Plant Cell Rep (2012) 31:1085–1091
DOI 10.1007/s00299-012-1228-x
ORIGINAL PAPER
Heme oxygenase is involved in nitric oxide- and auxin-induced
lateral root formation in rice
Yi-Hsuan Chen • Yun-Yang Chao • Yun Yen Hsu
Chwan-Yang Hong • Ching Huei Kao
Received: 30 November 2011 / Revised: 1 January 2012 / Accepted: 8 January 2012 / Published online: 20 January 2012
Ó Springer-Verlag 2012
Abstract Lateral root (LR) development performs the
essential tasks of providing water, nutrients, and physical
support to plants. Therefore, understanding the regulation
of LR development is of agronomic importance. In this
study, we examined the effect of nitric oxide (NO), auxin,
and hemin (Hm) on LR formation in rice. Treatment with
Hm [a highly effective heme oxygenase (HO) inducer],
sodium nitroprusside (SNP, an NO donor), or indole-3-
butyric acid (IBA, a naturally occurring auxin) induced LR
formation and HO activity. LR formation and HO activity
induced by SNP and IBA but not Hm was reduced by the
specific NO scavenger 2-(4-carboxyphenyl)-4,4,5,5-tetra-
methylimidazoline-1-oxyl-3-oxide. As well, Hm, SNP, and
IBA could induce OsHO1 mRNA expression. Zn proto-
porphyrin IX (the specific inhibitor of HO) and hemoglobin
(the carbon monoxide/NO scavenger) reduced LR number
and HO activity induced by Hm, SNP, and IBA. Our
data suggest that HO is required for Hm-, auxin-, and
NO-induced LR formation in rice.
Keywords Auxin  Heme oxygenases  Hemin 
Lateral roots  Nitric oxide  Rice
Communicated by Q. Zhao.
Y.-H. Chen  Y.-Y. Chao  Y. Y. Hsu  C. H. Kao (&)
Department of Agronomy, National Taiwan University,
Taipei, Taiwan, ROC
e-mail: kaoch@ntu.edu.tw
C.-Y. Hong
Department of Agricultural Chemistry,
Institute of Biotechnology, National Taiwan University,
Taipei, Taiwan, ROC
•
Introduction
Heme oxygenase (HO) catalyzes the degradation of heme
into biliverdin IXa (BV), Fe2?, and carbon monoxide (CO)
in a reaction requiring molecular oxygen and electrons
from NADPH (Muramoto et al. 2002; Terry et al. 2002;
Gohya et al. 2006). HO has been extensively investigated
in animal tissues (Synder and Baranano 2001). Arabidopsis
HOs can be grouped into the two subfamilies HO1 and
HO2 (Emborg et al. 2006). AtHO1 (HY1), AtHO3, and
AtHO4 belong to the HO1 subfamily, whereas AtHO2 is
the only member of the HO2 subfamily (Davis et al. 2001;
Gisk et al. 2010). Recently, Shen et al. (2011) identified
three novel HOs from rapeseed (Brassica napus), BnHO1,
BnHO2, and BnHO3 that share high identity with their
counterparts from Arabidopsis.
In plants, much attention has been paid to HO1 because
it is associated with the biosynthetic pathway leading to
phytochrome chromophore formation (Davis et al. 1999,
2001; Emborg et al. 2006; Gisk et al. 2010), protection
against oxidative damage (Noriega et al. 2004; Shen et al.
2011), and root development (Xuan et al. 2008; Guo et al.
2009). Expression of HO1 in plants is regulated by ultra-
violet-B, H2O2, nitric oxide (NO), cytokinin, and heavy
metals (Noriega et al. 2004; Yannarelli et al. 2006 Noriega
et al. 2007; Xuan et al. 2008; Santa-Cruz et al. 2010;
Huang et al. 2011; Wei et al. 2011; Xu et al. 2011).
Lateral roots (LRs) originate in the pericycle, penetrate
outward through the cortex, and then appear on the surface
of the parental roots (Hao and Ichii 1999). Nutrients are
one of the major environmental signals that affect LR
development. In soil, LRs preferentially proliferate in the
nutrient-rich zone (Robinson 1994). LR development is
also influenced by auxin (Muday and Haworth 1994;
Bhalero et al. 2002; Wang et al. 2006). As a signaling
123
1086
molecule, NO has an important role in auxin-induced LR
formation (Correa-Aragunde et al. 2004, 2006; Guo et al.
2008; Chen and Kao 2012).
The role of HO in regulating LR formation by auxin and
NO has been clarified in tomato (Guo et al. 2008). How-
ever, the role of HO regulating LR formation in rice has not
been examined. Hemin (Hm), a heme (ferroprotoporphyrin
IX) compound, is a potent HO1 inducer (Zilli et al. 2008;
Fu et al. 2011). In this study, we examined the role of HO
regulating LR formation in rice, with the effect of Hm on
LR formation used as a positive control. We provide evi-
dence that HO is required for auxin- and NO-induced LR
formation in rice.
Materials and methods
