Accepted Article

PROF. JEONG-TAE KOH (Orcid ID : 0000-0001-6279-6487)

PROF. YUN-CHAN HWANG (Orcid ID : 0000-0002-7891-9565)

PROF. BIN-NA LEE (Orcid ID : 0000-0001-8017-1835)

Article type : Original Scientific Article

Irisin promotes odontogenic differentiation and angiogenic potential in human dental pulp cells.

JW Son1, SH Choi 1, JH Jang2, JT Koh3, WM Oh1, YC Hwang1, BN Lee1

Ji-Won Son and Sung-Hyeon Choi contributed equally to this work as first authors.

1Department of Conservative Dentistry, School of Dentistry, Dental Science Research Institute, Chonnam
National University, Gwangju; 2Department of Conservative Dentistry, School of Dentistry, Kyung Hee
University, Seoul; 3Department of Pharmacology and Dental Therapeutics, Hard-tissue Biointerface
Research Center, School of Dentistry, Dental Science Research Institute, Chonnam National University,
Gwangju, Korea

Running title: Effects of irisin on human dental pulp cells

Keywords: angiogenesis, irisin, odontoblastic differentiation, regeneration

Corresponding authors
Bin-Na Lee, DDS, MSD, PhD

This article has been accepted for publication and undergone full peer review but has not been
through the copyediting, typesetting, pagination and proofreading process, which may lead to
differences between this version and the Version of Record. Please cite this article as doi:
10.1111/IEJ.13435
This article is protected by copyright. All rights reserved
 Associated professor, Department of Conservative Dentistry, School of Dentistry, Chonnam National
Accepted Article
University. Young-bong ro 77, Bukgu, Gwangju, Korea
Tel: +82-62-530-5868
Fax: +82-62-530-5629
E-mail: bnlee13@jnu.ac.kr

This article is protected by copyright. All rights reserved

 Abstract
Accepted Article
Aim To determine whether irisin, a newly discovered myokine that links exercise induced and metabolic
homeostasis, could promote odontogenic differentiation and angiogenesis in human dental pulp cells
(HDPCs).
Methodology Cell viability in the presence of irisin was measured. Real time PCR and western blot
analysis were performed to evaluate the expression levels of irisin, odontogenic and angiogenic markers.
The involvement of mitogen-activated protein kinase (MAPK) and the protein kinase B (Akt) signaling
pathway were evaluated by western blot. To evaluate mineralization nodule formation, alkaline
phosphatase (ALP) staining and alizarin red S staining were performed. Scratch wound assays were
performed to evaluate the effects of irisin on cell migration. The data were analyzed using one-way analysis
of variance (ANOVA) followed by Tukey post hoc test and the Student’s t test. Statistical significance was
considered at P < 0.05.
Results Irisin significantly promoted odontogenic differentiation as evidenced by formation of mineralized
nodules, induction of ALP activity, and upregulation of odontogenic and angiogenic markers (P < 0.05).
Scratch wound assays revealed that irisin significantly increased migration of HDPCs (P < 0.05).
Phosphorylation of both MAPK and Akt was increased by irisin. MAPK and Akt inhibitors inhibited
mineralization, cell migration and the increased expression of odontogenic and angiogenic markers.
Conclusions Irisin promoted odontogenic differentiation, mineralization and has the potential for
angiogenesis through activation of the MAPK and Akt signaling pathways in HDPCs.

This article is protected by copyright. All rights reserved

 Introduction
Accepted Article
The dental pulp is a highly innervated and vascularized connective tissue, which is encapsulated in a
mineralized structure formed by enamel, dentine and cementum (Rosa et al. 2016). It plays a crucial role in
tooth homeostasis by maintaining pulp vitality and controlling defensive functions (Tatullo et al. 2015).
Therefore, the maintenance of healthy pulp tissue is critical for tooth longevity (Barthel et al. 2000, Caplan
et al. 2005). Tissue engineering is widely applied in dentistry to restore injured dental structures with
biological tissues, rather than with conventional restorative materials. The use of stem cells, scaffolds or
bioactive materials is an important strategy in dental pulp regeneration (Conde et al. 2016).
Dental pulp stem cells (DPSCs) are mesenchymal stem cells with multi-lineage differentiation potential
and proliferative ability (Huang et al. 2009, Nuti et al. 2016). They differentiate into odontoblast-like cells
under certain stimuli, and can produce reparative dentine, a response which is called dentinogenesis.
Human dental pulp cells (HDPCs) including DPSCs, are crucial factors in vital pulp therapy and potentially
contribute to repairing the pulp-dentine complex (Wu et al. 2019).
Irisin, an endocrine factor secreted by skeletal muscle, has been identified as a hormone messenger from
muscle to bone during exercise (Elkasrawy & Hamrick 2010, Boström et al. 2012, Pedersen & Febbraio
2012, Colaianni et al. 2015). It is secreted by skeletal muscles in response to PGC-1α during exercise and is
produced from fibronectin type III domain containing protein 5 (FNDC5). After, induction of FNDC5
release, there is a cleavage event which produces irisin (Boström et al. 2012, Zhang et al. 2017).
Reports have suggested that irisin might have other favorable therapeutic effects, including bone
formation or bone fracture prevention (Colaianni et al. 2017), preventing hepatic lipid accumulation, and
improving cognitive functions. Irisin has previously been shown to increase osteoblastic differentiation and
bone mineralization in vitro (Qiao et al. 2016, Zhang et al. 2017). It has also been reported that irisin
directly targets osteoblasts, promoting osteoblast proliferation and differentiation via stimulating the
mitogen-activated protein kinases (MAPKs) signaling pathways (Qiao et al. 2016). Interestingly, another
recent study demonstrated that irisin exerts its influence on endothelial cell angiogenesis via the ERK and
PI3K/AKT signaling pathway (Song et al. 2014, Wu et al. 2015, Zhang et al. 2019).
However, there have been no investigations into the effects of irisin on dental pulp cells and therefore the
potential role of irisin as a bioactive material for vital pulp therapy or regenerating the pulp-dentine
complex is unknown. The purpose of this study therefore, was to evaluate whether irisin could promote
odontogenic differentiation and angiogenesis in HDPCs. Furthermore, the involvement of the intracellular
signaling pathway in the effects was determined.

