδζμνζζιέκεξ απυ ηζξ ανιυδζεξ οπδνεζίεξ ημο Τπμονβείμο πμθζηζζιμφ εαθάζζζεξ πενζμπέξ
εκαθίςκ ανπαζμθμβζηχκ πχνςκ ζφιθςκα ιε ηα μνζγυιεκα ζηα άνενα 12 ηαζ 15 ημο κ. 3028/2002 ηαζ
α) ζε ζοβηεηνζιέκα μζημθμβζηά εοαίζεδηα εαθάζζζα μζημζοζηήιαηα ζφιθςκα ιε ημοξ κυιμοξ
1650/1986, 3044/2002 ηαζ ηδκ Κ.Τ.Α. 33318/3028/1998.
πςξ πνμηφπηεζ απυ ηδκ ανίειδζδ υθςκ ηςκ πενζπηχζεςκ απαβυνεοζδξ ηαηάδοζδξ πνμξ ακαροπή,
αοηή επζαάθθεηαζ θυβς δζαζθάθζζδξ ζοθθμβζηχκ (πενζαάθθμκ, ανπαζμθμβζηή αλία) ή αημιζηχκ
(αζθάθεζα) εκκυιςκ αβαεχκ, ηα μπμία είκαζ πζεακυκ κα εζπημφκ ηαηά ηδ δζαδζηαζία ηδξ οπμανφπζαξ
ημθφιαδζδξ. Πνυηεζηαζ θμζπυκ βζα έκκμια αβαεά ηςκ μπμίςκ δ ζπμοδαζυηδηα είκαζ ανηεηή χζηε κα
πενζμνίζεζ ημ κμιζηά ηαημπονςιέκμ δζηαίςια ηδξ αοηυκμιδξ ηαηάδοζδξ ηαζ δδ αοηήξ πνμξ ακαροπή.
Ακαθμβζηά, εα ιπμνμφζε ηάπμζμξ κα επζηαθεζηεί υηζ ημ ίδζμ ζζπφεζ ηαζ βζα ηδκ επζζηδιμκζηή
ηαηάδοζδ, δ μπμία δε εα ιπμνμφζε κα ηαηζζπφζεζ ηςκ εκκυιςκ δζηαζςιάηςκ ή αβαεχκ πμο
πνμζηαηεφμκηαζ ιε ηζξ δζαηάλεζξ πενί ελαζνέζεςξ ηδξ ηαηάδοζδξ πνμξ ακαροπή ζε υθδ ηδκ
επζηνάηεζα. Χζηυζμ, ζηδκ πενίπηςζδ αοηή, έπμοιε ηδκ ελήξ παναδμλυηδηα, άιεζα ζοκδεδειέκδ ιε
ηδκ επζζηδιμκζηή ηαηάδοζδ, δ μπμία δζαθμνμπμζείηαζ ςξ πνμξ ημ ηίκδηνμ ημο δφηδ απυ ηδκ ηαηάδοζδ
πνμξ ακαροπή: δ επζζηδιμκζηή ηαηάδοζδ ζοκδέεηαζ ζοπκά ιε πχνμοξ βζα ημοξ μπμίμοξ πνμαθέπεηαζ
απαβυνεοζδ ηαηάδοζδξ ηαηά ημ άνενμ 11 ημο κ. 3409/2005. Καζ ζε αοηήκ ηδκ πενίπηςζδ,
απμδεζηκφεηαζ πενίηνακα ημ κμιζηυ ηεκυ ζηδκ ακηζιεηχπζζδ ημο επζζηήιμκα δφηδ, μ μπμίμξ
ειπμδίγεηαζ ζηδκ μθμηθήνςζδ ηδξ ένεοκαξ ημο υζμ ημ πεδίμ ένεοκάξ ημο είκαζ απνμζπέθαζημ ζε
επίπεδμ πνμζέββζζδξ, δδθαδή ημο απαβμνεφεηαζ κα ηαηαδοεεί ζε εηείκμκ ημ πχνμ. Δλαίνεζδ ζηδκ ςξ
άκς πνμαθδιαηζηή νφειζζδ, απμηεθεί ημ άνενμ 16 ημο ίδζμο κυιμο, υπμο ακαθένεηαζ ζηζξ
ενεοκδηζηέξ ηαηαδφζεζξ ςξ ελαζνεηέεξ ημο πανυκημξ κυιμο, εθυζμκ αοηέξ πναβιαημπμζμφκηαζ απυ ημ
Δθθδκζηυ Κέκηνμ Θαθαζζίςκ Δνεοκχκ (ΔΛ. ΚΔ. Θ. Δ.). Αοηή είκαζ ιία απυ ηζξ δφμ πενζπηχζεζξ
νφειζζδξ επζζηδιμκζηήξ ή ηαθφηενα ενεοκδηζηήξ ηαηάδοζδξ, μζ μπμίεξ νοειίγμκηαζ ιε ζαθήκεζα απυ
ημκ κυιμ, ηαεχξ ζδζαίηενμ εκδζαθένμκ έπεζ ηαζ δ δεφηενδ νφειζζδ ημο άνενμο 13 πενί «Πεξηνρώλ
Οξγαλσκέλεο Αλάπηπμεο Καηαδπηηθνύ Πάξθνπ», ζηζξ μπμίεξ είκαζ δοκαηή δ ηαηάδοζδ βζα
επζζηδιμκζηή ένεοκα, πςνίξ υιςξ κα μνίγεηαζ πμζμξ κμιζιμπμζείηαζ κα πναβιαημπμζεί ηδκ ένεοκα.
Γοζηοπχξ, παναηδνείηαζ ηαζ εδχ δ αζοκέπεζα ημο κμιμεέηδ ηαεχξ εκχ πνμαθέπεηαζ δ δοκαηυηδηα
έζης ηαζ ιενζηήξ πςνζηά επζζηδιμκζηήξ ένεοκαξ, πενζμνζζιέκδξ ιυκμ ζε γχκεξ Π. Ο. Α. Κ. Π., δεκ
οπάνπεζ ηαιία πνυαθερδ βζα ημ οπμηείιεκμ πμο εα ιπμνμφζε κα πναβιαημπμζήζεζ ηδκ επζζηδιμκζηή
ένεοκα. Σέθμξ, εκδζαθένμκ πανμοζζάγεζ δ ηαη'άνενμκ 9§2 πνυαθερδ βζα πμνήβδζδ πηοπίμο
ηαηάδοζδξ εναζζηεπκχκ ηαηαδοηχκ, αθθά ζημ ααειυ πμο αοηυ πμνδβείηαζ ζφιθςκα ιε ηα Δεκζηά
Πνυηοπα Καηαδφζεςκ Ακαροπήξ (Δ. Π. Κ. Α.) ηαζ ημ ζφκμθμ ηςκ κμιμεεηδιάηςκ αθμνά ζηζξ
ηαηαδφζεζξ ακαροπήξ, είκαζ άζημπμ ηαζ κμιζηά έςθμ κα πνμζπαεήζεζ ηάπμζμξ κα εκηάλεζ ημκ
επζζηήιμκα δφηδ ζε αοηή ηδ δζαδζηαζία απυηηδζδξ πηοπίμο ηαηάδοζδξ. Μάθθμκ, μ επζζηήιςκ
ηαηαδφηδξ εκηάζζεηαζ υπςξ πνμακαθένεδηε ζημκ εναζζηέπκδ πηοπζμφπμ ηαηαδφηδ υπςξ μνίγεηαζ ιε
ηδκ οπ'ανζει. 3131.1/9/1994 Τπμονβζηή απυθαζδ ημο Τπμονβμφ Διπμνζηή Ναοηζθίαξ (ΦΔΚ
858/1994).
314
HydroMedit 2014, November 13-15, Volos, Greece
315
HydroMedit 2014, November 13-15, Volos, Greece
υηζ, μ εεζιυξ δεκ οθίζηαηαζ ζηα μνβακμβνάιιαηα ηςκ Φμνέςκ Γζαπείνζζδξ ηςκ δφμ Δεκζηχκ
Θαθάζζζςκ Πάνηςκ Εαηφκεμο ηαζ πμνάδςκ.
φιθςκα ιε ημ εβπεζνίδζμ ηδξ CMAS (CMAS xi, 2000), δ επζζηδιμκζηή ηαηάδοζδ ανίζηεζ πεδία
εθανιμβήξ ζε πακεπζζηήιζα, ενεοκδηζημφξ ζηαειμφξ πακεπζζηδιίςκ, ηεπκζηά ημθθέβζα, ηναηζηέξ
οπδνεζίεξ ηαζ ενβαζηήνζα, κμζμημιεία, εεκζηά πάνηα ηαζ ιμοζεία, Μιδ ηενδμζημπζηέξ μνβακχζεζξ
ημζκήξ ςθεθείαξ. Ζ εονεία εθανιμβή ηδξ εέζδξ ιε ηα ζοβηεηνζιέκα πνμζυκηα, ηαεζζηά επζηαηηζηή ηδ
εεζιμεέηδζδ ημο νυθμο ημο δφηδ επυπηδ (diving officer), εζδζηυηενα υηακ θεζημονβμφκ ηαηαδοηζηέξ
μιάδεξ ηάης απυ ημ πθαίζζμ πακεπζζηδιζαηχκ ζδνοιάηςκ ή ζκζηζημφηςκ.
Δηηυξ υιςξ απυ ηδκ επζζηδιμκζηή ηαηάδοζδ ζε επαββεθιαηζηυ επίπεδμ, οπάνπεζ ηαζ ιία άθθδ
πνμζέββζζδ ηδξ επζζηδιμκζηήξ ηαηάδοζδξ, αοηήξ ζε εναζζηεπκζηυ επίπεδμ. Ζ ζδιακηζηυηενδ δνάζδ
ςξ πνμξ αοηυ ημ επίπεδμ έπεζ βίκεζ απυ ηδκ CMAS, δ μπμία έπεζ πενζθάαεζ ιζα ζεζνά ηαηαδοηζηχκ
εζδζημηήηςκ βζα ημοξ εναζζηέπκεξ δφηεξ, υπςξ αοηέξ πανμοζζάγμκηαζ ζημ ηεπκζηυ εβπεζνίδζμ Non-
professional CMAS Scientific Specialty Courses (SSC). Ζ αοηυκμιδ ηαηάδοζδ ακαροπήξ απμηεθεί
έκακ ζδιακηζηυ άλμκα δνάζδξ ζημοξ ημιείξ ηδξ πενζααθθμκηζηήξ εοαζζεδημπμίδζδξ ηαζ εηπαίδεοζδξ.
Πανάθθδθα υιςξ, εα ιπμνμφζε κα απμηεθέζεζ ηαζ έκα πμθφ ζδιακηζηυ ιέζμ ζηδκ οπδνεζία ηδξ
εηθαΐηεοζδξ ηδξ επζζηήιδξ ηαζ ζηδ δζάδμζδ ηδξ επζζηδιμκζηήξ βκχζδξ. Κάης απυ αοηυ ημ πνίζια, μ
ηαηαδοηζηυξ μνβακζζιυξ CMAS (απυ ηα πνχηα ηαηαδοηζηά υνβακα) πνμζθένεζ έκα ζδιακηζηυ
ηαηαδοηζηυ πνυβναιια εηπαίδεοζδξ ζφιθςκα ιε ημοξ παναηάης άλμκεξ (2014): Underwater
Geology Course (UGC) (CMAS(ii) 2014), Underwater Archaeology Course (UAC),(CMAS(iii)
2014), Ocean Discover Course (ODC) (CMAS(iv) 2014), Marine Biology Course (MBC) (CMAS(v)
2014), Freshwater Biology Course (FBC) (CMAS(vi) 2014), Advanced Underwater Geology Course
(AUGC) (CMAS(vii) 2014), Advanced Underwater Archaeology Course (AUAC) (CMAS(viii)
2014), Advanced Marine Biology Course (AMBC) (CMAS(ix) 2014), Advanced Freshwater Biology
Course (AFBC) (CMAS(x) 2014). Ζ δζαδζηαζίαξ ηδξ εηπαίδεοζδξ εναζζηεπκχκ δοηχκ ζε ενεοκδηζηά
πεδία, υπςξ ηα παναπάκς, πανμοζζάγεζ ζδζαίηενμ εκδζαθένμκ, αθμφ εηηυξ ημο υηζ δ ζοβηεηνζιέκδ
μιάδα δοηχκ θαιαάκεζ εηθασηεοιέκδ επζζηδιμκζηή βκχζδ, εα ιπμνμφζε κα θεζημονβήζεζ ηαζ
επζημονζηά ζε ενεοκδηζηά επζζηδιμκζηά πνμβνάιιαηα.
3.3. ΓΔΝΗΚΑ ΤΜΠΔΡΑΜΑ
Πνμηφπηεζ, θμζπυκ, ιε ζαθήκεζα υηζ δ εθθδκζηή κμιζηή πναβιαηζηυηδηα ιμζάγεζ κα ιδκ ακαβκςνίγεζ
ζπεδυκ ηαευθμο ηδ δοκαηυηδηα ηδξ επζζηδιμκζηήξ ηαηάδοζδξ, αθμφ ιε εθάπζζηεξ ελαζνέζεζξ, δεκ έπεζ
κα επζδείλεζ έκα άνηζμ ηαζ μθμηθδνςιέκμ κμιμεέηδια, ζηακυ κα απαθθάλεζ υζμοξ πναβιαημπμζμφκ
επζζηδιμκζηέξ ηαηαδφζεζξ ζηα κενά ηδξ πχναξ ιαξ απυ ημκ ηίκδοκμ ηδξ ζφθθδρδξ ηαζ ηςκ εκ βέκεζ
πμζκζηχκ ηαζ δζμζηδηζηχκ ηονχζεςκ. Ζ εθθδκζηή πμθζηεία ηαζ δδ μ Έθθδκαξ κμιμεέηδξ μθείθμοκ κα
εκανιμκζζημφκ ιε ηα πνμπςνδιέκα εονςπασηά δεδμιέκα, πνμηεζιέκμο κα δζεοημθοκεεί δ ιεηαθμνά
ηςκ εονςπασηχκ πνμηφπςκ ζηδκ εθθδκζηή πναβιαηζηυηδηα ηαζ κα μνζζημφκ ιε ζαθήκεζα μζ
πνμτπμεέζεζξ ηεηιδνίςζδξ ηαζ ακαβκχνζζδξ ηδξ επζζηδιμκζηήξ ηαηάδοζδξ, ιε ζημπυ ηδκ αζθάθεζα
ηυζμ ηςκ ίδζςκ ηςκ δοηχκ υζμ ηαζ ηςκ παναβυιεκςκ επζζηδιμκζηχκ δεδμιέκςκ απυ αοημφξ.
Βηβιηνγξαθία
ΦΔΚ 858α΄/1994. Γεκζηυξ Κακμκζζιυξ Λζιέκα, αν. 5. ζεθ. 8003-8013. Δεκζηυ Σοπμβναθείμ.
ΦΔΚ 978α'/1995. Γεκζηυ Κακμκζζιυ Λζιέκα, αν. 10. ζεθ. 12611-12618. Δεκζηυ Σοπμβναθείμ.
ΦΔΚ 273α'/2005. Νυιμξ 3409: Καηαδφζεζξ ακαροπήξ ηαζ άθθεξ δζαηάλεζξ. ζεθ. 4517-4522. Δεκζηυ
Σοπμβναθείμ.
ΦΔΚ 449α΄/2006. Τπμονβζηή απυθαζδ Τπμονβείμο Ναοηζθίαξ, Καεμνζζιυξ υνςκ ηαζ πνμτπμεέζεςκ
βζα ηδκ έηδμζδ Άδεζαξ Πανμπέα Καηαδοηζηχκ Τπδνεζζχκ Ακαροπήξ– δζαδζηαζίεξ εθέβπμο −
απαβμνεφζεζξ άζηδζδξ ηδξ δναζηδνζυηδηαξ. ζεθ. 5741-5747
American Academy of Underwater Sciences (2013). Standards for Scientific Diving. pp. 1-85.
CMAS(i), Scientific Committee (2014). Non-professional CMAS Scientific Specialty Courses (SSC),
Administrative text. pp. 1-7.
CMAS(ii), Scientific Committee (2014). Underwater Geology Course (UGC). pp. 1-4.
CMAS(iii), Scientific Committee (2014). Underwater Archaeology Course (UAC). pp. 1-4.
CMAS(iv), Scientific Committee (2014). Ocean Discover Course (ODC). pp. 1-4.
CMAS(v), Scientific Committee (2014). Marine Biology Course (MBC). pp. 1-4.
CMAS(vi), Scientific Committee (2014). Freshwater Biology Course (FBC). pp. 1-4.
CMAS(vii), Scientific Committee (2014). Advanced Underwater Geology Course (AUGC). pp. 1-4.
CMAS(viii), Scientific Committee (2014). Advanced Underwater Archaeology Course (AUAC). pp.
1-4.
CMAS(ix), Scientific Committee (2014). Advanced Marine Biology Course (AMBC). pp. 1-4.
CMAS(x), Scientific Committee (2014). Advanced Freshwater Biology Course (AFBC). pp. 1-4.
316
HydroMedit 2014, November 13-15, Volos, Greece
CMAS (xi) (2000), Scientific Diver, Advanced Scientific Diver, Scientific Diving Instructor,
Scientific Diving Confirmed Instructor, Editor: Dr Alain Norro CMAS CS secretary, pp. 1-10.
Sayer M.D.J., Fischer P., Feral J.P. (2008). Scientific Diving in Europe: Integration, Representation
and Promotion In: Brueggeman P, Pollock NW, eds. Diving for Science 2008.Proceedings of the
American Academy of Underwater Sciences 27th Symposium. Dauphin Island, AL: AAUS; 2008. pp
139-146.
317
HydroMedit 2014, November 13-15, Volos, Greece
1. Introduction
Bangladesh is known to be a riverine country with more than 700 rivers, most of which are fed by the
Ganges and Brahmaputra rivers that shapes the biodiversity within the country (Banglapedia 2004)
and Freshwater biodiversity is a major contributor to the economy through is provision to many
ecosystem goods and services. Fresh air, clean water, nutrients for plant and animal growth and crop
pollination are just some of the ‘ecosystem services‘ that nature provides. Dissolved oxygen is
obviously essential for the metabolism of all aquatic organisms that possess aerobic respiratory
biochemistry (Wetzel 1975, Trivedy 1988). Buriganga fishes and freshwater habitat can be occupying
significant position in the socio-economic of Dhaka cities by providing the population not only the
nutrition but also income and employment opportunities with healthy environment. Arguably, fishes
form the most important wetland product at a global scale, and are often referred to as a ―rich food for
poor people‖ (WorldFish Center 2005). A number of studies indicated that the major causes of
declining fish catch from floodplains are the increased fishing pressure and habitat destruction
(Siddique, 1990; Hoggarth et al., 1999; Tsai and Ali, 1987; de Graff et al., 2001). Due to irrational
fishing practices, environmental aberrations like reduction in water volume, increased sedimentation,
water abstraction, and pollution over the years this diversity is on a decline and few species have been
lost from the freshwater ecosystem of river Buriganga. As a consequence, they are often used as bio
indicator for the assessment of water quality, river network connectivity or flow regime (Chovance et
al. 2003). Today the fish diversity and associated habitats management is a great challenge (Dudgeon
et al. 2006). The river is a fresh water habitat and is located in the humid tropical region with seasonal
variation in temperature and rainfall patterns. About 94% of all freshwater fisheries occur in
developing countries (FAO, 2007). It was estimated that the global values of ecosystem goods (e.g.
fish as food and fresh water to drink), ecosystem regulation (e.g. creation of climate and rain through
the hydrological cycle), ecosystem support (e.g. nutrient recycling), and cultural considerations (e.g.
recreation), yields a value measured in trillions of dollars (Reid et al., 2013). Today, fishing remains
the largest extractive use of wildlife in the world. In 2010, the annual capture, combining both wild
capture and aquaculture, was 149 million tonnes (FAO, 2012).Human activities and annual
environmental effects e.g. dry season and damping continue to cause considerable damage to the
natural production of freshwater ecosystem. The Buriganga River is an important part of Dhaka City‘s
urban landscape, ecology, and economy. Early settlements developed, concentrating on the riverbank;
it had been sources of domestic water supply, groundwater recharge and recreation and fishing sites,
and served as major transportation route and flood control and drainage outlet. It has also been used
for agricultural, sanitary, and industrial purposes. According to Dhaka ―WASA‖ experts, 60% of the
318
HydroMedit 2014, November 13-15, Volos, Greece
city‘s sewerage is dumped into the river. Urban/township storm run-off carries various pollutants
washed off from the streets, roof-tops various types of land covers directly into the river water which
are being threatening the natural aquatic environment (Rahman & Chowdhury 1999).However, Fishes
from Buriganga are going to be extinct due to water pollution. Finally, it is intended that this paper
serve as a baseline for studying future changes of the fish faunal composition in the area.
2. Material and Methods
Study area: Buriganga River is located the south-western periphery of Dhaka City which is most
polluted river in the world. The study area was started from china-Bangladesh Friendship Bridge
(90°26´12'' E and 23°40´25''N) to Amin bazar Bridge (90°20´12''E and 23°46´25''N) in the River.
Sampling period & tools: The studies were carried out from the December 2012 to November 2013
in Buriganga River. Sampling were done two days per month with the help of traditional fishing gears
Plastic Jars, lift nets and gill nets locally known as Plastic bati, Veshal Jal and Current Jal. Active
gears and water transparency level were used as measurement tools. Study was usually made between
mornings to afternoon by boat base survey.
Observation & Identification: The fish species were identified up to species level following the
standard procedures lain in the literature. Also habitat identified on seasonal base. Habitats, fish and
fishing gears were directly observed by boat, randomly counted active fishing gears throughout the
year and fish samples were collected from fisherman during fishing time to confirm identification. A
rope attached with ―sacchidise‖ was sent to the water until it was just disappeared under water, and at
that time the value of the length of the rope was taken to measure the transparency.
3. Results
During the study period we have found polluted water, freshwater habitats on seasonal base and
fishing activities from china-Bangladesh Friendship Bridge to Aminbazar Bridge in the Buriganga
River. Especially four month (August to November 2013) maximum fishing effort and freshwater
habitats were observed at babu bazar, kamrangichar, kholamora ghat in the Buriganga River. A total
of 32 species were recorded from three gears (Table 1) within 56 species of inventory study in the
Buriganga River and heavy blackish or dark black habitat directly observed with minimum number of
fishes in the month of February, March, April and May. Maximum water transparencies (figure 1)
were recorded in July 2013 and minimum in April & May 2013 which was indicated quality of habitat
in the Buriganga River.
319
HydroMedit 2014, November 13-15, Volos, Greece
15
Time
Figure 1. Habitat observetion during
study period in the Buriganga River
25
Number of plastic jar
20
Plastic jar
15
10
0
May
July
Oct
Jan
Nov
Dec
Jun
Mar
Feb
Apr
Sep
Aug
Time
Figure 2. Fishing effort with plastic jar in
bank of the Buriganga River
320
HydroMedit 2014, November 13-15, Volos, Greece
16
14 Veshal Jal
Number of gear
12
10
8
6
4
2
0
Time
Figure 3. Fishing effort with Veshal
Jal in the Buriganga River
12
10
Number of gear
Current Jal
8
6
4
2
0
Time
Figure 4. Fishing effort with Current Jal
in the Buriganga River
321
HydroMedit 2014, November 13-15, Volos, Greece
Table 1. List of recorded fishes of three gears in the Buriganga River, Dhaka
Note: FW= Freshwater; PW= Polluted water; + = Less, ++= Much, +++ = Very Much, ++++= More. y= Present,
V= Veshal Jal, C= Current Jal, P = Plastic jar.
4. Discussion
Open river habitats were the most preferred habitat for fishes inhabited in the tropical rivers (Sarkar et
al. 2010; Lobb and Orth 1991; Aadland 1993; Arunachalam 2000). Fish communities in riverine
ecosystem typically follow a pattern of increasing species richness, diversity and abundance from
upstream to downstream (Welcomme, 1985, Bayley and Li, 1994, Granado, 2000). We can observe
maximum 46% fish species diversity in the lift net (Veshal Jal) and minimum 19% in the plastic Jar
during fishing time in river (figure 5). Colisa fasciata, Ctenops nobilis, Mystus tengara, Channa
punctatus and Heteropneustes fossilis were found in both habitats. Abundance were more of Labeo
rohita, Glossogobius giuris, Ctenops nobilis, Channa punctatus , Mastacembelus pancalus and
Puntius sophore in the Veshal Jal. Furthermore, total 32 fish population were recorded from three
gears the Buriganga River during study period but habitat has threatened due to several reasons
including habitat loss, siltation in river basins, over-exploitation and indiscriminate killing of juvenile
fish as a result of unregulated fishing pressure, water pollution caused by industrial and domestic
wastes, and destruction of breeding and nursery grounds because of flood control. Aquarium fishes of
Botia Dario, Botia lohachata were found in the Buriganga River which is economically important in
fisheries sector. We can observe low species richness at shadarghat site in the Buriganga River due to
water pollution. Climate change also poses threats to freshwater species and habitats. Labeo rohita,
Puntius sophore, Glossogobius giuris, Colisa fasciata, Mystus tengara, Channa punctatus,
Mastacembelus armatus, Mastacembelus pancalus were found in three gears of during fishing time in
the river.
322
HydroMedit 2014, November 13-15, Volos, Greece
become highly fragmented due to human intervention. In Bangladesh, Indonesia and the Philippines
freshwater fishes comprise 50% of animal protein intake, while in Thailand and Vietnam its share is
40%. It is the major and often the only source of animal protein for low income families (Briones et
al., 2004). But the main threats to freshwater habitat degradation in the Buriganga River caused by
infrastructure development and land conversion, water pollution, flow modification, overharvesting
and overexploitation.
Figure 6. Polluted water habitat at kamrangichar and shadarghat in the Buriganga River in the
Dry Season
Figure 7. Freshwater habitat with fishing activities at kamrangichar in the Buriganga River in the
Rainy Season.
Poor people and professional fisherman are engaged in part-time and full time fishing in monsoon
period due to moderately improved water quality but reduced water flow in the river has resulted in a
severe depletion of fisheries and also loss of healthy environment and aquatic resources. Most
examples the fish diversity and habitats in the Buriganga River is getting threatened by water habitat
loss. Ecological changes to the fish habitat indicating the need of immediate comprehensive studies
regarding to the biology of fish, aquatic habitat, protection of aquatic ecosystems and conservation of
fish species.
Acknowledgements
The author extends his thanks to the many fisherman and local people in the survey area for their
sincere cooperation. This research work was funded by Jagannath University Grant for Research
Work 2012-13. The authors would like to thank all the students of the Department of Zoology,
Jagannath University, Dhaka who helped during the field survey.
Reference
Aadland LP (1993) Stream habitat types: their fish assemblages and relationship to flow. North
Am J Fish Manag 13:790–806
Arunachalam M (2000) Assemblage structure of stream fishes in the Western Ghats (India).
Hydrobiologia 430:1–31
Banglapedia. (2004). National Encyclopedia of Bangladesh, Asiatic Society of Bangladesh, 1st
edn. February 2004. Dhaka, Bangladesh. Available from URL: www.banglapedia.org.
Bayley P, Li H (1994) Riverine fisheries. In: Calow P, Petts GE (eds) The river handbook:
hydrological and ecological principles. Blackwell, Boston, pp 251–281.
Bunn SE, Arthington AH (2002) Basic principles and ecological consequences of altered flow
regimes for aquatic biodiversity. Environ Manag 30:492–507.
Briones M., Dey M.M. and Ahmed, M. 2004. The future for fish in the food and livelihoods of
the poor in Asia. WorldFish Center Quarterly. 27(3-4):48-50
323
HydroMedit 2014, November 13-15, Volos, Greece
Chovance A, Hoffer R, Schiemer F (2003) Fish as bioindicators. In:Market BA, Breure AM,
Zechmeiser HG (eds) Bioindicatos and biomonitors, pp 639–675.
Dudgeon, D., Arthington, A.H., Gessner, M.O., Kawabata, Z., Knowler, D., Lévêque, C.,
Naiman, R.J., Prieur-Richard, A.-H., Soto, D., Stiassny, M.L.J. and Sullivan, C.A. (2006). Freshwater
biodiversity: importance, threats, status and conservation challenges. Biological Reviews 81:163– 182.
de Graff, G.J., Born, A.F., Uddin, A.K.M. and Martin, F., (2001). Floods, fish and fishermen.
Eight years‘ experience with floodplain fisheries in Bangladsh. University Press Ltd., Dhaka, 174 pp.
FAO. (2007). The state of world Aquaculture and Fisheries 2006. Food and Agriculture
Organization of the United Nations. Fisheries and Aquaculture Department. Rome, Italy.
FAO. (2012). The State of World Fisheries and Aquaculture 2012. Food and Agriculture
Organization of the United Nations. Fisheries and Aquaculture Department. Rome, Italy.
Granado C (2000) Ecologa de communidades el paradigma de los pecces de agua dulce.
Universidad de Sevilla Secretariado de Publicaciones, Sevilla
Hoggarth, D.D., Cowan, V.J., Halls, A.S., Aeron-Thomas, M.A., McGregor, J.A., Garaway,
C.A., Payne, A.I. and Welcomme, R.L. (1999). Management guidelines for Asian floodplain river
fisheries, FAO Fisheries Technical Paper 384/2, Rome, 117 pp.
Lobb MD, Orth DJ (1991) Habitat use by an assemblage of fish in a large warm water stream.
Trans Am Fish Soc 120:65–78.
Rahman, M.M. and Chowdhury, M.B.R. 1999. Isolation of bacterial pathogen causing on ulcer
disease in farmed carp fishes of Mymensingh. Bangladesh. J. Fish., 19: 103-110.
Reid, G. McG., Contreras MacBeath, T. and Csatadi, K. 2013. Global challenges in freshwater
fish conservation related to public aquariums and the aquarium industry. International Zoo Yearbook
47 (1): 6-45.
Sarkar UK, Gupta BK, Lakra WS (2010) Biodiversity, ecohydrology, threat status and
conservation priority of freshwater fishes of River Gomti, a tributary of River Ganga (India).
Environmen-talist 30:3–17
Sreekantha KV, Ramachandra TV (2005) Fish diversity in Linganamakki Reservoir, Sharavathi
River. Ecol Environ Conserv 11:337–348.
Siddiqui, H.M., (1990). Flood control and drainage development: Physical environmental issues.
In: A.A. Rahman, S. Huq and G.R. Conway (Eds.), Environmental aspects of surface water systems of
Bangladesh. Dhaka University Press Ltd., Dhaka: 104-108.
Trivedy, R.K. (1988). Studies on the biological characteristics of the river Krishna in
Maharashtra with reference to human activity and population. Technical reports submitted to Dept. of
Environment, Ministry of Environment, Forest and Wildlife, New Delhi.
Tsai, C. & Ali, L. (1987). The Changes in Fish Community and Major Carp Population in Beels
in the Sylhet-Mymensingh Basin, Bangladesh. Indian Journal of Fisheries, 34(1), 78-88.
Welcomme RL (1985) River fisheries. FAO Fish Tech Pap 262:1–318
Wetzel, R.G., (1975). Limnology, W.B. Saunders Company, Philadelphia, USA PP.743.
WorldFish Center. (2005). Fish and Food Security in Africa. The WorldFish Center, Penang,
Malaysia
324
HydroMedit 2014, November 13-15, Volos, Greece
ABSTRACT
Coastal sites and marine environments are considered popular natural settings for developing tourism
policies. Recreational beach sites play an essential role for human‘s well being. The purpose of this
study was to define variables that significantly affect visitors‘ willingness-to-pay concerning
improvements in the provision of nature-based tourism policies and products. The contingent
valuation method was applied on a hypothetical market scenario. The empirical results showed that
visitors‘ willingness-to-pay is positively influenced by income, education level, overall satisfaction
gained. In addition, respondents‘ willingness-to-pay disposition was found to be negatively affected
by overcrowded and not organized beach sites. The research findings have management implications
so as to advance thorough management plans in view of enhancing sustainable resource allocation
practices and fostering preferred destination places that meet consumer needs and wants.
1. Introduction
Tourism is a rapid growing industry which directly incorporates human beings, natural
resources, marketing and management approaches as well as environmental ethics and economy
theory (supply and demand). By its definition coastal tourism is based on a unique resource
combination at the interface of land and sea offering diverse amenities while it includes a wide range
of activities that take place in coastal waters and zones (UNEP, 2009). Supportively, effective
environmental coastal management ought to consider tourism development as an integral part of the
whole process. It is widely known that coastal areas represent natural settings that attract many
visitors with different needs wants and expectations. The benefits obtained from these areas are still
underestimated because of the difficulty in expressing the importance of their ecological functions in
monetary terms (Brenner et al. 2010). In the same wavelength, sustainable management strategies for
coastal tourism and recreation are based on a thorough assessment of their value within the relevant
policy context (Ghermandi & Nunes, 2013).
Environmental valuation studies offer information which policy makers and managers
require to manage the coastal environment (Beharry-Borg & Scarpa 2010). As the field of coastal
tourism continues to develop, the need for identifying factors that affect visitors‘ Willingness to Pay
(WTP) when visiting a destination remains a crucial issue in meeting their demands and satisfying
their needs. As a result, if we want to increase the benefits (recreation value) of a coast we must
improve the quality of environmental status and recreation services (Halkos & Matsiori, 2011). The
purpose of this study was to define visitors‘ WTP for improving environmental quality by establishing
sustainable tourism products to a coastal recreational site in prefecture of Fhtiotida as a function of
contingent valuation method in view of making effective decisions for sustainable resource allocation
and tourism accomplishments.
325
HydroMedit 2014, November 13-15, Volos, Greece
A contingent valuation survey was carried out to 1433 randomly selected beach visitors of
the coastal zone in interest in Prefecture of Fthiotida. The cluster sampling technique was used since
no sampling frames were available for beach users. The population was divided into non overlapping
populations called clusters (Zelin & Stubbs 2005). Cluster sampling is a random sampling technique
in which a cluster represents the sampling unit (Ahmed 2009). In this method, the total population is
divided into clusters. Then a sample of the clusters is selected. As a result, the analysis was conducted
on a population of clusters, n=33 days, since each day of the research was deemed as a cluster. The
population within a cluster should be as heterogeneous as possible. In cluster sampling only the
selected clusters are studied. On site face-to-face interviews were conducted. Respondents were asked
if they were willing-to-pay so as to advance and improve the quality of the tourism experience and
protect the natural ecosystem from unstructured tourism policies. The hypothetical market contained a
proposed tourism product that promotes dive and fishing tourism, experience-based water activities,
coastal events and coastal ecotourism as the core destination attributes in view of advancing
conservation concepts and environmental knowledge avoiding environmental degradation. Such
components will result in water quality improvement, biodiversity conservation and effective
environmental management. Stated WTP responses were checked for determining variables that affect
users‘ WTP. A pilot survey was conducted to provide feedback concerning the range of the amount
used in the questionnaires and determine bid values. According to the results derived from the pilot
survey the range of the amount was 5(€) to 50 (€). Binary logistic regression was implemented since
the dependent variable (WTP) was dichotomous. Binary logistic regression estimates the probability
that a characteristic is present given the values of other independent variables of any type (categorical
or not).
The mean WTP was calculated by using the following formula suggested by Hanemann
(1984) and Ekstrand & Loomis (1998):
1
MeanWTP *ln(1 e Bo )
/ b1 /
(2.1)
In the formula (2.1), 1 is the bid coefficient in absolute value and Bo is the sum of the
estimated constant plus the product of the other independent variables times their respective means for
each respondent.
3. Results
In the survey 933 participants stated a positive WTP answer while 390 respondents expressed
a ‗clear no‘ answer (not protest votes) (Table 1). The classification results (Table 2) showed that
89.3% of the answers were correctly classified as a result of the binary logistic method. In the
analysis, from those who answered No in the WTP question 110 answers were identified as protest
votes and, consequently, were excluded from the analysis (Hanley et al. 2006). Protest votes were
highly related with the answer that the government should pay for establishing new tourism practices
in view of improving the quality of the provided tourism experience (52 answers). In the sample of the
1323 individuals the mean years of education were almost 16 and the mean monthly income was
almost 1.965 (€).
326
HydroMedit 2014, November 13-15, Volos, Greece
Cumulative
Frequency Percentage Valid Percentage
Percentage
Table 2. Classification table of observed and predicted answers derived from binary logistic
regression
Predicted
Observed Willingness-to-pay
Percentage correct (%)
NO YES
297 93
NO 76,2
49 884
YES 94,7
Judging from the results of the binary logistic regression (Table 3) all coefficient signs were
in the expected direction and were statistically significant given a 95% confidence interval. The BID
amount coefficient had a negative sign indicated that respondents were unwilling to pay for bigger
amounts. This means that the higher the bid amount the lower the likelihood (probability) of the
respondent to pay the amount. Respondents‘ education level (EDUVAR) had a significant positive
impact on the likelihood of accepting to pay for coastal improvement in terms of tourism
development. In the same sense, individuals that were well educated were found to be more familiar
with terms such as coastal resource uses, environmental management and knowledge seeking through
experience based marine tourism. The WTP is higher if the respondents‘ income is higher (INCVAR).
Visitors that are economically robust do not hesitate to spend money for well organized beach sites
where sustainable forms of tourism and viable marine policies dominate the efforts for wise coastal
resource exploitation. Moreover, the results showed that the more satisfied the visitor (SATISVAR),
the more willing to pay for sustainable coastal tourism accomplishments. Respondents acknowledged
the potential of the coastal site in terms of quality improvement (IMPROVAR) and were found to be
willing to pay more for coastal improvement and modern tourism products in terms of environmental
quality.
327
HydroMedit 2014, November 13-15, Volos, Greece
The logical interpretation of the other negative signs of the coefficients generated by the
logistic regression was that respondents showed a clear disposition to pay less for overcrowded
beaches (CROWDBEACH) and for sites that unstructured and unplanned uses (COASTALUSES)
dominate the tourism practices causing devastating effects on the coastal ecosystem. According to the
formula (2.1) and the respective coefficients of the independent variables the mean WTP was
calculated by using the following formula:
1
MeanWTP *ln(1 e9,293 )
0, 232
(3.1)
The mean WTP was estimated at 40.054 (€) per person and the recreational value of the
coastal zone in interest was estimated at 4,005,400 (€).
4. Discussion
Valuing the marine leisure and recreation industry can provide an argument for making
sound decisions for effective coastal tourism policies, for sustainable use of areas with valuable
marine biodiversity, natural beauty as well as establishing customer driven tourism products that meet
visitors‘ expectations and fulfil their needs and wants. Issues such as willingness-to-pay and
estimation of recreational benefits have been overlooked in the current literature concerning beach
sites in central Greece. To the best of our knowledge there is no other research concerning economic
valuation methodologies in the study area. .Management and tourism planners may find the present
research useful in determining factors that directly affect (positively or negatively) the consuming
behaviour of vistors. Supportively, this research provides a platform on which local authorities may
find margins for improvement as far as tourism facilities, quality of the coastal environment and
implementation of eco-friendly tourism activities (e.g. dive or fishery tourism) are concerned in view
of protecting and improving the natural settings. As a result, factors that explain to a large degree
visitors‘ willingness-to-pay will be determined. It is imperative need for managers to know for what
reason and how tourists prefer or like to spend their money. By taking into account their needs and
desires customer satisfaction will be achieved and word of mouth advertising will be experienced. As
328
HydroMedit 2014, November 13-15, Volos, Greece
a direct consequence the study area will become a preferred destination place which fulfils visitors‘
expectations by providing them quality tourism products for various trends and tastes. It goes without
saying that future research in the area will help to become more reactive and provide solid solutions
for achieving high rates of performance since tourism market is dominated by volatile market
conditions and tourists‘ needs and wants vary from time to time.
Specifically, in Greece, coastal areas represent 72% of total territory, 86% of population,
88% of employment in manufacture, 90% of tourist activities and 90% of energy consumption (OECD
2000). Another interesting point is that the robustness of many economies is broadly based on tourism
development and sustainable exploitation of natural settings. The evolving profile of today‘s tourists
and under the existing considerable economic pressure, value for money is a frequently used phrase as
a marketing tool or mission statement which arises crucial issuues in terms of destination‘s
competitiveness, arrivals, average spend and duration of stay. Perceiving what customers value most
and the extent to which these valued attributes can be interpreted into applicable coastal tourism plans
are important determining factors for achieving coherent strategic policies which offer a great
challenge of placing tourism planners in the role of social change agents (Lew 2007). Data analysis is
not only about testing of statistical hypothesis but also about thinking to update, deciding to upgrade,
changing to recover and improving to proceed. One of the core objectives of coastal management is to
maximize the social value of coastal zones as preferred tourism settings. Therefore, coastal resource
valuations will shed light on the link between conservation and regional economic development as
well as help adapt systems of national accounting to better reflect the value of ecosystem services and
natural capital (Qadri 2001). Zoppi (2004) argues that the contingent valuation approach defines a
ranking of the planning options based on the degree of consensus concerning the local communities
while at the same time identifies a ranking of the criteria identified by the public administration to
assess the planning, options based on the preferences of the local communities. Last but far from least,
cooperation among various stakeholders of the tourism system and implementation of techniques in
view of assigning values in coastal settings are salient elements in achieving sustainability as well as
in creating growth and development to the region and host society.
Bibliography
Ahmed, S. (2009). Methods in sample surveys. Cluster sampling. John Hopkins Bloomberg. School of
Public Health.
Beharry-Borg N., Scarpa R. (2010). Valuing quality changes in Caribbean coastal waters for
heterogeneous beach visitors. Ecologivcal Economics, 69, 1124-1139.
Brenner J., Jimenes J.A., Sarda R., Garola A. (2010). An assessment of the non market value of the
ecosystem services provided by the Catalan coastal zone, Spain. Ocean & Coastal
Management, 53, 27-38.
Ekstrand E.R., Loomis J. (1998). Incorporating respondent uncertainty when estimating willingness to
pay for protecting cxritical habitat for threatened and endangered fish. Water Resource
Research, 34, 3149-3155.
Ghermandi A., Nunes P.A.L.D. (2013). A global map of of coastal recreation values. Results from a
spatially explicit meta-analysis. Ecological Economics, 86, 1-15.
Halkos G., Matsiori S. (2011). Economic valuation of coastal zone quality improvements. MPRA
Paper No 35395. Munich Personal RePEcS Archieve.
Hanemann W.,M. (1984). Welfare evaluations in contingent valuation experiments with discrete
response data. American Agricultural Economics Association, 66, 332-341.
Hanley N., Wright R.E., Alvarez-Farizo B. (2006). Estimating the economic value of improvements in
river ecology using choice experiments: an application to the water framework directive.
Journal of Environmental Management, 78, 183-193.
Lew, A. (2007). Invited commentary: Tourism planning and traditional urban planning theory – The
planner as an agent of social change. Leisure/Loisir, 31, 383–391.
329
HydroMedit 2014, November 13-15, Volos, Greece
330
HydroMedit 2014, November 13-15, Volos, Greece
Department of Ichthyology and Aquatic Environment, University of Thessaly, Nea Ionia Street
Fytokou Magnesia, 384 46, Greece
Abstract
The main aim of this study is the investigation of the competitive position of exports of Greek gilt-
head sea bream (Sparus aurata) in the market of EU-27. The gilt-head sea bream is one of the main
export products of Greece, especially in the EU-27 market, reinforcing exports and improving its
Balance of Trade. Initially, the major importing countries-markets and the main competing countries,
in terms of exports, were identified. Then, the competitive position and the evolution of the level of
competitiveness of the Greek gilt-head sea bream in each of the major importing markets were
evaluated. The study performed using the index of Revealed Export Competitive Advantage (RXCA)
and Import Share (IS), in the Greek market. Results revealed that the main importing markets of
Greek gilt-head sea bream in the EU-27 are Italy, France, Portugal, Spain, Great Britain and Germany.
In addition, an importing emerging market seems to be Romania, while the main competitive to Greek
exports countries seem to be Spain, Turkey, France, Italy, Malta and Croatia. Finally, the assessment
of the degree of penetration, using (IS) index, regarding sea-bream from the major competing
countries revealed that Albania, Italy, Turkey, Cyprus, and Spain constitute the main suppliers.
Keywords: fisheries and aquaculture product, gilt-head sea-bream, competitiveness, Greece,
European Union
* Corresponding author: Athina Oikonomou (aoikonom@mie.uth.gr)
Πεξίιεςε
Βαζζηυξ ζημπυξ ηδξ πανμφζαξ ενεοκδηζηήξ πνμζπάεεζαξ είκαζ δ δζενεφκδζδ ηδξ ακηαβςκζζηζηήξ
εέζδξ ηςκ ελαβςβχκ ηδξ εθθδκζηήξ ηζζπμφναξ (Sparus aurata) ζηδκ αβμνά ηδξ Δ.Δ.-27. Ζ ηζζπμφνα
απμηεθεί έκα απυ ηα ηονζυηενα ελαβςβζηά πνμσυκηα ηδξ Δθθάδαξ, ζδζαίηενα ζηδκ αβμνά ηδξ Δ.Δ.,
ζοιαάθθμκηαξ ζηδκ αφλδζδ ηςκ ελαβςβχκ ηαζ ζηδ αεθηίςζδ ημο ζζμγοβίμο ηςκ ειπμνζηχκ
ζοκαθθαβχκ ηδξ. Ανπζηά, εκημπίζηδηακ μζ ηονζυηενεξ εζζαβςβζηέξ πχνεξ ηδξ ηζζπμφναξ, ηαεχξ ηαζ
μζ ηονζυηενεξ ακηαβςκζζηζηέξ πχνεξ ζηδκ αβμνά ηδξ Δ.Δ.-27. Αημθμφεςξ, επζπεζνήεδηε δ δζενεφκδζδ
ηδξ ακηαβςκζζηζηήξ εέζδξ ηαζ ηδξ ελέθζλδξ ημο ααειμφ ακηαβςκζζηζηυηδηαξ, ηδξ εθθδκζηήξ
ηζζπμφναξ ζε ηάεε ιία απυ ηζξ ηονζυηενεξ εζζαβςβζηέξ αβμνέξ. Δπίζδξ, δζενεοκήεδηε δ
ακηαβςκζζηζηή εέζδ ηςκ ηονζυηενςκ ακηαβςκζζηζηχκ πςνχκ βζα ηάεε ιία απυ ηζξ παναπάκς αβμνέξ.
Ζ ακάθοζδ πναβιαημπμζήεδηε πνδζζιμπμζχκηαξ ημ δείηηδ ημο Απμηαθοπηυιεκμο Δλαβςβζημφ
Ακηαβςκζζηζημφ Πθεμκεηηήιαημξ (Revealed Export Competitive Advantage, RΥCA) ηαζ ημ δείηηδ
ιενζδίμο (Import Share, IS). Απυ ηα απμηεθέζιαηα ηδξ ένεοκαξ πνμέηορε υηζ, μζ ηονζυηενεξ
331
HydroMedit 2014, November 13-15, Volos, Greece
εζζαβςβζηέξ αβμνέξ ηδξ εθθδκζηήξ ηζζπμφναξ ζηδκ E.E.-27 είκαζ δ Ηηαθία, δ Γαθθία, δ Πμνημβαθία, δ
Ηζπακία, ημ Ζκςιέκμ Βαζίθεζμ ηαζ δ Γενιακία. Δπίζδξ, ζδιακηζηά ακαδουιεκδ αβμνά δζαθαίκεηαζ
υηζ απμηεθεί δ Ρμοιακία. Δκχ, μζ ηονζυηενεξ ακηαβςκζζηζηέξ πχνεξ ηδξ Δθθάδαξ είκαζ δ Ηζπακία, δ
Σμονηία, δ Γαθθία, δ Ηηαθία, δ Μάθηα ηαζ δ Κνμαηία. Σέθμξ, αάζεζ ημο ααειμφ δζεζζδοηζηυηδηαξ
(Import Share, IS) ηδξ ηζζπμφναξ ζηδκ αβμνά ηδξ Δθθάδαξ μζ ηονζυηενεξ ακηαβςκζζηζηέξ πχνεξ είκαζ
δ Αθαακία, δ Ηηαθία, δ Σμονηία, δ Κφπνμξ ηαζ δ Ηζπακία.
Λέμεηο θιεηδηά: Αθζεοηζηά πνμσυκηα ηαζ πνμσυκηα οδαημηαθθζένβεζαξ, ηζζπμφνα, ακηαβςκζζηζηυηδηα,
Δθθάδα, Δονςπασηή Έκςζδ
*οββναθέαξ επζημζκςκίαξ: Οζημκυιμο Αεδκά (aoikonom@mie.uth.gr)
1. Δηζαγσγή
Ζ έκκμζα ηδξ ακηαβςκζζηζηυηδηαξ, ηα ηεθεοηαία πνυκζα, έπεζ πνδζζιμπμζδεεί εονέςξ ζηδκ
μζημκμιζηή ένεοκα ηαζ ζηδκ μζημκμιζηή πμθζηζηή απυ δζαθμνεηζηέξ μπηζηέξ ζημπζέξ, αθθά
παναηδνείηαζ ιζηνή ζοιθςκία ακαθμνζηά ιε ημκ μνζζιυ ηδξ. Ο ακηαβςκζζιυξ ςξ έκκμζα δεκ έπεζ κα
ηάκεζ ιυκμ ιε ημκ ανζειυ ηςκ πςθδηχκ ζε ιζα ζοβηεηνζιέκδ αβμνά, αθθά ηαζ ημ ιενίδζμ ηδξ αβμνάξ
πμο απμηηά μ ηαεέκαξ ζε έκακ ηθάδμ, ηδ δζαηδνδζζιυηδηα ημο ιενζδίμο αοημφ ηαζ ηδκ ηενδμθμνία
ημο (Σζαηθάβηακμξ A., 2004).
O ααειυξ ημο ακηαβςκζζιμφ ιζαξ επζπείνδζδξ ιέζα ζε ιία ζοβηεηνζιέκδ αβμνά ελανηάηαζ
απυ ημοξ αηυθμοεμοξ πέκηε ααζζημφξ πανάβμκηεξ: α) απυ ημκ ανζειυ ηςκ κεμεζζενπυιεκςκ
επζπεζνήζεςκ, α) ηδκ φπανλδ οπμηαηάζηαηςκ πνμσυκηςκ, β) ηδ δζαπναβιαηεοηζηή δφκαιδ ηςκ
πνμιδεεοηχκ, δ) ηδ δζαπναβιαηεοηζηή δφκαιδ ηςκ αβμναζηχκ ηαζ ε) ημκ ακηαβςκζζιυ ιεηαλφ ηςκ
οπανπμοζχκ επζπεζνήζεςκ ζηδκ αβμνά. O ακηαβςκζζιυξ είκαζ δοκαιζηυξ ηαζ ζοκεπχξ ελεθίζζεηαζ,
ηαεχξ κέα πνμσυκηα, κέμζ ιέεμδμζ ιάνηεηζκβη, κέεξ δζαδζηαζίεξ παναβςβήξ ηαζ κέεξ αβμνέξ
ειθακίγμκηαζ (Porter M., 1998).
φιθςκα ιε ημοξ Kim D. and Marion B.W., (1997), μ ααειυξ ημο ακηαβςκζζιμφ ηςκ
επζπεζνήζεςκ ζηδκ εβπχνζα αβμνά είκαζ εεηζηά ζοκδεδειέκμξ ιε ηδκ ζηακυηδηα ηςκ επζπεζνήζεςκ κα
είκαζ ακηαβςκζζηζηέξ ζηζξ δζεεκείξ αβμνέξ, ηαεχξ δ έκημκδ εβπχνζα ακηαβςκζζηζηυηδηα απμηεθεί ημ
πθέμκ ηαηάθθδθμ οπυααενμ βζα κα πνμεημζιάζεζ ηζξ επζπεζνήζεζξ, χζηε κα είκαζ ακηαβςκζζηζηέξ ηαζ
αζχζζιεξ ζηδκ παβημζιζμπμζδιέκδ αβμνά.
Βαζζηυξ ζημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ δ δζενεφκδζδ ηδξ ακηαβςκζζηζηήξ εέζδξ ηςκ
ελαβςβχκ ηδξ εθθδκζηήξ ηζζπμφναξ (Sparus aurata). Γζα ημ ζημπυ αοηυκ, εκημπίζηδηακ μζ ηονζυηενεξ
εζζαβςβζηέξ πχνεξ ηδξ ηζζπμφναξ, ηαεχξ ηαζ μζ ηονζυηενεξ ακηαβςκζζηζηέξ πχνεξ - αβμνέξ ζηδκ
αβμνά ηδξ Δ.Δ.-27 ηαζ οπμθμβίζεδηε μ δείηηδξ ημο Απμηαθοπηυιεκμο Δλαβςβζημφ Ακηαβςκζζηζημφ
Πθεμκεηηήιαημξ (RΥCA), ζε ηάεε ιία απυ ηζξ ηονζυηενεξ εζζαβςβζηέξ πχνεξ ηδξ Δ.Δ.-27 ηδξ
ηζζπμφναξ. ηδ ζοκέπεζα ηδξ ενβαζίαξ, βίκεηαζ ακάθοζδ ηςκ δεζηηχκ ακηαβςκζζηζηυηδηαξ ηαζ ηδξ
ιεεμδμθμβίαξ πμο αημθμοεήεδηε ζηδκ ένεοκα ηαζ δ ηαηαβναθή ηςκ απμηεθεζιάηςκ ηδξ.
332
HydroMedit 2014, November 13-15, Volos, Greece
πμο, RCAij είκαζ μ δείηηδξ ημο Απμηαθοπηυιεκμο οβηνζηζημφ Πθεμκεηηήιαημξ βζα έκα πνμσυκ ή
ημιέα-ηθάδμ i ιζαξ πχναξ j, xij μζ ελαβςβέξ ημο πνμσυκημξ ή ημιέα-ηθάδμο i ηδξ πχναξ j, Xj μζ
ζοκμθζηέξ ελαβςβέξ ηδξ πχναξ j, xiw μζ ελαβςβέξ ημο πνμσυκημξ ή ημιέα-ηθάδμο i παβημζιίςξ, Xw
ζοκμθζηέξ ελαβςβέξ παβημζιίςξ.
Ακάθμβα ιε ηδκ ηζιή ημο δείηηδ, ιπμνμφιε κα ζοιπενάκμοιε εάκ ιία πχνα πανμοζζάγεζ ή
υπζ ζοβηνζηζηυ πθεμκέηηδια ςξ πνμξ ιία ηαηδβμνία πνμσυκηςκ. Δπμιέκςξ, υηακ δ ηζιή ημο δείηηδ
ημο Απμηαθοπηυιεκμο οβηνζηζημφ Πθεμκεηηήιαημξ είκαζ ιεβαθφηενδ ηδξ ιμκάδαξ, ηυηε δ οπυ
ιεθέηδ ηαηδβμνία πνμσυκηςκ πανμοζζάγεζ ζοβηνζηζηυ πθεμκέηηδια, εκχ ακηίεεηα βζα ηζιέξ
ιζηνυηενδξ ηδξ ιμκάδαξ πανμοζζάγεζ ζοβηνζηζηυ ιεζμκέηηδια (Havrila I. and Gunawardana P., 2003;
Polymeros K. and Katrakilidis K., 2008).
Σνμπμπμίδζδ ημο παναπάκς δείηηδ απμηεθεί μ δείηηδξ ημο Απμηαθοπηυιεκμο Δλαβςβζημφ
Ακηαβςκζζηζημφ Πθεμκεηηήιαημξ, RΥCA (Revealed Export Competitive Advantage), πμο οπμθμβίγεζ
ημ ακηαβςκζζηζηυ πθεμκέηηδια ιζαξ πχναξ βζα έκα ζοβηεηνζιέκμ πνμσυκ, υπζ ζηδκ παβηυζιζα αβμνά,
αθθά ζε ιία ζοβηεηνζιέκδ αβμνά-ζηυπμ ηαζ εηθνάγεηαζ ςξ ελήξ:
RXCAij X ij / X ij / X ij / X ij
i j ij
πμο: Υ είκαζ μζ αλίεξ ηςκ ελαβςβχκ, i είκαζ μζ οπυ ιεθέηδ πχνεξ, j είκαζ ηα οπυ ιεθέηδ
πνμσυκηα.
Ζ πνμζέββζζδ αοηή δίκεζ ηδκ δοκαηυηδηα δζενεφκδζδξ ηδξ ακηαβςκζζηζηήξ εέζδξ ηςκ
ελαβςβχκ ιζαξ πχναξ ζε ζοβηεηνζιέκεξ αβμνέξ, ηαεζζηχκηαξ δοκαηυκ, αθεκυξ ημκ εκημπζζιυ ηςκ
ηονζυηενςκ εζζαβςβζηχκ αβμνχκ ηαζ αθεηένμο ηδκ ελέθζλδ ημο ααειμφ ηδξ ακηαβςκζζηζηυηδηαξ ζηζξ
εκ θυβς αβμνέξ. Δπζπθέμκ, ιε ηδκ παναπάκς πνμζέββζζδ ηαείζηαηαζ εθζηηή δ δζαδζηαζία εκημπζζιμφ
ηςκ ηονζυηενςκ ελαβςβζηχκ ακηαβςκζζηζηχκ πςνχκ ζηζξ εζζαβςβζηέξ αοηέξ αβμνέξ.
ηακ δ ηζιή ημο δείηηδ RXCΑ είκαζ ιεβαθφηενδ ηδξ ιμκάδαξ, ηυηε δ οπυ ιεθέηδ πχνα
πανμοζζάγεζ ακηαβςκζζηζηυ πθεμκέηηδια, ακηίεεηα βζα ηζιέξ ιζηνυηενδξ ηδξ ιμκάδαξ πανμοζζάγεζ
ακηαβςκζζηζηυ ιεζμκέηηδια.
φιθςκα ιε ημοξ Havrila ηαζ Gunawardana (2003) έκαξ άθθμξ ηνυπμξ δζενεφκδζδξ ημο
ααειμφ ακηαβςκζζηζηυηδηαξ απμηεθεί δ πνδζζιμπμίδζδ ηςκ δεζηηχκ ημο ζοβηνζηζημφ
πθεμκεηηήιαημξ ημο Vollrath, μζ μπμίμζ είκαζ μζ ελήξ:
i) μ δείηηδξ ημο πεηζημφ Δλαβςβζημφ Πθεμκεηηήιαημξ, RXA (Relative Export Advantage Index),
ii) μ δείηηδξ ημο πεηζημφ Δζζαβςβζημφ Πθεμκεηηήιαημξ, RMA (Relative Import Advantage Index),
iii) o δείηηδξ ημο πεηζημφ Διπμνζημφ Πθεμκεηηήιαημξ, RTA (Relative Advantage Trade Index) ηαζ
iv) o δείηηδξ ηδξ πεηζηήξ Ακηαβςκζζηζηυηδηαξ, RC (Relative Competitiveness Index).
Οζ παναπάκς δείηηεξ ημο Vollrath απμηοπχκμκηαζ ςξ ελήξ:
RXAij= (Xij/Xnj)/(Xir/Xnr)
RMAij= (Mij/Mnj)/(Mir/Mnr)
RTAij = RXAij - RMAij
RCij = Ln(RXAij) - Ln(RMAij)
πμο: Υ: είκαζ μζ ελαβςβέξ, Μ: είκαζ μζ εζζαβςβέξ, i: είκαζ ημ πνμσυκ, j: είκαζ δ πχνα, n: είκαζ ημ
οπυθμζπμ ηςκ πνμσυκηςκ, r: ημ οπυθμζπμ ηςκ πςνχκ, Ln: μ θοζζηυξ θμβάνζειμξ.
Οζ δφμ δείηηεξ RXA ηαζ RMA ιπμνμφκ κα πάνμοκ ηζιέξ απυ 0 έςξ άπεζνμ, εκχ μζ ηζιέξ ημο
RTA είκαζ είηε εεηζηέξ, είηε ανκδηζηέξ. Δπμιέκςξ, υηακ μζ ηζιέξ ηςκ δεζηηχκ RXA ηαζ RMA είκαζ
ιεβαθφηενεξ ηδξ ιμκάδαξ έπμοιε ηδκ ειθάκζζδ ζπεηζημφ ελαβςβζημφ ή εζζαβςβζημφ πθεμκεηηήιαημξ,
ακηίζημζπα, εκχ υηακ είκαζ ιζηνυηενεξ ηδξ ιμκάδαξ έπμοιε ηδκ ειθάκζζδ ελαβςβζημφ ή εζζαβςβζημφ
ιεζμκεηηήιαημξ. ζμκ αθμνά ηζξ ηζιέξ ημο δείηηδ RTA, υηακ αοηέξ είκαζ εεηζηέξ ηυηε έπμοιε ζπεηζηυ
ειπμνζηυ πθεμκέηηδια, εκχ υηακ είκαζ ανκδηζηέξ έπμοιε ακηζζημίπςξ ιεζμκέηηδια (Havrila I. and
Gunawardana P., 2003).
Ζ ζπμοδαζυηδηα ηςκ δεζηηχκ ημο Vollrath έβηεζηαζ ζημ βεβμκυξ υηζ επζηνέπμοκ κα βίκεζ
δζάηνζζδ εκυξ πνμσυκημξ/πχναξ ηαζ ηςκ οπμθμίπςκ πνμσυκηςκ/πςνχκ, απμθεφβμκηαξ έηζζ ηδ δζπθή
ηαηαιέηνδζδ ζημ παβηυζιζμ ειπυνζμ (Havrila I. and Gunawardana P., 2003).
333
HydroMedit 2014, November 13-15, Volos, Greece
Ακηίζημζπα, μ δείηηδξ ημο Μενζδίμο Δζζαβςβχκ, ISi (Import Share) ελεηάγεζ ημ ιενίδζμ
εζζαβςβχκ ιζαξ πχναξ i, ζε ζπέζδ ιε ηζξ παβηυζιζεξ εζζαβςβέξ βζα έκα ζοβηεηνζιέκμ πνμσυκ, ημιέα
ή ηθάδμ, ηαζ εηθνάγεηαζ ςξ ελήξ:
n
IS i I i / I j
j
πμο: X είκαζ μζ εζζαβςβέξ ηαζ n είκαζ μζ
δζάθμνεξ πχνεξ.
Οζ ηζιέξ ημο παναπάκς δείηηδ ηοιαίκμκηαζ επίζδξ ιεηαλφ ημο 0 ηαζ ημο 1. Έηζζ, υηακ μ
δείηηδξ παίνκεζ ηδκ ηζιή 0, ηυηε δ πχνα i δεκ έπεζ ηαευθμο εζζαβςβέξ βζα ημ οπυ ιεθέηδ πνμσυκ, εκχ
υηακ παίνκεζ ηδ ιέβζζηδ ηζιή 1, ηυηε δ πχνα i είκαζ δ ιμκαδζηή εζζαβςβέαξ ημο ζοβηεηνζιέκμο
πνμσυκημξ (Kim D. and Μarion B.W., 1997).
ηδκ πανμφζα ενεοκδηζηή ενβαζία, μζ αλίεξ ηςκ εθθδκζηχκ ελαβςβχκ ηαζ εζζαβςβχκ ηδξ
ηζζπμφναξ, αθθά ηαζ ηςκ οπυθμζπςκ πςνχκ ηδξ Δ.Δ.-27 ζηδ αβμνά ηδξ Δ.Δ.-27 πμο
πνδζζιμπμζήεδηακ βζα ιζα ζεζνά εηχκ (απυ ημ 2000 έςξ ηαζ ημ 2013), πνμένπμκηαζ απυ ηδκ
δθεηηνμκζηή δζεφεοκζδ ηδξ Eurostat (http://epp.eurostat.ec.europa.eu). Ζ ηζζπμφνα ακήηεζ ζηδ
ηαηδβμνία ηςκ κςπχκ ρανζχκ ή ηςκ δζαηδνδιέκςκ ιε απθή ρφλδ ηαζ ζοβηεηνζιέκα ιε ημκ ηςδζηυ
―03026995‖ ηαζ ―03028530‖ απυ ημ 2012.
Ανπζηά, εκημπίζηδηακ μζ ηονζυηενεξ εζζαβςβζηέξ πχνεξ-αβμνέξ ηδξ ηζζπμφναξ, ηαεχξ ηαζ μζ
ηονζυηενεξ ακηαβςκζζηζηέξ πχνεξ ζηδκ αβμνά ηδξ Δ.Δ.-27. ηδ ζοκέπεζα, επζπεζνήεδηε δ δζενεφκδζδ
ηδξ ακηαβςκζζηζηήξ εέζδξ ηαζ ηδξ ελέθζλδξ ημο ααειμφ ακηαβςκζζηζηυηδηαξ ηδξ εθθδκζηήξ
ηζζπμφναξ, ζε ηάεε ιία απυ ηζξ ηονζυηενεξ εζζαβςβζηέξ αβμνέξ. Δπίζδξ, δζενεοκήεδηε δ
ακηαβςκζζηζηή εέζδ ηςκ ηονζυηενςκ ακηαβςκζζηζηχκ πςνχκ ςξ πνμξ ηζξ εζζαβςβέξ αοημφ ημο
πνμσυκημξ, απυ ηάεε ιία απυ ηζξ παναπάκς αβμνέξ.
Ζ ιεθέηδ έβζκε πνδζζιμπμζχκηαξ ημ δείηηδ ημο Απμηαθοπηυιεκμο Δλαβςβζημφ
Ακηαβςκζζηζημφ Πθεμκεηηήιαημξ (RΥCA), υπζ υιςξ ζε υθδ ηδκ αβμνά ηδξ Δ.Δ.-27, αθθά ζηζξ
ηονζυηενεξ εζζαβςβζηέξ πχνεξ-αβμνέξ ηςκ ηναηχκ-ιεθχκ ηδξ Δ.Δ.
ηδ ζοκέπεζα, πνδζζιμπμζχκηαξ ηδ ιαεδιαηζηή ζπέζδ αλίεξ πνμξ πμζυηδηεξ, ζοβηνίεδηακ
ιεηαλφ ημοξ μζ ηζιέξ πχθδζδξ ηδξ ηζζπμφναξ ηςκ ακηαβςκζζηζηχκ πςνχκ, ζηζξ ηονζυηενεξ
εζζαβςβζηέξ πχνεξ ηδξ Δ.Δ.-27.
Pij = Vij / Qij
πμο: P: δ ηζιή, V: μζ αλίεξ, Q: μζ πμζυηδηεξ, i: δ πχνα, j: ημ πνμσυκ
Σέθμξ, πνδζζιμπμζήεδηε μ δείηηδξ ημο Μενζδίμο Δζζαβςβχκ, IS (Import Share), βζα κα
εηηζιδεεί μ ααειυξ δζεζζδοηζηυηδηαξ ζηδκ αβμνά ηδξ Δθθάδαξ ηςκ ακηαβςκζζηζηχκ πςνχκ βζα ηδκ
ηζζπμφνα.
3. Απνηειέζκαηα – πδήηεζε
φιθςκα ιε πνμδβμφιεκεξ ένεοκεξ, δ Δθθάδα ηαηέπεζ ζδιακηζηή εέζδ ζημ ειπυνζμ ηςκ
αθζεοηζηχκ πνμσυκηςκ.. (Πμθφιενμξ, K., ηαζ ζοκ., 2005α: Πμθφιενμξ Κ., ηαζ ζοκ., 2005α: Polymeros
K., et al., 2005). Ηδζαίηενα μζ ελαβςβέξ ηςκ πνμσυκηςκ οδαημηαθθζένβεζαξ ηδξ Δθθάδαξ δζαθαίκεηαζ
υηζ ηονζανπμφκ ζε επίπεδμ Δ.Δ-27. (Polymeros ηαζ Katrakilidis, 2008: Λζυθζμο Μ., 2009: Λζυθζμο,
Μ., Πμθφιενμξ, Κ. ηαζ Καηναηοθίδδξ, Κ., 2010: Kaimakoudi, E., et al., 2014) Ζ ηζζπμφνα ηαζ ημ
θαανάηζ απμηεθμφκ ηα δφμ ηονζυηενα ελαβςβζηά πνμσυκηα οδαημηαθθζένβεζαξ ηδξ Δθθάδαξ ζηδκ
αβμνά ηδξ Δ.Δ.-27, ζοιαάθθμκηαξ ζηδκ αφλδζδ ηςκ ελαβςβχκ ηαζ ζηδ ιείςζδ ημο ανκδηζημφ
ειπμνζημφ ζζμγοβίμο. To 2008, δ αλία ηςκ ελαβςβχκ ηδξ ηζζπμφναξ έθεαζε πενίπμο ηα 138,25
εηαημιιφνζα εονχ.
Δπίζδξ, έπεζ δζαπζζηςεεί υηζ απυ ηζξ επηά ηονζυηενεξ οπμηαηδβμνίεξ ηςκ εθθδκζηχκ
αθζεοηζηχκ πνμσυκηςκ ηαζ ηςκ πνμσυκηςκ οδαημηαθθζένβεζαξ, δ οπμηαηδβμνία "302" (ράνζα κςπά ή
δζαηδνδιέκα ιε απθή ρφλδ) ηαηαθαιαάκεζ ημ ιεβαθφηενμ ιενίδζμ ηςκ εθθδκζηχκ ελαβςβχκ ζηδκ
αβμνά ηδξ Δ.Δ.-27, πανμοζζάγμκηαξ ζοβηνζηζηυ πθεμκέηηδια έκακηζ υθςκ ηςκ οπυθμζπςκ ζηδκ αβμνά
ηδξ Δ.Δ.-27, ηαζ ηαεζζηχκηαξ έηζζ ηδ πχνα ιαξ απυ ηζξ ηονζυηενεξ πχνεξ πμο ζοιιεηέπμοκ ζηδκ εκ
θυβς αβμνά. οβηεηνζιέκα, δ οπμηαηδβμνία "302", απυ 250.057 πζθζάδεξ εονχ ημ 2000 έθεαζε ηζξ
307.049 πζθζάδεξ εονχ ημ 2008, πανμοζζάγμκηαξ αφλδζδ ηαηά 22,79% (Καναβημφκδξ Υν., 2011:
Karagounis, C. and Polymeros K., 2011: Καναβημφκδξ, Υ. ηαζ Πμθφιενμξ Κ., 2012)
334
HydroMedit 2014, November 13-15, Volos, Greece
Γζα ηδκ αβμνά ηδξ Ρνπκαλίαο, πμο απμηεθεί ακαπηοζζυιεκδ αβμνά βζα ηδκ εθθδκζηή
ηζζπμφνα, ηδκ ηεθεοηαία 6εηία, δζαπζζηχκεηαζ υηζ, δ εθθδκζηή ηζζπμφνα έπεζ ηενδίζεζ ηδκ πνχηδ εέζδ
ηαζ αημθμοεεί δ Σμονηία (Πίκαηαξ 6).
Ακαθμνζηά ιε ηζξ ηζιέξ ηδξ ηζζπμφναξ ηςκ ακηαβςκζζηζηχκ πςνχκ ηδκ ηεθεοηαία 6εηία, ζηζξ
αβμνέξ Γαιιίαο, Πνξηνγαιίαο, Ηζπαλίαο δζαπζζηχκεηαζ υηζ, ημ πνμσυκ ηδξ Δθθάδαξ ηαζ ηδξ Σμονηίαξ
ειθακίγεζ ηζξ παιδθυηενεξ ηζιέξ, ιε πζμ θεδκή ηδκ ηζζπμφνα ηδξ Σμονηίαξ (Πίκαηεξ 2,3 ηαζ 5), εκχ
ζηδκ αβμνά ημο Ζλσκέλνπ Βαζηιείνπ δζαπζζηχκεηαζ υηζ ημ πνμσυκ ηδξ Δθθάδαξ ειθακίγεζ ηζξ
παιδθυηενεξ ηζιέξ (Πίκαηαξ 4). ηδ Ρνπκαλία δζαπζζηχκεηαζ υηζ, ημ πνμσυκ ηδξ Δθθάδαξ ηαζ ηδξ
Σμονηίαξ ειθακίγεζ ηζξ παιδθυηενεξ ηζιέξ, ιε ζπεηζηά ιζηνή δζαθμνά ιεηαλφ ημοξ ηαζ ηδκ ηζζπμφνα
ηδξ Σμονηίαξ θίβμ πζμ θεδκή (Πίκαηαξ 6).
Γζα ηδκ αβμνά ηδξ Γεξκαλίαο δζαπζζηχκεηαζ ιία ζδιακηζηή δζαθμνά έκακηζ ηςκ
πνμακαθενεέκηςκ εζζαβςβζηχκ αβμνχκ. Ζ Δθθάδα ηαηέπεζ ηδκ πνχηδ εέζδ ζε ακηαβςκζζηζηυ
πθεμκέηηδια ηαηά ιέζμ υνμ ηδκ ηεθεοηαία 6εηία. (Πίκαηαξ 7).
Δπίζδξ, αάζεζ οπμθμβζζιμφ ηςκ ηζιχκ ηδξ ηζζπμφναξ ηςκ ακηαβςκζζηζηχκ πςνχκ ζηδκ
αβμνά ηδξ Γενιακίαξ, δ Σμονηία ειθακίγεζ ηζξ παιδθυηενεξ ηζιέξ, ηδκ ηεθεοηαία 6εηία, ηαζ αημθμοεεί
δ Δθθάδα, εκχ ιέπνζ ημ 2007 πζμ θεδκή ήηακ δ εθθδκζηή ηζζπμφνα.
B) Χξ πνμξ ημ ααειυ δζεζζδοηζηυηδηαξ ζηδκ αβμνά ηδξ Διιάδαο ηδξ ηζζπμφναξ ηςκ ηονζυηενςκ
ακηαβςκζζηζηχκ πςνχκ πμο είκαζ δ Αθαακία, δ Ηηαθία, δ Σμονηία, δ Κφπνμξ ηαζ δ Ηζπακία, ηδκ
ηεθεοηαία 5εηία παναηδνείηαζ ιεβάθδ αφλδζδ ηςκ εζζαβςβχκ ηδξ Δθθάδαξ απυ Αθαακία ηαζ
335
HydroMedit 2014, November 13-15, Volos, Greece
αημθμοεμφκ δ Ηηαθία ηαζ Σμονηία ηαζ δ Κφπνμξ, εκχ ιέπνζ ημ 2008 δ πνχηδ πχνα ήηακ δ Ηηαθία ηαζ
αημθμοεμφζακ δ Σμονηία ηαζ δ Ηζπακία.
