Biology Fall Semester 2 Final Exam Study Guide

Unit 4: Ch. 8-10 – Cell Function

1. What kind of molecule is shown here? Where is the energy stored in this molecule?

2. What is an autotroph? A heterotroph? Give an example of each.

3. What are pigments? What is their role in photosynthesis?
4. How does chlorophyll affect the appearance of a plant?
5. What is the purpose of photosynthesis?

6. What are the products and reactants of photosynthesis?

7. What is the balanced equation for photosynthesis?
8. What are the factors that affect the rate of photosynthesis? (There are 3)
Chapter 9
9. How do organisms, such as humans, get the energy needed for their cells to survive?
10. What are the three reactions, in order, of aerobic (cellular) respiration?
11. How is cellular respiration different from fermentation?
12. What is the equation for cellular respiration?
13. What does aerobic mean? What does anaerobic mean? How do these terms relate to respiration
and fermentation?
14. How would you describe the relationship of photosynthesis and respiration? What affects
do they have on each other and the environment?
15. What organelle is responsible for carrying out respiration?
16. What is the first step in both cellular respiration and fermentation? What occurs during
this first step?
17. What follows glycolysis if oxygen is present? If it is absent?
18. During cellular respiration, how much ATP (approximately) is netted from each glucose?
19. What are the two main types of fermentation? What are their byproducts?
Chapter 10
20. How does diffusion affect large and small cells? How is this involved in cell division?
21. What is mitosis? What is the end result of mitosis?

22. What are chromosomes? Where are they found? When are they visible?
23. What are structures B in this diagram? What is structure A?

24. What are the phases of mitosis in order? What happens during each?
25. How does the number of chromosomes in the parent cell compare to the number of
chromosomes in the daughter cells during mitosis? How is this possible?
26. What is happening during stage “d” of the diagram

27. What is occurring during stage “a” of the diagram?

28. What stage is represented by the letter “b?” How about “e?”

29. What is shown in figure A above? What causes this?

Unit 5: Ch. 11-15 – Genetics & DNA
Chapter 11
30. What are genes? What are alleles? How are they different? Same?
31. What does homozygous mean? Heterozygous?
32. A breed of chicken shows codominance for feather color. One allele codes for black
feathers, another codes for white feathers. What color would a heterozygous chicken be?
33. What is diploid? What is haploid? Which is N? Which is 2N?
34. What is formed during meiosis? What can you say about the number of chromosomes in
the daughter cells at the end?
35. What phenotype would you expect to see in all of the offspring in the punnet square

shown here?
36. How many alleles do you get from each parent?

37. What process is shown here?

38. How many cells are formed at the end of meiosis? Are they identical?
39. Chapters 12 & 13

40. What structure/molecule is shown here? What is its shape?

41. What are the three parts of a nucleotide?
42. During replication, a DNA Polymerase reads the following DNA strand. Write in the
complementary strand that the DNA Polymerase would assemble.
43. ACTTGCGACGCGAGAATTCG
44. Is the strand of nucleic acid shown here DNA or RNA? How can you tell?

45. What are the functions of the three kinds of RNA? (mRNA, tRNA, rRNA)
46. What is protein synthesis? Walk through the steps from start to finish and identify the
molecules involved.
47. What is transcription? What is produced during transcription?
48. Using the key below, identify the amino acids coded for by each of the following codons.

a. GUC
b. CUC
c. UUG
d. UGA
e. UAG

f. UGG
49. What is translation? What is made? Where does it occur?
50. What information is coded for in your genes (DNA)?
51. What is the correct order of the following three terms? RNA, DNA, Proteins
52. What is a mutation?
Chapters 14 & 15

53. What is the probability that a child in humans will be male? Female?
54. Who is more likely to have a sex-linked trait on the X-chromosome? Why?
55. If the pedigree below shows the traits P and p, what is the genotype of individual 1?
Individual 3? Individual 8?

56. How many generations are shown in the pedigree above?

57. What is seen in this diagram?
58. What was the human genome project?
59. What is genetic engineering?
60. What is DNA fingerprinting and how does it work?
Unit 6: Ch. 16-19 - Evolution and Classification
Chapters 16-17
61. What is a gene pool?

62. What is a vestigial structure? What is a homologous structure? How are the two
similar/different?
63. How did Charles Darwin define fitness? How does that apply to natural selection?
64. What is a common ancestor? Why did Darwin claim all finches on the Galapagos came
from a common ancestor? How does this support evolution?