Materials and Methods

Cell isolation and culture of HDPCs

This article is protected by copyright. All rights reserved

 All procedures were performed with the informed consent of each patient. The experimental protocol was
Accepted Article
approved by the Institutional Review Board of Chonnam National University Dental Hospital, Gwangju,
Korea (IRB No: CNUDH-2016-0016).
HDPCs were isolated from freshly extracted caries-free supernumerary teeth of 10 healthy patients (6-12
years old) at the Department of Pediatric Dentistry, Chonnam National University Dental Hospital. After
tooth extraction, the dental pulp tissues were immediately separated from the teeth under aseptic conditions
by splitting the crown of the teeth and washing with Dulbecco’s phosphate-buffered saline solution (DPBS;
Welgene, Daegu, Korea). The pulp tissues were minced with fine sterilized scissors and placed in 60-mm
cell culture dishes. The tissue explants were cultured in alpha minimum essential medium (α-MEM (1X);
Gibco Invitrogen, Grand Island, NY, USA) supplemented with 10% foetal bovine serum (FBS; Gibco
Invitrogen) and 1% antibiotics (100 U/mL penicillin and 100 mg/mL streptomycin, Gibco Invitrogen) in a
humidified atmosphere of 5% CO₂ at 37℃. All cell culturing was performed under these incubation
conditions. The medium was refreshed every 3 days until confluent cell monolayers had formed. Upon
reaching confluence, subculture was performed and cells from passage numbers three to six were used for
experiments.
Irisin treatment
Recombinant human irisin solution (0.1 mg/ml) was purchased from Enzo Life Sciences Inc (Enzo Life
Sciences, Farmingdale, NY, USA). The irisin solution was diluted with DPBS (Welgene) to achieve
concentrations of 5, 10, 20 and 40 µM when added to the growth media to determine its effect on HDPCs.
Cell viability
The effect of irisin on the viability of HDPCs was examined using an Ez-Cytox Enhance Cell Viability
Assay Kit (Dogenbio, Seoul, Korea) according to the manufacturer’s instructions. HDPCs were seeded into
96-well cell culture plates at a density of 1 x 10⁴ cells per well and incubated for 24 hours. Cells were then
treated with irisin at different concentrations (5, 10, 20 and 40 µM) for 1 day, 3 days and 7days. After 1 day,
3 days and 7 days, 10 µL Ez-Cytox reagents (Dogenbio, Seoul, Korea) were added to each well and
incubated for 2 hours. The absorbance of each well was measured at a wavelength of 450 nm with a
microplate spectrophotometer (Multiskan GO Microplate Spectrophotometer; Thermo Scientific, Waltham,
MA, USA) and software (SkanIt Software 4.1 for Microplate Readers; Thermo Fisher Scientific, Rockford,
IL, USA).
Irisin expression on HDPCs
The following experiments were conducted to determine if irisin was expressed on the HDPCs. For
quantitative real-time polymerase chain reaction (PCR) assay and western blot assay, HDPCs were seeded
at a density of 3 × 10⁵ cells per dish on 60-mm cell culture plates, and cells were cultured for 5 days with
growth medium (control), odontogenic induction medium (OM) with 50 μg/mL ascorbic acid (Sigma-

