Bangladesh J. Zool.

47(2): 229-241, 2019 ISSN: 0304-9027 (print)

2408-8455 (online)

PREDATORY PERFORMANCE OF COCCINELLA TRANSVERSALIS

AND ITS MOLECULAR IDENTIFICATION

Susmita Sarker, Abdul Jabber Howlader, Faria Farhana Rain,

Abu Faiz Md. Aslam*

Department of Zoology, Jahangirnagar University, Savar,

Dhaka- 1342, Bangladesh

Abstract: Predatory efficacy of Coccinella transversalis (Coleoptera: Coccinellidae)

on three detrimental agriculturally important aphids (Aphis craccivora, A. fabae
and A. gossypii) was studied under laboratory condition. The 4th instar larvae of C.
transversalis consumed highest (21.56 ± 1.72) number of A. craccivora aphids
followed by A. fabae (12.33 ± 1.74) and A. gossypii (13.99 ± 0.77). Life cycle
studies of C. transversalis on the above three aphid species revealed that it took
maximum (27.66 ± 3.06) days to complete life cycle while reared on A. craccivora
followed by A. fabae (25.66 ± 0.58 days) and A. gossypii (22.33 ± 1.52 days)
respectively. As C. transversalis is a potential predator, an attempt was taken to
identify this biological control agent based on mitochondrial cytochrome c oxidase
(COI) gene sequence. Sequenced gene was submitted to the NCBI GenBank
database (Accession NO. MG 587947.1) followed by proper procedure.
Phylogenetic relationship of the beetle was constructed based on mitochondrial
COI gene. The nucleotide composition analysis revealed that the value of A+T
(69.3%) was greater than G+C (30.7%). Such study of C. transversalis would be
helpful in biological control programme of aphid pest.
Key words: Coccinella transversalis, Predatory efficacy, DNA barcode

INTRODUCTION
Damage in agricultural and horticultural crops caused by aphids is very
dreaded problem because one aphid is enough to profound damage for large
crop area by transmitting the viral diseases (Difonzo et al. 1997, Raboudi et al.
2002). It is especially harmful in nurseries and young orchards (Dean and
Sterling 1992). It has been reported that this pest accounts for yield losses
ranging from 37 to 90% (Abate et al. 2000, Ampofo and Massomo 2009). The use
of insecticides for controlling this pest causes several adverse side-effects
(Ahmed and Akhtar 2013). These adverse effects of synthetic insecticides can be
overcome by the use of biological control agents (Bellows 2001).

*Author for correspondence: <afm.aslam@gmail.com>.

©2019 Zoological Society of Bangladesh DOI: https://doi.org/10.3329/bjz.v47i2.44334
230 Sarker et al.

The coccinellid predators are tolerant to many insecticides which is an

advantage over other predators (Banks and Stark 2011). Both the adult and
larval stages of the coccinellid beetle, Coccinella transversalis feeds primarily on
diverse aphids (Karpacheva 1991, Nunez-Perez et al. 1992). But there is lack of
data on choice to consume aphid species by this predator. Improved
understanding of coccinellid activity and predation on aphids in the laboratory
could clarify their potential in aphid biological control. The present studies were
conducted to determine the biology of Coccinella transversalis and its predatory
efficacy on three detrimental aphid species of agricultural crops, i.e. A.
craccivora, A. fabae and A. gossypii (Hossain et al. 2006, Aslam and Bashar
2001, Chowdhury et al. 2008) under laboratory conditions.
Considering their economic importance, timely and accurate identification of
coccinellid predator species is crucial for effective pest management strategies.
The taxonomic study revealed that, there exist huge morphological variations
within the species that lead huge dilemma to identify insects accurately (Ball
and Armstrong 2006, Singh and Singh 2014). Unlike other insect species,
limited molecular studies have been undertaken in the members of the
subfamily Coccinellidae of the insect order Coleoptera (Lyla and Haseena 2008).
A novel methodology known as DNA barcoding has the potential to mitigate the
challenges posed by identification of insect pests (Rugman-Jones et al. 2009,
Gariepy et al. 2007, Quicke et al. 2012, Sethusa et al. 2014). DNA barcoding
involves the PCR amplification and sequencing of a key genetic marker from a
given specimen (Gariepy et al. 2007). A short, standardized region of its genome,
specifically the mitochondrial gene, cytochrome c oxidase subunit 1 (COI) is
used in most of the cases (Hebert et al. 2004).
Therefore, an initiative was undertaken for the molecular identification and
characterization of C. transversalis based on COI gene sequences and the
sequences will be submitted to the NCBI GenBank. The overall goal is to avail
tools that will contribute to timely and accurate identification of these biological
control agents, which should in turn facilitate quicker and effective
implementation of pest management and strengthening of the IPM systems in
countries affected by the aphid species.

