Regional Studies in Marine Science 34 (2020) 101067

Contents lists available at ScienceDirect

Regional Studies in Marine Science

journal homepage: www.elsevier.com/locate/rsma

Genetic records of intertidal sea anemones from Portugal

Bárbara Frazão a,b,c , Elsa Froufe a , Andreia Fernandes a,b , Aldo Barreiro a ,
∗
Vitor Vasconcelos a,b , Agostinho Antunes a,b ,
a
CIIMAR/CIMAR, Interdisciplinary Centre of Marine and Environmental Research, University of Porto, Terminal de Cruzeiros do Porto de Leixões, Av.
General Norton de Matos, s/n, 4450-208 Porto, Portugal
b
Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, 4169-007, Porto, Portugal
c
Instituto Português do Mar e da Atmosfera, I. P. (IPMA, I. P.), Rua C do Aeroporto, 1749-077, Lisboa, Portugal

article info a b s t r a c t

Article history: Sea anemones are among the most ubiquitous organisms inhabiting the rocky shores of the Atlantic
Received 25 September 2018 Ocean. We assessed the occurrence of intertidal sea anemones along several beaches on the Portuguese
Received in revised form 8 January 2020 coast, identifying three families: (i) Actiniidae, including Actinia equina, Actinia fragacea, Anemonia
Accepted 9 January 2020
viridis, Aulactinia verrucosa, and Anthopleura krebsi species, (ii) Hormathiidae, including Calliactis
Available online 11 January 2020
parasitica, and (iii) Sagartiidae, including Cereus pedunculatus. Analyses of concatenated sequences
Keywords: from one nuclear (18S) and four mitochondrial (16S, COI, COIII and ND6) genes revealed minimal
Anthozoa intraspecific phenotypic or genotypic heterogeneity among the sampled locations or relative with
Sea anemones species records in NCBI. A comparison among preservation methods across several different tissues
Phylogeny demonstrated that tissues preserved with ethanol, and in particular column tissue, yielded higher
Regionalism amounts of DNA compared with samples from other body parts, including tentacles, gastrodermis and
Genetic markers ectodermis preserved at −80 ◦ C.
DNA extraction
© 2020 Published by Elsevier B.V.

1. Introduction Anemonia viridis, benefits symbiotically by receiving oxygen and

Cnidarians, a diverse group of relatively simple animals, are
characterized by a specialized cell called the cnidocyte, which
gives the name to the phylum. Their structure at the level of
tissue organization consists of two epithelia, the ectoderm and
endoderm. The ectoderm is also referred to as the epidermis and
the endoderm as the gastrodermis (Fautin, 2009). Cnidarians are
common in marine environments and are well-known by the
scientific community and the general public. They are a source
of marine natural compounds that have potential biomedical ap-
plications (Mariottini and Grice, 2016) and some organisms, such
as Hydra sp. (Daly et al., 2008), have high regenerative capacity.
The phylum Cnidaria consists of six major classes, includ-
ing the Anthozoa and the sea anemones (Actiniidae family). Sea
anemones are predatory and often establish symbiotic relation-
ships. For example, with hermit crabs (e.g. Calliactis parasitica
feed while the hermit crab provides protection from predators
Pretterebner et al. (2012)); with fish (e.g. Heteractis sp. or Sti-
chodactyla sp. gains protection from predators and parasites while
the fish gets refuge plus food (Litsios et al., 2014)); and with sev-
eral genera of the Symbiodinaceae family (e.g. the sea anemone
∗ Corresponding author at: CIIMAR/CIMAR, Interdisciplinary Centre of Marine
and Environmental Research, University of Porto, Terminal de Cruzeiros do Porto
de Leixões, Av. General Norton de Matos, s/n, 4450-208 Porto, Portugal.
E-mail address: aantunes@ciimar.up.pt (A. Antunes).
food in the form of glycerol, glucose and alanine from the sym-
biont photosynthesis, while the dinoflagellate receives carbon
dioxide from the host respiration, and nutrients such as nitrogen
and phosphorus from the hosts metabolism (Revel et al., 2016)).
Assessment of the genetic relationships among these species
has often been challenging. Sea anemone taxonomy is based
on diagnostic morphological characters, including the acontia
nematocysts, the marginal sphincter muscle and the mesenteries.
However, these characteristics are highly homoplasious (shared
by several anemone taxa, but not evolving from a common
ancestor) and thus are unreliable markers for accurate taxonomic
classification (Rodríguez et al., 2012). Therefore, researchers have
increasingly relied on molecular techniques to classify and iden-
tify cnidarian groups (Schuchert, 2018). However, these organ-
isms often have a large quantity of polysaccharides (Dellacorte,
1994; Stabili et al., 2015), pigments (Sahu et al., 2012), polyphe-
nols (Leone et al., 2015), and other molecules that interfere
with genomic DNA extraction and downstream DNA applications
(Pinto et al., 2000). Selection of informative genetic markers has
also proved challenging, since in contrast to other metazoans
(namely bilaterians), the cnidarian’s mitochondrial genomes are
slow-evolving and relatively less-informative (Huang et al., 2008;
Shearer et al., 2002; Stampar et al., 2014).
Portuguese sea anemones are an understudied group in an un-
derstudied area. In this region there have been only a few studies