This article is protected by copyright. All rights reserved

 Aldrich, St. Louis, MO, USA) and 10 mmol/L β-glycerophosphate (Santa Cruz Biotechnology Inc., Dallas,
Accepted Article
TX, USA) medium, 1 µg/mL of LPS (InvivoGen, San Diego, CA, USA) and 5 µg/mL of LPS.
RNA extraction and PCR assay
After seeding cells into 6-well culture plates at a density of 2 x 10⁵ cells per well, cells were stimulated
with irisin at 20 µM for three and five days. Total RNA extraction and complementary DNA synthesis were
performed using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and the AccessQuick RT-PCR System
(Promega, Madison, WI, USA), respectively. Quantitative real-time PCR was performed in triplicates for
each sample using the Quanti-Tect SYBR Green PCR Kit (Qiagen, Valencia, CA, USA). All primers were
synthesized by Bioneer (Daejeon, Korea). Relative gene expression was quantified after normalizing
against the expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an endogenous
control. The gene-specific primer sequences used in this study are shown in Table 1. Gene expression data
were analyzed using the 2-ΔΔCt method (Livak & Schmittgen 2001).
Western blot analysis
Irisin-promoted odontogenic and angiogenic protein expression levels and activation of MAPK or Akt
were analyzed by western blotting. HDPCs were seeded at a density of 3 × 10⁵ cells per dish on 60-mm cell
culture plates and were treated with or without irisin at concentrations of 20 µM for three and five days.
After treatment, cells in different groups were washed twice with cold DPBS and lysed in protein lysis
buffer (Cell Signaling Technology, Beverly, MA, USA). After removing cell debris by centrifugation,
protein concentrations of cell lysates (supernatants) were evaluated with Lowry protein assay reagent (Bio-
Rad Laboratories, Hercules, CA, USA). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-
PAGE) and Western blot analysis were performed using polyvinylidene difluoride membranes. After
blocking with blocking solution (5% nonfat dried skimmed milk, 0.01 mol/L DPBS and 0.1% Tween 20
(PBST) [Biosesang, Sungnam, Korea]) at room temperature for 1 hour, membranes were incubated with the
following antibodies: anti-FNDC5 (1: 2000; Abcam, Cambridge, UK), anti-DSPP (1:1000; Thermo Fisher
Scientific), anti-DMP1 (1:2000; Abcam), anti-VEGF (1:2000; Abcam), anti-FGF1 (1:1000; Thermo Fisher
Scientific), anti-ERK, anti-phospho-ERK, anti-p38, anti-phospho-p38, anti-JNK, anti-phospho-JNK, anti-
AKT, and anti-phospho-Akt (Cell Signaling Technology) at 4℃ overnight. After washing three times with
PBST, membranes were then incubated with secondary antibodies such as horseradish peroxidase (HRP)–
conjugated anti-rabbit IgG (1:10000; Sigma-Aldrich) at room temperature for 1 hour. After washing with
DPBS five times, chemiluminescent HRP Substrate (Millipore, Billerica, MA, USA) was used for detection
and protein signals were visualized with a Chemiluminescence Imaging System (Ez-capture; Atto, Tokyo,
Japan). The density of protein bands was quantified using an image analysis program (Image J; National
Institutes of Health, Bethesda, MD, USA).
Alkaline phosphatase (ALP) staining assays

This article is protected by copyright. All rights reserved

 HDPCs were seeded on 48-well cell culture plates at a density of 3 x 10⁴ cells per well and cultured in
Accepted Article
growth medium followed by addition of 0 µM, 10 µM or 20 µM irisin and incubated for 10 days.
medium was changed every two days. After 10 days of exposure, media was removed and cells were
Growth

washed with DPBS, fixed in 70% ethanol for 30 minutes followed by rinsing with distilled water three
times. Fixed-cells were treated with 300 µL of ALP staining reagent (BCIP®/NBT Liquid substrate System;
Sigma-Aldrich) per well. After removing the staining reagent, a photograph was taken by using an Officejet
pro L7580 scanner (HP, Palo Alto, CA, USA). To quantitatively evaluate staining results, cells were rinsed
three times with distilled water, and then stain was treated with 10% (w/v) cetylpyridinium chloride
(pH=7.0) for 30 minutes, followed by absorbance measurement at wavelength of 562 nm on a
spectrophotometer (Multiskan GO Microplate Spectrophotometer) using software (SkanIt Software 4.1 for
Microplate Readers).
Alizarin red S staining assays
HDPCs were seeded at 3 x 104 cells per well on 24-well cell culture plates and cultured in α-MEM
(containing 10% FBS, penicillin 100 U/mL and streptomycin 100 μg/mL), then incubated for 24 hours. For
mineralization experiments, α-MEM supplemented with 10% FBS was added and cells cultured in OM
before treatment. Cells were divided into control and irisin groups; control group (OM was added to the
culture medium); and irisin groups (OM and irisin [10 or 20 µM] were added to the culture medium for
pretreatment), and cultured for 21 days. Fresh OM or OM with irisin was changed every two days. After 21
days, the medium was removed and cells were washed with DPBS. Cells were fixed in 70% ethanol and
stained with 300 µL of 2% alizarin red S staining reagent (LIFELINE Cell Tech, Frederick, MD, USA).
After removing the staining reagent, a photograph was taken as before. For quantitative analysis, after
washing with water or PBS, 10% cetylpyridinium chloride (pH=7.0) was added to samples and absorbance
values were measured at wavelength of 580 nm.
Scratch wound healing assay
To carry out the wound healing assay, the HDPCs were seeded in 6-well culture plates at a density of 7 x
105 cells per well and incubated for 24 hours. The monolayer of HDPCs was then scratched manually with
a 200 µL yellow plastic pipette tip and washed with DPBS. The cells were pre-incubated with or without
U0126 (ERK inhibitor), SB202190 (p38 inhibitor), SP600125 (JNK inhibitor) or LY294002 (Akt inhibitor)
(Cell Signaling Technology) for 1 hour before being scratched across the well. The wounded monolayer of
cells was allowed to heal for 0, 3, 6, 12 and 24 hours, either treated with, or without 20 µM irisin. An
inverted microscope (Olympus, Tokyo, Japan) was used to obtain wound healing images. Cell migration
was defined as the wound closure rate. Relative rates of wound closure were measured and expressed as
percentage of the initial wound length at the time of the scratch using an image J program.
Statistical Analysis

This article is protected by copyright. All rights reserved

 Each experiment contained triplicate independent samples, was repeated at least twice, and qualitatively
Accepted Article
identical results were obtained. The data were analyzed using one-way analysis of variance (ANOVA)
followed by Tukey post hoc test and the Student’s t test using SPSS version 23.0 software program (SPSS
Inc, Chicago, IL, USA). Statistical significance was considered at P < 0.05.

