Block-04 Environmental Cytotoxicity and Genotoxicity

ignou MEV-004
THE PEOPLE'S
UNIVERSITY Environmental
Indira Gandhi National Open University
School of Interdisciplinary and Toxicology
Trans-disciplinary Studies
ENVIRONMENTAL CYTOTOXICITY
AND GENOTOXICITY 4
MEV-004
Environmental Toxicology
Indira Gandhi National Open University
School of Interdisciplinary and
Trans-disciplinary Studies
Block
4
ENVIRONMENTAL CYTOTOXICITYAND
GENOTOXICITY
UNIT 1
Carcinogenicity 5
UNIT 2
Mutagenicity 20
UNIT 3
Teratogenesis 33
UNIT 4
Cytotoxicity and Genotoxicity Prevention 45
Tessa Media & Computers

4th Proof on 21/01/2019
PROGRAMME DESIGN AND EXPERT COMMITTEE
Dr. (Ms.) Shyamala Mani Dr. Rachna Agarwal Dr. Sushmitha Baskar Dr. Deeksha Dave
Professor, National Institute of Urban School of Vocational Education and Environmental Studies Environmental Studies, School
Affairs (NIUA) India Habitat Centre Training, Indira Gandhi National School of Interdisciplinary and of Interdisciplinary and Trans-
New Delhi Open University, Trans-disciplinary Studies disciplinary Studies,
New Delhi Indira Gandhi National Open Indira Gandhi National Open
Prof. R. Baskar University, New Delhi University, New Delhi
Department of Environmental Science Prof. Daizy R Batish
& Engineering, Guru Jambheshwar Department of Botany, Panjab Prof. Ruchika Kuba Dr. Shubhangi Vaidya
University of University, Chandigarh School of Health Sciences, Indira School of Interdisciplinary and Trans-
Science & Technology, Hisar Haryana Gandhi National Open University, disciplinary Studies, Indira Gandhi
Prof. M. Krishnan New Delhi National Open University
Prof. H.J. Shiva Prasad Vice Chancellor, Madurai Kamraj New Delhi
Professor of Civil Engineering University, Madurai, Tamil Nadu Prof. Nandini Sinha Kapur
College of Technology, G.B. Pant School of Interdisciplinary and Dr. Y.S.C. Khuman
University of Agriculture & Technology Dr. Chirashree Ghosh Trans-disciplinary Studies, School of Interdisciplinary and
Pant Nagar, Uttarakhand Department of Environmental Indira Gandhi National Open Trans-disciplinary Studies, Indira
Studies, University of Delhi, University, New Delhi Gandhi National Open University
Dr. T.K. Joshi New Delhi New Delhi
Director, Occupational & Dr. Shachi Shah
Environmental Programme, Centre Mr. Ravi Agarwal Environmental Studies,
Director, Toxic Link, Jangpura Dr. Sadananda Sahoo
for Occupational & Environmental School of Interdisciplinary and School of Interdisciplinary and
Health, Maulana Azad Medical Extension, New Delhi Trans-disciplinary Studies Trans-disciplinary Studies, Indira
College, New Delhi Prof. Jaswant Sokhi Indira Gandhi National Open Gandhi National Open University
School of Sciences, Indira Gandhi University, New Delhi New Delhi
Prof. Nilima Srivastava
School of Gender and Development National Open University, Dr. V. Venkat Ramanan
Studies, Indira Gandhi National Open New Delhi Environmental Studies
University, New Delhi Dr. B. Rupini School of Interdisciplinary and
Environmental Studies, School Trans-disciplinary Studies
Prof. S.K. Yadav Indira Gandhi National Open
School of Agriculture of Interdisciplinary and Trans-
disciplinary Studies, Indira Gandhi University, New Delhi
Indira Gandhi National Open
University, New Delhi National Open University, New Delhi
BLOCK PREPARATION TEAM

Unit 1 Unit 2 Unit 3 Unit 4
Dr. Maneesha Pandey Prof. M.V. Usha Rani, Retd Dr. Sushmitha Baskar Dr. Tanu Jindal, DirectorAmity Institute of
Professor, Department of Environmental Studies, Environmental Sciences, Environmental Toxicology
Biochemistry, School of
SOITS, IGNOU, Safety and Management Amity University, NOIDA
Sciences, IGNOU, New Delhi Environmental Sciences, Dr. Khushbu Gulati
Bharathiar University, New Delhi
Research ScientistAmity Institute of Environmental
Coimbatore, Tamil Nadu Toxicology Safety and Management Amity University,
NOIDA
PROGRAMME COORDINATORS
Dr. B. Rupini Dr. Sushmitha Baskar Prof. Ruchika Kuba
Environmental Studies, School of Interdisciplinary Environmental Studies, School of Interdisciplinary School of Health Sciences, Indira
and Trans-disciplinary Studies, Indira Gandhi and Trans-disciplinary Studies, Indira Gandhi Gandhi National Open University,
National Open University, New Delhi National Open University, New Delhi New Delhi
COURSE COORDINATOR CONTENT EDITORS