https://doi.org/10.1016/j.rsma.2020.101067
2352-4855/© 2020 Published by Elsevier B.V.
2 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067
Fig. 1. Map showing the 12 sampling site locations (including the GPS coordinates) along the Portuguese coast. Based on their geographical locations, samples were
classified into three groups: north, center and south. Gray dots represent underwater canyons: NC-Nazaré Canyon, CC-Cascais Canyon and SC-Setúbal Canyon.
of intertidal sea anemones, including studies on the proteomic
content of Bunodactis verrucosa (Domínguez-Pérez et al., 2018),
the microbial community of Anemonia viridis (Rocha et al., 2014),
temperature tolerance of Actinia equina (Gadelha et al., 2017) and
only a single work on the phylogenetic relationships among sea
anemone species (Actinia equina) (Pereira et al., 2014). Here we
address how the distinct geographic features of the Portuguese
sea coast have influenced the evolution of intertidal organisms.
Although the Portuguese coast is surrounded by the Atlantic
Ocean, the Mediterranean Sea also has a strong influence along
the south coast of Portugal, primarily by raising seawater temper-
atures. Previous studies also demonstrated that the Portuguese
coast is a biogeographic transition zone, representing the north-
ern or southern distribution limit of many macroalgae species
(Araújo et al., 2009). Moreover, upwelling of colder water from
undersea canyons (Sibaja-Cordero and Cortés, 2008) can consid-
erably influence the taxonomic composition or the patterns in
biodiversity, abundance and community structure (Amaro et al.,
2012; Cunha et al., 2011). In Portugal, there are three major
undersea canyons, in Nazaré, Cascais and Setúbal. Nazaré canyon,
arguably the most interesting biologically, is situated more or less
in the middle of the Portuguese coast line and is around 5000 m
deep and 170 km long (InstitutoHidrográfico, 2016).
Here we studied the Portuguese intertidal sea anemones to
assess patterns of genetic differentiation and the influence of ge-
ographic characteristics of the Portuguese coast mainland. Speci-
mens were collected from three areas separated from each other
by 250 km and also by the previous mentioned canyons. The
phylogenetic relationships among the species was assessed based
on sequence variation of the nuclear gene, 18S rRNA (18S) and
four mitochondrial markers, the 16S rRNA gene (16S), the cy-
tochrome oxidase I gene (COI), the cytochrome oxidase III gene
(COIII) and the NADH-ubiquinone oxidoreductase chain 6 gene
(ND6). Furthermore, we determined the optimal method for DNA
extraction from sea anemones and compared storage methods to
determine which methods yielded higher concentrations of qual-
ity DNA from four different body parts (tentacles, gastrodermis,
column or ectodermis).
2. Materials and methods
2.1. Taxon sampling
Sea anemone specimen collection was performed in 2010 and
2011 along the rocky shores of 12 beaches of the Portuguese
coast mainland (Fig. 1). The sampling days were selected so
as to coincide with the lowest low-tide in order to be able to
sample the highest diversity of species possible. At each site a
visual census was made and representatives of each species were
collected. Each specimen was given a unique code. The first letter
of the code was the first letter of the genus, followed by the
species name, a unique number to distinguish among specimens
from the same sample location and a letter to distinguish among
 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067
Table 1
List of primers used in this study.
Primer Sequence (5′ → 3′ )
anem16sa CACTGACCGTGATAATGTAGCGT
anem16sb CCCCATGGTAGCTTTTATTCG
16PF TCGACTGTTTACCAAAAACATAGC
16PR ACGGAATGAACTCAAATCATGTAAG
dgLCO1490 GGTCAACAAATCATAAAGAYATYGG
dgHCO2198 TAAACTTCAGGGTGACCAAARAAYCA
COIIIF CATTTAGTTGATCCTAGGCCTTGACC
COIIIR CAAACCACATCTACAAAATGCCAATATC
ND6F CATTTGGGRCYRTTGCYTCT
ND6R CTGWYCCKATYTCTTGRG
18S_A AACCTGGTTGATCCTGCCAGT
18S_B TGATCCTTCTGCAGGTTCACCTAC
18S_2F CTGGTGCCAGCAGCCGCGG
18S_1R TGGTGCCCTTCCGTCAATTCCT
the geographical groups North, Center and South (see Fig. 1).
Specimens were identified genetically and in accordance with the
morphological diagnostic characters (Boyra et al., 2008; Campbell
et al., 1994; Monteiro et al., 2010; Prados, 2008; Saldanha, 2003;
Wirtz et al., 2003).
Samples collected from the central and southern sampling
locations (including São Martinho do Porto, Empa, Porto Covo,
Almograve, and Monte Clérigo) were stored immediately in 99%
ethanol and samples from northern locations (and closer to the
laboratory facilities) were stored at −80 ◦ C as soon as possible.
2.2. Molecular data collection
2.2.1. For phylogenetic analysis
Genomic DNA was isolated from column tissues using the
phenol-chloroform method following Moran et al. (Moran et al.,
2008) with the use of the Precellys⃝ R
homogenizer. Mechanical
digestion was processed at 6800 rpm, for two times at 30 s
or until complete digestion. The tissue was dissolved in a di-
gestion buffer composed of 10 mM of Tris, pH 8.0, ethylenedi-
aminetetraacetic acid 100 mM, sodium dodecylsulfate 0.5% and
1 mg/ml proteinase K (Applichem Lifescience). Afterwards there
was an addition of 10% Cetrimonium (hexadecyltrimethylammo-
nium) bromide (Sigma) (CTAB) in 0.7 M NaCl to a final concen-
tration of 0.3% of the sample volume. CTAB is used to remove
polysaccharides and polyphenols that co-precipitate and interfere
negatively with the DNA extraction (Leone et al., 2015). The sam-
ples were then incubated for 20 min at 65 ◦ C and then an equal
volume of chloroform/isoamyl alcohol (24:1) was added, mixed,
and centrifuged at 16 000 g for 20 min. This emulsion forms an
interphase of macromolecules and polysaccharides that cannot be
disturbed when pipetting the supernatant. The CTAB addition and
centrifugation steps were replicated until the interphase became
invisible. Finally, phenol: chloroform: isoamyl alcohol (25:24:1)
in equal volume was added, mixed and centrifuged. To the su-
pernatant 1/10 NaCl 6 M, and 2.5 volumes of absolute ethanol
was added. The DNA was left to precipitate at −80 ◦ C for 1 h,
followed by a centrifugation at 16 000 g for 20 min at 4 ◦ C. The
pellet was washed with 70% ethanol and centrifuged and as much
of the supernatant was drained off as possible. The pellet was left
to air-dry for 10 min and was resuspended in TE buffer.
PCR products for one nuclear (18S) and four mitochondrial
markers (16S, COI, COIII and ND6) were amplified using the
primers listed in Table 1 (Daly et al., 2010, 2008; Rodríguez and
Daly, 2010). These markers were chosen because mitochondrial
markers have been shown previously to be insightful in dis-
criminating taxon variability in metazoans (Antunes et al., 2001;
Benziger et al., 2011; Gaubert et al., 2015; Gomes et al., 2016; Luo
et al., 2014, 2008).
3
Reference
Geller and Walton (2001)
Geller and Walton (2001)
Bridge et al. (1992)
Bridge et al. (1992)
Meyer et al. (2005)
Meyer et al. (2005)
Geller and Walton (2001)
Geller and Walton (2001)
This study (designed for NADH chain 6 from sea anemone)
This study (designed for NADH chain 6 from sea anemone)
Schmitt et al. (2005)
Schmitt et al. (2005)
Schmitt et al. (2005)
Schmitt et al. (2005)
ND6 gene primers were designed with Primaclade (Gadberry
et al., 2005) and further analyzed with OligoAnalyzer⃝ R
- Inte-
grated DNA Technologies. The phylogenetic nearest sequences
available to our studied species in NCBI were used for the primer
design. For the published primers, standard protocols were used.
For ND6 gene amplification, we used the following protocol:
initial denaturation at 95 ◦ C for 3 min., followed by 35 cycles
of 94 ◦ C for 30 s, 50 ◦ C for 40 s, and 72 ◦ C for 90 s, and a
final extension at 72 ◦ C for 10 min. Annealing temperatures were
46 ◦ C for COIII gene, 55 ◦ C for 18S_A/1R primer pair and COI
gene and 60 ◦ C for 18S_2F/B primer pair. All PCRs were amplified
using the BIOTAQTM DNA Polymerase from Bioline. PCR products
were cleaned with Diffinity RapidTip⃝ R
from GRISP. PCR products
were sequenced by the Macrogen company. Sequence data were
submitted to the GenBank under accession numbers according to
Table 2.
2.2.2. For DNA extraction methodology
Due to the difficulty in extracting large amounts of good
quality genetic material from sea anemones, we conducted an
experiment with the purpose of determining a reliable method
for DNA storage, and the best tissue to collect that would provide
a sufficient amount of good quality DNA. We compared yields
from 16 individuals preserved in either 99% ethanol (8 individ-
uals) or at −80 ◦ C (8 individuals) for each of the Actina equina
species. From each of the 16 individuals, four tissue samples were
collected from four body parts (tentacles, gastrodermis, column
and ectodermis). Overall, 8 replicates were conducted for each
combination of DNA storage and tissue type. DNA extraction was
preformed according to the method described previously and its
quantification (ng/µl) and contamination inference (Abs260/280
ratio) was measured in NanoDropTM .
2.3. Molecular data analysis
All sequences were assembled and edited using Geneious Pro
5.6.6⃝R
software (Biomatters, 0000) and were blasted against Gen-
Bank to check for successful amplification and species identifi-
cation (cnidarian or associated organisms). To improve the res-
olution of the inferred phylogenetic tree, we combined the se-
quences from both the nuclear markers and the maternally-
inherited mitochondrial markers and created one concatenated
alignment dataset (CD). We estimated the phylogenetic trees
with specimens that had all five genes sequenced, with the ex-
ception of Anthopleura specimens, for which we had sequence
from only three genes. GenBank sequences from Nematostella
vectensis (Order Actiniaria, Edwardsiidae family) were included as
the outgroup to root our analyses. NCBI sequences of 18S, 16S and
COIII genes were from three conspecifics, A. fragacea, A. viridis and
C. parasitica, were also included in our dataset. However, NCBI
4 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067