Plant material and growth conditions
Seeds of rice (Oryza sativa L., cv. Taichung Native 1, an
Indica type) were sterilized with 3% sodium hypochlorite
for 15 min and washed extensively with distilled water. To
obtain more uniformly germinated seeds, rice seeds in a
Petri dish (20 cm) containing distilled water were pre-
treated at 37°C for 1 day under dark conditions. Uniformly
germinated seeds were then selected and transferred to a
Petri dish (20 cm) containing two sheets of filter paper
moistened with distilled water for 2 days. Two-day-old
seedlings were then transferred to Petri dishes (9 cm)
containing distilled water, indole-3-acetic acid (IBA),
sodium nitroprusside (SNP), Hm, 2-(4-carboxyphenyl)-
4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO),
zinc protoporphyrin IX (ZnPPIX), or hemoglobin (Hb) at
the desired concentration. Root growth of rice seedlings
grown in distilled water is similar to that grown in medium
containing inorganic salts; thus, seedlings grown in dis-
tilled water were used as the control. Each Petri dish
contained five seedlings and each treatment was replicated
four times. The seedlings were allowed to grow at 27°C in
darkness. The seminal roots of rice seedlings at the times
specified were used for analysis of LR formation, HO
activity, and OsHO1 transcripts.
LR formation
To show LR formation in seminal roots for each treatment,
the number of LRs longer than 1 mm per seedlings was
counted.
HO extraction and assay
HO activity was analyzed basically as described
(Xuan et al. 2008). For extraction of HO, 25 roots were
123
Plant Cell Rep (2012) 31:1085–1091
homogenized with 3 mL of 25 mM HEPES–Tris (pH 7.4)
containing 250 mM mannitol, 1 mM EDTA, 1% (w/v)
polyvinylpyrrolidone, 10% (v/v) glycerol, and 1 mM
dithiothreitol. The whole isolation procedure was carried
out at 4°C. The homogenate was centrifuged at 15,0009g
for 30 min, and the resulting supernatant was used for
determination of HO activity as described (Xuan et al.
2008). The reaction mixture (1 mL) contained 2 mM des-
ferrioxamine in 100 mM HEPES–NaOH (pH 7.2), 100 lM
NADPH, 10 lM Hm, 0.15 mg mL-1 bovine serum albumin,
50 lg mL-1 (4.2 lM) spinach ferredoxin, 0.025 U mL-1
spinach ferredoxin-NADP? reductase, 5 mM ascorbate, and
enzyme extract (250 lL). The reaction was started by add-
ing NADPH and allowed to proceed at 37°C for 30 min. The
absorbance of BV was measured at 650 nm. The increase in
BV concentration was determined by the extinction coeffi-
cient 6.25 mM-1 cm-1 at 650 nm. One unit of activity for
HO was defined as the amount of enzyme that produced
1 lmol of BV per 30 min. Rice roots contained very low
protein. Thus, HO activity was expressed on a dry weight
(DW) basis.
Semi-quantitative RT-PCR
Total RNA was isolated from the roots of seedlings by
the TRIzol reagent method (Invitrogen, CA, USA). To
prevent DNA contamination, RNA was treated with
Turbo DNase I (Ambion, TX, USA) for 30 min at 37°C
before RT-PCR. Control PCR amplifications involved
RNA used as a template after DNase I treatment to verify
the elimination of contaminated DNA. Reverse-tran-
scription reactions involved 200 ng of total RNA and the
SuperScript III first-strand synthesis RT-PCR system
(Invitrogen, CA, USA).
We searched the rice genome annotation project
(http://rice.plantbiology.msu.edu/) for the sequence of
rice heme oxygenase 1 (OsHO1, LOC_Os06g40080) with
Arabidopsis HY1 (Davis et al. 1999) (AtHO1) used as a
reference. Gene-specific primers were designed from the
50 UTR of the rice OsHO1 gene. The sequences used and
the predicted amplicon are in Table 1. The RT-PCR pro-
gram was 94°C denaturation for 5 min, then 27–30 cycles
of 94°C for 45 s, 60°C for 45 s, 72°C for 45 s, 72°C
extension for 5 min, and finally 16°C. PCR was optimized
for a number of cycles to ensure product intensity within
the linear phase of amplification. For all treatments,
RT-PCR was performed three times with three batches of
total RNA isolated independently. PCR products were
resolved by electrophoresis in 3% agarose gel and stained
with ethidium bromide. The gel images were captured with
use of a SynGene gel documentation system and analyzed
by use of Genetools (Syngene, MD, USA). The rice
OsUbiquitin gene was used for normalization.
Plant Cell Rep (2012) 31:1085–1091 1087