Dr. Sushmitha Baskar, Prof. M. Krishnan, Vice Chancellor, Madurai Kamaraj University, Madurai, Tamil Nadu.
Environmental Studies, Prof. M.V. Usha Rani, Retd Professor, Department of Environmental Sciences, Bharathiar
SOITS, IGNOU, New Delhi University, Coimbatore, Tamil Nadu.
Dr. B. Rupini, Environmental Studies, IGNOU, New Delhi
Dr. Sushmitha Baskar, Environmental Studies, SOITS, IGNOU, New Delhi
Prof Ruchika Kuba, School of Health Science, IGNOU, New Delhi
FORMAT EDITORS
Dr. B. Rupini Dr. Sushmitha Baskar
Environmental Studies, School of Interdisciplinary and Environmental Studies, School of Interdisciplinary and Trans-
Trans-disciplinary Studies, Indira Gandhi National Open disciplinary Studies, Indira Gandhi National Open University,
University, New Delhi New Delhi
Secretarial/Technical Assistance: Ms. Sonali, SOITS, IGNOU, New Delhi; Mr. Vikram, SOITS, IGNOU, New Delhi
PRINT PRODUCTION
Mr. S. Burman Mr. Sudhir
Mr. Y. N. Sharma
Deputy Registrar (P), IGNOU, New Delhi Asst. Registrar (P), IGNOU, New Delhi Section Officer (P) IGNOU, New Delhi
February, 2019
 Indira Gandhi National Open University, 2019
ISBN: 987-88-88498-90-6
All rights reserved. No part of this work may be reproduced in any form, by mimeograph or any other means, without permission in writing from the
Copyright holder.
Further information on the IGNOU courses may be obtained from the University’s office at Maidan Garhi, New Delhi or the official website of IGNOU
at www.ignou.ac.in
Printed and published on behalf of IGNOU, New Delhi by Registrar, MPDD, IGNOU, New Delhi.
Laser Typeset by Tessa Media & Computers, C-206, A.F.E.-II, Okhla, New Delhi.
Printed at:
INTRODUCTION TO BLOCK 4
This block focuses on the environmental cytoxicity and genotoxicity. Cytotoxicity
and genotoxicity develops as a function of age, environment and genetic makeup
of the host. They can be caused by viruses, radiation and by chemicals. Mutagens
and teratogens are also associated with lifestyle, diet and environment. The block
describes in detail carcinogens, mutagens, teratogens, their classes and mode of
action. Finally the block focuses on the prevention of the same and screening for
cyto and genotoxicity.
Unit 1 deals with carcinogenicity. The terms such as pro-carcinogens, carcinogens

have been explained. The unit also gives an account of the various classes of
carcinogens and the mechanism of carcinogenesis. Cancer is the second most
fatal disease next after cardiovascular diseases and a major cause of suffering
and death. The unit also explains that a chemical substance may be genotoxic if
it possesses the ability to interact with DNA and/or the cellular apparatus and
thereby altering the integrity of the genome.
Unit 2 deals mutagenecity. Mutagens are agents that bring about changes in the
DNA and they are genotoxic in nature. The unit discusses that mutagens affect
the transcription and replication of the DNA and also lead to cellular death. It
also explains that certain mutagenic agents exert their mutagenic effect through
their metabolites and that powerful mutagens may result in chromosomal
instability, causing chromosomal breakages and rearrangement of the
chromosomes such as translocation, deletion, and inversion.
Unit 3 deals with teratogenecity. The unit explains that certain toxic substances
can penetrate the placental barrier and bring about birth defects with
malformations in the developing embryo and foetus causing teratogeneic effects.
The unit describes the effects of teratogens that cause mental retardation, paralysis
of the limbs, congenital heart defects, cleft palate, visual and auditory disturbances.
Finally the unit summarizes the teratogenic drugs and mechanisms of action.
Unit 4 deals with the cytotoxicity and genotoxicity prevention. The unit discusses
the screening methods like in vitro and in vivo toxicology testing, bioassay,
biomarkers, biosensors, bacterial mutagenesis, gene mutation chromosome
damage and DNA damage and repair assays and their usefulness in prevention
of cytotoxicity and genotoxicity.
Environmental Cytotoxicity
and Genotoxicity
4
Carcinogenicity
UNIT 1 CARCINOGENICITY
Structure
1.0 Introduction
1.1 Objectives
1.2 Carcinogens
1.3 Classes of Carcinogens
1.3.1 Physical Carcinogens
1.3.2 Biological Carcinogens
1.4 Carcinogenesis
1.4.1 Chemical Carcinogenicity
1.4.2 Etiology
1.4.3 Mechanism of Action
1.5 Let Us Sum Up
1.6 Key Words
1.7 References and Suggested Further Readings
1.8 Answers to Check Your Progress
1.0 INTRODUCTION
Cancer is a major cause of suffering and death. It is the second most fatal disease
next after cardiovascular diseases. Cancer develops as a function of age,
environment and genetic makeup of the host. According to an estimate 5% of
human cancers are caused by viruses, 5% by radiation and rest 90% by chemicals.
Of these, an estimated 30% are caused due to the use of tobacco products and
rest by chemicals associated with lifestyle, diet and environment.
In this unit you will study about carcinogens and carcinogenesis. Agents/chemicals
which can induce tumors are known as carcinogens while carcinogenesis is the
process of development of cancer. A cancerous cell possesses the ability of
uncontrolled cell proliferation. It is a multi-step process where suddenly a normal
cell turns into a rogue cell and starts dividing continuously leading to the
development of tumours (solid lumps) or dispersed cells (blood cells). You will
study in detail the etiology of cancer as well as the mechanism how carcinogens
work to induce cancer. In the preceding sections you will learn about various
classes of carcinogens.
Marginal Remarks: In their 60s human beings face an exponentially increased

risk of developing cancer. Approximately 70% of deaths from cancer occur in
low- and middle-income countries.
Marginal Remarks: Around one-third of deaths from cancer: high body mass
index, low fruit and vegetable intake, lack of physical activity, tobacco and alcohol
use.
5
and Genotoxicity 1.1 OBJECTIVES
After studying this unit you should be able to:
 define cancer and carcinogens;
 classify carcinogens;
 identify carcinogens;
 explain the etiology of cancer; and
 discuss the mechanism of action of chemical carcinogens.
1.2 CARCINOGENS
Any chemical substance or mixture of chemical substances which induce cancer
or increase its incidence are termed as “carcinogens”. Inhalation, ingestion,
application or injection of these carcinogens induce malignant tumours or increase
their incidence or shorten the time of tumor occurrence. Cancer is also known to
be caused due to changes in cell’s DNA. Some of these changes may be hereditary.
Others may be caused due to environmental factors like wide range of exposures
to our lifestyle (nutrition, tobacco, physical activity), naturally occurring exposures
(ultra violet light, radon gas, infectious agents), medical treatments (radiations,
chemotherapy, hormonal drugs, immumo suppressive drugs), workplace
exposures (occupational hazards), pollution and household exposures.
MR: carcinogenesis defines the initiation of a tumor, while oncogenesis defines

its maintenance and subsequent evolution.
Carcinogens can be categorized in many ways. Weisburger in 1976 distinguished

carcinogens into three classes depending on the mechanism of action of the
chemical substance.
1) Direct Action or Ultimate Carcinogens