φιθςκα ιε ηα απμηεθέζιαηα εηηίιδζδξ ηςκ ζπεηζηχκ δεζηηχκ ζηδκ πανμφζα ενβαζία,
δζαπζζηχκμοιε υηζ δ αβμνά ηδξ Δ.Δ.-27 είκαζ ζδζαίηενα απαζηδηζηή ηαζ ζοκεπχξ ελεθζζζυιεκδ,
ακηαβςκζζηζηά. οκμρίγμκηαξ, εα θέβαιε υηζ δ εθθδκζηή ηζζπμφνα παναηηδνίγεηαζ απυ ζηακμπμζδηζηυ
ααειυ ακηαβςκζζηζηυηδηαξ ζε ανηεηέξ απυ ηζξ οπυ ιεθέηδ εζζαβςβζηέξ αβμνέξ. ζμκ αθμνά ζηδκ
ακάθοζδ ηςκ ακηαβςκζζηζηχκ - ελαβςβζηχκ πςνχκ, δ Σμονηία, ζοκζζηά ιζα ζμαανή απεζθή βζα ηζξ
εθθδκζηέξ ελαβςβέξ ηζζπμφναξ. Ζ παιδθυηενδ ηζιή πμο ζοκήεςξ ζοκμδεφεζ ηδκ ημονηζηή ηζζπμφνα,
δζαθαίκεηαζ υηζ απμηεθεί ημ ζδιακηζηυηενμ πανάβμκηα βζα ηδ ζοκεπή αεθηίςζδ ηδξ ακηαβςκζζηζηήξ
εέζδξ ηδξ πχναξ αοηήξ έκακηζ ηςκ εθθδκζηχκ ελαβςβχκ. οκεπχξ, μζ εθθδκζηέξ ελαβςβέξ εα πνέπεζ
κα πνμζακαημθζζημφκ ζε εκαθθαηηζηέξ ζηναηδβζηέξ, μζ μπμίεξ εα ζημπεφμοκ ζηδ αεθηίςζδ ηδξ
ακηαβςκζζηζηυηδηαξ, πςνίξ κα εζηζάγμοκ ζηδκ ηζιή αοηή ηαε‘ αοηή αθθά ζε δζαδζηαζίεξ πμο εα
αεθηζχκμοκ ηδκ ηαηακαθςηζηή αλία, εηπθδνχκμκηαξ έηζζ ηαθφηενα ηζξ ζοκεπχξ ιεηαααθθυιεκεξ
απαζηήζεζξ ηςκ εονςπαίςκ πεθαηχκ ημοξ. Χξ ηέημζεξ εα ιπμνμφζακ κα εεςνδεμφκ δ επελενβαζία ηαζ
δ ιεηαπμίδζδ ηςκ αθζεοηζηχκ πνμσυκηςκ, δζαδζηαζίεξ πμο πνμζδίδμοκ ακηαβςκζζηζηυ πθεμκέηηδια,
ζηζξ πχνεξ πμο ηζξ οζμεεημφκ.
φιθςκα ιε ημοξ Πμθφιενμξ, K. ηαζ Αναακζημβζάκκδξ, Η.,2003, μ πνμζακαημθζζιυξ ζηδκ
πεναζηένς ακάπηολδ ιεηαπμζδηζηχκ δναζηδνζμηήηςκ, δ αεθηίςζδ ηςκ θεζημονβζχκ ημο ιάνηεηζκβη
βεκζηυηενα, ζε ζοκδοαζιυ ιε ηδκ εθανιμβή ζοζηδιάηςκ δζαζθάθζζδξ πμζυηδηαξ, απμηεθεί ηδ
δοκαιζηυηενδ ακηίδναζδ, εκυρεζ ηςκ εονςπασηχκ ηαζ δζεεκχκ πνμηθήζεςκ. Λαιαάκμκηαξ οπυρδ
επίζδξ, υηζ μ ημιέαξ ηδξ ζοθθεηηζηήξ αθζείαξ ακηζιεηςπίγεζ ηα ηεθεοηαία πνυκζα ημ μλφ πνυαθδια ηδξ
οπεναθίεοζδξ, δ ακάπηολδ ηςκ οδαημηαθθζενβεζχκ ζοκζζηά έκα πμθφ ζμαανυ εέια βζα ηδκ ακάπηολδ,
ηδξ υπμζαξ ιαξ μζημκμιίαξ αθθά ηαζ ηδ δζαζθάθζζδ ηδξ αεζθμνζηήξ δζαπείνζζδξ ημο οδάηζκμο
πενζαάθθμκημξ.
Βηβιηνγξαθία
Λζυθζμο, Μ. (2009). Γζενεφκδζδ ηδξ ακηαβςκζζηζηυηδηαξ ηδξ εθθδκζηήξ ηζζπμφναξ ζηδκ αβμνά ηδξ
Δονςπασηήξ Έκςζδξ. Μεηαπηοπζαηή δζαηνζαή. Σιήια Γεςπμκίαξ Ηπεομθμβίαξ ηαζ Τδάηζκμο
Πενζαάθθμκημξ, Πακεπζζηήιζμ Θεζζαθίαξ, Βυθμξ, ζεθ. 90-93
Λζυθζμο, Μ., Πμθφιενμξ, Κ. ηαζ Καηναηοθίδδξ, Κ., (2010). ''H δοκαιζηή ηςκ εθθδκζηχκ ελαβςβχκ
πνμσυκηςκ γςζηήξ πνμέθεοζδξ ζηδκ αβμνά ηδξ Δ.Δ''. Πναηηζηά 10μο Πακεθθδκίμο
οκεδνίμο Αβνμηζηήξ Οζημκμιίαξ, Θεζζαθμκίηδ, Δηδυζεζξ Γνάθδια, ζεθ. 487-495.
Καναβημφκδξ Υν. (2011). Οζ πνμμπηζηέξ ηςκ εθθδκζηχκ αθζεοηζηχκ πνμσυκηςκ ζηδκ αβμνά ηδξ
Δονςπασηήξ Έκςζδξ. Μεηαπηοπζαηή δζαηνζαή, Σιήια Γεςπμκίαξ Ηπεομθμβίαξ ηαζ Τδάηζκμο
Πενζαάθθμκημξ, Πακεπζζηήιζμο Θεζζαθίαξ, Βυθμξ, ζεθ. 39
Καναβημφκδξ, Υ. ηαζ Πμθφιενμξ Κ., (2012). ''Γζενεφκδζδ ηδξ ακηαβςκζζηζηυηδηαξ ηδξ εθθδκζηήξ
ηζζπμφναξ ζηδκ αβμνά ηδξ Δονςπασηήξ Έκςζδξ''. Πναηηζηά 11μο Πακεθθδκίμο οκεδνίμο
Αβνμηζηήξ Οζημκμιίαξ, Θεζζαθμκίηδ.
Πμθφιενμξ, K. ηαζ Αναακζημβζάκκδξ, Η. (2003). ''Μεηαπμίδζδ-Γζαηίκδζδ ηαζ Διπμνία Αθζεοηζηχκ
Πνμσυκηςκ''. Πναηηζηά 1μο Πακεθθδκίμο οκεδνίμο Τδνμαζμθμβίαξ – Αθζείαξ, (Αθζεία-
οδαημηαθθζένβεζεξ ακηζηνμουιεκεξ ή πανάθθδθεξ δναζηδνζυηδηεξ.
Πμθφιενμξ, K., Λμΐγμο , Δ. Καζ Σζαηζνίδμο, Δ. (2005). ''Δηηίιδζδ Γεζηηχκ Ακηαβςκζζηζηυηδηαξ ηςκ
Δθθδκζηχκ Αθζεοηζηχκ Πνμσυκηςκ''. Πναηηζηά 8μο Πακεθθδκίμο οκεδνίμο Αβνμηζηήξ
Οζημκμιίαξ, Δηδυζεζξ Αβνμηφπμξ α.ε., ζεθ. 44-52.
Πμθφιενμξ, K., Σζαηζνίδμο, Δ. ηαζ Καηναηοθίδδξ, Κ., (2005). ''Δηηίιδζδ ηςκ Μενζδίςκ Αβμνάξ ηςκ
Δθθδκζηχκ Δλαβςβχκ Αθζεοηζηχκ Πνμσυκηςκ ζηδκ Αβμνά ηδξ Δ.Δ.''. Πναηηζηά 2μο
Πακεθθδκίμο οκεδνίμο Τδνμαζμθμβίαξ – Αθζείαξ, (Πνμηθήζεζξ ηαζ Πνμμπηζηέξ ζημ
Μάνηεηζκβη ηαζ ζηδκ Σεπκμθμβία ηςκ Ηπεοδνχκ). Δηδυζεζξ Δκηοπχζεζξ, ζεθ. 159-167.
Σζαηθαβηάκμξ Α., (2004). Βαζζηέξ ανπέξ ημο Μάνηεηζκβη. Θεζζαθμκίηδ: Δηδυζεζξ Αδεθθχκ
Κονζαηίδδ.
Balassa B.,(1965). Trade liberalization and revealed comparative advantage. The Manchester School
of Economic and Social Studies. 1, 99 -123.
336
HydroMedit 2014, November 13-15, Volos, Greece
ΠΑΡΑΡΣΗΜΑ
Πίνακασ 1. Δείκτησ RXCA ςτην αγορά τησ Ιταλίασ και τιμζσ τςιποφρασ ςτην Ιταλία
ΔΕΙΚΣΗ RCXA ITAΛΙΑ TIME ΙΣΑΛΙΑ
ΕΛΛΑΔΑ ΙΠΑΝΙΑ ΓΑΛΛΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛΣΑ ΕΛΛΑΔΑ ΙΠΑΝΙΑ ΓΑΛΛΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛΣΑ
2000 2,88 0,28 0,18 0,46 0,01 0,20 7,40 2000 4,51 8,99 4,76 4,12 5,06 3,91 3,12
2001 3,37 0,35 0,19 0,31 0,01 0,32 6,88 2001 3,70 7,99 5,89 3,56 4,73 3,27 2,82
2002 3,38 0,41 0,17 0,49 0,01 0,48 8,38 2002 3,64 8,30 6,99 3,28 4,30 3,47 2,62
2003 3,41 0,40 0,15 0,83 - 0,51 7,16 2003 3,69 8,85 6,98 3,37 3,31 4,10 3,79
2004 3,26 0,28 0,19 0,85 - 0,53 5,91 2004 4,31 8,94 6,55 4,45 4,21 4,25 5,07
2005 3,48 0,29 0,19 1,48 0,01 1,00 4,53 2005 4,25 7,39 6,45 3,64 7,77 4,53 4,79
2006 3,78 0,26 0,23 1,09 0,11 1,15 6,45 2006 4,30 7,73 7,18 3,58 6,73 4,37 4,74
2007 3,17 0,30 0,16 1,83 0,06 0,79 6,01 2007 4,03 7,88 8,41 3,44 7,35 4,85 4,15
2008 3,42 0,33 0,22 2,14 0,08 0,73 5,98 2008 3,37 8,69 8,67 2,84 7,09 4,53 3,26
2009 3,18 0,38 0,26 2,31 0,04 1,07 5,65 2009 3,76 9,55 7,16 3,18 6,89 4,30 3,45
2010 2,92 0,29 0,22 3,47 0,15 1,16 5,07 2010 4,30 10,51 9,32 3,74 7,67 4,49 4,01
2011 2,67 0,29 0,25 3,04 0,22 0,84 4,72 2011 5,02 10,27 9,06 4,69 8,28 4,97 4,86
2012 2,60 0,33 0,20 2,77 0,19 1,11 4,25 2012 4,18 10,77 9,06 3,53 6,71 4,61 4,09
2013 2,90 0,28 0,23 2,95 0,13 1,13 4,26 2013 4,13 11,11 10,54 3,86 6,02 4,71 4,23
MAX 2000-2007 3,78 0,41 0,23 1,83 0,11 1,15 8,38 MAX 2000-2007 4,51 8,99 8,41 4,45 7,77 4,85 5,07
MIN 2000-2007 2,88 0,26 0,15 0,31 0,01 0,20 4,53 MIN 2000-2007 3,64 7,39 4,76 3,28 3,31 3,27 2,62
ΜΟ 2000-2007 3,33 0,33 0,19 1,07 0,06 0,67 6,46 ΜΟ 2000-2007 4,07 8,19 6,59 3,86 5,54 4,06 3,85
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2000-2007 10,19 6,58 -8,87 298,43 923,29 299,55 -18,79 2000-2007 -10,70 -12,32 76,57 -16,60 45,31 24,10 32,95
TYΠ. ΑΠΟΚΛΙΣΗ
2000-2007 0,26 0,06 0,02 0,53 0,04 0,33 1,15
MAX 2008-2013 3,42 0,38 0,26 3,47 0,22 1,16 5,98 MAX 2008-2013 5,02 11,11 10,54 4,69 8,28 4,97 4,86
MIN 2008-2013 2,60 0,28 0,20 2,14 0,04 0,73 4,25 MIN 2008-2013 3,37 8,69 7,16 2,84 6,02 4,30 3,26
ΜΟ 2008-2013 3,01 0,33 0,23 2,81 0,13 0,94 5,11 ΜΟ 2008-2013 4,19 9,90 8,85 3,76 7,15 4,63 4,06
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2008-2013 -15,15 -15,47 3,50 37,77 72,74 54,84 -28,72 2008-2013 22,40 27,91 21,59 35,96 -15,10 3,84 30,05
TYΠ. ΑΠΟΚΛΙΣΗ
2008-2013 0,31 0,04 0,02 0,49 0,07 0,18 0,72
Πίνακασ 2. Δείκτησ RXCA ςτην αγορά τησ Γαλλίασ και τιμζσ τςιποφρασ ςτην Γαλλία
337
HydroMedit 2014, November 13-15, Volos, Greece
ΕΛΛΑΔΑ ΙΣΑΛΙΑ ΙΠΑΝΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛΣΑ ΕΛΛΑΔΑ ΙΣΑΛΙΑ ΙΠΑΝΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛΣΑ
2000 28,03 0,74 3,59 - 0,59 - - 2000 5,39 6,71 5,73 - 5,88 - -
2001 24,71 0,03 2,14 - 0,10 - - 2001 3,32 5,53 5,59 - 4,44 - -
2002 20,27 0,23 1,86 0,57 0,11 - - 2002 3,43 5,24 5,95 4,57 5,37 - -
2003 18,01 0,28 2,26 - 0,18 - - 2003 4,07 4,70 5,77 - 3,96 - -
2004 16,74 0,28 1,95 - 0,31 - - 2004 3,89 4,47 5,62 - 4,81 - -
2005 16,71 1,12 2,31 - 0,17 - - 2005 3,62 4,80 5,09 - 7,27 - -
2006 16,27 0,55 2,30 - 0,17 - - 2006 4,09 5,24 5,00 - 6,54 - -
2007 13,23 0,32 2,56 - 0,56 - - 2007 4,28 8,08 5,38 - 4,24 - -
2008 13,32 1,67 2,34 7,89 0,30 - - 2008 3,32 7,33 4,34 2,92 3,47 - -
2009 13,79 1,74 2,97 - 0,19 - - 2009 3,63 5,01 3,92 - 4,37 - -
2010 13,97 2,03 3,10 9,27 0,22 - - 2010 4,14 4,79 4,49 4,14 4,52 - -
2011 12,85 2,56 2,30 - 0,49 - - 2011 5,14 5,73 5,19 - 5,95 - -
2012 10,99 1,88 2,84 23,95 0,57 - - 2012 4,71 4,23 5,20 - 4,61 - 3,96
2013 12,38 3,57 3,32 6,97 0,99 - - 2013 3,57 4,64 4,84 3,99 4,25 - -
MAX 2000-2007 28,03 1,12 3,59 0,57 0,59 - - MAX 2000-2007 5,39 8,08 5,95 4,57 7,27 - -
MIN 2000-2007 13,23 0,03 1,86 0,57 0,10 - - MIN 2000-2007 3,32 4,47 5,00 4,57 3,96 - -
ΜΟ 2000-2007 20,63 0,57 2,73 0,57 0,34 - - ΜΟ 2000-2007 4,35 6,27 5,48 4,57 5,62 - -
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2000-2007 -52,79 -56,99 -28,66 - -4,86 - - 2000-2007 -20,50 20,48 -6,08 - -27,87 - -
TYΠ. ΑΠΟΚΛΙΣΗ
2000-2007 4,89 0,34 0,54 - 0,20
MAX 2008-2013 13,97 3,57 3,32 23,95 0,99 - - MAX 2008-2013 5,14 7,33 5,20 4,14 5,95
MIN 2008-2013 10,99 1,67 2,30 6,97 0,19 - - MIN 2008-2013 3,32 4,23 3,92 2,92 3,47 - -
ΜΟ 2008-2013 12,48 2,62 2,81 15,46 0,59 - - ΜΟ 2008-2013 4,23 5,78 4,56 3,53 4,71
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2008-2013 -7,08 113,41 41,77 -11,68 229,23 - - 2008-2013 7,49 -36,64 11,40 36,54 22,68 - -
TYΠ. ΑΠΟΚΛΙΣΗ
2008-2013 1,10 0,72 0,41 8,01 0,30 - -
Πίνακασ 3. Δείκτησ RXCA ςτην αγορά τησ Πορτογαλίασ και τιμζσ τςιποφρασ ςτην Πορτογαλία
ΔΕΙΚΣΗ RCXA ΠΟΡΣΟΓΑΛΙΑ TIME ΠΟΡΣΟΓΑΛΙΑ
ΕΛΛΑΔΑ ΙΣΑΛΙΑ ΓΑΛΛΙΑ ΙΠΑΝΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛΣΑ ΕΛΛΑΔΑ ΙΣΑΛΙΑ ΓΑΛΛΙΑ ΙΠΑΝΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛΣΑ
2000 6,80 0,64 - 0,96 - - - - 2000 4,43 4,58 - 4,29 - - - -
2001 3,63 - 1,26 0,91 - - - - 2001 3,93 - 4,09 4,24 - - - -
2002 4,17 - - 0,90 - - - - 2002 3,62 - - 3,94 - - - -
2003 4,76 - 0,07 0,79 - - - - 2003 3,69 - 6,62 3,80 - - - -
2004 5,10 - 0,06 0,99 - - - - 2004 4,56 - 5,89 4,51 - - - -
2005 4,70 0,03 0,17 0,92 - - - - 2005 3,94 3,94 4,80 4,29 - 4,30 - -
2006 4,80 0,12 0,01 0,93 - - - - 2006 3,87 4,27 17,64 4,14 - - - -
2007 3,78 - 3,96 0,93 - - - - 2007 4,14 - 3,84 4,08 - - - -
2008 2,54 - 3,23 1,03 - - - - 2008 3,41 - 3,91 3,74 - - - -
2009 2,76 - 0,34 0,98 4,43 - - - 2009 3,61 - 8,85 3,69 2,91 - - -
2010 2,53 - 0,22 1,09 - - - - 2010 4,88 - 10,42 4,23 - - - -
2011 3,02 - 0,91 0,99 10,09 - - - 2011 4,91 - 6,77 5,14 3,51 - - -
2012 3,36 - 2,05 0,92 7,63 - - - 2012 4,25 - 5,93 4,86 3,79 - - -
2013 4,18 0,02 1,10 0,90 4,57 - 6,57 - 2013 4,19 3,79 4,72 4,51 3,38 - 3,59 -
MAX 2000-2007 6,80 0,64 3,96 0,99 - - - - MAX 2000-2007 4,56 4,58 17,64 4,51 - - - -
MIN 2000-2007 3,63 0,03 0,01 0,79 - - - - MIN 2000-2007 3,62 3,94 3,84 3,80 - - - -
ΜΟ 2000-2007 5,21 0,33 1,99 0,89 - - - - ΜΟ 2000-2007 4,09 4,26 10,74 4,16 - - - -
ΜΕΤΑΒΟΛΗ % ΜΕΣΑΒΟΛΗ %
2000-2007 -44,44 - - -3,51 - - - - 2000-2007 -6,58 - - -4,85 - - - -
TYΠ. ΑΠΟΚΛΙΣΗ
2000-2007 0,99 0,33 1,56 0,06 - - - -
MAX 2008-2013 4,18 0,02 3,23 1,09 10,09 - - - MAX 2008-2013 4,91 3,79 10,42 5,14 3,79 - - -
MIN 2008-2013 2,53 0,02 0,22 0,90 4,43 - - - MIN 2008-2013 3,41 3,79 3,91 3,69 2,91 -
ΜΟ 2008-2013 3,35 0,02 1,72 0,99 7,26 - - - ΜΟ 2008-2013 4,16 3,79 7,16 4,41 3,35 -
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2008-2013 64,40 - -66,00 -12,60 - - - - 2008-2013 23,01 - 20,80 20,50 -
TYΠ. ΑΠΟΚΛΙΣΗ
2008-2013 0,63 - 1,15 0,07 2,71 - - -
Πίνακασ 4. Δείκτησ RXCA ςτην αγορά του Ηνωμζνου Βαςιλείου και τιμζσ τςιποφρασ ςτο Ηνωμζνο Βαςίλειο
338
HydroMedit 2014, November 13-15, Volos, Greece
TYΠ. ΑΠΟΚΛΙΣΗ
2000-2007 1,17 0,93 0,44 0,04 - 0,46
ΜΕΤΑΒΟΛΗ %
MAX 2008-2013 5,36 2,28 2,98 0,68 12,25 2,38 - - 2000-2007 -26,47 - -28,69 - - -27,38 - -
MIN 2008-2013 2,82 1,07 1,69 0,06 2,62 1,18 - - MAX 2008-2013 4,58 4,65 6,76 5,85 5,31 5,18 - -
ΜΟ 2008-2013 4,09 1,68 2,33 0,37 7,43 1,78 - - MIN 2008-2013 2,41 2,78 3,98 4,41 3,59 3,48 - -
ΜΕΤΑΒΟΛΗ %
2008-2013 67,69 16,98 -0,46 - - 24,24 - - ΜΟ 2008-2013 3,50 3,71 5,37 5,13 4,45 4,33 - -
Πίνακασ 5. Δείκτησ RXCA ςτην αγορά τησ Ιςπανίασ και τιμζσ τςιποφρασ ςτην Ιςπανία
ΔΕΙΚΣΗ RCXA IΠΑΝΙΑ TIME ΙΠΑΝΙΑ
ΕΛΛΑΔΑ ΓΑΛΛΙΑ ΙΣΑΛΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΜΑΛΣΑ ΚΡΟΑΣΙΑ ΕΛΛΑΔΑ ΓΑΛΛΙΑ ΙΣΑΛΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΜΑΛΣΑ ΚΡΟΑΣΙΑ
2000 9,93 0,61 0,31 - - - - 2000 4,84 1,94 1,22 - - - -
2001 3,93 1,14 0,35 32,08 - - - 2001 4,57 1,61 50,21 3,41 - - -
2002 2,35 0,57 3,30 - - 646,55 - 2002 3,83 2,11 2,33 - - 2,93 -
2003 4,61 0,48 0,13 - - - - 2003 3,89 3,92 1,40 - - - -
2004 3,12 0,64 0,14 148,95 - - - 2004 4,69 8,84 1,27 4,28 2,33 - -
2005 2,93 0,37 0,13 - - - 21,60 2005 4,63 15,63 3,21 - - - 3,43
2006 6,99 0,13 0,05 - 0,47 - - 2006 5,07 7,42 1,98 - 6,61 - -
2007 5,70 0,87 0,38 27,93 0,20 - - 2007 3,97 0,78 2,01 3,62 4,07 - -
2008 9,62 0,56 0,30 16,67 0,05 - - 2008 3,43 39,34 2,33 3,13 5,22 - -
2009 10,16 0,27 0,08 3,09 0,02 - - 2009 3,67 25,54 3,87 3,46 6,45 - -
2010 9,89 0,20 0,04 2,76 0,01 - - 2010 4,22 27,07 1,77 3,90 4,97 - -
2011 10,03 0,18 0,03 11,87 0,01 - - 2011 5,29 17,31 3,80 4,78 6,41 - -
2012 7,90 0,89 0,02 91,78 - - - 2012 4,95 21,59 4,01 3,91 - - -
2013 7,91 0,39 - 18,78 0,02 - - 2013 5,14 21,99 - 3,86 1,44 - -
MAX 2000-2007 9,93 1,14 3,30 148,95 0,47 - - MAX 2000-2007 5,07 15,63 50,21 4,28 6,61 - -
MIN 2000-2007 2,35 0,13 0,05 27,93 0,20 - MIN 2000-2007 3,83 0,78 1,22 3,41 2,33 - -
ΜΟ 2000-2007 6,14 0,63 1,68 88,44 0,33 - - ΜΟ 2000-2007 4,45 8,20 25,72 3,84 4,47 - -
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2000-2007 -42,55 43,17 20,22 - - - - 2000-2007 -18,02 -59,81 64,44 - - - -
TYΠ. ΑΠΟΚΛΙΣΗ
2000-2007 2,53 0,31 1,10 68,70 0,19 - -
MAX 2008-2013 10,16 0,89 0,30 91,78 0,05 - - MAX 2008-2013 5,29 39,34 4,01 4,78 6,45 - -
MIN 2008-2013 7,90 0,18 0,02 2,76 0,01 - - MIN 2008-2013 3,43 17,31 1,77 3,13 1,44 - -
ΜΟ 2008-2013 9,03 0,53 0,16 47,27 0,03 - - ΜΟ 2008-2013 4,36 28,33 2,89 3,95 3,95 - -
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2008-2013 -17,78 -29,97 - 12,66 -68,48 - - 2008-2013 49,60 -44,11 - 23,53 -72,36 - -
TYΠ. ΑΠΟΚΛΙΣΗ
2008-2013 1,06 0,27 0,12 33,80 0,02 - -
Πίνακασ 6. Δείκτησ RXCA ςτην αγορά τησ Ρουμανίασ και τιμζσ τςιποφρασ ςτην Ρουμανία
339
HydroMedit 2014, November 13-15, Volos, Greece
TYΠ. ΑΠΟΚΛΙΣΗ
2000-2007 2,24 0,17 5,63 - 53,80 0,57 - -
ΜΕΤΑΒΟΛΗ %
MAX 2008-2013 6,00 1,59 0,64 - 4,83 - - - 2001-2007 -53,03 - -40,62 - - - - -
MIN 2008-2013 4,58 0,09 0,02 - 3,78 - - - MAX 2008-2013 5,65 7,42 5,39 0,00 4,84 8,19 - -
ΜΟ 2008-2013 5,29 0,84 0,33 - 4,31 - - - MIN 2008-2013 3,67 3,64 3,68 0,00 3,38 8,19 - -
ΜΕΤΑΒΟΛΗ %
2008-2013 -3,59 -73,81 -65,29 - - - - - ΜΟ 2008-2013 4,66 5,53 4,54 0,00 4,11 8,19 - -
Πίνακασ 7. Δείκτησ RXCA ςτην αγορά τησ Γερμανίασ και τιμζσ τςιποφρασ ςτην Γερμανία
ΔΕΙΚΣΗ RCXA ΓEΡΜΑΝΙΑ TIME ΓΕΡΜΑΝΙΑ
ΕΛΛΑΔΑ ΙΣΑΛΙΑ ΓΑΛΛΙΑ ΙΠΑΝΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛΣΑ ΕΛΛΑΔΑ ΙΣΑΛΙΑ ΓΑΛΛΙΑ ΙΠΑΝΙΑ ΣΟΤΡΚΙΑ ΟΛΛΑΝΔΙΑ ΚΡΟΑΣΙΑ ΜΑΛ
2000 13,83 11,63 3,29 1,41 - 0,19 - - 2000 5,82 6,35 8,34 8,40 - 4,71 - -
2001 15,31 11,60 2,31 0,23 - 0,19 - - 2001 5,15 6,19 7,35 5,67 - 5,43 - -
2002 16,76 11,51 1,03 0,11 - 0,18 - - 2002 4,33 5,62 6,82 4,35 - 5,74 - -
2003 10,37 13,31 1,14 0,28 0,91 0,12 - - 2003 4,15 5,61 6,04 5,67 5,95 5,15 - -
2004 10,90 16,70 1,36 0,19 29,78 0,17 - 0,27 2004 4,83 5,93 6,80 5,78 5,89 5,06 -
2005 9,73 10,26 1,05 0,14 16,96 0,22 - - 2005 4,53 5,85 6,68 5,36 4,41 5,24 - -
2006 8,93 10,50 1,26 0,38 - 0,21 - - 2006 4,91 6,23 6,67 5,73 - 5,65 - -
2007 13,67 9,44 1,84 2,13 - 0,25 - - 2007 4,50 5,37 6,77 6,76 - 5,65 - -
2008 12,90 6,91 1,24 0,76 1,99 0,24 - - 2008 3,71 4,55 6,56 6,05 2,64 5,39 - -
2009 11,27 5,62 1,97 0,98 6,65 0,31 - - 2009 4,17 4,85 3,72 5,58 4,06 5,42 - -
2010 11,36 5,30 1,64 0,53 12,51 0,35 - - 2010 4,67 5,49 6,37 6,77 4,58 5,71 - -
2011 12,24 5,11 1,64 0,95 8,49 0,34 - - 2011 5,80 6,30 8,38 7,48 4,96 7,20 - -
2012 11,45 2,46 1,07 0,86 10,55 0,55 - - 2012 5,21 5,46 8,50 7,13 3,43 4,43 - -
2013 10,53 5,95 0,99 0,23 10,62 1,32 - - 2013 5,66 5,99 8,21 6,59 3,70 4,34 - -
MAX 2000-2007 16,76 16,70 3,29 2,13 29,78 0,25 - 0,27 MAX 2000-2007 5,82 6,35 8,34 8,40 5,95 5,74 - -
MIN 2000-2007 8,93 9,44 1,03 0,11 0,91 0,12 - - MIN 2000-2007 4,15 5,37 6,04 4,35 4,41 4,71 - -
ΜΟ 2000-2007 12,84 13,07 2,16 1,12 15,35 0,18 - - ΜΟ 2000-2007 4,99 5,86 7,19 6,38 5,18 5,23 - -
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2000-2007 -1,10 -18,85 -44,05 50,56 - 29,82 - - 2000-2007 -22,69 -15,42 -18,84 -19,56 - 19,75 - -
TYΠ. ΑΠΟΚΛΙΣΗ
2000-2007 2,84 2,27 0,79 0,75 14,46 0,04
MAX 2008-2013 12,90 6,91 1,97 0,98 12,51 1,32 - - MAX 2008-2013 5,80 6,30 8,50 7,48 4,96 7,20 - -
MIN 2008-2013 10,53 2,46 0,99 0,23 1,99 0,24 - - MIN 2008-2013 3,71 4,55 3,72 5,58 2,64 4,34 - -
ΜΟ 2008-2013 11,71 4,69 1,48 0,61 7,25 0,78 - - ΜΟ 2008-2013 4,76 5,43 6,11 6,53 3,80 5,77 - -
ΜΕΤΑΒΟΛΗ % ΜΕΤΑΒΟΛΗ %
2008-2013 -18,35 -13,99 -20,20 -69,61 433,29 445,88 - - 2008-2013 52,51 31,56 25,19 8,85 39,88 -19,48 - -
TYΠ. ΑΠΟΚΛΙΣΗ
2008-2013 0,83 1,50 0,39 0,29 3,76 0,41 - -
340
HydroMedit 2014, November 13-15, Volos, Greece
POSTERS
341
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
AQUACULTURE
342
HydroMedit 2014, November 13-15, Volos, Greece
1
Department of Fisheries and Aquaculture, Ankara University, 06110 Ankara, Turkey
Abstract
The aim of the present study was to set up reference intervals for some blood parameters in Siberian
sturgeon (Acipenser baeri). The reference values of blood parameters were assessed for hematocrit,
blood cell counts (erytrocyte, total leucocyte and thrombocyte), differential leucocyte counts,
prothrombin beginning and ending time, plasma glucose, plasma lactic acid, total plasma protein,
plasma sodium, potassium, chloride, magnesium, calcium. In this study, hematological and
biochemical reference ranges determined in the Siberian sturgeon (A. baeri) for the first time will
make a significant contribution to monitor the health and physiological status of the fish.
Introduction
Hematological parameters of fish are closely related to the response of fish to environmental
and biological factors. In response to ecological and physiological conditions, major changes occur in
the fish blood composition (Zarejabad et al., 2009). Blood variables are a useful measure of
physiological disturbances in intensively farmed fishes and can provide important information for
diagnosis and prognosis of diseases. Therefore, haematological evaluation is gradually becoming a
routine practice for determining the health status of intensively bred fishes (Tavares – Dias and
Moraes, 2007). Currently, the use of diagnostic clinical pathology tests is limited in aquatic veterinary
medicine because of the lack of standard techniques and reliable reference values for most fish
species. Differences in sampling technique and test methodology may generate variable results
(Knowles et al., 2006). In order to indicate the reliability of an estimate, the results of measurements
were accompanied by confidence intervals in the present study. Hence, the reference intervals were
calculated according to recommendations of the International Federation of Clinical Chemistry, as
stated by Solberg (2004). Siberian sturgeon (A. baeri), have been successfully adapted to the
conditions of Central Anatolia, Turkey in intensive aquaculture and it was stated that this species is
also less demanding than many other cultured species in terms of water quality parameters (Köksal et
al., 2000). Although some blood parameters in clinically healthy Siberian sturgeon (A. baeri) were
assessed by Köksal et al. (1999), reference intervals for some blood parameters hasn‘t established yet.
The aim of the present study was to determine reference intervals for hematological and
biochemical reference ranges determined in the Siberian sturgeon (A. baeri). Hence, in this study
hematological and biochemical reference ranges for hematocrit, blood cell counts (erytrocyte, total
343
HydroMedit 2014, November 13-15, Volos, Greece
leucocyte and thrombocyte), differential leucocyte counts, prothrombin beginning and ending time,
plasma glucose, plasma lactic acid, total plasma protein, plasma sodium, potassium, chloride,
magnesium, calcium determined in the Siberian sturgeon (A. baeri) for the first time.
Fish
Siberian sturgeon (A. baeri) sampled were in Cifteler - Sakaryabasi Fish Production and
Research Station of Ankara University. Twenty-three clinically healthy individuals of similar age (14
years old), total length (102 ± 9,26 cm), weight (5.44 ± 0,5 kg) were selected to blood sampling.
Groups of fish were netted calmly in <15 s from the experimental tank to an anesthetic bath. After
approximately 1 min in the bath the fish were immediately sampled (Roque et al., 2010). Water
temperature was 21,5 – 22 °C, pH 5,5 – 6,5 and dissolved oxygen 5,80 – 6,00 mg lt-1.
Blood sampling
Blood samples were drawn by cardiac puncture into heparinized syringes for the analysis to
be performed (Kolman et al., 2000). Non-heparinized syringes were used only for the prothrombin
time analysis. Plasma was seperated after centrifugation at 8800 rpm in 10 min and frozen until
analysis.
Analytical procedures
Statistical analysis
The reference intervals bounded by the 2.5th and 97.5th were calculated by means of non-
parametric estimates, together with the 95% confidence intervals as the assumption of normal
distribution of samples.
Reference intervals for some blood parameters were summarized for Siberian sturgeon (A.
baeri) in Table 1 (n = 23).
Hematological and biochemical can be used as an effective method for monitoring physiological and
pathological changes in fish. Thus, in this study hematological and biochemical reference ranges
determined in the Siberian sturgeon (A. baeri).
344
HydroMedit 2014, November 13-15, Volos, Greece
In comparison with other Acipenserids, some values measured in the present study fell within
the ranges, some of them were lower or higher than values reported in this study. Hematocrit values
were similar to Adriatic sturgeon, Acipenser naccarii (Clementi et al., 1999) and Beluga sturgeon,
Huso huso (Zarejabad et al., 2009; Hoseinifar et al., 2010). Erytrocyte count were similar to shortnose
sturgeon, Acipenser brevirostrum (Knowles et al., 2006) and were lower than Beluga sturgeon, H.
huso (Zarejabad et al., 2009; Hoseinifar et al., 2010). Leucocyte count were in agreement with the
values determined for shortnose sturgeon, A. brevirostrum (Knowles et al., 2006; Matschel et al.,
2013) and Beluga sturgeon, H. huso (Zarejabad et al., 2009; Hoseinifar et al., 2010). Thrombocyte
count were lower than shortnose sturgeon, A. brevirostrum (Knowles et al., 2006). In Acipenserids,
differential leucocyte count, for lymphocyte count the values were similar to Beluga sturgeon, H. huso
(Zarejabad et al., 2009) and were higher than found in the same species by Hoseinifar et al. (2010).
For monocyte count the values were similar to Beluga sturgeon, H. huso (Hoseinifar et al., 2010) and
were higher than found in the same species by Zarejabad et al. (2009) and for shortnose sturgeon, A.
brevirostrum (Matschel et al., 2013). For neutrophil count the values measured in this study were
similar to shortnose sturgeon, A. brevirostrum (Matschel et al., 2013) and were lower than found in
the same species (Knowles et al., 2006) and Beluga sturgeon, H. huso (Zarejabad et al., 2009;
Hoseinifar et al., 2010). Eosinophil counts fell within the ranges found for shortnose sturgeon, A.
brevirostrum (Knowles et al., 2006; Matschel et al., 2013) and Beluga sturgeon, H. huso (Hoseinifar
et al., 2010). However, the values found by Zarejabad et al. (2009) who studied Beluga sturgeon, H.
huso were lower than values reported in the present study. In biochemical parameters values, such as
the plasma glucose level measured in this study were lower than Acipenserids such as shortnose
sturgeon, A. brevirostrum (Knowles et al., 2006), Amur sturgeon, Acipenser schrenckii, Chinese
sturgeon, Acipenser sinensis (Shi et al., 2006), Adriatic sturgeon, A. naccarii (Di Marco et al., 1999),
cultured sturgeon hybrids, A. naccarii female×A. baeri male (Di Marco et al., 2011), Beluga sturgeon,
H. huso (Zarejabad et al., 2009; Hoseinifar et al., 2010). The total plasma protein level measured in
our study were in agreement with the values determined for shortnose sturgeon, A. brevirostrum
(Knowles et al., 2006), Amur sturgeon, A. schrenckii (Shi et al., 2006), Adriatic sturgeon, A. naccarii
(Di Marco et al., 1999). However, the values of total plasma protein measured in our study were
higher than Chinese sturgeon, A. sinensis (Shi et al., 2006) and Beluga sturgeon, H. huso (Hoseinifar
et al., 2010). Conversely it was lower than cultured sturgeon hybrids, A. naccarii female×A. Baeri
Table 1 Reference values expressed as mean, standart deviation (SD) and 95% confidence interval for
the estimated analytes in Siberian sturgeon (A. baeri).
Erythrocyte counts (x 106 µl-1) 0,66 0,21 0,50 - 0,81 1,411 2,506
Lymphocyte counts
Leucocy
te Count
Differen
(x 103 µl-1)
345
HydroMedit 2014, November 13-15, Volos, Greece
Monocyte counts
9,50 4,68 3,68 - 15,31 1,656 3,485
(x 103 µl-1)
Neutrophil counts
4,44 2,95 0,78 - 8,09 2,205 4,891
(x 103 µl-1)
Eosinophil counts
1,58 2,83 0,00 - 5,10 2,151 4,683
(x 103 µl-1)
Thrombocyte counts (x 103 µl-1) 17,07 11,89 8,56 - 25,58 1,317 2,520
Plasma glucose (mg dl-1) 33,00 7,66 27,52 - 38,48 - 1,845 4,377
Plasma lactic acid (mg dl-1) 8,55 7,12 3,45 - 13,65 0,519 - 1,589
Total plasma protein (g dl-1) 3,52 1,80 2,23 - 4,81 - 0,437 - 1,135
Plasma sodium (mEq l-1) 127,90 9,23 121,30 - 134,50 - 0,901 0,809
Plasma potassium (mEq l-1) 2,73 0,78 2,17 - 3,29 1,712 3,147
Plasma chloride (mEq l-1) 102,00 10,00 94,85 - 109,15 - 0,147 1,701
Plasma magnesium (mg dl-1) 2,89 1,00 1,96 - 3,81 0,823 - 0,487
Plasma calcium (mg dl-1) 21,95 17,25 9,61 - 34,29 1,406 1,540
male (Di Marco et al., 2011). The lactic acid level was higher than shortnose sturgeon, A. brevirostrum (Baker et
al., 2005), was lower than cultured sturgeon hybrids, A. naccarii female×A. baeri male (Di Marco et al., 2011),
and was similar to Atlantic sturgeon, Acipenser oxyrinchus (Baker et al., 2005). In electrolytes levels such as
sodium measured in this study was lower than Adriatic sturgeon, A. naccarii (Clementi et al., 1999; Di Marco et
al., 1999), cultured sturgeon hybrids, A. naccarii female× A. baeri male (Di Marco et al., 2011). Potassium
levels was lower than shortnose sturgeon, A. brevirostrum (Knowles et al., 2006) and was higher than cultured
sturgeon hybrids, A. naccarii female× A. baeri male (Di Marco et al., 2011). The chloride level was lower than
Adriatic sturgeon, A. naccarii (Clementi et al., 1999), shortnose sturgeon, A. brevirostrum (Knowles et al.,
2006), Adriatic sturgeon, A. naccarii (Di Marco et al., 1999), cultured sturgeon hybrids, A. naccarii female× A.
baeri male (Di Marco et al., 2011). The magnesium level was in agreement with the values determined for
shortnose sturgeon, A. brevirostrum (Knowles et al., 2006), Beluga sturgeon, H. huso (Asadi et al.,
2006).However the level was lower than cultured sturgeon hybrids, A. naccarii female× A. baeri male (Di
Marco et al., 2011). The calcium level fell within the ranges found for Adriatic sturgeon, A. naccarii (Di Marco
et al., 1999) and cultured sturgeon hybrids, A. naccarii female× A. baeri male (Di Marco et al., 2011) and was
higher than shortnose sturgeon, A. brevirostrum (Knowles et al., 2006), Beluga sturgeon, H. huso (Asadi et al.,
2006). Some electrolyte levels measured in this study were lower than that of Acipenserids in the sea. The reason
regarding the low levels of sodium, chloride and potassium is possibly related to that the Siberian sturgeon (A.
baeri) is a freshwater fish. However, interestingly, plasma calcium level of the Siberian sturgeon (A. baeri) was
higher than the other Acipenserids.
346
HydroMedit 2014, November 13-15, Volos, Greece
Hematological and biochemical reference ranges in the Siberian sturgeon (A. baeri) assessed in this study
will make a significant contribution to monitor the health and physiological status of the Siberian sturgeon.
References
Asadi, F.; Halajian, A.; Pourkabir, M.; Asadian, P.; Jadidizadeh, F., 2006: Serum biochemical parameters of
Huso huso. Journal of Comparative Clinical Pathology 15: 245-248.
Baker, D. W.; Wood, A, M.; Litvak, M, K.; Kieffer, J. D., 2005: Haematology of juvenile Acipenser oxyrinchus
and Acipenser brevirostrum at rest and following forced activity. Journal of Fish Biology 66: 208-221.
Clementi, M. E.; Cataldiz, E.; Capo, C.; Petruzzelli, R.; Tellones, E.; Giardina, B., 1999: Purification and
characterization of the hemoglobin components of Adriatic sturgeon (Acipenser naccarii) blood. Journal of
Applied Ichthyology 15: 78-80.
Di Marco, P.; McKenzie, D.J.; Mandich A.; Bronzi, P.; Cataldi, E.; Cataudella, S., 1999: Influence of sampling
conditions on blood chemistry values of Adriatic sturgeon Acipenser naccarii (Bonaparte, 1836). Journal
of Applied Ichthyology 15: 73-77.
Di Marco, P.; Priori, A.; Finoia, M. G.; Petochi, T.; Longobardi, A.; Donadelli, V.; Marino, G., 2011:
Assessment of blood chemistry reference values for cultured sturgeon hybrids (Acipenser naccarii female
× Acipenser baerii male). Journal of Applied Ichthyology 27: 584-590.
Hoseinifar, S. H.; Mirvaghefi, A.; Merrifield, D. L.; Amiri, B. M.; Yelghi, S.; Bastami, K. D., 2010: The study of
some haematological and serum biochemical parameters of juvenile beluga (Huso huso) fed oligofructose.
Fish Physiology and Biochemistry 37: 91-96.
Knowles, S.; Hrubec, T. C.; Smith, S. A.; Bakal, R. S., 2006: Hematology and plasma chemistry reference
intervals for cultured shortnose sturgeon (Acipenser brevirostrum). Veterinary Clinical Pathology 35: 434-
440.
Köksal, G.; Rad, F.; Kindir, M., 2000: Growth performance and feed conversion efficiency of Siberian sturgeon
(Acipenser baeri) reared in concrete raceways. Turk Journal of Animal Science. 24: 435-442.
Köksal, G.; Yıldız, H. Y.; Rad, F.; Aydın, F.; Uysal, H., 1999: Blood parameters in sturgeon yearlings fed on
rainbow trout diet with particular references to skeletal deformity. 9th International Conference European
Assossiation of Fish Pathology.
Kolman, H.; Kolman, R.; Siwicki, A. K., 2000: Non - specific defence mechanisms of russian sturgeon
(Acipenser gueldenstaedti, Brandt) reared in cages. Archives of Polish Fisheries 8: 181-192.
Konuk, T., 1981: Pratik Fizyoloji 1 (in Turkish). Ankara University, Ankara, Turkey.
Matsche, M. A.; Rosemary, K. M.; Brundage, H. M.; O‘Herron, J. C., 2013: Hematology and plasma chemistry
of wild shortnose sturgeon Acipenser brevirostrum from Delaware River, USA. Journal of Applied
Ichthyology 29: 6-14.
Rad, F.; Köksal, G.; Kindir, M., 2003: Growth performance and food conversion ratio of Siberian sturgeon
(Acipencer baeri, Brandt) at different daily feeding rates. Turk Journal of Animal Science 27: 1085-1090.
Roque, A.; Yıldız, H. Y.; Carazo, I.; Duncan, N., 2010: Physiological stress responses of sea bass
(Dicentrarchus labrax) to hydrogen peroxide (H2O2) exposure. Aquaculture 304: 104-107.
Shi, X.; Li, D.; Zhuang, P.; Nie, F.; Long, L., 2006: Comparative blood biochemistry of Amur sturgeon,
Acipenser schrenckii, and Chinese sturgeon, Acipenser sinensis. Fish Physiology and Biochemistry 32: 63-
66.
Siwicki, A. K.; And Anderson, D. P., 1993: Immunostimulation in Fish: Measuring the Effects of Stimulants by
Serological and Immunological Methods. Nordic Symposium on Fish Immunology.
Solberg, H. E., 2004: The IFCC recommendation on estimation of reference intervals. The RefVal prog. Clinical
Chemistry and Laboratory Medicine 42: 710-714.
Tavares – Dias, M.; Moraes, F. R., 2007: Haematological and biochemical reference intervals for farmed channel
catfish. Journal of Fish Biology 71: 383-388.
Zarejabad, M. A.; Jalali, M. A.; Sudagar, M. A.; Pouralimotlagh, S., 2009: Hematology of great sturgeon (Huso
huso Linnaeus, 1758) juvenile exposed to brackish water environment. Fish Physiology and Biochemistry 36:
655-659.
347
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
The development of skeletal deformities in seabream (Sparus aurata) farming affects their growth, survival and
production costs. Research has shown that the distribution of collagen in different fish tissues might be
correlated to their swimming behavior. This study investigates whether gilthead seabream with lordosis
deformity showed collagen morphology abnormalities in their vertebras in comparison with those that did not
show any skeletal deformities. Samples for decalcified vertebras of both groups were examined with
transmission electron microscope and collagen micrographs were taken and analyzed. The results indicated that
the fishes with lordosis had significant smaller mean vertebras‘ collagen fibrils diameter than the controls.
Further research to understand if skeletal deformities are linked to collagen fibril abnormalities is needed.
Key words: Sparus aurata, lordosis, vertebra column, collagen.
*
Corresponding author: Dr. Berillis Panagiotis (pveril@uth.gr).
1. Introduction
Collagen is a group of naturally occurring proteins. It is abundant in most invertebrates and vertebrates
(Gallop and Paz 1975, Adams 1978). It is the main protein of connective tissue and represents about one-fourth
of the total body protein content (Bailey 1968). Its molecule is formed by three polypeptide strands, called alpha
chains, each possessing the conformation of a left-handed helix. Collagen is one of the long, fibrous structural
proteins whose functions are different from those of globular proteins such as enzymes. Tough bundles of
collagen (collagen fibers) are a major component of the extracellular matrix that supports most tissues.
In fishes, collagen fibrils form a delicate network structure with varying complexity in the different
connective tissues in a pattern similar to that found in mammals. The collagen in fish is much more thermolabile
and contains fewer, but more labile cross-links compared to the collagen from warm-blooded vertebrates. In
general, contains fewer hydroxyprolin than in mammals, although a total variation between 4.7 and 10% of the
collagen is observed (Sato et al. 1989). Different fish species contain varying amounts of collagen in their body
tissues. This has led to a theory that the distribution of collagen may reflect the swimming behavior of the
species (Yoshinaka et al. 1988).
Gilthead seabream (Sparus aurata) is one of the most important farmed fish species in the
Mediterranean region (FAO 2014). Skeletal deformities is a major factor that affects the production cost, the
external morphology of the fish as well as its survival and growth. The development of skeletal deformities is
not well understood but it is related to nutritional, environmental and genetic factors (Fernadez et al. 2008). Fish
bones consist of calcium-phosphor hydroxyapatite salts (inorganic part, about 65% of bone‘s dry mass)
embedded in a matrix of type I collagen fibers (organic part) (Mahamid et al. 2008). The relationship between
collagen and hydroxyapatite is crucial for bone toughness and stiffness.
The aim of this study was to determine if the skeletal deformity of lordosis is associated with changes to
the collagen fibrils morphology of the vertebras.
3. Results
The fibrils diameter measurements are presented in Table 1. There is a significant difference between
the vertebras‘ collagen fibrils diameter of the two groups, p<0.05.
348
HydroMedit 2014, November 13-15, Volos, Greece
Table 1. Vertebras’ collagen fibrils mean diameter from Sparus aurata with lordosis and from Sparus
aurata without any skeletal deformity.
Collagen fibrils mean diameter (nm)
Sparus aurata with lordosis 64.00±14.82 (844)
Sparus aurata without any skeletal deformity 72.79±14.81 (815)
Note: Results are means±SD. The numbers of fibrils sampled are given in parenthesis.
4. Discussion
Gilthead seabream is one of the most important farmed fish species, as mentioned before. According to
FAO the 2010-2012, the total European Sparus aurata aquaculture production was 289985 tones (1 851 588
000US dollars). Fishes with skeletal abnormalities are not preferred by the consumers, have diminished
survivance and increase the production cost. As it has already been reported the development of skeletal
deformities is not well understood and could be related to nutritional, environmental and genetic factors
(Fernadez et al. 2008). Rapidly growing animals are more likely to develop pathological lesions to the skeleton.
Thus, the hypothesis that growth rate may be another risk factor in the occurrence of spinal deformities is
acceptable (Halver et al. 1969, Weisbrode and Doige 2001). In bone, collagen represents more than 90% of the
organic bone matrix. It confers resistance to the structure and establishes the biomechanical properties of the
tissue (Moro et al. 2000). Lim and Lower (1978) showed that vitamin C deficiency in channel catfish (Ictalurus
punctatus) leaded to vertebra column deformities (kyphosis, scoliosis, lordosis) and to a decrement in the
collagen content of bone. Our results showed a correlation between the lordosis deformity and the vertebras‘
collagen fibril diameter in seabream. According to Chatain (1993) lordosis was developed in larval forms of
Dicentrarchus labrax and seabream when they were forced to swim against a current of at least 20 cm/s. The
luck of functional swimbladder in these species was also found to lead to lordosis development (Chatain 1993).
There is also a significant effect of water temperature on the development of skeletal deformities in seabream
(Georgakopoulou et al. 2010).
349
HydroMedit 2014, November 13-15, Volos, Greece
Figure 2: A) Collagen fibrils from vertebra of Sparus autata with lordosis deformity. B) Collagen fibrils
from vertebra of Sparus autata without any skeletal deformity.
References
Adams E. (1978). Invertebrate collagens. Marked differences from vertebrate collagens appear in only a few
invertebrate groups. Science 202(4368), 591–598.
Bailey A. (1968). The nature of collagen. Compr. Biochem. 26(B), 297–424.
Chatain B. (1994). Abnormal swimbladder development and lordosis in sea bass (Dicentrarchus labrax) and sea
bream (Sparus auratus). Aquaculture 119, 371-379.
FAO (2014). Food and Agriculture Organization of the United Nations, Cultured Aquatic Species Information
Program, Sparus aurata (Linnaeus, 1758).
http://www.fao.org/figis/servlet/SQServlet?file=/work/FIGIS/prod/webapps/figis/temp/hqp_659596006
7401687523.xml&outtype=html (accessed 14-5-2014).
Fernández I., Hontoria F., Ortiz-Delgado J.B., Kotzamanis Y., Estévez A., Zambonino-Infante J.L., Gisbert E.
(2008). Larval performance and skeletal deformities in farmed gilthead sea bream (Sparus aurata) fed
with graded levels of Vitamin A enriched rotifers (Brachionus plicatilis). Aquaculture 283, 102–115.
Gallop P.M., Paz M.A. (1975). Posttranslational protein modifications, with special attention to collagen and
elastin. Physiol. Rev. 55(3), 418–487.
Georgakopoulou E., Katharios P., Divanach P., Koumoundouros G. (2010). Effect of temperature on the
development of skeletal deformities in Gilthead seabream (Sparus aurata Linnaeus, 1758). Aquaculture
308, 13–19.
Halver J.E., Ashley L.M., Smith R.R. (1969). Ascorbic acid requirements of coho salmon and rainbow trout.
Trans Am Fish Soc 98, 762–771.
Lim C., Lowell R.T. (1978). Pathology of the vitamin C syndrome in channel catfish (Ictalurus punctatus). J.
Nutr.108, 1137–1146.
Mahamid J., Sharir A., Addadi L., Weiner S. (2008). Amorphous calcium phosphate is a major component
of the forming fin bones of zebrafish: Indications for an amorphous precursor phase. PNAS 105(35),
12748–12753.
Moro L., Romanello M., Favia A., Lamanna M.P., Lozupone, E. (2000). Posttranslational modifications of bone
collagen type I are related to the function of rat femoral regions. Calcif. Tissue Int. 66, 151–156.
Sato K., Yoshinaka R., Sato M., Tomit, J. (1989). Biochemical characterization of collagen in myocommata and
endomysium fractions of carp and spotted mackerel muscle. J. Food Sci. 54, 1511−1514.
Weisbrode S.E., Doige C.E. (2001): Bones and joints. In: ―Thompson‘s Specialized Veterinary Pathology‖
McGavin M.D., Carlton W.W., Zachary J.F. (eds). St. Louis, Missouri: Mosby, p. 499–536.
Yoshinaka R., Sato K., Anbe H., Sato M., Shimizu, Y. (1988). Distribution of collagen in body muscle of fishes
with different swimming modes. Comp. Biochem. Physiol. 89B, 147–151.
350
HydroMedit 2014, November 13-15, Volos, Greece
Karapanagiotidis Η.T.*, Bouzianas A., Fountas S., Papagiannopoulos Ν., Berillis P.,
Boziaris I.S., Mente E.
Department of Ichthyology and Aquatic Environment, School of Agricultural Sciences, University of Thessaly,
Fytoko street, 38446, Volos, Greece.
Abstract
Phytobiotics are natural plant-derived products, which are added in diets as nutritional supplements having
immunostimulant effects and act as antioxidants, enhance palatability and promote growth. The aim of the
present study was to evaluate the effect of dried citrus extract on the growth performance and feed utilization of
seabream (Sparus aurata). Three groups of fish were fed for 120 days experimental diets that were supplemented
with increasing levels of a dried citrus extract (0.25%, 0.5% and 1%), while another group were fed a control
diet without the extract. At the end of the trial, there were no statistically significant differences in weight gain,
feed conversion ratio and fish survival. In addition, there were not any significant differences between groups in
their liver histology. In all dietary groups, the inclusion of dried citrus extract in the diet lowered the moisture
and protein content of the muscle tissue and increased their lipid contents. In addition, fish fed the citrus diets
had increased hepatosomatic and viscerosomatic indices indicating metabolic stress. In conclusion, the inclusion
of dried citrus extract as high as 1% in the diet neither improved the feed utilization and growth performance of
the gilthead seabream, nor prolonged shelf life of chilled stored fillets.
Key words: Sparus aurata, nutrition, citrus extract, phytobiotics.
*
Corresponding author: Karapanagiotidis Ioannis T. (ikarapan@uth.gr).
Πεξίιεςε
Σα θοημαζμηζηά απμηεθμφκ ιζα μιάδα θοζζηχκ πνμσυκηςκ ιε ακμζμεκζζποηζηέξ ζδζυηδηεξ, εκχ ηαοηυπνμκα
εκδέπεηαζ κα αεθηζχκμοκ ηδ βεκζηυηενδ απυδμζδ ηςκ εηηνεθυιεκςκ μνβακζζιχκ υηακ αοηά
ζοιπενζθαιαάκμκηαζ ςξ δζαηνμθζηά ζοιπθδνχιαηα. ημπυξ ηδξ πανμφζαξ ιεθέηδξ ήηακ κα ιεθεηδεεί δ
επίδναζδ ημο απμλδναιέκμο εηποθίζιαημξ κεναηγζμφ ζηδ βεκζηυηενδ απυδμζδ ηδξ εηηνεθυιεκδξ ηζζπμφναξ.
Σνεζξ μιάδεξ ζπεοδίςκ ηζζπμφναξ (Sparus aurata) δζαηνάθδηακ βζα ζοκμθζηά 120 διένεξ ιε αολακυιεκεξ
δυζεζξ ημο εηποθίζιαημξ κεναηγζμφ (0,25%, 0,50% ηαζ 1%, ακηίζημζπα) ζηδ δίαζηα ημοξ, εκχ ιζα άθθδ μιάδα
δζαηνάθδηε ιε δίαζηα πμο δεκ πενζείπε ημ ζοβηεηνζιέκμ ζοζηαηζηυ. Γεκ παναηδνήεδηε ηάπμζα ζηαηζζηζηά
ζδιακηζηή (P>0,05) δζαθμνά ιεηαλφ ηςκ ηεζζάνςκ δζαηνμθζηχκ μιάδςκ ςξ πνμξ υθεξ ηζξ οπυ ιεθέηδ
παναιέηνμοξ ακάπηολδξ ηςκ ζπεφςκ, ηδξ αλζμπμίδζδξ ηδξ ηνμθήξ ηαζ ημο πμζμζημφ επζαίςζδξ αοηχκ.
Δπζπνυζεεηα, δεκ παναηδνήεδηε ηάπμζα ζδιακηζηή δζαθμνμπμίδζδ ζηδκ ζζημθμβία ημο ήπαημξ ιεηαλφ ηςκ
μιάδςκ. Ζ πμνήβδζδ απμλδναιέκμο εηποθίζιαημξ κεναηγζμφ ζε μπμζαδήπμηε πμζυηδηα μδήβδζε ζε ζδιακηζηά
ιεζςιέκδ πενζεηηζηυηδηα (%) ζε οβναζία ηαζ ζε μθζηέξ πνςηεΐκεξ ηαζ ζε ζδιακηζηά αολδιέκδ πενζεηηζηυηδηα
ζε μθζηά θζπίδζα ζοβηνζηζηά ιε ημοξ ζπεφεξ πμο δεκ ηαηακάθςζακ ημ εηπφθζζια. Ζ πμνήβδζδ ημο εηποθίζιαημξ
επίζδξ μδήβδζε ζε αολδιέκεξ ηζιέξ ημο δπαημζςιαηζημφ ηαζ εκδμζπθαπκζημφ δείηηδ οπμδδθχκμκηαξ
ιεηααμθζηυ ζηνεξ. οιπεναζιαηζηά, δ πμνήβδζδ απμλδναιέκμο εηποθίζιαημξ κεναηγζμφ ζε πμζμζηυ ςξ ηαζ 1%
ηδξ δίαζηαξ δεκ μδδβεί ζε αεθηζςιέκδ απμδμηζηυηδηα ηδξ ηνμθήξ ηδξ ηζζπμφναξ, μφηε αεθηζχκεζ ηδκ
δζαηδνδζζιυηδηα ημο θζθέημο ηαηά ηδκ ζοκηήνδζή ημο οπυ ρφλδ.
Λέξειρ κλειδιά: Sparus aurata, δηαηξνθή, εθρύιηζκα λεξαηδηνύ, θπηνβηνηηθά.
*οββναθέαξ επζημζκςκίαξ: Καναπακαβζςηίδδξ Ηςάκκδξ Θ. (ikarapan@uth.gr)
351
HydroMedit 2014, November 13-15, Volos, Greece
1. Δηζαγσγή
Λυβς ηςκ ανηεηχκ ιεζμκεηηδιάηςκ πμο πανμοζζάγεζ δ πνδζζιμπμίδζδ ακηζαζμηζηχκ ζηζξ
ζπεομηαθθζένβεζεξ (Defoirdt et al. 2011), έπεζ δζεβενεεί έκα έκημκμ ενεοκδηζηυ εκδζαθένμκ ζπεηζηά ιε ηδ
πνδζζιμπμίδζδ εκαθθαηηζηχκ θοζζηχκ πνμσυκηςκ, πμο μκμιάγμκηαζ θοημαζμηζηά (phytobiotics) (Sapkota et al.
2008, Windisch et al. 2008). Πένακ ηδξ ακηζ-ιζηνμαζαηήξ/ζσηήξ/ιοηδηζαηήξ ημοξ δνάζδξ, ηα θοημαζμηζηά ζοπκά
έπμοκ ακηζμλεζδςηζηέξ επζδνάζεζξ, ηάπμζα θεζημονβμφκ ςξ εκζζποηζηά ηδξ βεφζδξ, αεθηζχκμοκ ηδ θεζημονβία ημο
εκηένμο ή αηυια εκζζπφμοκ ηδκ ίδζα ηδ ζςιαηζηή ακάπηολδ (Windisch et al. 2008). Δπίζδξ, μζ μοζίεξ αοηέξ
είκαζ ιδ ημλζηέξ ηαζ αζμδζαζπχιεκεξ, εκχ ιέπνζ ζήιενα δεκ έπεζ ακαθενεεί ηαιία ακεεηηζηυηδηα παεμβυκμο ζε
αοηά. Πανυθμ πμο μζ ζδζυηδηεξ αοηέξ ηςκ θοημαζμηζηχκ είκαζ βκςζηέξ ζηδ θανιαηεοηζηή, ζήιενα ιυκμ ιζα
ιζηνή μιάδα ηέημζςκ μοζζχκ ανίζηεζ πνήζδ ζηζξ ζπεομηαθθζένβεζεξ. ηδκ εονεία αοηή μιάδα πενζθαιαάκμκηαζ
δζάθμνα αυηακα, ιπαπανζηά, νεηζίκζα ηαζ αζεένζα έθαζα απυ δζάθμνα άκεδ, θφθθα ηαζ θνμφηα. To απμλδναιέκμ
εηπφθζζια κεναηγζμφ είκαζ έκα παναπνμσυκ ηδξ επελενβαζίαξ ημο ζοβηεηνζιέκμο θνμφημο ηαζ είκαζ πθμφζζμ ζε
α-βθοηάκεξ, αζμθθααμκμεζδή ηαζ αθβζκζηά μλέα πμο εκζζπφμοκ ηδ ιδ εζδζηή ακμζία ημο μνβακζζιμφ ηαζ δνμοκ
ςξ ζζπονά ακμζμεκζζποηζηά (Rapisarda et al. 1999). Σμ ζοζηαηζηυ αοηυ εκδέπεηαζ κα ημκχκεζ ηδκ πεπηζηυηδηα
ηδξ ηνμθήξ, ηδ δζαεεζζιυηδηα ηςκ ενεπηζηχκ ζοζηαηζηχκ ηαζ ςξ εη ημφημο ηδκ ιεηαηνερζιυηδηα ηδξ ηνμθήξ.
ημπυξ ηδξ πανμφζαξ ιεθέηδξ ήηακ κα ιεθεηδεεί δ επίδναζδ πμο έπεζ ημ εηπφθζζια κεναηγζμφ ζηδ βεκζηυηενδ
απυδμζδ ηδξ εηηνεθυιεκδξ ηζζπμφναξ ιεθεηχκηαξ δείηηεξ υπςξ δ ζςιαηζηή ακάπηολδ, δ ιεηαηνερζιυηδηα ηδξ
ηνμθήξ, δ επίδναζδ ζηδκ ενεπηζηή ζφζηαζδ ημο θζθέημο, ζηδκ ζζημθμβία ημο ήπαημξ ηαζ ημ πνυκμ δζάνηεζαξ
γςήξ ημο θζθέημο ηδξ ηζζπμφναξ.
352
HydroMedit 2014, November 13-15, Volos, Greece
πμο Wα ηαζ Wη, ημ ιέζμ ανπζηυ ηαζ ιέζμ ηεθζηυ ζςιαηζηυ αάνμξ ηςκ ζπεφςκ, LnWα ηαζ LnWη oζ θοζζημί
θμβάνζειμζ ημο ιέζμο ανπζημφ ηαζ ιέζμο ηεθζημφ ζςιαηζημφ αάνμοξ ηςκ ζπεφςκ.
Οζ ζςιαημιεηνζημί δείηηεξ πμο οπμθμβίζηδηακ ήηακ: μ δπαημζςιαηζηυξ δείηηδξ (hepatosomatic index,
ΖSΗ), μ εκδμζπθαπκζηυξ δείηηδξ (viscerosomatic index, VSI) ηαζ μ δείηηδξ εονςζηίαξ (Κ):
ΖSΗ = Βάνμξ ήπαημξ × 100 / Βάνμξ ζχιαημξ (εηηυξ εκηυζεζςκ, ήπαημξ)
VSI = Βάνμξ εκηυζεζςκ × 100 / Βάνμξ ζχιαημξ (εηηυξ εκηυζεζςκ, ήπαημξ)
Κ = Οθζηυ αάνμξ ζχιαημξ × 100 / Οθζηυ ιήημξ3
Θξεπηηθή ζύζηαζε(%)
Τβναζία 92,7 92,8 92,8 92,8
Οθζηέξ πνςηεΐκεξ 47,8 47,8 47,7 47,7
Οθζηέξ θζπανέξ μοζίεξ 18,2 18,2 18,2 18,2
Τδαηάκεναηεξ 1 21,2 21,0 20,9 20,50
Ηκχδεζξ μοζίεξ 2 1,8 1,8 1,7 1,7
Σέθνα 5,3 5,3 5,3 5,3
Δκένβεζα (Kg/g) 3 22,0 21,9 21,9 21,8
δι.: Σα ζοζηαηζηά πνμιδεεφηδηακ απυ ηδκ Biomar Hellas, ημ ζζηάνζ απυ ηδκ ημπζηή αβμνά, εκχ ημ Provigoro
απυ ηδκ Citrox Technologies Ltd. 1 Σμ πμζμζηυ ηςκ οδαηακενάηςκ εηηζιήεδηε ιε αθαίνεζδ απυ ημ 100 ημο
ζοκυθμο ηςκ πμζμζηχκ πνςηεΐκδξ, θζπζδίςκ ηαζ ηέθναξ. 2 Οζ ζκχδεζξ μοζίεξ εηηζιήεδηακ αάζεζ ηςκ
πενζεηηζημηήηςκ ηςκ δζαθυνςκ ζοζηαηζηχκ ζφιθςκα ιε βκςζηέξ ζοβηεκηνχζεζξ (ΝRC 1993). 3 Ζ μθζηή
εκένβεζα οπμθμβίζηδηε ςξ άενμζζια ηςκ επζιένμοξ μθζηχκ εκενβεζχκ πμο πνμζθένεζ ηάεε ενεπηζηυ ζοζηαηζηυ
θαιαάκμκηαξ οπ‘ υρδ ημοξ ζοκηεθεζηέξ 5,64, 9,44 ηαζ 4,11 βζα ηζξ πνςηεΐκεξ, ηα θζπίδζα ηαζ ημοξ οδαηάκεναηεξ,
ακηίζημζπα.
Οζ πδιζηέξ ακαθφζεζξ ηδξ ενεπηζηήξ ζφζηαζδξ ηςκ ηνμθχκ ηαζ ηςκ ζζηχκ ηςκ ζπεφςκ
πναβιαημπμζήεδηακ ζφιθςκα ιε ηζξ ιεευδμοξ AOAC 1995 ςξ ελήξ: μ πνμζδνζμνζζιυξ ηδξ οβναζίαξ ιε
εένιακζδ βζα 24 χνεξ ζημοξ 105 °C, o πνμζδζμνζζιυξ ηςκ μθζηχκ θζπανχκ μοζζχκ έβζκε ιε ηδκ ιέεμδμ
εηπφθζζδξ Soxhlet, μ πνμζδζμνζζιυξ ηςκ μθζηχκ αγςημφπςκ μοζζχκ πναβιαημπμζήεδηε ιε ηδ ιέεμδμ Kjeldahl
ηαζ μ πνμζδζμνζζιυξ ηδξ ηέθναξ ιε απμηέθνςζδ ηςκ δεζβιάηςκ ζημοξ 600 °C βζα 3 χνεξ. Απυ ηάεε δζαηνμθζηή
μιάδα πάνεδηακ δείβιαηα ήπαημξ απυ ζοκμθζηά 9 ράνζα. Γζα ηδ ιζηνμζημπζηή ιεθέηδ ημο ήπαημξ
πνδζζιμπμζήεδηακ ηεπκζηέξ ζζημθμβίαξ μζ μπμίεξ πενζεθάιαακακ ιμκζιμπμίδζδ ημο ζζημφ ζε δζάθοια μοδέηενδξ
θμνιυθδξ 10% βζα 48 χνεξ, αθοδάηςζδ - δζαφβαζδ - εβηθεζζιυξ ημο ζζημφ ζε παναθίκδ, ημιέξ πάπμοξ 5-6 ιm,
απμπαναθίκςζδ, πνχζδ ημο ζζημφ ζε δζάθοια πνχζδξ αζιαημλοθίκδξ – εςζίκδξ ηαζ ηέθμξ ζηενεμπμίδζδ ηςκ
ημιχκ. Οζ ζζημθμβζηέξ ημιέξ ιεθεηήεδηακ ζε μπηζηυ ιζηνμζηυπζμ ζε ιεβέεοκζδ 400. Μζηνμθςημβναθίεξ
θήθεδζακ ιε ηδ αμήεεζα ρδθζαηήξ ηάιεναξ πνμζανιμζιέκδξ ζημ ιζηνμζηυπζμ. Φζθέηα ηςκ ζπεοδίςκ
απμεδηεφεδηακ ζημοξ 0°C ηαζ ακά ηαηηά πνμκζηά δζαζηήιαηα πναβιαημπμζμφκηακ δεζβιαημθδρίεξ βζα
ιζηνμαζμθμβζηέξ ακαθφζεζξ. Γέηα (10) g ζάνηαξ ιεηαθένμκηακ αζδπηζηά ζε 90 ml MRD (0,85% NaCl, 0,1%,
bacteriological peptone), αημθμοεμφζε μιμβεκμπμίδζδ βζα 1 θεπηυ, δζαδμπζηέξ αναζχζεζξ, ηαζ επζθακεζαηή
ελάπθςζδ 0,1 ml ακαζςνήιαημξ απυ ηδκ ηαηάθθδθδ αναίςζδ ζε ηνοαθία Plate Count Agar (PCA) ηαζ μ
πθδεοζιυξ ηςκ ιεζυθζθςκ ηαζ ροπνυηνμθςκ ααηηδνίςκ ηαηαιεηνχκηακ έπεζηα απυ επχαζδ 48 ςνχκ ζημοξ 25
ηαζ 10 °C, ακηίζημζπα.
Σα δεδμιέκα ηςκ παναιέηνςκ ακάπηολδξ ηςκ ζπεφςκ ηαζ αλζμπμίδζδξ ηδξ ηνμθήξ επελενβάζεδηακ ιε
ηδ ιέεμδμ ηδξ Ακάθοζδξ ηδξ Γζαηφιακζδξ Μμκήξ Καηεφεοκζδξ (one-way ANOVA) αημθμοεμφιεκδ απυ
Tukey‘s test ηαζ μζ δζαθμνέξ ηνίεδηακ ζηαηζζηζηά ζδιακηζηέξ βζα ηζιέξ P<0,05.
353
HydroMedit 2014, November 13-15, Volos, Greece
παναιέηνμοξ ακάπηολδξ ηςκ ζπεφςκ ηαζ ηδξ αλζμπμίδζδξ ηδξ ηνμθήξ πμο ιεθεηήεδηακ (Πίκαηαξ 2). Τπήνλε ιζα
ηάζδ, δ μπμία παναηδνήεδηε ήδδ απυ ηδ δεφηενδ εαδμιάδα, υπμο δ δυζδ ημο εηποθίζιαημξ κεναηγζμφ ηδξ
ηάλδξ ημο 0,5% ηδξ ηνμθήξ (μιάδα Γ) πανμοζίαζε ορδθυηενδ αφλδζδ ζςιαηζημφ αάνμοξ, εζδζηυ νοειυ
ακάπηολδξ ηαζ αλζμπμίδζδ ηδξ ηνμθήξ ζε ζπέζδ ηυζμ ιε ηζξ μιάδεξ πμο δζαηνάθδηακ ιε παιδθυηενδ ή
ορδθυηενδ δυζδ, υζμ ηαζ ιε ηδκ μιάδα πμο δζαηνάθδηε ιε ηδκ ηνμθή ιάνηονα (ιδδεκζηή δυζδ). Ζ ηάζδ,
ςζηυζμ, αοηή δεκ ήηακ ζδιακηζηή (P>0,05) ηαευθδ ηδ δζάνηεζα ημο πεζνάιαημξ. Σμ απμηέθεζια αοηυ δείπκεζ
υηζ ημ απμλδναιέκμ εηπφθζζια κεναηγζμφ δεκ επζθένεζ ηάπμζα ζδιακηζηή αεθηίςζδ ζηδκ απμδμηζηυηδηα ηδξ
ηνμθήξ ηαζ ζηδκ ακάπηολδ ηδξ ηζζπμφναξ. H Citrox Technologies (αδδιμζίεοηα απμηεθέζιαηα) δμηζιάγμκηαξ
ημ εηπφθζζια κεναηγζμφ ζε πμζμζηυ 0,25% ζηδ δίαζηα ηδξ πέζηνμθαξ (Oncorhynchus mykiss) ακέθενε υηζ μζ
ζπεφεξ απέηηδζακ ορδθυηενδ αφλδζδ αάνμοξ απυ υηζ μζ ζπεφεξ πμο δζαηνάθδηακ πςνίξ ηδκ πνμζεήηδ ημο
εηποθίζιαημξ. Οζ de la Cuesta et al. (2010), δμηζιάγμκηαξ έκα ιείβια πνεαζμηζηχκ ηαζ εηποθζζιάηςκ απυ θοηά
ημο βέκμοξ Citrus ζε πμζμζηυ 0,25-0,3% ηδξ δίαζηαξ ακέθενακ υηζ οπήνλε αεθηζςιέκδ ακάπηολδ ηαζ
ιεηαηνερζιυηδηα ηδξ ηνμθήξ ηυζμ ζηδκ πέζηνμθα (Oncorhynchus mykiss) υζμ ηαζ ζημ θαονάηζ (Dicentrarchus
labrax). Ακηίεεηα, μζ Rodrigues et al. (2011) ζοιπενζέθααακ πμφθπα κεναηγζμφ ζε ανηεηά ορδθά πμζμζηά ζηδ
δίαζηα ημο βαηυρανμο (Rhamdia quelen) ηαζ ηδξ ηζθάπζαξ (Oreochromis niloticus) ηαζ δζαπίζηςζακ ιεζςιέκδ
ακάπηολδ ηςκ ζπεφςκ πμο μθείθεηαζ ηονίςξ ζηδκ ορδθή πμνήβδζδ άπεπηςκ ζκςδχκ μοζζχκ.