Table 1 Primers used in semi-

Gene TIGR locus name Primer Sequence (50 –30 ) Products (bp)
quantitative RT-PCR assay
OsHO1 LOC_Os06g40080 HO1-50 CATTCCAATCCACTCCCACCA 209
HO1-30 AAG GTG CTC GAC GAT GGCGAC
OsUbiquitin LOC_Os03g13170.1 Ubi-50 CGCAAGTACAACCAGGACAA 101
Ubi-30 TGGTTGCTGTGACCACACTT

Statistical analysis

Data were analyzed by Duncan’s multiple range test.

P \ 0.05 was considered to be statistically significant.

Results

Effect of SNP and IBA on LR formation

and HO activity

In a previous work, SNP and IBA at 500 and 1 lM,

respectively, were found to be the optimal concentrations
for promoting LR formation (Chen and Kao 2012).
Figure 1 shows the time course of LR formation and HO
activity in rice treated with 500 lM SNP and 1 lM IBA for
1, 2, and 3 days. The number of LRs began to increase at
3 days of treatment (Fig. 1a). HO activity in SNP- and
IBA-treated roots was higher than that of control after
1 day of treatment (Fig. 1b).

Effect of Hm on LR formation and HO activity

To examine the effect of Hm on LR formation and HO
activity, 2-day-old rice seedlings were treated with various
concentrations of Hm for 1 or 3 days. As compared with
water treatment, Hm (5–50 lM) was effective in inducing
LR formation (Fig. 2a) and increasing HO activity
(Fig. 2b), with Hm at 10 lM being the optimal concentra-
tion. To examine the changes in the number of LRs and
activity of HO, 2-day-old rice seedlings were treated with
water and 10 lM Hm for 1, 2, and 3 days. The Hm-induced
increase in HO activity occurred at 1 day after treatment
and that of LR number at 3 days after treatment (Fig. 3a, b)
NO is involved in SNP- and IBA-, but not Hm-induced
LR formation and HO activity
To examine whether SNP-, IBA-, and Hm-increased LR
number and HO activity resulted from NO production, we
used 100 lM cPTIO, an NO-specific scavenger, along with
500 lM SNP, 1 lM IBA, or 10 lM Hm. cPTIO inhibited
the effect of SNP and IBA on LR formation (Fig. 4), but
had no effect on Hm-induced LR formation (Fig. 5).
Fig. 1 Changes in lateral root (LR) number (a) and HO activity (b) in
rice seedlings treated with sodium nitroprusside (SNP) or indole-
3-butyric acid (IBA). Two-day-old seedlings were treated with
water, 500 lM SNP, and 1 lM IBA for 1, 2, and 3 days. Data are
mean ± SE (n = 4). Values with the same letters are not significantly
different at P \ 0.05
Hm, IBA, and SNP increase OsHO1 mRNA expression
To examine whether Hm, SNP, and IBA affect the
expression of OsHO1, 2-day-old seedlings were treated
with Hm, SNP, or IBA for 24 h, which increased the mRNA
level of OsHO1 (Fig. 6).
Effect of zinc protoporphyrin IX (ZnPPIX)
or hemoglobin (Hb)
ZnPPIX (a potent HO1 inhibitor) inhibits HO activity in
plants (Liu et al. 2007; Xuan et al. 2008). We also found that
200 lM ZnPPIX pretreatment inhibited Hm-, SNP-, and
IBA-increased LR formation and HO activity (Fig. 7a, b).