Direct action or ultimate carcinogens are those whose structure confers them
the capacity to induce cancer without a previous metabolic activation in the
host organism. This category includes nitrosamines, epoxides, ethylene
imines and â-propiolactone.
2) Procarcinogens
Procarcinogens includes the majority of chemical carcinogens which are
initially non-carcinogenic but become active after metabolic processes i.e.
become active only when it is metabolized in an organism. Some of the
known procarcinogens are aminozoic colorants, aromatic hydrocarbons,
aflatoxins, aromatic amines and urethane.
6
3) Co-carcinogens Carcinogenicity
Co-carcinogens are chemical substances that have a helper role in

carcinogenesis. They cannot induce cancer when they are present alone, but
can enhance the carcinogenic effect of other substances. In general, co-
carcinogens act as promoters in tissues where the initiation stage appears.
Some of the co-carcinogens which help in promotion of cancer are certain
viruses, tar, pesticides, hair dyes, tobacco, alcohol etc.
Now you know the difference between a carcinogen, pro-carcinogen and co-
carcinogen is known. In the next section you will study about various classes of
carcinogens.
1.3 CLASSES OF CARCINOGENS

Carcinogens can be classified in many ways, depending on its nature of action or
where it acts, potential and so on. One of the ways of categorizing carcinogen
could be whether it is genotoxic or non-genotoxic. A chemical substance may
be genotoxic if it possesses the ability to interact with DNA and/or the cellular
apparatus, thereby altering the integrity of the genome. Non-genotoxic carcinogens
do not interact directly with DNA and enhance tumor progression by affecting
gene expression or cell proliferation.
Based on their cancer causing potential International Agency for Research on

Cancer (IARC) which is a part of World Health Organization (WHO) has
classified only a little over 100 chemicals as “carcinogenic to humans”. One of
the major goals of IARC is to identify carcinogens and classify them. In the past
30 years, the IARC has evaluated the cancer-causing potential for more than 900
likely candidates, placing them into one of the following groups:
 Group 1 : Carcinogenic to humans
 Group 2A : Probably carcinogenic to humans
 Group 2B : Possibly carcinogenic to humans
 Group 3 : Unclassifiable as carcinogenic in humans
 Group 4 : Probably not carcinogenic to humans
According to United States National Toxicology Program’s (US NTP) Report
on Carcinogen (RoC) in the year 2012 classifies carcinogens into two categories
 Known to be human carcinogens
 Reasonable anticipated to be human carcinogens
United States Environmental Protection Agency (US EPA) maintains the
Integrated Risk Information System (IRIS), an electronic database that contains
information on human health effects from exposure to certain substances in the
environment. The EPA uses a rating system similar to that of IARC when
describing the cancer-causing potential and has also classified carcinogens into
five groups.
 Group A: Carcinogenic to humans
 Group B: Likely to be carcinogenic to humans
 Group C: Suggestive evidence of carcinogenic potential 7
Environmental Cytotoxicity  Group D: Inadequate information to assess carcinogenic potential
and Genotoxicity
 Group E: Not likely to be carcinogenic to humans
The IARC Monographs identify environmental factors that can increase the
risk of human cancer. These include chemicals, complex mixtures,
occupational exposures, physical agents, biological agents, and lifestyle
factors. Some of the Group I potential carcinogens are:
Alcoholic beverages, Asbestos (all forms, including actinolite, amosite,
anthophyllite, chrysotile, crocidolite, tremolite), Aflatoxins, Areca nut,
Beryllium and beryllium compounds, Cadmium and cadmium compounds,
Coal-tar distillation, Cyclosporine, Benzene, Ethylene oxide, Betel quid with
tobacco, Betel quid without tobacco, Coal gasification, Coal (indoor
emissions from household combustion), Coke production, Engine exhaust
(diesel), Ethanol in alcoholic beverages, Estrogen therapy (postmenopausal),
Estrogen-progestogen oral contraceptives (combined), Helicobacter
pylori (infection with), Hepatitis B virus (chronic infection with), Hepatitis
C virus (chronic infection with), Human papillomavirus types 16, 18, 31,
33, 35, 39, 45, 51, 52, 56, 58, 59, Ionizing radiation (all types), Leather
dust, lindane, Mineral oils, untreated or mildly treated, Outdoor air pollution
(particulate matter in), Painter (occupational exposure as a), Phenacetin,
analgesic mixtures containing, Polychlorinated biphenyls, Processed meat
(consumption of), Rubber manufacturing industry, Processed meat
(consumption of), Soot (as found in occupational exposure of chimney
sweeps), Ultraviolet radiation (wavelengths 100-400 nm, encompassing
UVA, UVB, and UVC), Wood dust, X- and Gamma-Radiation and many
more.
Carcinogenic factors or carcinogens may also be classified as physical or

biological factors. Let us study about these factors briefly.
1.3.1 Physical Carcinogens