MATERIAL AND METHODS

Assessment of predatory efficacy: The predatory efficacy of larval stages of
Coccinella transversalis were tested on three agriculturally important aphid
species i.e. Aphis craccivora, A. fabae and A. gossypii separately under controlled
conditions (26 ± 2ºC and 65 ± 5% RH). To maintain a regular supply of the aphid
and beetle population, a garden of bean, Lablab purpureus and brinjal plants,
Predatory performance of Coccinella transversalis 231

Solanum melongena were maintained at the Insect Rearing and Experimental

Station, Department of Zoology, Jahangirnagar University.
To investigate the predatory efficacy of larvae of the predator against aphids,
newly hatched larvae of the predator were placed singly in six Petri dishes
having a Whatman filter paper. A counted number of aphids (30) were provided
in each Petri dish daily. Upper collar portion of the Petri dishes was treated with
vaseline and covered with muslin cloth to avoid larval escape. Everyday, old
leaves were substituted with new ones and unconsumed numbers of aphids
were noted. The predation potential of larvae of the predator was investigated by
feeding the grubs on aphids. The number of aphids consumed per day, during
the period of study was recorded in each treatment by counting the number of
remaining aphids and subtracting them from the total number of aphids
provided. The larvae of the predator were also checked daily for their moulting to
calculate the duration of each larval instar. This practice was continued until
pupation.

Molecular identification
DNA isolation: Coccinella transversalis was collected from the stock culture of
Molecular Entomology Laboratory of Jahangirnagar University. The genomic
DNA was extracted from somatic tissue rich in mitochondria, e.g., leg or elytra
(Levenbook and Williams 1956) using Wizard® Genomic DNA Purification Kit,
USA, following the manufacturer’s protocol with slight modification as
mentioned in Aslam et al. 2019. The remaining parts of insects and respective
individuals were kept as voucher specimens. Processed DNA was stored at 4⁰C
or −20⁰C.
DNA quantification and quality measurement: The quantity and purity of DNA
was measured by using Nano drop™ 2000 spectrophotometer (Thermo Fisher
Scientific, USA). 1 µl of nucleic acid was used to quantify nucleic acid. 260/280
Ratio, the ratio of absorbance was used to assess the purity of DNA. A ratio of
~1.8 was generally accepted as “pure” for DNA.
Polymerase chain reaction (PCR): The extracted DNA was subjected to PCR
amplification through Applied Biosystems® Veriti® 96-Well Thermal Cycler
following standard protocols. Primers used were forward primer: (LCO 1490 5′-
GGTCAACAAATCATAAAGATATTG G-3′) and reverse primer: (HCO 2198 5′-
TAAACTTCAGGGTGACCAAAAAATCA-3′). The PromegaGotaq® G2 Green Master
Mix (Promega Corporation) was used that contained GoTaq® G2 DNA
polymerase, dNTPs, MgCl2 and reaction buffers at optimal concentrations for
efficient amplification of a wide range of DNA templates by PCR. The PCR
reaction mixture consisted of total volume 20 µl among that master mix - 10 µl,
232 Sarker et al.