Table 2
List of samples included in this study, with sample location and subset and GenBank accession numbers. samples are organized alphabetically within each family.
Family Sample ID Species Group Sample location Marker
16S 18S COI COIII ND6
Aequina1C Actinia equina Center Empa MN538268 MN538324 MN561733 MN561764 MN539756
Aequina2C Actinia equina Center Empa MN538270 MN538326 MN561735 MN561766 MN539758
Aequina1S Actinia equina South Porto Covo MN538269 MN538325 MN561734 MN561765 MN539757
Aequina2S Actinia equina South Porto Covo MN538271 MN538327 MN561736 MN561767 MN539759
Aequina3S Actinia equina South Porto Covo MN538272 MN538328 MN561737 MN561768 MN539760
Afragacea2C Actinia fragacea Center Empa MN538276 MN538313 MN561724 MN561755 MN605969
Afragacea3C Actinia fragacea Center Empa MN538279 MN538316 MN561727 MN561758 MN605972
Afragacea4C Actinia fragacea Center Empa MN538281 MN538318 MN561729 MN561760 MN605974
Afragacea1N Actinia fragacea North Praia da Aguda MN538274 MN538311 MN561722 MN561753 MN605967
Afragacea2N Actinia fragacea North Praia da Aguda MN538277 MN538314 MN561725 MN561756 MN605970
Afragacea3N Actinia fragacea North Póvoa de Varzim MN538280 MN538317 MN561728 MN561759 MN605973
Afragacea4N Actinia fragacea North Valadares MN538282 MN538319 MN561730 MN561761 MN605975
Afragacea5N Actinia fragacea North Valadares MN538283 MN538320 MN561731 MN561762 MN605976
Actiniidae Afragacea6N Actinia fragacea North Valadares MN538284 MN538321 MN561731 MN561763 MN605977
Afragacea1S Actinia fragacea South Almograve MN538275 MN538312 MN561723 MN561754 MN605968
Afragacea2S Actinia fragacea South Almograve MN538278 MN538315 MN561726 MN561757 MN605971
Aviridis1S Anemonia viridis South Monte Clérigo-Aljezur MN538294 MN538341 MN486517 MN561782 MN561720
Aviridis2S Anemonia viridis South Monte Clérigo MN538295 MN538342 MN486518 MN561783 MN561721
Averrucosa1C Aulactinia verrucosa Center Empa MN538285 MN538343 MN486510 MN561775 MN561713
Averrucosa2C Aulactinia verrucosa Center Empa MN538288 MN538346 MN486513 MN561778 MN561716
Averrucosa1N Aulactinia verrucosa North São Bartolomeu do Mar MN538286 MN538344 MN486511 MN561776 MN561714
Averrucosa2N Aulactinia verrucosa North Valadares MN538289 MN538347 MN486514 MN561779 MN561717
Averrucosa3N Aulactinia verrucosa North Valadares MN538290 Accessi MN486515 MN561780 MN561718
MN538348
Averrucosa1S Aulactinia verrucosa South Porto Covo MN538287 MN538345 MN486512 MN561777 MN561715
Averrucosa4S Aulactinia verrucosa South Monte Clérigo MN538291 MN538349 MN486516 MN561781 MN561719
Akrebsi1C Anthopleura krebsi Center Empa – – MN561738 MN561769 MN539761
Akrebsi2C Anthopleura krebsi Center Empa – – MN561739 MN561770 MN539762
Cparasitica1N Calliactis parasitica North Praia da Aguda MN538304 MN538329 MN561740 MN561771 MN561709
Hormathiidae Cparasitica2N Calliactis parasitica North Matosinhos-Open sea MN538305 MN538330 MN561741 MN561772 MN561710
Cparasitica3N Calliactis parasitica North Matosinhos-Open sea MN538306 MN538331 MN561742 MN561773 MN561711
Sagartiidae Cpedunculatus1S Cereus pedunculatus South Porto Covo MN538307 MN538323 MN561743 MN561774 MN561712

Table 3
Length of PCR products aligned and characteristics of each marker dataset.
Dataset Length (bp) % T %C %A %G ts/tv bias Proportion of Proportion of parsimony
invariant sites informative characters
18S 1611 27.29 19.87 26.18 26.66 2.21 0.8504 0.0831
16S 421 34.71 19.18 24.33 21.77 2.56 0.9299 0.0453
COI 662 36.37 19.03 24.04 20.55 2.30 0.8338 0.1435
COIII 672 34.83 18.67 25.10 21.41 4.05 0.7247 0.1592
ND6 669 27.45 17.96 29.64 24.95 2.85 0.7743 0.1510
Concatenated data (CD) 4116 31.04 19.26 25.76 23.94 0.51 0.0477 0.9039