Physical carcinogens include radiation and non-radiation. Radiation includes
both ultra violet (UV) light and ionizing radiation. Both the forms of radiation
are implicated in causation of some forms of human cancers. In both the cases
there is an appearance of mutation followed by a long period of latency after
initial exposure which may be as long as 10 to 20 years or more. These radiations
not only act as carcinogens (mutagens) but also act as co-carcinogens and may
enhance the effect of carcinogens during the sequential stages of initiation,
promotion and progression of the tumor.
UV radiation exerts its effect on cells by induction of mutation, inhibition of

cell division, inactivation of enzymes, DNA damage and cell death. UV radiations
of wavelength about 3000 Angstrom mainly cause skin cancers. It penetrates the
skin for few millimeters, so its effect is limited to epidermis. The efficiency of
UV as a carcinogen depends upon the extent of light absorbing protective melanin
pigment of the skin.
Ionizing radiations (X-rays, alpha, beta, and gamma rays, radioactive isotopes,
protons and neutrons) may directly alter cellular DNA resulting in mutagenesis,
8
may cause chromosomal breakage, translocation or point mutations. It may also Carcinogenicity
dislodge ions of water and other molecules of cell resulting into formation of
reactive free radicals that may bring about damage. It can frequently cause
leukemia and cancers of thyroid, skin, breast, ovary, uterus, lung, and salivary
glands.
Non-radiation carcinogens Injury from stones in gall bladder or urinary tract,

healed scars following burns and tumors have been suggested as a cause of
increased risk of carcinoma in the tissues. Other causes can be asbestosis and
asbestos associated tumors of lung, implants of foreign inert materials like plastic,
glass etc. in prosthesis. However, currently the evidences are not very convincing
as far as implants are concerned.
1.3.2 Biological Carcinogens

Several transmissible biological agents are known to be involved in development
of cancer. These include parasites, fungus, bacteria, and viruses. However, the
role of viruses is more significant in causation of cancer. It has been estimated
that around 20% of all the cancers worldwide are caused due to persistent virus
infection.
Infection by a parasite Schistosoma haematobium, is associated with carcinoma

of urinary bladder, Clonorchis sinensis, a liver fluke cause’s cholangio-carcinoma,
cancer of the bile duct.
Aspergillus flavus and Aspergillus parasiticus, fungus best known for its
colonization of cereal grains and legumes liberate significant quantities of toxic
compounds generally termed as mycotoxins (Example Aflatoxin. Aflatoxins are
poisonous and carcinogenic. Consumption of aflatoxins is associated with
development of hepatocellular carcinoma.
Many bacteria have also been reported as causal organism for cancer. Helicobacter
pylori (H pylori) can cause ulcers and lead to stomach cancer. Salmonella typhi
is associated with gall bladder cancer, Streptococcus bovis with colorectal cancer,
Chlamydia pneumoniae with lung cancer and so on. However Salmonella
typhi has also been found useful in delivering chemotherapeutic agents for the
treatment of melanoma, colon and bladder cancer.
Viruses as cancer causing agents have been divided into two groups: DNA
oncogenic viruses and RNA oncogenic viruses. Both these viruses may induce
mutation in the target host cell. RNA viruses (e.g. HIV, HCV) generally have
very high mutation rate than DNA viruses. However, viral infection alone is not
responsible for oncogenesis, yet it is one of the steps of a multi step process of
cancer development. Viral infections may be a primary viral infection in which
the infection lasts for few days to few weeks and are generally cleared by host
immune system or persistent/ latent viral infection which may occur by acquiring
mutation in viruses which resist host’s immune attack or virus itself induces
immune-suppression in the host such as HIV. Table 1.1 gives an overview of
various causal agents categorized into different sub groups.
9
Environmental Cytotoxicity Table 2.1: Various types of Carcinogens
and Genotoxicity
Radiation Infectious Chemicals Dietary/ Lifestyle
UVlight Virus Occupational Fat
X-ray HPV Arsenic Calorie
Gamma-ray HIV Asbestos Low fiber
Nuclear HCV Coal tars
EBV Soot
KSHV Benzene
HEP B/C Vinyl chloride
Bacteria Alcohol
H. pylori
C. psittaci
Fungus Tobacco
A. flavus Parasite
Schistosoma
Clonorchis
MR: DNA oncogenic viruses: DNA is the genetic material

RNA oncogenic viruses: RNA is the genetic material
MR: Three common routes for most of the viral infections including oncogenic
viruses: direct contact with one another, inoculation from animals/insects to
humans and transmission of infection from parents to offsprings (oncogenic
viruses and retro-viruses).
Apart from these biological agents, there are many other factors that also
contribute to carcinogenesis. For example, age, hormonal status, family history,
diet and lifestyle. Generally prostate cancer occurs at the age of 50-55 years.
Females in their peri- and post – menopausal ages are prone to the cervix cancer.
Although no age group is immune to this disease yet hormonal factors play a
significant role in gender specific cancers. Also, having a family history adds to
the risk of developing cancers. It has been found that females run about 3 time
higher risk of developing breast cancer if either of their relatives like mother,
sister, grandmother or maternal aunt has suffered. Similar is the case with cervix
and prostate cancer.
Individuals who are more into deep-fried and preserved foods (high salt) are
prone to the incidence of gastric cancer. Similarly, regular consumption of diet
low in fiber content and high in animal fat increases the risk of stomach and
oesophageal cancer. It has also been reported that high fat diet and obesity has
positive correlation with breast cancer.
10
Check Your Progress 1 Carcinogenicity
1) Tick [] mark the correct option

1) Which of the following are the characteristics of a typical cancer cells?
a) cancer cells lack contact inhibition
b) cancer cells induce angiogenesis
c) cancer cells lack differentiation
d) All the above are correct
2) ................................is a cancer-causing gene
a) Oncogene
b) Mutagen
c) Antigen
d) Antibody
3) An agent or chemical substance that causes cancer is a/an:
a) Carcinogen
b) Mutagen
c) Oncogene
d) None of the above
4) Which of the following is NOT an environmental carcinogen?
a) Radiation
b) High fibre food
c) Viruses
d) Certain organic chemicals
5) Naturally occur carcinogens include
a) Asbestos
b) Certain dioxins
c) Aflatoxin
d) Aniline dyes
6) What DNA virus has been linked to a type of human cancer?
a) Hepatitis B virus
b) Human papilloma virus
c) Epstein-Barr virus
d) All the above are correct.
1.4 CARCINOGENESIS
In the previous section you studied about various ways of classifying carcinogens vis-
à-vis potency, state or mode of action; let us now study about the mechanisms behind
carcinogenesis. Firstlywe will deal with chemical carcinogens and their mode of action.
Carcinogenesis is a process of development of cancer. During the cancer development
unlimited and uncontrolled cell division occur which leads to the formation of malignant 11
Environmental Cytotoxicity tumor. Uncontrolled cell division may occur due to mutation of DNAin cells or may
and Genotoxicity
be due to imbalance between cell proliferation and cell death resulting into cancer.
Earlier it was believed that all cancers arose from viral genes that are contained in
normalcells. These viralgeneswhen get activatedbychemicalcarcinogens andradiation
result in cancer. It was believed that many cells harbor latent retroviruses and that
these viruses are activated by carcinogens. However, it may be the case for some
cancers but after many years of trying to prove this hypothesis, strong support has
never been obtained.
1.4.1 Chemical Carcinogenicity