forward primer - 1 µl (10 picomolar), reverse primer - 1 µl (10 picomolar),

template DNA (50 mg), and adjustable nuclease free water. Thermocycling
consisted of an initial denaturation of 94°C for 3 min, followed by 30 cycles of
denaturation at 94°C for 30 sec, annealing at 49°C for 30 sec, extension at 72°C
for 1 min, final extension: 72⁰C for 10 min and hold: 4⁰C.
Gel electrophoresis: The PCR amplified product was separated by 1% agarose
gel electrophoresis (in 1XTAE buffer). The DNA of PCR products was visualized
by using UV-Transilluminator under gel documentation system - BioDoc
Analyzer of Biometra, UK.
COI gene sequencing: The PCR products were purified using Promega
Wizard® SV Gel & PCR clean up system manufactured by Promega Corporation,
USA following manufacturer's protocol. The quantity and purity of PCR purified
products was checked by spectrophotometer. DNA sequencing was performed to
determine the nucleotide sequence in cytochrome oxidase I region. BigDye®
Terminator v3.1 cycle sequencing kit was used in this process. Each species was
bi-directionally sequenced to get sequence of both (5’ and 3’) the DNA strands.
Submission of gene to GenBank: BioEdit v.7.0.5 software was used for
checking the quality of sequenced data. Homology, insertions - deletions, stop
codons, and framshifts was checked using NCBI BLAST. BankIt, a WWW-based
submission tool with wizards to guide the submission process was used. The
GenBank database was designed for new sequence data that was determined
and annotated by the submitter. Sequence was uploaded to GenBank.
Data analysis: The chromatograms were converted to FASTA format using
FinchTV chromatogram viewer software. The DNA sequences in ABI file were
manually edited using BioEdit v.7.0.5. Results of sequence editing were
analyzed using BLAST (Basic Local Alignment Search Tool) NCBI to indicate the
homology from closest species. Phylogenetic tree was constructed using
maximum likelihood method, calculation using Bootstrap with 1000 times of
repetition in MEGA (Molecular Evolutionary Genetic Analysis) software program
v.10.0. (Tamura et al. 2013). COI gene sequence of five coccinellid beetle
(Coccinella transversalis) was also collected from National Centre for
Biotechnology Information (NCBI) to compare with the research sample for their
phylogenetic analysis.

RESULTS AND DISCUSSION

Predatory efficacy: The results of the tests of predatory efficacy of the larval
stages of Coccinella transversalis on three aphid species, viz. Aphis craccivora, A.
fabae and A. gossypii are presented in Table 1. The1st and 2nd instar larvae
were found to consume maximum number of A. fabae aphids (5.67 ± 0.58 and
Predatory performance of Coccinella transversalis 233

8.33 ± 0.58). In comparison, 3rd and 4th instar larvae predate highest (13.66 ±
0.85 and 21.56 ± 1.72) number of A. craccivora aphids followed by A. fabae
(10.17 ± 1.65, 12.33 ± 1.74) and A. gossypii (12.17 ± 1.34, 13.99 ± 0.77)
respectively. According to Gurung et al. (2018), the total number of aphids,

Table1. Predatory efficacy of the coccinellid beetle, Coccinella transversalis larval stages on
three different aphid species

Attributes Max. Min. Predatory efficacy

Larva 1st instar A. craccivora 5 4 4.67 ± 0.57
A. fabae 6 5 5.67 ± 0.58
A. gossypii 6 4 4.67 ± 1.15
2nd " A. craccivora 11 9 5.67 ± 0.58
A. fabae 9 8 8.33 ± 0.58
A. gossypii 8 7 7.33 ± 0.58
3rd " A. craccivora 17 11 13.66 ± 0.85
A. fabae 11 9 10.17 ± 1.65
A. gossypii 14 11 12.17 ± 1.34
4th " A. craccivora 29 15 21.56 ± 1.72
A. fabae 15 10 12.33 ± 1.74
A. gossypii 16 11 13.99 ± 0.77

Fig. 1. A. An infested shoot, B. Eggs of C. transversalis, C. 4th instar larva predating on

aphid, D. Aphid predation by adult of C. transversalis.
consumed by each instar grub, viz. first, second, third, fourth were 15.4 ± 4.39,
27.2 ± 5.40, 37.15 ± 5.27, 44.3 ± 7.60 aphids per grub per day. On the other
hand, Chakraborty and Korat 2014 also reported that the feeding potential of
1st, 2nd ,3rd and 4th instar grub of as C. transversalis 22.33 ± 0.89, 37.20 ±
1.22, 47.93 ± 1.41, 66.47 ± 2.28 aphids, respectively when reared on L. erysimi.
234 Sarker et al.