sequences from 16S and 18S genes from Actinia equina were not
included, since these sequences were not derived from the same
individuals. Sequences were aligned using webPRANK (Loytynoja
and Goldman, 2010). To identify the best-fit model of nucleotide
sequence evolution for the data set we used Mega 6.06 (Tamura
et al., 2013).
Phylogenies were estimated using a Maximum Likelihood (ML)
approach as implemented in Mega 6.06 (Tamura et al., 2013) with
1000 bootstraps and with the Kimura 2 parameter (K2P) plus
gamma nucleotide model substitution. This model is most effec-
tive for sequences with relatively low divergence rates (Tamura
et al., 2013). In addition, a Bayesian inference approach was
implemented using MrBayes (Ronquist and Huelsenbeck, 2003)
under the HKY model with fix stationary state frequencies. This
analysis was performed with four Markov chains run for 1 × 106
generations with a sampling frequency of 500 generations. The
log-likelihood score of each saved tree was plotted against the
number of generations to establish the point at which the log-
likelihood scores of the analysis reached their asymptote. The
posterior probabilities for clades were established by constructing
a majority rule consensus tree for all trees generated after the
completion of the burn-in phase. The trees were visualized in
Seaview4 (Guindon and Gascuel, 2010) and annotated using GIMP
(GNU Image Manipulation Program) and Mega 6.06 (Tamura et al.,
2013). Characteristics of the datasets estimated performed in
Mega 6.06, including the proportion of invariant sites, the number
of parsimony informative characters and singletons, the aver-
age distance and finally the translation/transversion bias (see
Table 3).
2.4. Statistical analysis for the DNA extraction methodology
Data from the DNA extraction assay were analyzed by fitting a
general linear model, with DNA concentration as the dependent
variable and preservation method and body tissue as fixed factors.
DNA concentration data were logarithmically transformed. The
interaction between the fixed factors was tested in an early
version of the model and was removed from the final analyses
because its effect was non-significant. A Shapiro–Wilks test ap-
plied to the model residuals confirmed the normal distribution
(W = 0.98, p = 0.29). An analysis of variance was used to test
the significance of model factors (Table 4). All of these analyses
were performed with R software.
 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067 5

Fig. 2. Species collected in this study. (I) Actinia equina, (II) Aulactinia verrucosa, (III) Cereus pedunculatus, (IV) Anemonia viridis, (V) Calliactis parasitica, (VI) Anthopleura
krebsi, (VII) Actinia fragacea.
Source: Images II, III and V are adapted from Frazão et al. (2012).

Table 4
Results of a two-way analysis of variance applied to absorbance data, as a proxy for DNA extraction
quality, using preservation method and tissue of origin as factors. F: Fischer - Snedecor contrast
statistic, df: degrees of freedom, p: associated probability value.
Factor F df p
Tissue type preservation 18.3 1 < 0.001
Body part 0.2 3 0.9
Residuals 60

3. Results 3.2. Phylogenetic study

3.1. Species identification
Along the Portuguese mainland coast, 12 rocky shores were
sampled: 7 in the north, 2 in the center and 3 in the southern
part of the country. A visual census of intertidal sea anemones
was conducted and samples from target species were collected
for subsequent analyses. Species were collected from a variety of
habitats. For example, Aulactinia verrucosa were buried in sand,
other species were exposed to the sun and waves (including Ac-
tinia equina, Actinia fragacea or Anemonia viridis), in rocky cracks
(e.g. Cereus pedunculatus) or shady areas (e.g. Anthopleura krebsi).
All the Calliactis parasitica specimens collected were not associ-
ated with hermit crabs. For the phylogenetic tree, 31 samples
from 7 species from 3 families were included in the analyses.
For other analyses, we included 5 specimens of Actinia equina,
11 of Actinia fragacea, 2 of Anemonia viridis, 7 of Aulactinia ver-
rucosa, 2 of Anthopleura krebsi, 3 of Calliactis parasitica and 1
of Cereus pedunculatus. The family Actiniidae was represented
by Actinia equina, Actinia fragacea, Anemonia viridis, Aulactinia
verrucosa (former Bunodactis verrucosa) and Anthopleura krebsi;
the family Hormathiidae, by Calliactis parasitica and the family
Sagartiidae by Cereus pedunculatus (see Fig. 2).
The identification of the species collected, was based on mor-
phological characteristics, as well as in the sequenced genes.
The length of 18S, 16S and COIII genes was 1611, 421 and 672
base pairs, respectively. The alignment between our sequenced
gene and the sequences in the NCBI database retrieved a 99.9%
score concerning its similarity. The molecular result therefore,
reinforces the identification made by the classic taxonomy.
From the visual census on the 12 beaches and by meticulous
inspections of the sampled specimens, the sea anemones from
the intertidal zone of Portuguese rocky beaches do not show
any phenotypic differences. This fact is true among specimens
from the same species, from the same location and from different
locations.
Both phylogenetic trees, constructed under the Maximum
Likelihood criterion or the Bayesian Inference retrieved the same
clades (Fig. 3), but the last with higher values of posterior proba-
bilities. From the analysis it can be seen that all the species group
accordingly to previous studies (Daly et al., 2010, 2008; Daly,
2003) and are in the same clade of NCBI representatives, indicat-
ing that the species were positively identified by the phenotypic
characteristics and furthermore do not form a sister clade to the
species sequenced worldwide and deposited in NCBI Genbank.
Looking into the phylogenetic tree (Fig. 3): Cereus pedunculatus
groups with Calliactis parasitica and form a distinct clade from
the Actiniidae family member (Endomyaria superfamily). Among
these, there are two clades: one composed by A. krebsi and A.
verrucosa and the other by A. viridis. Actinia equina and Actinia fra-
gacea. This last clade is not well supported (bootstrap value below
50). Cereus and Calliactis are from different families Sagartiidae
and Hormathiidae, respectively, but from the same superfamily
Acontiaria. The support values found in this study were: 97, 90,
83 and 89 for the pair of groups Actinia + A. viridis/A. krebsi + A.
verrucosa, C. pedunculatus/C. parasitica, A. fragacea/A. equina and
A. krebsi/A. verrucosa.
Regarding Table 3 and considering the CD dataset, cytosine
is in low abundance when compared to thymine, nonetheless
transition/transversion bias is 0.5, meaning there is no bias to-
wards either transitional or transversional substitution (Tamura
et al., 2012). Compared to the others datasets, CD dataset has
a higher value of parsimony informative characters, thus pro-
viding a more robust analysis. Considering this result, we have
performed our phylogenetic tree using the CD dataset. Another
parameter analyzed was the proportion of invariant sites, which
had its smallest value in the CD dataset. Fewer invariant sites
mean that most sites evolve at a same single rate. Summarizing,
CD dataset with 4116 bp shows more phylogenetic informative
sites, comparably to the other datasets (i.e. single markers have
fewer informative sites). Comparing markers among each other,
6 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067

Fig. 3. Maximum-Likelihood tree with 1000 bootstrap values and Bayesian posterior probability values (shown first), of the concatenated dataset with five markers
(18S, 16S, COI, COIII and ND6). The taxa are highlighted with different colors representing the different species studied. The taxa are represented by codes that are
elucidated in Table 2. NCBI sequences are represented by its accession numbers.