Results
Effect of irisin on cell viability of HDPCs
The viability of HDPCs cultured with irisin at different concentrations (0, 5, 10, 20 and 40 µM) and days
are shown in Figure 1. No significant differences were observed among groups (different concentrations of
irisin) after 7 days of culture. Cell viabilities were significantly higher at 5, 10, 20 µM of irisin than the
control (no irisin treatment) after 1 day of culture (P < 0.05). Cell viability was significantly lower at 40
µM of irisin than the control after 1 day and 3 days of culture (P < 0.05). However, the relative cell
viabilities of these groups were over 70% suggesting that all of the concentrations tested were
biocompatible with these cells and improved cell viability.
Irisin was expressed in HDPCs
Real-time PCR and western blot were performed to confirm that irisin was expressed in HDPCs. mRNA
level of irisin and protein level of FNDC5 (precursor of irisin) were expressed in HDPCs. In particular, it
was observed that the expressions of irisin and FNDC5 were increased in OM and LPS treatment (Figure 2).
Irisin promoted ALP expression and mineralization in HDPCs
To determine the ALP activity and mineralization effect of irisin in HDPCs, ALP staining was performed
on cells stimulated with 10 µM and 20 µM irisin for 10 days, and alizarin red S staining was performed on
cells stimulated with the same concentrations of irisin for 21 days (Figure 3A and B).
After induction, ALP activity (Figure 3A, C and E) and calcified nodule formation (Figure3B, D and F)
were significantly increased by 20 µM of irisin treatment compared with the control and 10 µM irisin of
irisin treatment (P < 0.05). Based on these results, 20 µM of irisin treatment was used for the following
experiments.
Effect of irisin on messenger RNA (mRNA) and protein expression of odontogenic and angiogenic
markers in HDPCs
The effect of irisin on odontogenic differentiation and angiogenesis in HDPCs was analyzed by real-time
PCR to quantify the expression levels of marker genes (DSPP, DMP-1, VEGF and FGF-1). After three
days of induction by irisin at a concentration of 20 µM, DSPP and FGF-1 mRNA levels were significantly
increased compared to those in the control group (P < 0.05) (Figure 4A and D). After five days of induction,
DSPP, DMP-1 and VEGF mRNA levels were significantly increased compared to the control group (P <
0.05) (Figure 4A-C). Of particular note, levels of DSPP and VEGF mRNA expression were significantly

This article is protected by copyright. All rights reserved

 increased at five days compared to three days (P < 0.05; Figure 4A and C). Although not significant, DMP-
Accepted Article
1 mRNA expression level also increased from three days to five days. As shown in Figure 4E, 20 µM of
irisin treatment significantly increased the expression of DSPP, DMP-1, VEGF and FGF-1 proteins
compared with those in the control group.
Irisin promoted HDPC migration
HDPCs were treated with irisin at 20 µM for 24 hours. As shown in Figure 5, the results of the wound
healing assay demonstrated that healing over the scratch was significantly increased after treatment with
irisin compared with that in the control group (P < 0.05). Also, the degrees of wound closure were
significantly increased in both the control and irisin groups over time from 0 to 24 hours (P < 0.05).
Irisin-promoted DSPP, DMP-1, VEGF and FGF-1 are dependent on MAPKs and Akt signaling
To investigate the signaling pathways involved in irisin-promoted odontogenic differentiation and
angiogenesis, ERK, p38, JNK and Akt in HDPCs were assessed by western blot analysis. As shown in
Figure 6, irisin at 20 µM enhanced phosphorylation levels of ERK, p38, JNK and Akt within 5 minutes of
induction.
To further investigate the role of ERK, p38, JNK and AKT signaling in the differentiation phenotype
promoted by irisin, cells were pretreated with or without U0126, SB202190, SP600125 and LY294002 for
1 hour followed by treatment with 20 µM irisin for 5 days. U0126, SB202190, SP600125, and LY294002
all inhibited the increased expression of DSPP, DMP-1, VEGF and FGF-1 promoted by irisin treatment
(Figure 7A). Also, ALP activity and mineralization which were significantly increased by irisin compared
to controls (P < 0.05), were significantly diminished by the presence of U0126, SB202190, SP600125, and
LY294002 (P < 0.01) (Figure 7B-E).
The scratch wound healing assay was also performed in the presence of U0126, SB202190, SP600125 and
LY294002. Wound closure tended to be significantly inhibited when MAPK inhibitors and Akt inhibitor
were used to pretreat cells (P < 0.05) (Figure 8).