Πεναζηένς, δ πμνήβδζδ ημο εηποθίζιαημξ ζηδ δζάζηα ηδξ ηζζπμφναξ μδήβδζε ζε εθαθνχξ ιεζςιέκεξ
εκδζζιυηδηεξ ζε ζφβηνζζδ ιε ηδ δίαζηα-ιάνηονα, ζδζαίηενα ζηδκ μιάδα Γ, πςνίξ ςζηυζμ ημ απμηέθεζια αοηυ
κα είκαζ ζηαηζζηζηά ζδιακηζηυ (P>0,05). Αοηυ δεζηκφεζ υηζ ημ απμλδναιέκμ εηπφθζζια κεναηγζμφ δεκ μδδβεί ζε
ζδιακηζηή αεθηζχζδ ηδξ επζαίςζδξ ηδξ ηζζπμφναξ. Ακηίεεηα, δ Citrox Technologies (αδδιμζίεοηα
απμηεθέζιαηα) ακέθενε υηζ δ πμνήβδζδ ημο εηποθίζιαημξ ζε πμζμζηυ 0,25% ηδξ δίαζηαξ μδήβδζε ζε
ζδιακηζηά ιεζςιέκεξ εκδζζιυηδηεξ ζηδκ πέζηνμθα (O. mykiss). Ακαθμνζηά ιε ηδ ενεπηζηή ζφζηαζδ ημο
ιοσημφ ζζημφ ηςκ ζπεφςκ, αοηή επδνεάζηδηε ζδιακηζηά (P<0,05) απυ ηζξ πεζναιαηζηέξ δίαζηεξ. οβηεηνζιέκα, δ
πμνήβδζδ ημο απμλδναιέκμο εηποθίζιαημξ κεναηγζμφ ζε μπμζαδήπμηε πμζυηδηα (μιάδεξ Β, Γ ηαζ Γ) μδήβδζε
ζε ζδιακηζηά ιεζςιέκδ πενζεηηζηυηδηα (%) ζε οβναζία ηαζ μθζηέξ πνςηεΐκεξ ηαζ ζε ζδιακηζηά αολδιέκδ
πενζεηηζηυηδηα ζε θίπμξ ζοβηνζηζηά ιε ημοξ ζπεφεξ πμο δεκ ηαηακάθςζακ ημ εηπφθζζια. Ζ ιεζςιέκδ
πενζεηηζηυηδηα ζε ιοσηέξ πνςηεΐκεξ ηαζ δ αολδιέκδ εκαπυεεζδ θίπμοξ ζε αοηέξ ηζξ μιάδεξ δείπκεζ ιεηααμθζηή
αλζμπμίδζδ (ηαηααμθζζιυξ) ηςκ πνχηςκ πνμξ παναβςβή ιεηααμθζηήξ εκένβεζαξ πμο απμεδηεφεηαζ ζημ ιοζηυ
ζζηυ ζηδ ιμνθή ημο θίπμοξ. Γζαθμνμπμζήζεζξ ζηδ πμνδβμφιεκδ πμζυηδηα ημο εηποθίζιαημξ, ςζηυζμ, δεκ
επέθενακ δζαθμνμπμζήζεζξ ζηδ ενεπηζηή ζφζηαζδ ημο ιοσημφ ζζημφ. Ζ πμνήβδζδ ημο εηποθίζιαημξ επίζδξ
επδνέαζε (P<0,05) ζδιακηζηά ημοξ ζςιαημιεηνζημφξ δείηηεξ ηςκ ζπεφςκ, ηαεχξ ηυζμ μ δπαημζςιαηζηυξ υζμ
ηαζ μ εκδμζπθαπκζηυξ ήηακ ορδθυηενμζ ζηζξ μιάδεξ ζπεφςκ πμο δζαηνάθδηακ ιε ημ εηπφθζζια, οπμδδθχκμκηαξ
ηάπμζμ ιεηααμθζηυ ζηνεξ. Απυ ηδκ άθθδ, δεκ παναηδνήεδηε ηάπμζα ζδιακηζηή δζαθμνμπμίδζδ ζηδκ ζζημθμβία
ημο ήπαημξ ιεηαλφ ηςκ μιάδςκ.
Οζ ιζηνμαζμθμβζηέξ ακαθφζεζξ έδεζλακ υηζ δεκ οπήνπε δζαθμνά ζηζξ ιεηααμθέξ ημο ιζηνμαζαημφ
πθδεοζιμφ (P>0.05) ιεηαλφ ηςκ ζπεοδίςκ πμο δζαηνάθδηακ ιε ηδκ ηνμθή ιάνηονα ηαζ ιε ηζξ ηνμθέξ πμο
πενζείπακ εηπφθζζια κεναηγζμφ. Ο ειπμνζηυξ πνυκμξ γςήξ πνμζδζμνίζεδηε βζα υθεξ ηζξ ιεηαπεζνίζεζξ πενί ηζξ 14
διένεξ, υπμο ήηακ μ πνυκμξ πμο πνεζάζηδηε κα θεάζεζ μ μθζηυξ ιεζυθζθμξ ιζηνμαζαηυξ πθδεοζιμφξ ημ επίπεδμ
ηςκ 107 cfu/g , υπμο ηαζ ζοκέπεζε ηαζ ιε ηδκ έκανλδ ηδξ ακάπηολδξ δοζάνεζηςκ μζιχκ. οιπεναζιαηζηά, δ
πμνήβδζδ απμλδναιέκμο εηποθίζιαημξ κεναηγζμφ ζε πμζμζηυ ςξ ηαζ 1% ηδξ δίαζηαξ δεκ μδδβεί ζε αεθηζςιέκδ
απμδμηζηυηδηα ηδξ ηνμθήξ ηδξ ηζζπμφναξ, μφηε ζηδκ επέηηαζδ ημο ειπμνζημφ πνυκμο γςήξ ηςκ θζθέηςκ.
354
HydroMedit 2014, November 13-15, Volos, Greece
Πίλαθαο 2. Παξάκεηξνη αλάπηπμεο, αμηνπνίεζεο ηξνθήο, ζξεπηηθή ζχζηαζε κπτθνχ ηζηνχ θαη
ζσκαηνκεηξηθνί δείθηεο ηρζπδίσλ S. aurata δηαηξεθφκελα κε ηηο πεηξακαηηθέο δίαηηεο. Οη ηηκέο
αληηπξνζσπεχνπλ κέζνπο φξνπο ± ηππηθή απφθιηζε (n=3).
Α Β Γ Γ
Παξάκεηξνη αλάπηπμεο
Ανπζηυ ιήημξ (cm) 5,4±0,1a 5,5±0,1a 5,4±0,1a 5,4±0,1a
a a a
Σεθζηυ ιήημξ (cm) 11,4±0,5 11,8±0,5 12,1±0,9 11,4±0,2a
Ανπζηυ αάνμξ (g) 2,03±0,02a 2,02±0,03a 2,02±0,04a 2,02±0,04a
a a a
Σεθζηυ αάνμξ (g) 21,08±2,15 22,25±2,50 24,59±2,56 19,89±0,37a
Θκδζζιυηδηεξ (%) 26,7±12,6a 20,0±5,0a 8,3±2,9a 20,0±5,0a
Αολ. αάνμοξ (WG, g) 19,06±2,13a 20,23±2,46a 22,56±2,56a 17,86±0,40a
Καηακάθςζδ ηνμθήξ (g) 20,56±3,53 22,67±2,72 24,22±0,50 20,27±3,13
a a a
SGR (%/δι.) 1,95±0,08 2,00±0,08 2,08±0,05 1,90±0,03a
FCR 1,07±0,09 1,12±0,12 1,07±0,10 1,13±0,15
ύζηαζε κπτθνύ ηζηνύ (%)
Τβναζία 78,49±1,08a 76,19±1,77b 76,16±0,58b 75,89±0,54b
a b b
Οθζηέξ πνςηεΐκεξ 80,80±0,50 74,62±0,22 75,80±1,39 75,99±1,17b
Οθζηά θζπίδζα 5,14±2,16a 10,91±2,13b 10,21±2,03b 10,11±2,18b
σκαηνκεηξηθνί δείθηεο
HIS 5,54±0,87a 8,19±2,06b 6,75±1,54ab 7,42±0,99ab
VSI 1,17±0,32a 1,70±0,39b 1,30±0,44ab 1,51±0,41b
δι.: Σζιέξ πμο δεκ ακηζπνμζςπεφμκηαζ απυ ημκ ίδζμ εηεέηδ δείπκμοκ ζηαηζζηζηχξ ζδιακηζηή δζαθμνά (P<0,05)
ιεηαλφ ηςκ δζαηνμθζηχκ μιάδςκ.
Δπραξηζηίεο
Δοπανζζημφιε ημκ ζπεομβεκκδηζηυ ζηαειυ ηδξ «ΓΗΑ ΗΥΘΤΟΚΑΛΛΗΔΡΓΔΗΔ» (Πεθαζβία Φεζχηζδμξ) βζα
ηδκ δςνεά ηςκ ζπεοδίςκ ηαζ ηδ αζμιδπακία ζπεομηνμθχκ «BioMar Hellas» βζα ηδ δςνεά ηςκ πνχηςκ οθχκ ηςκ
δζαίηςκ.
Βηβιηνγξαθία
Defoirdt T., Sorgeloos P., Bossier P. (2011). Alternatives to antibiotics for the control of bacterial disease in
aquaculture. Current Opinion in Microbiology 14, 251–258.
de la Cuesta S., López I., Martínez A., Muñoz L. (2010). Phytobiotics and prebiotics, a new alternative for
sustainable aquaculture. International Aquafeed May-June, 25.
Rapisarda P., Tomaino A., Lo Cascio R., Bonina F., De Pasquale A., Saija A. (1999). Antioxidant effectiveness
as influenced by phenolic content of fresh orange juices. Journal of Agricultural and Food Chemistry
47, 4718–4723.
Rodrigues A.P.O., Gominho-Rosa M.D.C., Cargnin-Ferreira E., De Franscisco A., Fracalossi D.M. (2011).
Different utilization of plant sources by the omnivores jundia catfish (Rhamdia quelen) and Nile tilapia
(Oreochromis niloticus). Aquaculture Nutrition 18, 65-72.
Sapkota A., Sapkota A.R., Kucharski M., Burke J., McKenzie S., Walker P., Lawrence R. (2008). Aquaculture
practices and potential human health risks: current knowledge and future priorities. Environmental
International 34, 1215–1226.
Windisch W., Schedle K., Plitzner C., Kroismayr A. (2008). Use of phytogenic products as feed additives for
swine and poultry. Journal of Animal Sciences 86, E140-E148.
355
HydroMedit 2014, November 13-15, Volos, Greece
Department of Marine Biology and Fisheries Sciences, Tonekabon Branch, Islamic Azad University,
Tonekabon, Iran.
ABSTRACT
The common carp Cyprinus carpio L. belongs to the Cyprinidae, the largest freshwater teleost family and is an
important economic species in Caspian Sea. In recent decades the restructuring of common carp stocks has been
done through artificial propagation that can change the genetic diversity. Five highly variable microsatellite loci
(MFW6, MFW7,MFW9, Syp4, Ca3/4) were used to investigate genetic diversity and population structure of
common carp in Anzali wetland and Gorganroud estuary. Totally, 60 samples of fin fish were collected. Allele
frequencies, the fixation index Fst, Rst, Fis, observed and expected heterozygosity, genetic distance, Hardy-
Weinberg equilibrium were determined at disomic loci amplified from fin tissue samples. The average of alleles
per locus was 9.5 (range 7 to 12 alleles per locus in regions). All sampled regions contained private alleles.
Average observed and expected heterozygosity were 0. 813 and 0. 839 respectively. In all cases, significant
deviations from Hardy-Weinberg equilibrium were reported (P≤ 0.01); only one locus (Syp4) was in Hardy-
Weinberg (HW) equilibrium in Anzali wetland samples. Basis on AMOVA for Fst, Rst and Nm values among
them indicated a significant difference between the populations. The genetic distance between populations which
indicates that the genetic difference among the studied populations is pronounced. These results support the
existence of different genetic populations in the Anzali Wetland and Gorganroud estuary.
1. Introduction
Wild carp Cyprinus carpio Linnaeus, 1758, prefers slow waters and inhabits the lower reaches of the Volga and
Ural rivers, as well as freshened waters of the North Caspian. It spawns in spring, in the shallows around the
islands in the avant-delta. Batch spawning starts at water temperature 18-200С and goes through spring and
summer. Feeding is suspended prior to and during spawning. Wild carp is a commercially valuable fish, also
used in aquaculture. It reaches 1 m in length and more than 30 kg weight. Commercial catches are based on 7-
year old fish (60 cm TL, > 5 kg Wt). The maximum recorded age is 20 years. Age of maturity – 3-4 years.
Fecundity amounts to 1,130 thousand eggs (Kazancheev, 1981). Wild carp is an omnivorous fish, the so-called-
water hog. It feeds on various benthic organisms (chironomids, insect larvae, and mollusks), aquatic plants, and
small fish. In winter it stays in holes and does not feed. In recent years, the intensity of wild carp migration into
rivers declined and its catches are largely determined by fishing efficiency in the coastal zone and the rivers
avant-deltas. In addition to hydrological factors (regulation of runoff, sea level rise, etc.) the population
dynamics is influenced significantly by the increased volume of unreported fishing, which affects directly the
uptake of commercial fishing quotas and reproduction of fish stocks (Velikova et al. 2012).
Among molecular techniques, microsatellite markers are seen as the best way to identify the population
structures of pelagic marine fishes because they are abundantly distributed across the genome, demonstrate high
levels of allele polymorphism and can easily be amplified with PCR (Sekar et al. 2009). Microsatellite genotypes
are particularly helpful in the detection of structure in closely related populations, regardless of whether they are
in evolutionary equilibrium. Additionally, primers designed for one species can often be used in other related
species (Chistiakov et al. 2005).
356
HydroMedit 2014, November 13-15, Volos, Greece
So, the objectives of the present study are to investigate the genetic structure of the common carp and test the
hypothesis that the common carp has an identical population in different regions of the South Caspian Sea.
The fishes were caught from two different regions, including 30 samples from Anzali wetland and 30 samples
from Gorganroud estuary (Iran) (Figure.1). Fin tissue samples were prepared from 60 fishes of each location and
preserved in 95% ethanol and stored at room temperature.
Genomic DNA was extracted from fin tissue using a high pure PCR Template preparation kit (Roach, Germany)
according to the manufacturer‘s instructions. The quality and concentration of DNA were assessed by 1%
agarose gel electrophoresis and spectrophotometry (CECIL model CE2040) and then stored at -20°C until use.
Genomic DNA was used as a template to amplify microsatellite loci by touchdown polymerase chain reaction
(PCR). The nuclear DNA was amplified using 5microsatellite primers designed for Cyprinidea (MFW6, MFW7,
MFW9 (Dimsoski et al., 2000) SyP4, Ca3/4 (Crooijmans et al., 1997). PCR products were electrophoresed on
10% polyacrylamide gels (29:1 acrylamide: bis-acrylamide; 1X TBE buffer) and followed by silver-staining.
Gels were run at 40 mA for 14h. Alleles were sized using Uvitec software, and each gel contained an allelic
ladder (100bp) to assist with consistent scoring (by ruler) of alleles.
Allele frequencies were estimated using F-statistics and Nei‘s genetic distance. The total genetic diversity
(heterozygosity) within and among populations can be classified as follows: Ho =observed heterozygosity and
He=expected heterozygosity. Hardy-Weinberg tests of equilibrium were estimated. Wright‘s F-statistics (Wright,
1965) as follows: Fis =inbreeding coefficient within individuals relative to the subpopulation for each locus and
stellate sturgeon sampling site were assessed; and Fst =inbreeding coefficient within subpopulations relative to
the total Fst and Rst were calculated using analysis of molecular variance (AMOVA) to estimate genetic
variation among populations and regions. AMOVA calculations and allelic richness (AR) were performed on
Arlequin 3.5 (Excoffier & Lischer 2010) using 10,000 permutations in each case. Nei‘s genetic identity and
distance were determined using a pairwise, individual-by-individual genetic distance, with all codominant data
computed in GeanAlex 6 software (Peakall & Smouse 2005).
Figure 1. Map showing sampling locations of populations of common carp: Anzali wetland (1) and Gorganroud
estuary (2).
357
HydroMedit 2014, November 13-15, Volos, Greece
3. Results
Overall 5 loci were successfully amplified. All microsatellite primers that were able to produce DNA bands
displayed a characteristic disomic banding pattern (Figures 2, 3). The allele frequencies at all loci are given in
Table 1. The average number of alleles found per site was 9.5, and the number of alleles in MFW6 ranged from
10 to 11 (AR=9.8), in MFW7 from 12 to 11 (AR=9.6), in MFW9 from 7 to 8 (AR=9.4), in SyP4 from 8 to 11
(AR=9.9), in Ca3/4 from 9 to 8 (AR=9.2). Out of 56 observed alleles, 35 alleles occurred at frequencies of less
than 0.05 in all samples. All sampled populations contained a significant number of private alleles (P < 0.05). In
total, 8 alleles were found, with the number of private alleles being Anzali wetland 2 alleles, and Gorganroud
estuary 6 alleles, none of which was found in other region. The observed and expected heterozygosity averaged
0.808 and 0.898 respectively; the observed heterozygosity ranged from 0.267-1. In all cases, deviations from
Hardy-Weinberg equilibrium were significant (P < 0.01), except for SyP4 in Anzali wetland (Table 1). Estimates
of inbreeding coefficient or Fis values were between -0.227 at MFW9 and 0.624 at Ca3/4 (mean Fis = 0.043),
and positive Fis values a relative dearth of heterozygotes. The average of Fst and Nm via frequency was 0.029
and 2.7, respectively, and as analyzed with AMOVA, showed a significant genetic differentiation among sites
(P<0.01), which suggested that the populations diverged from each other.
358
HydroMedit 2014, November 13-15, Volos, Greece
Table 1. Numbers of allelles observed within 2 sampling sites using 5 sets of microsatellite primers. Number of studied
samples (n), Observed (Ho) and expected (He) heterozygosities, number of alleles (Na), effective allele (Ne) at 10 loci
in
three sampling sites. Loci in accordance with H-W equilibrum *P < 0.05; **P < 0.01; ***P < 0.001; ns= not significant.
Anzali wetland Gorganroud estuary Touchdown protocol
4. Discussion
The present study showed the mean number of alleles 6.9 and the allelic range 7-12. Although the two locations
did not show a significant difference in genetic variation between the different loci, there was a significant
difference in genetic differentiation. In recent years, increased legal and illegal fishing activities, the reduced
return rate of released baby fish resulting from decreased released weight, and reduced natural reproduction have
decreased the catch of bony fish (Ghorbani et al., 2010).
Although the alleles were observed in the location of freshwater fish and common carps, a large number of
alleles with a low frequency were found in this study. The existence of many low-frequency alleles points to
genetic bottlenecks or to the effects of inbreeding (Alarcon et al., 2004). The loss of genetic variability in the
wild stocks might be related to the severe reduction in the stock of this fish in the past years as a result of
overutilization of stocks and excessive non-standard catch of immature fish. The small size of the spring in
beach seines has highly increased the portion of the catch of non-standard fish (Ghorbani et al., 2010).
Furthermore, issues such as overfishing, environmental pollution, the destruction of the main habitat (the Anzali
wetland), and the falling water levels in the Caspian Sea in the past decades have reduced the fish stock in the
Anzali wetland (Jafari, 2009). The reducing trend of genetic diversity would predispose them to diseases and
increase other selective parameters (Shen and Gong, 2004). If the present trend continues, it will lead to a severe
reduction in the population of this species in near future.
359
HydroMedit 2014, November 13-15, Volos, Greece
The present research on the common carp shows the mean heterozygosity at 0.81 (±0.09), which is higher than
that in freshwater fish (0.54± 0.25) (Dewoody and Avis, 2000). The mean heterozygosity in both sampling
locations was lower than the expected heterozygosity. The increased heterozygosity in some places might be due
to the existence of null alleles, which are ranked by mistake. Besides the low-frequency alleles, the positive
inbreeding coefficient is another reason for reduced genetic diversity and increased inbreeding, which are
affected by issues such as overfishing, reduced natural reproduction, and improper artificial reproductive
methods. In this study on the common carp, in both sampling locations, almost all loci were out of Hardy-
Weinberg equilibrium. The cause for deviation from Hardy-Weinberg equilibrium might be the mixing of
populations and non-random mating. The AMOVA test showed a significant difference between the Fst and Rst
of the two sampling locations (P<0.01); therefore, the genetic structure of the populations are separated from
each other, and at least, two genetically different populations exist in the Anzali wetland and estuary of
Gorganroud.
The low Fst is due to the high polymorphism (resulting from mutation) in microsatellites, which significantly
reduce the Fst (Balloux and Lugan, 2002). Shaklle (1982), Thorpe and Sol-cave (1994), Nei (1972) has reported
the
Mean genetic distance for the separation of populations at 0.3 (ranging from 0.03 to 0.61), which is compatible
with the genetic distance observed in this study, and confirms the genetic distinction between the observed
populations. The results of the present study offer initial evidence for the existence of the distinct populations of
the common carp in the Anzali Lagoon and the estuary of Gorganroud.
Acknowledgments
The study was supported by Islamic Azad University, Tonekabon Branch and was performed in Molecular
Genetic Lab. We would like to thank Dr. Nazemi (Dept. of Biology).
References
Alarcon, J. A., Magoulas, A., Georgakopoulos, T., Zouros, E., Alvarez, M. C. (2004). Genetic comparison of
wild and cultivated European populations of the gilthead sea bream (Sparus aurata) Aquaculture. Vol. 230, pp.
65–80.
Balloux, F., Lugon-Moulin, N. (2002). The estimate of population diffraction with microsatellite markers.
Molecular Ecology. 11, 155-165.
Chistiakov, D.A., Hellemans, B., Haley, C.S., Law, A.S., Tsigenopoulos, C.S., Kotoulas, G., Bertotto, D.,
Libertini A. and Volckaert, F.A. (2005). A microsatellite linkage map of the European sea bass Dicentrarchus
labrax L. Genetics. 170,1821–1826.
Crooijmans, R. P. M., Bierbooms, V., Komeh, J., Vanderpoe, J. J., Groenen, M. (1997). Microsatellite markers
in common carp (Cyprinus carpio). Animal genetics. 28, 129-134.
Dewoody, J. A., Avise, J. C. (2000). Microsatellite variation in Marine, freshwater and anadramous fishes
compared with other animals. Journal of fish biology. 56, 461-473.
Dimsoski, P., Toth, G. P., Bagley, M. J. (2000). Microsatellite chaeacterization in (Cyprinidae). Molecular
Ecology.9, 2187-2189.
Excoffier L., Lischer H.E.L. (2010) Arlequin suite ver 3.5: a new series of programs to perform population
genetics analyses under Linux and Windows. Molecular Ecology Resource 10, 564–567.
Ghorbani, R., Yelghi, S., Aghili, S.M. (2010). Survey and Assessment of Predation of Fish Beach seine
Cooperative Companies in Golestan Province in 2005-2006. Journal of Fisheries Islamic Azad University,
Azadshahr Branch. 4, 39-47.
Jafari, N. (2009). Ecological integrity of wetland, their functions and sustainable use, Journal of Ecology and
Natural Environment. 1, 45-54.
360
HydroMedit 2014, November 13-15, Volos, Greece
Kazancheev, E.N. (1981). Fishes of the Caspian Sea. M., Light and food ind.‖ publishers. 167 p. Nei, M., 1972.
Genetic distance between populations. American Naturalist.106, 283-292.
Nei M. (1972). Genetic distance between populations. American Naturalist 106, 283-292.
Peakall, R., Smouse, P. E. (2006). GENALEX 6: genetic analysis in Excel. Population genetic software for
teaching and research. Molecular Ecology Notes. 6, 288-295.
Sekar, M., Suresh E., Kumar N.S., Nayak S.K., Balakrishna C. (2009). Microsatellite DNA markers, a fisheries
perspective Part 1: The nature of microsatellites. Aquaculture Asia Magazine. 27-29.
Shaklle, J. B., Tamaru, C. S., Waples, R. S. (1982). Speciation and evolution of marine fishes studied by
electrophoretic analysis of proteins. Pacific Science, Vol.36, pp.141-157.
Shen, X.Y., Gong, Q. L. (2004). Population genetic structure analysis of the imported turbot seedlings
Scophthalmus maximus. Using RAPD and microsatellite technique. Oceanology and Limnology Science, Vol.
35, pp. 332–341.
Thorpe JP, Sole-Cava A.M. (1994). The use of allozyme electrophoresis in invertebrate systematics. Zoologica
Scripta 23, 3- 18.
Velikova V.N., Shaudanov A.K., Gasimov A., Korshenko A., Abdoli A., Morozov B., Katunin D. N.,
Mammadov E., Bokova E. B., Emadi H., Annachariyeva J., Isbekov K., Akhundov M., Milchakova, N.,
Muradov O., Khodorevskaya R., Shahifar R., Shiganova, T., Zarbaliyeva T. S., Mammadli T., Velikova, V.,
Barale, V., Kim Y. (2012). Review of the environment and bioresources in the Caspian Sea ecosystem 2000-
2010. CaspEco Report, 423P.
361
HydroMedit 2014, November 13-15, Volos, Greece
362
HydroMedit 2014, November 13-15, Volos, Greece
and their diameter measured 172.19±1.81 ιm . The cross section of the PALS contained 1 to2 arteries; the artery
was tortuous and branched in PALS . A wide marginal zone surrounds the white pulp and it was contained
sheathed arteries and smooth muscle cells (Figures 1&2).
Figure 1. External capsule (above arrow) that elongated to the spleen tissue (down arrow) (H&E, 4X).
Figure 2. Capsule was variable in its thickness outer layer (o), inner layer (I) with smooth muscles cell and
trabeculae (T) (H&E, 4X).
4. Discussion
This study showed that the capsule of the Persian sturgeon was thick and divided into an outer connective tissue
layer and an inner parallel thin smooth muscle layer. Cesta (2006) described that the capsule is composed of
dense fibrous tissue, elastic fibers, and smooth muscle and showed that the outermost layer of the splenic capsule
is composed of mesothelial cells, While in some mammales they have only 2-3 layers of smooth muscle cells are
oriented perpendicular to each other (Chen & Weiss). Brown and Dellmann (1976) showed that the capsule of
horse consists of an outer thick connective tissue and an inner thinner smooth muscle layer. The thickness of the
capsule, trabeculae and concentration of smooth muscles are very important agents to make strong contraction
when the body need the blood and the smooth muscle concentration may play a role in the immune reactions,
and this agree with what was found by Milicevic et al (1986). in their study on human spleen.The white pulp is
subdivided into the PALS, the follicles, and the marginal zone. It is composed of lymphocytes, macrophages,
dendrite cells, plasma cells, arterioles, and capillaries in a reticular framework similar to that found in the red
pulp (Keresztes et al, 1996). Therefore, the large area of white pulp and entity of the tortuous of artery which
that supply the PALS area by blood may be play essential role in production blood antibodies.
Acknowledgements
Financial support was provided by department of basic science, faculty of veterinary medicine, University of
Tehran and department of marine biology, faculty of marine science, Khorramshahr University of Marine
Science and Technology. The authors gratefully acknowledge deputy of research and technology for her
excellent technical assistance in rearing persian sturgeon.
References
Bacha, W. J., Linda, M. B. (2000). Color Atlas of Veterinary Histology. 2nd Ed.
Brown, E., Dellmann H. D. (1976). Lymphatic system. In Textbook of Veterinary Histology (Ed. H. D.
Dellmann and E. Brown). pp.161-184. Philadelphia: Lea & Febiger.
Cataldi, E., Albano, C. (2002). Acipenser nccarii; Fine structure of the alimentary canal references to its
ontogenesis, Applied Ichthyology 18, 329 -337.
Cesta, M. F. (2006). Normal structure, function, and histology of spleen. Toxicological Pathology 34, 455–465.
Chen, L., Weiss, L. (1973). The role of the sinus wall in the passage of the erythrocytes through the spleen.
Blood 41, 529-537.
Keresztes, G., Takacs, L., Vilmos, P., Kurucz, E., Ando, I. (1996). Monoclonal antibodies detecting components
of the bovine immune system in formaldehyde fixed paraffin-embedded tissue specimens. Veterinary
Immunology Immunopathology 52, 383-392.
Luna, L.G. (1960). Manual of Histological Staining Methods of the Armed Forces Institute of Pathology. 3rd ed.
by McGraw Book Company. New York, London.
Milicevic, Z., Cuschieri, A., Xuereb, A. Milicevic, N. (1996). Stereological study of tissue compartments of the
human spleen. Histology Histopathology 11, 833-836.
North, J., Farr, R., Vescei, P. (2002). A comparison of meristic and morphometric characters of green sturgeon
Acipenser medirostris. Applied Ichthyology 18, 234 – 239.
363
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
The lipopolysaccharide (LPS) is a factor that resembles bacterial infection and activates the innate immune
system. The aim of the present study was to investigate the effect of exogenous in vivo administration of LPS (6
mg/kg body weight) on the expression of signaling proteins, i.e. members of the mitogen activated protein
kinases (MAPKs) superfamily, protein-markers of cellular stress, like heat shock proteins (Hsps) and protein
markers of apoptosis (Bcl-2, Ubiquitin) in the gilthead seabream (Sparus aurata), after 24 and 72 h. Specifically,
we studied the heat shock proteins Hsp70 and Hsp90, the members of the MAPKs ERK 1/2 (Extracellular
Signal-Regulated Kinase), JNKs (Jun N-terminal kinases) and p38 MAPK, and Bcl-2 using Western blot
analysis. For ubiquitin dot blot analysis was used. LPS administration affected the Hsps in gills after 24h,
whereas in the kidney, only Hsp70 levels were affected. After 72h of LPS treatment, an increase was observed in
Hsp70 levels in the kidney and the red muscle. Activation of SAPKs (JNKs & p38MAPK) was present in all the
examined tissues. The phosphorylation ratio of ERKs (phospho ERKs/ERKs) increased in the liver at the 24h
trial, while after 72h it decreased in the red muscle and gills. Bcl-2 decreased in all examined tissues except for
kidneys at 24 hours. At 72 hours, however, an increase was observed in the brain, liver and red muscle.
Concerning the ubiquitin, diminished levels were found in all examined tissues besides the gills and kidneys at
24 hours, while at 72 hours the levels increased. In conclusion, the administration of LPS and the subsequent
activation of immunity in sea bream, mobilized tissue-specific and time-dependent homeostatic mechanisms.
Keywords: Lipopolysaccharide, MAPKs, HSPs, Bcl2,Ubiquitin
*Corresponding author: Kyriakis Dimitrios (kyriakds@bio.auth.gr)
Πεξίιεςε
Ο θζπμπμθοζαηπανίηδξ (Lipopolysaccharide, LPS), πνμζμιμζάγεζ ηδ ααηηδνζδζαηή ιυθοκζδ ηαζ επάβεζ ηδ ιδ
εζδζηή ακμζία. ημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ δ δζενεφκδζδ ηδξ επίδναζδξ ηδξ ελςβεκμφξ in vivo
πμνήβδζδξ LPS (6 mg/kg αάνμξ ζχιαημξ) ζηδκ έηθναζδ ζδιαημδμηζηχκ πνςηεσκχκ ιεθχκ ηδξ
οπενμζημβέκεζαξ ηςκ εκενβμπμζμφιεκςκ απυ ιζημβυκα πνςηεσκζηχκ ηζκαζχκ (MAPKs - Mitogen Activated
Protein Kinases), πνςηεσκχκ δεζηηχκ ηοηηανζηήξ ηαηαπυκδζδξ, υπςξ μζ πνςηεΐκεξ εενιζημφ πθήβιαημξ (Hsps –
Heat Shock Proteins) ηαζ πνςηεσκζηχκ δεζηηχκ απυπηςζδξ (Bcl-2, Ubiquitin), ζηδκ ηζζπμφνα (Sparus aurata),
ιεηά απυ 24 ηαζ 72 χνεξ. οβηεηνζιέκα ιεθεηήεδηακ ιε ακμζμακίπκεοζδ ηαηά Western Blot, μζ Hsp70 ηαζ
Hsp90, ηα ιέθδ ηςκ ΜΑΡΚs, ERK 1/2 (Extracellular Signal-Regulated Kinase), JNKs (Jun N-terminal kinases),
p38 MAPK ηαζ δ Bcl-2. Γζα ηδκ μοαζημοζηίκδ πνδζζιμπμζήεδηε δ ιέεμδμξ Dot Blot. Ζ πμνήβδζδ LPS επδνέαζε
ηζξ Hsps ζηζξ 24 χνεξ ζηα ανάβπζα, εκχ ζηα κεθνά επδνέαζε ιυκμ ηα επίπεδα ηδξ Hsp70. Μεηά ηζξ 72 χνεξ,
πανμοζζάζηδηε αφλδζδ ηςκ επζπέδςκ ιυκμ ηδξ Hsp70 ζηα κεθνά ηαζ ζημκ ενοενυ ιο. Ζ εκενβμπμίδζδ ηςκ
SAPΚs (JNKs & p38MAPK) θαίκεηαζ υηζ επδνεάζηδηε ζε υθμοξ ημο ζζημφξ. Ο θυβμξ θςζθμνοθίςζδξ ηςκ
ERKs (phospho ERKs/ERKs) αολήεδηε ζηζξ 24h ζημ ήπαν, εκχ ιεηά ηζξ 72h ιεζχεδηε ζημκ ενοενυ ιο ηαζ ζηα
ανάβπζα. Aφλδζδ ηδξ Bcl-2 πανμοζζάζηδηε ιυκμ ζηα κεθνά ζηζξ 24 χνεξ. ηζξ 72 χνεξ, ςζηυζμ, παναηδνήεδηε
364
HydroMedit 2014, November 13-15, Volos, Greece
αφλδζδ ζημκ εβηέθαθμ, ημκ ενοενυ ιο ηαζ ημ ήπαν. ζμ αθμνά ζηδκ μοαζημοζηίκδ, πανμοζζάζηδηε ανπζηά ζηζξ
24 χνεξ ιείςζδ ηδξ έηθναζδξ ηδξ ζημοξ ελεηαγυιεκμοξ ζζημφξ ιε ελαίνεζδ ηα ανάβπζα ηαζ ηα κεθνά, εκχ
ακηίεεηα ζηζξ 72 χνεξ αθέπμοιε αφλδζδ αοηήξ. οιπεναζιαηζηά, δ πμνήβδζδ LPS ηαζ δ επαηυθμοεδ
εκενβμπμίδζδ ηδξ ακμζίαξ ζηδκ ηζζπμφνα, ηζκδημπμίδζε μιμζμζηαηζημφξ ιδπακζζιμφξ ιε ζζημεζδζηυ ηαζ
πνμκμελανηχιεκμ ηνυπμ.
Λέμεηο θιεηδηά: Lipopolysaccharide, MAPΚs, HSPs, Bcl2,Ubiquitin
*οββναθέαξ επζημζκςκίαξ: Κονζάηδξ Γδιήηνζμξ (kyriakds@bio.auth.gr)
1.Δηζαγσγή
Γζα ηδ ιεβζζημπμίδζδ ηδξ απυδμζδξ ζηδκ παναβςβή ηςκ ζπεομηαθθζενβεζχκ, ηνίκεηαζ ακαβηαία δ
ιεθέηδ ηδξ επίδναζδξ δζαθυνςκ παναβυκηςκ, ζοιπενζθαιαακμιέκςκ ηαζ ηςκ ακμζμπμζδηζηχκ, ζε είδδ
μζημκμιζηήξ ζδιαζίαξ, υπςξ δ ηζζπμφνα, Sparus aurata. Ζ επίδναζδ ημο θζπμπμθοζαηπανίηδ
(Lipopolysaccharide, LPS), πμο πνμζμιμζάγεζ ηδ ααηηδνζδζαηή ιυθοκζδ ηαζ επάβεζ ηδ ιδ εζδζηή ακμζία, δεκ
έπεζ ενεοκδεεί πθήνςξ ζηα εηηνεθυιεκα ράνζα. Δκημφημζξ, ζηδκ ηζζπμφνα, δ πμνήβδζδ LPS επδνεάγεζ ηδκ
έηθναζδ ηςκ οπμδμπέςκ πμο εκενβμπμζμφκηαζ απυ πμθθαπθαζζαζηέξ οπενμλεζδζμζςιάηςκ (PPARs) ζε
ζοζηήιαηα in vivo ηαζ in vitro (Αntonopoulou et al., 2008; Κασηεηγίδμο et al. (2008, 2011), Δπίζδξ ιε ηδ πνήζδ
ιζηνμζοζημζπίαξ έπμοκ ακαδεζπεεί ηα βμκίδζα πμο ειπθέημκηαζ ζημ ιοσηυ ζζηυ ηαζ ηαη‘ επέηηαζδ ζηζξ
θεζημονβίεξ ημο ιε ηδκ επίδναζδ ηδξ ακμζμδζέβενζδξ ηαζ πανμοζίαξ παεμβυκςκ ζηδ ηζζπμφνα (Kaitetzidou et al.
2010, 2011, 2012). ημπυξ ηδξ πανμφζαξ ενβαζίαξ ήηακ δ δζενεφκδζδ ηδξ in vivo επίδναζδξ ημο LPS ζηδκ
έηθναζδ πνςηεσκχκ δεζηηχκ ηαηαπυκδζδξ (HSPs, MAPKs) ηαζ απυπηςζδξ (Bcl-2 & Ubiquitin) ζε ζζημφξ πμο
ζοιιεηέπμοκ ζηδκ ιδ εζδζηή ακμζία.
3. Απνηειέζκαηα - πδήηεζε
3.1 Δπίδναζδ LPS ζηζξ HSPs
Οζ Hsps απμηεθμφκ ιζα μζημβέκεζα ελαζνεηζηά ζοκηδνδιέκςκ πνςηεσκχκ. Γζαδναιαηίγμοκ έκα πμθφ
ζδιακηζηυ γςηζηυ νυθμ ζηδ δζαηήνδζδ ηδξ θοζζμθμβζηήξ ηοηηανζηήξ μιμζυζηαζδξ, πνμζηαηεφμκηαξ ημ ηφηηανμ
απυ πμζηίθμοξ πενζααθθμκηζημφξ ηαζ θοζζμθμβζημφξ πανάβμκηεξ (ππ. ζζημί πανάβμκηεξ ηαζ ιμνζαηέξ ημλίκεξ, δ
εενιμηναζία). Ζ πμνήβδζδ LPS επδνέαζε ηζξ HSPs ζηζξ 24 χνεξ ζηα ανάβπζα, εκχ ζηα κεθνά επδνέαζε ιυκμ
ηα επίπεδα ηδξ Hsp70. ηζξ 72 χνεξ, πανμοζζάζηδηε επαβςβή ιυκμ ηδξ Hsp70 ζηα κεθνά ηαζ ζημκ ενοενυ ιο
ζηα άημια ιε LPS πμνήβδζδ (πήια 1,2).
ρήκα 1,2: Έθθξαζε ησλ Hsp70 & Hsp90 ππφ ηελ επίδξαζε LPS ζηελ ηζηπνχξα κεηά απφ 24 θαη 72
ψξεο.
365
HydroMedit 2014, November 13-15, Volos, Greece
πμνήβδζδ LPS. οβηεηνζιέκα, μ θυβμξ θςζθμνοθίςζδξ ηςκ JNKs (phosphoJNKs/JNKs) αολήεδηε ζδιακηζηά
ζε ήπαν ηαζ ενοενυ ιο, εκχ ιεζχεδηε ζδιακηζηά ζηα ανάβπζα. Δπίζδξ, μ θυβμξ θςζθμνοθίςζδξ ηδξ p38
MAPK (phospho p38 MAPK/p38 MAPK) αολήεδηε ζδιακηζηά ζημκ ενοενυ ιο, αθθά ιεζχεδηε ζδιακηζηά ζημ
ήπαν ηαζ ζηα κεθνά. Ο θυβμξ θςζθμνοθίςζδξ ηςκ ERKs (phospho ERKs/ERKs) αολήεδηε ζδιακηζηά ζημ
ήπαν. Μεηά ηζξ 72 χνεξ, πανμοζζάζηδηε ζδιακηζηή ιείςζδ ημο θυβμο θςζθμνοθίςζδξ ηςκ JNKs ζηα ανάβπζα
ηαζ ζημκ ενοενυ ιο, εκχ μ θυβμξ θςζθμνοθίςζδξ ηδξ p38 MAPK αολήεδηε ζδιακηζηά ζημ ήπαν ηαζ ιεζχεδηε
ζδιακηζηά ζηα ανάβπζα. Ο θυβμξ θςζθμνοθίςζδξ ηςκ ERKs (phospho ERKs/ERKs) ιεζχεδηε ζδιακηζηά ζημκ
ενοενυ ιο ηαζ ζηα ανάβπζα (πήια 4,5,6).
ρήκα 4,5,6. Φσζθνξπιίσζε ησλ ERK 1/2, ησλ JNKs θαη ηεο p38 MAPK ζηνλ εγθέθαιν, βξάγρηα, λεθξφ,
εξπζξφ κπ θαη ήπαξ ππφ ηελ επίδξαζε LPS ζηελ ηζηπνχξα κεηά απφ 24 θαη 72 ψξεο.
ρήκα 7. Έθθξαζε ηεο Bcl-2 ππφ ηελ επίδξαζε LPS ζηελ ηζηπνχξα κεηά απφ 24 θαη 72 ψξεο.
366
HydroMedit 2014, November 13-15, Volos, Greece
ρήκα 8. Έθθξαζε ηεο νπβηθνπηηίλεο ππφ ηελ επίδξαζε LPS ζηελ ηζηπνχξα κεηά απφ 24 θαη 72 ψξεο.
πκπεξαζκαηηθά: H πμνήβδζδ LPS ηαζ δ επαηυθμοεδ εκενβμπμίδζδ ηδξ ιδ εζδζηήξ ακμζίαξ ζηδκ ηζζπμφνα
ηζκδημπμίδζε μιμζμζηαηζημφξ ιδπακζζιμφξ ιε ζζημεζδζηυ ηαζ πνμκμελανηχιεκμ ηνυπμ.
Βηβιηνγξαθία
Κασηεηγίδμο Δ., Βνάζημο Γ., Planas J.V., Ακηςκμπμφθμο Δ. (2008). Διπθμηή ηςκ οπμδμπέςκ πμο
εκενβμπμζμφκηαζ απυ πμθθαπθαζζαζηέξ οπενμλεζδζμζςιάηςκ (PPAR) ζηδ ιδ εζδζηή ακμζία ηδξ ηζζπμφναξ
(Sparus aurata). ημ “30o Δπηζηεκνληθό πλέδξην ηεο Διιεληθήο Δηαηξίαο Βηνινγηθώλ Δπηζηεκώλ”,
Θεζζαθμκίηδ, 22-24 Μαΐμο, ζεθ. 150-151.
Κασηεηγίδμο, Δ., Crespo, D., Βνάζημο, Γ., Planas, J., Ακηςκμπμφθμο, Δ. (2010). Γμκζδζαηή έηθναζδ ζημ ιοσηυ
ζζηυ ηδξ ηζζπμφναξ (Sparus aurata, Linnaeus, 1758) ιεηά απυ πνυηθδζδ εκενβμπμίδζδξ ηδξ ιδ εζδζηήξ
ακμζίαξ. ημ “14ν Παλειιήλην πλέδξην Ιρζπνιόγσλ ”, Πεζναζάξ, 6-9 Μαΐμο, 2010, ζεθ. 221-224.
Κασηεηγίδμο Δ.,Βνάζημο Γ., Planas J.V., Ακηςκμπμφθμο Δ. (2011). Δπίδναζδ ακμζμθμβζηχκ παναβυκηςκ ζηδκ
έηθναζδ ηςκ οπμδμπέςκ πμο εκενβμπμζμφκηαζ απυ πμθθαπθαζζαζηέξ ηςκ οπενμλεζδζμζςιάηςκ (PPAR) ζε
ηοηηανζηή ζεζνά ηδξ ηζζπμφναξ (Sparus aurata, Linnaeus 1758). ημ ―33o Δπηζηεκνληθό πλέδξην ηεο
Διιεληθήο Δηαηξίαο Βηνινγηθώλ Δπηζηεκώλ‖, Έδεζζα, 20-22 Μαΐμο, ζεθ. 98-99.
Φεζδάκηζδξ Κ. (2012) Eπμπζαηέξ αζμπδιζηέξ ηαζ θοζζμθμβζηέξ απμηνίζεζξ ηδξ ηζζπμφναξ (Sparus aurata).
οζπέηζζδ ιε ηδ εενιμηναζία ηδξ εάθαζζαξ ηαζ ηδκ ηθζιαηζηή αθθαβή. Γζδαηημνζηή δζαηνζαή. Σιήια
Βζμθμβίαξ, Α.Π.Θ.
Antonopoulou, E., Kaitetzidou, E., Vraskou, G., Planas, J. (2008). PPAR expression during immune and metabolic
challenges in fish. In ―33rd FEBS Congress & 11th IUBMB Conference‖ Athens, Greece, 28 June-3 July
2008. FEBS Journal 275 (Suppl.1) 99-437 (2008) ζεθ. 135.
Kaitetzidou E , Crespo D., Vraskou G., Planas JV, Antonopoulou E. (2011). Transcriptional effects of
lipopolysaccharide in sea bream (Sparus aurata, Linnaeus 1758) tissues with emphasis on the regulation of
peroxisome proliferator – activated receptors. In: ―International Symposium Genomics in Aquaculture 2011‖,
Heraklion, Crete, 14-17 September, 2011.
Kaitetzidou E., Crespo D., Vraskou Y., Antonopoulou E., Planas J.V. (2012). Transcriptomic Response of
Skeletal Muscle to Lipopolysaccharide in the Gilthead Seabream (Sparus aurata) Mar Biotechnol 14: 605–
619
367
HydroMedit 2014, November 13-15, Volos, Greece
Kokokiris L. 1*, Minos G.1, Simeonidis C.1, Mylonas C.2, Nathanailides C.3
1
Department of Fisheries Technology and Aquaculture, Alexander Technological Educational Institute of
Thessaloniki, P.O. BOX 157, GR-63200, Nea Moudania, Hellas, 2Institute of Marine Biology, Biotechnology
and Aquaculture, Hellenic Centre for Marine Research, P.O. Box 2214, Iraklion, Crete 71003, Hellas,
3
Department of Fisheries Technology and Aquaculture, Technological Educational Institution of Western
Greece, Nea Ktiria 30200, Messolonghi, Hellas
Abstract
The objectives of this study were to determine the basic parameters of thick lipped grey mullet, Chelon labrosus
semen in terms of sperm volume, sperm concentration, and sperm motility. Sperm was analyzed in 28 mature
male individuals from Thermaikos Gulf, sampled during February and March. Sperm volume ranged from 1.5 to
6 ml-1 Kg BW (mean value: 4.0 mL ± 1.5) and density from 4 to 45.5 x 109 spermatozoa mL-1 sperm (mean
value: 26.5 ± 2.5 x 109 spz x mL-1). The percentage of motile spermatozoa (sperm motility) ranged between 10
and 95% (mean value: 40.4% ± 4) and the duration of their forwarded movement from 1.14 to 2.39 min (mean
value: 1.6 ± 0.05 min). Sperm quality parameters ranged in values similar to those of male thick lipped grey
mullets kept in captivity. Data collected on sperm quality could be useful for optimization of fertilization
procedures and procedures of storage of milt.
Key words: sperm quality parameters, thick lipped grey mullet
*Corresponding author: Lambros Kokokiris (lamprosk@aqua.teithe.gr)
Κοκοκφρησ Λ.1*, Μίνοσ Γ.1, υμεωνίδησ X.1, Mυλωνάσ Κ.2, Ναθαναηλίδησ Κ.3
1
Σιήια Σεπκμθμβίαξ Αθζείαξ ηαζ Τδαημηαθθζενβεζχκ, Αθελάκδνεζμ Σεπκμθμβζηυ Δηπαζδεοηζηυ Ίδνοια
Θεζζαθμκίηδξ, Σ.Θ 157, 63200, Νέα Μμοδακζά, Δθθάδα, 2 Ηκζηζημφημ Θαθάζζζαξ Βζμθμβίαξ, Βζμηεπκμθμβίαξ
ηαζ Τδαημηαθθζενβεζχκ, Δθθδκζηυ Κέκηνμ Θαθάζζζςκ Δνεοκχκ, Σ.Θ. 2214, 71003, Ζνάηθεζμ, Δθθάδα, 3 Σιήια
Tεπκμθμβίαξ Αθζείαξ ηαζ Τδαημηαθθζενβεζχκ, ΣΔΗ Γοηζηήξ Δθθάδμξ, Νέα Κηίνζα 30200, Μεζμθυββζ, Δθθάδα
Πεξίιεςε
O ζημπυξ ηδξ ενβαζίαξ ήηακ κα πενζβνάρεζ ηα ααζζηά πμζμηζηά παναηηδνζζηζηά ημο ζπένιαημξ άβνζςκ
βεκκδηυνςκ ημο ηεθαθμεζδμφξ, Chelon labrosus (πεθυκζ, πεθμκάνζ, ιαονάηζ). Ζ ακάθοζδ ημο ζπένιαημξ έβζκε
ζε 28 βεκκήημνεξ (0,54-1,2 Kg) πμο αθζεφεδηακ ζημ Θενιασηυ Κυθπμ, ημο ιήκεξ Φεανμοάνζμ ηαζ Μάνηζμ. Ο
υβημξ ημο ζπένιαημξ ηοιάκεδηε απυ 1,5 έςξ ηαζ 6 mL ακά Kg ζςιαηζημφ αάνμοξ (ιέζμξ υβημξ: 4,0 ± 1,5mL )
εκχ δ ποηκυηδηα ημο απυ 4 έςξ ηαζ 45,5 x 109 ζπενιαημγςάνζα ακά mL ζπένιαημξ (ιέζδ ηζιή: 26,5 ± 2,5 x 109
368
HydroMedit 2014, November 13-15, Volos, Greece
mL-1). Σα ζπενιαημγςάνζα εκενβμπμζήεδηακ ζε εαθαζζζκυ κενυ, ζε πμζμζηυ απυ 10 έςξ ηαζ 95% αθθά δ ιέζδ
ηζκδηζηυηδηα ήηακ παιδθή (40,4% ± 4). Ζ δζάνηεζα ηδξ ηζκδηζηυηδηαξ ηςκ ζπενιαημγςανίςκ, ηοιάκεδηε απυ
1,14 έςξ ηαζ 2,39 min (ιέζδ ηζιή: 1,6 ± 0.05 min). H πμζυηδηα ημο ζπένιαημξ είκαζ πανυιμζα ι‘ αοηή
βεκκδηυνςκ πμο δζαηδνμφκηακ ζε ζοκεήηεξ αζπιαθςζίαξ. Σα δεδμιέκα ηδξ ενβαζίαξ εα πνδζζιμπμζδεμφκ βζα ηδ
αεθηζζημπμίδζδ ηςκ πνςημηυθθςκ παναβςβήξ βμκζιμπμζδιέκςκ αοβχκ ηαζ δζαηήνδζδξ ημο ζπένιαημξ.
1. Δηζαγσγή
Σμ ηεθαθμεζδέξ Chelon labrosus (Risso, 1827), ημζκχξ πεθμκάνζ, πεθυκζ ή ιαονάηζ, δζαεέηεζ ζάνηα
ελαζνεηζηήξ πμζυηδηαξ ηαζ πανάθθδθα ορδθή πνμζανιμζηζηυηδηα ζε ζοκεήηεξ εηηνμθήξ ζε έκα ιεβάθμ εφνμξ
αθαηυηδηαξ, παναηηδνζζηζηά πμο ημο πνμζδίδμοκ μζημκμιζηυ εκδζαθένμκ βζα ηδ Μεζμβεζαηή ζπεομηαθθζένβεζα
(Ben Khemis et al. 2006). Χζηυζμ, δ ειπμνζηή ακάπηολδ ηδξ εηηνμθήξ εκυξ είδμοξ πνμτπμεέηεζ ημκ έθεβπμ ηδξ
ακαπαναβςβήξ ζε ζοκεήηεξ αζπιαθςζίαξ ηαζ ηδ ιαγζηή παναβςβή βμκζιμπμζδιέκςκ αοβχκ (Mylonas & Zohar
2009). Ζ πμζυηδηα ημο ζπένιαημξ είκαζ ιία απυ ηζξ ζδιακηζηυηενεξ παναιέηνμοξ ηδξ ακαπαναβςβζηήξ
θοζζμθμβίαξ ηςκ ρανζχκ βζαηί επδνεάγεζ ηαεμνζζηζηά ηδκ επζηοπία ηδξ βμκζιμπμίδζδξ ηαζ ηδκ παναβςβή ηςκ
αοβχκ (Billard et al. 1995). Οζ δδιμζζεοιέκεξ πθδνμθμνίεξ πμο δζαεέημοιε βζα ηδ θοζζμθμβία ημο ζπένιαημξ
ηςκ ηεθαθμεζδχκ, ζοιπενζθαιαακμιέκμο ημο ημζκμφ ηέθαθμο (Mugil cephalus) είκαζ εθάπζζηεξ (Lee et al.
1992, Sahinoz et al. 2008, Yeganeh et al. 2008) εκχ δεκ βκςνίγμοιε ηαευθμο ηα ααζζηά παναηηδνζζηζηά ηαζ ηδ
θοζζμθμβία ημο ζπένιαημξ ημο πεθμκζμφ. Ο ζημπυξ αοηήξ ηδξ ενβαζίαξ ήηακ κα πενζβνάρεζ ηα παναηηδνζζηζηά
ηδξ πμζυηδηαξ ημο ζπένιαημξ ημο πεθμκζμφ ηαζ κα ζοβηεκηνχζεζ δεδμιέκα πνήζζια βζα ηδ αεθηζζημπμίδζδ ηςκ
πνςημηυθθςκ βμκζιμπμίδζδξ ηαζ δζαηήνδζδξ ημο ζπένιαημξ.
H πμζυηδηα ημο ζπένιαημξ πενζβνάθδηε ζε 28 ανζεκζηά άημια ημο είδμοξ Chelon labrosus, ηα μπμία
ζοθθέπεδηακ ιε ηοηθζηά δίπηοα, ζε πανάηηζα πενζμπή ημο Θενιασημφ Κυθπμο (40º 12‘ 63‘‘ Ν; 22º 34‘ 50‘‘Δ,
12-13ºC, αθαηυηδηα: 32-35 psu, δζαθοιέκμ μλοβυκμ: 11-12 ppm) ημοξ ιήκεξ Φεανμοάνζμ ηαζ Μάνηζμ. Μεηά απυ
πθήνδ κάνηςζδ ζε δζάθοια 2-θαζκμλοαζεακυθδξ (300 ppm), λεπθφεδηε δ ημζθζαηή πενζμπή ιε εαθαζζζκυ κενυ
ηαζ ζημοπίζηδηε ιε απμννμθδηζηυ πανηί μ βεκκδηζηυξ πυνμξ. Σμ ζπένια ελςεήεδηε ιε πνμζεηηζηέξ ιαθάλεζξ
χζηε κα απμθεοπεεί δ ακάιζλδ ημο ιε ημ πενζεπυιεκμ ημο εκηένμο ηαζ ηα μφνα ηαζ μβημιεηνήεδηε ζε
δζαααειζζιέκμ ζςθήκα υβημο 5 mL, ζε 22 άημια ηα μπμία έδζκακ άθεμκμ ζπένια µεηά απυ εθαθνά πίεζδ ή
έδζκακ εφημθα ζπένµα µεηά ηδκ πνχηδ µάθαλδ (δείηηδξ ζπενιίαζδξ 3 ηαζ 2 ακηίζημζπα, Mylonas et al. 2003). Ζ
ποηκυηδηα ημο ζπένιαημξ (ανζειυξ ζπενιαημγςανίςκ x mL -1) οπμθμβίζηδηε ζε υθα ηα άημια, ζε δείβια 0,1mL
ζπένιαημξ ημ μπμίμ αναζχεδηε 2500x ζε απζμκζζµέκμ κενυ. Ο οπμθμβζζιυξ έβζκε ιε ηαηαιέηνδζδ ηςκ
ζπενιαημγςανίςκ ζε ηοηυιεηνμ Neubauer, ζε μπηζηυ ιζηνμζηυπζμ (ΟΜ, 400x, 2 επακαθήρεζξ ακά δείβια). Ζ
ηζκδηζηυηδηα (% πμζμζηυ ηζκμφιεκςκ ζπενµαημγςανίςκ µε εµπνυζεζα ηζκδηζηυηδηα) εηηζιήεδηε ζε ΟΜ (400
x) ζε ζπένια υβημο 1-5 ιL, ημ μπμίμ ζοθθέπεδηε ζηδ ιφηδ αεθυκαξ 19G ηαζ αναζχεδηε ζε ακηζηεζιεκμθυνμ
πθάηα ιε ιζα ζηαβυκα εαθαζζζκμφ κενμφ (1 mL, 32 psu). ημ ίδζμ δείβια εηηζιήεδηε ηαζ δ δζάνηεζα ηδξ
ηζκδηζηυηδηαξ ηςκ ζπενιαημγςανίςκ (μ πνυκμξ πμο ιεζμθααεί βζα ηδ µείςζδ ηδξ ηζκδηζηυηδηαξ ζημ 10% ηςκ
παναηδνμφµεκςκ ζπενµαημγςανίςκ), πνδζζιμπμζχκηαξ ρδθζαηυ νμθυζ. Ζ πμζυηδηα ημο ζπένµαημξ εηηζµήεδηε
απυ ημκ ίδζμ παναηδνδηή ζε υθα ηα δείβιαηα
3. Aπνηειέζκαηα
To αάνμξ ηςκ ανζεκζηχκ ηοιάκεδηε απυ 0,54 έςξ 1,2 Kg (ιέζδ ηζιή: 0,80±0,17 Kg, δθζηίαξ 7-10
εηχκ, αδδιμζίεοηα απμηεθέζιαηα). Μυκμ δφμ (6% ηςκ βεκκδηυνςκ) απυ ημοξ βεκκήημνεξ δεκ πανήβαβακ
369
HydroMedit 2014, November 13-15, Volos, Greece
ζπένια εκχ ακηίεεηα μζ οπυθμζπμζ έδζκακ απυ θίβμ (12%) έςξ πμθφ ζπένια (82%), ζημζπείμ πμο οπμδδθχκεζ υηζ
ημκ Φεανμοάνζμ ηαζ ημ Μάνηζμ ηα άβνζα πεθμκάνζα είκαζ ήδδ χνζια. Ο υβημξ ημο ζπένιαημξ ηοιάκεδηε απυ 1,5
έςξ ηαζ 6 mL ακά Kg ζςιαηζημφ αάνμοξ (ιέζμξ υβημξ: 4,0 ± 1,4mL) εκχ δ ποηκυηδηα ημο απυ 4 έςξ ηαζ 45,5 x
109 ζπενιαημγςάνζα ακά mL ζπένιαημξ (ιέζδ ηζιή: ± SE: 26.5 ± 2,5 x 109 mL-1). Σα ζπενιαημγςάνζα ιεηά ηδκ
εκενβμπμίδζδ ημοξ ιε εαθαζζζκυ κενυ, ειθάκζζακ ειπνυζεζα ηζκδηζηυηδηα ζε πμζμζηυ απυ 10 έςξ ηαζ 95%
αθθά βεκζηά δ ιέζδ ηζκδηζηυηδηα ήηακ παιδθή (40,4%±4). Ζ δζάνηεζα ηδξ ηζκδηζηυηδηαξ ηοιάκεδηε απυ 1,14
έςξ ηαζ 2,39 min (ιέζδ ηζιή: 1,6 ± 0.05 min). Ζ ακάθοζδ ζοζπέηζζδξ Pearson δεκ πνμζδζυνζζε ηάπμζα ζπέζδ
ακάιεζα ζημ ζςιαηζηυ αάνμξ ιε μπμζαδήπμηε απυ ηζξ ελεηαγυιεκεξ παναιέηνμοξ, βζα ημ ιέβεεμξ (εφνμξ
αάνμοξ) ηςκ αηυιςκ πμο ελεηάζηδηακ.
4. πδήηεζε
Οζ πανάιεηνμζ ηδξ πμζυηδηαξ ημο ζπένιαημξ (υβημξ, ποηκυηδηα, ηζκδηζηυηδηα, δζάνηεζα ηζκδηζηυηδηαξ)
ηςκ άβνζςκ βεκκδηυνςκ ημο πεθμκζμφ ηοιαίκμκηαζ ζε πανυιμζεξ ηζιέξ ιε αοηέξ βεκκδηυνςκ πμο δζαηδνήεδηακ
ζε ζοκεήηεξ αζπιαθςζίαξ ηαζ παναημθμοεήεδηακ ζε εαδμιαδζαία αάζδ ηαηά ηδκ πενίμδμ ηδξ ζπενιίαζδξ
(Κμημηφνδξ θαη ζπλ. 2013) αθθά ηαζ βεκκδηυνςκ ζημοξ μπμίμοξ πμνδβήεδηε μ εηθοηζηυξ πανάβμκηαξ ηδξ
ςπνζκμπμζδηζηήξ μνιυκδξ (GnRHa) βζα κα ελεηαζηεί δ επίδναζδ ημο ζηδκ πμζυηδηα ημο ζπένιαημξ (Kokokiris
et al. 2014). H ζοβηνζηζηή αλζμθυβδζδ δείπκεζ υηζ δ δζαηήνδζδ ηςκ βεκκδηυνςκ ζε ζοκεήηεξ αζπιαθςζίαξ αθθά
ηαζ δ πμνήβδζδ ημο GnRHa δεκ επζθένμοκ ζδιακηζηέξ αθθαβέξ ζηζξ παναιέηνμοξ ημοξ ζπένιαημξ ημο πεθμκζμφ.
Οζ πανάιεηνμζ ημο ζπένιαημξ ημο πεθμκζμφ ηοιαίκμκηαζ ζε ηζιέξ πανυιμζεξ ιε αοηέξ ζε άθθα ζε άθθα
Μεζμβεζαηά εαθαζζζκά είδδ (Πίκαηα 1, δεξ ακαζηυπδζδ ηςκ Suquet et al., 1994). Πανυιμζεξ ηζιέξ
ηζκδηζηυηδηαξ ημοξ ζπένιαημξ έπμοκ ακαθενεεί βζα ημ Liza abu (26-77%, ιέζδ ηζιή: 54,25%, Sahinoz et al.
2008) αθθά ζδιακηζηά ορδθυηενεξ (πμο θεάκμοκ ημ 100%) ακαθένεδηακ βζα ημκ ημζκυ ηέθαθμ, M. cephalus,
ηαηά ηδκ εκενβμπμίδζδ ζπένιαημξ ημο, ιε εαθαζζζκυ κενυ αθαηυηδηαξ 32-34 psu (Lee et al. 1992). Δπίζδξ,
πανυιμζα δζάνηεζα ηζκδηζηυηδηαξ ακαθένεδηε βζα ημκ ημζκυ ηέθαθμ (3 min, Τeganeh et al. 2008) αθθά ηαζ βζα
ημ ηεθαθμεζδέξ, L. abu (ιέζδ ηζιή: 5,5 min, Sahinoz et al. 2008).
Πίλαθαο 1. Βαζηθά γλσξίζκαηα ηεο πνηφηεηαο ηνπ ζπέξκαηνο ηνπ θεθαινεηδνχο Liza abu θαη
εθηξεθφκελσλ εηδψλ ηεο Μεζνγεηαθήο ηρζπνθαιιηέξγεηαο.
βημξ Γζάνηεζα
Ποηκυηδηα Κζκδηζηυηδηα
ζπένιαημξ ηζκδηζηυηδηαξ οββναθέαξ
(x 109 mL-1) (%)
(mL Kg-1) (min)
1
υβημξ ζπένιαημξ ζε mL ηαζ υπζ ζε mL x Kg-1.
Ακ ηαζ ζηα ράνζα, o υβημξ ημο ζπένιαημξ ιπμνεί κα ιεηααάθθεηαζ ηαηά ηδ δζάνηεζα ηδξ ζπενιίαζδξ
(Mylonas et al. 2003, Papadaki et al. 2008, Suquet et al. 2010) μ ιέζμξ υβημξ ηςκ 4mL Kg-1 ζε ζοκδοαζιυ ιε
ηδκ ορδθή ποηκυηδηα ημο ζπένιαημξ, επανηεί βζα ηδκ ηεπκδηή βμκζιμπμίδζδ ηαζ δεκ εέηεζ ηάπμζμ πενζμνζζιυ
ζηα πνςηυημθθα βζα ηδκ παναβςβή βμκζιμπμζδιέκςκ αοβχκ. ηα πενζζζυηενα είδδ ρανζχκ παναηδνείηαζ ιζα
370
HydroMedit 2014, November 13-15, Volos, Greece
πμζηζθυηδηα ηςκ ηζιχκ ηδξ ποηκυηδηαξ ιεηαλφ ηςκ αηυιςκ (Suquet et al. 1994). ηδκ πενίπηςζδ ημο πεθμκζμφ,
έκα ιένμξ αοηήξ ηδξ πμζηζθυηδηαξ ιπμνεί κα ενιδκεοεεί απυ ηδ ζοπκή πανμοζία δεζβιάηςκ ζπένιαημξ ιε
ιεβάθμ ζλχδεξ, ηα μπμία βεκζηά δίκμοκ ζδιακηζηά ιεβαθφηενεξ ποηκυηδηεξ απυ ηα θζβυηενμ παπφννεοζηα
δείβιαηα, υπςξ έδεζλακ μζ Suquet et al (1992) ζημ ηαθηάκζ, Scopthalmus maximus.
Οζ ορδθέξ ηζιέξ αθαηυηδηαξ αολάκμοκ ηδκ ηζκδηζηυηδηα ηαζ ηδ δζάνηεζα ηδξ ηζκδηζηυηδηαξ ηςκ
ζπενιαημγςανίςκ ημο ημζκμφ ηέθαθμο (Lee et al. 1992, Zaki et al. 1993 in Yeganeh et al. 2008, Yeganeh et al.
2008). ιςξ, πανυθμ πμο δ εκενβμπμίδζδ ημο ζπένιαημξ ημο πεθμκζμφ έβζκε ζε κενυ ηδξ ίδζαξ αθαηυηδηαξ (32
psu) ιε αοηυ πμο πνδζζιμπμίδζακ μζ Lee et al. (1992) ηαζ Τeganeh et al. (2008), δ ηζκδηζηυηδηα ηςκ
ζπενιαημγςανίςκ ήηακ παιδθυηενδ. φιθςκα ιε ημοξ Lee et al. (1992), δ ζμκηζηή ζφζηαζδ ημο ιέζμο δεκ
επδνεάγεζ ηδκ ηζκδηζηυηδηα ηςκ ζπενιαημγςανίςκ ημο ηέθαθμο εκχ ακηίεεηα μζ Yeganeh et al. (2008),
οπμζηδνίγμοκ υηζ δ πανμοζία ζυκηςκ Ca+2 επζιδηφκεζ ηδκ ηζκδηζηυηδηα. ηα εαθαζζζκά είδδ, μζ ιεβάθεξ
αναζχζεζξ ημο ζπένιαημξ ηείκμοκ κα ιεζχκμοκ ηδκ ηζκδηζηυηδηα ηαζ ηδ δζάνηεζα ηδξ (Suquet et al. 1992, 2010)
ηαζ αοηυ βζαηί ημ ιέζμ εκενβμπμίδζδξ ακαηυπηεζ ημκ πνμζηαηεοηζηυ νυθμ ημο ζπενιαηζημφ οβνμφ ζηα
ζπενιαημγςάνζα (Billard 1982, 1983), επίδναζδ πμο πενζμνίγεηαζ ιε ηδκ πνμζεήηδ BSA (Bovine Serum
Albumin) ζημ ιέζμ (Suquet et al. 1994, 2010). Δπζπθέμκ, ζηδκ πενίπηςζδ εζδχκ ιε παπφνεοζημ ζπένια, δ
αναίςζδ ημο είκαζ ηαθυ κα ακαπηφζζεηαζ ζε δφμ αήιαηα. Ανπζηά, ημ ζπένια κα αναζχκεηαζ ζε ιέζμ πμο
δζαηδνεί ηα ζπενιαημγςάνζα ακεκενβά αθθά επζηνέπεζ ηδκ πθήνδ ακάιεζλδ ημο ζπένιαημξ (1:100) ηαζ
αημθμφεςξ, κα αναζχκεηαζ ζημ ιέζμ εκενβμπμίδζδξ (1:10) χζηε κα δζαζθαθζζηεί δ ιέβζζηδ εκενβμπμίδζδ ημο,
ηδκ χνα ηδξ ιέηνδζδξ (Βillard & Cosson, 1992). Δπίζδξ, αλίγεζ κα ζδιεζςεεί υηζ δ ημπμεέηδζδ δφμ
ακελάνηδηςκ ζηαβυκςκ κενμφ ηαζ ζπένιαημξ επάκς ζηδκ ακηζηεζιεκμθυνμ, ηαζ δ ακάιεζλδ ημοξ απυ ηδκ
εθεφεενδ πηχζδ ηδξ ηαθοπηνίδαξ (υπςξ έβζκε απυ ημοξ Lee et al., 1992) ελαζθαθίγεζ ζοκεήηεξ ηαθφηενδξ
ακάιεζλδξ ημο ζπένιαημξ ηαζ ζε ζοκδοαζιυ ιε ηδ ιέηνδζδ ηδξ ηζκδηζηυηδηαξ ιυκμ ζηδκ πενζμπή πθήνμοξ
ακάιεζλδξ ζπένιαημξ ηαζ ιέζμο (πενζμπή πνχηδξ επαθήξ ηςκ δφμ οβνχκ) ιπμνμφκ κα δζηαζμθμβήζμοκ ηζξ ορδθυηενεξ
ηζιέξ ηζκδηζηυηδηαξ πμο ηαηαβνάθδηακ απυ ημοξ Lee et al. (1992), ζοβηνζηζηά ιε αοηέξ πμο ηαηαβνάθδηακ ζ‘
αοηή ηδκ ενβαζία.
Eπραξηζηίεο
H πανμφζα ένεοκα ζοβπνδιαημδμηήεδηε απυ ηδκ Δονςπασηή Έκςζδ (Δονςπασηυ Κμζκςκζηυ Σαιείμ - ΔΚΣ)
ηαζ απυ εεκζημφξ πυνμοξ ιέζς ημο Δπζπεζνδζζαημφ Πνμβνάιιαημξ «Δηπαίδεοζδ ηαζ Γζα Βίμο Μάεδζδ» ημο
Δεκζημφ ηναηδβζημφ Πθαζζίμο Ακαθμνάξ (ΔΠΑ)–Δνεοκδηζηυ Υνδιαημδμημφιεκμ Ένβμ: ΑΡΥΗΜΖΓΖ ΗΗΗ.
Δπέκδοζδ ζηδκ ημζκςκία ηδξ βκχζδξ ιέζς ημο Δονςπασημφ Κμζκςκζημφ Σαιείμο.
Βηβιηνγξαθία
Κμημηφνδξ Λ., Μίκμξ Γ., οιεςκίδδξ Υ., Αθελάκδνμο Μ., Σμζμφκδξ Γ., Κανφδαξ Θ. (2011). Γζενεφκδζδ ηδξ
δοκαηυηδηαξ ακαπαναβςβήξ ημο πεθμκζμφ (Chelon labrosus, Risso 1827) ζε ζοκεήηεξ αζπιαθςζίαξ.
Πναηηζηά 4μο Γζεεκμφξ οκεδνίμο Τδνμαζμθμβίαξ-Αθζείαξ, 9-11 Ημοκίμο 2011, Βυθμξ, Δθθάδα.
Ben Khemis I., Zouiten D., Besbes R., Kamoun F. (2006). Larval rearing and weaning of thick lipped grey
mullet (Chelon labrosus) in mesocosm with semi-extensive technology. Aquaculture 259, 190-201
Billard R., 1982. Importance des protéines du liquide coelomique sur la fertilité des gametes de la truite arc en
ciel et possibilités de substitution. Bulletin Francaise de la Péche et de la Pisciculture 284: 168-l77.
371
HydroMedit 2014, November 13-15, Volos, Greece
Billard R., 1983. Effects of coelomic and seminal fluids and various saline diluents on the fertilizing ability of
spermatozoa in the rainbow trout, Salmo gairdneri. Journal of Reproduction and Fertility 68, 77-84.
Billard R., Cosson M.P. (1992). Some problems related to the assessment of sperm motility in freshwater fish.
Journal of Experimental Zoology 261, 122–131.
Billard R., Cosson J., Crim L.W., Suquet M. (1995). Sperm physiology and quality. In: «Broodstock
Management and Egg and Larval Quality», Bromage N.R., Roberts R.J. (eds), pp.25-52. Blackwell
Science, Oxford.
Fauvel C., Savoye O., Dreanno C., Cosson J., Suquet M. (1999). Characteristics of sperm of captive seabass in
relation to its fertilization potential. Journal of Fish Biology 159, 356–369.
Kokokiris L., Minos G., Mylonas C.C., Simeonidis C., Nathanailides C. (2014). GnRHa administration,
spermiation conditions and sperm quality response in thick lipped grey mullet (Chelon labrosus)
maintained in captivity. Proceedings of Aquaculture Europe 2014, Donostia-San, 14-17 October, Spain
(accepted).
Lee C.S., Tamaru C., Kelly C.D., Moriwake A., Miyamoto T. (1992). The effect of salinity on the induction of
spawning and fertilization rate in the stripped mullet, Mugil cephalus. Aquaculture 102, 289-296.