the COIII was the one showing greater variability with a value
of 0.1592. Considering the coding (COI, COIII and ND6) with the
non-coding (16S and 18S) markers, the coding genes showed
more variability. The values ranged from 0.14 to 0.16. The longest
marker (18S) was one of the least variables (0.0831), meaning
that the nuclear marker is more conserved, compared with the
mitochondrial markers (16S, COI, COIII, ND6). This fact is in ac-
cordance with Sinniger et al. (2008). All of these results followed
the previous trend in marker variability reported for actiniarians
(Rodríguez and Daly, 2010) (see Table 4).
3.3. DNA extraction and statistical analysis
The yield (ng/µL) and purity (Abs 260/280 ratio) of the 16
samples were analyzed and values of absorbance 260/280 ra-
tio below 1.8 were considered to have phenol or protein con-
tamination; values higher that 2.0 to have RNA contamination
and values between 1.8 and 2.0 indicate good DNA pureness
with absence of contaminants that could negatively influence
downstream applications.
DNA extracted from 99% ethanol preserved tissues showed
higher frequency of absorbance values indicating high DNA pure-
ness (Fig. 4a, upper panel). Differences between tissues, were not
significant (F 3, 60 = 0.2, p = 0.9), probably due to low number of
replicates and high dispersion rate. Differences between tissues
did not shown to be so remarkable, although tentacles showed
most of its values concentrated inside the interval indicating
high quality DNA. In contrast, the epidermis showed the high-
est dispersion (Fig. 4a, lower panel). Tentacle tissue displayed
larger absorbance values (average = 222.62, inter-quartile range
= 202.36) when compared to the other tissues: column (average
= 159,94, iqr = 80.28), epidermis (average = 93.96, iqr = 50.49),
gastrodermis (average = 88.94, iqr = 130.3), indicating higher
quality of DNA extracted from tentacles.
The extraction method using ethanol preserved tissues shows
larger average values and less dispersion rather than tissues pre-
served at - 80 ◦ C (Fig. 4b, upper panel). The extraction procedure
comparing different body parts showed slightly different average
values, and overlapping dispersion (Fig. 4b, lower panel). An
analysis of variance, using only the data from high quality DNA,
showed a significant effect of the factor ‘‘tissue type preserva-
tion’’, but not for the factor ‘‘body part’’ (Table 4). This is probably
due to this overlapped dispersion.
 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067
Fig. 4. Box whiskers plot of the DNA extraction results by tissue type preservation (upper panel) and body part (lower panel). (a) Absorbance values 260/280 indicate
the purity of the extracted DNA and (b) Ln of DNA concentration (ng/µl).
4. Discussion
The main purpose of this work was to describe distribution
patterns of sea anemones in intertidal Portuguese rocky shores.
These organisms are found worldwide, but a considerable gap of
knowledge exist for the coastline of Portugal. Regional studies are
an approach to understand global processes, which can therefore
be important for local decisions. Insights on the occurrence of
sea anemones in Portugal can lead the path to future study
species (e.g. enlightening population composition for unraveling
new compounds with biomedical importance). Here, we clarified
the occurrence of seven species, which grouped with theirs NCBI
conspecies. This fact reveals two aspects: for one hand, the phe-
notypic identification was made correctly and therefore the visual
census is reliable in terms of accuracy, and in the other hand,
Portuguese sea anemones are not different from others encounter
worldwide whose sequences are deposited in NCBI.
From the species retrieved (Actinia fragacea, Actinia equina,
Aulactinia verrucosa, Anemonia viridis, Anthopleura krebsi, Cereus
pedunculatus and Calliactis parasitica) they did not show pheno-
typic or genotypic variability, among members from the same
location or even among members from different sampled loca-
tions. From our results, the species found in at least two collec-
tion groups (Actinia fragacea, Actinia equina and Aulactinia verru-
cosa), did not reveal evidence of any genetic differentiation across
north, center and south for all the five markers (also supported by
the haplotypes networks resolved in TCS (Clement et al., 2000);
data not shown). This fact can be due, not only to the choice
of the markers, but also to the phylogenetic proximity of the
sampled groups. Indeed, corals that are 3000 km apart, also did
not showed any population difference with the COI gene marker,
despite the high levels of variation and population subdivision
from allozymes (Hellberg, 2006). As mentioned earlier, mitochon-
drial molecular evolution in basal lineages, such as cnidarians, is
slower than in bilaterians. Furthermore, within cnidarians, antho-
zoans are the most slow evolving (Daly et al., 2008; France and
Hoover, 2002; Goddard et al., 2006), even in geographically dis-
tant or potentially isolated populations (Hellberg, 2006; Medina
7
et al., 1999; Snell et al., 1998). This would also explain why some
of the haplotypes recorded in the sea anemones from Portugal
are similar to others found abroad (Actinia fragacea and Anemonia
viridis from California and Aulactinia verrucosa, Anthopleura krebsi,
Cereus pedunculatus and Calliactis parasitica from Kansas).
The molecular markers employed in this study do not provide
enough variation to assess population-level genetic differentia-
tion among sea anemones, confirming the results of previous
studies using the same genetic markers reported here (Hebert
et al., 2003; Huang et al., 2008; Shearer et al., 2008) or from
other regions of the anthozoan mitochondrial genome (McFadden
et al., 2011; Shearer et al., 2002). More recently, González-Muñoz
et al. (2015), found no 12S, 16S or COIII variation among Phyman-
thus crucifer morphotypes. Similarly, Anemonia viridis collected
from the English Channel and the Mediterranean Sea showed
no genetic structure based on variation of five nuclear markers
(Mallien et al., 2018). A broader geographic study confirmed that
COI and ITSII variation was inadequate for distinguishing sea
anemones from different geographic regions and hypothesized
populations (Dohna and Kochzius, 2016). This is in contrast with
the conclusions of Sinniger et al. (2008), who used two mitochon-