Carcinogenicity may be explained as the potential of a chemical molecule/carcinogen
to cause cancer. The induction of chemical carcinogenesis usually occurs after several
years in humans. It is not that once we come in the contact of a potent carcinogen; it
will immediately lead to cancer. Rather, it is largely influenced by the dose and mode
of administration as well as various pre-disposing factors.
Manycarcinogens are proved mutagens which suggest that a carcinogen might act by
causing a mutation in a proto-oncogene, thereby converting it to an oncogene. Basic
mechanism of chemical carcinogenesis is by induction of mutation in the proto-
oncogene and/or anti-oncogene (tumor suppressor gene).
In the previous section while studying classification, you have read that carcinogens
are classified according to their mode of action as genotoxic or non-genotoxic
carcinogens. Genotoxic carcinogens exert their carcinogenicity by direct interaction
with DNA, resulting in DNA damage or chromosomal aberrations. Non-genotoxic
carcinogens do not directly interact with DNA and are believed to enhance tumor
development byaffecting gene expression, signal transduction, and/or cell proliferation
i.e. they act by indirect or epigenetic mechanisms.
Genotoxic Carcinogens
 Direct action
 Pro-carcinogen
 Inorganic Carcinogen
Non-Genotoxic Carcinogens
 Solid state carcinogen
 Hormones
 Immunosuppression
Depending upon the mode of action chemical carcinogenicity can be divided into two
broad categories: chemical carcinogens as initiators and chemical carcinogens as
promoters.
Initiator Carcinogens: Chemical carcinogens which initiate the process of neoplastic
transformation are further divided into two subgroups:
i) Direct acting carcinogens/ pro-carcinogens: These do not require metabolic
activation and include:
12
a) Alkylating agents: These are mainly anti-cancer drugs (busulfan, Carcinogenicity
chlorambucil, cyclophosphamide, melphalan, nitroso urea etc.), beta-
propiolactone and epoxides. They are weakly carcinogenic and are
implicated in the etiologyof Leukemias and Lymphomas in humans;
b) Acylating agents: They include acetyl imidazole and dimethyl carbamyl

chloride.
ii) Indirect acting carcinogens/pro-carcinogens: These require prior metabolic

activation before becoming potent or an ‘ultimate’ carcinogen. This group
includes four categories:
a) Polycyclic aromatic hydrocarbons: They are one of the largest groups
of common pro-carcinogens. Theycause varying effects byvarious modes
of administration. For example, topical applications mayinduce skin cancer,
subcutaneous injection may cause sarcomas, inhalation produces lung
cancer, parenteral administration or administration through metabolizing
routes can cause cancer of the related organ and so on. The main sources
of polycyclic aromatic hydrocarbons are combustion and chewing of
tobacco, fossil fuel (for example coal), industrial and atmospheric pollutants,
mineral oil, smoke, smoked animal foods, soot and tar. Important chemical
compounds included in this group are anthracenes, benzapyrene and
methylclolanthrene.
b) Aromatic amines and azo-dyes: Azo dyes used for coloring foods (for
example butter and cherries) may be implicated in causation of hepato-
cellular carcinoma. Beta-naphthylamine cancause bladder cancer especially
in rubber industry workers.
c) Naturally occurring products: Aflatoxins derived from the fungus
Aspergillus flavus (that grows in stored grains and plants) is known to
cause hepatocellular carcinoma especiallywhen concomitant viral Hepatitis
B is present.
d) Miscellaneous products: Manyother chemical also have a role in etiology
of human cancer. For example, arsenic compounds in causing epidermal
hyperplasia and basal cell carcinoma; asbestos in bronchogenic carcinoma
and mesothelioma especially in smokers; metals like cobalt, chromium,
lead and nickel are known to cause lung cancer in industrial workers, and
so on. Nitrosoamines and nitrosoamides that are produced in stomach by
nitrosylationoffood preservativesare involvedin causinggastric carcinoma,
and vinyl chloride monomers derived from Poly Vinyl Chloride (PVC)
can cause haemangio-sarcoma of liver to name the few.
Chemicals like insecticides, fungicides, saccharin and cyclomates are known to induce
cancer in the experimental animals.
Promoter Carcinogens: These chemicals lack the intrinsic carcinogenic potential

but their applications subsequenttoinitiator exposure helps the initiatedcell toproliferate.
These substances include phorbol esters (known to be a promoter in experimental
animals, certain hormones (endogenous and exogenous administration of excess
13
Environmental Cytotoxicity oestrogen) in promotion of endometrium and breast cancer, prolonged administration
and Genotoxicity
of diethylstilbestrol in the etiology of postmenopausal endometrial carcinoma and in
vaginal cancer in younggirls born to mothers exposed to this hormone duringpregnancy.
Sometimes, dietary fats can also cause colon cancer. Even cigarette smoke, phenols,
certain drugs and viral infections can act as promoter carcinogens. Let us have look at
table 1.2 to understand some of the contrasting characteristics of initiator and promoter
carcinogens.
Table 1.2: Characteristic features of Initiator and Promoter Carcinogens
S.No Feature Initiator Carcinogens Promoter Carcinogens