Discussion
Irisin is a cleavage product of FNDC5 and is produced in response to exercise (Boström et al. 2012,
Crunkhorn 2012). Thus far, irisin’s function has been mainly associated with energy homeostasis and
metabolism (Perakakis et al. 2017), and to date, the effect of irisin on odontogenic differentiation and
angiogenesis has not been reported. Therefore, this is the first study of its kind to investigate the role of
irisin on the odontogenic and angiogenic potential of human dental pulp cells.
Cell viabilities with 5, 10 and 20 µM irisin were significantly higher than the control after 1 day of culture.
However, cell viability was significantly lower at 40 µM of irisin than the control after 1 day and 3 days of
culture. Nevertheless, the relative cell viabilities of all groups was over the cut-off level (70%) established

This article is protected by copyright. All rights reserved

 by ISO 10993-5 (ISO 10993-5 2009), suggesting that all of the concentrations tested were biocompatible
Accepted Article
with these cells and improved cell viability overall.
In this study, mRNA level of irisin and protein level of FNDC5 were not only expressed in HDPCs, but
also increased in OM and LPS treatment. These results mean that endogenous irisin would exert effect on
pulp tissue, and further suggest that it can be increased in special clinical environments such as pulp
capping or pulp inflammation.
Non-collagenous proteins such as DSPP, DMP-1 and ALP have previously been used as odontoblast-
specific markers (Papagerakis et al. 2002). DSPP and DMP-1 are members of the small integrin binding
ligand N-linked glycoprotein family. DMP-1, also expressed in early osteoblastic differentiation, is related
to the matrix mineralization of bone and dentine (Balic & Mina 2011, Fisher 2011). ALP activity is most
often used as an early-stage marker of odontoblastic differentiation (Min et al. 2010) and plays an
important role in mineralization. In this study, 20 µM irisin promoted the mRNA and protein expressions of
DSPP and DMP-1. In addition, irisin significantly increased ALP activity and mineralized nodule
formation in HDPCs. These results suggest that irisin can promote odontoblastic differentiation and
mineralization in HDPCs. And among proangiogenic factors, VEGF is well-known as a potent mitogen
capable of stimulating angiogenesis, and thus supporting oxygen delivery and nutrient supply (Cross &
Claesson-Welsh 2001, Ferrara 2005). The process of dental pulp repair begins with neovascularization and
proceeds with the proliferation, migration, and subsequent differentiation of precursor cells into
odontoblast-like cells (Clarkin et al. 2008, Mullane et al. 2008). Angiogenic growth factors, including
VEGF, are found in both soluble and insoluble dentine matrix (Roberts-Clark & Smith 2000) and might
contribute to the reparative response of the dentine-pulp complex by promoting stem/progenitor cell
migration and proliferation to the injured site (Cross & Claesson-Welsh 2001, Mullane et al. 2008), thereby
facilitating cell differentiation and tissue regeneration (Matsushita et al. 2000, Suzuki et al. 2011). Dental
pulp cells respond to these endothelial cell actions, by promoting tertiary dentine formation (Nakashima &
Iohara 2011). FGFs are also known as proangiogenic molecules that play a crucial role in angiogenesis
(Tran-Hung et al. 2008). In the present study, 20 µM irisin significantly affected the expressions of VEGF
and FGF-1 in HDPCs. These results are consistent with earlier work showing a potential role for irisin in
angiogenesis (Wu et al. 2015). Furthermore, FGFs have been shown to facilitate angiogenic activities in
DPSCs in vitro. Moreover, they can promote the regeneration of pulp-like tissues with dentine formation
along the dentinal wall in vivo (Takeuchi et al. 2015). Increased angiogenesis and blood flow would be
beneficial to the dentine/pulp healing process.
Angiogenesis proceeds in the following steps; (1) initiation: increased vasopermeability, (2) progression:
production of proteolytic enzymes that degrade the extracellular matrix and promote endothelial cell
migration, (3) differentiation into new vessels, (4) stabilization and maturation (Bussolino et al. 1997). As

This article is protected by copyright. All rights reserved

 above, cell migration is required for initiating the tissue healing and angiogenesis (Bussolino et al. 1997,
Accepted Article
Risau 1997, Carmeliet 2000). Therefore, a wound healing assay was employed to investigate the effect of
irisin on HDPC migration (Kramer et al. 2013). The data revealed that treatment of HDPCs with 20 µM
irisin significantly increased the degree of scratch wound closure.
Earlier work has reported that MAPK signaling pathway plays an important role in odontogenic
differentiation and angiogenesis in HDPCs (Liu et al. 2014, Lv et al. 2016, Ngo et al. 2018) and to focus on
Akt was chosen because it is known to play a key role in numerous cellular functions including
proliferation, adhesion, migration, invasion, metabolism and survival (Gerber et al. 1998, Bader et al.
2005). To investigate both pathways, western blotting and wound healing assays were performed with or
without MAPK inhibitors and an Akt inhibitor to determine whether irisin might exert its effects through
these particular signaling pathways. Irisin alone, increased the phosphorylation levels of ERK, p38, JNK
and Akt within 5 minutes of induction, and enhanced ALP activity and formation of mineralized nodules
strongly suggesting that it activates signaling through these MAPK and Akt. In important collaborative
experiments, inhibitors of ERK, p38, JNK and Akt all significantly inhibited ALP activity and the
formation of mineralized nodules promoted by irisin. In addition, these inhibitors significantly reduced the
degree of wound closure promoted by 20 µM irisin. These results lead to conclusion that odontogenic
differentiation and angiogenesis of HDPCs stimulated by irisin are in part controlled through MAPK and
Akt signaling, however, further investigation is needed to identify the precise underlying signaling
mechanisms involved in irisin-promoted differentiation of HDPCs.
Irisin may be an attractive new agent for use during vital pulp therapy because it may provide odontogenic
and angiogenic effects for pulp regeneration and healing, as well as in facilitating dentine formation.