Life cycle: Life cycle of C. transversalis was observed on three detrimental

aphid pests, viz. A. craccivora, A. fabae, A. gossypii separately under controlled
temperature (26 ± 2ºC) and relative humidity (65 ± 5%) in laboratory condition
(Table 2). The incubation period varied from 2 to 5 days with an average 2.70 ±
0.766 days and the hatching percentage of eggs was also remarkable (83.33 ±
14.57). It shows similarity with Shukla and Jadhav (2014). The duration of
fourth instar larvae of C. transversalis varied with an average 3.00 ± 0.0, 3.66 ±
0.58 and 4.66±0.58 days when reared on A. craccivora, A. fabae and A. gossypii,

Table 2. Life cycle of C. transversalis reared on A. craccivora, A. fabae and A. gossypii

Attributes Max. Min. Mean ± Sd

Incubation period (days) 5 2 2.70 ± 0.77
Hatching percentage 95 67 83.33 ± 14.57
Larva (days)
1st instar A. craccivora 4 2 2.66 ± 1.15
A. fabae 2 2 2±0
A. gossypii 3 2 2.66 ± 0.58
2nd instar A. craccivora 3 2 2.33 ± 0.58
A. fabae 3 2 2.66 ± 0.58
A. gossypii 3 3 3±0
3rd instar A. craccivora 4 3 3.33 ± 0.58
A. fabae 3 3 3±0
A. gossypii 4 3 3.66 ± 0.58
4th instar A. craccivora 3 3 3±0
A. fabae 4 3 3.66 ± 0.58
A. gossypii 5 4 4.66 ± 0.58
Total larval development
period (days)
A. craccivora 12 11 11.33 ± 0.58
A. fabae 13 12 12.33 ± 0.58
A. gossypii 13 11 12.33 ± 1.15
Prepupal period (days) A. craccivora 1 1 1±0
A. fabae 1 1 1±0
A. gossypii 1 1 1±0
Pupal period (days) A. craccivora 3 2 2.33 ± 0.58
A. fabae 3 2 2.66 ± 0.58
A. gossypii 3 3 3±0
Total life cycle (days) A. craccivora 31 25 27.66 ± 3.06
A. fabae 26 25 25.66 ± 0.58
A. gossypii 24 21 22.33 ± 1.52
Predatory performance of Coccinella transversalis 235

respectively. On the other hand, Shukla and Jadhav (2014) observed the
duration of fourth instar larvae of C. transversalis varied with an average 4.14 ±
0.888, 3.74 ± 0.823 and 4.36 ± 1.084 days when reared on A. craccivora, L.
erysimi and M. persicae. However, Solangi et al. (2007) recorded that fourth
instar larvae of C. undecimpunctata lasted for 3.3 ± 0.94 days when reared on
mustard aphid, L. erysimi. Khursheed et al. (2006) found that the mean duration
of fourth instar larvae of C. septempunctata was 4.0 ± 0.58 days when reared on
L. erysimi while it was 2.1 days in case of H. convergence when fed L. erysimi
(Lohar et al. 2012).
The total life cycle of C. transversalis varied from 25 - 31, 25 - 26 and 21 - 24
days when reared on A. craccivora, A. fabae and A. gossypii with an average
27.66 ± 3.06, 25.66 ± 0.58 and 22.33 ± 1.52 days, respectively in laboratory
condition.

Molecular characterization
Sequence result and BLAST analysis: The PCR results were separated using
1% agarose gel electrophoresis (in TBE buffer 1x) and observed by using UV-
Trans illuminator. The amplified DNA was visualized using UV-Trans illuminator
and the success of PCR was detected in the presence of a single DNA band of
700 bp (Fig. 2). It revealed that desired COI of mt DNA was properly polymerized.

Fig. 2. Agarose gel electrophoresis of mitochondrial DNA cytochrome

oxidase I (COI) from C. transversalis (1, 2), L = 100 bp ladder.
236 Sarker et al.

Coccinella transversalis was sequenced to further confirmation. The PCR

product of the mitochondrial cytochrome oxidase subunit I (COI) gene of
Coccinella transversalis yielded a single product of 638 bp. National Center for
Biotechnology Information (NCBI) BLAST was used to check homology between
the retrieved sequences and GenBank library or database of sequences. This
helped to identify sequence similarity across genomes.
BLAST analysis revealed that the observed sequence no.1 showed 100%
homology with the sequences in GenBank submitted from India, Pakistan,
Thailand, Australia and Polynesia (Table 3). It indicates that the observed
sample was Coccinella transversalis.