Mylonas C.C., Zohar Y. (2009). Controlling reproduction in aqua-culture. In: «New Technologies in
Aquaculture: Improving Production Efficiency, Quality and Environmental Management», Burnell G.,
Allan G. (eds), Woodhead Publishing Ltd, Cambridge, UK, pp. 001–038.
Mylonas C.C., Mitrizakis N., Papadaki M. Sigelaki I. (2013). Reproduction of hatchery-produced meagre
Argyrosomus regius in captivity I. Description of the annual reproductive cycle. Aquaculture, 309–317.
Papadaki M., Papadopoulou M., Siggelaki I. Mylonas C.C. (2008). Egg and sperm production and quality of
sharpsnout sea bream (Diplodus puntazzo) in captivity. Aquaculture 276, 187–197.
Rainis S., Mylonas C.C., Kyriakou Y. Divanach P. (2003). Enhancement of spermiation in European sea bass
(Dicentrarchus labrax) at the end of the reproductive season using GnRHa implants. Aquaculture 219,
873–890.
Sahinöz E., Aral F., Doğu, Z. (2008). Determination of spermatological properties of male Liza abu (Heckel,
1843) in Atatürk Dam Lake, Sanliurfa. Fish Physiology and Biochemistry 34, 71–76.
Sorbera L.A., Mylonas C.C., Zanuy S., Carrillo M., Zohar Y. (1996). Sustained administration of GnRHa
increases milt volume without altering sperm counts in the sea bass. Journal of Experimental Zoology
276, 361–368.
Suquet M., Omnes M. H., Normant Y., Fauvel C. (1992). Assessment of sperm concentration and motility in
turbot (Scophthalmus maximus). Aquaculture 101, 177–185.
Suquet M., Billard R., Cosson J., Dorange G., Chauvaud L., Mugnier C., Fauvel C. (1994). Sperm features in
turbot: a comparison with other freshwater and marine fish species. Aquatic Living Resources 283–294.
Suquet M., Cosson J., de la Gandara F, Mylonas C.C., Papadaki M., Lallemant S., Fauvel C. (2010). Sperm
features of captive Atlantic bluefin tuna (Thunnus thynnus). Journal of Applied Ichthyology 26, 775–778.
Yeganeh S., Amiri B. M., Alavi S. M. H. (2008). Motility of Mugil cephalus L. spermatozoa in coelomic fluid,
seminal fluid and saline media. Journal of Applied Ichthyology 24, 517–518
Zaki M.I., Garabavi M.M.E., Assem S.S. (1993). Characteristics of spermatogenesis and the production of sperm
in the grey mullet, Liza ramada. Journal of Ichthyology 33, 152–158.
372
HydroMedit 2014, November 13-15, Volos, Greece
Laboratory of Applied Hydrobiology, Department of Animal Science and Aquaculture, Agricultural University
of Athens, Iera Odos 75, Votanikos, 11855, Athens, Greece
Abstract
Pagasitikos Gulf is a semi-closed gulf in the prefecture of Magnisia, at the coast of which thrives a multitude of
urban, industrial, agricultural and touristic activities. The purpose of the present study, is the investigation of the
possibility of establishing and operating in-land system of production of marine fishes. This investigation
concerns the main factors involved such as the selection of the most suitable available location, the
characteristics and the availability of water, as well as the relationship between natural (water), biological
(organisms) and economic conditions (height of production), especially regarding the selection of the most
suitable aquatic organisms and the advantages and the possibilities for rearing, farming and marketing.
In this frame the socio-economic characteristics of the study region were examined, as well as the general
situation of Pagasitikos Gulf, the farmed species and the in-land systems of production. Besides was created a
geographic system of information and were drawn thematic maps, as well as a map of regions which are more
appropriate for the installation of land-based systems of production. In the investigation of possibilities of
establishing and operating in-land system of production of marine species, an economic analysis of in-land farm
in the study region was included. For this reason, a production system was designed and evaluated for cost of
investment and production, as well as expected economical results.
Key words: in-land system of production of marine fishes, Pagasitikos Gulf, geographic system of information.
Πεξίιεςε
Ο Παβαζδηζηυξ ηυθπμξ απμηεθεί έκακ διίηθεζζημ ηυθπμ ζημ Νμιυ Μαβκδζίαξ, ζηα πανάθζα ημο μπμίμο
ανίζηεηαζ έκα πθήεμξ αζηζηχκ, αζμιδπακζηχκ, αβνμηζηχκ ηαζ ημονζζηζηχκ δναζηδνζμηήηςκ. ημπυξ ηδξ
πανμφζαξ ιεθέηδξ είκαζ δ δζενεφκδζδ ηςκ δοκαημηήηςκ εβηαηάζηαζδξ ηαζ θεζημονβίαξ πενζαίμο ζοζηήιαημξ
παναβςβήξ εαθάζζζςκ εζδχκ ζπεφςκ. Ζ δζενεφκδζδ αοηή αθμνά ημοξ ηονζυηενμοξ ειπθεηυιεκμοξ πανάβμκηεξ,
υπςξ, δ επζθμβή ηδξ ηαηάθθδθδξ ημπμεεζίαξ βζα ηδκ εβηαηάζηαζδ ηδξ ιμκάδαξ, ηα παναηηδνζζηζηά ηαζ δ
δζαεεζζιυηδηα ημο κενμφ, ηαεχξ ηαζ δ ζπέζδ ιεηαλφ θοζζηχκ (κενυ), αζμθμβζηχκ (μνβακζζιμί) ηαζ μζημκμιζηχκ
(φρμξ παναβςβήξ) ζοκεδηχκ, ζδζαίηενα απυ ηδκ άπμρδ ηδξ επζθμβήξ ηςκ ηαηάθθδθςκ οδνυαζςκ μνβακζζιχκ
373
HydroMedit 2014, November 13-15, Volos, Greece
ηαζ ηα πθεμκεηηήιαηα ηαζ ηζξ δοκαηυηδηεξ ηδξ εηηνμθήξ αθθά ηαζ ηδξ ειπμνίαξ ημοξ. ημ πθαίζζμ αοηυ
ελεηάζεδηακ ηα ημζκςκζηυ-μζημκμιζηά παναηηδνζζηζηά ηδξ πενζμπήξ ιεθέηδξ, ηαεχξ ηαζ δ βεκζηή ηαηάζηαζδ
ημο Παβαζδηζημφ Κυθπμο, ηα είδδ εηηνεθυιεκςκ εζδχκ ζπεφςκ ηαζ ηα πενζαία ζοζηήιαηα παναβςβήξ.
Δπζπνυζεεηα, δδιζμονβήεδηε έκα βεςβναθζηυ ζφζηδια πθδνμθμνζχκ, ζπεδζάζεδηακ εειαηζημί πάνηεξ, ηαεχξ
ηαζ έκαξ πάνηδξ ηςκ πενζμπχκ πμο ειθακίγμοκ ιεβαθφηενδ ηαηαθθδθυηδηα βζα εβηαηάζηαζδ πενζαίςκ
ζοζηδιάηςκ παναβςβήξ. ηδκ δζενεφκδζδ ηςκ δοκαημηήηςκ εβηαηάζηαζδξ ηαζ θεζημονβίαξ πενζαίμο
ζοζηήιαημξ παναβςβήξ εαθάζζζςκ εζδχκ ζπεφςκ, εκηάπηδηε ιζα μζημκμιζηή ακάθοζδ ιζαξ πενζαίαξ ιμκάδαξ
εηηνμθήξ ζηδκ πενζμπή ιεθέηδξ ηαζ βζα ημκ θυβμ αοηυ ζπεδζάζεδηε έκα πζεακυ ζφζηδια παναβςβήξ,
απμηζιήεδηε ημ ηυζημξ επέκδοζδξ ηαζ παναβςβήξ ηαεχξ ηαζ ηα ακαιεκυιεκα μζημκμιζηά απμηεθέζιαηα.
Λέξειρ κλειδιά: Υεξζαία ζπζηήκαηα εθηξνθήο, Παγαζεηηθόο θόιπνο, γεσγξαθηθά ζπζηήκαηα πιεξνθνξηώλ.
1. Δηζαγσγή
Πανά ημ βεβμκυξ υηζ μ ηθάδμξ ηςκ οδαημηαθθζενβεζχκ έπεζ ζδιεζχζεζ ναβδαία ακάπηολδ ζηδκ πχνα
ιαξ ηα ηεθεοηαία πνυκζα, δ δναζηδνζυηδηα αοηή πενζμνίγεηαζ ζε ζπεηζηά ιζηνυ ανζειυ εζδχκ εηηνεθυιεκςκ
μνβακζζιχκ, ηαεχξ ηαζ πνδζζιμπμζμφιεκςκ ηεπκζηχκ. Πανάβμκηεξ πμο ζοκεηέθεζακ ζηδκ ακάπηολδ ημο
ηθάδμο ηαζ έδςζακ ηδκ απαναίηδηδ χεδζδ, απμηεθμφκ ιεηαλφ άθθςκ, δ αολδιέκδ γήηδζδ πνμσυκηςκ
οδαημηαθθζενβεζχκ, δ έθθεζρδ αθζεοηζηχκ πνμσυκηςκ, θυβς νφπακζδξ ηαζ οπεναθίεοζδξ εαθάζζζςκ πενζμπχκ,
ηαεχξ επίζδξ ηαζ δ απυηηδζδ ηδξ ηαηάθθδθδξ ηεπκμβκςζίαξ απυ ημοξ παναβςβμφξ ηαζ δ αφλδζδ ημο
επεκδοηζημφ εκδζαθένμκημξ. Δπζπνυζεεηα, δ ακάβηδ βζα ηδκ παναβςβή υζμ ημ δοκαηυκ ηαθφηενςκ δζαηνμθζηχκ
πνμσυκηςκ, υζμ ηαζ δ επζηαηηζηή ακάβηδ βζα ιείςζδ ηςκ πενζααθθμκηζηχκ επζπηχζεςκ, απμηεθμφκ πανάβμκηεξ
πμο εα επζδνάζμοκ δοκαιζηά ζηδκ ιεθθμκηζηή ελέθζλδ ηδξ οδαημηαθθζενβδηζηήξ δναζηδνζυηδηαξ. ημπυξ ηδξ
πανμφζαξ ενβαζίαξ, είκαζ δ δζενεφκδζδ ηςκ δοκαημηήηςκ εβηαηάζηαζδξ ηαζ θεζημονβίαξ εκυξ πενζαίμο
ζοζηήιαημξ παναβςβήξ εαθάζζζςκ εζδχκ ζπεφςκ ζημκ Παβαζδηζηυ Κυθπμ. Γζα ηδκ εβηαηάζηαζδ ιζαξ πενζαίαξ
ιμκάδαξ εηηνμθήξ εαθάζζζςκ εζδχκ ζπεφςκ ζηδκ πενζμπή ελεηάζηδηακ πανάβμκηεξ υπςξ δ δζαεεζζιυηδηα
κενμφ ηαζ δ πμζυηδηα ημο, δ ημπμβναθία ηαζ ημ ηθίια ηδξ πενζμπήξ, ηαεχξ ηαζ δ πζεακή φπανλδ ακηαβςκζζηζηχκ
δναζηδνζμηήηςκ ζηδκ πενζμπή, υπςξ βζα πανάδεζβια ημονζζηζηέξ, αζμιδπακζηέξ, αβνμηζηέξ ή άθθεξ
δναζηδνζυηδηεξ.
Σα ζημζπεία πμο πνδζζιμπμζήεδηακ βζα ηδκ εηπυκδζδ ηδξ ενβαζίαξ πνμένπμκηαζ απυ αζαθζμβναθζηέξ
πδβέξ, ηαεχξ ηαζ ζπεηζηέξ ιεθέηεξ, πμο έπμοκ πναβιαημπμζδεεί ζημ πανεθευκ βζα ηδκ πενζμπή ημο Παβαζδηζημφ
Κυθπμο ηαζ ημο Νμιμφ Μαβκδζίαξ βεκζηυηενα (Θεμδχνμο & ζοκ., 1997, Θεμδχνμο, 2000, Πεηνάηδξ, 2000,
Mitsios & Gatsios, 2000, Triantafyllou et al., 2001, Petihakis et al., 2002, Petihakis et al., 2005). Πανάθθδθα,
ζοθθέπεδηακ ζδιακηζηά ζημζπεία απυ ηζξ ημπζηέξ ανιυδζεξ οπδνεζίεξ ηδξ πενζμπήξ βζα ζπεηζηά εέιαηα, εκχ βζα
ηδκ απμηυιζζδ ιζαξ πζμ άιεζδξ εζηυκαξ ηςκ πενζμπχκ, ηαεχξ ηαζ ημκ ζπμθζαζιυ ηςκ απμηεθεζιάηςκ,
πναβιαημπμζήεδηε επζηυπζα επίζηερδ ηςκ επζιένμοξ πενζμπχκ. Γζα ιζα πζμ ζοζηδιαηζηή ιεθέηδ ηδξ εονφηενδξ
πενζμπήξ, πναβιαημπμζήεδηε επελενβαζία ηςκ δεδμιέκςκ ιε ηδκ πνήζδ βεςβναθζηχκ ζοζηδιάηςκ
πθδνμθμνζχκ ηαζ ζπεδζάζεδηακ εειαηζημί πάνηεξ ηδξ πενζμπήξ, ηαεχξ ηαζ πάνηδξ ιε ηζξ επζιένμοξ πενζμπέξ πμο
ειθακίγμοκ εοκμσηέξ ζοκεήηεξ βζα ηδκ εβηαηάζηαζδ πενζαίςκ ζοζηδιάηςκ παναβςβήξ ζπεφςκ. Γζα ημκ
ζπεδζαζιυ ηςκ εειαηζηχκ πανηχκ, πνδζζιμπμζήεδηε ημ θμβζζιζηυ ―ArcGIS‖, εκχ βζα ημκ ζπεδζαζιυ ημο
αοεμιεηνζημφ πάνηδ ημο Παβαζδηζημφ Κυθπμο ημ θμβζζιζηυ ―Surfer 7.0‖ ιε δεδμιέκα ακηίζημζπμο καοηζημφ
πάνηδ ηδξ πενζμπήξ απυ ηδκ Τδνμβναθζηή Τπδνεζία ημο Πμθειζημφ Ναοηζημφ. Ζ ιέεμδμξ πνμζέββζζδξ ιε ηδκ
πνήζδ ηςκ βεςβναθζηχκ ζοζηδιάηςκ πθδνμθμνζχκ, ζοκέααθε ζδιακηζηά ζηδκ ζοζηδιαηζηή επελενβαζία ηςκ
δεδμιέκςκ, δ μπμία ηαζ ιε ηδκ αμήεεζα ηαζ ηδξ επζηυπζαξ επαθήεεοζδξ ηαζ ελέηαζδξ ηςκ πενζμπχκ μδήβδζε
ζηζξ ηεθζηέξ απμθάζεζξ επζθμβήξ. Σα ηνζηήνζα επζθμβήξ ηςκ πενζμπχκ πμο εθανιυζηδηακ ζηδ επελενβαζία ηςκ
βεςβναθζηχκ ζοζηδιάηςκ ήηακ δ ηθίζδ ημο εδάθμοξ, πενζμπέξ νφπακζδξ, εηαμθέξ πεζιάννςκ, πενζμπέξ Natura,
374
HydroMedit 2014, November 13-15, Volos, Greece
μζηζζηζηέξ πενζμπέξ, ανπαζμθμβζημί πχνμζ, αζμιδπακζηέξ πενζμπέξ, μδζηυ δίηηομ, απυζηαζδ απυ ηδκ αηηή ηαζ
έηηαζδ ηδξ πενζμπήξ. Ακαθμνζηά ιε ηδκ μζημκμιζηή δζενεφκδζδ πζεακήξ επέκδοζδξ ηαζ βζα ηδκ ελέηαζδ ηδξ
απμδμηζηυηδηαξ ηδξ ιμκάδαξ εηηνμθήξ πμο επζθέπεδηε κα ζπεδζαζηεί πνδζζιμπμζήεδηακ ηα ηνζηήνζα ηδξ
Καεανήξ Πανμφζαξ Αλίαξ (ΚΠΑ) ηαεχξ ηαζ μ Δζςηενζηυξ οκηεθεζηήξ Απυδμζδξ (ΔΑ).
3. Απνηειέζκαηα – πδήηεζε
Ο Παβαζδηζηυξ Κυθπμξ, απυ ηδκ μπηζηή ηδξ πμζυηδηαξ ημο κενμφ, βζα ηδκ πνήζδ αοημφ βζα εηηνμθή
ηςκ ελεηαγυιεκςκ ζηδκ πανμφζα ιεθέηδ εζδχκ ζπεφςκ, δεκ δζαθαίκεηαζ κα ειθακίγεζ πανάβμκηεξ μζ μπμίμζ κα
εέημοκ μοζζαζηζημφξ πενζμνζζιμφξ. Δπζπνυζεεηα, ακαθμνζηά ιε ηδκ ακάπηολδ ηδξ εηηνμθήξ ζπεφςκ, δ μπμία
είκαζ έκημκδ ζε άθθμοξ ηθεζζημφξ ή διίηθεζζημοξ ηυθπμοξ ηδξ πχναξ ιαξ, ζημκ Παβαζδηζηυ Κυθπμ δ
δναζηδνζυηδηα αοηή ειθακίγεηαζ ζδζαίηενα πενζμνζζιέκδ. φιθςκα ιε ηα απμηεθέζιαηα ημο Γεςβναθζημφ
οζηήιαημξ Πθδνμθμνζχκ (GIS) πμο πναβιαημπμζήεδηε βζα ηδκ πενζμπή ιεθέηδξ, μπμφ θαιαάκμκηαζ οπυρδ ηαζ
μζ βεκζηυηενεξ οπμδμιέξ ηςκ πενζμπχκ, ιπμνμφκ κα δζαηνζεμφκ ηνεζξ εονφηενεξ πενζμπέξ υπμο πενζθαιαάκμκηαζ
εηηάζεζξ πμο πθδνμφκ ηζξ ααζζηέξ απαζηήζεζξ βζα ηδκ εθανιμβή πενζαίςκ εβηαηαζηάζεςκ ακελάνηδηα απυ ημκ
πανάβμκηα ηδξ πμζυηδηαξ ημο δζαεέζζιμο κενμφ.
α) Οζ πενζμπέξ ζηα ακαημθζηά πανάθζα ημο Παβαζδηζημφ Κυθπμο έςξ ηαζ κμηζυηενα ζηδκ πενζμπή
ημο Σνίηενζ.
375
HydroMedit 2014, November 13-15, Volos, Greece
αολδιέκμ ηυζημξ επέκδοζδξ, θυβς ενβαζζχκ δζαιυνθςζδξ ηδξ πενζμπήξ, ηαεχξ ηαζ ημ αολδιέκμ ηυζημξ
άκηθδζδξ ημο κενμφ θυβς ορμιεηνζηήξ δζαθμνάξ απυ ηδκ επζθάκεζα ηδξ εάθαζζαξ, πανάβμκηεξ πμο εα πνέπεζ
κα ιεθεηδεμφκ πνμζεηηζηά ηαζ βζα ηάεε ζοβηεηνζιέκδ πενίπηςζδ. Σα ζοζηήιαηα επμιέκςξ πμο θαίκεηαζ κα
ειθακίγμκηαζ πθεμκεηηζηυηενα βζα ηδκ πενζμπή εα πνέπεζ κα εκζςιαηχκμοκ αεθηζςιέκεξ δζαπεζνζζηζηέξ
πναηηζηέξ ηαζ πζεακυκ ηεπκμθμβίεξ ακαηφηθςζδξ ημο κενμφ εηηνμθήξ. φιθςκα ιε ηδκ βεκζηυηενδ ηάζδ βζα
εκηαηζημπμίδζδ ηδξ παναβςβήξ ηαζ αθμιμίςζδ ελεθζβιέκδξ ηεπκμθμβίαξ ζηα ζοζηήιαηα παναβςβήξ, μζ
πνμηάζεζξ πμο εα ιπμνμφζακ κα ηεεμφκ ακαθμνζηά ιε ηδκ εθανιμβή πενζαίςκ ζοζηδιάηςκ παναβςβήξ
εαθάζζζςκ εζδχκ ζπεφςκ ζηδκ πενζμπή εα εζηίαγακ ζε ζοζηήιαηα πενζζζυηενμ εκηαηζημφ πανά διζεηηαηζημφ
παναηηήνα. Ακαθμνζηά ιε ηζξ πνμηεζκυιεκεξ πενζμπέξ, ιπμνεί κα ακαθενεεί υηζ μζ εονφηενεξ εηηάζεζξ βεζημκζηά
ηδξ πενζμπήξ ημο Πηεθεμφ, ειθακίγμκηαζ πθεμκεηηζηυηενεξ ζπεηζηά ιε ηζξ οπυθμζπεξ εηηάζεζξ. Ζ μζημκμιζηή
ακάθοζδ πμο πναβιαημπμζήεδηε βζα ηδκ εβηαηάζηαζδ ηαζ θεζημονβζά ιζαξ πενζαίαξ ιμκάδαξ εηηνμθήξ
εαθάζζζςκ εζδχκ ζπεφςκ, ακαδεζηκφεζ ηζξ μζημκμιζηέξ δοζημθίεξ πμο ειθακίγεζ ιζα ηέημζμο είδμοξ
επζπεζνδιαηζηή δναζηδνζυηδηα, πανμοζζάγμκηαξ πανάθθδθα ηζξ εοηαζνίεξ ηαζ δοκαηυηδηεξ πμο δδιζμονβμφκηαζ.
Ζ θήρδ επζδυηδζδξ, εκυξ ζδιακηζημφ πμζμζημφ ημο ανπζημφ ηυζημοξ επέκδοζδξ, ζηδκ πανμφζα ιεθέηδ,
ηαεμνίγεζ ηδκ μζημκμιζηή αζςζζιυηδηα ή υπζ ηδξ ιμκάδαξ εηηνμθήξ πμο ζπεδζάζεδηε. οκεπχξ, είκαζ θακενή δ
ακάβηδ θεπημιενμφξ ηαζ ζοβηνδηζηήξ ελέηαζδξ υθςκ ηςκ πζεακχκ εκαθθαηηζηχκ ζπεδίςκ πμο ιπμνμφκ κα
πνμηφρμοκ βζα ηδκ δδιζμονβία ιζαξ ιμκάδαξ πενζαίςκ εβηαηαζηάζεςκ εηηνμθήξ ζπεφςκ ζηδκ εονφηενδ
πενζμπή ημο Παβαζδηζημφ Κυθπμο. Ζ ημζκςκζηή ηαζ μζημκμιζηή εοδιενία ημο Νμιμφ, ηαεχξ ηαζ δ ημονζζηζηή
ημο ακάπηολδ, απμηεθμφκ έκα εεηζηυ ζημζπείμ βζα ηδκ ακάθδρδ επζπεζνδιαηζηχκ πνςημαμοθζχκ βζα ηδκ εηηνμθή
ζπεφςκ. Ζ ζδιακηζηά ορδθή αλία ημο εδάθμοξ υιςξ, ζηζξ παναεαθάζζζεξ πενζμπέξ πενζιεηνζηά ημο
Παβαζδηζημφ Κυθπμο, είκαζ ίζςξ μ ααζζηυηενμξ πανάβμκηαξ πμο ζοιαάθεζ ζδιακηζηά ζημ αφλδζδ ημο ηυζημοξ
επέκδοζδξ. Σμ βεβμκυξ αοηυ, απμηεθεί ίζςξ ηαζ ημκ ηονζυηενμ πανάβμκηα πμο ςεεί ζηδκ εκηαηζημπμίδζδ ηςκ
ζοζηδιάηςκ παναβςβήξ, αολάκμκηαξ ηδκ ζπεομποηκυηδηα εηηνμθήξ. Οπςζδήπμηε, μζ ζηυπμζ ηαζ μζ απαζηήζεζξ
ζε πμζυηδηα παναβυιεκμο πνμσυκημξ, ηαεχξ ηαζ δ ακάβηδ βζα παναβςβή πμζμηζηχκ πνμσυκηςκ ηαεμνίγμοκ ημ
μζημκμιζηυ φρμξ επέκδοζδξ ιζαξ ηέημζαξ επζπεζνδιαηζηήξ πνμζπάεεζαξ, ημ ηυζημξ παναβςβήξ, αθθά ηαζ ηα
έζμδα απυ ηα παναβυιεκα πνμσυκηα.
Βηβιηνγξαθία
376
HydroMedit 2014, November 13-15, Volos, Greece
Petihakis, G., Triantafyllou, G., Koliou, A. and Theodorou, A. (2002). Exploring the Dynamics of a
Marine Ecosystem (Pagasitikos Gulf, Western Aegean, Greece) through the Analysis of Temporal and
Spatial Variability of Nutrients. Littoral, 22-26.
Triantafyllou G., Petihakis, G., Dounas, C. and Theodorou, A. (2001). Assessing Marine Ecosystem
Response to Nutrient Inputs. Marine Pollution Bulletin, 43, (7-12), 175-186.
377
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
Ecuador is a developing country where the continuous increase in the standard of living and the low average per
capita fish consumption, guarantee the absorption of new aquaculture products. However, there seem to be a lack
of central planning in issues of inland aquaculture and in the assessment of inland natural water resources for
aquaculture purposes. This research aimed at recording the status of inland aquaculture at two Ecuadorian
provinces (Esmeraldas & Sucumbios) and at compiling suggestions for its amelioration in terms of production
methods, total biomass production and the sustainable management of human and natural resources. The two
research areas present significant potential for inland aquaculture development. Particular emphasis should be
given to exploring the culture requirements (reproduction, management, nutrition) of endemic species for the
selection of the most suitable ones for rearing in local geomorphological and climatic conditions. Furthermore,
the elaboration of a national business plan is deemed necessary, a plan that will thoroughly explore the
possibilities for inland aquaculture development without detrimental effects on the environment, the unique
biodiversity of this country and by ensuring the sustainability of natural and human resources.
Παληαδήο Π. Α. 1, 2 *
1
Δνβαζηήνζμ Ηπεομθμβίαξ, Τδνυαζαξ Πακίδαξ & Ηπεομπαεμθμβίαξ, Σιήια Κηδκζαηνζηήξ, πμθή Δπζζηδιχκ
Τβείαξ, Πακεπζζηήιζμ Θεζζαθίαξ, Σνζηάθςκ 224, Σ.Θ. 199, Σ.Κ. 43100, Κανδίηζα, Δθθάδα
2
Τπυηνμθμξ PROMETEO, Secretaria Nacional De Educacion Superior, Ciencia Tecnologia E Innovacion-
SENESCYT, Sanchez Y Cifuentes Y Velasco, Edificio ―La Provisora », Ibarra, ECUADOR
ΠΔΡΗΛΖΦΖ
Ο Ηζδιενζκυξ (Ecuador) είκαζ ιζα ακαπηοζζυιεκδ πχνα υπμο δ ζοκεπήξ αφλδζδ ημο αζμηζημφ επζπέδμο ηαζ δ
παιδθή ιέζδ ηαηά ηεθαθήκ ηαηακάθςζδ ζπεοδνχκ, εββοχκηαζ ηδκ απμννυθδζδ κέςκ οδαημηαθθζενβδηζηχκ
πνμσυκηςκ. Οιςξ ζηα εέιαηα οδαημηαθθζένβεζαξ εζςηενζηχκ οδάηςκ παναηδνείηαζ ιία έθθεζρδ ηεκηνζημφ
378
HydroMedit 2014, November 13-15, Volos, Greece
ζπεδζαζιμφ ηαζ αλζμθυβδζδξ ηςκ δοκαημηήηςκ ηςκ θοζζηχκ οδάηζκςκ πυνςκ βζα οδαημηαθθζενβδηζημφξ
ζημπμφξ. Ζ ένεοκα αοηή ζημπεφεζ ζηδκ ηαηαβναθή ηδξ πανμφζαξ οδαημηαθθζενβδηζηήξ δναζηδνζυηδηαξ ζε δφμ
επανπίεξ ημο Ηζδιενζκμφ (Esmeraldas & Sucumbios) ηαζ ζηδκ ζοβηνυηδζδ πνμηάζεςκ βζα ηδκ αεθηίςζδ ηδξ
υζμκ αθμνά ηζξ ιεευδμοξ παναβςβήξ, ημ φρμξ παναβςβήξ ηαζ ηδκ αεζθμνζηή δζαπείνζζδ ηςκ ακενχπζκςκ ηαζ
θοζζηχκ πυνςκ. Οζ δφμ πενζμπέξ ένεοκαξ πανμοζζάγμοκ ζδιακηζηέξ δοκαηυηδηεξ ακάπηολδξ ηδξ
οδαημηαθθζένβεζαξ εζςηενζηχκ οδάηςκ. Ηδζαίηενδ έιθαζδ πνέπεζ κα δμεεί ζηδκ δζενεφκδζδ ηςκ απαζηήζεςκ
εηηνμθήξ (ακαπαναβςβή, δζαπείνζζδ, δζαηνμθή) ηςκ εκδδιζηχκ εζδχκ βζα ηδκ ακάδεζλδ ηςκ ηαηαθθδθυηενςκ
βζα εηηνμθή ζηζξ ημπζηέξ βεςιμνθμθμβζηέξ ηαζ ηθζιαημθμβζηέξ ζοκεήηεξ. Απαναίηδηδ εεςνείηαζ ηαζ δ
εηπυκδζδ εκυξ εεκζημφ επζπεζνδιαηζημφ ζπεδίμο (business plan) πμο εα δζενεοκήζεζ δζελμδζηά ηζξ δοκαηυηδηεξ
ακάπηολδξ ηδξ οδαημηαθθζένβεζαξ εζςηενζηχκ οδάηςκ πςνίξ ανκδηζηέξ επζπηχζεζξ ζημ πενζαάθθμκ, ηδκ
ιμκαδζηή αζμπμζηζθυηδηα ηδξ πχναξ ηαζ ιε ελαζθάθζζδ ηδξ αεζθμνίαξ ηςκ θοζζηχκ ηαζ ακενχπζκςκ πυνςκ ηδξ.
1. Δηζαγσγή
Σμ 2011, δ μθζηή ζπεομπαναβςβή ημο Ecuador (αθζεία & οδαημηαθθζένβεζα) ηαηαβνάθδηε ζημοξ 817.4
πζθζάδεξ ηυκμοξ (24.26% αφλδζδ απυ ημ 2000) εη ηςκ μπμίςκ ηςκ 37.8% πνμήθεε απυ ηδκ οδαημηαθθζένβεζα
ηαζ ημ οπυθμζπμ 62% πνμήθεε απυ ηδκ αθζεία. Σμ 2011, δ οδαημηαθθζένβεζα εζςηενζηχκ οδάηςκ απμηέθεζε ημ
18.8% ηδξ μθζηήξ οδαημηαθθζενβδηζηήξ παναβςβήξ ημο Ecuador. Γεδμιέκμο υηζ δ μθζηή επζθάκεζα ηςκ
εζςηενζηχκ οδάηςκ ημο Ecuador οπμθμβίγεηαζ ζε πενζζζυηενμ ημο 30% ηδξ επζθάκεζαξ ηςκ οδάηςκ ηδξ
δπεζνςηζηήξ οθαθμηνδπίδαξ ημο, δζαβνάθεηαζ ιζα ζδιακηζηή πνμμπηζηή ακάπηολδξ ηδξ οδαημηαθθζένβεζαξ
εζςηενζηχκ οδάηςκ ζηδκ πχνα αοηή. Πανάθθδθα ημ ζζμγφβζμ ελαβςβχκ/εζζαβςβχκ (million USD) ημο
Ecuador υζμκ αθμνά ηα πνμσυκηα αθζείαξ & οδαημηαθθζένβεζαξ είκαζ εεηζηυ (2,494.0 / 293.7) εκχ δ ηαηά
ηεθαθή ηαηακάθςζδ ζπεοδνχκ ακένπεηαζ πενίπμο ζηα 8kg/yr, ηαηά πμθφ παιδθυηενδ ημο ιέζμο υνμο ηδξ
Δονςπασηήξ Δκςζδξ ηαζ άθθςκ πςνχκ εηηυξ Δονχπδξ (FAO 2014).
Ζ ένεοκα αοηή ζημπεφεζ ζηδκ ηαηαβναθή ηδξ πανμφζαξ οδαημηαθθζενβδηζηήξ δναζηδνζυηδηαξ ζε δφμ επανπίεξ
ημο Ecuador (Esmeraldas & Sucumbios) ηαζ ζηδκ ζοβηνυηδζδ πνμηάζεςκ βζα ηδκ αεθηίςζδ ηδξ υζμκ αθμνά ηζξ
ιεευδμοξ παναβςβήξ, ημ φρμξ παναβςβήξ ηαζ ηδκ αεζθμνζηή δζαπείνζζδ ηςκ ακενχπζκςκ ηαζ θοζζηχκ πυνςκ.
Ζ ένεοκα δζεκενβείηαζ ιε ηδκ αμήεεζα ημο Τπμονβείμο Γεςνβίαξ, Κηδκμηνμθίαξ, Αθζείαξ &
Τδαημηαθθζενβεζχκ ημο Ecuador (MAGAP 2014) ημ μπμίμ πανέπεζ ηεπκζηή αμήεεζα βζα ηζξ ιεηαηζκήζεζξ ζηζξ
πενζμπέξ ένεοκαξ εκηυξ ηδξ πχναξ ηαεχξ ηαζ οπμζηήνζλδ ζε ακενχπζκμ δοκαιζηυ βζα ηζξ επαθέξ ιε ημπζημφξ
θμνείξ, ηαθθζενβδηέξ βήξ, οδαημηαθθζενβδηέξ, αθζείξ ηαζ επζζηήιμκεξ άθθςκ οπδνεζζχκ πμο ζπεηίγμκηαζ ιε ημ
ακηζηείιεκμ ηδξ ένεοκαξ. Πανάθθδθα απυ ημ ίδζμ Τπμονβείμ πανέπεηαζ ηαζ αζαθζμβναθζηή οπμζηήνζλδ ιέζς
ηεπκζηχκ εηεέζεςκ ηαζ ακαθμνχκ πμο ηαηά ηαζνμφξ έπμοκ ζοκηαπεεί απυ οπαθθήθμοξ ημο.
379
HydroMedit 2014, November 13-15, Volos, Greece
ημ Πενμφ ηαζ ηδκ Κμθμιαία επζηναηεί ηνμπζηυ ηθίια ηφπμο Αιαγμκίμο ( πενζμπή Amazonia). Οζ εενιμηναζίεξ
αένα (ιέζδ εθαπ. 21oC- ιέζδ ιεβ. 30oC) ηαζ δ αηιμζθαζνζηή οβναζία (70% - 90%) είκαζ ορδθέξ ηαευθδ ηδκ
δζάνηεζα ημο πνυκμο εκχ μζ ανμπμπηχζεζξ είκαζ ζοκεπείξ ιε επμπζαηέξ δζαηοιάκζεζξ (2.0cm – 9.0cm ιέζδ
ιδκζαία). ηδκ πενζμπή αοηή ηδξ Αιαγμκίαξ οθίζηαηαζ ζδιακηζηή οδαημηαθθζενβδηζηή δναζηδνζυηδηα ιε είδδ
εκδδιζηά αθθά ηαζ αθθυπεμκα. Σα ηονζυηενα ελ αοηχκ είκαζ: Cachama blanca (Piaractus brachypomus),
Cachama negra (Colossoma macropomum), Sabalo (Brycon spp.), Bocachico (Prochilodus nigricans) ηαζ
ηζθάπζα (Oreochromis spp.). Ζ εηηνμθή ημοξ δζεκενβείηαζ ζε πςιάηζκεξ δελαιεκέξ δζαθυνςκ δζαζηάζεςκ
ακάθμβα ιε ηδκ δθζηία ηαζ ημ ιέβεεμξ: 15mX17m, 35mX17m, and 70mX17m. Σα είδδ αοηά εηηνέθμκηαζ
ζοκήεςξ ζε ζοζηήιαηα πμθοηαθθζένβεζαξ δζυηζ είκαζ ζε εέζδ κα αλζμπμζμφκ δζαθμνεηζηά ηιήιαηα ηδξ οδάηζκδξ
ζηήθδξ ηαζ ημο αέκεμοξ. Ζ ακακέςζδ κενμφ πμζηίθθεζ απυ 5% έςξ 40% ημο υβημο δελαιεκήξ διενδζίςξ (Saltos
2011). Παναηδνμφκηαζ επμπζαηά πνμαθήιαηα μλέςζδξ ημο κενμφ ηαεχξ ηαζ επμπζαηυξ εοηνμθζζιυξ πμο εα
ιπμνμφζακ κα ακηζιεηςπζζημφκ ιε ηαθφηενδ δζαπείνζζδ ημο κενμφ εηηνμθήξ ηαεχξ ηαζ ηαθφηενδ δζαπείνζζδ
ημο πανεπυιεκμο ζζηδνεζίμο. Ζ ζοκήεδξ πναηηζηή είκαζ δ ζε αναζά πνμκζηά δζαζηήιαηα πανμπή ζπυνςκ ή
αθεφνςκ ζε πνςημβεκή ιμνθή πςνίξ πνμδβμφιεκδ επελενβαζία ημοξ βζα ηδκ δζαιυνθςζδ ζοιπήηηςκ, ιε
ελαίνεζδ ηδκ ηζθάπζα βζα ηδκ μπμία πανέπμκηαζ εζδζηά ζφιπδηηα πμο δζαηίεεκηαζ ζημ ειπυνζμ. Γέκ οθίζηακηαζ
ζημζπεία βζα ηζξ εζδζηέξ δζαηνμθζηέξ απαζηήζεζξ ηςκ εκδδιζηχκ εζδχκ. ηδκ πενζμπή ακαθένεηαζ δ φπανλδ
ιμκάδαξ επελενβαζίαξ ζπεοδνχκ πμο δδιζμονβήεδηε ηφνζα βζα ηα είδδ cachama ηαζ ηζθάπζα, υιςξ δ ιμκάδα
αοηή οπμ-θεζημονβεί δζυηζ μζ ημπζημί οδαημηαθθζενβδηέξ δεκ δφκακηαζ κα ελαζθαθίζμοκ ιία ζοκεπή νμή
ειπμνεφζζιμο πνμσυκημξ (πνμζςπζηή επζημζκςκία ιε Blgo. Roberto Dixon Saltos, MAGAP - Sucumbios).
Ζ επανπία Esmeraldas ζηα Ακαημθζηά ηδξ, ζοκμνεφεζ ιε ηζξ δπεζνςηζηέξ επανπίεξ Carchi, Imbaburra,
Pinchincha εκχ ζηα Γοηζηά απμηεθεί ηιήια ηδξ αηημβναιιήξ ημο Δζνδκζημφ Χηεακμφ. Σμ ιεβαθφηενμ % ηδξ
επζθάκεζαξ ηδξ επανπίαξ αοηήξ ανίζηεηαζ ζε ορυιεηνμ <450m απυ ηδκ επζθάκεζα ηδξ εάθαζζαξ ηαζ
παναηηδνίγεηαζ απυ ηθίια ηνμπζηυ (ιέζδ εθαπ. 22 oC- ιέζδ ιεβ.29oC, 0.6 cm – 5.6 cm ιέζδ ιδκζαία
ανμπυπηςζδ). ηδκ επανπία αοηή ημ ιεβαθφηενμ % ηςκ ζπεοδνχκ πνμένπεηαζ απυ ηδκ εαθάζζζα αθεία εκχ δ
οδαημηαθθζένβεζα εηπνμζςπείηαζ ζε ιζηνυ % ηαζ ηφνζα απυ ηδκ βανίδα. ηδκ επανπία αοηή παναηδνείηαζ
έθθεζρδ πνμσυκημξ ζηζξ ημπζηέξ ζπεοαβμνέξ δζυηζ ηα πενζζζυηενα αθζεφιαηα δζμπεηεφμκηαζ ζηα ιεβάθα αζηζηά
ηέκηνα ηδξ εκδμπχναξ. Χξ εη ημφημο οπάνπεζ ιία αολδιέκδ ακάβηδ βζα πνμιήεεζα πνμσυκηςκ
οδαημηαθθζένβεζαξ ζηζξ ζπεοαβμνέξ ηδξ επανπίαξ αοηήξ (πνμζςπζηή επζημζκςκία ιε ειπυνμοξ αθζεοηζηχκ
πνμσυκηςκ ζηδκ επανπία).
Σμ 2012 λεηίκδζε έκα ηναηζηυ πνυβναιια δδιζμονβίαξ πςιάηζκςκ δελαιεκχκ (40mX25m) βζα ηδκ εηηνμθή
ηζθάπζαξ ζε δζάθμνεξ πενζμπέξ ηδξ επανπίαξ αοηήξ. Λυβς αηαηάθθδθδξ ημηημιεηνζηήξ ζφζηαζδξ ημο εδάθμοξ
(έθθεζρδ ανβίθθμο) ζηζξ πενζζζυηενεξ απυ ηζξ δελαιεκέξ αοηέξ παναηδνήεδηε ζδιακηζηή οπυβεζα δζαθοβή
κενμφ ηαζ απχθεζα ζπεοδίςκ. Πανάθθδθα πνμέηορακ ηαζ πνμαθήιαηα ιε ημ ζδζμηηδζζαηυ ηαεεζηχξ ηςκ
δελαιεκχκ αοηχκ δζυηζ ζε πμθθέξ πενζπηχζεζξ μζ ειπθεηυιεκμζ οδαημηαθθζενβδηέξ δεκ ήηακ ηαζ ζδζμηηήηεξ ηςκ
εκ θυβς εηηάζεςκ (πνμζςπζηή επζημζκςκία ιε Blgo Fabio Sixto Caicedo, Sub Secretaria De Acuicultura,
MAGAP - Esmeraldas). Δκ ημφημζξ ζε πμθθέξ πενζμπέξ ηδξ επανπίαξ αοηήξ (ηφνζα ζημ ΒΑ ηιήια ηδξ),
οπάνπμοκ ιζηνμί ηαθθζενβδηέξ πενζαίςκ αβνμηζηχκ πνμσυκηςκ πμο έπμοκ εηδδθχζεζ εκδζαθένμκ βζα ηδκ
εηηνμθή δζαθυνςκ εκδδιζηχκ ρανζχκ υπςξ: Sabalo (Brycon spp.), Belone (Strongylura fluviatilis), Guayas
cichlid (Cichlasoma festae) & Chame (Dormitator latifrons). Σα είδδ αοηά εα ιπμνμφζακ κα «εκζςιαηςεμφκ»
ζημ οπάνπμκ ζφζηδια πενζαίςκ ηαθθζενβεζχκ ιε ηδκ δδιζμονβία πςιάηζκςκ δελαιεκχκ εηηνμθήξ ιζηνήξ
έηηαζδξ ηαζ κα ζοιαάθθμοκ ζδιακηζηά ζηδκ αεθηίςζδ ημο αζμηζημφ επζπέδμο ηςκ ηαθθζενβδηχκ αοηχκ, αθθά
ηαζ κα ηνμθμδμηήζμοκ ηζξ ημπζηέξ ζπεοαβμνέξ ηαθφπημκηαξ ιένμξ ηδξ αολδιέκδξ ημπζηήξ γήηδζδξ (πνμζςπζηή
επζημζκςκία ιε Eduardo Rebolledo Monsalve, Director Centro de Investigacion y Desarrollo, PUCESE). Χξ εη
ημφημο δ ακάπηολδ ηδξ οδαημηαθθζένβεζαξ εζςηενζηχκ οδάηςκ ζηδκ επανπία Esmeraldas εα ιεζχζεζ ημ έθθεζια
πμο παναηδνείηαζ ζηζξ ημπζηέξ ζπεοαβμνέξ αθθά πανάθθδθα εα είκαζ ζε εέζδ κα ηνμθμδμηήζεζ ηαζ άθθεξ
επανπίεξ ηδξ εκδμπχναξ (i.e. Imbaburra, Pinchincha) υπμο παναηδνείηαζ ιζα ζοκεπχξ αολακυιεκδ γήηδζδ ζε
αθζεφιαηα. Πανάθθδθα οπάνπεζ πάκηα ηαζ δ επζθμβή ηδξ ελαβςβήξ ιένμοξ ηδξ αολδιέκδξ παναβςβήξ ζε
βεζημκζηέξ πχνεξ (Πενμφ, Κμθμιαία) υπμο δ γήηδζδ είκαζ ζοκεπήξ ηαζ αολακυιεκδ.
380
HydroMedit 2014, November 13-15, Volos, Greece
5. πκπεξάζκαηα - Πξνηάζεηο
Σμ Ecuador είκαζ ιζα ακαπηοζζυιεκδ πχνα υπμο δ ζοκεπήξ αφλδζδ ημο αζμηζημφ επζπέδμο ηαζ δ παιδθή ιέζδ
ηαηά ηεθαθήκ ηαηακάθςζδ ζπεοδνχκ, εββοχκηαζ ηδκ απμννυθδζδ κέςκ οδαημηαθθζενβδηζηχκ πνμσυκηςκ.
Οιςξ ζηα εέιαηα οδαημηαθθζένβεζαξ εζςηενζηχκ οδάηςκ παναηδνείηαζ ιία έθθεζρδ ηεκηνζημφ ζπεδζαζιμφ ηαζ
αλζμθυβδζδξ ηςκ δοκαημηήηςκ ηςκ θοζζηχκ οδάηζκςκ πυνςκ βζα οδαημηαθθζενβδηζημφξ ζημπμφξ. Αοηυ
ηαείζηαηαζ αηυια πζυ δφζημθμ απυ ηδκ ηαοηυπνμκδ εηιεηάθθεοζδ ηςκ οδάηζκςκ πυνςκ απυ άθθεξ αζμιδπακίεξ
(ελυνολδ πεηνεθαίμο, ελυνολδ ιεηαθθεοιάηςκ, οδνμδθεηηνζηή εκένβεζα) πμο οπυ μνζζιέκεξ ζοκεήηεξ είκαζ
δοκαηυκ κα ηαηαζημφκ νοπμβυκεξ βζα ημοξ ίδζμοξ αοημφξ ημοξ οδάηζκμοξ πυνμοξ πμο πνδζζιμπμζμφκ (Rebolledo
& Prado 2014). Πανάθθδθα οπάνπεζ ηαζ έθθεζρδ ελεζδζηεοιέκμο πνμζςπζημφ ζηζξ ανιυδζεξ οπδνεζίεξ πμο
ζοπκά αδοκαημφκ κα ενιδκεφζμοκ ηα απμηεθέζιαηα δζαθυνςκ ενεοκδηζηχκ πνμζπαεεζχκ ηαζ κα ζοκημκίζμοκ
υθεξ αοηέξ ηζξ δναζηδνζυηδηεξ πςνίξ ανκδηζηέξ αθθδθεπζδνάζεζξ βζα ηζξ ίδζεξ αθθά ηαζ ημ πενζαάθθμκ.
Οζ δφμ πενζμπέξ ένεοκαξ πανμοζζάγμοκ ζδιακηζηέξ δοκαηυηδηεξ ακάπηολδξ ηδξ οδαημηαθθζένβεζαξ εζςηενζηχκ
οδάηςκ, πάκηα υιςξ ιε ημοξ πνμακαθενυιεκμοξ πενζμνζζιμφξ. Πένακ ηςκ πενζμνζζιχκ αοηχκ, ζδζαίηενδ
έιθαζδ πνέπεζ κα δμεεί ζηδκ δζενεφκδζδ ηςκ απαζηήζεςκ εηηνμθήξ (ακαπαναβςβή, δζαπείνζζδ, δζαηνμθή) ηςκ
εκδδιζηχκ εζδχκ βζα ηδκ ακάδεζλδ ηςκ ηαηαθθδθυηενςκ βζα εηηνμθή ζηζξ ημπζηέξ βεςιμνθμθμβζηέξ ηαζ
ηθζιαημθμβζηέξ ζοκεήηεξ. ηα πθαίζζα αοηά εα πνέπεζ πνςηανπζηά κα δδιζμονβδεμφκ ενεοκδηζηά ηέκηνα ιε ηζξ
ηαηάθθδθεξ οθζημηεπκζηέξ ηαζ ακενχπζκεξ οπμδμιέξ, εκχ δεοηενεουκηςξ εα ήηακ ζηυπζιδ ηαζ δ δδιζμονβία
ζπεομβεκκδηζημφ ζηαειμφ πμο κα πνμιδεεφεζ ημοξ παναβςβμφξ ιε ζπεφδζα ηαθήξ πμζυηδηαξ ηαζ ζοβηεηνζιέκςκ
πνμδζαβναθχκ. Απαναίηδηδ εεςνείηαζ ηαζ δ εηπυκδζδ εκυξ εεκζημφ επζπεζνδιαηζημφ ζπεδίμο (business plan)
πμο εα δζενεοκήζεζ δζελμδζηά ηζξ δοκαηυηδηεξ ακάπηολδξ ηδξ οδαημηαθθζένβεζαξ εζςηενζηχκ οδάηςκ πςνίξ
ανκδηζηέξ επζπηχζεζξ ζημ πενζαάθθμκ, ηδκ ιμκαδζηή αζμπμζηζθυηδηα ηδξ πχναξ ηαζ ιε ελαζθάθζζδ ηδξ
αεζθμνίαξ ηςκ θοζζηχκ ηαζ ακενχπζκςκ πυνςκ ηδξ.
Δπραξηζηίεο
Ζ ένεοκα αοηή πνδιαημδμηήεδηε απυ ηδκ Γεκζηή Γναιιαηεία Ακχηαηδξ Δηπαίδεοζδξ, Δπζζηήιδξ,
Σεπκμθμβίαξ ηαζ Καζκμημιίαξ ημο Ecuador (Secretaria Nacional De Educacion Superior, Ciencia Tecnologia E
Innovacion - SENESCYT), Contract No 20140571.
διακηζηή ήηακ ηαζ δ ζοιαμθή ημο Τπμονβείμο Γεςνβίαξ, Κηδκμηνμθίαξ, Αθζείαξ &
Τδαημηαθθζενβεζχκ ημο Ecuador (MAGAP - Ministerio de Agricultura, Ganadería, Acuacultura y Pesca – Zona
1) ημ μπμίμ ιε ηδκ ακενχπζκδ & οθζημηεπκζηή ημο οπμδμιή ελαζθάθζζε ηδκ ζοθθμβή πθδνμθμνίςκ απμ ηζξ
πενζμπέξ ένεοκαξ.
Γεκ πνέπεζ κα παναθεζθεεί δ ζδιακηζηή αμήεεζα ηςκ ζοκαδέθθςκ ενεοκδηχκ Eduardo Rebolledo Monsalve ηαζ
Pedro Jiménez Prado ημο πακεπζζηδιίμο ―Pontificia Universidad Catolica del Ecuador, Sede Esmeraldas‖-
(PUCESE) πμο πανείπακ ζημζπεία βζα ηδκ αθζεία & οδαημηαθθζένβεζα ζηδκ επανπία Esmeraldas.
Βηβιηνγξαθία
FAO (2014). Food and Agriculture Organization of the United Nations, Departamento dePesca y Acuicultura,
Perfiles sobre la pesca y la acuicultura por países, La República Del Ecuador.
http://www.fao.org/fishery/facp/ECU/es#CountrySector-GenGeoEconReport (Πνυζααζδ 15-10-2014).
MAGAP (2014). Ministerio de Agricultura, Ganadería, Acuacultura y Pesca – Zona 1.
http://www.agricultura.gob.ec/el-ministerio/ (Πνυζααζδ 15-10-2014).
381
HydroMedit 2014, November 13-15, Volos, Greece
Rebolledo E. M., Prado P. J. (2014). Calidad de agua, actividad minera aurífera y comunidades de peces de agua
dulce de la zona media baja del sistema hidrográfico Santiago- Cayapas, Esmeraldas, Ecuador.
Memorias de ―1mero Encuentro Nacional De Ictiologia‖, PUCESE, Esmeraldas, Ecuador, pp. 32-36.
Saltos, Roberto Dixon (2011). Guia tecnica para la produccion piscicola. Gobierno Autonomo Descentralizado
De Sucumbios. Centro De Investigaciones Y Servicios Agropecuarios Sucumbios – CISAS.
Coordinación General Ing. Lidio Villarreal Bolaños, Director del CISAS, Ecuador, pp. 70.
382
HydroMedit 2014, November 13-15, Volos, Greece
1
Department of Pathology, Faculty of Veterinary Medicine, University of Adnan Menderes, 09016 Isikli-Aydin,
TURKEY
E-Mail :sbirincioglu@adu.edu.tr
ABSTRACT
The present study describes pathological and immunohistochemical findings resulting from acute and chronic
infections in juvenile sea bass (Dicentrarhus labrax) and gilthead sea bream (Sparus aurata) naturally infected
with Photobacterium damselae subsp. piscicida. The disease has an acute presentation in sea bass while in
gilthead sea bream acute and chronic forms were recorded. The highest mortality rates in both fish species were
observed in June when the water temperature is elevated. In both species, the acute form is histopathologically
characterized by the abundance of bacterial clusters coupled to vascular lesions in many organs (gills, heart,
kidney, spleen, liver and gastrointestinal tract at a lesser extend). In the chronic form, granulomatous lesions
consisted in clusters of bacteria in the center surrounded by epithelial histiocytes and macrophages and finally
fibroblasts. By immunohistochemistry, immunopositive bacteria were densely evidenced in the kidney, spleen,
gills, heart and liver in acute cases in both fish species whereas they were mainly located in kidney and spleen
during the chronic form.
Keywords: Fish pasteurellosis, sea bass, gilthead sea bream, pathological findings, immunohistochemistry.
Introduction
Photobacterium damselae subsp. piscicida, the causative agent of fish pasteurellosis, was initially
isolated from natural populations of white perch (Morone americanus) and striped bass (Morone saxatilis) in
1963 during a massive epizootic in Chesapeake Bay, USA [16], and is now widely distributed throughout the
world [5,18]. Sea bass (Dicentrarhus labrax) and gilthead sea bream (Sparus aurata) fish are the species most
susceptible to the disease [7,9, 18]. The disease generally affects larvae causing mortality of 50-100%, but the
disease can also affect juveniles with mortality up to 50% [2, 15]. The incidence of diseases and types of
bacterial pathogens has well documented in several cultured fish species [3]. The disease was described as an
acute to chronic disease [17].
383
HydroMedit 2014, November 13-15, Volos, Greece
The aims of the study are to present and evaluate histopathological and immunohistochemical findings
of fish pasteurellosis in juvenile sea bass (Dicentrarhus labrax) and gilthead sea bream (Sparus aurata) naturally
infected with Photobacterium damselae subsp. piscicida.
In the early summer , an outbreak was occurred in a fish farm, which was located in the southern Aegean of part
Turkey. Fish samples were collected monthly from the rearing pools from March to June.
For bacteriological examinations, samples were taken in cooled boxes (1-4OC) to laboratory and then
the samples were processed within 1 hour after collection for bacteria identification using microbiological
methods [5, 10].
For histological examinations, a total of 96 dead or euthanized fish (44 juvenile sea bass and 52 juvenile
gilthead sea bream) were fixed in 10% neutral-buffer formalin solution, embedded in paraffin, sectioned at 5 µm
and stained routinely with haematoxylin and eosin and examined using light microscope. The selected kidney,
liver, spleen, heart and gill sections were also stained by Brown and Brenn staining method for bacteria [6].
Replicated sections were also used for immunohistochemistry.The immunohistochemical procedure used in the
present study was based on the method of ADAMS and MARIN DE MATEO [1].
Results
Photobacterium damselae subsp. piscicida was isolated and identified from the sea bass and gilthead sea bream
samples Only acute form of the disease was observed in sea bass whereas chronic and acute forms were
recorded in gilthead sea bream. In both fish species, the highest mortality rates were seen in June when the
temperature of the water reached 24°C. During the investigation period, water salinity and quality were uniform,
but it was noted that water temperatures ranged between 20-24°C during the epizootics. However, globally
morbidity and mortality rates were higher in gilthead sea breams than in sea basses. In acute form, darkening of
skin colour and swimming near to the water surface were among clinical findings. Fishes with these clinical
findings usually died within 2-3 days. In chronic form (only seen in gilthead sea breams), the prominent clinical
findings were decrease in food consumption, irregular swimming movements, lethargy and varying degrees of
skin colour modifications (darkening or lightening). In addition, unilateral exophthalmia and erosive changes in
the skin were also seen in acute and chronic forms.
Vascular lesions in many organs and tissues consisting in oedema, hyperaemia and haemorrhages were
found during the acute form in both fish species. In the chronic form, adhesions were seen in the abdominal
cavity of some gilthead sea breams but the prominent macroscopic finding was light greyish white nodules at the
size of 0.5-1 mm, hardly visible with naked eye.
384
HydroMedit 2014, November 13-15, Volos, Greece
Histopathological Finding
The most important histopathological finding seen in both sea basses and gilthead sea breams was the presence
of dense bacterial clusters in the parenchyma and vessel lumens of kidney, spleen and liver and in vessel lumens
of gills, heart, stomach, pyloric caecum, peritoneum, pancreas, muscles and meninges.
In acute form, vessel lumens were enlarged in gills and they were filled with plasma, erythrocytes and
clusters of bacteria. In secondary lamellae telangiectasias containing bacterial clusters were present in many
cases of both fish species (figure 1A). Necrosis was present in primary and secondary lamellar epithelium, but
more commonly and severely in the secondary lamella.
In the heart, pericardial cavity was expanded due to haemorrhages containing large clusters of bacteria (figure
1B). In many cases, lumen of ventricle and atrium were filled with bacterial clusters and erythrocytes.
Spleen and kidney were the more affected organs both in sea bass and gilthead sea bream. In the acute form,
spleen lesions including focal or irregularly located multifocal necrotic areas containing clusters of bacteria,
oedema, severe hyperaemia and haemorrhages were related to septicaemia. Clusters of bacteria either completely
filled the vessel lumens or were focally or diffusely distributed in parenchyma. In kidney, vessels were
hyperaemic and in many cases, focal or diffuse haemorrhagic areas were present in interstitium.
In all cases, clusters of bacteria were distributed to the whole organ including vessel lumens and parenchyma
(figure 1C). Tubular epithelia were generally swollen and in some epithelial cells, cytoplasm had granular
eosinophilic appearance. Necrotic changes were present in haematopoietic tissues of the kidney as well (figure
1D). Necrotic lesions were often focal or multifocal but sometimes they were in the form of single cell necrosis.
Especially in gilthead sea breams, macrophages containing bacteria in their cytoplasm were seen in the renal
haematopoietic tissue. In the chronic form, marked lesions were noticed in spleen (figure 2A) and kidney (figure
2B) and at a lower degree in peritoneum and gills. The lesions were similar to those found in the acute form but
they were generally less intense and were associated to the presence of granulomas with clusters of bacteria in
the center surrounded by epithelial histiocytes and macrophages and finally fibroblasts at the outermost forming
a thin connective tissue. In newly formed granulomas, macrophages with a dark eosinophilic cytoplasm
containing bacteria and picnotic nucleus were often evidenced.
Immunohistochemical Findings
Bacteria found in many tissues and organs from sea basses and gilthead sea breams were stained positively by
immunohistochemistry and bacterial morphology was clearly evidenced. In necrotic areas, positive reactions
were usually in granular appearance and less dense.
In the acute form, positive reactions were prominently encountered in kidney (figure 3A), spleen and
gills (figure 3B) whereas immunolabelling was less intense in heart (figure 3C) and in liver. Immunopositive
reactions were also detected in cytoplasm of few macrophages in the kidney, spleen, gills, heart and liver but
385
HydroMedit 2014, November 13-15, Volos, Greece
also in the submucosa of pyloric caecum and intestines. In the chronic form, immunopositive bacteria were
essentially observed in the kidney and spleen. Positive staining was strongly marked in the vessel lumens (figure
3D) and in parenchyma while in the center of newly formed or old granulomas, immunopositive bacterial density
was decreased or sometimes null. Additionally, strong immunopositive reactions were also detected in
macrophage cytoplasms (figure 3D). Staining in the other organs and tissues was less dense than in the acute
form.
Table I: Clinical and macroscopical findings (number of cases) in juvenile sea bass (Dicentrarhus labrax) and
gilthead sea bream (Sparus aurata) naturally infected with Photobacterium damselae subsp. piscicida.
Necropsied animals 44 52
Morbidity (%) 30 84
Irregular swimming 44 52
Skin erosion 10 15
Exophthalmia 7 11
Adhesion 0 8
Granuloma in kidney 0 5
Table II: Histopathological and immunohistochemical findings (number of cases) in juvenile sea bass
(Dicentrarhus labrax) and gilthead sea bream (Sparus aurata) naturally infected with Photobacterium damselae
subsp. piscicida.
Gill
Cluster of bacteria 25 29
Necrosis 10 25
386
HydroMedit 2014, November 13-15, Volos, Greece
Telangiectasia 9 23
Granuloma 0 2
Immunohistochemistry 26 34
Heart
Cluster of bacteria 7 16
Pericardial haemorrhages 24 28
Necrosis 5 13
Immunohistochemistry 24 31
Liver
Cluster of bacteria 14 22
Hyperaemia- Haemorrhages 18 20
Degeneration 22 27
Necrosis 13 17
Immunohistochemistry 16 23
Spleen
Cluster of bacteria 21 29
Hyperaemia- Haemorrhages 22 29
Necrosis 21 32
Granuloma 0 6
Immunohistochemistry 23 32
Kidney
Cluster of bacteria 35 37
Hyperaemia- Haemorrhages 35 43
Necrosis (glomerulus) 12 14
387
HydroMedit 2014, November 13-15, Volos, Greece
Granuloma 0 7
Immunohistochemistry 31 39
Discussion
In the present study, clinical, pathological and immunohisto-chemical findings of natural pasteurellosis occurring
in juvenile sea basses and gilthead sea breams were investigated comparatively and findings were
comprehensively evaluated.
In pasteurellosis cases reported by many investigators [2, 4, 14], kidney and spleen are among the
organs where microscopic and macroscopic findings are commonly seen. However, whereas clusters of bacteria
were common in acute cases, sometimes clusters of bacteria were few or even absent in chronic cases.
Additionally, immunopositive bacteria detected by immunohistochemistry were also found to be more abundant
in acute cases than in chronic cases, suggesting that in juvenile fish, kidney and spleen might be not enough
sufficient in isolation and identification of the pathogen agent, probably because of activation of cellular
immunity, whilst in chronic cases, this situation should be taken into account [ 11, 13, 14]. The
immunoperoxidase method is used for the definitive diagnosis of fish pasteurellosis [ 8, 12]. In the present study,
when two forms of the disease were compared (acute vs. chronic forms), the distribution of immunopositive
bacteria in tissues and organs varied: positive reactions were more common in the acute form than in the chronic
one and even, in some fishes chronically affected no immunopositive bacteria were identified.
References
1. ADAMS A., MARIN DE MATEO M.: Imnunohistochemical detection of fish pathogens. In: Techniques
in fish imnunology, STOLEN J.S., FLETCHER T.C., ROWLEY A.F., ZELIKOFF J.T., KAATTARI S.L.
and SMITH S.A. (eds.): SOS Publication, USA, 1994, pp.: 133-144.
2. BAKOPOULOS V., PERIC Z., RODGER H., ADAMS A., RICHARDS R.H.: First report of fish
pasteurellosis from Malta. J. Aquat. Anim. Health, 1997, 9, 26-33.
3. BALEBONA M.C., ZORRILLA I., MORINIGO M.A., BORREGO J.J.: Survey of bacterial pathologies
affecting farmed gilt-head sea bream (Sparus aurata L.) in southwestern Spain from 1990-1996.
Aquaculture, 1998, 166, 19-35.
4. BAPTISTA T., ROMALDE J.L., TORANZO A.E.: First occurence of pasteurellosis in Portugal affecting
cultured gilthead seabream (Sparus auratus). Bull. Eur. Assoc. Fish Pathol., 1996, 16, 92-95.
5. CANDAN A., KUCKER M.A., KARATAS S.: Pasteurellosis in cultured sea bass (Dicentrarchus labrax)
in Turkey. Bull. Eur. Assoc. Fish Pathol., 1996, 16, 150-153.
388
HydroMedit 2014, November 13-15, Volos, Greece
6. CULLING A.F., ALLISON T.R., BARR T.W.: Cellular Pathology Technique, CULLING A.F., ALLISON
T.R. and BARR T.W. (eds), 4th edition, Butterworth & Co.(Publ.). Ltd., London, 1985, pp.: 269-270.
7. JONES M.W., COX D.I.: Clinical Disease in seafarmed Atlantic salmon (Salmo salar) associated with a
member of the family pasteurellaceae-a case history. Bull. Eur. Assoc. Fish Pathol., 1999, 19, 75-78.
8. JUNG T.S., THOMPSON K.D., MORRIS D.J., ADAMS A., SNEDDON K.: The production and
characterization of monoclonal antibodies against Photobacterium damselae ssp. piscicida and initial
observations using immunohistochemistry. J. Fish Dis., 2001, 24, 67-77.
9. KUSUDA R., KAWAI K.: Bacterial diseases of cultured marine fish in Japan. Fish Pathol., 1998, 33, 221-
227.
10. LIU P.C., CHENG C.F., CHANG C.H., LIN S.L., WANG W.S., HUNG S.W., CHEN M.H., LIN C.C., TU
C.Y., LIN Y.H.: Highly virulent Photobacterium damselae subsp. Piscicida isolated from Taiwan paradise
fish, Macropodus opercularis (L.), in Taiwan. Afr. J. Microbiol. Res., 2011, 5, 2107-2113.
11. MAGARINOS B., TORANZO A.E., ROMALDE J.L.: Different susceptibility of gilthead seabream and
turbot to Pasteurella piscicida infection by the water route. Bull. Eur. Assoc. Fish Pathol., 1995, 15, 88-90.
12. MANIATIS K., MORRIS D.J., ADAMS A., PEARSON M.: Detection of Photobacterium damsela
subspecies piscicida in fixed tissue sections using immnunohistochemistry and antigen retrieval
immunohisto-chemistry. J Fish Dis., 2000, 23, 343-347.
13. MLADINEO I., MILETIC I., BOCINA I.: Photobacterium damselae subsp. piscicida outbreak in cage-
reared Atlantic bluefin tuna Thunnus thynnus. J. Aquat. Anim. Health, 2006, 18, 51-54.
14. NAGANO I., INOUE S., KAWAI K., OSHIMA S.I.: Repeatable immersion infection with Photobacterium
damselae subsp. piscicida reproducing clinical signs and moderate mortality. Fish. Sci., 2009, 75, 707-714.
15. NOYA M., MAGARINOS B., LAMAS J.: Interactions between peritonel exudate cells (PECs) of gilthead
seabream (Sparus aurata) and Pasteurella piscicida. A morphological study. Aquaculture, 1995, 131,
11-21.
16. SNIESZKO S.F., BULLOCK G.L., HOLLIS E., BOONE J.G.: Pasteurella sp. from an epizootic of white
perch (Roccus americanus) in Chesapeake Bay tidewater areas. J. Bacteriol., 1964, 88, 1814-1815.
17. THUNE R.L. STANLEY L.A., COOPER R.K.: Pathogenesis of gram-negative bacterial infections in
warmwater fish. Annu. Rev. Fish Dis., 1993, 3, 37-68.
18. TORANZO A.E. BARREIRO S., CASAL J.F., FIGUERAS A., MAGARINOS B., BARJA
J.L.:Pasteurellosis in cultured gilthead seabream (Sparus aurata):first report in Spain. Aquaculture,
1991,99, 1-15.
389
HydroMedit 2014, November 13-15, Volos, Greece
1
Department of Fisheries and Aquaculture Technology, Alexander Technological Educational Institute of
Thessaloniki, P.O. Box. 157, GR-63200, Nea Moudania, Greece.
2
Department of Information Technology, Alexander Technological Educational Institute of Thessaloniki, P.O.
Box. 141, GR-57400, Thessaloniki, Greece.
ABSTRACT
The present work focuses on the development of a digital checklist of all the fish species inhabiting the Greek
Seas and inland waters. The developed application is fully interactive and has an easy to use and friendly user
interface providing to the user excellent operational capabilities to search and find any species together with
complete information on it (scientific and Greek-English common names, systematic, morphological and
ecological information, a picture of the fish and the geographical distribution). It is an easy to use and scalable
digital application, very useful to the scientific community, as it enables an easy and fast way to achieve
information on a given fish species or on a group (e.g. family), further assisting ichthyologists, students,
professional or recreational fishermen.
1
Σιήια Σεπκμθμβίαξ Αθζείαξ ηαζ Τδαημηαθθζενβεζχκ, Αθελάκδνεζμ Σεπκμθμβζηυ Δηπαζδεοηζηυ Ίδνοια
Θεζζαθμκίηδξ, Σ.Θ. 157, 63200, Νέα Μμοδακζά, Δθθάδα.
2
Σιήια Μδπακζηχκ Πθδνμθμνζηήξ, πμθή Σεπκμθμβζηχκ Δθανιμβχκ, Αθελάκδνεζμ Σεπκμθμβζηυ Δηπαζδεοηζηυ
Ίδνοια Θεζζαθμκίηδξ, Σ.Θ. 141, 57400, Θεζζαθμκίηδ, Δθθάδα.
Πεξίιεςε
Ζ πανμφζα ενβαζία επζηεκηνχκεηαζ ζηδκ ακάπηολδ εκυξ ρδθζαημφ ηαηαθυβμο ιε υθα ηα είδδ ρανζχκ
πμο απακηχκηαζ ζηζξ εθθδκζηέξ εάθαζζεξ ηαζ ηα εζςηενζηά φδαηα. Ζ εθανιμβή πμο ακαπηφπεδηε είκαζ πθήνςξ
δζαδναζηζηή ηαζ δζαεέηεζ έκα εφημθμ ζηδ πνήζδ ηαζ θζθζηυ πενζαάθθμκ ενβαζίαξ πμο πανέπεζ ζημοξ πνήζηεξ
ελαζνεηζηέξ δοκαηυηδηεξ βζα κα ακαγδηήζμοκ ηαζ κα ανμοκ υθα ηα είδδ ηςκ ρανζχκ ιαγί ιε πθδνμθμνίεξ
ζπεηζηά ιε ηδκ (επζζηδιμκζηή ηαζ εθθδκζηή - αββθζηή ημζκή μκμιαζία, ηδκ ζοζηδιαηζηή ημο ηαηάηαλδ,
390
HydroMedit 2014, November 13-15, Volos, Greece
ιμνθμθμβζηά ηαζ μζημθμβζηά ζημζπεία, ιζα εζηυκα ηςκ ρανζχκ ηαζ ηδξ βεςβναθζηήξ ημο ελάπθςζδξ). Δίκαζ ιζα
εφημθδ ζηδ πνήζδ ηαζ ρδθζαηή εθανιμβή, πμθφ πνήζζιδ βζα ηδκ επζζηδιμκζηή ημζκυηδηα, ηαεχξ επζηνέπεζ έκα
εφημθμ ηαζ βνήβμνμ ηνυπμ βζα ηδκ επίηεολδ πθδνμθμνζχκ ζπεηζηά ιε έκα ζοβηεηνζιέκμ είδμξ ρανζμφ ή ζε ιζα
μιάδα (π.π. μζημβέκεζα), βζα κα αμδεήζεζ ζπεομθυβμοξ, θμζηδηέξ, επαββεθιαηίεξ ή εναζζηέπκεξ αθζείξ.
1. Δηζαγσγή
ήιενα πενζβνάθμκηαζ παβημζιίςξ πενίπμο 32.900 είδδ ρανζχκ (Froese & Pauly 2014) εκχ ζηδκ Μεζυβεζμ
εάθαζζα ακαθένμκηαζ 735 είδδ (Froese & Pauly 2014) ή ιε ζοκηδνδηζηυηενμοξ οπμθμβζζιμφξ 684 είδδ (602
μζηεζπεφεξ, 79 Υμκδνζπεφεξ ηαζ 3 Κοηθυζημιμζ) (Psomadakis et al., 2012). ηζξ Δθθδκζηέξ εάθαζζεξ ζοκακηάιε
πενίπμο 510 είδδ ρανζχκ (441 Οζηεζπεφεξ, 68 Υμκδνζπεφεξ ηαζ 1 Άβκαεα) (Papaconstantinou, 2014) εη ηςκ
μπμίςκ 414 είδδ ζημ Αζβαίμ πέθαβμξ (Froese & Pauly 2014). ηα βθοηά κενά ηδξ Δθθάδαξ έπμοκ ηαηαβναθεί
154 είδδ ρανζχκ (Kottelat & Freyhof 2007, Λεβάηζξ & Μαναβημφ 2009). Πμθθά υιςξ απυ αοηά ηα είδδ ηςκ
ρανζχκ απακηχκηαζ ηαζ ζηδ εάθαζζα (π.π. 3 ζημονζυκζα, 1 θάιπναζκα, 6 ηέθαθμζ, 1 αεενίκα, 1 ζαημνάθα, 1
ζανδεθμιάκα, 1 πέθζ, 1 θαανάηζ), ιε απμηέθεζια ημ άενμζζια 664 (510+154) βζα ημκ ζοκμθζηυ ανζειυ ηςκ
ρανζχκ πμο απακηχκηαζ ζηα Δθθδκζηά φδαηα κα είκαζ αζθαθχξ ιζηνυηενμ (π.π. 649).
Μέπνζ ζήιενα, μζ πθδνμθμνίεξ βζα ηα ράνζα ηδξ Δθθάδαξ ιπμνμφζακ κα ακαγδηδεμφκ ζε έκηοπμοξ
ηαηαθυβμοξ (π.π. Καζπίνδξ 2000, Kottelat & Freyhof 2007, Λεβάηζξ & Μαναβημφ 2009, Μίκμξ 2011,
Papaconstantinou 2014). Ακ ηαζ μζ ηαηάθμβμζ αοημί πνμζθένμοκ αλζυπζζηδ ηαζ εκοπυβναθδ πθδνμθυνδζδ, ημ
πνυαθδια είκαζ υηζ δ εκδιένςζή ημοξ είκαζ δφζημθδ ηαζ πνμκμαυνα θυβς ηδξ δζαδζηαζίαξ επακεηηφπςζδξ ηαζ
ηςκ ηεθεοηαίςκ ελεθίλεςκ ιε ηδ ζπεδυκ ηαεδιενζκή ειθάκζζδ κέςκ εζδχκ ζηδκ πενζμπή ή αθθαβή ζηδκ
επζζηδιμκζηή ημοξ μκμιαζία, ημ απμηέθεζια είκαζ κα λεπενκζμφκηαζ βνήβμνα. Σα ηεθεοηαία πνυκζα ιε ηδκ
ακάπηολδ ημο δζαδζηηφμο ειθακίζηδηακ παβηυζιζμζ δθεηηνμκζημί ηαηάθμβμζ ιε ράνζα, υπςξ δ FishBase
(Froese & Pauly 2014), ημ Integrated Taxonomic Information System (ITIS 2014), ημ World Register of Marine
Species (WoRMS 2014), ημ IUCN Red List of Threatened Species (IUCN 2014) ηαζ ημ Marine Species
Identification Portal (2014) πμο πενζθαιαάκμοκ ηαζ είδδ πμο απακηχκηαζ ηαζ ζηδκ Δθθάδα. Οζ δθεηηνμκζημί
ηαηάθμβμζ έπμοκ ηδ δοκαηυηδηα ηδξ ζοκεπμφξ εκδιένςζδξ ηςκ δεδμιέκςκ ημοξ αθθά απαζημφκ ζφκδεζδ ιέζς
δζαδζηηφμο ηαζ πανάθθδθα πνέπεζ ζε ηάεε ακαγήηδζδ κα βίκεζ δζαζηαφνςζδ ηδξ πθδνμθμνίαξ απυ πενζζζυηενεξ
απυ ιία πδβέξ θυβς ιεζςιέκδξ αλζμπζζηίαξ ηςκ εηάζημηε δζαδζηηοαηχκ ηυπςκ.
