Professional Documents
Culture Documents
PRE-BOARD EXAMINATION-2022
CLASS-XII
SUBJECT-BIOLOGY
SUBJECT CODE-044/01
General instructions:
All questions are compulsory.
The question paper has three sections and 13 questions. All questions
are compulsory.
Section–A has 6 questions of 2 marks each; Section–B has 6 questions of 3
marks each; and Section–C has a case-based question of 5 marks.
There is no overall choice. However, internal choices have been provided in
some questions. A student has to attempt only one of the alternatives in such
questions.
Wherever necessary, neat and properly labelled diagrams should be drawn.
SECTION-A
1. Enumerate the two properties of cancer cells that distinguish them from
normal cell.
2. Why do clown fish and sea anemone pair up? And what is this interaction
called as?
3. Write the attributes that a population has but not an organism.
OR
What does Bt stands for in Bt cotton? In which group of plants Bt is used as a
biocontrol agent?
4. A linear DNA fragment and a plasmid has three restriction sites for EcoRI.
How many fragments will be produced from linear DNA and plasmid
respectively.
5. How is gene Z used as a marker?
6. A population of Paramoeciumcaudatum was grown in a culture medium. After
5 days the culture medium became overcrowded with Paramoeciumand had
depleted nutrients. What will happen to the population and what type of
growth curve will the population attain? Draw the growth curve.
OR
SECTION-B
Page 1 of 4
7. Fill in the blanks (A-F)
8. Expand the name of the enzyme ADA. Why is the enzyme essential in the
human body? Suggest a gene therapy for its deficiency?
9. The following graph represents the organismic response to certain
environmental condition (e.g. temperature)
OR
Page 2 of 4
In the given flow diagram, the replication of retrovirus in a host is
shown. Observe and answer the following questions.
a. Fill in (1) and (2)
b. Why is the virus called retrovirus?
c. Can the infected cell survive while viruses are being replicated and
released?
11. The relation between species richness and area for a wide variety of taxa
turns out to be a rectangular hyperbola. Give a brief explanation.
12. (i) How is the copy number of plasmid vector and yield of the recombinant
protein related to each other?
(ii) How is Ti plasmid of Agrobacterium tumefaciens modified to convert it into
a cloning vector?
SECTION-C
13. Some restriction enzymes break a phosphodiester bond on both the DNA
strands,
such that only one end of each molecule is cut and these ends have regions of
single stranded DNA. BamH1is one such restriction enzyme which binds at the
recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the
5’- guanine on each strand.
(a) What is the objective of this action?
(b) Explain how the gene of interest is introduced into a vector.
(c) You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’
Page 3 of 4
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would you
expect? Write the sequence of these double-stranded DNA fragments with
their respective polarity.
(d) A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site.
What will be its impact on the recombinant plasmids? Give a possible way by
which you could differentiate non recombinant to recombinant plasmids.
OR
GM crops especially Bt crops are known to have higher resistance to
pest attacks. To substantiate this an experimental study was conducted in 4
different farmlands growing Bt and non Bt-Cotton crops. The farm lands had
the same dimensions, fertility and were under similar climatic conditions. The
histogram below shows the usage of pesticides on Bt crops and non-Bt crops
in these farm lands.
(a) Which of the above 4 farm lands have successfully applied the concepts of
Biotechnology
to show better management practices and use of agrochemicals? If you had to
cultivate, which crop would you prefer (Btor Non- Bt) and why?
(b) Cotton Bollworms were introduced in another experimental study on the above
farm lands wherein no pesticidewas used. Explain what effect would a Bt and
Non Bt crop have on the pest.
***
Page 4 of 4