Table 3. BLAST analysis of C. transversalis

Species Max. Total Query Identity GenBank

E. value
name score score cover (%) (%) Acc. No.
C. transversalis 1142 1142 96 0.0 100 MF140496.1
C. transversalis 1173 1173 100 0.0 99.84 KY838208.1
C. transversalis 1168 1168 100 0.0 99.69 MH187251.1
C. transversalis 1123 1123 100 0.0 98.43 KX052276.1

The sequence was found to be a novel and has been deposited in the NCBI
GenBank (Accession No. MG 587949.1).
Nucleotide composition of C. transversalis: Retrieved sequence was subjected
for analysis of nucleotide composition (Table 4). Codon positions included were
1st + 2nd + 3rd + non-coding. All positions containing gaps and missing data
were eliminated from the dataset. The A, T, G, C, AT and GC content of all
sequences was obtained using a computer program (MEGA v.10.0). From the
analysis it was found that the average largest number of nucleotide was
thiamine (T) and composed of 38.7% nucleotide and lowest was guanine (G)
which composed of 14.6% . The maximum value of adenine and thiamine (A+T,
69.3) and the minimum value of guanine and cytosine (G+C, 30.7) was also
found in C. transversalis. As expected, AT content was found significantly higher
than the GC content. It showed similarity with that reported by Aslam et al.
2019.

Table 4. Nucleotide composition of C. transversalis

Species T(U) C A G Total A+T G+C

C. transversalis 38.7 16.1 30.6 14.6 638.0 69.3 30.7

Multiple sequence alignment: Sequences were aligned using the MEGA v.10.0.
Residue and pairwise distances were estimated using the Clustal W tool with
Predatory performance of Coccinella transversalis 237

default settings of gap opening penalty 15, and a gap-extension 6.6 in pairwise
alignment and 0.05 in multiple alignments. Multiple sequence alignment of six
COI gene nucleotide sequences of C. transversalis was given in Fig. 3. A total of
five sequences from different parts of the world available in the NCBI GenBank
were used for a proper comparison. Non-conserved regions were presented by
letter and identical or conserved regions were indicated by dot.

Fig. 3. Multiple sequence alignment based on COI gene sequences of C. transversalis. Letter denotes
the conserved region and dot means non conserved portion among the four nucleotide
sequences.
238 Sarker et al.

Phylogenetic analysis: Maximum likelihood (ML) tree was analyzed to find the
phylogenetic relationship among the samples of C. transversalis using MEGA
v.10.0 software. According to maximum likelihood with 1000x bootstrap
repetition, a phylogeny was constructed (Fig. 4) by the MEGA v.10.0 software
using analyzed six sequences (marked as Research sample) of C. transversalis. A
total of nine sequences from different parts of the world available in the NCBI
GenBank were used for a proper comparison. Here, Apis cerana, a bee belongs
to the order Hymenoptera was used as an out group. All C. transversalis
originated from one clade and showed 100% genetic diversity among them. The
bar at the bottom provides a scale for the genetic change. In this case, the line
segment with the number '0.05' showed the length of branch that signifies an
amount genetic change of 0.050.

Fig. 4. Molecular phylogenetic analysis by maximum likelihood method. The evolutionary history was
inferred using the maximum likelihood method based on the Tamura-Nei model. The tree is
drawn to scale, with branch lengths measured in the number of substitutions per site. The
percentage of trees in which the associated taxa clustered together is shown above the branches.

Over the last decade the field of DNA barcoding has emerged as a molecular
method for species identification. The goal of DNA barcoding is to create a
library of every organism on earth (Stoeckle et al. 2004, Kerr et al. 2007).
Although the major insect pests in food and their biological control agents are
widespread worldwide, only a few studies have been conducted on the DNA
barcodes for these species (Seo et al. 2013). Therefore, this study is the first
attempt of construction of a DNA reference dataset using the mitochondrial COI
gene along with molecular characterization and other related bioinformatics
analysis from Bangladesh. Though there are sequences of C. transversalis in
Predatory performance of Coccinella transversalis 239

NCBI GenBank, any published paper on molecular characterization of this

important biological control agent was not available. This dataset can be
effectively used to identify this biological control agent. DNA barcoding can help
in identifying such agents in any stage of life. Such identification would help to
use this predator as a biological control agent more effectively in nature. Thus,
this system would help farmers to save cost of billion dollars from pest damage
(Kaur 2015, Sarvananda 2018). Moreover, our results showed the potential role
of C. transversalis in bio control of three detrimental agricultural aphids.
However, further field based studies are needed to confirm this hypothesis.
Acknowledgements: This work was partially supported by grants from Higher
Education Quality Enhancement Project (CP-3424), a project of University
Grants Commission of Bangladesh and Ministry of Education, Bangladesh.