Μζα άθθδ πνμζέββζζδ ζημ γήηδια είκαζ ρδθζαηέξ εθανιμβέξ πμο εηηεθμφκηαζ ημπζηά ζημκ οπμθμβζζηή
ηαζ δίκμοκ πανάθθδθα ζημ πνήζηδ ηδ δοκαηυηδηα εκδιένςζδξ (πνμζεήηδξ, δζαβναθήξ, αθθαβήξ) ηδξ ημπζηήξ
αάζδξ δεδμιέκςκ. Με ημκ ηνυπμ αοηυ ημο δίκεηαζ δ εθεοεενία βζα δζαιυνθςζδ ηδξ ρδθζαηήξ ημο αάζδξ ηαηά
ημ δμημφκ επζθέβμκηαζ μ ίδζμξ ηζξ πδβέξ πμο εα ζοιαμοθεοηεί βζα ηδ ζοιπθήνςζδ ηδξ αάζδξ ηδξ εθανιμβήξ.
Σέημζεξ ρδθζαηέξ εθανιμβέξ πμο εηηεθμφκηαζ πςνίξ κα απαζηείηαζ δ πνήζδ ημο δζαδζηηφμο (οπάνπεζ ημπζηή
αάζδ) είκαζ είηε βζα ηδκ ηαοημπμίδζδ ηςκ εζδχκ ηςκ ρανζχκ ιέζς δθεηηνμκζηχκ ηθεζδχκ (Kostoglou et al.
2013, Minos et al. 2013) είηε βζα ηδκ ακαγήηδζδ ηδξ ζοζηδιαηζηήξ ηαλζκυιδζδξ ηςκ ζπεφςκ ιε ηδ πνήζδ
βναιιςημφ ηχδζηα (Μίκμξ ηαζ ζοκ. 2013).
ηδκ πανμφζα ενβαζία πανμοζζάγεηαζ ιζα ημπζηή εθανιμβή πμο πενζθαιαάκεζ έκα ηαηάθμβμ ιε ηα
ράνζα ηδξ Δθθάδαξ, ιε ηδ ζοζηδιαηζηή ημοξ ηαηάηαλδ, πθδνμθμνίεξ βζα ηδκ ιμνθμθμβία ηαζ ηδκ μζημθμβία
ημοξ ηαεχξ ηαζ ζπεηζηέξ πθδνμθμνίεξ βζα ημ ηάεε είδμξ.
Ζ εθανιμβή ακαπηφπεδηε ιε ηδ βθχζζα πνμβναιιαηζζιμφ Microsoft Visual Basic 6.0 ηαζ οθμπμζήεδηε ιε ημ
Microsoft Visual Studio 2013. Σα δεδμιέκα βζα ηα είδδ ηςκ ρανζχκ ηδξ Δθθάδμξ ακηθήεδηακ απυ ημοξ
391
HydroMedit 2014, November 13-15, Volos, Greece
Καζπίνδξ (2000), Kottelat & Freyhof (2007), Λεβάηζξ & Μαναβημφ (2009), Μίκμξ (2011), Froese & Pauly
(2014) ηαζ Papaconstantinou (2014). Αημθμοεείηαζ δ ζοζηδιαηζηή ηαζ μκμιαημθμβία ηςκ εζδχκ ζφιθςκα ιε ημκ
Eschmayer (2014), ηδκ FishBase (Froese & Pauly, 2014), ημ Integrated Taxonomic Information System (ITIS
2014) ηαζ ημ WoRMS (2014).
3. Απνηειέζκαηα
ηδκ πανμφζα ρδθζαηή εθανιμβή πενζέπμκηαζ ζοβηεκηνςιέκα υθα ηα είδδ ζπεφςκ πμο ζοκακηάιε ζηζξ
εθθδκζηέξ εάθαζζεξ, πανέπμκηαζ πμθθέξ πθδνμθμνίεξ βζα ημ ηάεε έκα ηαζ δίκεηαζ δ δοκαηυηδηα ζημκ ηάεε
πνήζηδ κα αθθάγεζ (εζζάβεζ-δζαβνάθεζ-εκδιενχκεζ) ηζξ πθδνμθμνίεξ ημο ηαηαθυβμο. Πανάθθδθα, δ εθανιμβή
είκαζ ζδζαίηενα πνήζζιδ βζα άιεζδ πθδνμθυνδζδ, πςνίξ κα απαζηείηαζ ζφκδεζδ ζημ δζαδίηηομ βζα δζάθμνα
εέιαηα, ζοιπενζθαιαακμιέκμο ηςκ ημζκχκ μκμιάηςκ ηςκ ρανζχκ, ηδξ πανμοζίαξ ηςκ εζδχκ ζηα Δθθδκζηά
φδαηα. Αοηυ έπεζ ςξ απμηέθεζια μ πεζνζζηήξ ηδξ, κα ιπμνεί κα ακαγδηήζεζ μπμζμδήπμηε είδμξ επζεοιεί, εφημθα
ηαζ πςνίξ ηαεοζηένδζδ ηαζ κα θάαεζ υθεξ ηζξ απαναίηδηεξ πθδνμθμνίεξ ζπεηζηά ιε αοηυ.
Τπάνπμοκ δφμ ηνυπμζ ακαγήηδζδξ ζηδ αάζδ. Ο πνχημξ πναβιαημπμζείηαζ ζφιθςκα ιε ηδκ
ζοζηδιαηζηή ηαλζκυιδζδ ηςκ ρανζχκ (‗Search by Systematics‘) ηαζ ειθακίγμκηαζ ςξ απμηέθεζια ηα είδδ ηςκ
ρανζχκ πμο πενζθαιαάκμκηαζ ζε ιζα ζοζηδιαηζηή μιάδα πμο επζθέπεδηε (ακχηενδ υπςξ π.π. Οιμηαλία, Σάλδ ή
ηαηχηενδ υπςξ π.π. Οζημβέκεζα). Ο δεφηενμξ ηνυπμξ πναβιαημπμζείηαζ πθδηηνμθμβχκηαξ ημ επζζηδιμκζηυ
υκμια ημο ρανζμφ (‗Search by Scientific Name‘), ακαγδηχκηαξ άιεζα έκα ζοβηεηνζιέκμ είδμξ ρανζμφ ακάιεζα
ζε αοηά πμο απακηχκηαζ ζηα Δθθδκζηά οδάηζκα πενζαάθθμκηα (εάθαζζα ηαζ εζςηενζηά κενά) ηαζ
πενζθαιαάκμκηαζ ζηδκ ημπζηή αάζδ.
Ακαθοηζηυηενα, ζηδκ πενίπηςζδ πμο μ πνήζηδξ επζθέλεζ ηδκ ακαγήηδζδ ζφιθςκα ιε ηδ ζοζηδιαηζηή
ηαλζκυιδζδ ημο είδμοξ ‗Search by Systematics‘, ειθακίγμκηαζ ηα επίπεδα ηδξ ζοζηδιαηζηήξ ηαλζκυιδζδξ ηςκ
δζαθυνςκ εζδχκ ηςκ ζπεφςκ (Δζηυκα 1). Ξεηζκχκηαξ απυ ημ πζμ βεκζηυ ζοζηδιαηζηυ επίπεδμ ηαζ ηαηαθήβμκηαξ
ζημ πζμ εζδζηυ, έπμοιε ηα αηυθμοεα: SuperClass (Τπενηθάζδ), Group (Οιάδα), Class (Κθάζδ), SubClass
(Τπμηθάζδ), Division (-), SuperOrder (Τπένηαλδ), Order (Σάλδ), SubOrder (Τπυηαλδ), Family (Οζημβέκεζα),
Genus (Γέκμξ), Species (Δίδμξ). Ζ εθανιμβή είκαζ ζπεδζαζιέκδ έηζζ χζηε ακελάνηδηα απυ ημ επίπεδμ βκχζεςκ
ημο πνήζηδ πάκς ζημ ακηζηείιεκμ, μζ επζθμβέξ (Δζηυκα 1) κα ημκ αμδεμφκ κα ηαηαθήλεζ ζημ απμηέθεζια πμο
ακαγδηεί. Γζα πανάδεζβια, μ πνήζηδξ ηδξ εθανιμβήξ πμο δε βκςνίγεζ ηδ ζοζηδιαηζηή ηαλζκυιδζδ ημο ηάεε
είδμοξ, ιπμνεί κα ηαεμδδβδεεί απυ ηα εζδζηά ‗Labels‘ υπμο οπάνπμοκ δίπθα απυ ηάεε επζθμβή (Step 1, Step 2,
Step 3,…) ηαζ ημο δείπκεζ ηα αήιαηα υπμο πνέπεζ κα αημθμοεήζεζ λεηζκχκηαξ απυ εονφηενα επίπεδα
ζοζηδιαηζηήξ ηαηάηαλδξ (π.π. Superclass, Class) πνμξ ηα πζμ εζδζηά (π.π. Family).
392
HydroMedit 2014, November 13-15, Volos, Greece
Δίκαζ ζδιακηζηυ υηζ φζηενα απυ ηάεε επζθμβή ημο πνήζηδ, βζα πανάδεζβια ιζα ζοβηεηνζιέκδ
μζημβέκεζα (Step 9. Select Family), μζ δζαεέζζιεξ επζθμβέξ ημο ζημ επυιεκμ αήια (Step 10. Select Genus) έπμοκ
πνμζανιμζηεί ιυκμ ακάιεζα ζηα βέκδ ηαζ ηα είδδ ηςκ ζπεφςκ πμο ακήημοκ ζηδκ μζημβέκεζα ηδξ πνμδβμφιεκδξ
επζθμβήξ (Δζηυκα 1). Πανάθθδθα ιπμνεί ακά πάζα ζηζβιή κα εθέβλεζ πμζα είδδ πενζθαιαάκεζ ηάεε ζοζηδιαηζηή
μιάδα πμο επζθέβεζ. Γζα πανάδεζβια, εάκ επζθέλεζ (Step 9. Select Family) ηδκ μζημβέκεζα Mugilidae ιπμνεί ζηδ
ζοκέπεζα κα εθέβλεζ ηα βέκδ (Step 10. Select Genus) ηαζ ηα είδδ (Step 11. Select Species) πμο πενζθαιαάκεζ δ
ζοβηεηνζιέκδ μζημβέκεζα ζπεοχκ ηαζ απακηχκηαζ ζηα Δθθδκζηά φδαηα (Δζηυκα 1).
Αθμφ μθμηθδνςεεί δ δζαδζηαζία ηςκ επζθμβχκ, ειθακίγεηαζ ζημ ηάης ιένμξ ηδξ μευκδξ ιήκοια πμο
εκδιενχκεζ ημ πνήζηδ βζα ημκ αηνζαή ανζειυ ηςκ ρανζχκ πμο έπμοκ ακεονεεεί ζφιθςκα ιε ηα παναηηδνζζηζηά
πμο έπεζ επζθέλεζ (Δζηυκα 1). Γζα ηδκ ειθάκζζδ ημο απμηεθέζιαημξ (Δζηυκα 2), ιπμνεί πμθφ απθά κα παηήζεζ ημ
ημοιπί ‗Show‘ (Δζηυκα 1) εκχ ζηδκ πενίπηςζδ πμο επζεοιεί κα βίκεζ ηαεανζζιυξ ηςκ επζθμβχκ ημο ιπμνεί κα
παηήζεζ ημ ημοιπί ‗Clear Selections‘ (Δζηυκα 1) ηαζ κα λεηζκήζεζ λακά απυ ηδκ ανπή ηζξ επζεοιδηέξ ηζξ επζθμβέξ
ηδξ ζοζηδιαηζηήξ ηαηάηαλδξ (Δζηυκα 1). ζμκ αθμνά ημ απμηέθεζια ηδξ ακαγήηδζδξ (Δζηυκεξ 2 ηαζ 3), μ
πνήζηδξ ιπμνεί κα ηάκεζ επζθμβή μπμζμοδήπμηε ρανζμφ απυ αοηά πμο ειθακίγμκηαζ ςξ απμηέθεζια ηδξ
ακαγήηδζδξ ημο επζπέδμο ζοζηδιαηζηήξ ηαηάηαλδξ. ηδκ πανμφζα έηδμζδ δ εθανιμβή πενζθαιαάκεζ 643 είδδ
ρανζχκ ιε ηζξ ακηίζημζπεξ πθδνμθμνίεξ βζα ημ ηάεε έκα απυ αοηά.
393
HydroMedit 2014, November 13-15, Volos, Greece
ηδκ πενίπηςζδ πμο επζθεβεί δ ακαγήηδζδ ζφιθςκα ιε ημ επζζηδιμκζηυ υκμια ημο ρανζμφ,
ειθακίγεηαζ ζημ άκς ιένμξ ηδξ μευκδξ, έκα πεδίμ (Scientific name) βζα ηδκ εζζαβςβή ηεζιέκμο (Δζηυκα 2 ηαζ 3)
ζημ μπμίμ μ πνήζηδξ πθδηηνμθμβεί ημ επζζηδιμκζηυ υκμια ημο ρανζμφ ή έκα ιένμξ ημο μκυιαημξ ημο. Καηά ηδ
δζάνηεζα ηδξ εββναθήξ ηάεε βνάιιαημξ ημο επζζηδιμκζημφ μκυιαημξ απυ ημ πνήζηδ, πναβιαημπμζείηαζ
αοηυιαηδ ηάκεζ ακαγήηδζδ ζηδ αάζδ ηαζ ειθακίγμκηαζ απμηεθέζιαηα ζπεηζηά ιε ηδκ ακηίζημζπδ εββναθή. Ακ μ
πνήζηδξ βνάρεζ ιενζηχξ ημ υκμια ηαζ οπάνπμοκ πενζζζυηενεξ απυ ιία εββναθέξ, ηυηε μ πνήζηδξ εα έπεζ ηδκ
δοκαηυηδηα κα ηάκεζ επζθμβή μπμζαζδήπμηε απυ αοηέξ επζεοιεί.
Σμ απμηέθεζια ηςκ ακαγδηήζεςκ ζε υθεξ ηζξ πενζπηχζεζξ (Δζηυκα 3) πενζθαιαάκεζ πθδνμθμνίεξ υπςξ:
α) ημ επζζηδιμκζηυ, ημ εθθδκζηυ/ά ηαζ ημ αββθζηυ υκμια ημο είδμοξ ημο ρανζμφ, α) ιμνθμθμβζηή ηαζ μζημθμβζηή
πενζβναθή ημο είδμοξ, β) ηδ ζοζηδιαηζηή ημο ηαλζκυιδζδ ηαζ εζηυκεξ ηυζμ ηδξ ιμνθμθμβίαξ ημο είδμοξ υζμ ηαζ
ηδξ βεςβναθζηήξ ημο ελάπθςζδξ. Απυ ημ ιεκμφ ‗File,‘ ζηδκ επζθμβή ‗Print‘ ιπμνεί κα βίκεζ είηε εηηφπςζδ ημο
394
HydroMedit 2014, November 13-15, Volos, Greece
απμηεθέζιαημξ είηε δδιζμονβία ανπείμο ιμνθήξ pdf βζα ηδκ απμεήηεοζδ ημο απμηεθέζιαημξ ζημκ οπμθμβζζηή
(επζθέβμκηαξ ηδκ εθανιμβή PdfCreator πμο ζοκμδεφεζ ηδκ εθανιμβή ηαζ έπεζ εβηαηαζηαεεί ζημκ οπμθμβζζηή).
Με ηδκ επζθμβή ‗Back‘ μ πνήζηδξ ιπμνεί κα επζζηνέρεζ ζηδκ επζθμβή ηςκ πεδίςκ ηδξ ζοζηδιαηζηήξ
(Δζηυκεξ 1) ή ιε ηδκ επζθμβή ‗Exit‘ απυ ημ ιεκμφ ‗File‘ κα ηάκεζ έλμδμ απυ ηδκ εθανιμβή (Δζηυκεξ 1, 2 ηαζ 3)
είηε κα επζζηνέρεζ ζηδκ ανπή ή ζε ηάπμζμ απυ ηα εκδζάιεζα ζηάδζα παηχκηαξ ημ ιζηνυ αεθάηζ ημ μπμίμ
ανίζηεηαζ πάκς απυ ημ ‗Help‘ ηαζ κα επζθέλεζ υπμζα επζθμβή επζεοιεί (Δζηυκα 3).
4. πδήηεζε
Ο πθδεοζιυξ ηςκ ρανζχκ ζε ιζα πενζμπή οθίζηαηαζ ζοκεπείξ αθθαβέξ ηαεχξ ιε ηδκ πάνμδμ ημο πνυκμο
μνζζιέκα είδδ ελαθακίγμκηαζ (θυβς αθθαβήξ ημο πενζαάθθμκημξ ηαζ ακενςπμβεκείξ επζδνάζεζξ), εκχ ζοκήεςξ
ειθακίγμκηαζ κέα λεκζηά (ηνμπζηά) είδδ ιε απμηέθεζια ηδκ αθθαβή ηδξ ζφκεεζδξ ηςκ ζπεομπθδεοζιχκ.
Παναηδνείηαζ ςξ απμηέθεζια εκίζποζδ ηςκ ηνμθζηχκ ακηαβςκζζιχκ υπμο ηα κεμεζζενπυιεκα είδδ αζημφκ
ζδιακηζηή πίεζδ ζημοξ οπάνπμκηεξ πθδεοζιμφξ θυβς ηαζ ηδξ έθθεζρδξ εδνεοηχκ βζα ηα κεμεζζενπυιεκα είδδ.
ζμκ αθμνά ηδ ζφκεεζδ ηςκ εζδχκ ηςκ ρανζχκ ζηα Δθθδκζηά κενά, δ πνμζεήηδ κέςκ εζδχκ είκαζ ζοκεπήξ ηαζ
ιε αολδηζηή ηάζδ ηα ηεθεοηαία πνυκζα. διακηζηυ νυθμ ζε αοηυ ημ βεβμκυξ παίλεζ δ βεςβναθζηή εέζδ ηδξ
πχναξ ιαξ ηαεχξ βζα ημκ πνυζθαημ ειπθμοηζζιυ ηδξ Δθθδκζηήξ ζπεομπακίδαξ εοεφκεηαζ δ επζηοπία ηςκ
Λεζζερζακχκ ιεηακαζηχκ ζημκ απμζηζζιυ ηδξ Ακαημθζηήξ Μεζμβείμο ηαεχξ ηαζ δ αφλδζδ ηδξ εενιμηναζίαξ
ηςκ Δθθδκζηχκ Θαθαζζχκ ηαηά ηδ δζάνηεζα ηςκ ηεθεοηαίςκ εηχκ πμο μδήβδζε ζηδκ πνμξ ηα αυνεζα
ιεηακάζηεοζδ ηςκ πζμ εενιυθζθςκ εζδχκ (Papakonstantinou 2014). Σα ηεκά ημο Γζαναθηάν είκαζ επίζδξ
ζδιακηζηά βζα ηδκ ελάπθςζδ εζδχκ πμο πνμένπεηαζ απυ ημκ Αηθακηζηυ ζηζξ Δθθδκζηέξ εάθαζζεξ. Σέθμξ δ
ακάπηολδ ηδξ πμκημπυνμο καοζζπθμΐαξ ηαζ δ θεζημονβία δζαιεηαημιζζηζηχκ ηέκηνςκ ζηα ιεβάθα θζιάκζα ηδξ
Δθθάδαξ εκίζποζε ηδ ιεηαθμνά κέςκ εζδχκ ιε ημ εηθουιεκμ ένια απυ ηα πθμία.
Με ηδ ζοκεπή αθθαβή ζηδκ ζφκεεζδ ηςκ εζδχκ ηςκ ζπεφςκ ζε ιζα βεςβναθζηή πενζμπή, είκαζ
ζδιακηζηή δ δοκαηυηδηα ηδξ ζοκεπμφξ εκδιένςζδξ ηςκ ηαηαθυβςκ ηςκ ζπεφςκ. Με ηδκ πανμφζα εθανιμβή
πμο δδιζμονβήεδηε ζημ Αθελάκδνεζμ ΣΔΗ Θεζζαθμκίηδξ, ζοκεπίγεηαζ δ ακάπηολδ ημπζηχκ εθανιμβχκ (πςνίξ
κα απαζηείηαζ δ πνήζδ ημο δζαδζηηφμο) βζα ηδκ ζπεομθμβζηή ένεοκα ηαζ ηδκ δζάποζδ ηδξ πθδνμθμνίαξ βζα ηα
ράνζα. Πνυηεζηαζ βζα εθανιμβή πμο δίκεζ ζημ πνήζηδ ηδ δοκαηυηδηα παναιεηνμπμίδζδξ ηδξ ημπζηήξ αάζδξ
δεδμιέκςκ (πνμζεήηδξ, δζαβναθήξ, αθθαβή δεδμιέκςκ) επζθέβμκηαζ μ ίδζμξ ηζξ πδβέξ πμο εα ζοιαμοθεοηεί βζα
ηδκ δζαιυνθςζδ ηδξ αάζδξ ηδξ εθανιμβήξ. ηδκ πανμφζα εθανιμβή δ αάζδ πενζθαιαάκεζ έκακ ηαηάθμβμ ιε ηα
ράνζα ηδξ Δθθάδαξ, ιε ηδ ζοζηδιαηζηή ημοξ ηαζ υθεξ ηζξ δζαεέζζιεξ πθδνμθμνίεξ βζα ημ ηάεε είδμξ υπμο μ
πνήζηδξ ιπμνεί κα εηηοπχζεζ ημ απμηέθεζια ή κα ημ απμεδηεφζεζ ημπζηά. Ζ εθανιμβή δζαηίεεηαζ δςνεάκ ηαζ
είκαζ εφημθδ ζημ πεζνζζιυ απυ ηάεε πνήζηδ, απυ ημκ ελεζδζηεοιέκμ επζζηήιμκα (ζπεομθυβμ, αζμθυβμ), ημκ
θμζηδηή ηαζ ημκ θοζζμδίθδ ιέπνζ ημκ δφηδ, ημκ ζπεοέιπμνμ, ημκ επαββεθιαηία ή εναζζηέπκδ αθζέα ηαζ ημκ απθυ
θάηνδ ηςκ ρανζχκ.
ε ηάεε ηαζκμφνβζα έηδμζδ ηδξ εθανιμβήξ πμο εα δζαηίεεηαζ, εα εκδιενχκεηαζ μ ηαηάθμβμξ ηςκ
ρανζχκ (πζεακέξ αθθαβέξ ζηδκ επζζηδιμκζηή μκμιαζία ή ηδκ ζοζηδιαηζηή ηςκ ρανζχκ, ειθάκζζδ κέςκ εζδχκ)
αημθμοεχκηαξ ηζξ κευηενεξ επζζηδιμκζηέξ ελεθίλεζξ. Πανάθθδθα, ζε ιεθθμκηζηέξ ακαααειίζεζξ ηδξ εθανιμβήξ
εα βίκεζ ειπθμοηζζιυξ ηςκ πθδνμθμνζχκ ηδξ αάζδξ είηε εζδζηά βζα ημ ηάεε είδμξ ρανζμφ (π.π. ειθάκζζδ
ζοκςκφιςκ, ηνμθζηά επίπεδα, εάκ πενζθαιαάκεηαζ ζημ Κυηηζκμ Βζαθίμ ηςκ Απεζθμφιεκςκ Εχςκ ηδξ Δθθάδαξ)
είηε βεκζηά βζα ηδκ ηάεε ζοζηδιαηζηή μιάδα (π.π. Τπενηθάζδ, Κθάζδ, Σάλδ).
Δπραξηζηίεο
H πανμφζα ένεοκα ζοβπνδιαημδμηήεδηε απυ ηδκ Δονςπασηή Έκςζδ (Δονςπασηυ Κμζκςκζηυ Σαιείμ - ΔΚΣ)
ηαζ απυ εεκζημφξ πυνμοξ ιέζς ημο Δπζπεζνδζζαημφ Πνμβνάιιαημξ «Δηπαίδεοζδ ηαζ Γζα Βίμο Μάεδζδ» ημο
Δεκζημφ ηναηδβζημφ Πθαζζίμο Ακαθμνάξ (ΔΠΑ)–Δνεοκδηζηυ Υνδιαημδμημφιεκμ Ένβμ: ΑΡΥΗΜΖΓΖ ΗΗΗ.
Δπέκδοζδ ζηδκ ημζκςκία ηδξ βκχζδξ ιέζς ημο Δονςπασημφ Κμζκςκζημφ Σαιείμο.
395
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
Eschmeyer, W.N. (2014). Catalog of fishes: genera, species, references. Electronic version.
http://research.calacademy.org/research/ichthyology/catalog/fishcatmain.asp. (Πνυζααζδ: 3-9-2014).
Froese R., Pauly D. (2014). FishBase. World Wide Web electronic publication. www.fishbase.org. (Πνυζααζδ:
29-8-2014).
ITIS (2014). Integrated Taxonomic Information System on-line database. http://www.itis.gov. (Πνυζααζδ: 2-9-
2014).
IUCN (2014). The IUCN Red List of Threatened Species. Version 2014.2. http://www.iucnredlist.org.
(Πνυζααζδ: 5-9-2014).
Καζπίνδξ Π. (2000) Σα ράνζα ηδξ Δθθάδαξ (Κθείδεξ πνμζδζμνζζιμφ). ΣΤΠΟffset Κ. Μακμφδδ-ηακίδδ. Πάηνα
Kostoglou V., Minos G., Tolis E. (2013). Development of an innovative information system: A fish
identification e-key with update capabilities. Information Systems and e-Business Management 11(2),
253-264.
Kottelat M., Freyhof J. (2007). Handbook of European Freshwater Fishes. Kottelat, Cornol and Freyhof, Berlin,
pp. xiv + 646.
Λεβάηζξ Α., Μαναβημφ, Π. (2009). Σμ Κυηηζκμ Βζαθίμ ηςκ Απεζθμφιεκςκ Εχςκ ηδξ Δθθάδαξ. Δθθδκζηή
Εςμθμβζηή Δηαζνεία, Αεήκα, 528 ζεθ.
Marine Species Identification Portal (2014). Electronic version. http://species-identification.org/. (Πνυζααζδ: 2-
9-2014).
Minos G., Kostoglou V., Tolis E. (2013). An innovative decision making e-key application for the identification
of fish species. In: 'Optimization Theory, Decision Making, and Operational Research Applications‘,
Migdalas A., Sifaleras A., Georgiadis C.K., Papathanasiou J., Stiakakis E. (eds.). Springer Proceedings in
Mathematics & Statistics 31, p. 319-329.
Μίκμξ Γ. (2011). διεζχζεζξ Μαεήιαημξ ‗Βζμθμβία & οζηδιαηζηή Ηπεφςκ. Σεφπμξ Γεφηενμ‘. Αθελάκδνεζμ
Σ.Δ.Η. Θεζζαθμκίηδξ, Πανάνηδια Ν. Μμοδακζχκ, Σιήια Σεπκμθμβίαξ Αθζείαξ & Τδαημηαθθζενβεζχκ.
209 ζεθ.
Μίκμξ Γ., Γήιμο Η., Κχζημβθμο Β. (2013). Ακάπηολδ εθανιμβήξ βζα ηδκ ακαγήηδζδ ηδξ ζοζηδιαηζηήξ
ηαλζκυιδζδξ ηςκ ζπεφςκ ιε πνήζδ βναιιςημφ ηχδζηα. Πναηηζηά Πακεθθδκίμο οκεδνίμο Ηπεομθυβςκ
15, pp. 157-160.
Papaconstantinou C. (2014). Fauna Graeciae. An updated checklist of the fishes in the Hellenic Seas,
Monographs on Marine Sciences, 7, Athens 2014, HCMR, pp. 340.
Psomadakis P.N., Giustino S., Vacchi M. (2012). Mediterranean fish biodiversity: an updated inventory with
focus on the Ligurian and Tyrrhenian seas. Zootaxa, 3263, 1-46.
WoRMS Editorial Board (2014). World Register of Marine Species. Available from
http://www.marinespecies.org at VLIZ. Accessed 2 September 2014.
396
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
FISHERIES
TECHNOLOGY
397
HydroMedit 2014, November 13-15, Volos, Greece
1
Laboratory of Ichthyology and Marine Fishery, Institute of Marine Biology, University of Montenegro, P.O.
Box 69, 85 330 Kotor, Montenegro
ABSTRACT
The bogue, Boops boops (Linnaeus, 1758) is one of the commercially important species of the small-scale
fishery in Montenegrin waters. A total of 283 specimens of bogue were collected by gill net and trammel net
fishing between May 2013 and April 2014 in Boka Kotorska Bay (south Adriatic Sea). Total length ranged from
12.2 to 30.3 cm, while weight varied between 15.97 and 117.83 g. Female:male ratio was 2.6. A negative
allometric growth was recorded for the all sampled specimen as well as for the both sexes. The highest
gonadosomatic index value was in winter when Fulton's condition factor showed minimum value.
Key words: Boops boops, small-scale fishery, Boka Kotorska Bay, South Adriatic Sea
1. Introduction
One of the semi-pelagic species caught in Montenegrin territorial waters by vessels under 12 metres is
bogue, Boops boops. During the sampling months, it was noted that bogue was mainly caught by gill and
trammel nets. Gillnets are the most common type of fishing gear used in small–scale fisheries, followed closely
by trammel nets. Out of the 70 vessels registered, 71% operate in Boka Kotorska Bay (ports of Herceg Novi,
Zelenika, Kotor and Tivat), the area where small–scale fisheries, particularly those involving beach seines, have
been present for centuries, and are part of the cultural identity of the people from the region. Around 61%, are
vessels with length overall below 6 m, and the rest (39%) are in the 6–12 m segment (Ikica et al., 2013).
Previous studies showed that significant quantities of bogue were caught by trawlers (Kasalica et al.,
2011) and the few existing references concerning the species are from trawl fishery.
The objective of this study was to gather some information of the length-weight relationship, length
frequency distribution, sex ratio, spawning period and condition of bogue caught by the small-scale fishery in
Boka Kotorska Bay.
A total of 283 B. boops specimens (179 females; 68 males; 36 undetermined) were collected from
monthly commercial catches using gill nets and trammel nets in the Boka Kotorska Bay, southern Adriatic Sea
from May 2013 to April 2014. Sampling was conducted in the framework of the MORM-MONT national project
(Monitoring of small-scale coastal fisheries and composition of fish fry with the aim of conservation and
398
HydroMedit 2014, November 13-15, Volos, Greece
management of marine fishery resources). Collected fish were preserved with ice in a cooler box and
immediately transported to the laboratory. Fish total length and body weight were measured to the nearest 0.1 cm
and nearest 0.01 g, respectively. The general power equation (W = a*Lb) was applied to estimate the length-
weight relationship, where a and b are constants whose values were estimated by the least square method. The
significant difference of b values from 3, which represent isometric growth, was tested with the Student's t-test.
Fulton‘s condition factor (K=100W/TL3) (Fulton, 1904) was calculated for each specimen and for each season
(autumn, winter, spring and summer). Sex was assigned macroscopically. Gonads of all specimens were
dissected and weighed to the nearest 0.01 g to calculate the GSI (GSI = weight of gonads/weight of fish x 100).
This index was calculated for each of the analyzed specimen and, finally, a mean seasonal index was estimated.
Correlation between GSI and Fulton's condition factor was examined using the Pearson's r coefficient. The sex
ratio (female:male) was calculated and significant differences from the expected ratio (1:1) were tested by means
of π2 test. Maturity stages were recorded according to the MEDITS protocol: specimens were considered adult
when classified as: 2b (recovering), 2c (maturing), 3 (mature/spawner), 4a (spent) and 4b (resting), while
immature/juvenile ones were classified as 1 (immature virgin) and 2a (virgin developing) (ICES, 2008).
Of the 283 collected specimens, 24% were males, 63.25% were females and 12.75% undetermined.
Length frequency data for all collected specimen is presented in Figure 1. Total length of the sampled fish
ranged from 12.2 to 30.3 cm TL with the mean length of 17.35 cm TL. The body weight ranged between 15.97 g
and 117.83 g. The mean observed length of the commercial catch of B. boops (17.35cm) was higher than that the
value obtained in 2007-2008 (13.95 cm: Marković et al., 2014) and almost the same with the value obtained in
2009-2010 (17.10 cm; Kasalica et al, 2011). The lower value of the mean length in 2007/2008 could be
explained by disappearance of larger fish from the catch and different fishing area because that catch was caught
in the Montenegrin territorial waters and on continental shelf and significant quantities were caught by trawlers.
The LFD of the whole sample (pooled data) shows that the majority of catches consisted of individuals ranging
in length from 16.0 to 20.0 cm TL. The total length of females and males ranged from 12.2 to 30.3 cm (17.48 cm
± 2.91), and from 12.6 to 21.2 cm (17.61 ± 1.43), respectively. Females were more frequent at bigger size classes
than males which is similar to what Mozara (2013) reports for the bogue in the southeastern Adriatic Sea. Gordo
(1992) observed that the relative percentages of females increase with length class and he concluded that the
bogue might be considered a rudimentary hermaphrodite species in which the majority of males develop from
bisexual gonads in the juvenile stage (primary males) while a small proportion goes through sexual inversion
(secondary males). Massaro (2012) reported the opposite situation, the predominance of females at the smaller
sizes and the high number of males at larger sizes. So, we can conclude that variations of the sex ratio at
different sizes are related to unequal rates of growth and mortality.
The overall sex ratio during the study period was in favor of females (F/M=2.6). This ratio was
significantly different from the expected value of 1:1 (ρ2=49.88, P < 0.01). High ratio of females in the catch
may be caused by several factors related to the physiology and the ethology of the species, such as the age, a
tendency for slower growth or a higher mortality rates in males (Desbrosses, 1933) as well as different
catchability between two sexes.
399
HydroMedit 2014, November 13-15, Volos, Greece
25
20
Females
Males
15
Number
Undetermined
10
0
13 . 5
14 . 5
15 . 5
16 . 5
17 . 5
18 . 5
19 . 5
20 . 5
21 . 5
22 . 5
23 . 5
24 . 5
25 . 5
26 . 5
27 . 5
28 . 5
29 . 5
30 . 5
5
0.
2
4
5
6
7
8
9
1
2
3
4
5
6
7
8
9
-1
-1
-1
-1
-1
-1
-1
-1
-2
-2
-2
-2
-2
-2
-2
-2
-2
-2
-3
12
Figure 1. Length frequency distribution for Boops boops females, males and undetermined from the Boka
Kotorska Bay, South Adriatic Sea
The length-weight relationships of bogue was W=0.0338*L2.5247 for females, W=0.0114*L2.9005 for
males and W=0.0218*L2.6864 for the total sampled population (Figure 2). The b values were within the limits of
2.5-3.5 reported by Froese (2006) and showed significant differences from 3. All relationships were statistically
highly significant (r2 > 0.85, P < 0.001). The length-weight relationship of B. boops shows a negative allometric
growth which is not in agreement with various studies which indicated positive allometric growth or isometric
growth (Petrakis & Stergiou, 1995; Özaydin & Taskavak, 2005, Massaro, 2012). Similar growth pattern was
observed in Croatian waters (central and southeastern Adriatic) (Dulĉić & Glamuzina, 2006; Mozara, 2013) and
in Egyptian Mediterranean waters off Alexandria (El-Okda, 2008). This variation in the b exponents for the same
species could be attributed to differences in sampling, sample size or length ranges (Šantić et al., 2005).
400
HydroMedit 2014, November 13-15, Volos, Greece
250
200 Males
y = 0.0114x2.9005 Females
y = 0.0338x2.5247
Weight (g)
2
150 R = 0.9148
R2 = 0.9146
100
50 Females
M ales
0
10 15 20 25 30 35
Total length (cm)
Figure 2. Relationship between total length (TL) and body weight (W) in Boops boops (sexes separated)
The gonadosomatic index was used to determine the reproductive period and according to Tsikliras et
al., (2013) it remains the best predictor of spawning period (i.e., onset and duration of spawning). The GSI
reached maximum values in winter period and minimum in summer and autumn (Figure 3). Previous study on
reproductive biology of bogue also observed that spawning activity occurred in winter season in Montenegrin
waters (max GSI values for both sexes were recorded in February). (Kasalica et al., 2011). Both indices followed
the same pattern. This time period is in line with reports in the literature on the maturity cycle of bogue in
eastern Mediterranean (Vidalis, 1950; Hassan, 1990; Mozara, 2013) and eastern Atlantic (Gordo, 1995; Massaro,
2012). Alegria-Hernández (1990) found that the almost the entire population of bogue is spent in June from the
mid-Adriatic Dalmatian channels which is in agreement with our findings of post-spawning specimen in the
early summer. The greatest number of specimen in stage 2c and stage 3 was in winter period as Massaro (2012)
found in central-east Atlantic.
5
4.5
4
3.5
3
GSI
2.5
2 Females
1.5 M ales
1
0.5
0
SPRING SUMMER AUTUMN WINTER
Season
401
HydroMedit 2014, November 13-15, Volos, Greece
Fulton's condition factor ranged from 0.8481 to 0.9094. Monthly changes of Fulton's condition factor
showed a seasonal cycle with a peak in spring and minimum value in winter when the spawning begin. This
factor and gonadosomatic index showed almost the same pattern, except in winter where they showed high
negative correlation (r = - 0.436) (Figure 4). Mozara (2013) also found this negative correlation for bogue in
southeastern Adriatic. Fulton's condition factor varied between season, with the highest value in spring probably
caused by an inflow of nutrition and food as the sea temperatures increased. This high factor value could
probably be attributed to ndividual recruits in spring using energy from food for both gonad development and
muscle development. The condition factor normally decreases at the start of the spawning period due to very
high metabolic rates.
4.5 0.92
GSI 0.91
4
2 0.86
1.5 0.85
0.84
1
0.83
0.5 0.82
0 0.81
SPRING SUMMER AUTUMN WINTER
Season
Figure 4. Fulton's condition factor and gonadosomatic index in bogue samples of the Boka Kotorska Bay (south
Adriatic Sea), during May 2013-April 2014
In conclusion, this study provides the some useful information which are important data for the fisheries
management.
References
Alegria-Hernández, V. (1990). Some aspects of reproductive biology of bogue (Boops boops L., Pisces Sparidae)
from the Mid-Adriatic channels. Acta Adriatica., 31 (1/2): 301-313.
Desbrosses, P. (1933). Contribution a la biologie du rouget-barbet en Antlantique Nord (Contribution to the
biology of red mullet in the North Atlantic). Revue des Travaux de l'Office des Peches Maritimes, 6 (3):
249-270.
Dulĉić, J., Glamuzina, B. (2006). Length–weight relationships for selected fish species from three eastern
Adriatic estuarine systems (Croatia). Journal of Applied Ichthyology, 22 (4), 254–256.
El-Okda, N. I. (2008). Age and growth of Boops boops (L.) from Egyptian Mediterranean waters off Alexandria.
Egyptian Journal of Aquatic Biology & Fisheries. Vol 12, No 1:13-23.
Froese, R. (2006). Cube law, condition factor and weight-length relationships: History, meta-analysis and
recommendations. Journal of Applied Ichthyology, 22, 241-253.
402
HydroMedit 2014, November 13-15, Volos, Greece
Fulton, T. W. (1904). The rate of growth of fishes. Twenty-second Annual Report, Part III. Fisheries Board of
Scotland, Edinburgh, pp. 141–241.
Gordo, L. S. (1992). Contribuição para o conhecimento da biologia e do estado de exploração do stock de boga
(Boops boops Linné. 1758) da costa portuguesa. Faculdade de Ciências, Tese de Doutoramento, Lisboa,
pp. 361.
Gordo, L. S. (1995). On the sexual maturity of the bogue (Boops boops) (Teleostei, Sparidae) from the
Portuguese coast. Scientia Marina, 59 (3-4): 279-286.
Hassan, M. W. A. (1990). Comparative biological studies between two species of family Sparidae, Boops boops
and Boops salpa in Egyptian Mediterranean waters. M.Sc. Thesis, Faculty of Science, Alexandria
University, pp. 198.
ICES (2008). Report of Workshop on Maturity Ogive Estimation for Stock Assessment (WKMOG). 3 June
2008, Lisbon, Portugal, pp. 68.
Ikica Z., Djurović M., Joksimović A., Mandić M., Marković O., Pešić A. (2012). Small-scale fisheries in
Montenegro. In: AdriaMed. 2013. Report of the AdriaMed Technical meeting on Adriatic Sea Small-
scale Fisheries (Split, Croatia, 13th-14th November 2012). AdriaMed Technical Documents, 33: 59-68.
Kasalica, O., Regner, S., Djurović, M. (2011). Some aspects of the biology of the bogue, Boops boops
(Linnaeus, 1758) in Montenegrin waters (south Adriatic Sea). Studia Marina, 25 (1): 59-72.
Livadas, R. J. (1989). The growth and maturity of bogue (Boops boops L.), family Sparidae, in waters of Cyprus.
F.A.O. Fisheries Report (412): 52-71.
Marković, O., Ikica, Z., Pešić, A., Joksimović, A., Djurović, M., Mandić, M. (2014). Length-weight relationship
and condition factors of the bogue, Boops boops (Linnaeus, 1758) in the south Adriatic Sea
(Montenegro). Natura Montenegrina 12 (3), in press.
Massaro, A. (2012). Reproductive biology of bogue Boops boops (Linnaeus, 1758) off Gran Canaria (Canary
Islands): a preliminary study. Phd in Sustainable Management of Fisheries Resources. Faculty of
Marine Science, Universidad de Las Palmas de Gran Canaria, pp. 33.
Mozara, R. (2013). Histological aspect of the reproductive cycle of bogue, Boops boops, (Linnaeus, 1758).
Master in Mariculture. Department of Aquaculture, University of Dubrovnik, pp. 35.
Özaydin, O, Taskavak, E. (2006) Length-weight relationship for 47 fish species from Izmir Bay (eastern Aegean
Sea, Turkey). Acta Adriatica 47 (2): 211-216.
Petrakis, G., Stergiou, K. I. (1995). Weight-length relationships for 33 fish species in Greek waters. Fisheries
Research, 21: 465-469.
Šantić, M., Pallaoro, A., Jardas, I. (2006). Co-variation of gonadosomatic index and parameters of length-weight
relationships of Mediterranean horse mackerel, Trachurus mediterraneus (Steindachner, 1868), in the
eastern Adriatic Sea. Journal of Applied Ichthyology, 22 (3): 214-217.
Tsikliras, A. C., Stergiou, K. I., Froese, R. (2013). Editorial note on reproductive biology of fishes. Acta
Ichthyologica et Piscatoria., 43 (1): 1-5.
Vidalis, E. (1950). Contribution to the study of the biology of the bogue (Boops boops Lin.) in Greek waters.
Prak. Hell. Hidrobiol. Inst., 4 (1): 51-71.
403
HydroMedit 2014, November 13-15, Volos, Greece
Department of Basic Sciences, Faculty of Fisheries, Cukurova University, Balcalı, Sarıçam, 01330, Adana,
Turkey
Abstract
The aim of this study was to compare Bayesian and Classical estimation for describing the growth curves of red
mullet (Mullus barbatus barbatus Linnaeus, 1758). Classical nonlinear regression method and Bayesian
estimation method were used to obtain the estimation of the components of the von Bertalanffy growth model.
The estimated parameters showed that Bayesian estimation is better than Classical nonlinear regression in
estimating growth parameters and reducing variation of growth model parameters.
Key words: Mullus barbatus barbatus, Bayes theory, Growth, von Bertalanffy
*Corresponding author: Sedat Gündoğdu ( sgundogdu@cu.edu.tr)
1. Introduction
Generally, the von Bertalanffy growth equation (VBGE) is fit to length-age data using classical
nonlinear methods such as nonlinear regression. Classical nonlinear regression assumes that there are enough
measurements to say something meaningful. This assumption somehow affects the assumptions of the VBGE. In
the Bayesian approach, the data are supplemented with additional information in the form of a prior probability
distribution. The prior information comes from past experience or prior belief about parameters. The prior belief
is combined with the data's likelihood function according to Bayes theorem to compute the posterior (Congdon
2003; Siegfried & Sanso 2006; Link & Barker 2010; Box & Tiao 2011; Akar & Gundogdu 2014). For this
reason Bayesian inference provide a quantitative concept and obvious language in so as to analyze and express
growth procedures. Logically, Bayesian inference is the clearest way of analyzing and interpreting growth
models in light of data.
In this study we used Bayesian approach and classical approach to estimate VBGE parameters.
Estimates of the von Bertalanffy growth parameters are compared with estimates of the classical method. By this
way, we tried to explain biological plausibility of parameters estimated by both methods.
404
HydroMedit 2014, November 13-15, Volos, Greece
where and K are the VBGE parameters, and the are assumed to be normally distributed error.
The growth parameters and K were estimated using the Classical Least Squares Method as
recommended by Sparre & Venema (1998). This produced least-squares estimates of the three von Bertalanffy
growth parameters.
Bayesian approach fits the VBGE to the length at age data using Markov Chain Monte Carlo (MCMC)
methods (Hastings 1970; Gelman et al. 2004). These methods has four steps; i) finding likelihood of the data, ii)
defining priors for all parameters, iii) defining conditional probabilities for all parameters, and iv) using the
Bayesian method to estimate the posterior distribution for parameters (Gelman et al. 2004; Siegfried & Sanso
2006). Thus, our likelihood is as following:
We used informative priors for and K based on published estimates of the same parameters in the
FishBase (Froese & Pauly 2012):
We used uninformative priors for , giving the full power of estimation to the data:
OpenBUGS (Spiegelhalter et al. 2007; http://www.openbugs.net) was used to fit the model. The
estimates of parameters were evaluated based on 1000000 samples, from Markov chain Monte Carlo (MCMC)
simulation of the joint posterior distribution. We used a burn-in period of 10000 chains and generated posteriors
for the parameters of the VBGE with the remaining chains.
3. Results
A total of 422 individuals were sampled, ranging in size from 6.2 to 27.5 cm FL. Overall mean FL was
calculated as 11.08 cm. Length-frequency distribution, minimum, maximum length, standard error, sample size,
mean length and its confidence interval values of red mullet for each age class are listed in Table 1. As it can be
seen, the age of Red Mullet ranged from I to VI age classes and the most dominant age class was 2 with a value
of 43.8% and age class 3 ranks second with a value of 27.9%.
Table 1. Length-frequency distribution, minimum, maximum, standard error (SE), 95% confidence
interval and mean fork length values for each age class for Red Mullet
405
HydroMedit 2014, November 13-15, Volos, Greece
Classical 8.48 10.95 12.97 14.63 15.99 17.11 0.20 22.2 - -1.42
The estimates of of Bayesian approach were much closer to the observed maximum length than
those of the Classical approach. The coefficient of K estimated by both approaches was between 0 and 1.
However, the K value of Bayesian approach was higher than K values estimated by the Classical approach and
Bayesian value was much closer to zero than Classical value. Correlation between parameters was found as
, and using Bayesian approach. Note that
they decrease as increases.
Figure 2. Bayesian and Classical von Bertalanffy length-at-age growth curves and observed lengths at age
for the red mullet.
A ―burn in‖ sample of 10000 was initially rejected and the remaining 1000000 iterations from the chain
sequence thinned at a rate of 1 sample in 10 (for removing autocorrelation of MCMC). Autocorrelation of the
chain diminished after a lag of about 5.
Discussion
Since the growth function may vary, the shape of the growth curve may vary between various fish
populations or species. Therefore, it is essential to assess the goodness of fit in any comparison among
approaches. According to many authors (Pauly 1979; Chen et al. 1992; Sparre & Venema 1998), should be
reasonably close to the maximum fish length in observed data, should be smaller or equal to zero and, and
might vary between 0 and 1. The results of Bayesian approach showed that value was closer to maximum
observed length (27.5 cm) compared to value of the Classical approach and was almost equal to zero
(Table 2, Figure 2). The comparison of the Bayesian estimates in this study with growth estimates of the red
mullet poulations along the Turkish coast (Table 3) indicate the production of more plausible estimations by the
Bayesian approach.
The estimated parameters of VBGE should be related to the biological characteristics of the inspected species
(Pauly 1978, Sparre & Venema 1998). As a demersal fish species, the red mullet is expected to have a low K
value similarly to what has been reported by various studies along the Turkish coast (mean K value: 0.3, Table
3). The estimated value by the Bayesian approach in this study was closer to 0 value comparing to values
reported (Table 3), since the prior knowledge taken into account by the Bayesian approach minimizes
406
HydroMedit 2014, November 13-15, Volos, Greece
differences between real values and estimations (Box & Tiao 2011; Lee 2004). Otherwise, the value should
equals zero, since fish larvae at hatching (when fish growth begins) they already have their length (Sparre &
Venema 1998),
Concluding, the non-linear analysis using Bayesian inference can effectivley used to assses growth of
the red mullet, M. barbatus. Main conclusion from this study of Red Mullet growth is that suitable statistical
methods can be used to assess growth parameters. Our use of nonlinear analysis using Bayesian inference for
fish growth has the advantage of biological plausibility.
Acknowledgement
This study is supported by Cukurova University Scientific Research Found Project No:SUF2012D4.
References
Akar M., Gundogdu S. (2014). The usage of Bayes Theory in fisheries sciences. Journal of
FisheriesSciences.com 8(1), 8-16.
Beverton R.J.H. (1992). Patterns of reproductive strategy parameters in some marine teleost fishes. Journal of
Fish Biology 41, 137–160.
Beverton R.J.H., Holt S.J. (1957). A.review of methods for estimating mortality rates in exploited fish
populations, with special reference to sources of bias in catch sampling. Rapp. P.-v. Reun. CIEM, 140(1),
67-85.
Box G.E., Tiao G.C. (2011). Bayesian inference in statistical analysis (Vol. 40). John Wiley & Sons. Toronto.
pp.588.
Chen Y., Jackson D.A., Harvey H.H. (1992). A comparison of von Bertalanffy and polynomial functions in
modelling fish growth data. Canadian Journal of Fisheries and Aquatic Science 49, 1228-1235.
Congdon P. (2003). Applied bayesian modelling. Wiley Series in Probabilty and Statistics, Jon Wiley and Sons.
London. pp. 478.
Froese R., Pauly D. (2012). FishBase. World Wide Web electronic publication, version 12/2012: Available at:
http://www.fishbase.org .
Gelman A., Carlin J.B., Stern H.S., Rubin D.B. (2004). Bayesian data analysis. Chapman and Hall. Boca Raton.
pp. 689.
Hastings W. (1970). Monte Carlo sampling methods using Markov chains and their applications. Biometrika 57,
97-109.
Helser T.E., Lai H.L. (2004). A Bayesian hierarchical meta-analysis of fish growth: with an example for North
American largemouth bass (Micropterus salmoides) Ecological Modelling 178(3), 399-416.
Helser T.E., Stewart I.J., Lai H.L. (2007). A Bayesian hierarchical meta-analysis of growth for the genus
Sebastes in the eastern Pacific Ocean. Canadian Journal of Fisheries and Aquatic Science 64(3), 470-485.
Kinacigil H.T., İlkyaz A.T., Akyol O., Metin G., Çira E., Ayaz A. (2001). Growth parameters of red mullet
(Mullus barbatus L., 1758) and seasonal cod-end selectivity of traditional bottom trawl nets in izmir Bay
(Aegean Sea). Acta Adriatica 42 (1), 113-123.
Lee P.M. (2004). Bayesian Statistics an Introduction. Arnold Publication. London. pp. 351.
Link W.A., Barker R.J. (2010). Bayesian inference with ecological applications. Elsevier Academical
Publication. California. pp. 339.
Özbilgin H., Tosunoglu Z., Bilecenoğlu M., Tokaç A. (2004). Population parameters of Mullus barbatus in Izmir
bay (Aegean sea), using length frequency analysis. Journal of Applied Ichthyology 20, 231-233.
Özvarol Z.A.B., Balcı B.A., Özbaş M., Gökoğlu M., Gülyavuz H., Taşlı A., Pehlivan M., Kaya Y. (2006). An
investigation on the growth properties of red mullet (Mullus barbatus L., 1758) in Antalya Bay. E.U.
Journal of Fisheries & Aquatic Sciences 23, 113-118.
Ricker W.E. (1975). Computation an interpretation of biological statistics of fish population. Journal of Fisheries
Research Board of Cananada 191, 382.
Pauly D. (1979). A preliminary computation of fish length growth parameters. Berichte des Institut für
Meereskunde an der Universitat Kiel. No. 55, 200.
Siegfried K.I., Sansó B. (2006). Two Bayesian methods for estimating parameters of the von Bertalanffy growth
equation. Environmental Biology of Fishes 77, 301-308.
Sparre P., Venema S.C. (1998). Introduction to tropical fish stock assessment. Part 1. Manual. FAO. Rome.
Spiegelhalter D., Thomas A., Best N., Lunn D. (2007). OpenBUGS user manual, version 3.0. 2. MRC
Biostatistics Unit. Cambridge.
407
HydroMedit 2014, November 13-15, Volos, Greece
1 Department of Marine Biology and Fisheries Sciences, Tonekabon Branch, Islamic Azad University,
Tonekabon, Iran.
Abstract
Feeding activity and diet composition of Liza aurata in mazandaran costline, south Caspian Sea was studied
between November 2013 and March 2014. The maximum and minimum total length and weight of fish in
autumn were 52.5 cm and 40 cm; 990 and 384 g respectively. The maximum and minimum total length and
weight of fish in spring were 61 cm and 42.2 cm; 1844 g and 472 g respectively. Feeding intensity increased as
the fish got bigger and was higher in the autumn season (VI =20±23.09) than in spring season (VI = 5±10.00).
Eight major items constituted the diet of L. aurata. These included Crustacean (Gammarus), Bivalvia (Mytilus
and Cardium),Gastropoda (Hydrobia), Polychaeta (Nereis), shironomidea larva, Ulvales (Entermorpha),
Ctenophora (Mnemiopsis leidyi) as dietaries.
Keywords: Diet composition, Feeding intensity, Liza aurata, Caspian Sea.
*Corresponding author: Mehrnoush Norouzi (mnoroozi@toniau.ac.ir)
Introduction
Golden grey mullet Liza aurata (Risso, 1810) is a typical marine schooling fish. It was introduced into the
Caspian from the Black Sea (targeted acclimatization) and spread widely within the Caspian Sea, except for the
estuarine sea areas. Golden grey mullet is found in the southern part of the sea throughout the year; in the Middle
Caspian it appears in spring and migrates back to the south in autumn. During migration, it feeds intensively,
preferring shallow coastal areas (Velikova et al., 2012).
The Golden gray mullet, as the Mugilidae in general, is a euryhaline species. This characteristic allows to this
species to migrate annually from the sea to lagoons, estuaries or lakes (Lafaille et al., 2000; Gautier & Hussenot,
2005; Cardona, 2006). And sensitive to a decrease in water temperature. Age of maturity 3-4 years old. It feeds
on detritus, silt, and occasional mollusks. The species winters in the southern part of the Caspian. The fish is
concentrated mostly in the sectors with rich marine vegetation and in areas with muddy bottoms. There are many
factors that potentially influence both the amount and type of food found in the digestive tracts of fish, including
the diel cycle, seasonal change, size of fish, food availability, and differential digestion rates (Bowen and
Allanson, 1982). That juvenile mullet are initially carnivorous and planktonic feeders and the adults detritovores
has also been noted by Odum (1970). It has been suggested that ingested sand acts as a grinding paste for the
degradation of plant cell walls in the pyloric portion of the stomach (Thomson, 1966). The suitable environment
has enabled the population to increase in number rapidly, Nowadays they provide one of the principal fishing
resources, especially in the southern part of the Caspian Sea. The aim of present study was to determine any
difference diet of grey mullet in the middle of the South Caspian Sea and to observe difference diet of L. aurata
in this region.
408
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1. Map showing sampling locations of Golden grey mullet: 1-Tonekabon, 2-Nowshahr, 3- Fereydunkenar
and 4-Behshahr coastline.
In the laboratory, the total and standard length was measured to the nearest 0.1 cm using a measuring board. Fish
were weight to the nearest 0.1 g. The intestine length was measured to the nearest 0.1 cm. Feeding intensity was
determined using the vacuity index. This index is defined as the number of empty stomach divided by total
number of stomachs multiplied by 100. Ontogenic, seasonal and sexual variations in feeding intensity based on
the vacuity index were examined.
The point and frequency of occurrence methods were used to assess the food composition. The fish stomach was
removed and dissected. The contents were displayed in a petri dish with a few drops of distilled water and
examined microscopically and with unaided eyes. The percentage frequency of occurrence (F) was based on the
number of stomachs in which a food item was found, expressed as a percentage of the total number of non-
empty stomach (Hynes, 1950).
3. Results
Golden grey mullet obtained for this study consisted of 40 specimens in total length ranging from 42.2 cm
(Fereydunkenar) to 61 cm (Behshahr) in autumn and from 40 cm (Nowshahr) to 52.5 cm (Behshahr) in spring,
and weight of fish ranging from 472 (Fereydunkenar) g to 1844 g (Behshahr) in autumn and from 384 g
(Nowshahr) to 990 g (Behshahr) in spring. This result indicates that significant change in the weight occurred
with total length of the fish (Figure 2).
A total of 40 stomachs were examined of which 5 were empty. The overall vacuity index (VI) of L. aurata was
12.5±18.32. Figure 3 shows the vacuity index of Liza aurata. The trophic spectrum of L. aurata shows that its
diet was made up of Eight major items, with the dietaries including Crustacean (Gammarus), Bivalvia (Mytilus
and Cardium), Gastropoda (Hydrobia), Polychaeta (Nereis), shironomidea larva, Ulvales (Entermorpha),
Ctenophora (Mnemiopsis leidyi) were of diet importance (Table 1). Frequency of occurrence (%F) of food items
in the diet of L. aurata show in figure 3 and they are different in autumn and spring seasons (Figure. 4).
409
HydroMedit 2014, November 13-15, Volos, Greece
Weight (g)
Table 1. Overall composition variation in the diet of L. aurata in the Caspian Sea.
Stomach Contents
Station Gammarus Mytilus Cardium Hydrobia Nereis Chironomide Entromorpha M. leidyi
Tonekabon 3 5 4 0 8 0 0 3
Nowshahr 2 4 4 0 0 1 0 4
Fereydoun kenar 2 1 1 0 2 1 1 4
Behshahr 2 2 0 1 0 0 0 5
Total 9 12 9 1 10 2 1 16
410
HydroMedit 2014, November 13-15, Volos, Greece
Mnemiopsi Gammarus
s leidyi 15%
27%
Entromorp Mytilus
ha 20%
2%
Chironomi
de larva
3%
Nereis Hydrobia Cardium
17% 1% 15%
18
16
14
12
10
8
6
4
2 spring
0
autumn
Figure 4. Frequency of occurrence (%F) of food items in the diet of L. aurata in autumn and spring seasons.
4. Discussion
The importance of detritus as a major food source for estuarine organisms has been widely reported (Fagade and
Olaniyan, 1973; Barnes, 1974). Mugilids generally prefer fine particles to coarser ones. The significance of this
has been discussed by Odum (1970), Marias (1980) and Brusle (1981). It include amongst other things, the fact
that fine particles are richer in absorbed organic matter, bacteria, protozoa and other microorganisms than
coarser ones. This promotes growth and brings about an increase in invertebrate productivity (Olojo et al., 2003).
On the whole, the trophic flexibility of this species ensures a supply of constant energy which is important for
sustenance of its population. The variations in the food habits of the different seasons of L. aurata were possibly
determined by abundance and types of food materials available in the habitat.
In conclusion, L. aurata is omnivorous, and its wide food spectrum may be attributed to the high productivity of
south Caspian Sea. Seasonal fluctuations observed in the volume and composition of food consumed by L.
aurata was correlated with the relative abundance of the food material in the environment.
Acknowledgments
The study was supported by Islamic Azad University, Tonekabon Branch and was performed in Fishery
Research Lab. We would like to thank Mr. Bagheri.
411
HydroMedit 2014, November 13-15, Volos, Greece
References
Bowen S.H., Allanson B.R. (1982). Behavioral and trophic plasticity of juvenile Tilapia mossambica in
utilization of the unstable littoral habitat. Environmental Biology of Fishes 7, 357-362.
Lafaille P., Feunteun E., Lefeuvre, J.C. (2000). Composition of fish communities in a European macrodidal salt
marsh (the Mont saint-Michel Bay, France). Estuarine, Coastal and Shelf Science 51, 429-438.
Gautier D., Hussenot, J. (2005). Mullets of the European Seas. Summary of knowledge about their biological
bases and aquaculture techniques. Brest Ifremer 120p.
Cardona, L., 2006. Habitat selection by grey mullets (Osteichthyes: Mugilidae) in Mediterranean estuaries: the
role of salinity. Scientia Marina, 70(3), 443-455.
Odum W.E. (1970). Utilization of the direct grazing and plant detritus food chains by the striped mullet Mugil
cephalus. In Marine food chains, edited by J.H. Steele, Edinburgh, Oliver and Boyd pp.222-40.
Thomson J.M. (1966). The grey mullet. Oceanography and Marine Biology. Annual Review 4, 301-335.
Hynes H. B.N. (1950). The food of fresh water sticklebacks (Gasterosteus acutectus and Pygosteus punigitius)
with a review of methods used in studies of the food of fish. Journal of Animal Ecology 19, 35-38.
Fagade S. O., Olaniyan, C. I. O. (1973). The food and feeding interrelationship of the fishes in the Lagos
Lagoon. Journal of Fish Biology 5, 205-225.
Barnes, R. S. K. (1974). Estuarine Biology. Journal of Fish Biology 49, 77.
Marias, J. F. K. (1980). Aspects of food intake, food selection and elementary canal morphology of Mugil
cephalus Linnaeus, 1758, Liza tricuspidens (Smith, 1935) and Liza dumerili (Steindachner, 1870). Journal of
Experimental Marine Biology and Ecology 44,193-209.
Brusle J. (1981). Food and feeding in grey mullet. In: O. H. Oren. Aquaculture of grey mullet. International.
Biology Program. 26. Cambridge Univ. Press. p. 185-217.
Olojo E. A. A., Olurin, K. B., Osikoya, O. J. (2003). Food and Feeding Habits of Synodontis nagrita from Osun
River, SW, Nigeria. NAGA, World Fish Center Quarterly. 26(4), 21-23.
Velikova V.N., Shaudanov A.K., Gasimov A., Korshenko A., Abdoli A., Morozov B., Katunin D. N.,
Mammadov E., Bokova E. B., Emadi H., Annachariyeva J., Isbekov K., Akhundov M., Milchakova, N.,
Muradov O., Khodorevskaya R., Shahifar R., Shiganova, T., Zarbaliyeva T. S., Mammadli T., Velikova, V.,
Barale, V., Kim Y. (2012). Review of the environment and bioresources in the Caspian Sea ecosystem 2000-
2010. CaspEco Report, pp 423.
412
HydroMedit 2014, November 13-15, Volos, Greece
1
Department of Biology, Section of Zoology- Marine Biology, University of Athens,
Panepistimiopolis, Ilisia, 15784, Athens, Greece.
2
Hellenic Centre for Marine Research, Institute of Marine Biological Resources and Inland Waters,
46.7 km Athens- Sounio, Mavro Lithari, PO BOX 712, 19013, Anavissos Attica, Greece.
Abstract
Aspects on the biology of Galeus melastomus in the Ionian Sea were studied from a total of 257
specimens (124 male and 133 female). Specimens were caught with bottom longlines in depths
ranging between 440 - 818 m. The length distribution of the examined individuals showed that females
attained slightly larger lengths compared to males. Total length (TL) of males and females ranged
between 247 - 495 mm and 203 - 518 mm respectively. Length-weight relationships were found to
differ significantly between males and females. Allometric coefficient (b) values for females were
higher. Gonadosomatic index (GSI) appeared to increase with maturity stage until spawning, while the
hepatosomatic index (HSI) decreased during spawning, indicating that liver may play an important
role for vitellogenesis and egg case production. The smallest mature male and female were 393 mm
ηαζ 395 mm in TL, respectively; all males and females were mature above 430 mm and 478 mm TL,
respectively. Length at first maturity (L50) was estimated at 412.2 mm for males and 444.2 mm for
females. Egg cases, 1 - 4 per oviduct, were on average 41.6 mm in length without horns, 17.4 mm
wide and weighed 2.33 g.
Key words: Galeus melastomus, length-weight relationship, gonadosomatic index, hepatosomatic
index, length at first maturity
*Corresponding author: Apostolopoulos George ( betterpace@yahoo.gr )
1
Σιήια Βζμθμβίαξ, Σμιέαξ Εςμθμβίαξ- Θαθάζζζαξ Βζμθμβίαξ, Δεκζηυ ηαζ Καπμδζζηνζαηυ Πακ/ιζμ
Αεδκχκ, Πακεπζζηδιζμφπμθδ Ηθίζζα, 15784, Αεήκα, Δθθάδα.
2
Δθθδκζηυ ηέκηνμ Θαθαζζίςκ Δνεοκχκ, Ηκζη. Θαθάζζζςκ Βζμθμβζηχκ Πυνςκ ηαζ Δζςηενζηχκ
Τδάηςκ, 46.7 πθι. Αεδκχκ- μοκίμο, Μαφνμ Λζεάνζ, Σ.Θ. 712, 19013 Ακάαοζζμξ Αηηζηήξ, Δθθάδα.
413
HydroMedit 2014, November 13-15, Volos, Greece
Πεξίιεςε
ημζπεία ηδξ ακαπαναβςβζηήξ αζμθμβίαξ ημο είδμοξ Galeus melastomus ζημ Ηυκζμ Πέθαβμξ
ιεθεηήεδηακ ζε ζοκμθζηά 257 άημια (124 ανζεκζηά ηαζ 133 εδθοηά). Σα δείβιαηα ζοθθέπεδηακ ιε
παναβάδζ αοεμφ ζε αάεδ πμο ηοιαίκμκηακ απυ 440 έςξ 818 m. Ζ ιεθέηδ ηδξ ηαηά ιήημξ ζφκεεζδξ
έδεζλε υηζ ηα εδθοηά ήηακ θίβμ ιεβαθφηενα ζε ζπέζδ ιε ηα ανζεκζηά, ιε ημ μθζηυ ιήημξ ηςκ
ανζεκζηχκ κα ηοιαίκεηαζ απυ 247 έςξ 495 mm, εκχ ηςκ εδθοηχκ απυ 203 έςξ 518 mm. Ζ ζπέζδ
ιήημοξ-αάνμοξ ανέεδηε κα δζαθένεζ ζηαηζζηζηά ζδιακηζηά ιεηαλφ ηςκ δφμ θφθςκ, ιε ηα εδθοηά κα
έπμοκ ιεβαθφηενεξ ηζιέξ αθθμιεηνζημφ ζοκηεθεζηή b. Ο βμκαδμζςιαηζηυξ δείηηδξ (GSI) θάκδηε κα
αολάκεηαζ ηαεχξ ςνζιάγμοκ ηα άημια έςξ ηδκ ςμημηία, εκχ μ δπαημζςιαηζηυξ (HSI) κα ιεζχκεηαζ
ηαηά ηδκ ςμημηία, βεβμκυξ πμο απμηεθεί έκδεζλδ υηζ ημ ήπαν ζοζπεηίγεηαζ ιε ηδ θεηζεμβέκεζδ ηαζ ηδκ
παναβςβή ηαρχκ. Σμ ιζηνυηενμ χνζιμ ανζεκζηυ ηαζ εδθοηυ άημιμ είπακ ιήημξ 393 mm ηαζ 395 mm
ακηίζημζπα, εκχ χνζια ήηακ υθα ηα ανζεκζηά ηαζ εδθοηά άημια πάκς απυ ηα 430 mm ηαζ 478 mm
ακηίζημζπα. Σμ ιήημξ ηδξ πνχηδξ βεκκδηζηήξ ςνίιακζδξ (L50) ανέεδηε βζα ηα ανζεκζηά 412,2 mm ηαζ
βζα ηα εδθοηά 444,2 mm. Οζ ηάρεξ αοβχκ (1 - 4 ακά ςαβςβυ) είπακ ιέζδ ηζιή ιήημοξ πςνίξ
άβηζζηνα 41,6 mm, πθάημοξ 17,4 mm ηαζ αάνμοξ 2,33 g.
Λέξειρ κλειδιά: Galeus melastomus, ζρέζε κήθνπο-βάξνπο, γνλαδνζσκαηηθόο δείθηεο,
επαηνζσκαηηθόο δείθηεο, κήθνο πξώηεο γελλεηηθήο σξίκαλζεο
*οββναθέαξ επζημζκςκίαξ: Απμζημθυπμοθμξ Γζχνβμξ ( betterpace@yahoo.gr )
1. Δηζαγσγή
Ζ δζεεκχξ αολακυιεκδ αθζεοηζηή πίεζδ ηαζ δ ακάβηδ βζα αζχζζιδ αθζεοηζηή πμθζηζηή έπεζ μδδβήζεζ
ζηδκ επζηαβή ηδξ ιεθέηδξ ηςκ ζπεομαπμεειάηςκ ηςκ Υμκδνζπεφςκ, μζ πθδεοζιμί ηςκ μπμίςκ είκαζ
οπμιεθεηδιέκμζ (Vannuccini 1999), ζδζαίηενα εοαίζεδημζ ζηδκ οπεναθίεοζδ ηαζ ανβμί ζηδκ
ακάηαιρή ημοξ (Musick 2005). Σμ Galeus melastomus (Rafinesque, 1810) είκαζ έκαξ ςμηυημξ
Υμκδνζπεφξ ηδξ Οζημβέκεζαξ ηςκ Scyliorhinidae πμο ελαπθχκεηαζ ζημκ Ακαημθζηυ Αηθακηζηυ ηαζ ηδ
Μεζυβεζμ, παιδθμφ ειπμνζημφ εκδζαθένμκημξ ηαζ ιε ιεβάθδ αθεμκία αθθά ηαζ έκημκδ πανμοζία ζηδκ
απμννζπηυιεκδ αθζεία (Costa et al. 2005). Πανμοζζάγεζ εονεία ααεοιεηνζηή ηαηακμιή (55-1873 m)
αθθά πζμ ζοπκά ζοκακηάηαζ ζηα 300-800 m (Rey et al. 2005). Μεθέηεξ πμο έπμοκ πναβιαημπμζδεεί
βζα ημ Galeus melastomus ζπεηίγμκηαζ ιε ηδκ αθεμκία, ηδ ααεοιεηνζηή ηαηακμιή ηαζ ηδ αζμθμβία ημο
(π.π. Ragonese et al. 2009, Tserpes et al. 2013, Anastasopoulou et al. 2013, Costa et al. 2005).
Γζαεέζζια ζημζπεία βζα ηδκ ακαπαναβςβή ημο είδμοξ ζηδ Μεζυβεζμ πνμένπμκηαζ απυ ηδ Βυνεζα
(Capape et al. 2008), ηδ Νμηζμδοηζηή (Rey et al. 2005) ηαζ ηδκ ηεκηνζηή Μεζυβεζμ (Ragonese et al.
2009, Rinelli et al. 2005, Sion et al. 2004). Ζ πανμφζα ενβαζία επζηεκηνχεδηε ζηδ ιεθέηδ ηδξ
ακαπαναβςβήξ ημο G. melastomus ζηδ πενζμπή ημο Ακαημθζημφ Ημκίμο Πεθάβμοξ.
414
HydroMedit 2014, November 13-15, Volos, Greece
TLb βζα ημ ζφκμθμ ηςκ δεζβιάηςκ ηαζ λεπςνζζηά βζα ανζεκζηά ηαζ εδθοηά άημια. Οζ δζαθμνέξ ιεηαλφ
ηςκ παναιέηνςκ ηςκ ανζεκζηχκ ηαζ εδθοηχκ ελεηάζηδηακ ζηαηζζηζηά ζηδ θμβανζειζηή ιμνθή ηςκ
ιεηααθδηχκ. Tα ζηάδζα βεκκδηζηήξ ςνζιυηδηαξ εηηζιήεδηακ ιε ιαηνμζημπζηή ελέηαζδ ημο
ακαπαναβςβζημφ ζοζηήιαημξ ημο ηάεε αηυιμο ιε αάζδ ηδκ ηθίιαηα βζα ςμηυημοξ
Δθαζιαημανάβπζμοξ πμο πνμηάεδηε ζημ Workshop on Sexual Maturity Staging of Elasmobranchs
(WKMSEL, ICES 2012) ημ μπμίμ μνίγεζ ηα ζηάδζα ςξ ελήξ: Ανζεκζηά: 1. πανεέκα, 2.
ακαπηοζζυιεκα, 3a. ζηακά βζα ακαπαναβςβή, 3b. εκενβά, 4a. ελακηθδιέκα, Θδθοηά: 1. πανεέκα, 2.
ακαπηοζζυιεκα, 3a. ζηακά βζα ακαπαναβςβή, 3b. ςμημημφκηα, 4a. ελακηθδιέκα ηαζ 4b. οπυ
ακάηαιρδ. Γζα ηδ ιεθέηδ ημο δπαημζςιαηζημφ (HSI) ηαζ ημο βμκαδμζςιαηζημφ δείηηδ (GSI) ζε
ηάεε ζηάδζμ βεκκδηζηήξ ςνζιυηδηαξ πνδζζιμπμζήεδηακ μζ ιέζεξ ηζιέξ ηαζ ημ ηοπζηυ ζθάθια αοηχκ,
λεπςνζζηά βζα ανζεκζηά ηαζ εδθοηά. Ο HSI ηαζ μ GSI μνίγμκηαζ ςξ ελήξ: ΖSI = (Βάνμξ ήπαημξ / DW)
× 100 ηαζ GSI = (Βάνμξ βμκάδςκ / DW) × 100. Γζα ηδ εηηίιδζδ ημο ιήημοξ πνχηδξ βεκκδηζηήξ
ςνίιακζδξ L50 πνδζζιμπμζήεδηε ημ θμβζζηζηυ ιμκηέθμ. Χξ «ακχνζια» παναηηδνίζηδηακ ηα ανζεκζηά
ηαζ εδθοηά άημια ηςκ ζηαδίςκ 1 ηαζ 2, εκχ ςξ «χνζια» ηα ανζεκζηά ηςκ ζηαδίςκ 3a, 3b ηαζ 4a ηαζ
ηα εδθοηά ηςκ ζηαδίςκ 3a, 3b, 4a ηαζ 4b. Πναβιαημπμζήεδηακ ιεηνήζεζξ ζε 97 ηάρεξ αοβχκ απυ 34
ςμημημφκηα εδθοηά άημια ηαζ οπμθμβίζηδηακ μζ δζαζηάζεζξ ημοξ (± ηοπζηή απυηθζζδ).