Conclusions
Irisin promoted odontogenic differentiation, mineralization and angiogenesis through activation of the
MAPK and Akt signaling pathways in HDPCs.

Acknowledgements
This study was supported by the National Research Foundation of Korea (NRF) grant funded by the
Korean government (No. 2019R1F1A1060935 and 2019R1A5A2027521) and a grant (BCRI20030) of
Chonnam National University Hospital Biomedical Research Institute.

Conflict of Interest statement

The authors have stated explicitly that there are no conflicts of interest in connection with this article.

This article is protected by copyright. All rights reserved

 References
Accepted Article
Bader AG, Kang S, Zhao L, Vogt PK (2005) Oncogenic PI3K deregulates transcription and translation.
Nature Reviews Cancer 5, 921.
Balic A, Mina M (2011) Identification of secretory odontoblasts using DMP1-GFP transgenic mice. Bone
48, 927-37.
Barthel CR, Rosenkranz B, Leuenberg A, Roulet J-F (2000) Pulp capping of carious exposures: treatment
outcome after 5 and 10 years: a retrospective study. Journal of Endodontics 26, 525-8.
Boström P, Wu J, Jedrychowski MP et al. (2012) A PGC1-α-dependent myokine that drives brown-fat-like
development of white fat and thermogenesis. Nature 481, 463.
Bussolino F, Mantovani A, Persico G (1997) Molecular mechanisms of blood vessel formation. Trends in
Biochemical Sciences 22, 251-4.
Caplan DJ, Cai J, Yin G, White BA (2005) Root canal filled versus non‐root canal filled teeth: a
retrospective comparison of survival times. Journal of Public Health Dentistry 65, 90-6.
Carmeliet P (2000) Mechanisms of angiogenesis and arteriogenesis. Nature Medicine 6, 389-95.
Clarkin CE, Emery RJ, Pitsillides AA, Wheeler‐Jones CP (2008) Evaluation of VEGF‐mediated signaling
in primary human cells reveals a paracrine action for VEGF in osteoblast‐mediated crosstalk to endothelial
cells. Journal of Cellular Physiology 214, 537-44.
Colaianni G, Cuscito C, Mongelli T et al. (2015) The myokine irisin increases cortical bone mass.
Proceedings of the National Academy of Sciences 112, 12157-62.
Colaianni G, Mongelli T, Cuscito C et al. (2017) Irisin prevents and restores bone loss and muscle atrophy
in hind-limb suspended mice. Scientific Reports 7, 2811.
Conde M, Chisini L, Demarco F, Nör J, Casagrande L, Tarquinio S (2016) Stem cell‐based pulp tissue
engineering: variables enrolled in translation from the bench to the bedside, a systematic review of
literature. International Endodontic Journal 49, 543-50.
Cross MJ, Claesson-Welsh L (2001) FGF and VEGF function in angiogenesis: signalling pathways,
biological responses and therapeutic inhibition. Trends in Pharmacological Sciences 22, 201-7.
Crunkhorn S (2012) Metabolic disease: exercise hormone fights metabolic disease. Nature Reviews Drug
Discovery 11, 189.
Elkasrawy MN, Hamrick MW (2010) Myostatin (GDF-8) as a key factor linking muscle mass and skeletal
form. Journal of Musculoskeletal & Neuronal Interactions 10, 56.
Ferrara N (2005) The role of VEGF in the regulation of physiological and pathological angiogenesis.
Mechanisms of angiogenesis, pp. 209-31: Springer.
Fisher LW (2011) DMP1 and DSPP: evidence for duplication and convergent evolution of two SIBLING
proteins. Cells Tissues Organs 194, 113-8.

This article is protected by copyright. All rights reserved

 Gerber HP, McMurtrey A, Kowalski J et al. (1998) Vascular endothelial growth factor regulates
Accepted Article
endothelial cell survival through the phosphatidylinositol 3′-kinase/Akt signal transduction pathway
requirement for Flk-1/KDR activation. Journal of Biological Chemistry 273, 30336-43.
Harichane Y, Hirata A, Dimitrova-Nakov S et al. (2011) Pulpal progenitors and dentin repair. Advances in
Dental Research 23, 307-12.
Huang GJ, Gronthos S, Shi S (2009) Mesenchymal stem cells derived from dental tissues vs. those from
other sources: their biology and role in regenerative medicine. Journal of Dental Research 88, 792-806.
ISO 10993-5 (2009). Biological evaluation of medical devices. Part 5: Tests for cytotoxicity: in vitro
methods. 3rd edn. Geneva: International Organization for Standardization.
Kramer N, Walzl A, Unger C et al. (2013) In vitro cell migration and invasion assays. Mutation
Research/Reviews in Mutation Research 752, 10-24.
Liu CH, Hung CJ, Huang TH, Lin CC, Kao CT, Shie MY (2014) Odontogenic differentiation of human
dental pulp cells by calcium silicate materials stimulating via FGFR/ERK signaling pathway. Materials
Science and Engineering: C 43, 359-66.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative
PCR and the 2− ΔΔCT method. Methods 25, 402-8.
Lv T, Wu Y, Mu C et al. (2016) Insulin-like growth factor 1 promotes the proliferation and committed
differentiation of human dental pulp stem cells through MAPK pathways. Archives of Oral Biology 72,
116-23.
Matsushita K, Motani R, Sakutal T et al. (2000) The role of vascular endothelial growth factor in human
dental pulp cells: induction of chemotaxis, proliferation, and differentiation and activation of the AP-1-
dependent signaling pathway. Journal of Dental Research 79, 1596-603.
Min KS, Lee YM, Hong SO, Kim EC (2010) Simvastatin promotes odontoblastic differentiation and
expression of angiogenic factors via heme oxygenase-1 in primary cultured human dental pulp cells.
Journal of Endodontics 36, 447-52.
Mullane EM, Dong Z, Sedgley C et al. (2008) Effects of VEGF and FGF2 on the revascularization of
severed human dental pulps. Journal of Dental Research 87, 1144-8.
Nakashima M, Iohara K (2011) Regeneration of dental pulp by stem cells. Advances in Dental Research 23,
313-9.
Ngo VA, Jung JY, Koh JT, Oh WM, Hwang YC, Lee BN (2018) Leptin induces odontogenic
differentiation and angiogenesis in human dental pulp cells via activation of the mitogen-activated protein
kinase signaling pathway. Journal of Endodontics 44, 585-91.
Nuti N, Corallo C, Chan B, Ferrari M, Gerami-Naini B (2016) Multipotent differentiation of human dental
pulp stem cells: a literature review. Stem Cell Reviews and Reports 12, 511-23.