LITERATURE CITED
ABATE, T., VAN, H.A. and AMPOFO, J.K. 2000. Pest management strategies in traditional
agriculture: An African perspective. J. Ann. Rev. Entomol. 45: 631-659.
AHMED, M. and AKHTER, S. 2013. Development of insecticide resistance in field populations of
Brevicoryne brassicae (Hemiptera: Aphididae) in Pakistan. J. Econ. Entomol. 106 (2): 954-958.
AMPOFO, J.K. and MASSOMO, S.M. 2009. Some cultural strategies for management of bean stem
maggots (Diptera: Agromyzidae) on beans in Tanzania. Afr. Crop Sci. J. DOI: tspace.library.
utoronto.ca/handle/1807/20304.
ASLAM, A.F.M., SULTANA, S., RAIN, F.F., SARKER, S., DAS, S.R. and HOWLADER, A.J. 2019.
Molecular characterization and identification of three stored grain pests based on
mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Bangladesh J. Zool.
47(1):1-11.
ASLAM, A.F.M. and BASHAR, M.A. 2001. Aphid pest problems on duckweed in minipond
ecosystems. Bangladesh J. Zool. 29(2): 159-166.
BALL, S.L. and ARMSTRONG, K.F. 2006. DNA barcodes for insect pest identification. Canadian J.
Forest Res. 36(2): 337-350.
BANKS, J.E. and STARKS, J.D. 2011. Effects of a nicotinic insecticide, insidacloprid and vegetarian
diversity on movement of a common predator, Coccinella septempunctata. Bioseptic.Int. 7(2):
113-122.
BELLOWS, T.S. 2001. Restoring population balance through natural enemy introductions. Bio. Con.
21: 199-205.
CHAKRABORTY, D. and KORAT, D.M. 2014. Biology, mormphometry and feeding potential of
Coccinella transversalis (Fabricus) on aphids. Indian J. Entomol.77: 197-198.
CHOWDHURY, S.P., AHAD, M.A., AMIN, M.R. and RASEL, N.A. 2008. Bean aphid predation
efficiency of lady bird beetle Micraspis discolor F. (Coleoptera: Coccinellidae). J. Soil Nature
2(3): 40-45.
DEAN, D.A. and STERLING, W.L. 1992. A comparison of sampling methods to predict phenology of
predaceous arthropods in a cotton agro-ecosystems. J. Agri. Res. 46(8): 257-282.
DIFONZO, C.D., RAGSDALE, D.W., RADCLIFFE, E.B., GUMESTAD, N.C. and SECOR, G.A. 1997.
Seasonal abundance of aphid vectors of potato virus Y in the Red River Valley of Minnesota
and North Dakota. J. Econ. Entomol. 90: 824-831.
240 Sarker et al.