3. Απνηειέζκαηα
Σμ ιήημξ ηςκ ανζεκζηχκ ηοιάκεδηε απυ 247 - 495 mm (ιέζδ ηζιή 395 mm ± 68 mm) ηαζ
ηςκ εδθοηχκ απυ 203 - 518 mm (ιέζδ ηζιή 408 mm ± 86 mm), ιε ηα ιεβαθφηενα πμζμζηά κα
ειθακίγμκηαζ ηονίςξ ζηζξ ηθάζεζξ άκς ηςκ 440 mm (πήια 1). ηζξ ιεβαθφηενεξ ηθάζεζξ (480-520
mm) οπενίζποε δ πανμοζία ηςκ εδθοηχκ. Ζ ζφβηνζζδ ηδξ ηαηά ιήημξ ζφκεεζδξ ανζεκζηχκ ηαζ
εδθοηχκ έδεζλε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ ιεηαλφ ηςκ ηαηακμιχκ (p < 0,0001).
415
HydroMedit 2014, November 13-15, Volos, Greece
15
ΑΡΗΘΜΟ ΑΣΟΜΧΝ
10 Αρςενικά (Ν=124)
Θθλυκά (Ν=133)
0
200
210
220
230
240
250
260
270
280
290
300
310
320
330
340
350
360
370
380
390
400
410
420
430
440
450
460
470
480
490
500
510
520
530
TL (mm)
Ζ ζφβηνζζδ ηςκ παναιέηνςκ ηςκ ελζζχζεςκ ιήημοξ-αάνμοξ ιεηαλφ ηςκ ανζεκζηχκ ηαζ εδθοηχκ
έδεζλε ζηαηζζηζηά ζδιακηζηέξ δζαθμνέξ ιυκμ βζα ηζξ ηθίζεζξ b (p = 0,0364).
Σα απμηεθέζιαηα ηδξ ακάθοζδξ ηςκ HSI ηαζ GSI ακά ζηάδζμ βεκκδηζηήξ ςνζιυηδηαξ πανμοζζάγμκηαζ
ζηα δζαβνάιιαηα ηςκ πδιάηςκ 2 ηαζ 3. Σα απμηεθέζιαηα απυ ηδκ ακάθοζδ ημο GSI έδεζλακ ηαζ βζα
ηα δφμ θφθα αολδηζηέξ ηζιέξ ζηα ζηάδζα βεκκδηζηήξ ςνζιυηδηαξ ημο είδμοξ (3a ηαζ 3b) ιε
επαηυθμοεδ ιείςζδ ζηδ θάζδ ελάκηθδζδξ (4a) ηζ επακάηαιρδξ (4b). Ακηίεεηα, μζ ηζιέξ ημο HSI
έθααακ ηδ παιδθυηενδ ηζιή ημοξ ζημ ζηάδζμ ςμαπυεεζδξ (3b) βζα ηα εδθοηά, εκχ ζηα ανζεκζηά δ
ιείςζδ ήηακ ζηαδζαηή απυ ημ 3a ζημ 4a.
416
HydroMedit 2014, November 13-15, Volos, Greece
7.00 9.00
HSI HSI
6.00 19 32 8.00
GSI 3 GSI
47 23 7.00 11
5.00 20
6.00 35 2
4.00 2 5.00 60
3
3.00 4.00 35
3.00 18
2.00 32 23 2
19
2.00
1.00 47 1.00 11 2
60
0.00 0.00
1 2 3a 3b 4a 1 2 3a 3b 4a 4b
ηάδην γελλεηηθήο σξηκφηεηαο ηάδην γελλεηηθήο σξηκφηεηαο
ρήκα 4. Μήθνο πξψηεο γελλεηηθήο σξίκαλζεο ρήκα 5. Μήθνο πξψηεο γελλεηηθήο σξίκαλζεο
ρήκα
(L 2. Γηαθχκαλζε
50) αξζεληθψλ ηνπmelastomus.
αηφκσλ G. HSI θαη ηνπΜε GSI ησλ
θφθθηλν ρήκα 3. Γηαθχκαλζε
(L50) ζειπθψλ αηφκσλ ηνπ HSI θαη ηνπΜεGSI
G. melastomus. ησλ
θφθθηλν
αξζεληθψλ
ην 95% δηάζηεκα αλά ζηάδην γελλεηηθήο
εκπηζηνζχλεο.
G. melastomus ζειπθψλ
ην 95% δηάζηεκα αλά ζηάδην γελλεηηθήο
εκπηζηνζχλεο.
G. melastomus
σξηκφηεηαο. Γείρλεηαη ην ηππηθφ ζθάικα θαη ν σξηκφηεηαο. Γείρλεηαη ην ηππηθφ ζθάικα θαη ν
αξηζκφο αηφκσλ/ζηάδην. αξηζκφο αηφκσλ/ζηάδην.
οκμθζηά ιεθεηδεήηακ 139 ακχνζια (66 ανζεκζηά, 73 εδθοηά) ηαζ 118 χνζια άημια (58 ανζεκζηά,
60 εδθοηά). Σμ ιζηνυηενμ χνζιμ ανζεκζηυ άημιμ είπε ιήημξ 393 mm TL, εκχ ημ ιεβαθφηενμ
ακχνζιμ είπε 430 mm. θα ηα ανζεκζηά πάκς απυ 430 mm TL ήηακ χνζια. Ακηίζημζπα, ημ ιζηνυηενμ
χνζιμ εδθοηυ άημιμ ήηακ 395 mm TL, εκχ ημ ιεβαθφηενμ ακχνζιμ 477 mm. θα ηα εδθοηά πάκς
απυ ηα 478 mm TL ήηακ χνζια. Σμ ιήημξ πνχηδξ βεκκδηζηήξ ςνίιακζδξ (L50) ιε αάζδ ημ θμβζζηζηυ
ιμκηέθμ (πήιαηα 4 ηαζ 5) ανέεδηε βζα ηα ανζεκζηά L50 = 412,2 mm (Ν=124 άημια) ηαζ βζα ηα
εδθοηά L50 = 444,2 mm (Ν=133 άημια).
Οζ ηάρεξ αοβχκ είπακ ιήημξ ιε άβηζζηνα πμο ηοιαζκυηακ ιεηαλφ 35 - 52 mm (ιέζδ ηζιή 46,3 ± 2,9
mm), ιήημξ πςνίξ άβηζζηνα 31 - 48 mm (ιέζδ ηζιή 41,6 ± 2,6 mm), πθάημξ 16 - 19,5 mm (ιέζδ ηζιή
17,4 ± 0,8 mm) ηαζ αάνμξ 1,79 - 3,02 g (ιέζδ ηζιή 2,33 ± 0,32 g). Ο ανζειυξ ηςκ ηαρχκ ηοιαζκυηακ
απυ 1 έςξ 4 ακά ςαβςβυ ηαζ ήηακ ζζυπμζα ηαηακειδιέκεξ ιεηαλφ ηςκ δφμ ςαβςβχκ, ιε ελαίνεζδ
έκα άημιμ πμο έθενε 1 ηάρα ζημκ ανζζηενυ ςαβςβυ ηαζ ηαιία ζημ δελζυ ηαζ δφμ άημια πμο έθενακ 2
ηάρεξ ζημκ ανζζηενυ ςαβςβυ ηαζ 1 ζημ δελζυ. ηα οπυθμζπα δείβιαηα ανέεδηακ 2 ηάρεξ ακά άημιμ
(21 άημια), 4 ηάρεξ (7 άημια), 6 ηάρεξ (2 άημια) ή 8 ηάρεξ (1 άημιμ).
4. πδήηεζε
Οζ ηαηά ιήημξ ζοκεέζεζξ έδεζλακ υηζ ηα εδθοηά θηάκμοκ ζε ιεβαθφηενα ιήηδ, βεβμκυξ πμο
έπεζ ακαθενεεί ηαζ απυ άθθμοξ ενεοκδηέξ βζα ημ είδμξ ζηδ Μεζυβεζμ ηαζ ημκ Αηθακηζηυ (Sion et al.
2004, Costa et al. 2005). Δπίζδξ επζαεααζχκμοκ υηζ ζηδ Μεζυβεζμ αθζεφμκηαζ άημια ιζηνυηενμο
ιήημοξ ζε ζπέζδ ιε ημκ Αηθακηζηυ (Costa et al. 2005). Ο ιεβαθφηενμξ αθθμιεηνζηυξ ζοκηεθεζηήξ (b)
πμο παναηδνήεδηε ζηα εδθοηά, πζεακυκ ακηακαηθά ηζξ αολδιέκεξ εκενβεζαηέξ ακάβηεξ πμο έπμοκ ηα
εδθοηά ηαηά ηδ δζάνηεζα ηδξ θεηζεμβέκεζδξ (Capapé et al. 2008). Τρδθυηενεξ ηζιέξ b ζηα εδθοηά
έπμοκ ακαθενεεί ηαζ απυ ημοξ Ragonese et al. (2009) ζηδ ζηεθία, ημοξ Capapé et al. (2008) ζηδ Ν.
Γαθθία ηαζ ημοξ Moore et al. (2013) ζημκ Αηθακηζηυ. Ο GSI έδεζλε, υπςξ ακαιεκυηακ, αολδηζηή ηάζδ
απυ ηα ακχνζια πνμξ ηα χνζια άημια, εκχ άνπζζε κα ιεζχκεηαζ ζηα άημια πμο έπμοκ βεκκήζεζ ηαζ
παθζκδνμιμφκ, πνμεημζιαγυιεκα βζα έκα κέμ ακαπαναβςβζηυ ηφηθμ. O GSI πανμοζίαζε ιεβαθφηενεξ
ηζιέξ ζηα εδθοηά απυ υ,ηζ ζηα ανζεκζηά, ζηα ζηάδζα 3a ηαζ 3b (ςμημηία), θυβς ηδξ αφλδζδξ ηςκ
417
HydroMedit 2014, November 13-15, Volos, Greece
ςμηοηηάνςκ ηαηά ηδ θεηζεμβέκεζδ, εκχ δ ιείςζή ημο ζηα ζηάδζα ιεηά ηδ ςμημηία είκαζ πζμ ιεβάθδ
ζε ζπέζδ ιε ηα ανζεκζηά, βεβμκυξ πμο ελδβείηαζ απυ ημ υηζ δ ςμεήηδ οθίζηαηαζ ιεβάθεξ αθθαβέξ ηαζ
δεκ πενζέπεζ πθέμκ ακεπηοβιέκα ςάνζα. Οζ ιεηααμθέξ ημο HSI δείπκμοκ υηζ ημ ήπαν πζεακά παίγεζ
επίζδξ ζδιακηζηυ νυθμ ζηδκ ακαπαναβςβή ημο είδμοξ. ημ ζηάδζμ ηδξ ςμημηίαξ (3b) μ HSI
ιεζχκεηαζ. Ζ ιείςζδ ημο HSI είκαζ πζμ ειθακήξ ζηα εδθοηά άημια, πζεακά επεζδή ζπεηίγεηαζ ιε ηδ
δζαδζηαζία ηδξ θεηζεμβέκεζδξ ηαζ ηδξ παναβςβήξ ηαρχκ, ιζα ιεηααμθζηή δζαδζηαζία ηαηά ηδκ μπμία
ζημ ήπαν παναηδνείηαζ ζοζζχνεοζδ ηαζ ηαηακάθςζδ δπαηζηχκ θζπζδίςκ (Capapé et al. 2008). Σμ
ιήημξ ηδξ πνχηδξ βεκκδηζηήξ ςνίιακζδξ είκαζ πανυιμζμ ιε ηζξ πενζζζυηενεξ ακαθμνέξ απυ ηδ
Μεζυβεζμ εάθαζζα (Ragonese et al. 2009, Tursi et al. 1993, Rey et al. 2005 εκχ αθέπε Capapé et al.
2008) εκχ είκαζ ιζηνυηενμ ζε ζπέζδ ιε ημκ Αηθακηζηυ (Costa et al. 2005, Moore et al. 2013). Σα
ανζεκζηά θάκδηε κα εζζένπμκηαζ ζημ ζηάδζμ βεκκδηζηήξ ςνίιακζδξ ζε ιζηνυηενα ιήηδ απυ ηα
εδθοηά, βεβμκυξ πμο έπεζ ακαθενεεί ηαζ απυ άθθμοξ ενεοκδηέξ (π.π. Ragonese et al. 2009, Capapé et
al. 2008, Rey et al. 2005, Costa et al. 2005, Moore et al. 2013). Οζ δζαζηάζεζξ ηςκ ηαρχκ αοβχκ
δζαθένμοκ ακάθμβα ιε ηδ βεςβναθζηή πενζμπή. Οζ ηάρεξ αοβχκ πμο πνμένπμκηαζ απυ ημκ Αηθακηζηυ
πανμοζζάγμοκ ιεβαθφηενεξ δζαζηάζεζξ (π.π. Bannister 1998, Costa et al. 2005, Iglesias et al. 2002)
απυ αοηέξ ηδξ Μεζμβείμο (π.π. Tursi et al. 1993, Capapé et al. 2008). Σα δζηά ιαξ απμηεθέζιαηα
ζοιθςκμφκ πενζζζυηενμ ιε αοηά ηδξ Μεζμβείμο. Ο ανζειυξ ηςκ ηαρχκ αοβχκ ακά άημιμ (2-8) ηδξ
πανμφζαξ ενβαζίαξ ζοιθςκεί ιε αοηά πμο ακαθένμοκ μζ Costa et al. (2005) ηαζ Capapé et al. (2008)
εκχ μζ Tursi et al. (1993) ηαζ Iglesias et al. (2002) ανήηακ ιεβαθφηενμ ανζειυ ηαρχκ ακά άημιμ.
Πεναζηένς ιεθέηδ ηςκ ζημζπείςκ αοηχκ ηαηά ηδ δζάνηεζα υθμο ημο έημοξ εα ιαξ δχζεζ πθδνέζηενδ
ηαζ πζμ μθμηθδνςιέκδ εζηυκα βζα ηδκ ακαπαναβςβζηή αζμθμβία ημο G. melastomus ζημ Ακαημθζηυ
Ηυκζμ.
Βηβιηνγξαθία
Anastasopoulou A., Mytilineou Ch., Lefkaditou E., Dokos J., Smith C.J., Siapatis A., Bekas P.,
Papadopoulou K.-N. (2013). Diet and feeding strategy of blackmouth catshark Galeus
melastomus. Journal of Fish Biology 83 (Issue 6), 1637–1655
Bannister K. (1998). The book of the shark, 2nd edn. Grange Books Publishing Ltd., London.
Capapé C., Guélorget O., Vergne Y., Reynaud C. (2008). Reproductive biology of the blackmouth
catshark, Galeus melastomus (Chondrichthyes: Scyliorhinidae) off the Languedocian coast
(southern France, northern Mediterranean). Journal of the Marine Biological Association of
the United Kingdom 88 (2), 415–421.
Compagno L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark
Species Known to Date. FAO, Rome, pp. 312.
Costa M.E., Erzini K., Borges T.C. (2005). Reproductive biology of the blackmouth catshark, Galeus
melastomus, off the south coast of Portugal. Journal of the Marine Biological Association of
the United Kingdom 85, 1173–1183.
ICES. (2013). Report of the workshop on Sexual Maturity Staging of Elasmobranchs (WKMSEL), 11-
14 December 2012. ICES CM 2012/ACOM:59, Lisbon, Portugal, pp. 66.
Iglesias S.P., Du Buit M.H., Nakaya K. (2002). Egg capsules of deep-sea catsharks from eastern north
Atlantic, with first descriptions of the capsule of Galeus murinus and Apristurus aphyodes
(Chondrichthyes: Scyliorhinidae). Cybium 26, 59–63.
Moore D.M., Neat F.C., McCarthy I.D. (2013). Population biology and ageing of the deep water
sharks Galeus melastomus, Centroselachus crepidater and Apristurus aphyodes from the
418
HydroMedit 2014, November 13-15, Volos, Greece
Rockall Trough, north-east Atlantic. Journal of the Marine Biological Association of the
United Kingdom 93 (7), 1941–1950.
Musick J. A. (2005). Introduction: management of sharks and their relatives (Elasmobranchii). In:
―FAO Fisheries Technical Paper 474: Management techniques for elasmobranch fisheries‖,
Musick J. A., Bonfil R. (eds). FAO, Rome, p. 1-5.
Quéro J.C. (1984). Scyliorhinidae. In: ―Fishes of the north-eastern Atlantic and the Mediterranean
(FNAM)‖, Whitehead P.J.P. et al (eds). Vol. 1. UNESCO, Paris, p. 95-100.
Rey J., De Sola L. G., Massutí E. (2005). Distribution and Biology of the Blackmouth Catshark
Galeus melastomus in the Alboran Sea (Southwestern Mediterranean). Journal of Northwest
Atlantic Fishery Science 35, 215-223.
Ragonese S., Nardone G., Ottonello D., Gancitano S., Giusto G.B., SinacoriI G. (2009). Distribution
and biology of the Blackmouth catshark Galeus melastomus in the Strait of Sicily (Central
Mediterranean Sea). Mediterranean Marine Science 10/1, 55-72.
Rinelli P., Bottari T., Florio G., Romeo T., Giordano D., Greco S. (2005). Observations on distribution
and biology of Galeus melastomus (Chondrichthyes, Scyliorhinidae) in the southern
Tyrrhenian Sea (central Mediterranean). Cybium 29, 41–46.
Sion L., Bozzano A., D‘Onghia G., Capezzuto F., Panza M. (2004). Chondrichthyan species in deep
waters of the Mediterranean sea. Scientia Marina 68 (Suppl.3), 153-162.
Tserpes G., Maravelias C.D., Pantazi M., Peristeraki P. (2013). Distribution of relatively rare demersal
elasmobranchs in the eastern Mediterranean. Estuarine, Coastal and Shelf Science 117, 48–53.
Tursi A., D‘Onghia G., Matarrese A., Piscitelli G. (1993).Observations on population biology of the
blackmouth catshark Galeus melastomus (Chondrichthyes, Scyliorhinidae) in the Ionian Sea.
Cybium 17, 187-196.
Vannuccini S. (1999). FAO Fisheries Technical Paper No. 389: Shark utilization, marketing and trade.
FAO, Rome, pp. 470.
419
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
With the aim of implementing long-term management plans for all its fisheries, the European Union
considered MSY as the upper benchmark. Many fisheries in Europe, particularly in the Mediterranean,
lack enough data to estimate the MSY, and therefore other reference points must be employed, e.g. the
more precautionary F0.1; this approach is especially needed for ―fragile‖ or overexploited stocks.
Having in mind these objective difficulties, this paper suggests a rapid procedure for establishing a
global production model using as case studies two species in the northern Tyrrhenian Sea: a selachian
fish, the blackmouth catshark (Galeus melastomus), and a stomatopod crustacean, the mantis shrimp
(Squilla mantis). The method is that proposed by Garcia et al. (1989), i.e. using published and grey
data on catch, standing stock and a likely estimate of mortality to assess the MSY: in the specific
cases, F0.1 (as proxy of FMSY), gross catches and standing biomasses reported by STECF and/or
MEDITS estimates have been employed. This approach may allow fixing an exploitation limit
coherent with the EU decision also in data-scarce situations.
keywords: mantis shrimp, blackmouth catshark, fisheries, MSY, stock assessment, Tyrrhenian Sea
1. Introduction
The demersal resources of the Mediterranean have a long history of high exploitation and
most of them seem in a chronic state of ―sustainable‖ overfishing (Lleonart & Maynou, 2003).
After many unsuccessful attempts to improve the situation (Khalilian et al., 2010), limiting
capacity and effort, setting alternative reference point and spending money in subsidies, the European
Union (EU) decided to implement long-term management plans based on scientific assessments of its
fisheries (CEC, 2006a; 2006b), to reach quantitative goals on the basis of specific target and limit
reference points, following the Marine Strategy Directive 2008/56/CE and the Green Paper on the
Reform of the CFP (CEC, 2009).
In the framework of its decision, the maximum sustainable yield (MSY) has been recently
adopted as upper benchmark, i.e. as an overfishing limit (OFL) (Mace, 2001), notwithstanding serious
420
HydroMedit 2014, November 13-15, Volos, Greece
shortcomings (Finley & Oreskes, 2013). Many fisheries in Europe, particularly in the Mediterranean,
lack enough data to implement surplus production models and to estimate MSY-related parameters,
and therefore other reference points have been employed, e.g. the fishing mortality parameter F 0.1
(Froese et al., 2011), easy to assess despite its lack theoretical foundation (Jensen, 2000); this
precautionary strategy appears particularly necessary when managing ―fragile‖ and/or overexploited
resources, like cartilaginous fishes and demersal shrimps.
This paper suggests a data-scarce approach, using F0.1 as proxy of the required FMSY, for
establishing a global production model, both for management of their fisheries and as case studies, on
two such species in the northern Tyrrhenian Sea (part of GFCM‘s GSA9), i.e. Galeus melastomus, a
selachian fish, and Squilla mantis, a stomatopod crustacean.
The small blackmouth catshark (Galeus melastomus RAFINESQUE, 1810) occurs from
50-100 m down to more than 1000 m, and is a low-value bycatch (mainly of bottom trawling
fisheries), often rejected at sea (with unknown survival rates); like many other selachians, its stocks
are in general considered highly vulnerable to trawling (Ragonese et al., 2009; Dell‘Apa et al., 2012).
The Mediterranean mantis shrimp (Squilla mantis L., 1758) is a sedentary, territorial and opportunistic
predator, occurring on soft bottoms, and is a common catch of coastal fisheries; notwithstanding its
supposed resilience, due to its borrowing and nictemeral behaviours, the mantis shrimp appears in
many instances as highly stressed (Ragonese et al., 2012).
The approach is that proposed by Garcia et al. (1989), i.e. using published and grey metadata
on gross catch (or landings), standing stock and a likely estimate of mortality at MSY to assess Fox‘s
surplus production models per each available year, not necessarily ordered in time series:
Speaking of the blackmouth catshark in the northern Tyrrhenian, F0.1 (0.125 [mean], as proxy
of FMSY) reported by STECF (2011; 2012), and landings (9.4÷13.0 t) and standing
biomasses (672÷620 t) obtained from MEDITS (2012) ―direct‖ estimates and/or from a LCA exercise
(232 t) have been employed; average Fest have been derived from Bcurr/Ycurr.
In the case of Squilla mantis from the GSA9, F0.1 (0.59 [mean], as proxy of FMSY), landings as
equivalent to gross catches (485÷433 t) and standing biomasses (368÷831 t) reported by STECF
(2012) for the triennium 2009-2011 have been utilized; again, average Fest have been derived from
Bcurr/Ycurr.
421
HydroMedit 2014, November 13-15, Volos, Greece
3. Results
Notwithstanding the paucity of the data, the Fox's surplus production model has been fitted
averaging the available yearly estimates (landings + discards; years 2009 and 2010) for the
blackmouth catshark in the GSA9. The graph (Figure 1) clearly shows a not-fully developed fishery,
with ―dead‖ catches securely on the left side of the Fox's surplus-production model (SPM), and Fest
(0.014÷0.021) lower than F0.1.
422
HydroMedit 2014, November 13-15, Volos, Greece
Moreover, given the fishermen habit of throwing overboard almost all blackmouth catsharks
while still alive, different scenarios (based on the 2010 LCA simulation) considered alternative
hypotheses on survival of sharks returned at sea; in every case, the graphical integration shows that, at
the present exploitation levels, survival may not be of major concern for the Galeus melastomus stock
in GSA9.
It was also possible to fit the production model averaging the available yearly estimates for the
mantis shrimp in the northern Tyrrhenian Sea. The graph (Figure 3) and the corresponding
Fest (1.32÷0.52) show an overexploited situation in 2009 and 2010, with catches on the right side of the
Fox's SPM, and Fest much higher than F0.1, while in 2011 the status of the fishery seems improving.
423
HydroMedit 2014, November 13-15, Volos, Greece
yield (t)
750
500
2009
2011 2010
250
There are two basic approaches in population dynamics studies, both formalized in the ‗50s
(Quinn & Deriso, 1999): the Beverton and Holt‘s ―dynamic pool models‖ (DPM) and the Schaefer‘s
―surplus-production models‖ (SPM). Notwithstanding the lack of agreement among scientists, SPM
are often preferred over DPM, being easier to understand and to ―sell‖ to fishermen and politicians.
In data-scarce situations, scientists were asked by the EU to estimate the fishing mortality via
F0.1 by applying synthetic models and use this target reference point as a substitute (proxy) for F MSY.
F0.1 is expected to be lower than FMSY in the most productive stocks, corresponding on a theoretical
basis to around 90% of FMSY (Prager, 1994); matter-of-factly, F0.1 lower than 0.3 do not perform well
as proxy of FMSY.
Still, the possibility of determining the (mean) MSY as a benchmark for management may
allow fixing an exploitation limit coherent with the EU decision (CEC, 2009). The major caveats of
any assessment based on MSY are the ―steady state‖ assumption (Hilborn & Walters, 1992) and the
congruity of landings and standing data; nevertheless, notwithstanding its limitations, ―there seems to
be no operational rival to MSY‖ (Barber, 1988), especially in complex circumstances, such as those
frequent in the Mediterranean.
The blackmouth catshark is caught frequently and abundantly in bottom trawling for
deep-water red shrimps (Ragonese et al., 2000), and its stocks may seem theoretically vulnerable; in
fact, even if the effective survival rate of animals returned to sea is unknown, they all appear vital and
viable when tossed overboard, and this fact could explain the assessed resilience of the species.
Mantis shrimp resources are considered quite tough to fisheries due to burrowing habits and
preference for coastal bottoms, generally closed to trawling. Despite this fact, current analytical
424
HydroMedit 2014, November 13-15, Volos, Greece
models (STECF, 2011; 2012) highlighted a strong overexploitation (Fcurr=1.24 >> FMSY), requiring
fishing effort cuts almost unacceptable by administrators and fishermen (Mace, 2001). On the
contrary, present results support a moderate resilience of the stock, showing a status between the fully
exploitation and moderate overexploitation (Fcurr ≈ FMSY).
In conclusion, the proposed approach, already implemented in different cases (Bianchini &
Ragonese, 2012; Ragonese et al., 2012) supports the possibility of getting an independent assessment
of MSY, as well as the congruity as proxy of F0.1 derived from analytical models, when "true" FMSY is
not available.
References
Barber W.E. 1988. Maximum sustainable yield lives on. North American Journal Fisheries
Management, 8: 153-157.
Bianchini M.L., Ragonese S. 2012. An approach to more sustainable fisheries: the European Union's
MSY requirement and the case of the turbot in the Black Sea. Proceedings 3 rd International
Scientific Congress of the Technical University of Varna, 7: 192-196.
CEC (Commission of the European Communities). 2006a. Communication from the Commission to
the Council and the European Parliament: implementing sustainability in EU fisheries through
maximum sustainable yield. COM(2006)/360: 1-13.
CEC (Commission of the European Communities). 2006b. Technical background to the Commission‘s
Communication "Implementing sustainability in EU fisheries through maximum sustainable
yield: a strategy for growth and employment" {COM(2006)/360}. Commission Staff Working
Document, SEC(2006)/868: 1-23.
CEC (Commission of the European Communities). 2009. Green paper: reform of the Common
Fisheries Policy. COM(2009)/163.
Dell‘Apa A., Kimmel D.G., Clò S. 2012. Trends of fish and elasmobranch landings in Italy: associated
management implications. ICES Journal of Marine Science, 69(6): 1045-1052.
Finley C., Oreskes N. 2013. Maximum sustainable yield: a policy disguised as science. ICES Journal
of Marine Science, 70(2): 245-250.
Froese R., Branch T.A., Proelß A., Quaas M., Sainsbury K., Zimmermann C. 2011. Generic harvest
control rules for European fisheries. Fish and Fisheries, 12: 340–351.
Garcia S., Sparre P., Csirke J. 1989. Estimating surplus production and maximum sustainable yield from
biomass data when catch and effort time series are not available. Fisheries Research, 8: 13-23.
Hilborn R., Walters C.J. 1992. Quantitative fisheries stock assessment: choice, dynamics and
uncertainty. Chapman & Hall: 570 p.
Jensen A.L. 2000. Harvest reference points for the Beverton and Holt dynamic pool model. Fisheries
Research, 47(1): 93-96.
Khalilian S., Froese R., Proelß A., Requate T. 2010. Designed for failure: a critique of the Common
Fisheries Policy of the European Union. Marine Policy, 34(6): 1178-1182.
Lleonart J., Maynou F. 2003. Fish stock assessments in the Mediterranean: state of the art. Scientia
Marina, 67(Suppl.1): 37-49.
Mace P.M. 2001. A new role for MSY in single-species and ecosystem approaches to fisheries stock
assessment and management. Fish and Fisheries, 2: 2-32.
425
HydroMedit 2014, November 13-15, Volos, Greece
426
HydroMedit 2014, November 13-15, Volos, Greece
Kokokiris L.*1, Minos G.1, Kiriakidou Μ.1, Alexandrou M.1, Papadaki Μ.2, Karidas T.1,
Economidis P.S.3
1
Alexander Technological Educational Institute of Thessaloniki, Department of Aquaculture and Fisheries
Technology, P.O.Box 157, HL-63200, Nea Moudania, Hellas, 2Hellenic Centre for Marine Research, Institute of
Marine Biology, Biotechnology and Aquaculture, P.O.Box 2214, 71003, Iraklion, Crete, Hellas, 3Karakasi 79, GR-
54453, Thessaloniki, Hellas
Abstract
The present study was designed to identify maturity of the agujon needlefish, Tylosurus acus imperialis, using
microscopic criteria. Histological analysis was applied on 110 individuals sampled between May and August in
Thermaikos Gulf (N. Aegean Sea, Greece). Female gonadal development was observed in that only one
functional ovary persisted in all females. This was normally on the right, while on the left side the ovary failed to
differentiate. Male agujon needlefish had bilateral testes but an asymmetry between testes became evident, with
the left testis being significantly less developed. All female and male individuals were in spawning capability or
even in spawning active phase, providing evidence of a spawning period from May to August with a peak in
June and July. The minimum size for maturity of females was 64.5 cm TL whilst minimum size for male
maturity was 59.3 cm TL. The coexistence within ovary of oocytes at various maturity steps, i.e. secondary
growth full grown, hydrated oocytes (eggs) and postovulatory follicles clearly indicated T. acus imperialis as a
multiple spawner. Furthermore, the absence of immature individuals among specimens provided strong evidence
for the existence of a spawning ground in the study area.
1
Σιήια Σεπκμθμβίαξ Αθζείαξ ηαζ Τδαημηαθθζενβεζχκ, Αθελάκδνεζμ Σεπκμθμβζηυ Δηπαζδεοηζηυ Ίδνοια
Θεζζαθμκίηδξ, Σ.Θ. 157, 63200, Νέα Μμοδακζά, Δθθάδα, 2Ηκζηζημφημ Θαθάζζζαξ Βζμθμβίαξ, Βζμηεπκμθμβίαξ
ηαζ Τδαημηαθθζενβεζχκ, Δθθδκζηυ Κέκηνμ Θαθάζζζςκ Δνεοκχκ, Σ.Θ. 2214, 71003, Ζνάηθεζμ, Δθθάδα,
3Καναηάζδ 79, 54453, Θεζζαθμκίηδ, Δθθάδα
427
HydroMedit 2014, November 13-15, Volos, Greece
Πεξίιεςε
ηδκ ενβαζία αοηή πενζβνάθεηαζ δ βεκκδηζηή ςνίιακζδ ηδξ ααζζθμγανβάκαξ Tylosurus acus imperialis, ιε αάζδ
ηδκ ζζημθμβζηή ακάθοζδ ηςκ βμκάδςκ 110 αηυιςκ, ηα μπμία αθζεφεδηακ ηδκ πενίμδμ Μαΐμο-Αοβμφζημο ζημ
Θενιασηυ Κυθπμ. ηα εδθοηά άημια ήηακ ακεπηοβιέκδ ιυκμ δ δελζά βμκάδα εκχ ζηα ανζεκζηά άημια
παναηδνήεδηε έκημκδ αζοιιεηνία ηςκ υνπεςκ ιε ημκ ανζζηενυ υνπζ κα είκαζ ζδιακηζηά πζμ ιζηνυξ απυ ημ
δελζυ. θα ηα άημια ήηακ χνζια εκχ ηα πενζζζυηενα ημοξ ιήκεξ Ημφκζμ ηαζ Ημφθζμ ήηακ ζηα ηεθζηά ζηάδζα ηδξ
ςνίιακζδξ (ζηάδζμ ςμημηίαξ, ζηάδζμ ζπενιίαζδξ). Ζ πενίμδμξ ςμημηίαξ ηδξ ααζζθμγανβάκαξ ζημ Θενιασηυ
Κυθπμ εηηείκεηαζ απυ ημκ Μάζμ ιέπνζ ημκ Αφβμοζημ, ιε ηδκ ςμημηία κα ημνοθχκεηαζ ημοξ ιήκεξ Ημφκζμ ηαζ
Ημφθζμ. Σμ εθάπζζημ ιέβεεμξ ηςκ χνζιςκ αηυιςκ ήηακ 64,5 cm μθζημφ ιήημοξ βζα ηα εδθοηά άημια ηαζ 59,3
cm βζα ηα ανζεκζηά. Ζ ηαοηυπνμκδ ζοκφπανλδ ςμηοηηάνςκ ζε πενζζζυηενα απυ δφμ ζηάδζα ακάπηολδξ ηαζ
εζδζηυηενα δ ζοκφπανλδ θεηζεζηχκ ςμηοηηάνςκ, ςμηοηηάνςκ ζημ ζηάδζμ ηδξ ηεθζηήξ ςνίιακζδξ (οαθχδδ ή
εκοδαηςιέκα) ηαζ ηεκχκ ςμεοθαηίςκ, οπμδδθχκμοκ υηζ δ ααζζθμγανβάκα είκαζ πμθθαπθυξ απμεέηδξ. Ζ
πακηεθήξ απμοζία ακχνζιςκ αηυιςκ ζηα δείβιαηα απυ ηδκ πενζμπή ιεθέηδξ, δείπκεζ υηζ δ ζοβηεηνζιέκδ
πενζμπή ιπμνεί κα είκαζ πεδίμ ςμημηίαξ ηδξ ααζζθμγανβάκαξ.
1. Introduction
The needlefish, Tylosurus acus (Belonidae, Lacepède 1803) is an epipelagic species that is widely
distributed in tropical and subtropical waters with many subspecies that have been recognized depending to their
geographical distribution (Collette 2003). T. a. acus (Lacépède 1803) is found in the Western Atlantic; T. a.
rafale (Collette & Parin 1970) is mainly distributed in the Gulf of Guinea, T. a. melanotus (Bleeker 1850) is
found throughout the Indo-Western Pacific, extending to the Eastern Pacific and the agujon needlefish T. a.
imperialis is found in the Mediterranean Sea (Collette 2003).
The agujon needlefish T. a. imperialis consists part of the catches of the coastal small scale fishery in
Thermaikos Gulf (N. Aegean Sea) since 2012. Agujon needlefish are usually being caught by gillnets, beach
seines and night spear fishing throughout late spring and summer months reaching a relatively high price in local
fish markets. Despite the existence of various information on its distribution in the Meditteranean Sea (Bello
1995, Akyol & Kara 2011, Pećarević et al. 2013, Türker Çakır & Zengin 2013, Imsiridou et al. 2014),
information on its biology and particularly on its reproductive biology is still scarce. Moreover, the biological
information accumulated on species of the six Tylosurus genera (Collette 2003) across their world-wide
distribution is not well documented. To our knowledge, detailed information on the reproductive biology of
Tylosurus genera is rather limited to T. a. melanotus in waters of southeastern Taiwan (Liao & Chang 2011).
However, the reproductive biology information is essential for fisheries management schemes.
The aim of this study was to identify the maturity of the agujon needlefish, T. a. imperialis, using
microscopic criteria, coming to a better understanding of its reproductive biology and contributing to the
development of appropriate management schemes.
A total of 110 T. a. imperialis individuals were sampled on a monthly basis between May and August,
during 2013 and 2014. All fish were caught by artisanal fishery (gillnets, beach seines, permanent fish traps,
night spear fishing from boat, arrowhead fixed fish trap) operating in Thermaikos Gulf (40º23′00″N;
22º47′00″E). For each specimen, total length (TL) to the nearest centimetre, as well as the total and gutted
428
HydroMedit 2014, November 13-15, Volos, Greece
weight (gWb), and gonad and liver weights were measured (accuracy of 0.01 g). Specimens ranged from 59 to
107 cm (TL) and 0.23 to 1.7 kg (W b).
Slices of the gonads were fixed in 10% buffered formaldehyde. After 24–48 h, a segment from the
central part of the left lobe was dehydrated in increasing concentrations of ethanol and clarified in xylene. Each
segment was then embedded in paraffin wax and cross-sections of 4–5ιm thickness were cut and stained with
Mayers‘ haematoxylin-eosin.
Sex and maturity stage (MS) were determined from microscopic observations of histological slides.
Ovarian maturity was defined by the maturation stage of the most advanced oocytes and testicular maturity by
the most advanced spermatic cells. For the development classification of oocytes, the classification scheme of
Grier et al. (2009) was used. Ovarian and testicular maturity was divided into phases, following the conceptual
models and the standardised terminology proposed by Brown-Peterson et al. (2011). The presence of
postovulatory and atretic follicles was also recorded.
For each individual the following indices were calculated: (i) gonadosomatic index (I g), (Ig=100 x
gonads weight/gutted weight), (ii) hepatosomatic index (I h), (Ih=100 x liver weight/gutted weight, and (iii)
condition index (Kn =total weight/TLb).
3. Results
Specimens were caught only from May to August. Males outnumbered females. The smaller specimen
collected was of 64.5 cm TL for females and 59.3 cm for males. Those sizes were also the minimum sizes for
maturity of females and males, since all specimens were sexually mature with gonads capable of spawning and
no immature individual was collected at lower length sizes.
Female gonadal development was observed in that only one functional ovary persisted in all mature
females. This was normally on the right, while on the left side the ovary failed to differentiate and underwent a
degenerative fate along with its associated reproductive tract. Adult male agujon needlefish had bilateral testes
but an asymmetry between left and right testes became very evident, with the left testis significantly less
developed than the right testis (reaching only up to 10% of the right testis).
Mature ovaries were cylindrical, swollen, ranging from 13.4 to 33.1 cm in length (Table 1), having a
deep yellowish-orange in colour. Ovaries divided into those being capable of spawning (‗spawning capable‘) and
actively spawning (‗active spawning‘). Spawning capable ovaries contained oocytes at all steps of oogenesis but
fullgrown vitellogenic oocytes (SGfg), were the most advanced and large oocytes. SGfg oocytes were
distinguished by the formation of large regions of fluid yolk, the appearance of an ooplasm displaced into the
peripheral rim surrounding the yolk mass and a zona pellucida having its maximum length. The oil droplets
concentrated around the nucleus, then fused into one or a few oil drops. The germinal vesicle was of an irregular
shape with an envelope became progressively folded. Numerous small and large nucleoli could also be seen.
Spawning active ovaries were characterised by the presence of hydrated oocytes (final maturation step, OM);
having the yolk material completely fused with a few or one oil drops formed inside. The appearance of the
oocyte was homogenous, finely granular, whilst the germinal vesicle was invisible due to disintegration and
dispersion of the nuclear membrane (GVBD). The ooplasm, was restricted to a narrow rim, laying next to the
zona pellucida, which had became thinner. At the late portion of the spawning season (i.e. August) in some
spawning-capable ovaries, empty ovarian follicles (post ovulatory follicles, POFs) were present, indicating that
ovulation had occurred. Clear sings of atresia could be also identified in some ovaries.
Mature testes were triangular or diamond shaped, white in colour, thick and long in size with an average
length of 16.8 cm significantly less elongated than ovaries (ANOVA, P=0.04, Table 1). Testes in spawning
429
HydroMedit 2014, November 13-15, Volos, Greece
capable phase were identified by the presence of spermatozoa in the lumen of the lobules and in the sperm ducts.
Some males were moved to the actively spawning subphase, releasing milt after a gentle pressure was placed on
the abdomen (spermiating males). Males remained in the spawning capable phase during the majority of the
period from May to August and underwent active spermatogenesis during which all stages of spermatogenesis
were observed. They were classified as being in the early, middle or late portion of the spawning season based
on continuous or discontinuous germinal epithelium (GE). During the early GE subphase of the spawning
capable phase, they were distinguished by a continuous GE throughout testis and the presence of spermatogonia
(Sg) in the spermatocyts. During the mid-GE subphase, spermatogenesis ceased in some spermatocysts in
lobules near the sperm ducts, resulting in a discontinuous GE near the ducts but a continuous GE at the periphery
of the lobules. By the end of July, males were in late GE subphase having a discontinuous GE throughout the
testis, an increasing prevalence of anastomosing lobules and reduced spermatogenesis. During August, at the
late portion of the spawning season some males with testes entering the regressing phase were seen.
Table 1. Mean values (± SD) and range of values for body weight (W b), gutted body weight (gWb), total
length (TL), gonadosomatic index (Ig), hepatosomatic index (Ih), condition index (K n) and gonads length in
female and male spawning capable needlefish, T. acus imperialis.
Females Males
(n=29) (n=81)
4. Discussion
Collette (1981) and Bauchot (1987) were the first to report the existence of L-R gonads asymmetry in T.
a. imperialis individuals, where only a functional ovary exists in females but they reported the presence of two
asymmetric testes in male individuals. Similarly, L-R asymmetry of paired gonads has been also reported for the
congeneric species, T. crocodiles (Colette 1981) but no gonads asymmetry has been reported for the subspecies
T. a. melanotus or other species of Belonidae family. It seems that further research is required towards the
430
HydroMedit 2014, November 13-15, Volos, Greece
identification of factors controlling the establishment of L-R gonads asymmetry and its functional significance in
this species.
References
Akyol, O. and Kara, A. (2011). Occurrence of Tylosurus acus imperialis (Rafinesque, 1810) (Osteichthyes:
Belonidae) in the northern Aegean Sea. Journal of Applied Ichthyology 27, 1396.
Bauchot M.L., (1987). Poissons osseux. In: W. Fischer, M.L. Bauchot and M. Schneider (eds.) Fiches FAO
d'identification pour les besoins de la pêche (rev. 1). Méditerranée et mer Noire. Zone de pêche 37. Vol.
II. Commission des Communautés Européennes and FAO, Rome., p. 891-1421.
Bello G. (1995). Tylosurus acus imperialis (Osteichthyes: Belonidae), a fish new to the Adriatic Sea. Cahier de
Biologie Marine 36, 197–199.
Brown-Peterson N., Wyanski D.M., Saborido-Rey F., Macewicz B.J., Lowerre-Barbieri S.K. (2011). A
standardized terminology for describing reproductive development in fishes. Marine and Coastal
Fisheries: Dynamics, Management, and Ecosystem Science 3, 52–70.
Collette B. (1981). Belonidae. In: ―FAO species identification sheets for fishery purposes. Eastern Central
Atlantic. Fishing Area 34 and part of 47‖. Canada Funds-in-Trust. Ottawa. Fischer W., Bianchi G.,
Scott W.B. (eds), Department of Fisheries and Oceans Canada, by arrangement with FAO of the United
Nation. Vols. 1-6: pag. var.
Collette B.B. (2003). Family Belonidae (Bonaparte, 1832) needlefish. Annotated checklist of fish. California
Academy of Sciences 16, 1–22.
Châari M., Derbel H., Neifar L. (2013). Lecithostaphylus tylosuri sp. nov. (Digenea, Zoogonidae) from the
digestive tract of the needlefish Tylosurus acus imperialis (Teleostei, Belonidae). Acta Parasitologica
58, 50–56.
Grier H.J., Carmen Uribe M., Aranzabal M.C., Patino R. (2009). The ovary, folliculogenesis, and oogenesis in
teleosts. In: ―Reproductive biology and phylogeny of fishes (Agnathans and Bony Fishes)‖, Vol. 8, A.
B.G. M. Jamieson, (Ed.) Science Publishers, Enfield, pp 25–84.
Imsiridou A., Minos G., Kokokiris L. (2014). Documentary appearance of Tylosurus acus imperialis individuals
in Thermaikos Gulf. Proceedings of HydroMedit 2014, 1 st International Congress on Applied
Ichthyology and Aquatic Environment, Volos, Hellas (accepted).
Liao Y. & Chang, Y. (2011). Reproductive Biology of the Needlefish Tylosurus acus melanotus in Waters
around Hsiao-Liu-Chiu Island, Southwestern Taiwan. Zoological Studies 50, 296–308.
431
HydroMedit 2014, November 13-15, Volos, Greece
Pećarević M., Mikuš J., Bratoš Cetinić A., Dulĉić J. and M. Ĉalić (2013). Introduced marine species in Croatian
waters (Eastern Adriatic Sea). Mediterranean Marine Science, 14/1,: 224-237.
Türker Çakır, D. and Zengin, K. (2013). Occurrence of Tylosurus acus imperialis (Rafinesque, 1810)
(Osteichthyes: Belonidae) in Edremit Bay (Northern Aegean Sea). Journal of Applied Ichthyology
29, 671–672.
432
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
ENVIROMENTAL
MANAGEMENT
433
HydroMedit 2014, November 13-15, Volos, Greece
1 Department of Marine Biology and Fisheries Sciences, Tonekabon Branch, Islamic Azad University,
Tonekabon, Iran.
2 Iranian Fishery Research Organization, Tehran, Iran.
3 Persian Gulf Institute, Persian University, Boushehr, Iran.
Abstract
In total, 135 samples of adult stellate sturgeon Acipenser stellatus were collected at three sites (the
estuaries of the Ural, Kura and Sefidrud Rivers) around the Caspian Sea. Fifteen sets of microsatellite primers
were tested on genomic DNA. Ten primer sets revealing polymorphic loci were used to analyze the genetic
variation found in adults of the stellate sturgeon populations. The analyses revealed that the average of alleles
per locus was 12.1 and all the sampled regions contained private alleles. The observed and expected
heterozygosity averaged 0.674 and 0.860, respectively. Average of Fis, Fit and Nm were 0.181, 2.16 and 5.21
respectively. Fst, Rst and gene flow estimates in AMOVA indicated significant genetic differentiation among
regions (P≤0.01), indicating that the populations were divergent. The genetic distance between populations was
0.530, thus indicating that the genetic difference among populations is pronounced. These results provide useful
information on the genetic variation and differentiation among the Caspian Sea populations of the stellate
sturgeon.
Keywords: Microsatellite, Genetic variability, genetic differentiation, Caspian Sea, Acipenser stellatus
*Corresponding author: Mehrnoush Norouzi (mnoroozi@toniau.ac.ir)
1. Introduction
Sevruga or stellate sturgeon (anadromous fish) is a brackish-water species, the most euryhaline among the
Caspian sturgeons. In the last decade, due to higher water temperature considerable part of the North Caspian
sevruga winters at the steep slopes of the North Caspian and in the north-eastern Middle Caspian. In spring, the
North Caspian population migrates northward and then mature spawners enter the Volga and Ural Rivers. South
Caspian population spawns in the Sefidrud and Kura Rivers. The post-spawn fish migrate back into the sea for
feeding. Feeding migrations take place within the shelf zone of the sea. Food spectrum of sevruga is highly
diverse (Velikova et al., 2012). Overfishing and illegal catches are the main causes of decrease in stocks of this
species and of the number of adult spawners and, being also listed as endangered species by IUCN (Pourkazemi
2006).
Microsatellites are frequent in fish genome and can easily be amplified with PCR; they denote high levels
of allele polymorphism (Chistiakov et al., 2005). These features, taken together, offer the basis for a successful
analysis in a wide range of fundamental and applied sectors of fisheries and aquaculture (Sekar et al. 2009). The
development of management plans and the implementation of actions to restore stellate sturgeon within its native
stocks can benefit from an understanding of the genetic diversity of its populations. This information is helpful
in choosing donor populations to use as sources of reintroduction, as well as in formulating restoration goals
regarding the population structure. This study was aimed at analyzing inter-population genetic diversity in
stellate sturgeon by the analysis of microsatellites.
The fishes were caught from three different regions, including 43 samples from Ural (Kazakhstan), 49 samples
from Kura (Azerbaijan) and 43 samples from Sefidrud estuary (Iran) (Fig.1). Fin tissue samples were prepared
from 135 fishes of each location and preserved in 95% ethanol and stored at room temperature.
The genomic DNA was extracted following the method described by Pourkazemi et al. (1999). The quality and
concentration of DNA were assessed by 1% agarose gel electrophoresis and then stored at -20 °C until use. The
nuclear DNA was amplified using 15 microsatellite primers designed for Acipenser and Scaphirhynchus (LS-19,
434
HydroMedit 2014, November 13-15, Volos, Greece
34, 39, 54, 57, 62, 68, 69, May et al. 1997; Spl-104, 105, 113, 163, 168, 170, 173, McQuown et al. 2000.
Polymerase Chain Reaction (PCR) conditions for each primer set was optimized for stellate sturgeon. The
annealing temperatures were: 56 °C for LS-19 and Spl-113, 58 °C for LS-34 and Spl-163 /170, 59 °C for LS-54
and Spl-105, 61.2 °C for LS-68, 57 °C for Spl-104, and 58.5 °C for Spl-173. Polymerase chain reaction was
performed in 20 ιl volume containing 100 ng of template DNA, 0.5-1 pmol of each primer, 200 mM each of the
dNTPs, 0.5 U of Taq DNA polymerase and 1-2.5mM MgCl2. PCR products were separated on 6%
polyacrylamide gels (29:1 acrylamide: bis-acrylamide; 1X TBE buffer) and followed by silverstaining. The gels
were run at 170 W for 2h and 30 min. Alleles were sized using BioCapt software, and each gel contained an
allelic ladder (50bp) to assist in consistent scoring of alleles.
Allele frequencies were estimated using F-statistics and Nei‘s genetic distance. The total genetic diversity
(heterozygosity) within and among populations can be classified as follows: Ho =observed heterozygosity and
He=expected heterozygosity. Hardy-Weinberg tests of equilibrium were estimated. Wright‘s F-statistics (Wright,
1965) as follows: Fis =inbreeding coefficient within individuals relative to the subpopulation for each locus and
stellate sturgeon sampling site were assessed; Fit =the inbreeding coefficient within individuals relative to the
total; and Fst =inbreeding coefficient within subpopulations relative to the total Fst and Rst were calculated
using analysis of molecular variance (AMOVA) to estimate genetic variation among populations and regions.
AMOVA calculations and allelic richness (AR) were performed on Arlequin 3.5 (Excoffier & Lischer 2010)
using 10,000 permutations in each case. Nei‘s genetic identity and distance were determined using a pairwise,
individual-by-individual genetic distance, with all codominant data computed in GeanAlex 6 software (Peakall
& Smouse 2005). The Cornuet and Luikart (1996) programme BOTTLENECK ver. 1.2.02 was used to detect
recent effective population size reduction (to assess the impact of population decline) using data from the
microsatellites under the more suitable two-phased model (TPM).
3. Results
Overall 10 loci were successfully amplified (LS-19, 34, 54, 68, Spl-105, 104,
163, 170, 173, 113). The allele frequencies at all loci are given in Table 1. The
average number of alleles found per site was 12.1, and the number of alleles in
LS-34 ranged from 8 to 9 (AR=13), in LS-19 from 12 to 14 (AR=18), in LS-54
from 10 to 13 (AR=46), in LS-68 from 11 to 12 (AR=14), in Spl-105 from 8 to 11
(AR=11), in Spl-104 from 13 to 14 (AR=14), in Spl-163 from 11 to 14 (AR=20), in
Spl-170 from 13 to 15 (AR=24), in Spl-173 from 13 to 14 (AR=25), and in Spl-
113 from 11 to 17 (AR=15). Out of 165 observed alleles, 110 alleles occurred at
frequencies of less than 0.05 in all samples. All sampled populations contained a
significant number of private alleles. In total, 21 alleles were found, with the
number of private alleles being Ural 10 alleles, Kura 7 alleles, Sefidrud 4 alleles,
none of which was found in other seasons. The observed and expected
heterozygosity averaged 0.674 and 0.860, respectively; the observed
heterozygosity ranged from 0.349 in Sefidrud estuary to 1 in Kura (Table 1).
Bottleneck analysis of stellate sturgeon was 0.03489 in Ural, 0.05396 in Kura and 0.35963 in Sefidrud.
Figure 1. Map showing sampling locations of populations of stellate sturgeon: Ural, Kura and Sefidrud Rivers.
Estimates of inbreeding coefficient or Fis values were positive and between LS-19, -0.132; LS-34, 0.25; LS54,
0.238; LS-68, -0.5; Spl104, 0.326; Spl105, 0.073; Spl113, 0.213; Spl163, 0.097; Spl170, 0.323; Spl173, 0.395
(mean Fis =0.181; Fit=2.16), and high Fis values a relative dearth of heterozygotes and may be due to
homozygotes. In all cases, deviations from Hardy-Weinberg equilibrium were significant (P < 0.01), except for
LS-68 in Sefidrud and Spl-104 in Ural (Table 1). The Fst and Nm via frequency ranged from 0.029 to 0.038 and
from 6.284 to 8.289, respectively (Table 2) and as analyzed with AMOVA, showed a significant genetic
differentiation among sites (P<0.01), which suggested that the populations diverged from each other. Values pair
wise of Rst among samples were consistently much higher (as much as an order of magnitude) than equivalent
Fst values but the difference was not significant (P > 0.05). The genetic distance computed by Nei (1972)
between the Ural and Kura populations was 0.547, Ural and Sefidrud 0.522, and Sefidrud and Kura 0.519. The
mean genetic distance was 0.530 (±0.08) between the populations.
Table 1. Numbers of allelles observed within 3 sampling sites using 10 sets of microsatellite primers. Number of
studied
435
HydroMedit 2014, November 13-15, Volos, Greece
samples (n), Observed (Ho) and expected (He) heterozygosities, number of alleles (Na), effective allele (Ne) at 10 loci
in
three sampling sites. Loci in accordance with H-W equilibrum *P < 0.05; **P < 0.01; ***P < 0.001; ns=not significant.
Ural Kura Sefidrud Touchdown protocol
Loci Actual size (bp)
LS-19 Na/Ne 14/ 8.405 13/ 7.11 12/ 8.95 56 oC/35
Ho/He 0.977*** /0.881 1*** / 0.859 1*** /0.888 132-213
LS-34 Na/Ne 8/ 6.0 9/ 5.3 9/ 5.32 58 oC/35
Ho/He 0.442***/0.833 0.551*** /0.801 0.767***/ 0.812 132-180
LS-54 Na/Ne 11/ 5.11 13/ 8.03 10/ 4.61 59 oC/35
Ho/He 0.488*** /0.804 0.694*** /0.880 0.605***/ 0.783 152-224
LS-68 Na/Ne 12/ 9.1 11/ 7.0 12/ 5.03 61.2 oC/35
Ho/He 0.698***/ 0.891 0.633** /0.857 0.581ns /0.801 104-160
Spl104 Na/Ne 14/ 10.0 13/ 7.83 14/ 10.5 57 oC/25
Ho/He 0.744ns /0.900 0.857**/ 0.823 0.860*** /0.905 184-248
Spl105 Na/Ne 11/ 7.33 9/ 5.66 8/ 4.65 59 oC/25
Ho/He 0.372***/ 0.864 0.878*** /0.872 0.349***/ 0.785 104-180
Spl113 Na/Ne 17/ 9.5 13/ 9/78 11/ 6.0 56 oC/35
Ho/He 0.488*** /0.895 0.551*** /0.872 0.465***/ 0.869 260-348
Spl163 Na/Ne 14/ 8.7 12/ 7.82 11/ 6.0 58 oC/35
Ho/He 0.935***/ 0.885 0.980* /0.891 0.535***/ 0.833 160-244
Spl170 Na/Ne 14/ 10.35 15/ 9/16 13/ 8.9 58 oC/35
Ho/He 0.465***/ 0.903 0.735*** /0.870 0.977*** /0.888 200-264
Spl173 Na/Ne 14/ 7.67 13/ 9.72 13/ 7.0 58.5 oC/30
Ho/He 0.442*** /0.870 0.551*** /0.551 0.581***/ 0.857 176-296
Average Na/Ne 12.9/ 8.22 12.1/ 7.5 11.3/ 6.8
Ho/He 0.607 /0.873 0.743 /0.863 0.672/ 0.842
Table 2. Pairwise estimates of genetic differentiation detected at 10 loci in stellate sturgeon samples, using Nm values
(above diagonal) and Fst (below diagonal).
Nm
Samples Ural Kura Sefidrud
Ural - 8.289 6.664
Fst Kura 0.029 - 6.284
Sefidrud 0.036 0.038 -
4. Discussion
Of the 15 pairs of primers, 4 were not amplified by the PCR reaction, due to the lack of flanking sites in these
primers, possibly as the result of the high genetic distance between stellate sturgeon and the species used as
source of these primers. The proportion of polymorphic loci among the markers that did amplify decreased with
the increasing genetic distance (Cui et al. 2005).
The average number of alleles per locus and the observed heterozygosity were comparable in the populations
from the north and south of the Caspian Sea, as reported previously using RFLP on these same populations
(Shabani et al. 2006). In fact, although these populations do not differ in the amount of genetic variation
expressed as heterozygosity or alleles per loci, they differ highly for the nature of their genetic variation, which
depends on the private alleles and genotypes. The losses of alleles and heterozygosity may increase with
bottlenecking and inbreeding through time in the artificial propagation center stocks. Regular monitoring of
genetic variability among the progenies is essential to avoid the loss of current polymorphism due to inbreeding
and outbreeding.
In this study, a deviation from the H-W equilibrium was observed in most loci and no significant differences
were found between the observed and the expected heterozygosities among the populations. The significant
deviations from H-W equilibrium can be due to a bias in our samples or because we have not used species-
specific primers or as the result of null alleles occurring in the studied populations. Heterozygotes with a null
436
HydroMedit 2014, November 13-15, Volos, Greece
allele could be erroneously recorded as homozygotes for the variant allele. Similar results have been reported in
lake and white sturgeons (Rodzen and May 2002; McQuown et al. 2003; Welsh and May 2006), Chinese
sturgeon (Zhao et al. 2005) and it may also be related to sampling from mixtures of migrating populations.
In our study, structure analysis and significant Fst in all sampling sites reveal at least three populations are
genetically differentiated and not part of a single panmigric population. In fact, in the great majority of cases, the
Fst is low, because the effect of polymorphism (due to mutations) drastically deflates Fst expectations (Balloux
et al. 2002). In fish species, a negative correlation has been demonstrated between Fst values and dispersal
capability (Waples 1987). According to this, feeding and spawning migrations at this fish are the result of a
continuous movement from one part of the sea to another (Keyvan 2003). However, the loss of genetic
variability might also be caused by sampling errors. Additionally, released fingerlings with hatcheryorigin that
return to rivers to spawn may contribute to the loss of regional genetic differentiation (Vasemägi et al. 2005).
Shaklee et al. (1982) and Thorpe and Sol-Cave (1994) showed that the Nei (1972) genetic distance values
averaged 0.05 (range: 0.002-0.07) for con-specific populations and 0.30 (range: 0.03-0.61) for con-generic
species. The distance value obtained in the present study (Table 4) falls within the average value of con-generic
species, which indicates that the genetic difference among the studied populations was pronounced.
In summary, this study provides preliminary evidence for the existence of at least three differentiated
populations in the Caspian Sea, including the Ural, Volga, Sefidrud and Gorganrud populations. Probably in
each river more than one population exists, suggesting that more samples from each river should be investigated.
Characterizing the genetic structure of A. stellatus currently being used in the aquaculture industry will aid for
future breed stock development and will improve management plans aimed at conserving diversity and
minimizing inbreeding in artificial propagation.
Acknowledgments
We thank all those support provided by Iranian Fishery Research Organization (Project Cod 82-0710441000-
53); Molecular Genetic Lab of the International Sturgeon Research Institute, Rasht.
References
Balloux F., Lugon-Moulin N. (2002). The estimate of population diffraction with microsatellite markers.
Molecular Ecology 11,155- 165.
Chistiakov D. A., Hellemans B., Haley C. S., Law A. S., Tsigenopoulos C. S., Kotoulas G., Bertotto D.,
Libertini A., Volckaert F. A., 2005. A microsatellite linkage map of the European sea bass Dicentrarchus labrax
L. Genetics, 170:1821–1826.
Cornuet, J. M., Luikart G. (1996). Description and power analysis of two tests for detecting recent population
bottlenecks from allele frequency data. Genetics 144, 2001-2014
Cui J.Z, Shen X.Y., Yang G.P., Gong Q.L., Gu Q.Q. (2005). Characterization of microsatellite DNAs in
Takifugu rubripes genome and their utilization in the genetic diversity analysis of T. rubripes and T.
pseudommus. Aquaculture 250, 129–137.
Excoffier L., Lischer H.E.L. (2010) Arlequin suite ver 3.5: a new series of programs to perform population
genetics analyses under Linux and Windows. Molecular Ecology Resource 10, 564–567.
Keyvan A. (2003). Iranian sturgeons in the Caspian Sea. Iranian Fisheries Company. pp. 101-102.
McQuown E., Sloor B.L., Sheehen R.J., May B. (2000). Microsatellite analysis of genetic variation in sturgeon:
new primer sequences for Scaphyrhinchus and Acipenser. American Fisheries Society 129, 1380-1388.
McQuown E., Krueger C.C., Kincaid H.L., Gall A.E., May B. (2003). Genetic comparison of Lake Sturgeon
population: Differentiation based on allelic frequencies at seven microsatellite loci. Journal of Great Lakes
Research 29, 3-13.
May B., Charles C., Krueger C., Kincaid L. (1997). Genetic variation at Microsatellite loci in sturgeon primer
sequence homology in Acipenser and Scaphirhenchus. Canadian Journal of Fisheries and Aquatic Sciences 54,
1542-1547.
Nei M. (1972). Genetic distance between populations. American Naturalist 106, 283-292.
Peakall R., Smouse P.E. (2005). GenAlEx 6: Genetic Analysis in Excel. Population genetic software for teaching
and research. The Australian National University Canberra Australia. Available at:
http://www.anu.edu.au/BoZo/GenAlEx.
437
HydroMedit 2014, November 13-15, Volos, Greece
Pourkazemi M., Skibinski D.O.F., Beardmore J.A. (1999). Application of mtDNAd-loop region for the study of
Russian sturgeon population structure from Iranian coastline of the Caspian Sea. Journal of Applied Ichthyology
15, 23-28.
Pourkazemi M. (2006). Caspian Sea sturgeon conservation and fisheries past, present and future. Journal of Applied
Ichthyology 22 (suppl.1): 1-4.
Rodzen J.A., May B. (2002). Inheritance of microsatellite loci in the polyploid white sturgeon (Acipenser
transmontanus). Genome 54, 1064-1076.
Shabani A., Pourkazemi M., Rezvani S. (2006). Study of mtDNA variation of stellate sturgeon (Acipenser
stellatus) population from the north (Volga River) and South (Sefidrud River) Caspian Sea using RFLP analysis
of PCR Amplified ND 5/6 gene regions. Journal of agricultural science and natural resources 12, 195-204 (In
Persian).
Sekar M., Suresh E., Kumar N.S., Nayak S.K., Balakrishna C. (2009). Microsatellite DNA markers, a fisheries
perspective Part 1: The nature of microsatellites. Aquaculture Asia Magazine. pp. 27-29.
Shaklee J.B., Tamaru CS, Waples R.S. (1982). Speciation and evolution of marine fishes studied by
electrophoretic analysis of proteins. Pacific Science 36, 141-157.
Thorpe JP, Sole-Cava A.M. (1994). The use of allozyme electrophoresis in invertebrate systematics. Zoologica
Scripta 23, 3- 18.
Vasemägi A.M., Gross R., Paavo T., Koljonen M.L., Nilsson J. (2005). Extensive immigration from
compensatory hatchery releases into wild Atlantic salmon populations in the Baltic sea: spatio-temporal analysis
over 18 years. Heredity 95, 76-83.
Velikova V.N., Shaudanov A.K., Gasimov A., Korshenko A., Abdoli A., Morozov B., Katunin D. N.,
Mammadov E., Bokova E. B., Emadi H., Annachariyeva J., Isbekov K., Akhundov M., Milchakova, N.,
Muradov O., Khodorevskaya R., Shahifar R., Shiganova, T., Zarbaliyeva T. S., Mammadli T., Velikova, V.,
Barale, V., Kim Y. (2012). Review of the environment and bioresources in the Caspian Sea ecosystem 2000-
2010. CaspEco Report, pp 423.
Waples R.S. (1987). A multispecies approach to the analysis of gene flow in marine shore fishes. Evolution 41,
385–400.
Welsh A., May B. (2006). Development and standardization of disomic microsatellite markers for lake sturgeon
genetic studies. Journal of Applied Ichthyology 22, 337–344.
Zhao N., Ai W., Shao Z.l., Zhu B., Brosse S., Chang J. (2005). Microsatellites assessment of Chinese sturgeon
(Acipenser sinensis Gray) genetic variability. Journal of Applied Ichthyology 21, 7-13.
Wright S. (1965). The interpretation of population structure by F-Statistics with special regard to systems of
mating. Evolutionary 19, 395-420.
438
HydroMedit 2014, November 13-15, Volos, Greece
1
Amvrakikos Wetlands‘ Management Body, Dimotiko Katastima Anezas, 47100 Aneza Arta, Greece
2
The sea turtle Protection Society of Greece ARCHELON, Solomou 57 10432 Athens, Greece
Abstract
The Amvrakikos Wetlands‘ National Park is a Protected Area, in which a variety of threatened species live
together with stakeholders that exploit the natural resources. This investigation deals with the antagonistic action
between the fishermen and the loggerhead turtle Caretta caretta. A semi-structured questionnaire, which was
used for the investigation, has shown that this antagonistic action is related to the decline of the fish stocks
(encouraging the abuser-victim relation) and the seasonal fishing bans of some commercial species, i.e. the local
shrimp Melicertus kerathurus (encouraging the unreported fishing).
1
Φμνέαξ Γζαπείνζζδξ Τβνμηυπςκ Αιαναηζημφ, Γδιμηζηυ Καηάζηδια Ακέγαξ, 47100 Ακέγα Άνηαξ, Δθθάδα
2
φθθμβμξ βζα ηδκ Πνμζηαζία ηδξ Θαθάζζζαξ Υεθχκαξ ΑΡΥΔΛΧΝ, μθςιμφ 57 10432 Αεήκα, Δθθάδα
Πεξίιεςε
Σμ Δεκζηυ Πάνημ Τβνμηυπςκ Αιαναηζημφ απμηεθεί ιζα Πνμζηαηεουιεκδ Πενζμπή, ζηδκ μπμία ζοκοπάνπμοκ
ιζα πμζηζθία απεζθμφιεκςκ εζδχκ ηαοηυπνμκα ιε έκα ιςζασηυ πνήζεςκ. Ζ ένεοκα αοηή αββίγεζ εέιαηα
ακηαβςκζζηζηήξ δνάζδξ ηςκ αθζέςκ ιε ηδ εαθάζζζα πεθχκα Caretta caretta. φιθςκα ιε ημ διζ-δμιδιέκμ
ενςηδιαημθυβζμ πμο πνδζζιμπμζήεδηε, ιπμνμφιε κα ζοιπενάκμοιε υηζ μ ακηαβςκζζιυξ αθζέα-εαθάζζζαξ
πεθχκαξ ζπεηίγεηαζ ιε ηδ ιείςζδ ηςκ ζπεοαπμεειάηςκ (μπυηε εκεαννφκεηαζ δ ζπέζδ εφηδ-εφιαημξ) ηαζ ιε ηδκ
επμπζηή απαβυνεοζδ αθίεοζδξ ηάπμζςκ ειπμνζηχκ εζδχκ, υπςξ δ κηυπζα γαξίδα Melicertus kerathurus (μπυηε
εκεαννφκεηαζ δ θαεναία αθζεία).
Λέξειρ κλειδιά: αιηεία, ζαιάζζηα ρειώλα, Ακβξαθηθόο
οββναθέαξ επζημζκςκίαξ: Κχκζηαξ πφνμξ (foreas_amvrakikou@yahoo.gr)
1. Δηζαγσγή
Ο εαθάζζζμξ πχνμξ ημο Αιαναηζημφ Κυθπμο ζοιπενζθαιαάκεζ 256 km αηημβναιιήξ ηαζ ειπίπηεζ ζημ
Δεκζηυ Πάνημ Τβνμηυπςκ Αιαναηζημφ. Ο Αιαναηζηυξ Κυθπμξ απμηεθεί ιζα ηθεζζηή εαθάζζζα έηηαζδ 405
km2 πενίπμο, ζηδκ μπμία ημ οδαηζηυ ζζμγφβζμ ελανηάηαζ απυ ηα δφμ ιεβάθα πμηάιζα πμο εηαάθθμοκ ζε αοηυκ,
439
HydroMedit 2014, November 13-15, Volos, Greece
ημ Λμφνμ ηαζ ημκ Άναπεμ. Αοηά ηα πμηάιζα είκαζ ηαεμνζζηζηά βζα ηδκ οδνμβναθία ηδξ πενζμπήξ ηαζ
δδιζμφνβδζακ ηζξ πανάηηζεξ θζικμεάθαζζεξ (πενζζζυηενεξ απυ 20) ηαζ ζπάκζμοξ οβνυημπμοξ, πμο απμηεθμφκ
μζηυημπμοξ πνμηεναζυηδηαξ ημο δζηηφμο NATURA2000. Ζ θεζημονβία ηςκ πμηαιχκ ηαεμνίγεζ ηα
παναηηδνζζηζηά ηδξ εαθάζζζαξ έηηαζδξ ημο Αιαναηζημφ, δδθαδή ηα νεφιαηα, ηδ εενιμηναζία, ηδκ αθαηυηδηα
ηαζ άθθα θοζζημπδιζηά ηαζ ςηεακμβναθζηά ζημζπεία ηδξ ζηήθδξ ημο κενμφ ημο. Σμ αάεμξ ημο Αιαναηζημφ
αββίγεζ πενίπμο ηα 65 ιέηνα ημ ιέβζζημ, ςζηυζμ ιεβάθμ πμζμζηυ ηςκ πανάηηζςκ πενζμπχκ ηοιαίκεηαζ απυ 0
έςξ 5 ιέηνα αάεμξ.
Ζ εαθάζζζα πεθχκα πνμζηαηεφεηαζ απυ εθθδκζηή, εονςπασηή ηαζ δζεεκή κμιμεεζία, εκχ
παναηηδνίγεηαζ ςξ είδμξ απεζθμφιεκμ αάζεζ ηδξ ηυηηζκδξ θίζηαξ ηδξ IUCN. οβηεηνζιέκα, ημ είδμξ ακαθένεηαζ
ζηζξ οιαάζεζξ ηδξ Οοάζζκβηημκ βζα ημ δζεεκέξ ειπυνζμ ηςκ απεζθμφιεκςκ εζδχκ (CITES), ηδξ Βένκδξ (πμο
εκανιμκίζηδηε ιε ημ Νυιμ 1335/1983), ηδξ Βυκκδξ βζα ηδκ πνμζηαζία ηςκ ιεηακαζηεοηζηχκ εζδχκ, ηδξ
Βανηεθχκδξ (UNEP πμο εκανιμκίζηδηε ιε ημ Νυιμ 1634/1986). ημ εθθδκζηυ δίηαζμ ακαθένεηαζ ημ Π.Γ. 617
(ΦΔΚ 163A/18-7-1980), πμο απαβμνεφεζ ηδκ αθζεία, ηδκ ηαηαζηνμθή ηςκ αοβχκ ηαζ ηδ ζοθθμβή κεμζζχκ ηαζ
ημ Π.Γ 67 (ΦΔΚ 23A/30-1-1981 ηαζ 43A/18-2-1981) πμο παναηηδνίγεζ ηδκ Caretta caretta, Chelonia mydas,
Dermochelys coriacea ςξ πνμζηαηεουιεκα είδδ πακίδαξ ηαζ απαβμνεφεζ ηδ εακάηςζδ, ηαημπμίδζδ, ειπμνία,
ηαημπή, ηθπ..
ημ Δεκζηυ Πάνημ Τβνμηυπςκ Αιαναηζημφ οπάνπεζ έκα ιςζασηυ πνήζεςκ ηςκ θοζζηχκ πυνςκ, μζ
μπμίεξ θαιαάκμκηαζ οπυρδ ηαηά ηδ δζαπείνζζδ. Οζ δζάθμνεξ πνήζεζξ θαιαάκμοκ πχνα ηυζμ ζημ πενζαίμ, υζμ
ηαζ ζημ οδάηζκμ ηιήια ηδξ Πνμζηαηεουιεκδξ Πενζμπήξ. Οζ ηονζυηενεξ πνήζεζξ πμο απακηχκηαζ ζηδκ πενζμπή
είκαζ δ βεςνβία, δ ηηδκμηνμθία ηαζ δ αθζεία. Οζ ηάημζημζ ημο ηυπμο αζπμθμφκηαζ ζε ιεβάθμ ααειυ ιε ημκ
πνςημβεκή ημιέα ηαζ δεοηενεουκηςξ ιε ηδ ιεηαπμίδζδ ηςκ πνμσυκηςκ αοηχκ.
Καηά ηδκ εκαζπυθδζή ημοξ μζ κηυπζμζ ιε ηδκ αθζεία ζε ιζα πενζμπή ιε ηέημζμ θοζζηυ πθμφημ, ένπμκηαζ
ζοπκά ακηζιέηςπμζ ιε ακηαβςκζζηζηά άβνζα είδδ. Έκα ηέημζμ είδμξ είκαζ εαθάζζζα πεθχκα Caretta caretta, δ
μπμία δε βεκκά ζημκ Αιαναηζηυ αθθά έπεζ έκημκδ πανμοζία ηαζ ηνέθεηαζ ζηδκ πενζμπή.