123
1088
Fig. 2 Effect of Hm on LR number (a) and HO activity (b) in rice.
Two-day-old seedlings were treated with Hm (0–50 lM) for 1 day
(b) and 3 days (a). Data are mean ± SE (n = 4). Values with the
same letters are not significantly different at P \ 0.05
Fig. 3 Changes in the LR number (a) and HO activity (b) in rice
seedlings treated with Hm. Two-day-old seedlings were treated with
10 lM Hm for 1, 2, and 3 days. Data are mean ± SE (n = 4). Values
with the same letters are not significantly different at P \ 0.05
123
Plant Cell Rep (2012) 31:1085–1091
Fig. 4 Effect of cPTIO on LR number (a) and HO activity (b) of rice
seedlings treated with SNP and IBA. Two-day-old seedlings were
treated with H2O, SNP, cPTIO, SNP ? cPTIO, IBA, and IBA ?
cPTIO for 1 day (b) and 3 days (a), respectively. The concentrations
of cPTIO, SNP, and IBA, were 100, 500 and 1 lM, respectively. Data
are mean ± SE (n = 4). Values with the same letters are not
significantly different at P \ 0.05
Treating rice roots with 0.14 g L-1 Hb (a CO/NO scaven-
ger) inhibited the effect of Hm, SNP, and IBA on LR
formation (Fig. 8a) and HO activity (Fig. 8b).
Discussion
Application of Hm or hematin could induce HO activity
and HO1 mRNA and HO1 protein expression in cucumber
(Xuan et al. 2008), Arabidopsis (Xie et al. 2011), alfalfa
(Fu et al. 2011), and tomato roots (Xu et al. 2011). Here,
we confirmed that Hm increased HO activity and OsHO1
transcript levels in rice roots. Similarly, the application of
IBA and SNP increased HO activity and OsHO1 mRNA
levels in rice roots. Therefore, the increase in HO activity
in Hm-, SNP-, and IBA-treated rice roots could be regu-
lated at the transcriptional level.
Chen and Kao (2012) demonstrated that IBA- and SNP-
promoted LR formation in rice was mediated by NO. Here,
we showed that the NO scavenger cPTIO blocked SNP-
and IBA-increased HO activity in rice roots (Fig. 4b),
which suggests that LR and HO activity in rice roots
increased by SNP and IBA depends on NO. As well, the
Plant Cell Rep (2012) 31:1085–1091
Fig. 5 Effect of cPTIO on LR number (a) and HO activity (b) of rice
seedlings treated with Hm. Two-day-old seedlings were treated with
H2O, cPTIO, Hm, or cPTIO ? Hm for 1 day (b) and 3 days (a),
respectively. The concentrations of cPTIO and Hm were 100 and
10 lM, respectively. Data are mean ± SE (n = 4). Values with the
same letter are not significantly different at P \ 0.05
OsHO1
OsUbiquitin
Relative amount of mRNA
(OsHO1 / OsUbiquitin )
Fig. 6 Effect of Hm, IBA, and SNP on OsHO1 mRNA level in rice
roots. Two-day-old seedlings were treated with H2O, 10 lM Hm,
1 lM IBA, or 500 lM SNP for 1 day. Semi-quantitative RT-PCR
analysis of mRNA levels relative to that of OsUbiquitin. Data are
mean ± SE (n = 3). Values with the same letters are not significantly
different at P \ 0.05
expression of HO1 was previously found to be triggered by
NO (Noriega et al. 2007; Xuan et al. 2008; Santa-Cruz
et al. 2010).
1089