drial markers (COI and 16S) to study the order Zoantharia (the
sister group with Actiniaria which includes sea anemones) and
who stated that these markers held promise for distinguishing
both species groups and most morphologically distinct species.
Due to the absence of literature about the suitableness of using
concatenated data from 18S, 16S, COI, COIII and ND6 to infer
about population differentiation on sea anemones, we assessed its
suitableness in our study. Indeed, nuclear and mitochondria data
usually give concordant trees in actiniarians and integrate data
from different sources is known to be more likely to accurately
reconstruct the evolutionary history (Rodríguez et al., 2012).
The results from our phylogenetic analyses are concordant
with previous analyses (Daly et al., 2010, 2008; Rodríguez et al.,
2012; Rodríguez and Daly, 2010). Our genetic data, along with
our visual censuses and sampling, found no genetic differentia-
tion among these sea anemones across the Portuguese beaches.
However, a more extended and systematic sampling is needed
8 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067
to make inferences about the abundance, distribution, and pos-
sible population genetic structure of these organisms, and to
test whether there are correlations with geographical features of
the Portuguese coast. A well-characterized study area, including
detailed physical and chemical parameters, combined with a new
approach and broader assessment of genomic levels of genetic
variation differences are crucial. Our results suggest that this
group of organisms might be an example of Lewontin’s Paradox,
where unlike what is generally expected, they represent large
populations with low genetic structure.
Although there have been an increasing number of molec-
ular genetic studies of sea anemones, there is still a limited
amount of data in public databases (e.g., NCBI, http://www.ncbi.
nlm.nih.gov/). This is due to insufficient taxon sampling, as well
as technical challenges in extracting high-quality DNA from these
species. Here we demonstrated that the quality and quantity of
DNA from sea anemones can be maximized by using an opti-
mized phenol extracting method with the support of a mechanic
homogenizer with beads, such as the Precellys⃝ R
tissue homoge-
nizer. Of the methods tested here, the best protocol was to store
sea anemone tissue in ethanol 99% and extract DNA from the
anemone column tissue. We also found that lower-yields of DNA
were extracted from the epidermis relative to other body parts.
However, we confirmed that the collection of a sample from a
small portion of the epidermis, including mucus, is a viable non-
invasive approach, as was previously demonstrated by Stewart
et al. (2017).
5. Conclusions
We found that the highest quality DNA was obtained from
sea anemones using the Precellys⃝ R
homogenizer, followed by the
phenol DNA extraction. Column tissue stored in 99% ethanol pro-
vided the highest DNA yields. Our exploratory work identified the
following seven species of sea anemones in the intertidal rocky
beaches of Portugal: Actinia equina, Actinia fragacea, Anemonia
viridis, Aulactinia verrucosa Anthopleura krebsi, Calliactis parasit-
ica and Cereus pedunculatus. The visual census, integrated with
the genetic study, found no evidence of differentiation among
intertidal sea anemones from different sample locations and the
genetic haplotypes were similar to NCBI haplotypes from individ-
uals previously collected from other geographic locations. Our ML
phylogenetic tree was also concordant with the results of previ-
ous studies on these species. Altogether, our study increased the
number of specimens deposited in NCBI, significantly improving
the amount of information that will be available for future genetic
studies on this group of organisms.
Given the low levels of genetic variation of the mitochondrial
markers observed here among sea anemones, future population
genetic studies should consider using more-variable markers,
such as microsatellites (Thornhill et al., 2013), or more rapidly
evolving nuclear DNA regions, such as introns (McFadden et al.,
2004). Alternatively, amplified fragment length polymorphism
(AFLP) markers could also be used for intraspecific genetic vari-
ation in anthozoans (Chomsky et al., 2009; Douek et al., 2002;
McFadden et al., 2004). Next-generation sequencing is also being
increasingly used for population genetic differentiation (Fuma-
galli et al., 2013) and would provide robust data suitable for
assessment of fine-scale genetic structure.
Declaration of competing interest
The authors declare that they have no known competing finan-
cial interests or personal relationships that could have appeared
to influence the work reported in this paper.
CRediT authorship contribution statement
Bárbara Frazão: Conceptualization, Data curation, Formal anal-
ysis, Investigation, Methodology, Software, Visualization, Writing
- original draft. Elsa Froufe: Data curation, Formal analysis. An-
dreia Fernandes: Methodology. Aldo Barreiro: Methodology.
Vitor Vasconcelos: Funding acquisition, Project administration,
Supervision. Agostinho Antunes: Conceptualization, Funding ac-
quisition, Investigation, Methodology, Project administration, Re-
sources, Software, Supervision, Validation, Writing - review &
editing.
Acknowledgments
Comments made by the Associate Editor and two anonymous
referees improved an earlier version of the manuscript. The au-
thors would like to thank Dr. Warren E. Johnson (Smithsonian
Institution, MD, USA) for helping edit the manuscript.
Funding
BF was supported by a PhD grant (SFRH/BD/48184/2008) from
Portuguese Foundation for Science and Technology (FCT—
Fundação para a Ciência e a Tecnologia, Portugal). AA was par-
tially supported by the Strategic Funding UID/Multi/04423/2019
through national funds provided by FCT, Portugal and the Eu-
ropean Regional Development Fund (ERDF) in the framework of
the program PT2020, by the European Structural and Investment
Funds (ESIF) through the Competitiveness and Internationaliza-
tion Operational Program — COMPETE 2020 and by National
Funds through the FCT, Portugal under the project PTDC/CTA-
AMB/31774/2017 (POCI-01-0145-FEDER/031774/2017).
References
Amaro, T., Luna, G.M., Danovaro, R., Billett, D.S.M., Cunha, M.R., 2012. High
prokaryotic biodiversity associated with gut contents of the holothurian