Ο ακηαβςκζζιυξ ηδξ εαθάζζζαξ πεθχκαξ ιε ημοξ αθζείξ έβηεζηαζ ηονίςξ ζημ βεβμκυξ υηζ ηαζ μζ δφμ
ράπκμοκ ηδκ ίδζα θεία. Φανεφμκηαξ ηα ίδζα πνάβιαηα ηαοημπνυκςξ οπάνπεζ ζοπκά ηαηαζηνμθή ηςκ αθζεοηζηχκ
ενβαθείςκ απυ ηζξ εαθάζζζεξ πεθχκεξ. Δζδζηά βζα ηζξ μζηναημηαθθζένβεζεξ πμο είκαζ ζηαεενέξ εβηαηαζηάζεζξ, δ
εαθάζζζα πεθχκα ανίζηεζ ανηεηή δζαεέζζιδ ηνμθή ζηζξ ανιαεζέξ ηζξ μπμίεξ ηαηαζηνέθεζ. Ζ ζφβηνμοζδ αοηή
μλφκεηαζ ηαηά ηδκ ηαθμηαζνζκή πενίμδμ, υηακ δ πανμοζία ημο είδμοξ αολάκεηαζ. Σδκ ηαθμηαζνζκή πενίμδμ
ακαβκςνίγμκηαζ ηαζ ηα πενζζζυηενα ηνμφζιαηα ρυθζςκ πεθςκχκ πμο λεανάγμκηαζ ζηζξ αηηέξ ηδξ
Πνμζηαηεουιεκδξ Πενζμπήξ.
Σμ εέια αοηυ είκαζ ιείγμκ βζα ηδ δζαηήνδζδ ηδξ άβνζαξ γςήξ, ηαεχξ πμθθμί απυ ημοξ πνήζηεξ
εακαηχκμοκ ή ηαημπμζμφκ ηζξ πεθχκεξ αοηέξ, εεςνχκηαξ υηζ εα ιεζςεεί μ ανζειυξ ημοξ ή απυ εηδίηδζδ εθυζμκ
δεκ έπμοκ πνμζηαζία απυ ηδκ Πμθζηεία. Σμ γήηδια αοηυ δζενεοκήεδηε υπςξ θαίκεηαζ παναηάης.
440
HydroMedit 2014, November 13-15, Volos, Greece
Δζηυκα 1: Θαθάζζζα πεθχκα Caretta caretta λεαναζιέκδ ζηδκ αηηή ζε πνμπςνδιέκδ ζήρδ
3. Απνηειέζκαηα
Σμ δθζηζαηυ πνμθίθ ημο δείβιαημξ ηςκ αθζέςκ πμο ζοιιεηείπακ ζηδκ ένεοκα ήηακ ηαηά ιέζμ υνμ 47
εηχκ (απυ 23 έςξ 80 εηχκ). Σα έηδ εκαζπυθδζδξ ηςκ αθζέςκ ήηακ ηαηά ιέζμ υνμ 23 πνυκζα εκαζπυθδζδξ ιε
ηδκ αθζεία (απυ 2 έςξ 62 πνυκζα).
Σα αθζεοηζηά ενβαθεία πμο ακαθένεδηακ ζηδκ ένεοκα είκαζ ζηαηζηά ενβαθεία βζα ηδκ άζηδζδ ηδξ
πανάηηζαξ αθζείαξ ηαζ άθθα ενβαθεία νίρδξ. Γζα ηδκ πανάηηζα αθζεία ακαθένεδηακ ζπεομπαβίδεξ (αμθημί,
κηαμφθζα), δίπηοα (ιακζςιέκα, απθάδζα, ζφκεεηα), παναβάδζα ηαζ άθθα ενβαθεία νίρδξ (πεγυαμθμξ).. Σα
ενβαθεία αοηά πνδζζιμπμζμφκηαζ εονφηαηα ζηδκ πενζμπή απυ ηδκ πθεζμρδθία ηςκ ρανάδςκ ηαζ είκαζ
ακηζπνμζςπεοηζηά.
Σα ζηάθδ πμο ακαθένεδηακ υηζ πνδζζιμπμζμφκηαζ απυ ημοξ αθζείξ είκαζ ιζηνά αθζεοηζηά ζηάθδ, υπςξ
είκαζ ηα πνζάνζα ηαζ μζ βαΐηεξ, ηα μπμία είκαζ αηανίκςηα παναδμζζαηά ζηάθδ ηδξ πενζμπήξ πμο
πνδζζιμπμζμφκηαζ εονφηαηα βζα ηα αααεή. Δπίζδξ, ακαθένεδηακ ηαζ ιεβαθφηενα αθζεοηζηά ζηάθδ, υπςξ είκαζ
μζ ηνάηεξ ηαζ ηα ηνεπακηήνζα.
Σα είδδ ρανζχκ πμο αθζεφμκηαζ ζηδκ πενζμπή είκαζ ηεθαθμεζδή, ηζζπμφνα, ημοηζμιμφνα, ζανδέθα.
Δπίζδξ, ζημκ Αιαναηζηυ Κυθπμ αθζεφμκηαζ πέθζα, βανίδα ηαζ ηεθαθυπμδα (ζμοπζέξ, πηαπυδζα). Ζ ιεβάθδ
πθεζμρδθία (91%) ηςκ ρανάδςκ βκςνίγεζ υηζ δ πεθχκα Caretta caretta πνμζηαηεφεηαζ, αθθά δε ζοιθςκμφκ ιε
441
HydroMedit 2014, November 13-15, Volos, Greece
αοηυ, ηαεχξ δδθχκμοκ υηζ «έπεζ αολδεεί ηα ηεθεοηαία πνυκζα έκακηζ ηδξ πνάζζκδξ πεθχκαξ (Chelonia mydas)
ηαζ δε πνήγεζ ζδζαίηενδξ πνμζηαζίαξ». Πμθθμί ρανάδεξ (42%) βκςνίγμοκ πςξ δ εαθάζζζα πεθχκα Caretta
caretta πνδζζιμπμζεί ηδκ πενζμπή ςξ πεδίμ ηνμθμθδρίαξ, εκχ ανηεημί (34%) δεκ λένμοκ ημ θυβμ βζα ημκ μπμίμ δ
εαθάζζζα πεθχκα είκαζ πανμφζα ζηδκ πενζμπή. Τπάνπεζ επίζδξ έκα ιζηνυ πμζμζηυ (10%) πμο δδθχκεζ υηζ ηζξ
πεθχκεξ Caretta caretta «ηάπμζμζ ηζξ έθενακ ζημκ Αιαναηζηυ Κυθπμ», εκχ παθζυηενα δεκ οπήνπακ ζηδκ
πενζμπή.
Γζα ηζξ δζαηνμθζηέξ ζοκήεεζεξ ηςκ εαθάζζζςκ πεθςκχκ μζ αθζείξ απακημφκ υηζ ηνχκε ηα ράνζα
ιαζχκηαξ ηα ζημ δίπηο αθήκμκηαξ ηνφπεξ ζημ δίπηο. Πμθθμί απακημφκ πςξ δ πεθχκα έπεζ πνμηίιδζδ ζηδκ
ημοηζμιμφνα, έκακηζ ηςκ άθθςκ ρανζχκ πμο ανίζημοκ ζηα δίπηοα. Χζηυζμ, πμθθμί αθζείξ δδθχκμοκ πςξ δ
εαθάζζζα πεθχκα έπεζ πνμηίιδζδ ζηα ράνζα πμο μζ ίδζμζ αθζεφμοκ. Σέθμξ, ηα αθζεοηζηά ενβαθεία ζηα μπμία
πζάκμκηαζ μζ εαθάζζζεξ πεθχκεξ αθμνμφκ ηονίςξ δίπηοα 87%, δεοηενεουκηςξ ηαθάιζα/πεημκζέξ 7%, κηαθζάκζα
3% ηαζ παναβάδζα 3%. Πάκηςξ, ζδιακηζηυ πμζμζηυ ηςκ ρανάδςκ ζοιθςκεί υηζ ηα αθζεφιαηα θείκμοκ,
ακηακαηθχκηαξ ηδκ παβηυζιζα ηάζδ ηςκ αθζεοηζηχκ πυνςκ.
Πίλαθαο 1: Δκπινθή ζε αιηεπηηθά εξγαιεία θαη ηξαχκαηα πνπ έθεξαλ νη ζαιάζζηεο ρειψλεο Caretta
caretta πνπ παξαηεξήζεθαλ ζην πεδίν θαηά ηε δηάξθεηα ηνπ θαινθαηξηνχ ηνπ 2013
Σξαπκαηηζκέλεο ρειψλεο Caretta caretta (20 απφ 131 πνπ καξθαξίζηεθαλ)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Έθενακ:
Αβηίζηνζ
Πεημκζά •
πμζκί •
Σναφια ζημ
• • •
ηεθάθζ
Σναφια ζημ
• • • • • • • • • • • • • • • •
ηααμφηζ
Σναφια ζημ
• • • • • • • •
πηενφβζμ
Άθθμ αίηζμ •
θμζ μζ αθζείξ (100%) πμο νςηήεδηακ απάκηδζακ πςξ μζ ίδζμζ πνμζςπζηά ή ηάπμζμζ ηνίημζ έπμοκ
ακηζιεηςπίζεζ πνμαθήιαηα ιε ηζξ εαθάζζζεξ πεθχκεξ. Ζ ζοκηνζπηζηή πθεζμρδθία ημοξ (69%) απακηά υηζ
πνυηεζηαζ βζα ιεβάθδξ ηθίιαηαξ πνμαθήιαηα ζηα αθζεοηζηά ενβαθεία, ζδίςξ θίβα θεπηά ιεηά ημ λδιένςια.
ηδκ ενχηδζδ πχξ ακηζιεηςπίγμοκ μζ ίδζμζ ηδκ πενίπηςζδ εβηθςαζζιμφ ζηα αθζεοηζηά ενβαθεία ημ
91% απάκηδζε πςξ ηζξ εθεοεενχκεζ εθυζμκ είκαζ αηυια γςκηακή, ημ 4% δεκ απάκηδζε, εκχ 2 αθζείξ (4%)
απάκηδζακ υηζ ηζξ ζημηχκμοκ. Πανυθα αοηά υηακ νςηήεδηακ ακ λένμοκ βζα άθθμοξ αθζείξ υηζ αθάπημοκ
εαθάζζζεξ πεθχκεξ, ημ 67% ηςκ ενςηδεέκηςκ απάκηδζε υηζ έπεζ αημφζεζ ζζημνίεξ υηζ άθθμζ ρανάδεξ
ζημηχκμοκ ηζξ εαθάζζζεξ πεθχκεξ. Ακ ηαζ ακδζοπδηζηή, δ έιιεζδ αοηή πθδνμθμνία δεκ επζηνέπεζ πμζμηζηέξ
εηηζιήζεζξ. Ζ άιεζδ παναηήνδζδ ηαζ ηαηαβναθή ημο ανζειμφ ηςκ κεηνχκ ή ηναοιαηζζιέκςκ γχςκ ηαζ μζ
δζαπνμκζηέξ ηάζεζξ ημο παναιέκεζ δ πζμ απμδμηζηή ιέεμδμξ.
442
HydroMedit 2014, November 13-15, Volos, Greece
Πίλαθαο 2: Απεηιέο γηα ηελ Caretta caretta ζε ζηεξηά θαη ζάιαζζα ζηελ πεξηνρή ηνπ Δζληθνχ Πάξθνπ θαη
πξνηεξαηφηεηα αληηκεηψπηζεο
ΠΡΟΣΔΡΑΗΟΣΖΣΑ
ΑΠΔΗΛΔ
ΑΝΣΗΜΔΣΧΠΗΖ
Δζθεκκέλε ζλεζηκόηεηα/ηξαπκαηηζκνί
Υηοπήιαηα ζε ηεθάθζ ηαζ ηααμφηζ, ηναφιαηα ζε πηενφβζα Τρδθή
Με εζθεκκέλε ζλεζηκόηεηα
Καηάπμζδ – παβίδεοζδ ζε αβηίζηνζα ηαζ πεημκζέξ Μέζδ (Ακάβηδ δζενεφκδζδξ)
Παβίδεοζδ ζε δίπηοα Μέζδ (Ακάβηδ δζενεφκδζδξ)
Σναφιαηα ζε ηεθάθζ ηαζ ηααμφηζ απυ πνμζηνμφζεζξ ζε ζηάθδ Τρδθή
4.πδήηεζε
Καηά ηδ δζελαβςβή ηδξ ένεοκαξ θάκδηε υηζ μζ ρανάδεξ έπμοκ έκα ακηζηεζιεκζηυ πνυαθδια, πμο
ζπεηίγεηαζ ιε ηζξ γδιίεξ πμο πνμηαθμφκηαζ ζηα αθζεοηζηά ημοξ ενβαθεία υηακ μζ εαθάζζζεξ πεθχκεξ ειπθαημφκ
ζε αοηά.
Οζ έιπεζνμζ αθζείξ δζαπζζηχκμοκ ζε ιεβάθμ πμζμζηυ ηδκ ιείςζδ ηςκ ζπεοαπμεειάηςκ ζε ζπέζδ ιε ημ
πανεθευκ, ηάηζ ημ μπμίμ ιενζημί απυ αοημφξ ζπεφδμοκ κα ημ απμδχζμοκ ηαζ ζηζξ εαθάζζζεξ πεθχκεξ Caretta
caretta. εκχ ηαοηυπνμκα δεκ είκαζ ανκδηζημί πνμξ ηζξ πνάζζκεξ πεθχκεξ Chelonia mydas, πμο δδθχκμοκ πςξ
ήηακ μζ ιυκεξ πανμφζεξ παθζυηενα ζηδκ πενζμπή.
οιπεναζιαηζηά, απυ ηδκ ένεοκα ηαζ απυ ζημζπεία πνμδβμφιεκςκ εηχκ πνμηφπηεζ υηζ, πανυθα ηα
πνμαθήιαηα πμο δδιζμονβμφκ μζ εαθάζζζεξ πεθχκεξ Caretta Caretta ζηα αθζεοηζηά ενβαθεία ηςκ αθζέςκ, δ
εζηειιέκδ εακάηςζδ ηςκ πεθςκχκ απυ ημοξ αθζείξ έπεζ ηδκ ηάζδ κα πενζμνίγεηαζ.. Δκδεζηηζηυ είκαζ υηζ πμθθμί
αθζείξ οπμζηήνζλακ θζθμπενζααθθμκηζηέξ εέζεζξ ηαζ έδεζλακ εοαζζεδζία βζα ηζξ εαθάζζζεξ πεθχκεξ,
ακαβκςνίγμκηαξ ηδ ζδιαζία ημοξ βζα ημ μζημζφζηδια ημο Αιαναηζημφ Κυθπμο. οκεπχξ μζ ιαηνμπνυκζεξ
πνμζπάεεζεξ εκδιένςζδξ ηαζ εοαζζεδημπμίδζδξ θαίκεηαζ κα απμδίδμοκ. Σμ θαζκυιεκμ ηδξ εζηειιέκδξ
εακάηςζδξ ηςκ εαθαζζίςκ πεθςκχκ ζπεηίγεηαζ άιεζα ιε ηδ θαεναία αθζεία (ππ. δίπηοα, ζονυιεκα ενβαθεία),
υπςξ δείπκμοκ ηα δεθηία εηεαθάζζςζδξ εαθάζζζςκ πεθςκχκ (φθθμβμξ βζα ηδκ Πνμζηαζία ηδξ Θαθάζζζαξ
Υεθχκαξ ΑΡΥΔΛΧΝ). Γζα πανάδεζβια, μζ εηεαθαζζχζεζξ ηαημπμζδιέκςκ εαθάζζζςκ πεθςκχκ αολάκμκηαζ ηδκ
ηαθμηαζνζκή πενίμδμ, υηακ δ πανμοζία ηδξ εαθάζζζαξ πεθχκαξ αολάκεηαζ ηαζ λεηζκά δ απαβυνεοζδ ηδξ
αθίεοζδξ ηδξ βάιπανδξ (Melicertus kerathurus). Ο πενζμνζζιυξ ηδξ θαεναθζείαξ εα ζοκεζζθένεζ ζδιακηζηά
ζηδκ πνμζηαζία ημο είδμοξ πενζμνίγμκηαξ ημοξ δεεθδιέκμοξ ηναοιαηζζιμφξ ή εακαηχζεζξ. Μζα αηνζαέζηενδ
πενζβναθή ηαζ εηηίιδζδ ηςκ αημοζίςκ ηναοιαηζζιχκ εα ιπμνμφζε κα αμδεήζεζ ζημκ πενζμνζζιυ ηαζ αοημφ ημο
θαζκμιέκμο.
Γζα ηδκ ακηζιεηχπζζδ ηςκ ζοιαάκηςκ αοηχκ, είκαζ απαναίηδηδ ιζα ιαηνμπνυεεζιδ εηζηναηεία
εκδιένςζδξ ιε ζημπυ ηδκ αθθαβή ηδξ ζηάζδξ ηςκ πνδζηχκ έκακηζ ηςκ εζδχκ ηδξ άβνζαξ πακίδαξ. Με ηδκ
εηζηναηεία εκδιένςζδξ πνμηείκεηαζ πανάθθδθα κα βίκεζ εκδιένςζδ βζα ηδκ μζημθμβία ηςκ εζδχκ ηδξ άβνζαξ
πακίδαξ. διακηζηή ηνίκεηαζ δ ζοζπέηζζδ ηςκ αθζεοηζηχκ ενβαθείςκ, ηςκ εακάηςκ ηςκ πεθςκχκ ηαζ ηδξ
πνυηθδζδξ γδιζχκ ζημοξ αθζείξ απυ ηζξ εαθάζζζεξ πεθχκεξ, δ μπμία απαζηεί δζαθμνεηζηή ιεεμδμθμβία (Laurent
et al. 2001, Margaritoulis et al. 2003, Deflorio et al. 2005, FISH/2005/28A Final Report to the the Directorate-
General for Fisheries and Maritime Affairs 2008) ιε ελεζδζηεοιέκμ ζπεδζαζιυ βζα ηδ ζοθθμβή ηςκ δεδμιέκςκ
ηαζ δνάζεζξ υπςξ: πανμοζία ενεοκδηχκ (onboard-observers) ζε αθζεοηζηά ζηάθδ βζα ηδκ επζηυπμο ηαηαβναθή
ημο θαζκμιέκμο, εεεθμκηζηή ηαηαβναθή απυ ζοκενβαγυιεκμοξ αθζείξ, ένεοκα ιε ενςηδιαημθυβζα, δζαηναηζηή
ζοκενβαζία ηθπ.
Ζ ένεοκα δζελήπεδ ζηα πθαίζζα ημο Γζαζοκμνζαημφ Πνμβνάιιαημξ Δδαθζηήξ οκενβαζίαξ «Δθθάδα-
Ηηαθία 2007-2013» PRO.ACT.NATURA2000 ηαζ εκηάζζεηαζ ζημκ Άλμκα πνμηεναζυηδηαξ 3 «Βεθηίςζδ ηδξ
πμζυηδηαξ γςήξ, πνμζηαζία ημο πενζαάθθμκημξ ηαζ ακάπηολδ ηδξ ημζκςκζηήξ ηαζ πμθζηζζηζηή ζοκμπήξ» ηυπμξ
3.2: Πνμχεδζδ ηαζ αεθηίςζδ ηδξ απυ ημζκμφ πνμζηαζίαξ ηαζ δζαπείνζζδξ ηςκ θοζζηχκ πυνςκ, πνυθδρδ ηςκ
θοζζηχκ ηαζ ηεπκμθμβζηχκ ηζκδφκςκ βζα ημ Φμνέα Γζαπείνζζδξ Τβνμηυπςκ Αιαναηζημφ.
443
HydroMedit 2014, November 13-15, Volos, Greece
Βηβιηνγξαθία
Κεθάιαην ζε βηβιίν
Ζιεθηξνληθή Βηβιηνγξαθία
φθθμβμξ βζα ηδκ Πνμζηαζία ηδξ Θαθάζζζαξ Υεθχκαξ ΑΡΥΔΛΧΝ. Γεθηίμ εηεαθάζζςζδξ εαθάζζζςκ
πεθςκχκ http://www.archelon.gr/files/Deltio_Ekthalassosis.pdf (Πνυζααζδ 21-10-2014)
Φμνέαξ Γζαπείνζζδξ Τβνμηυπςκ Αιαναηζημφ http://www.amvrakikos.eu (Πνυζααζδ 21-10-2014)
FISH/2005/28A – Service Contract SI2.439703 ‗Assessment of turtle bycatch‘. Final Report to the the
Directorate-General for Fisheries and Maritime Affairs, February (2008)
http://ec.europa.eu/fisheries/documentation/studies/turtle_bycatch_2008_en.pdf (Πνυζααζδ 21-10-2014)
444
HydroMedit 2014, November 13-15, Volos, Greece
1 Department of Marine Biology and Fisheries Sciences, Tonekabon Branch, Islamic Azad University,
Tonekabon, Iran.
ABSTRACT
Genetic structure of golden mullet, Liza aurata, investigated in the Fereydoon-Kenar and Raamsar costs (south
Caspian Sea, Iran) using 6 microsatellite markers designed for gray mullet (Mugil cephalus) and hand mullet (M.
soiuy). Totally 60 samples of adult golden mullet were collected from these regions. All primer sets as
polymorphic loci were used to analyze the genetic variation. Analyses revealed that average of alleles (Na) per
locus was 6.2 (range 3 to 9 alleles). All sampled regions contained private alleles. The average estimates of
inbreeding coefficient (Fis) values of 6 microsatellites were positive. The average observed and expected
heterozygosity was 0.394 and 0.743 respectively. Deviations from Hardy-Weinberg equilibrium were in all cases
(P<0.001). F-statistics (Fst) and gene flow (Nm) estimates in allele frequencies were 0.078 and 2.9 respectively.
Rst and Fst estimates in AMOVA indicated significant genetic differentiation among regions (P<0.01). Genetic
distance was 0.679, indicating that the genetic difference among the studied populations is pronounced. The data
generated in this study provides the genetic variation and differentiation in populations of golden mullet in the
southern Caspian Sea (Mazandaran province).
Keywords: golden mullet, Liza aurata, population genetic, microsatellite, Caspian Sea
Introduction
Golden grey mullet, Liza aurata (Risso, 1810) is a typical marine schooling fish. It was introduced into the
Caspian from the Black Sea (targeted acclimatization) and spread widely within the Caspian Sea, except for the
estuarine sea areas. Golden grey mullet is found in the southern part of the sea throughout the year; in the Middle
Caspian it appears in spring and migrates back to the south in autumn. It is rarely caught in the northern part of
the sea, except in Mangyshlak area. In early March, following the rise in water temperature, it starts migration
from the southern feeding grounds. In April, it appears in the Middle Caspian. During migration, it feeds
intensively, preferring shallow coastal areas (Velikova et al., 2012).
Golden mullet is a euryhaline fish, sensitive to a decrease in water temperature. Age of maturity 3-4 years old.
Spawning takes place in the open sea, at great depths (400-500 m) and upon available aquatic vegetation. The
species winters in the southern part of the Caspian. The fish is concentrated mostly in the sectors with rich
marine vegetation and in areas with muddy bottoms. During the south-east winds, it moves off the shoreline
notably and its concentration reduces. During the north - east winds and in still weather, the density of fish in the
coastal zone increases significantly. Golden mullet is a valuable commercial fish. The second mullet species
introduced from the Black Sea to the Caspian is Liza saliens Popov, 1930. The two Caspian mullet species are
not separated (itemized) in fishery statistics; however, golden mullet prevails (up to 1.5 thousand tons) in the
total mullet catches (Velikova et al., 2012).
445
HydroMedit 2014, November 13-15, Volos, Greece
Among molecular techniques, microsatellite markers are seen as the best way to identify the population
structures of pelagic marine fishes because they are abundantly distributed across the genome, demonstrate high
levels of allele polymorphism and can easily be amplified with PCR (Sekar et al., 2009). Microsatellite
genotypes are particularly helpful in the detection of structure in closely related populations, regardless of
whether they are in evolutionary equilibrium. Additionally, primers designed for one species can often be used in
other related species (Chistiakov et al., 2005). So, the objectives of the present study are to investigate the
genetic structure of the Golden grey mullet and test the hypothesis that the Golden mullet has an identical
population in different regions of the South Caspian Sea (Mazandaran province).
The fishes were caught from two different regions, including 30 samples from Fereydoon-Kenar and 30 samples
from Raamsar costs (south Caspian Sea, Iran) (Figure.1). Fin tissue samples were prepared from 60 fishes of
each location and preserved in 95% ethanol and stored at room temperature.
Genomic DNA was extracted from fin tissue using a high pure PCR Template preparation kit (Roach, Germany)
according to the manufacturer‘s instructions. The quality and concentration of DNA were assessed by 1%
agarose gel electrophoresis and spectrophotometry (CECIL model CE2040) and then stored at -20°C until use.
The nuclear DNA was amplified using 6 microsatellite primers designed for M. cephalus (Muce-55, 37 , Xu et
al., 2010) and M. soiuy (Muso10, 16, 19, 22 , Xu et al., 2009). PCR products were electrophoresed on 10%
polyacrylamide gels (29:1 acrylamide: bis-acrylamide; 1X TBE buffer) and followed by silver-staining. Gels
were run at 40 mA for 14h. Alleles were sized using Uvitec software, and each gel contained an allelic ladder
(100bp) to assist with consistent scoring of alleles. Allelic frequencies, observed and expected heterozygosities
(Ho and He), genetic distance (Nei, 1972), genetic identity, Fst and Rst value, Nm, Hardy-Weinberg (HW) tests
of equilibrium, and AMOVA were computed in GeanAlex 6.0 software (Peakall and Smouse, 2006). AMOVA
calculations and allelic richness (AR) were performed on Arlequin 3.5 (Excoffier & Lischer 2010) using 10,000
permutations in each case. The Cornuet and Luikart (1996) programme BOTTLENECK ver. 1.2.02 was used to
detect recent effective population size reduction (to assess the impact of population decline) using data from the
microsatellites under the more suitable two-phased model (TPM).
Figure 1. Map showing sampling locations of populations of L. aurata: Fereydoon-Kenar and Raamsar costs.
446
HydroMedit 2014, November 13-15, Volos, Greece
3. Results
All primer sets as polymorphic loci were used to analyze the genetic variation. All microsatellite primers that
were able to produce DNA bands displayed a characteristic disomic banding pattern (Figures 2, 3). The allele
frequencies at all loci are given in Table 1. The average number of alleles found per site was 6.2, and the number
of alleles in Muso10 ranged from 4 to 6 (AR=8), in Muso16 from 3 to 7 (AR=6), in Muso19 from 9 to 9 (AR=8),
in Muso22 from 9 to 9 (AR=11), in Muce-37 from 5 to 9 (AR=9), in Muce-55 from 8 to 5 (AR=8).
Out of 53 observed alleles, 21 alleles occurred at frequencies of less than 0.05 in all samples. All the populations
sampled contained private alleles at a significant level (P < 0.05). The observed and expected heterozygosity
averaged 0. 349 and 0. 743, respectively; the observed heterozygosity ranged from 0.383 in Raamsar to 0.406 in
Fereydoon-Kenar (Table 1). Bottleneck analysis of golden mullet was 0.04121 in Fereydoon-Kenar and 0.04014
in Raamsar.
Estimates of inbreeding coefficient or Fis values were between -0.194 at Muso -37 and 0.879 at Muso-10 (mean
Fis= 0.483; Table 2), and positive Fis values a relative dearth of heterozygotes. To test the departures from
Hardy-Weinberg equilibrium were significant (P< 0.01) (Table 1). The Fst, Rst, and gene flow, as analyzed with
AMOVA, showed a significant genetic differentiation among sites (P< 0.01), which suggested that the
populations diverged from each other. The genetic distance and genetic identify computed by Nei (1972)
between populations was 0.679 and 0.507 respectively.
447
HydroMedit 2014, November 13-15, Volos, Greece
Table 1. Numbers of allelles observed within 2 sampling sites using 6 sets of microsatellite primers. Number of
studied samples (n), Observed (Ho) and expected (He) heterozygosities, number of alleles (Na), effective
allele (Ne) at 6 loci in two sampling sites. Loci in accordance with H-W equilibrum *P < 0.05; **P < 0.01;
***P < 0.001; ns= not significant.
Loci Regions Touchdown protocol
4. Discussion
The results of the study on golden mullet fish shows that the obtained allelic average in this study (9.5) is less
than the declared range (19.9±6.6) for saltwater fish (Dewoody and Avis, 2000). Also, in this study some allele
have been observed with low frequency. This may be due to overfishing of this species in recent years. In
previous years, due to overfishing of mullet, whose average weight was only 210 g, its resources have been
damaged severely. In general, low number of alleles is a sign of genetic bottleneck which perhaps is occurred in
wild population condition due to the isolation of population or a great reduction in its effective size. Since
golden mullet fish is not indigenous to Caspian Sea, it is likely that the small founder population which first
came to Caspian Sea from Black Sea is the cause of reduction in allelic variation. The results of this study
confirm this because many alleles with low frequency are the sign of genetic bottleneck or the result of
inbreeding. Average of inbreeding coefficient (Fis) which is positive for these two regions also supports this
idea.
The average heterozygosity observed in this study (0.394±0.1) is less than the declared amount for marine water
fish (0.77±0.22) (Dewoody and Avis, 2000). In both sampling regions there have been places in which the
448
HydroMedit 2014, November 13-15, Volos, Greece
observed heterozygosity was less than the expected amount. However, the observed reduced heterozygosity
compared to expectable heterozygosity, reduction in allelic variation and also existence of alleles with low
frequency can be due to reasons like overfishing and environmental causes like pollutants which reduce the
natural breeding of this fish.
Undoubtedly, the golden mullet stock in the Caspian Sea is in a critical condition and is suffering more damage
every year. Recently, unfavorable hydrological conditions related to climate change have had a negative impact
on the sustainability of exploitable yield of golden mullet; the thermal structure of the upper layers of the sea has
been detrimental to the species, and there has also been poor vertical mixing of surface and deeper water
(Velikova et al., 2012).
Reduction in genetic variation increases the possibility of becoming ill and other selective factors and as a result
it decreases size of population (Shen and Gong, 2004). Since in this study the average of inbreeding coefficient
was positive, It is possible that first parents were selected from one or two places near to each other in Black Sea
or genetic variation of this species is low in Black Sea,and it may also be related to sampling from Admixture of
stocks due to specific feeding grounds or nursery areas for reproduction, sufficient information on location of the
harvest is not available (Ghodsi et al., 2011).
Considering Hardy-Weinberg equilibrium, all places in every location were out of equilibrium (p<0.001). The
cause of deviation from equilibrium was sample mixing, population combination and sampling error (since the
populations were small and samples were low in number). Fst based on allelic frequency was 0.078 which shows
average genetic differentiation (Balloux et al. 2002). Genetic flow was calculated to be 2.9. Fst and Rst via
AMOVA for Codominant data in all sampling site were significant (P≤0.01). So the populations are separated
from each other,
suggesting that at least two populations are genetically differentiated and do not represent a single panmictic
population. High capacity of dispersion which is probably due to lack of physical or ecological barriers in south
coast of Caspian Sea, leads to high contact in sub-populations when they migrate and this is the reason of the
average population structure for this species.
Shaklee (1982), Thorpe and Sole-Cava (1994) showed that the Nei (1972) genetic distance for separation of
populations is said to be 0.3 in average (from 0.03 to 0.61) which is compatible to the observed genetic distance
and confirms genetic differentiation among observed populations.
This study shows the preliminary results and reasons for the existence of different populations of golden mullet
fish in two regions of Fereydoon-Kenar and Raamsar costs. The existence private alleles and significant Fst and
Rst confirm that different populations in two regions. The losses of genetic diversity may increase with
bottlenecking for this species in Caspian Sea. The small founder population which first came to Caspian Sea,
overfishing and environmental pollution of the sea are the causes of reduction in population size which leads to
reduction in allelic variation of the fish. Also, inbreeding is the reason of allelic variation reduction in every
sampling location. It is possible that members of the same family were sampled or it is because of low genetic
variation in mullet fries who first came from Black Sea to Caspian Sea. Private alleles, difference in frequency of
dominant alleles in every sampling location and the index of significant differentiation show that different
populations exist in south of Caspian Sea in coast of Mazandaran.
Acknowledgments
The study was supported by Islamic Azad University, Tonekabon Branch and was performed in Molecular
Genetic Lab. We would like to thank Dr. Nazemi (Dept. of Biology).
449
HydroMedit 2014, November 13-15, Volos, Greece
References
Balloux F., Lugon-Moulin N. (2002). The estimate of population diffraction with microsatellite markers.
Molecular Ecology 11,155- 165.
Chistiakov D.A., Hellemans B., Haley C.S., Law A.S., Tsigenopoulos C.S., Kotoulas G., Bertotto D., Libertini
A., Volckaert F.A. (2005). A microsatellite linkage map of the European sea bass Dicentrarchus labrax L.
Genetics. 170,1821–1826.
Cornuet, J. M., Luikart G. (1996). Description and power analysis of two tests for detecting recent population
bottlenecks from allele frequency data. Genetics 144, 2001-2014.
Excoffier L., Lischer H.E.L. (2010) Arlequin suite ver 3.5: a new series of programs to perform population
genetics analyses under Linux and Windows. Molecular Ecology Resource 10, 564–567.
Ghodsi Z., Shabani A., Shabanpur B. (2011). Genetic diversity of Liza aurata (Risso, 1810) in the coastal
regions of Golstan province, using microsatellite marker. Taxonomy and Biosystematics. 6, 35-46.
Nei M. (1972). Genetic distance between populations. American Naturalist 106, 283-292.
Peakall R., Smouse P.E. (2006). GenAlEx 6: Genetic Analysis in Excel. Population genetic software for teaching
and research. The Australian National University Canberra Australia. Available at:
http://www.anu.edu.au/BoZo/GenAlEx.
Sekar M., Suresh E., Kumar N.S., Nayak S.K., Balakrishna C. (2009). Microsatellite DNA markers, a fisheries
perspective Part 1: The nature of microsatellites. Aquaculture Asia Magazine. pp. 27-29.
Shaklee J.B., Tamaru CS, Waples R.S. (1982). Speciation and evolution of marine fishes studied by
electrophoretic analysis of proteins. Pacific Science. 36, 141-157.
Thorpe JP, Sole-Cava A.M. (1994). The use of allozyme electrophoresis in invertebrate systematics. Zoologica
Scripta. 23, 3- 18.
Velikova V.N., Shaudanov A.K., Gasimov A., Korshenko A., Abdoli A., Morozov B., Katunin D. N.,
Mammadov E., Bokova E. B., Emadi H., Annachariyeva J., Isbekov K., Akhundov M., Milchakova, N.,
Muradov O., Khodorevskaya R., Shahifar R., Shiganova, T., Zarbaliyeva T. S., Mammadli T., Velikova, V.,
Barale, V., Kim Y. (2012). Review of the environment and bioresources in the Caspian Sea ecosystem 2000-
2010. CaspEco Report, 423P.
Welsh A., May B. 2006. Development and standardization of disomic microsatellite markers for lake sturgeon
genetic studies. Journal of Applied Ichthyology. 22, 337–344.
Xu, G., Shao, Ch., Liao, X., Tian, Y., and Chen, S. 2009. Isolation and characterization of polymorphic
microsatellite loci from so-iuy mullet (Mugil soiuy Basilewsky 1855). ConservationGenetetics 10: 653-655.
Xu, T.-j., Sun, D.-Q.,Shi,G, Wang, R-X., .2010. Devlopment and characterization of polymorphic microsatellite
markers in the gray mullet (Mugil cephalus), Gentics and Molecular Research. 9, 1791-1795
450
HydroMedit 2014, November 13-15, Volos, Greece
Skordas K.,* Korakaki D., Kosmidis D., Nikolaou M., Neofitou N., Panagiotaki P.
Department of Ichthyology and Aquatic Environment, School of Agricultural Sciences, University of Thessaly,
Fytokou St, N. Ionia, 38446, Volos, Greece
Abstract
This preliminary study deals with the contents of copper and zinc in muscle tissue of Boops boops and Spicara
smaris, the two most commercial species caught in the Kissamos Gulf in Crete. The metal contents in muscle
were determined using the USEPA Method 3052. Determinations of copper (Cu) and zinc (Zn) contents were
carried out using a flame atomic absorption spectrometer (Flame AAS). The mean content of copper in B. boops
was 9.60 ± 3.65 ιg kg-1 and the mean figure for zinc was 20.50 ± 5.36 mg kg-1, while in S. smaris were 6.98 ±
2.46 ιg kg-1 and 14.51 ± 3.24 mg kg-1 respectively. The estimated daily intake of copper and zinc was calculated
and an assessment of the health risk to consumers was made. Σhe heavy metal contents in the edible part
(muscle) of fish caught in the Kissamos Gulf did not exceed permissible limits and therefore their consumption
should be considered safe for human health.
Key words: Copper, Zinc, Boops boops, Spicara smaris, Eastern Mediterranean
*Corresponding author: Konstantinos Skordas (kskord@apae.uth.gr)
1. Introduction
Many fish species are widely used as indicators of pollution of the aquatic environment (Marks et al.
1980) and they play an important role in environmental research (Evans et al. 1993).
Metals, such as Fe, Zn, Cu, Se and Mn are essential for metabolic functioning in fish but become toxic
for the organism when their contents are excessive, also causing problems for human health when fishes are
consumed (Prego & Cobelo-Garcia 2003; Vlahogianni et al. 2007; Mayor & Solan 2011). Heavy metals are
considered to be among the most dangerous pollutants of the marine environment because they do not degrade
and thus they remain unchanged in the aquatic environment (McIntyre 1995). Consequently they represent a
long-term selective pressure depending on their chemical form and bioavailability (Cukrov et al. 2011).
Furthermore, bio-accumulated heavy metals can be bio-magnified via the food chain, resulting in health risks
when finally assimilated by human consumers (Agah et al. 2009).
In aquatic ecosystems metals are found in low contents. Since they do not degrade in water, and cannot
be deposited in sediments or digested (Abdel-Baki et al. 2011), heavy metals bio-accumulate in aquatic
organisms and they may become toxic when their contents reach high levels (Huang 2003). The determination of
heavy metal contents in fish provides useful information on their suitability as food for humans, as well as
contributing to an overall assessment of pollution in the environment (Forstner & Wittman 1983).
The purpose of this preliminary study was to examine the content of copper and zinc in B. boops and S.
smaris which are the two most commercially important species intended for human consumption that are caught
in the Gulf of Kissamos in Crete. In addition, the study gives an estimation of the degree of risk to humans from
heavy metals in these two species. The results of this study give a complete picture of the content of the two
metals in the two most commercial species and the degree of risk to the consumer.
451
HydroMedit 2014, November 13-15, Volos, Greece
(FL), accurate to 0.1 cm, and total weight (TW) to the nearest 0.01 g were recorded (B. boops: n = 30, TW =
42.14-74.21 g, TL = 14.60 - 17.20 cm and S. smaris: n = 30, TW = 11.53-17.68 g, TL = 10.90-12.60 cm).
Metal contents were determined using USEPA Method 3052 (1996) for microwave-assisted acid
digestion of siliceous and organically based matrices. All samples of fish muscle tissue were homogenised and
stored in a dry environment until digestion. For total dissolution, 9 ml of concentrated HNO3 were added to 0.5 g
of muscle tissue in acid-cleaned Teflon vessels. The vessels were sealed and placed in a closed, high-pressure
microwave system (Multiwave 3000, Anton Paar, Austria). After digestion, the samples were diluted with ultra-
pure water in 50 ml volumetric flasks and stored in polypropylene sample bottles at 4 ºC until further analysis.
Quantitative determinations of copper (Cu) were carried out with a graphite furnace atomic absorption
spectrometer (GF AAS), while for zinc (Zn) they were carried out with a flame atomic absorption spectrometer
(Flame AAS), using standard addition methods.
The estimation of human health risk from consumption of wild fish from the Kissamos Gulf in Greece was
assessed according to Onsanit et al. (2010). The human health risk was assessed and then comparisons of mean
metal contents with internationally established food safety standards for edible fish tissues were made.
3. Results
Figures 1.1 and 1.2 show the results for contents of copper and zinc in muscle tissue separately for each
species. The average content of copper in B. boops was 9.60 ιg kg-1 and the average figure for zinc was 20.50
mg kg-1, while in S. smaris the contents were 6.98 ιg kg-1 and 14.51 mg kg-1 respectively.
15
Contents of Cu (κg kg-1)
10
0
B. boops S. Smaris
452
HydroMedit 2014, November 13-15, Volos, Greece
30
Contents of Zn (mg kg -1)
25
20
15
10
0
B. boops S. Smaris
Figure 1.2: Mean ± SD contents of zincnin muscle tissue of B. Boops and S.
smaris.
The estimation of human health risk from consumption of wild fish from the Kissamos Gulf in Greece
was assessed according to Onsanit et al. (2010). An average adult body weight of 70 kg in the general
population and an average consumption of 68.68 g/d of wild fish were the figures used to calculate estimated
daily intake (EDI; ιg/kg bw/d) of analytes (FAO, 2010; Stirling Institute of Aquaculture, 2004). Comparisons of
mean analyte contents with permitted limits for edible fish tissues were made.
The estimated daily intake (EDI, ιg/kg bw/d) of copper and zinc was calculated (Table 1) and compared
with the Allowed Daily Intake (ADI) and with Reference Doses (RfD). The daily intake (ιg/kg bw/day) was
calculated using the following equation:
EDI = Cfish *[ dcfish/bw]
Where Cfish = average trace element content in fish muscle (κg/g wet weight), dcfish = daily fish
consumption (g/day) per capita as recorded by the FAO (2008) and bw = average body weight (kg) of the target
population. The hazard quotient (HQ) was calculated by dividing the estimated daily intake (EDI) by the
established RfD to assess the health risk from fish consumption. There would be no obvious risk if the HQ were
less than 1.
For an average consumer in Greece, the estimated daily intake of copper and zinc from the consumption
of wild B. boops and S. smaris is lower than the Allowed Daily Intake (ADI) and the Reference Doses (RfD) of
these metals (JECFA 2003, Ikem & Egilla 2008, Onsanit et al. 2010, USEPA 2012) (Table 1). The hazard
quotient (HQ) for both species is less than 1 in all cases.
Table 1: Daily intake of trace elements by Greeks through consumption of marine fish. Estimated daily intake
(EDI, κg/kg bw/d) of wild fish (n = 60) caught in the Kissamos Gulf, allowed daily intake (ADI), ADI1 is
calculated from the provisional tolerance weekly intake set by the JECFA (2003) while ADI2 is calculated from
Ikem & Egilla (2008), and reference doses (RfD, ιg/kg bw/d) of trace elements as established by the United
States Environmental Protection Agency (2012).
453
HydroMedit 2014, November 13-15, Volos, Greece
4. Disscussion
Comparing the average contents of copper and zinc in the muscle tissue of the two species caught in
this area, higher contents of the metals were observed in B. boops. Levels of heavy metals in the environment,
size (weight - length) of individuals and stage of development are all considered to be important factors affecting
the content of metals in aquatic organisms. Type of fish also seems to be a very important factor for the
accumulation of elements in fish tissues. This could be due to differences in physiology between the two species
(Kalantzi et al. 2013).
In assessing health risks for human consumption of these fish, a comparison with limits for copper and
zinc in edible parts of fish which have been established by various national or international authorities showed
that both species had lower contents than the values set for safety standards. Furthermore, a comparison of
estimated daily intake (EDI) with allowed daily intake and reference doses (RfD) demonstrates that there is no
obvious risk for human health from copper and zinc through consumption of B. boops and S. smaris caught in
this area of Greece.
In almost all cases the contents of the metals in the muscle tissue of both species studied were lower
than the various permitted limits for copper and zinc of 30 mg kg -1 (FAO 1983), 20 mg kg-1 (Usero et al. 2003),
30 mg kg-1 (Kalantzi et al. 2013) and 100 mg kg-1 (Canadian Food Standards), with the exception of Zinc in B.
boops which was marginally above the figure of 20 mg kg-1 given by Usero et al. (2003). The results of this
study showed that the contents of copper and zinc in wild fish caught in the Kissamos Gulf are at safe levels in
comparison with permissible established limits.
References
Abdel-Baki A.S., Dkhil M.A., Al-Quraishy S. (2011). Bioaccumulation of some heavy metals in tilapia fish
relevant to their concentration in water and sediment of, Wadi Hanifah, Saudi Arabia. African Journal
of Biotechnology 10, 2541-2547.
Agah H., Leemarkers M., Elskens M., Rez Fatemi S. M., Baeyens W. (2009). Accumulation of trace metals
in the muscle and liver tissues of five fish species from the Persian Gulf. Environmental
Monitoring and Assessment 157, 449–514.
454
HydroMedit 2014, November 13-15, Volos, Greece
Kalantzi I., Black K.D., Pergantis S.A., Shimmield T.M., Papageorgiou N., Sevastou K., Karakassis I. (2013).
Metals and other elements in tissues of wild fish from fish farms and comparison with farmed species in
sites with oxic and anoxic sediments, Food Chemistry 141, 680-694
Mayor DJ, Solan M (2011). Complex interactions mediate the effects of fish farming on benthic chemistry
within a region of Scotland. Environmental Research 111, 635-642.
Marks P.J., Plaskett D., Potter I.C., Bradley J.S. (1980) Relationship between Concentration of Heavy Metals in
Muscle Tissue and Body Weight of Fish from the Swan-Avon Estuary, Western Australia. Australian
Journal of Marine & Freshwater Research 31, 783-793.
McIntyre A.D. (1995). Human impact on the oceans: The 1990s and beyond. Marine Pollution Bulletin 31:147-
151.
Onsanit S., Ke C., Wang X., Wang K.J., Wang W.X. (2010). Trace elements in two marine fish cultured in fish
cages in Fujian province, China. Environmental Pollution 158, 1334-1342.
Prego R., Cobelo-García A. (2003). Twentieth century overview of heavy metals in the Galician Rias (NW
Iberian Peninsula). Environmental Pollution 121, 425-452.
Stirling Institute of Aquaculture (2004). Study of the market for aquaculture produced lubina y dorada species.
Report to the European Commission, DG Fisheries.
United States Environmental Protection Agency (USEPA) (1996) Method 3052: Microwave assisted acid
digestion of sediments, sludges, soils and oils, in Test Methods for Evaluating Solid Waste,
Physical/Chemical Methods - SW-846. USEPA, Washington DC.
United States Environmental Protection Agency (USEPA) (2012). Fish Tissue Screening Levels. U.S. EPA,
Region 3, Philadelphia, PA.
URL http://www.epa.gov/reg3hwmd/risk/human/index.htm (Accessed on: 05-04-2014).
Usero J., Izquierdo C., Morillo J., Gracia I. (2003). Heavy metals in fish (Solea vulgaris, Anguila Anguilla and
Liza aurata) from salt marshes on the southern Atlantic coast of Spain. Environment International 29,
949-956.
Vlahogianni T., Dassenakis M., Scoullos M.J., Valavanidis A. (2007). ‗Integrated use of biomarkers (superoxide
dismutase, catalase and lipid peroxidation) in mussels Mytilusgalloprovincialis for assessing heavy
metals‘ pollution in coastal areas from the Saronikos Gulf of Greece‘ Marine Pollution Bulletin 54,
1361-1371.
455
HydroMedit 2014, November 13-15, Volos, Greece
Laboratory of Benthic Ecology, Department of Ichthyology & Aquatic Environment, University of Thessaly,
Fytoko Street, 38 445, Volos, Greece
Abstract
The sensitivity of 8 commonly used evenness indices to species rarity and differences in community structure,
was evaluated using a set of simulated communities, generated from data of existing macrobenthic communities
modified in a controlled way. Three transformations were applied to the original sets of data and replicated 100
times, in order to modify i) the community structure into random sets, ii) the abundance of rare species and iii)
the abundance of dominant species. A total of 60.000 different communities were generated and the sensitivity
of the given indices was evaluated by means of the Coefficient of Variation, between-indices relationships were
assessed by the Spearman rank correlation and a Hierarchical Cluster Analysis. Pielou‘s Evenness Index
appeared to be sensitive to the abundance of dominant and McInthosh‘s Index to the abundance of rare species,
whereas Hurlbert‘s Index proved quite sensitive to all the transformation.
Key words: Pielou, Hurlbert, McIntosh, upper sublittoral
*Corresponding author: Lolas Alexios (allolas@uth.gr)
Δνβαζηήνζμ Βεκεζηήξ Οζημθμβίαξ, Σιήια Γεςπμκίαξ Ηπεομθμβίαξ ηαζ Τδάηζκμο Πενζαάθθμκημξ, Πακεπζζηήιζμ
Θεζζαθίαξ, Οδυξ Φοηυημο, 38 445, Βυθμξ, Δθθάδα
Περίληψη
ηδ ζοβηεηνζιέκδ ιεθέηδ, αλζμθμβήεδηε δ επίδναζδ ηδξ ζπακζυηδηαξ ηςκ εζδχκ ζηδ ζοιπενζθμνά 8 εονέςξ
πνδζζιμπμζμφιεκςκ δεζηηχκ μιμζυιμνθδξ ηαηακμιήξ, ιέζα απυ ηδκ πνμζμιμίςζδ ηδξ δζαθμνεηζηήξ ζφζηαζδξ
ιαηνμαεκεζηχκ ημζκμηήηςκ. Δθανιυζηδηακ 3 ζοβηεηνζιέκμζ ιεηαζπδιαηζζιμί ζε πναβιαηζηά δεδμιέκα απυ
οθζζηάιεκεξ αζμημζκυηδηεξ ημο Παβαζδηζημφ ηυθπμο, ιε ζηυπμ κα εκζζπφζμοκ ακηίζημζπα, ηδκ ηοπαζυηδηα ζηδκ
ηαηακμιή ηαζ ηδκ πανμοζία ηςκ ζπάκζςκ ηαζ ηςκ ηονίανπςκ εζδχκ ζηδ ζοκεεζδ ηςκ κέςκ, εζημκζηχκ
ημζκμηήηςκ. οκμθζηά δδιζμονβήεδηακ 60.000 εζημκζηέξ αζμημζκυηδηεξ βζα ηάεε ιεηαζπδιαηζζιυ ηαζ δ
εοαζζεδζία ηςκ δεζηηχκ αλζμθμβήεδηε ιέζς ηδξ ζοιπενζθμνάξ ημο οκηεθεζηή Παναθθαηηζηυηδηαξ (CV), ηδξ
ζοζπέηζζδξ ιεηαλφ ημοξ ιε αάζδ ημκ ζοκηεθεζηή Spearman ηαζ ηδξ ηαηάηαλήξ ημοξ ιε αάζδ ηδκ Ηενανπζηή
Ακάθοζδ Οιάδςκ (ΖCA). O δείηηδξ Οιμζυιμνθδξ Καηακμιήξ Pielou έδεζλε εοαζζεδζία ζηδκ αθεμκία ηςκ
ηονίανπςκ ηαζ μ δείηηδξ McIntosh ζηδκ αθεμκία ηςκ ζπάκζςκ εζδχκ, εκχ μ δείηηδξ Hurlbert έδεζλε κα
επδνεάγεηαζ ηαζ απυ ημοξ 3 ιεηαζπδιαηζζιμφξ.
Λέξειρ κλειδιά: Pielou, Hurlbert, McIntosh, αλώηεξε ππνπαξαιηαθή
*οββναθέαξ επζημζκςκίαξ: Λυθαξ Αθέλζμξ (allolas@uth.gr)
456
HydroMedit 2014, November 13-15, Volos, Greece
1. Δηζαγσγή
Ο πζμ ημζκυξ ηνυπμξ εηηίιδζδξ ηδξ αζμπμζηζθυηδηαξ είκαζ δ ιέηνδζδ ημο ανζειμφ ηςκ εζδχκ ζε έκα
ζοβηεηνζιέκμ ηυπμ, ιζα δεδμιέκδ πνμκζηή ζηζβιή, αοηυ δδθαδή πμο μκμιάγεηαζ «πθμφημξ εζδχκ» (species
richness) ηαζ μοζζαζηζηά, απμηεθεί ηδκ πζμ εονέςξ απμδεηηή ενιδκεία ηδξ έκκμζαξ «ιέηνδζδ ηδξ
αζμπμζηζθυηδηαξ» (Hubbell 2001). Aοηή δ πθδνμθμνία, υιςξ, δεκ επανηεί βζα κα πενζβνάρεζ ηδ δμιή ιζαξ
αζμημζκυηδηαξ, αθμφ δ αθεμκία ηάεε είδμοξ δζαθένεζ, ηυζμ ζημ πχνμ υζμ ηαζ ζημ πνυκμ. Γζ‘ αοηυ ημ θυβμ,
έπμοκ ακαπηοπεεί ιζα ζεζνά απυ δείηηεξ (Magurran 2004), μζ μπμίμζ εηηζιμφκ ηδκ πμζηζθυηδηα θαιαάκμκηαξ
οπυρδ ηα δφμ ηφνζα ζοζηαηζηά πμο ηδ ζοκεέημοκ, ημκ «πθμφημ» (richness) ηαζ ηδκ «μιμζυιμνθδ ηαηακμιή»
(evenness) ηςκ εζδχκ (Pielou 1966).
Κάεε έκαξ απυ ημοξ δείηηεξ πμο έπμοκ πνμηαεεί, δίκεζ πενζζζυηενδ αανφηδηα ζε έκα απυ ηα δφμ
παναπάκς ζημζπεία ηδξ πμζηζθυηδηαξ. ιςξ, αηυιδ δεκ έπεζ ανεεεί έκαξ δείηηδξ πμο κα πενζβνάθεζ
μθμηθδνςιέκα ηαζ ηα δφμ αοηά ζημζπεία. Αοηυ έπεζ ςξ απμηέθεζια, κα οπάνπεζ πθέμκ πθδεχνα δεζηηχκ
πμζηζθυηδηαξ, αθθά δ επζθμβή ημο ηαηαθθδθυηενμο κα είκαζ ιζα δφζημθδ οπυεεζδ, αθμφ δε θαίκεηαζ λεηάεανα
ακ ηαζ πυζμ επδνεάγμκηαζ απυ ηδ ζοιιεημπή ζπάκζςκ ή ηονίανπςκ εζδχκ ζηδ ζφκεεζδ ηδξ αζμημζκυηδηαξ πμο
πνμζπαεμφκ κα πενζβνάρμοκ (Smith & Wilson 1996, Gotelli & Colwell 2001). ηδ ζοβηεηνζιέκδ ιεθέηδ, έβζκε
ιζα πνμζπάεεζα κα αλζμθμβδεεί δ επίδναζδ πμο αζηεί δ ζπακζυηδηα ηςκ εζδχκ πμο ζοκεέημοκ ιζα αζμημζκυηδηα
αεκεζηχκ αζπυκδοθςκ ζηδ ζοιπενζθμνά ηςκ δεζηηχκ μιμζυιμνθδξ ηαηακμιήξ πμο πνδζζιμπμζμφκηαζ εονφηενα
ζηδ αζαθζμβναθία.
Πίλαθαο 4. Ολνκαζία, καζεκαηηθή δηαηχπσζε θαη βηβιηνγξαθηθή αλαθνξά ησλ θπξηφηεξσλ Γεηθηψλ Οκνηνκνξθίαο,
πνπ εμεηάζηεθαλ
5 Παραλλαγι τθσ κυριαρχίασ του Simpson 1-D Smith & Wilson 1996
6 Παραλλαγι τθσ κυριαρχίασ του Simpson 1/D Smith & Wilson 1996
7 Παραλλαγι τθσ κυριαρχίασ του Simpson -lnD Smith & Wilson 1996
457
HydroMedit 2014, November 13-15, Volos, Greece
Γζα ηδ δδιζμονβία ηςκ «εζημκζηχκ αζμημζκμηήηςκ», επζθεβυηακ ανπζηά έκαξ ηοπαίμξ ανζειυξ εζδχκ απυ
ηδκ ανπζηή ζφκεεζδ, ιε ηδκ πνμτπυεεζδ δ κέα ζφκεεζδ κα ιδκ έπεζ πμηέ θζβυηενα απυ 5 είδδ. ηδ ζοκέπεζα,
εθανιμγυκηακ 2 επζπθέμκ ιεηαζπδιαηζζιμί, ιε ζηυπμ κα εηηζιδεεί δ εοαζζεδζία ηςκ δεζηηχκ ζε ζπέζδ ιε ηδ
ζπακζυηδηα ηςκ εζδχκ. Γζα κα εκζζποεεί δ επίδναζδ ηςκ ζπάκζςκ εζδχκ (ανζειυξ αηυιςκ < 4), δ κέα ζφκεεζδ,
ανπζηά, ειπθμοηζγυηακ ιε έκακ ηοπαίμ ανζειυ εζδχκ ιεηαλφ 0 ηαζ 2κ, υπμο κ μ ανζειυξ ηςκ ζπάκζςκ εζδχκ. ηδ
ζοκέπεζα, ζηα κέα αοηά είδδ, απμδίδμκηακ έκαξ ηοπαίμξ πθδεοζιυξ ιεηαλφ 1 ηαζ 3 αηυιςκ (Beisel et al. 1996).
Γζα κα εκζζποεεί δ επίδναζδ ηςκ ηονίανπςκ εζδχκ (πεηζηή Κονζανπία > 5%), μζ πθδεοζιμί ημοξ
ιεηααάθθμκηακ ηοπαία ιε έκα ζοκηεθεζηή ιεηαλφ 0,75 ηαζ 1,25 (Beisel et al. 1996).
Γζα ηάεε ιία απυ ηζξ 20 ιαηνμπακζδζηέξ ζοκεέζεζξ, πναβιαημπμζήεδηακ 100 πνμζμιμζχζεζξ βζα ηάεε
ιεηαζπδιαηζζιυ ηαζ οπμθμβίζηδηακ μζ ζοβηεηνζιέκμζ δείηηεξ βζα ηάεε ιία απυ αοηέξ. ηδ ζοκέπεζα,
οπθμβίζηδηε μ οκηεθεζηήξ Παναθθαηηζηυηδηαξ βζα ηάεε δείηηδ ηαζ δ δζαδζηαζία επακαθήθεδηε 10 θμνέξ,
χζηε κα δδιζμονβδεμφκ ζοκμθζηά 60.000 ηοπαίεξ δζαθμνεηζηέξ ζοκεέζεζξ.
Γζα ηδ ζφβηνζζδ ηςκ δζάθμνςκ δεζηηχκ ηαζ ημκ εκημπζζιυ ηςκ πζεακχκ μιμζμηήηςκ ιεηαλφ ημοξ,
επζθέπεδηε μ ζοκηεθεζηήξ ζοζπέηζζδξ Spearman ηαζ δ Ηενανπζηή Ακάθοζδ Οιάδςκ (Hierarchical Cluster
Analysis). Γζα ηδκ εηηίιδζδ ηδξ εοαζζεδζίαξ ζε ηάεε πνμζμιμίςζδ ηαζ ηδ ζφβηνζζδ ιεηαλφ ηςκ δεζηηχκ,
πνδζζιμπμζήεδηε μ οκηεθεζηήξ Παναθθαηηζηυηδηαξ (Coefficient of Variation, CV). Ζ δδιζμονβία ηςκ
«εζημκζηχκ αζμημζκμηήηςκ» ηαζ μζ οπμθμβζζιμί ηςκ δεζηηχκ πναβιαημπμζήεδηακ ιε ηδ πνήζδ ιαηνμεκημθχκ
ημο θμβζζιζημφ επελενβαζίαξ θμβζζηζηχκ θφθθςκ Microsoft Excel 2003 ηαζ ηχδζηα ζηδ βθχζζα
πνμβναιιαηζζιμφ Microsoft Visual Basic® for Applications (VBA). θεξ μζ ακαθφζεζξ πναβιαημπμζήεδηακ
ζημ ζηαηζζηζηυ παηέημ STATGRAPHICS Centurion (έηδμζδ 16.1.11).
3. Απνηειέζκαηα – πδήηεζε
ημκ Πίκαηα 2 ηαηαβνάθμκηαζ ηα πμζμηζηά παναηηδνζζηζηά ηδξ δζαηφιακζδξ ηςκ ηζιχκ ηάεε δείηηδ,
υπςξ οπμθμβίζηδηε βζα ηάεε ιεηαζπδιαηζζιυ. Ζ δζαηφιαζκδ ημο οκηεθεζηή Παναθθαηηζηυηδηαξ ηαζ δ
μιαδμπμίδζδ ηςκ δεζηηχκ, ζφιθςκα ιε ηδκ Ηενανπζηή Ακάθοζδ Οιάδςκ, απμδίδεηαζ ζημ πήια 1. Απυ ηα
απμηεθέζιαηα ηδξ ακάθοζδξ ηδξ εοαζζεδζίαξ ηςκ δεζηηχκ, θάκδηε υηζ δ απυηνζζή ημοξ ζημοξ δζάθμνμοξ
ιεηαζπδιαηζζιμφξ ήηακ λεπςνζζηή βζα ηάεε δείηηδ, εκχ έδεζλε κα επδνεάγεηαζ απυ ηα πμζμηζηά παναηηδνζζηζηά
ηςκ ιεηαζπδιαηζζιχκ. Πζμ ζοβηεηνζιέκα, μ δείηηδξ ημο Hurlbert θάκδηε πςξ είκαζ μ πενζζζυηενμ ακελάνηδημξ
απυ υθμοξ, ηαεχξ έδεζλε ζδιακηζηή εοαζζεδζία ζε ηάεε ιεηαζπδιαηζζιυ. Ακηίεεηα, δ επίδναζδ ηδξ αθεμκίαξ
ηςκ ζπάκζςκ εζδχκ θάκδηε κα επδνεάγεζ ζδιακηζηά ημκ δείηηδ ημο McIntosh, ηαεχξ υπςξ θάκδηε, μ
ζοβηεηνζιέκμξ δείηηδξ πανμοζίαζε ηδ ιεβαθφηενδ εοαζζεδζία ζημκ ζοβηεηνζιέκμ ιεηαζπδιαηζζιυ. Δλίζμο
ζδιακηζηή επίδναζδ είπε δ αθεμκία ηςκ ηονίανπςκ εζδχκ ζημκ δείηηδ Pielou, μ μπμίμξ έδεζλε πμθφ ιεβαθφηενδ
εοαζζεδζία ζημκ ζοβηεηνζιέκμ ιεηαζπδιαηζζιυ ζε ζφβηνζζδ ιε ημοξ άθθμοξ δφμ.
Πίλαθαο 5. πληειεζηήο Παξαιιαθηηθφηεηαο (CV), Διάρηζηε, Μέγηζηε θαη Μέζε ηηκή (± Σππηθή Απφθιηζε) γηα θάζε
δείθηε νκνηφκνξθεο θαηαλνκήο θαη γηα θάζε κεηαζρεκαηηζκφ
458
HydroMedit 2014, November 13-15, Volos, Greece
ρήκα 6. Γηαθχκαλζε ηνπ ζπληειεζηή παξαιιαθηηθφηεηαο (CV) φπσο ππνινγίζηεθε απφ ηηο ηηκέο ησλ
δεηθηψλ νκνηφκνξθεο θαηαλνκήο (Α), Ηεξαξρηθή θαηάμε θαη νκαδνπνίεζε ησλ δεηθηψλ, κε βάζε ηελ
νκνηφηεηα ηνπο (Β), γηα θάζε έλαλ απφ ηνπο 3 κεηαζρεκαηηζκνχο δεδνκέλσλ πνπ εθαξκφζηεθαλ.
ε ακηίζημζπδ ιεθέηδ ηδξ εοαζζεδζίαξ μνζζιέκςκ δεζηηχκ Οιμζυιμνθδξ Καηακμιήξ ζηζξ ιεηααμθέξ
ηδξ αθεμκίαξ, πμο πναβιαημπμίδζακ μζ Boyle et al. (1990), ακ ηαζ πνδζζιμπμίδζακ δζαθμνεηζηή ιαεδιαηζηή
πνμζέββζζδ ζημκ ηνυπμ πμο ιεηαζπδιάηζζακ ηα δεδμιέκα ημοξ, ηαηέθδλακ ζε πανυιμζα ζοιπενάζιαηα.
459
HydroMedit 2014, November 13-15, Volos, Greece
οβηεηνζιέκα, ηαηέθδλακ ζημ ζοιπέναζια υηζ μ δείηηδξ ημο McIntosh έδεζλε ζδιακηζηή εοαζζεδζία ζε ιζηνέξ
ιεηααμθέξ ηδξ αθεμκίαξ ηαζ ηυκζζακ υηζ εεςνείηαζ πζμ ηαηάθθδθμξ βζα εηηζιήζεζξ, υηακ οπάνπμοκ ανηεηά
ζπάκζα είδδ. Ακηίεεηα μ δείηηδξ ηδξ Pielou, έδεζλε κα επδνεάγεηαζ απυ ιεβάθεξ ηζιέξ αθεμκίαξ ηαζ αοηυξ είκαζ μ
θυβμξ πμο είκαζ πζμ ηαηάθθδθμξ ζε δείβιαηα πμο οπάνπμοκ ηονίανπα είδδ. Σέθμξ, βζα ημκ δείηηδ ημο Hurlbert,
μζ ζοβηεηνζιέκμζ ενεοκδηέξ ηυκζζακ υηζ είκαζ ζπεηζηά ακελάνηδημξ απυ ηζξ ηζιέξ ηδξ αθεμκίαξ, ακ ηαζ θάκδηε
πςξ είπε πενζζζυηενδ εοαζζεδζία ζηζξ παιδθυηενεξ ηζιέξ.
Λίβμ δζαθμνεηζηή ήηακ δ άπμρδ ηςκ Beisel et al. (1996), ακ ηαζ ζηδ δζηή ημοξ ιεθέηδ μζ δείηηεξ πμο
εηηζιήεδηακ ήηακ 4 ηαζ απυ αοημφξ, ιυκμ μ δείηηδξ Simpson ηαζ McIntosh ήηακ ημζκμί ιε ηδκ πανμφζα ιεθέηδ.
Πανυθα αοηά, αλίγεζ κα ζδιεζςεεί πςξ μζ ζοββναθείξ, ζοιπένακακ πςξ μζ δείηηεξ Simpson ηαζ McIntosh είπακ
ηδ ιεβαθφηενδ ζοζπέηζζδ, αθθά μ δείηηδξ McIntosh είπε ηδ ιεβαθφηενδ εοαζζεδζία ζηα ηονίανπα είδδ ηαζ θίβμ
ιζηνυηενδ ζημοξ οπυθμζπμοξ ιεηαζπδιαηζζιμφξ. Θεχνδζακ υιςξ υηζ αοηή δ δζαθμνά ήηακ ιζηνή ηαζ ημκ
πνυηεζκακ ςξ ημκ πζμ ηαηάθθδθμ απυ ημοξ 4 δείηηεξ πμο είπακ ζοβηνίκεζ.
Απυ ηδκ πανμφζα ιεθέηδ, πνμηφπηεζ πςξ μ δείηηδξ Hurlbert (1971) είκαζ ανηεηά αλζυπζζημξ ζε ηάεε
απυπεζνα εηηίιδζδξ ηδξ μιμζμιμνθίαξ ηδξ ηαηακμιήξ ιζαξ αεκεζηήξ αζμημζκςκίαξ. Ακ υιςξ οπάνπεζ θυβμξ κα
δμεεί έιθαζδ ζηα ζπάκζα είδδ, ηυηε μ δείηηδξ McIntosh (1967) είκαζ πζμ ηαηάθθδθμξ, εκχ ζηδκ πενίπηςζδ ηςκ
ηονίανπςκ εζδχκ, πνμηείκεηαζ δ πνήζδ ημο δείηηδ ηδξ Pielou (1966). Δπεζδή υιςξ δ αζμθμβζηή πμζηζθυηδηα
ειπενζέπεζ ηαζ ηδκ αθεμκία ηαζ ημκ πθμφημ ηςκ εζδχκ (Magurran 2004), ηακέκαξ δείηηδξ Οιμζυιμνθδξ
Καηακμιήξ δεκ πνέπεζ κα ελεηάγεηαζ ιυκμξ ημο. Ακηίεεηα, είκαζ ηαθφηενα κα πνδζζιμπμζείηαζ ζε ζοκδοαζιυ ιε
ηάπμζμκ απυ ημοξ δείηηεξ πμζηζθυηδηαξ, έηζζ χζηε δ ενιδκεία ηςκ απμηεθεζιάηςκ κα είκαζ πζμ εφζημπδ.
Βηβιηνγξαθία
Alatalo R.V. (1981). Problems in the measurement of evenness in ecology. Oikos 37, 199–204.
Beisel J.N., Moreteau J.C. (1997). A simple formula for calculating the lower limit of Shannon's diversity index.
Ecological Modelling 99, 289–292.
Beisel J.N., Thomas S, Usseglio-Polatera P., Moreteau J.C. (1996). A sensitivity analysis of indices summarizing
community structure. Journal of Freshwater Ecology 11, 291–299.
Boyle T.P., Smillie G.M., Anderson J.C., Beeson D.R. (1990). A sensitivity analysis of nine diversity and seven
similarity indices. Research Journal of the Water Pollution Control Federation 62, 749–762.
Clifford H.F., Casey R.J. (1992). Differences between operators in collecting quantitative samples of stream
macroinvertebrates. Journal of Freshwater Ecology 7, 271–276.
Heip C. (1974). A new index measuring evenness. Journal of the Marine Biological Association of the United
Kingdom 54, 555–557.
Hubbell S.P. (2001). The Unified Neutral Theory of Biodiversity and Biogeography. Princeton, Princeton
University Press, pp 448.
Hurlbert S.H. (1971). The nonconcept of species diversity: a critique and alternative parameters. Ecology 52,
577–586.
Kerans B.L., Karr J.R., Ahlstedt S.A. (1992). Aquatic invertebrate assemblages: spatial and temporal differences
among sampling protocols. Journal of the North American Benthological Society 11, 377-390.
Lolas A. Vafidis D. (2013). Population dynamics of two caprellid species (Crustaceae: Amphipoda: Caprellidae)
from shallow hard bottom assemblages. Marine Biodiversity 43, 227-236.
Magurran A.E. (2004). Measuring Biological Diversity. Blackwell Publishing, Oxford, pp 260.
McIntosh R.P. (1967). An index of diversity and the relation of certain concepts to diversity. Ecology 48, 392–
404.
Pielou E.C (1966). The measurement of diversity in different types of biological collections. Journal of
Theoretical Biology 13, 131–144.
Shannon C.E. (1948). A mathematical theory of communication. Bell System Technical Journal 27, 379–423.
Simpson E.H. (1949). Measurement of diversity. Nature 163, 688.
Smith B., Wilson J.B. (1996). A consumer‘s guide to evenness indices. Oikos 76, 70–82.
Gotelli N.J., Colwell R.K. (2001). Quantifying biodiversity: Procedures and pitfalls in the measurement and
comparison of species richness. Ecology Letters 4, 379–391.
460
HydroMedit 2014, November 13-15, Volos, Greece
Papaharisis L.1*, Pavlidis M.2 , Chatziplis D.3, Kottaras E.1, Dimitroglou A.1, Samaras A.2, Loukovitis D.3,
Tsigenopoulos C.S.4
1
Nireus Aquaculture S.A. , Greece
2
Department of Biology , University of Crete, Greece
3
Laboratory of Agrobiotechnology and Agricultrural Products Inspection, Dept. of Agricultural Technology,
School of Agricultural Technology, Food Technology and Nutrition, Alexander Technological Educational
Institute of Thessaloniki, Greece
4
Institute of Marine Biology, Biotechnology and Aquaculture (IMBBC), Hellenic Centre for Marine Research
(HCMR), Heraklion, Greece
Abstract
The European sea bass and the gilthead sea bream have the biggest contribution (110,000 tons/year) in the
aquaculture of Greece. Integrated scientific program for genetic selection have recently started and the first
results appear very promising. However, proper breeding selection programmes should incorporate the new
scientific evidences and not based merely on classical growth characteristics. The aim of the two research
initiatives, recently funded by the Hellenic Republic, is the application of selective breeding programmes in
NIREUS S.A. for the genetic improvement of European sea bass (BASSGEN) and the gilthead sea bream
(BREAMIMPROVE) production traits based on molecular markers (MAS, Marker Assisted Selection) in
combination with classical selection techniques. Selection will be based on microsatellite markers which,
according to research studies, are linked to quantitative trait loci (QTL) controlling commercially important
traits, such as body weight and stress response. In addition, a new QTL detection study will be carried out in
each species aiming at more precise and detailed mapping of existing QTL for the implementation of future
breeding programs. BASSGEN aims to develop and evaluate an innovative selection breeding program based on
performance, immunological and endocrine parameters, while BREAMIMPROVE is focused on introducing new
techniques in the selection of breeding candidates based both on phenotypic measurements and molecular
markers. It is worth mentioning, that these programmes based on molecular genetic markers will be carried out
for the first time in Greek aquaculture, highlighting the potential of innovative molecular methods in rapid
improvement of economically important productive traits.
Keywords: Selection program, Stress response, Bodyweight, Quantitative Trait Loci
*
Contact author: Leonidas Papaharisis, l.papaharisis@nireus.com
1. Introduction
The European sea bass Dicentrarchus labrax together with the gilthead sea bream Sparus aurata
constitute the two main export products of Greece in the sector of animal foods of high alimentary value. With
an annual production at the order of 110,000 tons, these two species contribute considerably in the consolidation
of Greece as the first country in Europe to produce Mediterranean marine fishes. Until today, however, breeding
is based on the production of eggs from broodstocks that have not been genetically characterized and from the
producers' empirical choice. Integrated scientific programmes for genetic selection have recently started and the
first results appear very promising. The methodology of genetic selection is based on the continuous choice of
candidate fish that present better response to production indicators such as the higher growing rate, disease
resistance, lower deposition of fat etc. compared to the remainder individuals of the population. Then, there is
controlled reproduction between the candidate fish, with concrete restrictions to avoid inbreeding and produce
descendants that will present improved production traits.
461
HydroMedit 2014, November 13-15, Volos, Greece
However, proper breeding selection programmes should incorporate the new scientific evidences and
not based merely on classical growth characteristics. The aim of the two research initiatives, recently funded by
the Hellenic Republic, is the application of selective breeding programmes in NIREUS S.A. for the genetic
improvement of European sea bass (BASSGEN) and the gilthead sea bream (BREAMIMPROVE) production
traits based on molecular markers (MAS, Marker Assisted Selection) in combination with selection techniques
based on phenotypic values of economically important productive traits.