Fig. 7 Effects of ZnPPIX on Hm-, SNP-, and IBA-increased LR
number (a) and HO activity (b) in rice. Two-day-old seedlings were
pretreated with or without ZnPPX for 3 h and then treated with H2O,
Hm, SNP, or IBA, respectively, for 1 day (b) or 3 days (a). The
concentrations of Hm, SNP, IBA, and ZnPPIX were 10, 500, 1, and
200 lM, respectively. Data are mean ± SE (n = 4). Values with
different letters are not significantly different at P \ 0.05
In rapeseed seedlings, hematin induced an increase in
endogenous NO during the development of lateral root
primordia (Cao et al. 2007). As well, HO/CO-increased LR
number in tomato depended on NO synthesis (Guo et al.
2008). However, our Hm treatment could not produce NO
in rice roots (data not shown) and Hm-promoted LR for-
mation and HO activity were not affected by cPTIO
(Fig. 5).
We found that Hm, SNP and IBA, which increased HO
activity (Figs. 1, 2, 3) and OsHO1 mRNA level (Fig. 6),
could induce LR formation in rice roots (Figs. 1, 2, 3).
In addition, Hm-, SNP-, and IBA-induced HO activity
occurred before LR formation (Figs. 1, 3). Finally, Hm-,
SNP-, and IBA-promoted LR formation, and HO activity
could be blocked by ZnPPIX, an HO inhibitor (Fig. 7), and
Hb, a CO/NO scavenger (Fig. 8). Thus, our pharmacolog-
ical evidence supports that HO might be involved in Hm-,
SNP-, and IBA-promoted LR formation in rice roots.
CO was found to induce LR formation in tomato (Guo
et al. 2008) and rapeseed (Cao et al. 2007). HO has been
claimed as the sole enzymatic source of CO (Muramoto
et al. 2002; Terry et al. 2002; Gohya et al. 2006). In the
123
1090
Fig. 8 Effects of Hb on SNP-, IBA-, and Hm-induced LR number
(a) and HO activity (b) in rice. Two-day-old seedlings were treated
with H2O, Hb, SNP, IBA, Hm, SNP ? Hb, IBA ? Hb, or Hm ? Hb
for 1 day (b) or 3 days (a). The concentrations of Hb, SNP, IBA, and
Hm were 0.14 g L-1, and 500, 1, and 10 lM, respectively. Bars show
mean ± SE (n = 4). Values with different letters are not significantly
different at P \ 0.05
present study, we did not examine the effect of CO on LR
formation and HO activity in rice; nor did we investigate
whether Hm, SNP, and IBA induced CO production in rice
roots. However, our data indicate that the application
of Hb, an NO/CO scavenger, reduced Hm-, SNP-, and
IBA-increased HO activity (Fig. 8b). This indirect evi-
dence suggests that CO might increase HO activity in rice
roots.
In summary, this is the first study investigating the
involvement of HO in LR formation in the rice root system.
Our data strongly suggest that NO is responsible for auxin-
but not Hm-promoted LR formation and that HO is
required for auxin-, NO-, and Hm-induced LR formation in
rice. It is not known whether overexpression of OsHO1
in rice results in an increase in LR formation. Further work
in this direction seems warranted.
Acknowledgments This work was supported by a research Grant
from the National Science Council of the Republic of China (NSC
99-2628-B-002-002).
123