GARIEPY, D.T., KULHMANN, U., GILLOTT, C. and ERLANDSON, M. 2007. Parasitoids, Predators and
PCR: the use of diagnostic molecular marker in control of Arthropods. J. Appl. Ecol. 131(4):
225-240.
GURUNG, B. PONNUSAMY, N. and PAL. S.2018. Biology and feeding potential of lady beetle
Coccinella transversalis (Fabricus) (Coleoptera: Coccinellidae) on Lipaphis erysimi (Koch). J.
Insect Sci. 31(1-2): 47-50.
HOSSAIN, A.F., FERDOUS, J. and SALIM, M.M.R. 2006. Relative abundance and yield loss
assessment of lentil aphid Aphis craccivora Koch in relation to different sowing dates. J. Ari.
Rural Dev. 4(1&2): 101-106.
HEBERT, P.D.N., STOECKLE, M.Y., ZEMLAK, T.S. and FRANCIS, C.M. 2004. Identification of birds
through DNA barcodes. Proc. R. Soc. Land. B. Biol. Sci. 2: 1657–1663.
KARPACHEVA, N.S.1991. Ladybird beetle, Zaschchita rastenii. J. Econ. Entomol. 10: 34-35.
KAUR, S. 2015. DNA barcoding and its applications. Int. J. Eng. Res. Gen. 3(2): 602-604.
KENNEDY, J.S., DAY, M.F. and EASTOP, V.F. 1962. A Conspectus of Aphids as Vectors of Plant
Viruses. Commonwealth Institute of Entomology, London.
KERR, K.C.R., STOECKLE, M.Y., DOVE, C.J., WEIGT, L.A., FRANCES, C.M. and HEBERT, P.D.N.
2007. Comprehensive DNA barcode coverage of North American birds. Mol. Ecol. Notes. 7:
535-543.
KHURSHEED, R., HUSSAIN, B., AHMED, S.B. and ASHRAF, M. 2006. Biology and feeding potential
of Coccenella septempunctata on mustard aphid, Lipaphis erysimi. Int. J. Zool. Res. 2(1):
30-33.
LEVENBOOK, L and WILLIAMS, C.M. 1956. Mitochondria in the flight muscles of insects. J. Gen.
Physiol. 39(4): 497-512.
LOHAR, M.K., KHUHRO, S.N., LAKHO, M.H., MAGSI, G.A. and KHUHRO, T.A. 2012. Biology and
feeding potential of predator, Hipppdamia convergence Guir (Coleoptera : Coccinella) on
mustard aphid, Lipaphis erysimi Kalt.) in laboratory. Pak. J. Agri., Agril. Engg. Vet. Sci.
28(2):150-159.
LYLA, K. R. and HASEENA, B. 2008. Biology and feeding preference of the coccinellid predator,
Coccinella transversalis Fab. Ins. Environ. 14(2): 75-76.
NUNEZ, P.E., TIZADO, E.J. and NIETO, J.M. 1992. Coccinellid (Coleoptera: Coccinellidae) predators
of aphids on cultivated plants in Leon. Bole. Sani. Veg. Plagas. 18: 765-775.
QUICKE, D.L., ALEX SMITH, M., JANZEN, D.H., HALLWACHS, W., FERNANDEZ-TRIANA, J.,
LAURENNE, N.M., ZALDIVAR-RIVERON, A., SHAW, M.R., BROAD, G.R. and KLOPFSTEIN, S.
2012. Utility of the DNA barcoding gene fragment for parasitic wasp phylogeny (Hymenoptera:
Ichneumonoidea): Data release and new measure of taxonomic congruence. Mol. Ecol. Resour.
12: 676-685.
RABOUDI, F., BENMOUSSA, A., MAKNI, H., MARRAAKACHI, M. and MAKNI, M. 2002.Serological
detection of plant viruses and host plant in Tunisia. EPP. Bulle. 32: 495-498.
RUGMAN-JONES, P. F., ROBERT, W., TOM, van NOORT.and RICHARD, S. 2009. Molecular
differentiation of the Psyttalia concolor (Szépligeti) species complex (Hymenoptera: Braconidae)
associated with olive fly, Bactro ceraoleae (Rossi) (Diptera: Tephritidae), in Africa. J. Biol.
Control. 49(1): 17-26.
SARVANANDA, L. 2018. Short introduction of DNA barcoding. Int. J. Res. 5(4): 673-685.
SEO, Y.C., KYONG, S. and BAE, Y. J. 2013. DNA barcode library and its efficacy for identifying food-
associated insect pests in Korea. Entomol. Res. 43: 253-261.
Predatory performance of Coccinella transversalis 241

SETHUSA, M.T., MILLAR, I.M., YESSOUFOU, K., JACOBS, A., VAN DER BANK, M. and VAN DER
BANK, H. 2014. DNA barcode efficacy for the identification of economically important scale
insects (Hemiptera: Coccoidea) in South Africa. African J. Zool. 22(1): 257-267.
SHUKLA, A. and JADHAV, D.S. 2014. Biology of Coccinella transversalis (Fabricus) on different
aphid species. J. Bio. 9(1): 17-22.
SINGH, B.B.and SINGH, R. 2014. Major rice insect pests in north eastern UP. Int. J. Life Sc. Bt &
Pharm. 3(1):124-143.
SOLANGI, B.K., LANJAR, A.G. and LOHAR, M.K. 2007.Biology of 11-spotted beetle Coccinella
undecimpunctataL. (Coccinellidae: Coleoptera) on mustard aphid Lipaphis erysimi Kalt. J.
Appl. Sci. 7(20): 3086-3090.
STOECKLE, M., WAGGONER, P.E. and AUSUBEL, J.S. 2004. Barcoding Life: Ten Reasons.
Consortium for the Barcode of Life, v3.0.Retrieved.from:http://www.barcodeoflife.org/
content/barcoding-life-ten-reasons-pamphlet.
TAMURA, K., PETERSON, D., PETERSON, N., STECHER, G., NEI, M. and KUMAR, S. 2013. MEGA6:
Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Mol. Biol. Evol. 28: 2731-2739.

(Manuscript received on 10 July, 2019; revised on 10 October, 2019)