3. Results
BASSGEN programme (Increase Greek fish farm competitiveness through innovative breading
selection programme for European sea bass, Dicentrarchus labrax), aims to develop and evaluate an innovative
selection breeding programme based on performance, immunological and endocrine (stress resistance)
parameters. Preliminary data demonstrate, for the first time in European sea bass families, a consistency in the
stress response report with the presence of individuals that show consistent high or low cortisol plasma
concentrations following exposure to standardized acute stressor (Figure 1). These results are of importance and
could contribute to the improvement of breeding as alternative selection criteria other than the ordinary ones, and
consequently could potentially grow the number of fish in the nucleus population.
462
HydroMedit 2014, November 13-15, Volos, Greece
200
0
HR LR
Groups
Figure 1: Presence of high cortisol responders (HR) and low cortisol responders (LR) in European sea
bass, following exposure to acute stressors for four consecutive months. Blood samples were taken 0.5
hours post-stress.
463
HydroMedit 2014, November 13-15, Volos, Greece
0.000012 120
LOD SCORES
0.000010 100
P - VALUES
0.000008 80
0.000006 60
0.000004 40
0.000002 20
0.000000 0
0 2 4 5 7 8.2 10 12 14 16 18 20 22
Distance (cM)
Figure 2. Lod scores and P-values of QTL affecting bodyweight, detected in Linkage Group 1 of the
gilthead seabream
4. Discussion
It is worth mentioning, that these genetic selection programmes in both species based on molecular
genetic markers and in the same company will be carried out for the first time in Greek aquaculture, highlighting
the potential of innovative molecular methods in rapid improvement of economically important productive traits.
Acknowledgements
Financial support for this study has been provided by the General Secretariat for Research and
Technology (GSRT), Ministry of Education and Religious Affairs, under the National Programme for
Competitiveness & Entrepreneurship (EPAN II) funded by National sources and the European Regional
Development Fund" for the gilthead sea bream and by the Ministry of Rural Development and Food under the
European Fisheries Fund and Programme for Public Investments for the European sea bass.
References
D. Loukovitis, E. Sarropoulou, C. Batargias, A. P. Apostolidis, G. Kotoulas, C. S. Tsigenopoulos and D.
Chatziplis (2012) Quantitative Trait Loci for Body Growth and Sex Determination in the
Hermaphrodite Teleost Fish Sparus aurata L. Animal Genetics doi: 10.1111/j.1365-2052.2012.02346.
464
HydroMedit 2014, November 13-15, Volos, Greece
THEMATIC FIELD:
INLAND AQUATIC
RESOURCES
&
FISHERIES
ECONOMICS
465
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
The growth, age and size structure of the round goby (Neogobius melanostomus) inhabiting different types of
water bodies in Bulgaria were investigated. The species is a Ponto - Caspian benthophillic species, which lives
both in fresh and in brackish waters (large rivers, estuaries, sublittoral zones in the sea bays). Despite its wide
distribution and high numbers, so far there are no profound investigations on the growth of the species along the
Bulgarian Black Sea coast. Moreover, despite the evidence for differences in growth of gobies living in fresh,
brackish and salt waters there are no data on the Bulgarian waters, which are part of the native area of the
species. Variable life histories as evidences of ecological plasticity are discussed at the background of varying
ecological conditions. There were significant differences between mean back-calculated sizes of same age males
at all ages among the three populations. The age structure, size structure and growth of the three populations
were different. Considering age and size structure, the riverine and lacustrine populations demonstrated much
more similarities as opposed to population from the sea.
Key words: Round goby, growth, invasive species, Bulgarian ichthyofauna, fish ecology
*Corresponding author: Velkov Boris (boris.velkov@gmail.com)
1. Introduction
The round goby (Neogobius melanostomus) is a Ponto-Caspian benthophillic species, originally
inhabiting mainly fresh and brackish waters (large rivers, estuaries) and the coastal areas of Black, Azov and
Caspian Seas (Georgiev 1966, Pinchuk et al. 2003). In Bulgarian waters the round goby occurs along the entire
Black sea coast, the entire stretch of Danube River, lower stretches of all Danube and Black Sea tributaries,
seaside lakes and lagoons. In its native area it is an important species for the artisanal and commercial fishery
(Moskalkova 1996) and together with other gobiids is an important component of sublittoral fish communities.
Despite its wide distribution and its significant ecological role, so far there are no investigations on growth, age
and size structure of the round goby in Bulgaria. The only published information available is based on personal
communication (Corkum et al. 2004).
In the period since 1990, the round goby has extended widely its spread through Europe and even North
America (Pinchuk et al. 2003, Corkum et al. 2004, Sapota 2004). The success of the species as an invader has
been attributed mainly to its ecological plasticity. The latter includes variable life histories and is coupled with
varying growth, size and age structure. Growth and size structure of round goby populations have been
investigated recently, mainly in novel habitats (Macinnis & Corkum 2000, Simonović et al. 2001, Pliszka 2002,
Corkum et al. 2004, French & Black 2009, Shemonaev &Kirilenko 2009). Most of the authors point out at
differences of growth of the fish, age and size structure of novel populations, compared to native ones. These
differences generally include schemes with lower number of age groups, lower growth and earlier maturation of
fish in invasive (recently introduced) populations. In the recent years however new papers appeared, describing
new populations which are excluded of the above mentioned scheme (Sokołowska & Fey 2011). These results
demonstrate the dynamics of the round goby population and its plasticity, and are reminders that a population is
a constantly changing system which cannot only be viewed on the ―native‖–―introduced‖ axis.
The objective of our study was to describe growth, age and age structure of three isolated native
populations of the round goby, which represent the three main habitats of the species in Bulgaria: Danube River,
Black sea and seaside lakes. These water bodies differ in terms of basic hydrology and features, like water
current, depth, substratum and salinity. We assumed the possible differences will reflect the natural response of
the round goby to variable environmental conditions and their analysis will reveal more information on the
population dynamics of this highly invasive species.
466
HydroMedit 2014, November 13-15, Volos, Greece
Three populations were samples from 2009 to 2010. The ―Lake‖ sample was collected from Durankulak
Lake (North-Eastern Bulgaria, 43° 41‘ 17.71‖ N, 28° 33‘ 37.27‖ E). The ―Marine‖ sample-was collected near
Primorsko city-Southeastern Bulgaria (42° 17‘ 20.07‖ N, 27° 47‘ 02.79‖E). The ―River‖ sample was collected in
Danune River near Belene city (43° 39‘ 13.80‖ N, 25° 07‘ 36.16‖E, May 2010). Specimens were fixed in
formole (10% formaldehyde 38%) for further analysis. The standard length (SL) of each fish was measured to
the nearest 1 mm and body weight measured to 0,1g. Scales were collected and observed under stereomicroscope
with 3X magnification. After the annuli were determined the distance from the scale center to each annulus and
to the edge of the scale was measured. The longest distance on the oral radius was used. Linear equation of SL
on scale radius was calculated and used to back calculate the size at each age, based on the scale readings.
The relative rate of increase in length was calculated according to Ricker (1975). According to this
scheme, the relative rate of increase for the first year is 100%. The rate in the each following year is calculated
as: ((Lt-Lt-1)/Lt-1)*100, where Lt is the length at given year and Lt-1 is the length at previous year. Mann-Whitney
U Test was used to compare the differences in size at given age between same sex of different populations and
between different sex within the same population. The size corresponded to the time formation of the last two
annuli was used. For example, to obtain values for size at age 1, the fish aged 1+ and 2+ years were used in order
to increase the sample size. Age structure was expressed as the number and the proportions of the age groups.
3. Results
The number of individuals sampled from each population was 86 gobies for Lake population, 174 for
marine population and 48 for the River population. The age composition varied between the three populations.
No difference was found for the number of age groups according to sex. The Lake population consisted of four
groups but mainly of fish aged one year (1+, 63 %, 2+: 25.9%, 3+: 7.4% and 4+: 3.7%). The Marine population
consisted of 5 groups but mainly of fish aged 2+ and 3+ years (1+: 4%, 2+: 34.5%, 3+: 44.8%, 4+: 9.2%, 5+:
7.5%). The River population consisted of three groups but mainly of fish aged 1+ years (1+:42.5%, 2+: 37.5%
and 3+: 20%). The length ranged from 34 to 133 mm in Lake population (mean length: 62.6mm, 0.9-64.7g) from
60-181mm (mean length 101.4mm, 3-114g) in marine population and from 25 to 117mm (mean 66.4mm) in
River population. A higher percentage of large fish was seen in Marine population.
Table 1. Mean back calculated length (SL, mm) of male and female round gobies from
Marine, Lake and River populations (in parenthesis, the standard deviation values)
Population Age
Male Female
(Location)
Marine 1 59.2 (± 8.3) 57.1 (± 7.5)
(Black Sea) 2 87.2 (± 11.6) 78.6 (± 7.9)
3 108.1 (± 14.3) 93.7 (± 7.2)
4 123.6 (± 12.1) 106.9 (± 6.1)
5 140.2 (± 14.0) 119.6 (± 5.6)
Lake 1 47.7 (± 7.7) 43.5 (± 7.6)
(Durankulak) 2 58.2 (± 6.9) 55.6 (± 7.9)
3 82.5 (± 8.3) 67.3 (± 5.9)
4 105.9 (± 14.9) 78.2 -
River 1 58.4 (± 6.2) 58.5 (± 8.9)
(Belene) 2 75.3 (± 9.3) 73.1 (± 11.4)
3 91.1 (± 11.7) 84.3 (± 11.8)
There were significant differences between mean back-calculated sizes of same age males at all ages
among the three populations (Table 1). Black Sea had the largest males at all ages, though at age 1 the difference
with males from Danube was not significant. At age 2 and age 3 the Marine males were significantly larger than
males of the other populations and at age 4 – larger than the Riverine males (no age 4 males were present in the
lacustrine population). There were differences between the two freshwater populations too. Riverine males were
larger than lacustrine males at all ages. Differences have been also noticed between female fish. At age 1 to age
3 sizes of Marine females were not significantly different than River females and were significantly larger than
Lake females. At age 4 there was no difference between Marine and Lake females (no similar age in Danube). At
age 1 the only significant difference between back calculated size was found in the Lake population, with males
467
HydroMedit 2014, November 13-15, Volos, Greece
being larger than females (47.5 vs. 43.5mm). At age 2 the Marine males were significantly larger than females
(87.2 vs. 78.6mm) and no differences were found within the Lake and the River populations. The male fish were
longer than Marine females at age 3 (108.1 vs. 93.7mm) and Lake females (82.5mm vs. 67.3mm) and no
difference were found for the River population. At age 4 Marine males were larger than Marine females (123.6
vs. 106.9mm) and no significant differences were found between the Lake males and females. Marine population
was the only one, where five years old fish were found. Males were significantly larger than females (140.2 vs.
119.6mm, Figure 1). Both marine female and male fish sustained higher level of growth compared to freshwater
populations during their 2nd year of life. The respective values were 53% and 41% for males and females of
Marine sample, 29% and 28% for the males and females of lacustrine sample, and 37% and 30% for the males
and females of Danube population (Figure 2).
Significant decline of growth rate in sea fish occurred after age 2. At age 3 the growth rate of
male sea gobies dropped to 27% and the female – to 20%. At older age the decline continued, however
at lower rate. At all ages the fish from marine population demonstrated higher rate of increase,
compared to the lacustrine and riverine populations and in all populations the males had higher rate of
increase, compared to females of the same age except the sea fish during their fifth year.
4. Discussion
The age structure, size structure and growth of the three populations were different.
Considering age and size structure, the riverine and lacustrine populations demonstrated much more
similarities as opposed to population from the sea. Among them were smaller number of age groups
and higher proportion of younger individuals. We found five age groups (1+ - 5+) in the Back Sea
population, four (1+ - 4+) in the Durankulak Lake population and only three (1+ - 3+) in the Danube
River. The lower number of age groups of the two freshwater populations resembled the age structure
of previously investigated freshwater populations both in Europe (Simonović et al. 2001, Shemonaev
& Kirilenko 2008) and in North America (Charlebois et al. 1997, Macinnis & Corkum 2000, French &
Black 2009).. The Danube population in our study was composed of only three age groups, similar to
the upper Detroit River (0+ - 3+, Macinnis & Corkum 2000) and the upper Danube (0+ to 2+,
Simonović et al. 2001). Macinnis & Corkum (2000) found age 1 to be the most abundant group in
Detroit River, followed by age two, which is similar to the composition of our ―riverine‖ and
―lacustrine‖ but not the ―marine‖ population. Freshwater habitats were suggested as containing smaller,
earlier maturing fish previously (Corkum et al. 2004). On the other hand the running waters were
reported as being avoided by the round goby (at least compared to other representatives of genus
468
HydroMedit 2014, November 13-15, Volos, Greece
Neogobius) - Harka & Bíró (2007). This suggests suboptimal conditions in running waters for the
round goby. Running waters pose an obstacle to this sedentary fish by requiring more energy
allocation. Existing literature on marine populations of the round goby demonstrates varying age
characteristics. There are numerous investigations on the round goby populations of Black
(Apanasenko 1973, Svetovidov 1964, Gümüs & Kurt 2009), Caspian (Azizova 1962, Stepanova 2001),
as well as Azov Seas (Revina et al. 1971, Kostyuchenko 1961, Apanasenko 1973). The determined age
compositions for Black Sea were from 5 age groups (Gümüs & Kurt 2009) to 8 (0+ - 7+, Apanasenko
1973). Azov Sea investigations revealed 3 (1+ - 3+, Apanasenko 1973) to 5 (1+ - 5+, Kostyuchenko
1961) age groups. Caspian populations consisted of 4-5 age groups, depending on the year and region
(Azizova 1962, Stepanova 2001). Gümüs & Kurt (2009) reported age structure for a population of
round goby in Southern Black sea.
The number of age groups and the dominance of 2- and 3-years old fish resemble our own
observations. Generally males attained larger size than females studying this study, which could be
expected, based on previously published results (Bilko 1971, Macinnis & Corkum 2000, Shemonaev
&Kirilenko 2009, Kornis et al. 2012). Differences in size between male and female fish appeared after
age 1, except for the ―lacustrine‖ population. The delay in size differentiation according to sex has
already reported (Bilko 1971, Shemonaev & Kirilenko 2009) and could be explained by maturation
terms. The ―lacustrine‖ males were larger than females even earlier – at age 1, which probably reflects
the earlier maturation of lacustrine male fish. The ―riverine‖ population had the least differences on
growth between males and females. No significant difference was found at any age. The differences in
growth of both sexes are backed up by the complex social structure of round goby. Hypothesis that 2
forms of males occur in some round goby populations (Marentette et a.l 2009) was not proven.
Among the 3 investigated populations marine fish had the highest growth. On the opposite,
the lacustrine fish had the lowest size at age and rate of increase. The round gobies from Danube
demonstrated growth rates closer to the sea fish however significantly lower (except for age 1). Lower
growth and size at age for freshwaters were reported previously (Corkum et al. 2004). Brackish waters
were suggested as optimal for the round goby growth (Corcum et al. 2004) and running waters as less
preferable to the species (Harka & Bíró 2007). Simonović et al. (2001) in their investigation on the
round goby in Danube found that the length at various ages was smaller than the corresponding values
of sea gobies (Caspian and Azov Seas). These results are similar to our survey, in addition with those
of Polaĉik et al. (2008), who reported the size of round goby along the Bulgarian section of Danube to
range between approximately 17 and 77 mm (median: 45mm). The round goby demonstrates highly
variable growth even in the same water body, depending on the feeding conditions (Bilko 1971). Up
until recently the higher growth was observed in populations inhabiting brackish sea waters of its
native area (Berg 1949, Svetovidov 1964, Bilko 1971, Apanasenko 1973, Gümüs & Kurt 2009)
compared to newly invaded areas (Macinnis & Corkum 2000, Simonović et al. 2001, Johnson et al.
2005, French & Black 2009). In recent years the Baltic Sea populations demonstrated growth, which is
probably at the upper limit of all area of distribution (Sapota 2004, Sokołowska and Fey 2011). The
authors addressed this rapid growth to the lack of predators and the high availability of food (Sapota
2004).
Food availability is an important factor for round goby growth (Bilko 1971). The higher
availability of potential food in the sea, compared to Durankulak Lake and Danube, probably results in
higher growth rate. Usually the populations inhabiting Black Sea were reported as performing highest
growth within the native area (Apanasenko 1973). Published data revealed freshwater populations as
slower growing, especially in rivers. Compared to previous data the back calculated sizes of Black Sea
round gobies of this study were intermediate. The highest growth was reported by Berg (1949) and
Svetovidov (1964). They reported maximum size of approximately 250mm and Berg (1949) noted the
size of 130mm for 1 year old males, which is approximately double the size we estimated. Later
various papers, considering various regions of Black, Caspian and Azov Seas revealed the complex
character of growth. Occurrence of local populations was proposed, which experience different growth,
depending on feeding conditions (Bilko 1961). Later Apanasenko (1973) compared age and growth of
populations in Azov and Black Seas and found that the Black Sea supports highest growth, larger size
and most complex age structure for the round goby populations. Pollution, eutrophication and intensive
fishing (Apanasenko, 1973) can shift growth, age and size structure.
Within all three populations the highest growth occurred during the 1 st year of life, similarly to
what has been reported by Bilko (1971) for Black sea populations. During the 2 nd year length rate
decreased significantly for the freshwater populations but less for marine ones, which experienced their
major decline during the 3rd year. At older ages the length gain retains approximately at the similar
levels. The variation of length of same age fish increased with age and was highest in lacustrine
population. The highest rate of growth during the 1 st year of life and consecutive decrease with age was
469
HydroMedit 2014, November 13-15, Volos, Greece
observed previously (Shemonaev & Kirilenko 2009). Male fish of all populations retained higher
growth during their 2nd year compared to females. These results are in concordance with other
observations (Bilko 1971, Kovtun et al. 1974, 1976) and are most probably related to the higher growth
until maturity and earlier maturation of the female fish. The lack of significant difference in length
between male and female round goby at age 1 and the higher rate (compared to the other two
populations) rate of increase during their 2nd year probably indicate that marine population reach
maturity at later age. These differences were less pronounced in riverine population, where we found
no significant difference between size of male and female fish at any age. The faster growth of males is
observed in many fish with nest guarding males and is inherent to all round goby populations.
Acknowledgements
The manuscript has been prepared by the aims of the project DО 02-201/08 funded by the
Bulgarian Scientific Research Fund.
References
Apanasenko M.K. (1973). Size-age composition of round goby Neogobius melanostomus Pallas from
different areas of Azov and Black Seas. Biologia Morya 31, 98-106 (in Russian).
Azizova N.A. (1962). The possibility of a goby fishery in the Caspian. Rybnoe Khozyaistvo 3, 14
Berg L.S., (1949). Freshwater Fishes of the USSR and Adjacent Countries. Vol. III. pp. 510. Acad. Sci.
USSR Zool. Inst. (Translated from Russian by the Israel Program for Scientific Translations,
Jerusalem, 1965).
Bilko V.P. (1971). Comparative description of the growth of gobies (Gobiidae) and Lee‘s phenomenon.
Journal of Ichthyology 11, 543–555.
Charlebois P.M., Marsden J.E., Goettel R.G., Wolfe R.K., Jude D.J., Rudnika S. (1997). The Round Goby,
Neogobius melanostomus (Pallas). A Review of European and North American Literature. Illinois–
Indiana Sea Grant Program and Illinois Natural History Survey, Illinois Natural History Survey
Special Publication 20, Champaign, pp. 76.
Corkum L.D., Sapota M.R., Skora K.E. (2004). The round goby, Neogobius melanostomus, a fish invader on
both sides of the Atlantic Ocean. Biological Invasions 6, 173–181.
French J.R.P. III & Black, M. G. (2009). Maximum length and age of round gobies (Apollonia
melanostomus) in Lake Huron. Journal of Freshwater Ecology 24, 173–175.
Georgiev J.M. (1966). Species composition and characteristics of the gobies (Gobiidae, Pisces) of Bulgaria.
Izv. Nauchn. Izsled. Inst. Rib. Stop. Okeanogr. Varna, 7, 159-228.
Gümüs A. & Kurt, A. (2009). Age structure and growth by otolith interpretation of Neogobius
melanostomus (Gobiidae) from southern Black Sea. Cybium 33, 29–37.
Harka A. & Bíró P. (2007). New patterns in danubian distribution of Ponto-Caspian gobies – a result of
global climatic change and/or canalization? Electronic Journal of Ichthyology, 1, 1-14.
Johnson T.B., Bunnell D.B., Knight C.T. (2005a). A potential new energy pathway in Central Lake Erie: the
round goby connection. Journal of Great Lakes Research 31 (Suppl. 2), 238–225.
Kornis M.S., Mercado-Silva N., Vander Zanden M. J. (2012). Twenty years of invasion: a review of round
goby Neogobius melanostomus biology, spread and ecological implications. Journal of Fish
Biology, 80, 235–285.
Kostyuchenko A.A. (1961). Age and growth of the round goby N. melanostomus (Pallas) in the Azov Sea.
Tr. Azov. Chernom. Nauchn. Izsled. Inst. Rybn. Khoz. Okeanogr. 19, 45-60 (In Russian).
Kovtun I.F., Nekrasova M. Ja., Revina N. I. (1974). On the diet of round goby (Neogobius melanostomus)
and utilization of food supply in Azov Sea. Zool. Zh. 53, 728-736.
Kovtun I.F., Nekrasova M. Ya., Dombrovskiy Yu. A., Revina N. I. (1976). Application of regressionanalysis
for forecasting the size of the round goby stock in the Sea of Azov. Hydrobiol. J. 12, 37-41
(English translation of Gidrobiol. Zh. 12, 49-53)
Moskalkova K.I. (1996). Ecological and morpho-physiologycal prerequisites for distribution expansion of
the goby Neogobius melanostomus under conditions of anthropogenous pollution of water bodies.
Vopr. Ikchthyol. 36 (5), 615-621.
Pinchuk V., Vasil‘eva E.D., Vasil‘ev V.P., Miller P.J. (2003). Neogobius melanostomus (Pallas, 1814). – In:
Miller P.J. ed. The Freshwater Fishes of Europe: 8(1), 293-345. AULA-Verlag GmbH
Wiebelsheim.
Pliszka J. A. (2002). Morphology of otoliths, age and growth rate of round goby (Neogobius melanostomus)
from the Vistula Lagoon. MSc Thesis, University of Gda´nsk, Gdynia, Poland (in Polish).
470
HydroMedit 2014, November 13-15, Volos, Greece
Polaĉik M., Janáĉ M., Trichkova T., Vassilev M., Jurajda P. (2008): The distribution and abundance of the
Neogobius fishes in their native range (Bulgaria) with notes on the non-native range in the Danube
River. Large Rivers 18, 193–208.
Rass, T.S. (1992). Fish resources of the Black Sea and their changes. Okeanologiya 32: 293-302.
Revina N.I. (1971). The state of the Neogobius melanostomus stock in the Sea of Azov. Rybn. Khoz.
Moskva, 10, 7-9.
Shemonaev E. V. & Kirilenko E. V. (2009). Some Features of Biology of the Round Goby Neogobius
melanostomus (Perciformes, Gobiidae) in Waters of Kuibyshev Reservoir. Journal of Ichthyology,
Vol. 49, No. 6, 454–459.
Simonović P, Paunović M., Popović S. (2001) Morphology, feeding and reproduction of the round goby,
Neogobius melanostomus (Pallas) in the Danube River basin, Yugoslavia. Journal of Great Lakes
Research 27, 281–289
Smirnov A.I. (1986). [Perciformes (Gobioidei), Scorpaeniformes, Pleuronectiformes, Lophiiformes]. Fauna
Ukraini 8, 7–183 (in Russian).
Sokołowska E. & Fey D.P. (2011). Age and growth of the round goby Neogobius melanostomus in the Gulf
of Gdansk several years after invasion. Is the Baltic Sea a new Promised Land? Journal of Fish
Biology 78, 1993–2009.
Stepanova T.G. (2001). Some features of reproduction and growth of gobies in the Northern Caspian. In:
Ecology of young fish and problems of Caspian fish reproduction. VNIRO Press pp. 268-276.
Svetovidov A.N. (1964). Fishes of the Black Sea. Nauka, Moskow. pp. 552.
471
HydroMedit 2014, November 13-15, Volos, Greece
Atamanalp M.1, Kocaman E.M.,1, Alak G.2, Uçar A.1, Arslan H.1
1
Fisheries Faculty, Ataturk University, 25240, Erzurum, Turkey
2
Agriculture Faculty, Ataturk University, 25240 Erzurum, Turkey
Abstract
Swimming performance is considered a good means of evaluating sublethal effects and an important
criterion for the quantification of the sublethal effects of toxicants on fish. In this study, Oncorhynchus
mykiss were exposed to three difference doses (0.7 mg/lt, 1.4 mg/lt and 2.1 mg/lt) of sodium
bicarbonate during 4 days. Critical swimming speed (Ucrit) was investigated at the end of the trial
period. The statistically analyses showed that differences between groups in critical swimming speed
are not significant (p<0.05).
1. Introduction
Sodium bicarbonate (NaHCO3) known as baking soda, is white in color, dissolved in water
easily and gives carbon dioxide when dissolved in water. Carbon dioxide gas is listed for anaesthetic
purposes in cold, cool and warm water fishes and has been used primarily to sedate fish during
transport or to allow handling of large numbers of fish (Bowser 2001).
In fisheries researches and aquaculture, some applications such as weighing or transporting the
fishes from pond to pond should be carried out in a short time. The decreasing of water temperature
may cause stress on fishes. So the determining the effects of anaesthetics appearing on the fishes at
their natural ambient water temperature is important (Altun et al. 2009)
Swimming performance is one of the most important factors enabling the survival of many
fish species in ecological environment. Swimming performance depends on the diversity of biological
and physiological factors. The characteristic of the species, i.e. body shape, fin shape, muscle function,
swimming mode and fish size, is effective in swimming performance. Environmental factors are pH,
oxygen, photoperiod and various pollutants. (Wolter & Arlinghaus 2003).
472
HydroMedit 2014, November 13-15, Volos, Greece
In fish, swimming activities are categorized as sustainable (more than 200 minutes), prolonged
(between 15 seconds and 200 minutes) and maximum swimming speed (the possible highest swimming
speed). Sustainable swimming speed includes the speed that fish use in activities like immigration,
slow movements without muscle tiredness and search for feed. Prolonged swimming speed is the speed
that the fish can sustain between 14 seconds and 200 minutes. The energy required for this speed is
provided from both red muscle fibers (oxygenic) and white muscle fibers (oxygen-free). Maximum
swimming speed occurs anaerobically with the participation of all movement muscles. (Reidy et al.
2000; Özbilgin & Başaran 2005).
The most common method in measuring swimming performance for fish and other aquatic
species is critical swimming speed. Critical swimming speed is a measurement for determining the
swimming capability of fish (Plaut 2001). In this method, fish is placed in a water tunnel and
swimming capability against water flow at different speeds is evaluated. Fish needs to protect its
position against current because of optomotor. Critical swimming speed which is a special part of
prolonged swimming speed depends on many environmental and physical factors. These factors are
temperature and seasonal difference, body size, feeding, saltiness and pollution (Beamish 1978).
Numeral expression of this activity in fish is possible with the measurement of swimming
performance. Because swimming activity consists of many physiological processes and systems,
calculation of swimming performance becomes possible in a controlled environment created specially.
Swimming performance used as a sensitive index in the determination of health and stress situations of
fish varies depending on many factors such as fish species, size, living environment and style, water
parameters like temperature and saltiness, water pollution, current velocity of the water, feeding style
of the fish and energy situation. The aim of this study is to determine the effects of sodium bicarbonate
applied in different dosages on critical swimming speed of rainbow trout.
80 rainbow trout (165±25 g) (Oncorhynchus mykiss) obtained from Atatürk University Faculty
of Aquaculture Inland Water Fish Application and Research Center and not exposed to any infection or
toxicity before were placed in test tank found in Faculty of Aquaculture Toxicology Research Unit.
Two of the tanks were determined as control groups and other four were determined as treatment
groups. In every tank, 10 fish were places and there were 8 tanks (Atamanalp 2000).
Critical swimming speed is accepted as the estimated value of the highest sustainable speed in
the measurement of the swimming speed of fish. This system is based on measuring the swimming
performance of fish against current by increasing the water speed gradually after the fish are placed in
water tunnel whose speed can be controlled (Figure 2.1).
In the measurement of critical swimming speed, the time of exhaustion and current velocity
are used (Hammer 1995).
473
HydroMedit 2014, November 13-15, Volos, Greece
The critical swimming speed at exhaustion was calculated in cm s-1 for each fish using the following
formula:
3. Results
474
HydroMedit 2014, November 13-15, Volos, Greece
Figure 1. Critical swimming speed data points, linear regression lines and equations
4. Discussion
Hammer (1995) reported that critical swimming speed determined with the swimming
performance evaluation system is one of the most important criteria in determining the effects of
chemical toxicity on fish. In the studies, it was concluded that swimming performance of fish exposed
to sublethal concentrations of organic and inorganic contaminants was negatively affected. (Beamish
1978; Heath 1995; Nikl & Farrell 1993; Beaumont et al. 1995b; Jain et al. 1998; Baltz et al. 2005;
McKenzie et al. 2007).
The resultant difference in groups in terms of critical swimming speed values in rainbow trout
exposed to three different doses of sodium bicarbonate was considered as insignificant. The average
values concerning the aforementioned parameter was identified as 4.95±0.73 BL/sec, 4.36±0.1.71
BL/sec 4.97±0,86 BL/sec and 5.50±0.41 BL/sec for K, D1 (0.7 mg/lt), D2 (1.4 mg/lt) and D3 (2.1
mg/lt) groups. It was concluded that there was a decrease in D1 and D2 groups compared to the control
group and an increase was observed in D3 group compared to the control group. Pollutants cause the
differentiation of the mechanism by reducing the swimming capability of fish. As a result of the
exposition to different substances, gills are damaged, respiration change is prevented, oxygen intake
and critical swimming speed decreases. In the study, it was observed that different doses of sodium
bicarbonate used as an anesthetic substance didn‘t have important effects on critical swimming speed
of rainbow trout.
The ability to swim is central to the health and survival of fish species. As such, swim
performance is one of the most observable and critical measures of the effect of various stressors on
fish health and performance (Beitinger & McCauley 1990). Swimming ability is important for a variety
of behavioural responses such as prey capture and predator avoidance, avoidance of unfavourable
environmental conditions and migration (Beaumont et al., 1995; Drucker 1996; Plaut 2001).
475
HydroMedit 2014, November 13-15, Volos, Greece
References
Altun T., Bilgin R., Danabaş D. (2009). Effects of Sodium Bicarbonate on Anaesthesia of Common
Carp (Cyprinus carpio L., 1758) Juveniles. Turkish Journal of Fisheries and Aquatic Sciences
9: 29-31.
Atamanalp M. (2000). The effects of sublethal doses of Cypermethrin on haematological and
biochemical parameters of rainbow trout (O. mykiss). A. Ü. Fen Bil. Enst. Doktora Tezi 95–
101.
Baltz D.M., Chesney E. J., Tarr M. A., Kolok A. S. Bradley M. J. (20059. Toxicity and sublethal
effects of methanol on swimming performance of juvenile Florida pompano. Transactions of
the American Fisheries Society 134, 730–740.
Beamish F.W.H. (1978). Swimming Capacity. In Fish Physiology, vol. 7 (ed. W. S. Hoar and D.
J.Randall), pp. 101–187. New York: Academic Press.
Beaumont M.W., Butler P.J., Taylor E.W. (1995). Exposure of brown trout, Salmo trutta, to sub-lethal
copper concentrations in soft acidic water and its effect upon sustained swimming
performance. Aquatic Toxicology 33(1), 45–63.
Beitinger T.L., McCauley R.W. (1990). Whole animal physiological processes of the assessment of
stress in fishes. J. Gt. Lakes Res. 16:542-575.
Bowser P.R. (2001). Anesthetic options for fish. In: R.D. Gleed and J.W. Ludders (Eds.), Recent
advances in veterinary anaesthesia and analgesia: Companion animals, international
veterinary information service (www.ivis.org), Ithaca, New York, USA.
Brauner C.J., Iwama G.K., Randall D.J. (1994). The effect of short-duration seawater exposure on the
swimming performance of wild and harchery-reared juvenile coho salmon (Oncorhynchus
kisutch) during smoltification. Can. J. Fish. Aquat. Sci. 51:2188-2194.
Brett J.R. (1964). The respiratory metabolism and swimming performance of young sockeye salmon.
J.Fish. Res. Bd. Can. 21: 1183–1226.
Drucker E.G. (1996). The use of gait transition speed incomparative studies of fish locomotion. Am.
Zool., 36, 555–566.
Hammer C. (1995). Fatigue and exercise tests with fish. Comp. Biochem. Physiol. A 112:1–20.
Heath A.G. (1995). Water Pollution and Fish Physiology. 2. ed., CRC Press Inc., Florida.
Jain K.E., Birtwell I.K., Farrell A.P. (1998). Repeat swimming performance of mature sockeye salmon
following a brief recovery period: a sensitive measure of fish health and water quality. Can. J.
Zool., 76,1488–1496.
Kaplan O., Avci M., Yertürk M. (2005). Sıcaklık Stresi Altındaki Bıldırcın Karma Yemlerine Sodyum
Bikarbonat Katkısının Besi Performansı ve Bazı Kan Parametreleri Üzerine Etkileri. YYÜ Vet
Fak Derg, 16 (1):27-31.
McKenzie D.J., Garofalo E., Winter M.J., Cerandi S., Verweij F., Day N., Hayes R., Van der Oost R.,
Butler P.J., Chipma J. K. and Taylor E.W. (2007). Complex physiological trait as biomarkers
of sub-lethal toxicological effects of pollutant exposure in fishes. Philosophical Transactions
of the Royal Society of London B. 362, 2043–2059.
Nikl D.L., Farrell A.P. (1993). Reduced swimming performance and gill structural changes in juvenile
salmonids exposed to 2-(thiocyanomethylthio) benzothiazole. Aquat. Toxicol. 27, 245–263.
Özbilgin Y., Başaran F (2005). Su sıcaklığı ve balık boyunun Isparoz‘un (Diplodus annularis L., 1758)
yüzme performansı üzerine etkileri. E. Ü. Su Ürünleri Dergisi 22(3–4): 407–411.
Plaut I. (2001). Critical swimming speed: its ecological relevance. Comp. Biochem. Physiol. 131(A):
41–50.
Randall D.J., Mense D., Boutilier R.G. (1987). The effects of burst swimming on aerobic swimming in
Chinook salmon (Oncorhynchus tshawytscha). Mar. Behav. Physiol. 13: 77-88.
Reidy S.P., Kerr S.R., Nelson J.A. (2000). Aerobic and anaerobic swimming performance of individual
Atlantic Cod. J. Exp. Biol. 203: 347–357.
Swanson C., Baxa D. V., Young P. S., Cech J. J. Jr and Hedrick R. P. (2002). Reduced swimming
performance in delta smelt infected with Mycobacterium spp. Journal of Fish Biology 61,
1012-1020.
Tierney K.B., Farrell A.P. (2004). The relationships between fish health, metabolic rate, swimming
performance and recovery in return-run sockeye salmon(Oncorhynchus nerka Walbaum).
Journal of Fish Diseases 27, 663-671.
Van Der Oost R., Beyer J., Vermeulen N.P.E. (2003). Fish bioaccumulation and biomarkers in
environmental risk assessment: a review. Environ Toxicol Pharmacol 13: 57-149.
Wolter C., Arlinghaus R. (2003). Navigation impacts on freshwater fish assemblages: the ecological
relevance of swimming performance Reviews in Fish Biology and Fisheries. 13: 63–89.
476
HydroMedit 2014, November 13-15, Volos, Greece
ÖZGÜR M.E.a, UĞUR Yb, DAĞLI M.a, ERDOĞAN S.c, BAYIR, Ġ.d
a
İnönü University, Sürgü Vocational High School, Fishery Department, Malatya, Turkey
b
Apricot Research Institute, Malatya, Turkey
c
İnönü University, Faculty of Pharmacy, Department of Analytical Chemistry, Malatya, Turkey
d
Erzincan University, Haci Ali Akin Vocational High School, Fishery Department, Erzincan, Turkey
ABSTRACT
This study was carried out some egg quality parameters and the fatty acids contents of
unfertilized eggs in Rainbow trout (Oncorhynchus mykiss) and Brown trout (Salmo trutta fario). Some
of the contents of saturated, monounsaturated and polyunsaturated fatty acids were measured and
evaluated between Rainbow trout and Brown trout. Total saturated and monounsaturated acids in eggs
of Oncorhynchus mykiss occurred in higher quantities than Salmo trutta fario. Miristic acid, palmitic
acid and stearic acid were main saturated fatty acids, palmiteloic acid and oleic acid were main
monounsaturated fatty acids and linoleic acid, eicosapentaenoic acid (EPA) and docosahexaenoic acid
(DHA) were main polyunsaturated fatty acids of eggs. The concentrations of saturated fatty acids
(palmitic and pentadecanoic acids), and polyunsaturated fatty acids (nervonic acid) were significantly
different (p<0.05) between fish species. Especially, the concentrations of EPA and DHA in unfertilized
eggs of both fish species determined no significant different (p>0.05). In the study, egg diameter
5.58±0.18 mm, relative eggs production per kg 771.31±88.07, absolute egg production per individual
2891.13±339.41, hatching ratio during incubation period 69.43±6.10 % of broodstocks of Rainbow
trout (Oncorhynchus mykiss) was determined. In Brown trout (Salmo trutta fario), 4.31±0.12 mm,
558.05±56.71, 1533.11±157.51 and 52.17±7.06% was determined, respectively.
From egg quality parameters and fatty acid contents, point of view, it was determined that the
values were not within the limits of the purpose in which this study was built.
Key words: Oncorhynchus mykiss, Salmo trutta fario, egg quality parameters, fatty acids of eggs.
Introduction
High quality gametes are necessary for successful aquaculture development. In salmonid and
other finfish industries, the proportion of gametes surviving the embryonic period is highly variable
(Bromage, 1996; Kjørsvik, 1994). The continual increasing demand for cultured fish requires greater
supplies of eggs, as egg number and survival determine the number of juveniles available for the on-
growing process (Watanabe, 1985).
One species that is grown worldwide due to its marketability and adaptability is the rainbow trout
(Oncorhynchus mykiss) (Hershberger, 1992). Although this species has been cultured for many years,
477
HydroMedit 2014, November 13-15, Volos, Greece
this industry still experiences some embryonic mortality and/or poor quality eggs from their broodstock
(Stoddard et al., 2005). Accumulating evidence suggests that most of the problems with rainbow trout
embryo viability can be attributed to the female (Nagler et al., 2000). Fatty acids and lipids have an
extremely important role in egg and alevin production; for example, DHA is essential for neural and
membrane development of the embryo (Sargent et al., 2002). Consequently the rapidly developing
embryo must be supplied with adequate levels, to ensure proper development (Bell et al., 1997). DHA
and EPA compete for a number of metabolic pathways and a change in levels of one could have
implications on the function of the other (Mazorra et al., 2003). However, a predominant factor that
can affect survival and juvenile quality is egg quality, which in turn is influenced by broodstock
nutrition (Watanabe, 1985; Izquierdo et al., 2001). Several methods have been developed to assess the
egg quality of fish (Kjorsvik et al., 1990; Fernandez-Palacios et al., 1995). One of the parameters,
fecundity, has been used to determine egg quality, which is also affected by a nutritional deficiency in
broodstock diets. Fecundity is the total number of eggs produced by each fish expressed either in terms
of eggs/spawn or eggs/body weight. In Oncorhynchus mykiss farming, fertilization, eye formation and
hatching ratios, form the main criteria used in determining egg quality. Several owners of
Oncorhynchus mykiss farms have chosen eye formation ratio as eggs quality determinant, and the high
ratio of eye formation value, shows high quality of eggs (Bromage, 1995).
The aim of this study was to determine reproductive performance of female broodstocks.
Therefore, in this study investigated some egg quality parameters (fertility, fecundity, eyed performed,
hatching ratio) and the fatty acids contents of egg in rainbow trout (Oncorhynchus mykiss) and Brown
trout (Salmo trutta fario).
Female broodstocks of rainbow and brown trout were obtained from a fish farm in Sürgü
Town of Malatya province, Turkey. In this farm, broodstocks (male and female) were being maintained
at a density of 200 per fish in a concrete pond of 12 m3 without natural photoperiod (indoor) until
reproduction period. For this research, 18 males took out and stocked into 300-L fiberglass tank at
reproduction term in this farm. Water quality parameters determined according to APHA (1985).
Spawning method was became by Munkittrick & Moccia (1987). The eggs quality parameters during
the incubation period were done according to Shiau & Chen (1992).
The fatty acid composition of eggs was investigated in eggs from six mature males for every
species. Lipids extraction from eggs was performed according to AOAC (2005) and Manirakiza et al.
(2001). 1 g of homogenized eggs and 2 g of Na2SO4 were placed in a Soxhlet extractor (Sox test, Trade
Raypa Soxhlet, SX-6, Spain). 30 milliliters of n-hexane were passed through, in hot extraction mode at
140 oC for 4 h (AOAC-2005). After extraction, the extraction solution was evaporated under a stream
of nitrogen and the lipid was stored at -20 °C until analysis. Saponification and etherification was
carried out according to the method provided by (Metcalfe et al. 1966; Sahari et al. 2013). 60 mg of
extracted oil was added 10 ml n-hexane (Merck, Darmstadt, Germany) and then was saponified with
0.5 milliliters of methanolic NaOH (0.5 M) solution by refluxing for 10 min. Finally the upper hexane
layer containing the fatty acid methyl esters (FAME) was placed in mini-vials.
The fatty acid methyl esters were analyzed on a GC-FID-QP2010 Ultra (Shimadzu
Corporation, Kyoto, Japan) gas chromatograph fitted with a AOC series auto sampler, Restek Rt-2560
capillary column (100 m x 0.25 mm i.d. x 0.2 ιm film thickness), FID detector, and integrated with
Shimadzu GC Solution software. The operating conditions were: oven temperature: 140 °C for 5 min
then warming to 240 °C at a rate of 25 °C/min, 240 °C for 15 min; injection port temperature: 250 °C;
detector temperature: 250 °C; split injection volume with Helium (>99.996%) was used as carrier gas.
(25 cm/s): 1:l; split ratio: 50:1. Methyl ester standards (Supelco 37 Comp. Fame Mix 10 mg/ml in
478
HydroMedit 2014, November 13-15, Volos, Greece
CH2CI2) were used to identify peaks, and results were reported as a proportion of total fatty acids
using correction factors (Ackman, 2002).
Results are expressed as mean values±standard deviation and used regression and other
statistical analysis by SPSS 15 packet program for Windows software packet (Sümbüloğlu &
Sümbüloğlu, 1998).
Results
Total saturated and monounsaturated acids in eggs of Oncorhynchus mykiss occurred in higher
quantities than Salmo trutta fario. Miristic acid, palmitic acid and stearic acid were main saturated fatty
acids, palmiteloic acid and oleic acid were main monounsaturated fatty acids and linoleic acid,
eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) were main polyunsaturated fatty acids
of eggs. The concentrations of saturated fatty acids (palmitic and pentadecanoic acids), and
polyunsaturated fatty acids (nervonic acid) were significantly different (p<0.05) between fish species.
Especially, the concentrations of EPA and DHA in unfertilized eggs of both fish species determined no
significant different (p>0.05) (Table 1).
Egg diameter, fertilization ratio, eyed-egg ratio, hatching ratio and free-swimming ratios are
accepted as criteria for egg quality. It was estimated, the number of white eggs and their fertilization
ratio within the first 36 hours after fertilization, the number of eggs with eyes and eyes ratio after 15-20
days, hatched eggs and ratio after 30-31 days. According to this, the average of fertilized eggs, eye
formation ratio and hatching ratio were identified, respectively (Table 2).
Table 2. Quality parameters of eggs, weight and total length of female broodstocks
Table 1. Fatty acids profiles of eggs in Oncorhynchus mykiss and Salmo trutta fario,
ST 0.14±0.07 0.08-0.22
ST 8.49±0.90 7.51-9.29
479
HydroMedit 2014, November 13-15, Volos, Greece
ST 3.11±0.24 2.86-3.34
ST 1.04±0.53 0.51-1.56
ST 0.20±0.12 0.07-0.29
ST 0.49±0.53 0.03-1.07
ST 0.33±0.09 0.23-0.41
ST 4.48±0.12 4.35-4.57
ST 0.24±0.03 0.22-0.27
ST 16.44±13.32 10.06-24.22
ST 0.18±0.01 0.17-0.19
ST 6.54±0.25 6.25-6.72
ST 1.99±0.08 1.93-2.08
ST 2.03±0.55 1.59-2.64
ST 2.70±0.18 2.49-2.83
ST 20.90±3.02 17.93-23.96
ST 18.71±2.69
480
HydroMedit 2014, November 13-15, Volos, Greece
ST 22.39±6.94
ST 28.59±3.71
* Significant difference as statistically, p<0.05; OM: Rainbow trout, ST: Brown trout
Discussion
This study was carried out for a farmer who needs to determine his broodstock performance.
Because female broodstocks were complained with some problems which were decrease of fecondity,
fertilization, eyed of egg ratio and hatching ratio in incubation period, respectively. Especially this farm
had been a big problem which broodstocks (male and female) were being maintained at a density of
200 fish per in a concrete pond of 12 m3 without natural photoperiod (indoor) until reproduction period.
It also meant that their stocking ratio was not suitable. Total saturated and monounsaturated acids in
eggs of Oncorhynchus mykiss occurred in higher quantities than Salmo trutta fario. Miristic acid,
palmitic acid and stearic acid were main saturated fatty acids, palmiteloic acid and oleic acid were main
monounsaturated fatty acids and linoleic acid, eicosapentaenoic acid (EPA) and docosahexaenoic acid
(DHA) were main polyunsaturated fatty acids of eggs. The concentrations of saturated fatt acids
(palmitic and pentadecanoic acids), and polyunsaturated fatty acids (nervonic acid) were significantly
different (p<0.05) between fish species. Especially, the concentrations of EPA and DHA in unfertilized
eggs of both fish species determined no significant different (p>0.05). However, in this study,the
concentration of DHA in the eggs determined in 15.82% (O. mykiss) and 11.65% (S. trutta fario) and it
was found lower than other studies (Ballestrazzi et al., 2003; Ronnie et al., 2005). Similar situations
were investigated on the concentration linoleic and EPA. We know that the lipids play a major role as
membrane constituents and as reserve energy in the development of embryos fish (Tocher & Sargent,
1984; Falk-Petersen et al, 1986). However, Watanabe (1985) also said that the lipid content and fatty
acid spectrum of eggs and embryos, in neutral as well as in polar lipids, was strongly influenced by that
of the diet on which the broodstock was fed for fish. Deficiencies in essential fatty acids can alter
fecundity and hatching rate and provoke anomalies in the larval fish which develop from these eggs.
Therefore, in this farm, the decreasing of reproductive performance can be caused by broodstocks food
which has deficiency contents of fatty acids.
In this study, the egg production of broodstocks (Absolute-Relative) was determined about
2890-771 in O. mykiss and 1533-558 in S.trutta fario. Especially our relative egg production data was
found lower than some other studies (Springate et al.1984; Aydın & Çelebi, 2000). Fecundity (number
of eggs) and egg diameter are the most used criteria in egg production. Relative amount of eggs
decreases with increase in broodstocks weight and egg diameter (Bromage et al., 1992; Bromage &
Cumaratunge, 1988 ). For this condition, the fishes used in this study were rather heavy but served to as
a proof for the low relative amount of eggs. The rate of eye formation of the incubated eggs in the
study was identified as 65 % in O.mykiss and 52% in S.trutta fario, and determined more lower than
other studies (Aydın & Çelebi, 2000; Özgür & Bayir, 2013). In this study, the hatching ratio of the
incubated eggs determined 69% in O. mykiss and 52% in S. trutta fario and was found lower than
other studies (Aydın & Çelebi, 2000; Özgür & Bayir, 2013). According to our data on incubation
period, reproductive performance of broodstocks in farm was found very lower than other studies and
normal expected performance of trout.
481
HydroMedit 2014, November 13-15, Volos, Greece
In this research, the reasons for the differences in the results of the values of fertilization ratio,
embryonic stage, hatching ratio and fatty acid contents when compared with the results obtained in
other studies were attributed to: experimental medium properties, water parameter (temperature,
oxygen, pH, etc.), broodstock size, quality of feeds given to broodstock and feeding mode, structure of
fish genotypes, incubation of fertilized eggs, stocking level of broodstock or broodstock stress factors
and culture conditions. Especially, we think that the quality parameters in incubation period and fatty
acids composition of broodstock eggs can be affected by the excessive stocking rate of broodstocks.
Also we can appreciate to these results according to Kime & Nash (1999) who said the quality of fish
gametes depends on the appropriate hormonal environment during development but this may be
disturbed by stress. Also, Campbell et al. (1992) reported that continually acute stress during
reproductive development prior to spawning significantly delayed ovulation and reduced egg size, and
significantly decreased sperm counts and most importantly significantly decreased survival rates for
progeny from stressed fish compared to that from unstressed controls in rainbow trout.
In conclusion, we suggest that a) all broodstocks should be stocked at 8-10 kg/m3 and in
natural photoperiod, not in dark, b) all broodstocks should be fed by special trout food with high fatty
acids content until reproduction term, c) farmers should attend technical practices in trout aquaculture.
References
Ackman R.G. (2002). The gas chromatograph in practical analysis of common and uncommon
fatty acids for the 21st century. Anal. Chim. Acta 465:175–192.
AOAC. (2005). Official Methods of Analysis of the Association of Official Analytical
International. In W. Horwitz (Ed.), Method 989.05 (18th ed.. Arlington, USA: AOAC International.
Aydın H., Çelebi R. (2000). Gökkuşağı alabalığında damızlık yaşının yumurta verimi ve
gelişimine etkisi. Su Ürünleri Sempozyumu, Sinop. 219-224.
Ballestrazzi,R., Rainis S., Tulli F., Bracelli A.(2003). The effect of dietary coconut oil on
reproductive traits and egg fatty acid composition in rainbow trout (Oncorhynchus mykiss),
Aquaculture International 11, 289-299.
Bromage N., Cumaranatunge P.R.C. (1988). Egg Production in the Rainbow Trout. In:
―Recent Advances in Aquaculture‖, Roberts R.J., Muir J.F. (eds). Croom Helm, London, Vol. 3, p. 65-
137.
Bromage N.R. (1996). Broodstock management and seed quality general considerations. In:
―Broodstock Management and Egg and Larval Quality‖, Bromage N.R., Roberts R.J. (eds.). Blackwell
Science Ltd., London, p. 1– 24.
Bromage, N. (1995). Broodstock Management and Seed Quality-General Considerations. In:
―Broodstock Management and Egg and Larval Quality‖. Bromage N., Roberts R. J., (eds). Blackwell
Science Ltd., London, p.1-24.
Bromage N., Jones J., Randall C., Thrush M., Davies B., Springate J., Duston J., Barker G.
(1992). Broodstock management, fecundity, egg quality and timing of egg production in the rainbow
trout (Oncorhynchus mykiss). Aquaculture 100, 141-166.
Bell J.G., Farndale B.M., Bruce M.P., Navas J.M., Carillo M. (1997). Effects of broodstock
dietary lipid on fatty acid composition of eggs from sea bass (Dicentrarchus labrax). Aquaculture 149,
107-119.
Campbell P.M., Pottinger T.G., Sumpter J.P. (1992). Stress reduces the quality of gametes
produced by rainbow trout. Biol. Reprod., 47, 1140-1150.
Falk-Petersen S., Falk-Petersen I.B., Sargent J.R., Haug T. (1986). Lipid class and fatty acid
composition of eggs from the Atlantic halibut (Hippoglossus hippoglossus). Aquaculture,52, 207-211.
Fernandez-Palacios H., Izquierdo M.S., Robaina L., Valencia A., Salhi M., Vergara J. (1995).
Effect of n-3 HUFA level in broodstock diets on egg quality of gilthead seabream, Sparus aurata L.
Aquaculture, 132, 325–337.
Hershberger W.K. (1992). Genetic variability in rainbow trout populations. Aquaculture, 112,
125-142.
Izquierdo M.S., Fernandez-Palacios H., Tacon A.G.J. (2001). Effect of broodstock nutrition
on reproductive performance of fish. Aquaculture 197, 25–42.
Kime D. E., Nash J. P. (1999). Gamete viability as an indicator of reproductive endocrine
disruption in fish. Sci. Total Environ., 233, 123–129.
482
HydroMedit 2014, November 13-15, Volos, Greece
Kjorsvik E., Mangor-Jesen A., Holmefjord I. (1990). Egg quality in fishes. Advances in
Marine Biology, 26,71-113.
Metcalfe L., Schmitz A.A., Pelka J. (1966). Rapid preparation of fatty acid esters from lipids
for gas chromatographic analysis. Anal. Chem. 38:514-515.
Manirakiza, P., Covaci, A., & Schepens, P. (2001). Comparative study on total lipid
determination using Soxhlet, Roese-Gottlieb, Bligh and Dyer, and modified Bligh and Dyer extraction
methods. Journal of Food Composition and Analysis, 14, 93–100.
Mazorra C., Bruce M., Bell J.G., Davie A., Alorend E., Jordan N., Rees J., Papanikos N.,
Porter M., Bromage N. (2003). Dietary lipid enhancement of broodstock reproductive performance and
egg and larval quality in Atlantic halibut (Hippoglossus hippoglossus). Aquaculture 227, 21-33.
Munkittrick K.R., Moccia R.D. (1987). Seasonal changes in the quality of rainbow trout
(Salmo gairdneri) semen: Effect of a delay in stripping on spermatocrit, motility, volume and seminal
plasma constituents, Aquaculture. 64 (2), 147-156.
Nagler J.J., Parsons J.E., Cloud J.G. (2000). Single pair mating indicates maternal effects on
embryo survival in rainbow trout, Oncorhynchus mykiss. Aquaculture. 184, 177-183.
Özgür M.E., Bayir İ. (2013). A Research On Quality Parameters Of Sperm, Egg, Larvae and
Fry For Broodstocks Of Rainbow Trout (Oncorhynchus mykiss W., 1792) in A Fish Farm, Research
Journal of Biological Sciences (BIBAD), 6(2): 01-07.
Rennie S. F. A. Huntingford A. Loeland M. Rimbach. (2005). Long term partial replacement
of dietary fish oil with rapeseed oil; effects on egg quality of Atlantic salmon Salmo salar, Aquaculture
248, 135-146.
Sahari M.A., Farahani F., Soleimanian Y., Mokhlesi A. (2013). n-3 Fatty Acid Distribution of
Commercial Fish Species Components. J Am Oil Chem Soc 90:1167-1178.
Sargent J.R., Tocher D., Bell J.G. (2002). The lipids. In: ―Fish Nutrition‖, Halver J.E., Hardy
R.W. (eds). Elsevier, USA, p. 181–257.
Stoddard J.W., Parsons J.E., Nagler J.J.( 2005). Early onset of embryonic mortality in
subfertile families of rainbow trout (Oncorhynchus mykiss). Reprod. Fertil. Develop. 17, 785-790.
Sümbüloğlu K., Sümbüloğlu V. (1998). Biyoistatistik, Hatiboğlu yayınevi, Ankara, pp. 269.
Springate J.R.C. Bromage N.R., Elliot J.A.K., Hudson D.L. (1984). The timing of ovulation
and stripping and the effect on the rate of fertilization and survival to eying, Hatch and swim-up in the
rainbow trout (Salmo gairdneri). Aquaculture. 43, 313-322.
Shiau S.Y., Chen. S.Y. (1992). The influence of dietary energy levels with and without PCB
induction on the growth of tilapia, Oreochromis niloticus x Oreochromis aureus. Fish Physiology and
Biochemistry. 10, 321-326.
Tocher D.R., Sargent, J.R. (1984). Analyses of lipids and fatty acids in ripe roes of some
northwest European marine fish. Lipids, 19, 492-499.
Watanabe T. (1985). Importance of the study of broodstock nutrition for further development
of aquaculture. In: ―Nutrition and Feeding in Fish‖, Cowey C.B., Mackie A.M., Bell J.G. (eds).
Academic Press, London, p. 395– 414.
483
HydroMedit 2014, November 13-15, Volos, Greece
Abstract
The present survey aims to document the current situation of snail farming in Cyprus and further
explores the growth potential of this industry. A primary survey was executed using a specially
formatted questionnaire to gather data. The main questions asked regarded subjects concerning the type
of breeding units, the breeding species, the feed used, the installation characteristics of units, the value,
the quantity, the production, the disposal of snails and the processing industry. According to the survey
results, the functioning of the breeding units, though in its first stages, is encouraging. It creates new
job opportunities, as for example the field of snails processing and standardization.
Key words: Heliciculture, Snail farming, Cyprus, net covered greenhouse.
*Corresponding author: Hatziioannou Marianthi (mxatzi@uth.gr)
Πεξίιεςε
ηδκ πανμφζα ένεοκα έβζκε πνμζπάεεζα κα ηαηαβναθεί δ οπάνπμοζα ηαηάζηαζδ ημο ηθάδμο ηδξ
αθζβηανμηνμθίαξ ζηδκ Κφπνμ ηαζ κα δζενεοκδεμφκ μζ πνμμπηζηέξ ακάπηολήξ ημο ηθάδμο. Γζελήπεδ
πνςημβεκήξ ένεοκα ιε ηδ πνήζδ εζδζηά δζαιμνθςιέκμο ενςηδιαημθυβζμο βζα ηδ ζοθθμβή δεδμιέκςκ.
Οζ ηονζυηενεξ ενςηήζεζξ πμο ηθήεδηακ κ‘ απακηήζμοκ μζ ενςηχιεκμζ ακαθένμκηακ ζε εέιαηα πμο
αθμνμφζακ ημκ ηφπμ ηςκ ιμκάδςκ εηηνμθήξ, ημ είδμξ εηηνμθήξ, ηδκ ηνμθή, ηα παναηηδνζζηζηά
εβηαηάζηαζδξ ηςκ ιμκάδςκ ηδκ πμζυηδηα, ηδκ παναβςβή, ηδ δζάεεζδ ηςκ ζαθζβηανζχκ. φιθςκα ιε
ηα απμηεθέζιαηα ηδξ ένεοκαξ δ θεζημονβία ηςκ ιμκάδςκ εηηνμθήξ είκαζ ζε πνχζιμ ζηάδζμ αθθά
εκεαννοκηζηή. Γδιζμονβεί κέεξ εοηαζνίεξ βζα δναζηδνζυηδηεξ, υπςξ μ ημιέαξ ηδξ ιεηαπμίδζδξ ηαζ
ηοπμπμίδζδξ ηςκ ζαθζβηανζχκ.
Λέξειρ κλειδιά: αιηγθαξνηξνθία, Δθηξνθή ζαιηγθαξηώλ, Κύπξνο, Γηρηπνθήπηα.
*οββναθέαξ επζημζκςκίαξ: Υαηγδζςάκκμο Μανζάκεδ (mxatzi@uth.gr)
1. ΔΗΑΓΧΓΖ
Σμ ζαθζβηάνζ απμηεθεί απυ ηδκ ανπαζυηδηα ιένμξ ηδξ ιεζμβεζαηήξ ημογίκαξ, ηαζ έκακ
μνβακζζιυ ιε εεναπεοηζηέξ ζηακυηδηεξ, ηαεχξ ζηεοάζιαηα απυ ζαθζβηάνζα πνδζζιμπμζήεδηακ ζημ
πανεθευκ ηαζ ελαημθμοεμφκ κα πνδζζιμπμζμφκηαζ βζα ηδκ παναζηεοή θανιάηςκ (Βonemmain 2003).
Ανπαζμθμβζηά ζημζπεία δίκμοκ πθδνμθμνίεξ βζα ηα πέκηε ζδιακηζηυηενα είδδ πενζαίςκ ζαθζβηανζχκ
πμο απακημφκ ιέπνζ ηαζ ζήιενα ζηδ Μεζυβεζμ, υπςξ ηα είδδ Cornu aspersum (ζοκ. Helix aspersa),
Helix melanostoma, Leucochroa candissima ηαζ Helicella setifensi (Lubell 2004). ηδκ Κφπνμ ηαζ
ζοβηεηνζιέκα ζηδ εέζδ Κζζζυκενβα Λειεζμφ, ανέεδηακ εονήιαηα ηεθοθχκ βαζηενμπυδςκ ηδξ
κεμθζεζηήξ πενζυδμο, ηα μπμία έπμοκ ενιδκεοεεί ςξ οπμθείιιαηα ηνμθίιςκ (Lubell 2004). Ζ εηηνμθή
ζαθζβηανζχκ (αθζβηανμηνμθία - Heliciculture) έπεζ πμθθά πθεμκεηηήιαηα, ηαεχξ ηα ζαθζβηάνζα
έπμοκ ιεβάθδ ζηακυηδηα πνμζανιμβήξ, απμηεθχκηαξ απμδμηζημφξ παναβςβμφξ ηνέαημξ ηαζ πνμσυκηςκ
ιε πνμζηζεέιεκδ αλία (Bonnet et al. 1990, Hatziioannou et al. 2008). Ζ ηαηακάθςζδ ηςκ ζαθζβηανζχκ
ζηδκ αβμνά ηδξ Δονςπασηήξ Έκςζδξ ηοιαίκεηαζ ζε ζδζαίηενα ορδθά επίπεδα ηαεχξ μζ εζζαβςβέξ
αολήεδηακ απυ 33.715.315€ ημ 1995, ζε 66.158.504€ ημ 2010 (Οζημκυιμο 2013).
ηδκ Κφπνμ ημ 1985 άνπζζε δ εκαζπυθδζδ ημο Τπμονβείμο Γεςνβίαξ ιε ηδ
αθζβηανμηνμθία, ιε ηζξ παθαζμφ ηφπμο ιεευδμοξ εηηνμθήξ. Σμ 1989 δ εκαζπυθδζδ αηυκδζε ιέπνζ ημ
2005 πμο άνπζζε κα ημκχκεηαζ ηαζ πάθζ ημ εκδζαθένμκ ηςκ παναβςβχκ.ηαζ ημ 2009 έβζκε ηαηαβναθή
ηςκ ιμκάδςκ απυ ημ Τπμονβείμ Γεςνβίαξ ηαζ έηδμζδ εζδζημφ δζαηάβιαημξ. Δκηυξ ημο 2009 ημ
484
HydroMedit 2014, November 13-15, Volos, Greece
485
HydroMedit 2014, November 13-15, Volos, Greece
ιμκάδα εηηνμθήξ, εκχ ημ 7,7% ηα είπε ζοθθέλεζ ηαζ απυ θοζζημφξ πθδεοζιμφξ ηαζ είπε αβμνάζεζ ηαζ
απυ άθθδ ιμκάδα εηηνμθήξ. διακηζηυ είκαζ ημ βεβμκυξ υηζ επζθέβμοκ κα εηηνέθμοκ είδδ πμο
οπάνπμοκ ζηδ Κφπνμ (άβνζμζ πθδεοζιμί) βζα ημ θυβμ υηζ ηα ζαθζβηάνζα είκαζ εοαίζεδηα ηαζ
πνμζανιυγμκηαζ ηαθφηενα υηακ ιεηαθένμκηαζ ζε πενζαάθθμκ υιμζμ ιε ημ δζηυ ημοξ.
φιθςκα ιε ηα απμηεθέζιαηα δ πθεζμρδθία δζαεέηεζ ηδκ παναβςβή ηδξ ζε εζηζαηυνζα ηαζ
ηαηαζηήιαηα ηνμθίιςκ (πήια 1). Γζάεεζδ ζε λεκμδμπεία ηαζ ελαβςβέξ δεκ έπμοκ βίκεζ εθζηηέξ. Ζ
ηαηακάθςζδ ηςκ ζαθζβηανζχκ ζηδκ Κφπνμ έπεζ αολδιέκδ γήηδζδ ηαεχξ απμηεθεί παναδμζζαηυ πζάημ
ημ μπμίμ ιαβεζνεφεηαζ ιε δζάθμνμοξ ηνυπμοξ ηαζ ζεναίνεηαζ ςξ εηθεηηυ έδεζια ζε εζηζαηυνζα ηαζ ζε
λεκμδμπεία (Chatziayxentis et al. 2009).
Ζ ιέβζζηδ ηζιή δζάεεζδξ ηςκ κςπχκ ζαθζβηανζχκ ήηακ 10,10 € /Kg ηαζ δ εθάπζζηδ ηζιή 6,38
€/Kg, απμηέθεζια εεηζηυ βζα ημκ ηθάδμ ηαζ ηζξ πνμμπηζηέξ ημο. ζμκ αθμνά ημ ιέζμ ιδκζαίμ
εζζυδδια απυ ηδ ζαθζβηανμηνμθία δ πθεζμρδθία (53,8%) δήθςζε υηζ έπεζ εζζυδδια θζβυηενμ απυ 300
€, ημ 7,7% έπεζ εζζυδδια 900-1.200 € ςξ ηαεανυ ηένδμξ, ημ 23,1% δεκ έπεζ ηαευθμο εζζυδδια απυ ηδ
ζαθζβηανμηνμθία είηε θυβς ημο υηζ ανίζημκηαζ ζε ανπζηυ ζηάδζμ, είηε ηάπμζςκ πνμαθδιάηςκ ζηδ
ιμκάδα ηαζ ηςκ ηαζνζηχκ ζοκεδηχκ, εκχ ημ 15,4% δεκ έπεζ δχζεζ ηαευθμο ζημζπεία. Ζ πμζυηδηα ημο
δείβιαημξ, δεκ ήηακ επανηήξ ηαζ ζηακμπμζδηζηή υζμκ αθμνά ηζξ απακηήζεζξ βζα ηα ηένδδ ηδξ
παναβςβήξ ηαζ μ θυβμξ είκαζ δ ζηεκυηδηα ηδξ αβμνάξ, έηζζ έζης ηαζ ακχκοια κα ιδκ δίκμοκ ζαθή
ζημζπεία βζα θμνμθμβζημφξ θυβμοξ. Απαζηείηαζ πενεηαίνς δζενεφκδζδ μζημκμιζηχκ δεδμιέκςκ, χζηε
κα πνμηφρμοκ ζοιπενάζιαηα βζα ηδ αζςζζιυηδηα ηςκ επζπεζνήζεςκ.
οιπεναζιαηζηά ημ ζφζηδια εηηνμθήξ πμο πνδζζιμπμζείηαζ ζηζξ ιμκάδεξ δεκ είκαζ αηυια
εκηεθχξ λεηάεανμ, ηαεχξ μζ ζαθζβηανμηνυθμζ ζζπονίγμκηαζ υηζ μ ηφπμξ εηηνμθήξ ημοξ είκαζ δ ιεζηηή
εηηνμθή, αθθά δεκ έπμοκ εάθαιμ ακαπαναβςβήξ. επίζδξ, μζ εηηνμθείξ ακηζιεηςπίγμοκ πνμαθήιαηα
ζηδκ απμεήηεοζδ, ζηδ ζοκηήνδζδ ηαζ ζηδ δζαηίκδζδ ημο πνμσυκημξ. Παν‘ υθα αοηά, ηνίκμκηαξ απυ ημ
ιζηνυ δείβια ηςκ ιμκάδςκ πμο αλζμθμβήεδηακ, δ θεζημονβία ημοξ είκαζ εκεαννοκηζηή ηαζ εα
ιπμνμφζε κα απμηεθέζεζ ιζα εκαθθαηηζηή πνυηαζδ βζα ηδκ απαζπυθδζδ ηςκ ηαημίηςκ. Ζ
ζαθζβηανμηνμθία ακήηεζ ζηδκ ηαηδβμνία ηςκ δναζηδνζμηήηςκ πμο απαζημφκ ορδθή ηεπκμβκςζία ηαζ
ειπεζνία ηαζ ζε ηαιία πενίπηςζδ δε εα πνέπεζ κα ζοβηνίκεηαζ ιε άθθεξ αβνμηζηέξ δναζηδνζυηδηεξ.
Γδιζμονβεί κέεξ εοηαζνίεξ βζα δναζηδνζυηδηεξ, υπςξ μ ημιέαξ ηδξ ιεηαπμίδζδξ ηαζ ηοπμπμίδζδξ ηςκ
ζαθζβηανζχκ. Δπίζδξ, ζοιαάθθεζ ζηδκ πνμζηαζία ηςκ θοζζηχκ πθδεοζιχκ ηςκ ζαθζβηανζχκ, ηαεχξ
μζ θοζζημί πθδεοζιμί έπμοκ ιεζςεεί ζδιακηζηά θυβς ηδξ ακελέθεβηηδξ ζοθθμβήξ ηαζ εκηαηζημπμίδζδξ
ηδξ βεςνβζηήξ παναβςβήξ ιε ηδκ πνήζδ θζπαζιάηςκ ηαζ θοημθανιάηςκ (Βανδζκμβζάκκδ θαη ζπλ.
2010).
ΒΗBΛΗΟΓΡΑΦΗΑ
Βανδζκμβζάκκδ Κ., Γηζχηαξ ., Μοθςκάξ Μ. (2010). Υενζαία Γαζηενυπμδα. ημ: «Σμ Κυηηζκμ Βζαθίμ
ηςκ Απεζθμφιεκςκ Εχςκ ηδξ Δθθάδαξ», Λεβάηζξ Α., Μαναβημφ Π. (Δπζιέθεζα). Δθθδκζηή
Εςμθμβζηή Δηαζνεία. Αεήκα. εθ. 436-454.
Οζημκυιμο . (2013). Γζενεφκδζδ ηςκ πνμμπηζηχκ ηςκ Δθθδκζηχκ ζαθζβηανζχκ ζηδκ αβμνά ηδξ
Δονςπασηήξ Έκςζδξ. Πηοπζαηή ενβαζία. Πακεπζζηήιζμ Θεζζαθίαξ.
486
HydroMedit 2014, November 13-15, Volos, Greece
Bonnemain B. (2005). Helix and drugs: Snails for western health care from antiquity to the present.
Evidence-Based Complementary and Alternative Medicine 2:25-28.
Bonnet J.C., Aupinel P., Vrillon J.L.. (1990). L'escargot Helix aspersa: Biologie, Elevage. In the series:
Du Labo au Terrain. Paris: Institut National de la Recherche Agronomique, pp. 124.
Chatziafxentis A., Hatziioannou M., Matsiori S., Neofitou Ch. (2009). Conjoint analysis: a preliminary
approach for snails processed products. 11th ICZEEGAR ABSTRACTS International Congress
on the Zoogeography, Ecology and Evolution of Eastern Mediterranean.
Hatziioannou, M., Exadaktilos, A., Panagiotaki, P., Lazaridou, M., Neofitou, Ch., (2008). Setting
quality standards for farmed snails Helix aspersa. Final Report of a research project funded by the
OP II - Pythagoras II (Measure 2.2.3, enhance University research groups) of the Ministry of
Education and Religious Affairs. pp. 168.
Lubell D. (2004). Prehistoric edible land snails in the circum-Mediterranean: the archaeological
evidence. Petits animaux et sociétés humaines. Du complément alimentaire aux ressources
utilitaires. XXIVe Rencontres internationales d‘archéologie et d‘histoire d‘Antibes. Direction de
J.-P. Brugal & J. Desse, Éditions APDCA, Antibes, pp.77-98.
487
HydroMedit 2014, November 13-15, Volos, Greece
ORGANIZING COMMITTEE
SCIENTIFIC COMMITTEE
Scientific Committee
Aggelidis Panayiotis (Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece)
Batzios Christos (Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece)
Fountoulaki Eleni (Institute of Aquaculture, Hellenic Centre of Marine Research, Greece)
Galanopoulos Constantinos (Department of Agriculture Development, Democritus University of Thrace,
Greece)
Galinou-Mitsoudi Sofia (Department of Fisheries and Aquaculture Technology, ΑTEI of Thessaloniki, Greece)
Govaris Alekos (Faculty of Veterinary Science, University Thessaly, Greece)
Halkos George (Department of Economics, University of Thessaly, Greece)
Hotos Giorgos (Department of Fisheries and Aquaculture Technology, TEI of Western Greece, Greece)
Katselis George (Department of Fisheries and Aquaculture Technology, TEI of Western Greece, Greece)
Kallianiotis Argyris (Fisheries Research Institute, Greece)
Kladas Ioannis (Department of Fisheries and Aquaculture Technology, TEI of Western Greece, Greece)
Kokkinakis Antonis (Faculty of Forestry and Natural Environment, Aristotle University of Thessaloniki, Greece)
Kormas Konstantinos (Department of Ichthyology & Aquatic Environment, University Thessaly, Greece)
Leonardos Ioannis (Department of Biological Applications and Technologies, University of Ioannina, Greece)
Mamuris Zisis (Department of Biochemistry & Biotechnology, University Thessaly, Greece)
Mattas Constantinos (School of Agriculture, Aristotle University of Thessaloniki, Greece)
Michaelidis Vasilios (School of Biology, Aristotle University of Thessaloniki, Greece)
Nathanailides Cosmas (Department of Fisheries and Aquaculture Technology, TEI of Western Greece, PASTI)
Orfanidis Sotiris (Fisheries Research Institute, Greece)
Spilanis Ioannis (Department of Environment, University of the Aegean, Greece)
Vafidis Dimitris (Department of Ichthyology & Aquatic Environment, University Thessaly, Greece)
Verriopoulos George (Faculty of Biology, National & Kapodistrian University of Athens, Greece)
Neofitou Christos (Department of Ichthyology & Aquatic Environment, University Thessaly, Greece)-Liaison
with OC
Panagiotaki Panagiota (Department of Ichthyology & Aquatic Environment, University Thessaly, Greece)-
Liaison with OC
Exadactylos Athanasios (Department of Ichthyology & Aquatic Environment, University Thessaly, Greece)-
Liaison with OC
488
HydroMedit 2014, November 13-15, Volos, Greece
489
HydroMedit 2014, November 13-15, Volos, Greece
Keynote Speakers
Former Director of Institut National de la Recherché Agronomique (INRA) France, and Elected President of the
European Aquaculture Society (EAS) 2014 - 2016, and EAS Board of Directors 2012-2014
2. Fisheries Technology
"Richness of artisanal fishery tools in the eastern Adriatic Sea"
Aleksandar Joksimovic,
Head of Ichthyology & Fisheries Biology Laboratory, University of Montenegro, Institute of Marine Biology
(Kotor)
3. Environmental Management
"Exploring seaweed biodiversity and ecology in the Eastern Mediterranean"
Frithjof C. Kuepper,
Professor, University of Aberdeen, Chair in Marine Biodiversity, Oceanlab.
4. Fisheries Economics
"EU Consumer Perceptions of Value of (new) Aquaculture Fish Products: a Cross-Cultural Proof-of-
Evidence"
Krystallis-Krontalis Athanasios,
Professor, Aarhus University, Department of Business Administration, Business and Social Sciences
490