1 Mechanism Mutagenic; electrophile Non-Mutagenic; No
production and covalent electrophile production
binding to DNA and do not bind covalently
to DNA
2 Dose Single for a short time, no Repeated dose exposure,
measurable threshold dose for a long time; measurable
threshold dose
3 Response Sudden response Slow response
4 Change Permanent, irreversible May be reversible
5 Sequence Applied first, then followed Applied after prior
by promoter exposure to initiator
6 Effectivity Effective alone if exposed Not effective alone
in large dose
7 Molecular Most common mutation of Clonal expansion of
Changes RAS oncogenes, p53 anti- mutated cells
oncogene
8 Nature of Agents considered as Agents considered as co-
agent carcinogens carcinogens
8 Examples Most chemical carcinogens, Hormones, phorbol ester
radiations
1.4.2 Etiology
You studied about various chemical carcinogens and their carcinogenic effects.
In this section let us study the etiology of cancer. Cancer is a pathologic condition
where clonally expanded cells derived from a common precursor cell get
accumulated. It may occur due to genetic damage or may be acquired as well.
During the past three decades, researches have led to accumulation of an

impressive amount of evidence concerning molecular pathways that when altered
contribute to malignant growth. People are continuously exposed exogenously
to varying amounts of chemicals that have been shown to have carcinogenic or
mutagenic properties in experimental systems. It has been estimated that exposure
to environmental chemical carcinogens may contribute significantly to the
causation of a sizeable fraction, perhaps a majority, of human cancers, when
exposures are related to “life-style” factors such as diet, tobacco use, etc.
14
In the preceding sections you studied about carcinogens, molecules or factors which Carcinogenicity
have the potential to cause cancer. It’s not only a carcinogen rather set of causes that
are responsible for neoplastic transformation and expansion of cancer. To understand
these various reasons behind cancer, let us briefly study some of the theories of
carcinogenesis.
i) Somatic Mutation Theory
The somatic mutation theory (SMT) or gene mutation theory is one of the
prevailing theories in cancer research for the last 50 years. Somatic gene
mutations are widely accepted which is based on the premise that
carcinogen-DNA interaction leads to some irreversible changes in the gene
which may result and trigger malignant transformation. Generally,
carcinogenic process involves alterations of four broad categories of genes:
(1) activation of oncogenes, (2) inactivation of tumor suppressor genes, (3)
evasion of apoptosis gene, and (4) defective DNA repair genes.
Certain genetic alterations (point mutations) in cancer genes accumulate

over time and are considered as “driver” mutations that drive the cancer’s
uncontrolled growth.
ii) Aneuploidy Theory

Aneuploidy hypothesis is currently gaining momentum. According to this
hypothesis, carcinogen initiates carcinogenesis by a preneoplastic
aneuploidy, which destabilizes mitosis. This hypothesis provides a plausible
explanation for the long latent periods carcinogen exposure to cancer
development.
iii) Epigenetic Theory

Epigenetics refers to sudden heritable changes in gene expression that occur
without mutation like post translational modification of histones and DNA
methylation. Histone modification and DNA methylation may lead to DNA
compaction (heterochromatin) and ultimately to gene silencing. Since these
non-mutational changes are sudden yet stable and occur in cellular genome,
may contribute to carcinogenesis.
Although each theory has its own merits, yet in many cases combination of two
or many processes work in cooperation leading to neoplastic cell transformation
and also facilitate promotional changes.

Cancer development is understood to be a multistep process. Berenblum and
Schubik in 1948 proposed the concept of multistage carcinogenesis. Today’s
oncology recognizes three sequential stages of carcinogenesis: initiation,
promotion, and progression. Let us try to understand briefly how a carcinogen
acts to initiate and promote carcinogenesis.
Initiation of Carcinogenesis: It is the first step induced by initiator chemical

carcinogens, the product of which is termed as an “initiated cell”. The change so
induced is sudden, permanent and irreversible. These initiated cells do not appear
as tumor cells, and hence cannot be recognized directly. They reveal themselves
in the subsequent stage known as promotion.
15
Environmental Cytotoxicity In section 1.4 you have studied about the two categories of initiators (chemical
and Genotoxicity
carcinogens).Whether the initiator is direct acting carcinogen (induces cellular
transformation without undergoing any prior metabolic activities) or indirect acting
carcinogen or pro-carcinogen (requires metabolic conversion within the bodyto become
‘ultimate’ carcinogen having carcinogenicity), in both the cases, following steps are
involved in transforming ‘the target cell’ into the ‘initiated cell’:
a) Metabolic activation
b) Reactive electrophiles (direct and indirect acting carcinogens)
c) Target molecules (chieflyDNA)
d) Initiated or mutated cells (permanent DNA damage)
Initiators interact withhostcellular macromolecules andnucleic acids in specific patterns,
typically involving the generation of reactive electrophiles, esters, or free radicals that
bind covalentlyto nucleophilic sites in critical cellular macromolecules. The majorities
of carcinogens have both initiatingand promoting activityand can thus induce neoplasm
rapidlyand in high yield when given repeatedly.
Promotion of Carcinogenesis: Promotion is the next sequential stage in chemical

carcinogenesis. This step causes the ‘initiated cells’ to develop into ‘tumor cells’
that replicate to yield gross tumors. Although, promotion is often considered to
be a single stage, it requires a prolonged period and probably comprises more
than one process. Promoters include agents such as drugs, plant products and
hormones that do not damage or interact directly with host cellular DNA (are not
genotoxic or mutagenic) but somehow influence the expression of genetic
information encoded in the cellular DNA or indirectly enhance the effect of direct
acting carcinogens or pro carcinogens. It is also known that promoting agents
may cause gene repression and de-repression in cells.
Progression of Carcinogenesis: Progression of cancer is the stage when