This article is protected by copyright. All rights reserved

 Papagerakis P, Berdal A, Mesbah M et al. (2002) Investigation of osteocalcin, osteonectin, and dentin
Accepted Article
sialophosphoprotein in developing human teeth. Bone 30, 377-85.
Pedersen BK, Febbraio MA (2012) Muscles, exercise and obesity: skeletal muscle as a secretory organ.
Nature Reviews Endocrinology 8, 457.
Perakakis N, Triantafyllou GA, Fernández-Real JM et al. (2017) Physiology and role of irisin in glucose
homeostasis. Nature Reviews Endocrinology 13, 324-37.
Qiao X, Nie Y, Ma Y et al. (2016) Irisin promotes osteoblast proliferation and differentiation via activating
the MAP kinase signaling pathways. Scientific Reports 6, 18732.
Risau W (1997) Mechanisms of angiogenesis. Nature 386, 671-4.
Roberts-Clark D, Smith A (2000) Angiogenic growth factors in human dentine matrix. Archives of Oral
Biology 45, 1013-6.
Rosa V, Dubey N, Islam I, Min K-S, Nör JE (2016) Pluripotency of stem cells from human exfoliated
deciduous teeth for tissue engineering. Stem Cells International 2016, 5957806.
Song H, Wu F, Zhang Y et al. (2014) Irisin promotes human umbilical vein endothelial cell proliferation
through the ERK signaling pathway and partly suppresses high glucose-induced apoptosis. PloS One 9,
e110273.
Suzuki T, Lee C, Chen M et al. (2011) Induced migration of dental pulp stem cells for in vivo pulp
regeneration. Journal of Dental Research 90, 1013-8.
Takeuchi N, Hayashi Y, Murakami M et al. (2015) Similar in vitro effects and pulp regeneration in ectopic
tooth transplantation by basic fibroblast growth factor and granulocyte‐colony stimulating factor. Oral
Diseases 21, 113-22.
Tatullo M, Marrelli M, Shakesheff KM, White LJ (2015) Dental pulp stem cells: function, isolation and
applications in regenerative medicine. Journal of Tissue Engineering and Regenerative Medicine 9, 1205-
16.
Tran-Hung L, Laurent P, Camps J, About I (2008) Quantification of angiogenic growth factors released by
human dental cells after injury. Archives of Oral Biology 53, 9-13.
Wu F, Song H, Zhang Y et al. (2015) Irisin induces angiogenesis in human umbilical vein endothelial cells
in vitro and in zebrafish embryos in vivo via activation of the ERK signaling pathway. PloS One 10,
e0134662.
Zhang D, Zhang P, Li L et al. (2019) Irisin functions to inhibit malignant growth of human pancreatic
cancer cells via downregulation of the PI3K/AKT signaling pathway. OncoTargets and Therapy 12, 7243.
Zhang J, Valverde P, Zhu X et al. (2017) Exercise-induced irisin in bone and systemic irisin administration
reveal new regulatory mechanisms of bone metabolism. Bone research 5, 16056.

This article is protected by copyright. All rights reserved

 Table 1 Primer sequences used for real-time PCR
Accepted Article Gene Primer sequence (5’-3’)

Forward: AGCGAGCCTGTGCTCTTCAAGA
Human irisin (h-irisin) Reverse:
GAACAGGACCACGACGATGATC

Forward: GGGAATATTGAGGGCTGGAA
Dentin sialophosphoprotein (DSPP)
Reverse: TCATTGTGACCTGCATCGCC

Forward: ATGCCTATCACAACAAACC
Dentin matrix protein-1 (DMP-1)
Reverse: CTCCTTTATGTGACAACTGC

Forward: AAGCCCGTCGGTGTCCATGG
Fibroblast growth factor-1 (FGF-1)
Reverse: GATGGCACAGTGGATGGGAC

Forward: CTACCTCCACCATGCCAAGT
Vascular endothelial growth factor (VEGF)
Reverse: GCAGTAGCTGCGCTGATAGA