Molpadia musculus from the Nazaré Canyon (NE Atlantic). Deep Sea Res. Part
I 63, 82–90.
Antunes, A., Faria, R., Weiss, S., Alexandrino, P., 2001. Complex evolutionary
history in the brown trout: Insights on the recognition of conservation units.
Conserv. Genet. 2 (4), 337–347.
Araújo, R., Bárbara, I., Tibaldo, M., et al., 2009. Checklist of benthic marine algae
and cyanobacteria of northern Portugal. Bot. Mar. 52 (1), 24–46.
Benziger, A., Philip, S., Raghavan, R., et al., 2011. Unraveling a 146 years old
taxonomic puzzle: Validation of Malabar Snakehead, species-status and its
relevance for Channid systematics and evolution. PLoS One 6 (6), e21272.
Biomatters, 0000. Geneious Pro 5.6.6. (http://www.geneious.com/).
Boyra, A., Espino, F., Freitas, M., Haroun, R.J., Biscoito, M., González, J.A., 2008.
GuÍa de Campo - 365 Espécies AtlâNticas. Divulgación, Educación y Ciencia,
Oceanográfica.
Bridge, D., Cunningham, C.W., Schierwater, B., Desalle, R., Buss, L., 1992. Class-
level relationships in the phylum Cnidaria: Evidence from mitochondrial
genome structure. Proc. Natl. Acad. Sci. 89, 8750–8753.
Campbell, A., Nicholls, J., Riem, S., 1994. Fauna e Flora do Litoral de Portugal.
Câmara Municipal do Porto.
Chomsky, O., Douek, J., Chadwick, N.E., Dubinsky, Z., Rinkevich, B., 2009.
Biological and population-genetic aspects of the sea anemone Actinia equina
(Cnidaria: Anthozoa) along the Mediterranean coast of Israel. J. Exp. Mar.
Biol. Ecol. 375, 16–20.
Clement, M., Posada, D., Crandall, K., 2000. TCS: a computer program to estimate
gene genealogies. Mol. Ecol. 9, 1657–1660.
Cunha, M.R., Paterson, G.L.J., Amaro, T., et al., 2011. Biodiversity of macrofaunal
assemblages from three Portuguese submarine canyons (NE Atlantic). Deep
Sea Res. II 58, 2433–2447.
Daly, M., 2003. The anatomy terminology and homology of acrorhagi and
pseudoacrorhagi in sea anemones. Zool. Verh. Leiden 345, 89–101.
Daly, M., Chaudhuri, A., Gusmao, L., Rodriguez, E., Gusmão, L., Rodríguez, E.,
2008. Phylogenetic relationships among sea anemones (Cnidaria: Anthozoa:
Actiniaria). Mol. Phylogenet. Evol. 48, 292–301.
Daly, M., Gusmao, L.C., Reft, A.J., Rodriguez, E., 2010. Phylogenetic signal in
mitochondrial and nuclear markers in sea anemones (Cnidaria, Actiniaria).
Integr. Comp. Biol. 50, 371–388.
 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067
Dellacorte, C., 1994. Isolation of nucleic acids from the sea anemone Condylactis
gigantea (Cnidaria: Anthozoa). Tissue Cell 26, 613–619.
Dohna, T.A., Kochzius, M., 2016. Obstacles to molecular species identification in
sea anemones (Hexacorallia: Actiniaria) with COI, a COI intron, and ITS II.
Mar. Biodivers. 46 (1), 291–297.
Domínguez-Pérez, D., Campos, A., Alexei Rodríguez, A., et al., 2018. Proteomic
Analyses of the Unexplored Sea Anemone Bunodactis verrucosa. Mar. Drugs
16 (2), E42.
Douek, J., Barki, Y., Gateño, D., Rinkevich, B., 2002. Possible cryptic speciation
within the sea anemone Actinia equina complex detected by AFLP markers.
Zool. J. Linn. Soc. 136, 315–320.
Fautin, D.G., 2009. Structural diversity, systematics, and evolution of cnidae.
Toxicon 54, 1054–1064.
France, S.C., Hoover, L.L., 2002. DNA sequences of the mitochondrial COI
gene have low levels of divergence among deep-sea octocorals (Cnidaria:
Anthozoa). Hydrobiologia 471, 149–155.
Frazão, B., Vasconcelos, V., Antunes, A., 2012. Sea anemone (Cnidaria Anthozoa
Actiniaria) toxins: An overview. Mar. Drugs 10, 1812–1851.
Fumagalli, M., Vieira, F.G., Korneliussen, T.S., et al., 2013. Quantifying population
genetic differentiation from next-generation sequencing data. Genetics 195,
979–992.
Gadberry, M.D., Malcomber, S.T., Doust, A.N., Kellogg, E.A., 2005. Primaclade-
a flexible tool to find conserved PCR primers across multiple species.
Bioinformatics 21, 1263–1264.
Gadelha, J.R., Jesus, F., Gomes, P.B., Osten, J.R., Von Morgado, F., Soares, A.M.V.
da M., 2017. Temperature tolerance test exposition with temperate sea
anemone Actinia equina, a climatic and environmental changes simulation.
OALib J. 4, e3360.
Gaubert, P., Njiokou, F., Olayemi, A., et al., 2015. Bushmeat genetics: Setting up
a reference framework for the DNA typing of African forest bushmeat. Mol.
Ecol. Resour. 15 (3), 633–651.
Geller, J.B., Walton, E.D., 2001. Breaking up and getting together: evolution
of symbiosis and cloning by fission in sea anemones (Genus Anthopleura).
Evolution (N.Y.) 55, 1781–1794.
Goddard, M.R., Leigh, J., Roger, A.J., Pemberton, A.J., 2006. Invasion and
persistence of a selfish gene in the cnidaria. PLoS One 1, e3.
Gomes, C., Sousa, R., Mendes, T., et al., 2016. Low genetic diversity and high
invasion success of Corbicula fluminea (Bivalvia, Corbiculidae) (Müller, 1774)
in Portugal. PLoS One 11 (7), e0158108.
González-Muñoz, R., Simões, N., Mascaró, M., Tello-Musi, J.L., Brugler, M.R.,
Rodríguez, E., 2015. Morphological and molecular variability of the sea
anemone Phymanthus crucifer (Cnidaria, Anthozoa, Actiniaria, Actinoidea). J.
Mar. Biol. Assoc. U.K. 95 (1), 69–79.
Guindon, G.M., Gascuel, O., 2010. SeaView version 4: a multiplatform graphical
user interface for sequence alignment and phylogenetic tree building. Mol.
Biol. Evol. 27, 221–224.
Hebert, P.D.N., Ratnasingham, S., de Waard, J.R., 2003. Barcoding animal life:
cytochrome c oxidase subunit 1 divergences among closely related species.
Proc. R. Soc. B 270, S96–S99.
Hellberg, M.E., 2006. No variation and low synonymous substitution rates in
coral mtDNA despite high nuclear variation. BMC Evol. Biol. 6, 24.
Huang, D., Meier, R., Todd, P.A., Chou, L.M., 2008. Slow mitochondrial COI
sequence evolution at the base of the metazoan tree and its implications
for DNA barcoding. J. Mol. Evol. 66, 167–174.
2016. Instituto_Hidrográfico Ondas Gigantes na Praia do Norte na Nazaré. http:
//www.hidrografico.pt/noticia-ondas-gigantes-nazare.php.
Leone, A., Lecci, R.M., Durante, M., Meli, F., Piraino, S., 2015. The bright side of
gelatinous blooms: Nutraceutical value and antioxidant properties of three
Mediterranean jellyfish (Scyphozoa). Mar. Drugs 13, 4654–4681.
Litsios, G., Kostikova, A., Salamin, N., 2014. Host specialist clownfishes are
environmental niche generalists. Proc. Biol. Sci. 281, 20133220.
Loytynoja, A., Goldman, N., 2010. WebPRANK: a phylogeny-aware multiple
sequence aligner with interactive alignment browser. BMC Bioinformatics
11, 579.
Luo, S.J., Johnson, W.E., Martenson, J., et al., 2008. Subspecies genetic assign-