Plant Cell Rep (2012) 31:1085–1091
References
Bhalero RP, Ekd} of J, Ljung K, Marchant A, Bennett M, Sandberg G
(2002) Shoot-derived auxin is essential for early lateral root
emergence in Arabidopsis seedlings. Plant J 29:325–332
Cao X-Y, Xuan W, Liu Z-Y, Li X-N, Zhao N, Xu P, Wang Z, Guan
R-Z, Shen W-B et al (2007) Carbon monoxide promotes lateral
root formation in rapeseed. J Integr Plant Biol 49:1070–1079
Chen YH, Kao CH (2012) Calcium is involved in nitric oxide- and
auxin-induced lateral root formation in rice. Protoplasma
249:187–195
Correa-Aragunde N, Graziano M, Lamattina L (2004) Nitric oxide
plays a central role in determining lateral root development in
tomato. Planta 218:900–905
Correa-Aragunde N, Graziano M, Chevallier C, Lamattina L (2006)
Nitric oxide modulates the expression of cell cycle regulatory
genes during lateral root formation in tomato. J Exp Bot
57:581–688
Davis SJ, Kurepa J, Vierstra RD (1999) The Arabidopsis thaliana
HY1 locus, required for phytochrome-chromophore biosynthesis,
encodes a protein related to heme oxygenases. Proc Natl Acad
Sci USA 96:6541–9546
Davis SJ, Bhoo SH, Durski AM, Walter JM, Vierstra RD (2001) The
heme-oxygenase family required for phytochrome chromophore
biosynthesis is necessary for proper photomorphogenesis in
higher plants. Plant Physiol 126:656–659
Emborg TH, Walker JM, Noh B, Vierstra RD (2006) Multiple heme
oxygenase family members contribute to the biosynthesis of
the phytochrome chromophore in Arabidopsis. Plant Physiol
140:856–968
Fu G, Zhang L, Cui W, Wang Y, Shen W, Ren Y, Zheng T (2011)
Induction of heme oxygenase-1 with b-CD-hemin complex
mitigates cadmium-induced oxidative damage in the roots of
Medicago sativa. Plant Soil 345:271–285
Gisk B, Yasui Y, Kohchi T, Frankenbeg-dinkel N (2010) Character-
ization of the haem oxygenase protein family in Arabidopsis
thaliana reveals a diversity of functions. Biochem J 435:425–434
Gohya T, Zhang X, Yoshida T, Migita CT (2006) Spectroscopic
characterization of a higher plant heme oxygenase isoform-1
from Glycine max (soybean): coordination structure of the heme
complex and catabolism of heme. FEBS J 273:5384–5399
Guo K, Xia K, Yang ZM (2008) Regulation of tomato lateral root
development by carbon monoxide and involvement in auxin and
nitric oxide. J Exp Bot 58:3443–3452
Guo K, Kong WW, Yang ZM (2009) Carbon monoxide promotes root
hair development in tomato. Plant Cell Environ 32:1033–1045
Hao ZB, Ichii M (1999) A mutant RM09 of rice (Oryza sativa L.)
exhibiting altered lateral root initiation and gravitropism. Jpn J
Crop Sci 68:245252
Huang J, Han B, Xu S, Zhou M, Shen W (2011) Heme oxygenase-1 is
involved in the cytokinin-induced alleviation of senescence in
detached wheat leaves during dark incubation. J Plant Physiol
168:768–775
Liu K, Xu S, Xuan W, Ling T, Cao Z, Huang B, Sun Y, Fang L, Liu
Z, Zhao N, Shen W (2007) Carbon monoxide counteracts the
inhibition of seed germination and alleviated oxidative damage