Glyceraldehyde 3-phosphate dehydrogenase Forward: CATCACCATCTTCCAGGAG

(GAPDH) Reverse: AGGCTGTTGTCATACTTCTC

This article is protected by copyright. All rights reserved

 Figure legends
Accepted Article
Figure 1 Results of the WST-1 assay for assessing the viability of HDPCs cultured with irisin at different
concentrations for 1 day, 3 days and 7 days (red dashed line: ISO cut-off level 70%). The cell viability in
the control group (media without irisin) was considered as the reference value. *Statistically significant
difference compared with the control group after 1 day of culture (P < 0.05). #Statistically significant
difference compared with the control group after 3 days of culture (P < 0.05)..
Figure 2 The expression of irisin in HDPCs. mRNA level of irisin (A) and protein level of FNDC5 (B)
were expressed in HDPCs at 5 days. The expressions of irisin and FNDC5 were increased in OM and LPS
treatment (OM: odontogenic induction medium, LPS1: 1 µg/ml of LPS, LPS5: 5 µg/ml of LPS).
*Statistically significant difference compared with the control group (P < 0.05). ***Statistically significant
difference compared with the control group (P < 0.001).
Figure 3 The effect of irisin on mineralization in HDPCs. (A) HDPCs were cultured with or without irisin
for 10 days. ALP activity was evaluated by ALP staining. (B) HDPCs were cultured with or without irisin
for 21 days. Calcium nodule deposition was evaluated by alizarin red S staining. (C, D) Magnified images
of Figure 3A and B. When treated with 20 µM of irisin, was observed that the larger area was stained more
darkly. Irisin (20 µM) significantly increased (A, C and E) ALP activity and (B, D and F) mineralized
nodule formation in HDPCs. Results were normalized to those of the control from 3 independent
experiments. *Statistically significant difference compared with the control group (P < 0.05).
Figure 4 The effect of irisin on the expression of odontogenic and angiogenic markers at mRNA level was
determined by quantitative real-time PCR. The expression of (A) DSPP (B) DMP-1 (C) VEGF and (D)
FGF-1 in HDPCs stimulated with 20 µM of irisin treatment over different times were determined.
*Statistically significant difference compared with the control group (P < 0.05). (E) The effect of irisin on
the expression of odontogenic and angiogenic markers determined by western blot. 20 µM of irisin
treatment increased the expression levels of DSP, DMP-1, VEGF and FGF-1 protein in HDPCs.
Figure 5 Irisin promoted migration of HDPCs. (A) Images of wound healing assays of HDPCs that were
cultured with or without 20 µM irisin for 24 hours. (B) Healing over the scratch was significantly increased
after treatment with irisin compared with that in the control group (P < 0.05). In addition, the degrees of
wound closure were significantly increased in both the control and irisin groups over times from 0 hour, 3
hours, 6 hours, 12 hours to 24 hours (P < 0.05). *Statistically significant difference compared with the
control group (P < 0.05). **Statistically significant difference compared with the control group (P < 0.01).
***Statistically significant difference compared with the control group (P < 0.001). Different capital letters
mean significantly different in irisin treatment groups over time from 0 hour to 24 hours (P < 0.05).
Different small letters mean significantly different in control group over time from 0 hour to 24 hours (P <
0.05).

This article is protected by copyright. All rights reserved

 Figure 6 The effect of irisin on the phosphorylation of MAPKs and AKT in HDPCs. The phosphorylation
Accepted Article
levels of ERK, p38, JNK and AKT were determined by western blotting. Actin was used as an internal
control. Similar results were observed from 3 independent experiments.
Figure 7 The involvement of MAPK and AKT activation in irisin-mediated DSPP, DMP-1, VEGF and
FGF-1 protein levels and mineralization in HDPCs. U0126, SB202190, SP600125 and LY29402 reduced
the expression of DSPP, DMP-1, VEGF and FGF-1 protein (A) ALP activity (B and D) and mineralized
nodule formation (C and E) that were increased by 20 µM irisin. The results were normalized to those of
the control (B-E) from 3 independent experiments. #Statistically significant difference compared with the
control group. *Statistically significant difference compared with HDPCs treated with 20 µM irisin (P <
0.05). **Statistically significant difference compared with HDPCs treated with 20 µM irisin (P < 0.01).
Figure 8 The involvement of MAPK and AKT activation in irisin-mediated migration of HDPCs. (A)
Images of wound healing assays of HDPCs that were pre-incubated with or without U0126, SB202190,
SP600125 or LY29402 and then cultured with or without 20 µM irisin for 24 hours. Increased migration
of HDPCs by 20 µM irisin were decreased by (B) U0126, (C) SB202190, (D) SP600125 and (E) LY29402.
Results were normalized to those of the control from 3 independent experiments. #Statistically significant
difference compared with the control group. *Statistically significant difference compared with HDPCs
treated with 20 µM irisin (P < 0.05). **Statistically significant difference compared with HDPCs treated
with 20 µM irisin (P < 0.01). ***Statistically significant difference compared with HDPCs treated with 20
µM irisin (P < 0.001).

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f1.tif

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f2.tif

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f3.tif

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f4.tif

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f5.tif

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f6.tif

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f7.tif

This article is protected by copyright. All rights reserved

Accepted Article

iej_13435_f8.tif

This article is protected by copyright. All rights reserved