ments of worldwide captive tigers increase conservation value of captive
populations. Curr. Biol. 18 (8), 592–596.
Luo, S.J., Zhang, Y., Johnson, W.E., et al., 2014. Sympatric Asian felid phylogeog-
raphy reveals a major Indochinese-Sundaic divergence. Mol. Ecol. 23 (8),
2072–2092.
Mallien, C., Porro, B., Zamoum, T., et al., 2018. Conspicuous morphological
differentiation without speciation in Anemonia viridis (Cnidaria, Actiniaria).
Syst. Biodivers. 16 (3), 271–286.
Mariottini, G.L., Grice, I.D., 2016. Antimicrobials from cnidarians. A new
perspective for anti-infective therapy? Mar. Drugs 14, 48.
McFadden, C.S., Benayahu, Y., Pante, E., Thoma, J.N., Nevarez, P.A., France, S.C.,
2011. Limitations of mitochondrial gene barcoding in Octocorallia. Mol. Ecol.
Resour. 11, 19–31.
9
McFadden, C.S., Tullis, I.D., Hutchinson, M.B., Winner, K., Sohm, J.A., 2004.
Variation in coding (NADH dehydrogenase subunits 2, 3, and 6) and non-
coding intergenic spacer regions of the mitochondrial genome in Octocorallia
(Cnidaria: Anthozoa). Mar. Biotechnol. 6, 516–526.
Medina, M., Weil, E., Szmant, A.M., Mar, B., 1999. Examination of the Montas-
traea annularis species complex (Cnidaria: Scleractinia) using ITS and COI
sequences. Mar. Biotechnol. York 1, 89–97.
Meyer, C.P., Geller, J.B., Paulay, G., 2005. Fine scale endemism on coral reefs:
Archipelagic differentiation in turbinid gastropods. Evolution (N.Y.) 59, 113.
Monteiro, J.G., Porteiro, F., Matos, V., 2010. Lista de invertebrados marinhos
costeiros. In: Listagem dos Organismos Terrestres e Marinhos Dos Açores.
Princípia Editora, Lda, pp. 287–324.
Moran, Y., Weinberger, H., Sullivan, J.C., Reitzel, A.M., Finnerty, J.R., Gurevitz, M.,
2008. Concerted evolution of sea anemone neurotoxin genes is revealed
through analysis of the Nematostella vectensis genome. Mol. Biol. Evol. 25,
737–747.
Pereira, A.M., Brito, C., Sanches, J., Sousa-Santos, C., Robalo, J.I., 2014. Zootaxa
absence of consistent genetic differentiation among several morphs of Actinia
(Actiniaria: Actiniidae) occurring in the Portuguese coast. Zootaxa 3893,
595–600.
Pinto, S.M., Fernandes-Matioli, F.M.C., Schlenz, E., 2000. DNA extraction from sea
anemone (Cnidaria: Actiniaria) tissues for molecular analyses. Genet. Mol.
Biol. 23, 601–604.
Prados, Á.A., 2008. Bibliografía de los Cnidarios de la Península Ibérica e Islas
Baleares. In: Proyecto Fauna Ibérica. Museo Nacional de Ciencias Naturales,
Madrid.
Pretterebner, K., Riedel, B., Zuschin, M., Stachowitsch, M., 2012. Hermit crabs
and their symbionts: Reactions to artificially induced anoxia on a sublittoral
sediment bottom. J. Exp. Mar. Biol. Ecol. 411, 23–33.
Revel, J., Massi, L., Mehiri, M., et al., 2016. Differential distribution of lipids
in epidermis, gastrodermis and hosted Symbiodinium in the sea anemone
Anemonia viridis. Comp. Biochem. Physiol. A. Mol. Integr. Physiol. 191,
140–151.
Rocha, J., Coelho, F.J.R.C., Peixe, L., Gomes, N.C.M., Calado, R., 2014. Optimization
of preservation and processing of sea anemones for microbial community
analysis using molecular tools. Sci. Rep. 4, 6986.
Rodríguez, E., Barbeitos, M., Daly, M., Gusmao, L.C., Häussermann, V., 2012. To-
ward a natural classification: Phylogeny of acontiate sea anemones (Cnidaria,
Anthozoa, Actinaria). Cladistics 28, 375–392.
Rodríguez, E., Daly, M., 2010. Phylogenetic relationships among deep-sea
and chemosynthetic sea anemones: actinoscyphiidae and actinostolidae
(Actiniaria: Mesomyaria). PLoS One 5, e10958.
Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19, 1572–1574.
Sahu, S.K., Thangaraj, M., Kathiresan, K., 2012. DNA extraction protocol for plants
with high levels of secondary metabolites and polysaccharides without using
liquid nitrogen and phenol. ISRN Mol. Biol. 2012, 1–6.
Saldanha, L., 2003. Fauna Submarina Atlântica. Publicações Europa-América.
Schmitt, S., Hentschel, U., Zea, S., Dandekar, T., Wolf, M., 2005. ITS-2 and 18S
rRNA gene phylogeny of Aplysinidae (Verongida, Demospongiae). J. Mol. Evol.
60, 327–336.
Schuchert, P., 2018. DNA barcoding of some Pandeidae species (Cnidaria,
Hydrozoa, Anthoathecata). Rev. Suisse Zool. 125, 101–127.
Shearer, T.L., Coffroth, M.A., Mol Ecol, R., 2008. DNA BARCODING: Barcoding
corals: limited by interspecific divergence, not intraspecific variation. Mol.
Ecol. Resour. 8, 247–255.
Shearer, T.L., Van Oppen, M.J., Romano, S.L., Worheide, G., 2002. Slow mito-
chondrial DNA sequence evolution in the Anthozoa (Cnidaria). Mol. Ecol. 11,
2475–2487.
Sibaja-Cordero, J.A., Cortés, J., 2008. Vertical zonation of rocky intertidal organ-
isms in a seasonal upwelling area (Eastern Tropical Pacific). Costa Rica. Rev.
Biol. Trop. 56, 91–104.
Sinniger, F., Reimer, J.D., Pawlowski, J., 2008. Potential of DNA sequences to
identify Zoanthids (Cnidaria: Zoantharia). Zool. Sci. 25, 1253–1260.
Snell, T.L., Foltz, D.W., Sammarco, P.W., 1998. Variation in morphology vs
conservatism of a mitochondrial gene in Montastrea cavernosa (Cnidaria,
Scleractinia). Gulf Mex. Sci. 2, 188–195.
Stabili, L., Schirosi, R., Parisi, M.G., Piraino, S., Cammarata, M., 2015. The mucus
of Actinia equina (Anthozoa, Cnidaria): An unexplored resource for potential
applicative purposes. Mar. Drugs 13, 5276–5296.
Stampar, S.N., Maronna, M.M., Kitahara, M.V., Reimer, J.D., Morandini, A.C., 2014.
Fast-evolving mitochondrial DNA in Ceriantharia: A reflection of hexacorallia
paraphyly? PLoS One 9, e86612.
Stewart, Z.K., Campos, A.B., Pavasovic, A.J.P., 2017. A non-disruptive method for
obtaining DNA samples from sea anemones (Cnidaria: Anthozoa: Actiniaria).
Conserv. Genet. Resour. 1–3.
Tamura, K., Battistuzzi, F.U., Billing-Ross, P., Murillo, O., Filipski, A., Kumar, S.,
2012. Estimating divergence times in large molecular phylogenies. Proc. Natl.
Acad. Sci. 109, 19333–19338.
10 B. Frazão, E. Froufe, A. Fernandes et al. / Regional Studies in Marine Science 34 (2020) 101067

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Wirtz, P., Ocaña, O., Molodtsova, T., Ocana, O., Molodtsova, T., 2003. Actiniaria
Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30 (12), and Ceriantharia of the Azores (Cnidaria Anthozoa). Helgol. Mar. Res. 57,
2725–2729. 114–117.
Thornhill, D.J., Xiang, Y.D.T.P., Zhong, M., Santos, S.R., Mol, E., 2013. Population
genetic data of a model symbiotic cnidarian system reveal remarkable
symbiotic specificity and vectored introductions across ocean basins. Mol.
Ecol. 22, 4499–4515.