proliferated and mutated cells show phenotypic features of malignancy. Such
features appear only when the initiated cells start to proliferate rapidly and in the
process acquire more and more mutations. The new progeny of cell that finally
develop after repetitive proliferations inherit genetic and biochemical
characteristics of malignancy, such as excessive growth, invasiveness and distant
metastasis.
Check Your Progress 2
Note: a) Write your answer in about 50 words.
b) Check your progress with possible answers given at the end of the
unit.
1) What is the correct order of steps in carcinogenesis
a) promotion, intitiation, progression
b) progression, promotion, initiation
c) initiation, progression, promotion
d) initiation, promotion, progression
2) Differentiate between initiator carcinogen and promoter carcinogen.
16
..................................................................................................................... Carcinogenicity
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
3) What are the various steps involved in transforming ‘the target cell’ into the
‘initiated cell’
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
1.5 LET US SUM UP

a) Cancer is the second most fatal disease next after cardiovascular diseases
and a major cause of suffering and death. It develops as a function of age,
environment and genetic makeup of the host. Fundamental cause of all
cancers is genetic damage (changes in cell’s DNA) which may be congenital
or acquired (caused due to environmental factors like wide range of exposures
to our lifestyle viz. nutrition, tobacco, or naturally occurring exposures).
b) A cancerous cell possesses the ability of uncontrolled cell proliferation. It is

a multi-step process where suddenly a normal cell turns into a rogue cell
and starts dividing continuously leading to the development of tumours
(solid lumps) or dispersed.
c) Agents/chemicals which can induce tumors are known as carcinogens.

Carcinogens can be further divided into three types: direct action or ultimate
carcinogens, procarcinogens and co-carcinogens. Certain viruses, tar,
pesticides, hair dyes, tobacco, alcohol are known co-carcinogens which help
in promotion of cancer.
d) International Agency for Research on Cancer (IARC) which is a part of

World Health Organization (WHO) has classified over 100 chemicals as
“carcinogenic to humans”. Other ways of categorizing carcinogen could be
whether it is genotoxic or non-genotoxic. A chemical substance may be
genotoxic if it possesses the ability to interact with DNA and/or the cellular
apparatus and thereby altering the integrity of the genome. Non-genotoxic
carcinogens do not interact directly with DNA and enhance tumor
progression by affecting gene expression or cell proliferation.
e) Carcinogens may also be classified as physical or biological factors. Physical

carcinogens include radiation and non-radiation carcinogens. Radiation includes
both ultra violet UV radiation and Ionizing radiations (X-rays, alpha, beta, and 17
Environmental Cytotoxicity gamma rays, radioactive isotopes, protons etc). Biological Factors include
and Genotoxicity
parasites, fungus, bacteria, and viruses.Apart from these biological agents, there
are many other factors that also contribute to carcinogenesis. For example, age,
hormonal status, familyhistory, diet and lifestyle.
f) Carcinogenesis is a process of development of cancer. Cancer development is

understood to be a multistep process. The three sequential stages of carcinogenesis
are initiation, promotion, and progression.
1.6 KEY WORDS

Carcinogen : Chemicals/ agents which can induce cancer.
Epigenetics : Refers to sudden heritable changes in gene expression that occur
without mutation like post translational modification of histones
and DNA methylation.
Genotoxic : A chemical substance may be genotoxic if it possesses the ability
to interact with DNA and/or the cellular apparatus and thereby
altering the integrity of the genome.
Mutagen : Any physical or chemical agent that changes the genetic material,
usually DNA and thus increases the frequency of mutations or
anything that causes a mutation (a change in the DNA of a cell).
Oncogene : An oncogene is a gene that has the potential to cause cancer when
mutated or expressed at abnormally-high levels.
1.7 REFERENCES AND SUGGESTED FURTHER

READINGS
David E. Malarkey, Mark Hoenerhoff, Robert R. Maronpot Haschek and
Rousseaux. 2013. Carcinogenesis: Mechanisms and Manifestations. In
Eds. Wanda M. Haschek, Colin G. Rousseaux and Matthew A. Wallig,
Handbook of Toxicologic Pathology, Third Edition, 2013, 107–146.
Environmental Protection Agency (EPA): www.epa.gov/iris
International Agency for Research on Cancer (IARC). 2015. Agents classified
by the IARC Monographs, Volumes 1-114.
Weisburger JH. 1976. Environmental cancer. J.Occupat. Med. 18: 245–252.

US Department of Health and Human Services. 2016. Public Health Service,
National Toxicology Program. Report on Carcinogens, 14th Ed.
1.8 ANSWERS TO CHECK YOUR PROGRESS