caused salt stress in Oryza sativa. Plant Sci 172:544–555
Muday GK, Haworth P (1994) Tomato root growth, gravitropism
and lateral development: correlation with auxin transport. Plant
Physiol Biochem 32:193–203
Muramoto T, Tsurui N, Terry MJ, Yokota A, Kochi T (2002)
Expression and biochemical properties of a ferredoxin-depen-
dent heme oxygenase required to phytochrome chromophore
synthesis. Plant Physiol 130:1958–1966
Plant Cell Rep (2012) 31:1085–1091
Noriega GO, Balestrasse KB, Batlle A, Tomaro ML (2004) Heme
oxygenase exerts a protective role against oxidative stress in
soybean leaves. Biochem Biophys Res Commun 323:1003–1008
Noriega GO, Yannarelli GG, Balestrasse KB, Battle A, Tomaro ML
(2007) The effect of nitric oxide on heme oxygenase gene
expression in soybean leaves. Planta 226:1155–1163
Robinson D (1994) The responses of plants to non-uniform supplies
of nutrients. New Phytol 27:635–674
Santa-Cruz DM, Pacienza NA, Polizio AH, Balestrasse KB, Tomaro
ML (2010) Nitric oxide synthase-like dependent NO production
enhances heme oxygenase up-regulation in ultraviolet-B-irradi-
ated soybean plants. Phytochemistry 71:1700–1707
Shen Q, Jiang M, Li H, Che LL, Yang ZM (2011) Expression of a
Brasssica napus heme oxygenase confers plant tolerance to
mercury toxicity. Plant Cell Environ 34:752–763
Synder XH, Baranano DE (2001) Heme oxygenase: a font of multiple
messengers. Neuropsychopharmacology 25:294–298
Terry MJ, Linley PJ, Kohchi T (2002) Making light of it: the role of
plant haem oxygenases in phytochrome chromophore synthesis.
Biochem Soc Trans 30:604–609
Wang H, Taketa S, Miyao A, Hirochika H, Ichii M (2006) Isolation of
a novel lateral-rootless mutant in rice (Oryza sativa L.) with
reduced sensitivity to auxin. Plant Sci 170:70–77
1091
Wei YY, Zheng Q, Liu ZP, Yang ZM (2011) Regulation of tolerance
of Chlamydomonas reinhardtii to heavy metal toxicity by heme
oxgenase-1 and carbon monoxide. Plant Cell Physiol 52:1665–
1675
Xie Y-J, Xu S, Han B, Wu M-Z, Yuan X-X, Han Y, Tu Q, Xu D-K,
Yang Q, Shen W-B (2011) Evidence of Arabidopsis salt
acclimation induced by up-regulation of HY1 and the regulatory
role of RbohD-derived reactive oxygen species synthesis. Plant J
66:280–292
Xu S, Zhang B, Cao Z-Y, Ling T-F, Shen W-B (2011) Heme oxygenase
is involved in cobalt chloride-induced lateral root development in
tomato. Biometals. doi:10.1007/x10534-010-9386-1
Xuan W, Zhu F-Y, Xu S, Huang B-K, Ling T-F, Qi J-Y, Ye M-B,
Shen W-B (2008) The heme oxygenase/carbon monoxide system
is involved in the auxin-induced cucumber adventitious root
process. Plant Physiol 148:881–893
Yannarelli G, Noriega GO, Battle A, Tomaro ML (2006) Heme
oxygenase up-regulation in ultraviolet-B irradiated soybean
plants involves reactive oxygen species. Planta 224:1154–1162
Zilli CG, Balestrasse KB, Yannarelli GG, Polizio AH, Santa-Cruz
EM, Tomaro ML (2008) Heme oxygenase up regulation under
salt stress protects nitrogen metabolism in nodules of soybean
plants. Environ Exp Bot 64:83–89
123