Answers to Check Your Progress 1
1) d, 2) a, 3) a, 4) c, 5) c, 6) d.
1) d,
18
2) Initiators carcinogens are those carcinogens which initiate the process of neoplastic Carcinogenicity
transformation and do not require metabolic activation, for example Alkylating
agents like busulfan, cyclophosphamide, epoxides, etc. Promotor carcinogens
lackthe intrinsic carcinogenic potentialbut their applicationssubsequent to initiator
exposure helps the initiated cell to proliferate. For example phorbol esters, certain
hormones (endogenous and exogenous administration of excess oestrogen) in
promotion of endometrium and breast cancer, etc.
3) Steps involved in transforming ‘the target cell’ into the ‘initiated cell’ are:
1) Metabolic activation
2) Reactive electrophiles (direct and indirect acting carcinogens)
3) Target molecules (chiefly DNA)
4) Initiated or mutated cells (permanent DNA damage)
19
and Genotoxicity UNIT 2 MUTAGENICITY
Structure
2.0 Introduction
2.1 Objectives
2.2 Effects of Mutagens
2.3 Types of Mutations
2.4 Origins of Spontaneous Mutations
2.5 Mutagens
2.6 DNA Repair Systems
2.7 Let Us Sum Up
2.8 Key Words
2.0 INTRODUCTION
Mutation is any heritable change in the genetic material. It is significant in higher
organisms where mutations can occur both in the gametes (germline mutations)
and in body cells (somatic mutations). Mutations are important in several ways.
They are important to geneticists as the genetic variants possess mutant alleles
of the genes. They are also important in genetic variation which fuels evolutionary
change. Mutations are some changes that take place in our DNA sequence. This
may be due to some mistakes when the DNA is copied or due to certain factors
in the environment. These factors may be UV light, chemicals, food additives,
cigarette smoke and so on. The changes that occur in our DNA are in the sequence
of bases of adenine (A), cytosine (C), guanine (G) and thymine (T). These changes
can alter the protein formation in our systems. Mutations can also be inherited
through generations. One example is that of sickle cell anaemia. It is caused due
to a mutation in the gene that directs the protein formation of haemoglobin. It
causes the red blood cells to become abnormal and sickle shaped. It has been
observed that this mutation among the Africans helps them tide over malaria. In
this way mutations have advantages as well as disadvantages. This unit introduces
you to mutations, mutagens and their effects especially on the human systems.
2.1 OBJECTIVES
After studying this unit you should be able to:
 define mutations;
 classify the various types of mutagens;
 explain the effects of mutagens on living systems; and
 describe the DNA repair systems
20
Mutation
2.2 EFFECTS OF MUTAGENS
As mutagens bring about changes in the DNA, they are genotoxic agents. They can
affect the transcription and replication of the DNA. In some cases this can lead to
cellular death. Deleterious mutation can result in aberrant, impaired or loss of function
for a particular gene, and accumulation of mutations may lead to cancer. Mutagens
may therefore be also carcinogens. Certain mutagenic agents exert their mutagenic
effect through their metabolites. So such mutagens actually become carcinogenic
dependending on the metabolic processes of an organism. Also a compound shown
to be mutagenic in one organism may not necessarily be carcinogenic in another.
Different types of mutagens act on the DNAdifferently. Powerful mutagens mayresult
in chromosomal instability, causing chromosomal breakages and rearrangement of the
chromosomes such as translocation, deletion, and inversion. Such mutagens are called
clastogens.
Mutagens may also modify the DNA sequence. This means the changes in nucleic
acid sequences by mutations. This includes substitution of nucleotide base-pairs
and insertions and deletions of one or more nucleotides in DNA sequences. Some
of these mutations are lethal and some cause minor effects. Many mutations are
silent mutations. They are termed so as they cause no visible effects. This may
be because they occur in non-coding or non-functional sequences, or they do not
change the amino-acid sequence due to the redundancy of codons. Some mutagens
change the number of chromosomes in the cell and cause aneuploidy. In Ames
test, where the varying concentrations of the chemical are used in the test, the
dose response curve obtained is nearly always linear, suggesting that there is no
threshold for mutagenesis. Similar results are also obtained in studies with
radiations, indicating that there may be no safe threshold for mutagens. However,
some proposed that low level of some mutagens may stimulate the DNA repair
processes and therefore may not necessarily be harmful.
unit.
1) Define mutation.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
2) What are the effects of mutagens?

.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
21
and Genotoxicity 2.3 TYPES OF MUTATIONS
Mutations in the genetic material can occur at the chromosome level which may be
major mutations. They can also be point alterations. This means that these mutations
not visible as cytological abnormalities. It can involve just a single nucleotide pair in
DNA. Let us now learn about the types of mutations.
Gene mutations can be classified in two groups.
 Hereditary mutations: They are inherited from a parent and are genetic. They
are present throughout a person’s life in all cells in the body. These mutations are
also known as germline mutations. This is due to their presence in the parent’s
egg or sperm cells known as germ cells. When an egg and a sperm cell unite a
fertilized zygote is produced. This receives DNA from both parents. When this
DNA has a mutation, then the embryo/ foetus will have the mutation in each of
his/her cells.
 Somatic mutations: They occur in the somatic or body cells and not in the germ
cells. So they are not inherited from the parents. They take place at some time
during a person’s life time. These changes can be caused byenvironmental factors
such as ultraviolet radiation from the sun. It can also occur when certain errors
are made when DNA copies itself during cell division. They are also known as
acquired mutations. These mutations are not passed to the next generation.
Now let us learn about small changes in DNA, of the point mutation type.
A) Base Pair (Nucleotide Pair) Substitutions

These are of two types: transitions (purine to purine or pyrimidine to
pyrimidine) and transversions (purine to pyrimidine or pyrimidine to
purine). Both occur in two different ways.
The consequences of base substitution mutations in protein coding regions

of a gene depend on the substitution and its location. They may be silent,
not resulting in a new amino acid in the protein sequence. For example,
GCA or GCG codons in mRNA both mean arginine. In the third position of
a codon there is a transition. This occurs due to wobble base pairing. A base
substitution can also result in an amino acid substitution. This type of
mutation is known as missense mutation. For example, CTC in the DNA or
GAG in mRNA will code for a glutamate residue in the protein. This may
be altered to CAC in the DNA or GUG in the mRNA that codes for valine
residue in the beta-globin protein chain. This mutation causes the disease
sickle-cell anemia. Also base substitutions in a protein coding region may
mutate an amino acid codon to a termination codon or vice versa. It can
lead to a prematurely shortened protein. This process is known as a nonsense
mutation. Base substitution mutations may also occur in promoters or 5'
regulatory regions of genes or in introns and may affect their transcription,
translation, or splicing. Mojority of the beta-thalassemias are the result of
these types of non-structural mutations that affect the level of expression of
the globin genes. All of the above mutations have been observed in human
globin genes.
22
B) Frameshift Mutations Mutation
These mutations occur as a result of the insertion or deletion of one or more

nucleotides in the coding region of a gene. Such mutations will lead to an
alteration in the reading frame. A DNA sequence is a chain of smaller
molecules called nucleotides. DNA (or RNA) nucleotide sequences are read
three nucleotides at a time in units called codons. Each codon corresponds
to a specific amino acid or stop signal. At the time of translation, the sequence
of codons is read in order from the nucleotide sequence to synthesize a
chain of amino acids resulting in the formation of a protein. These mutations
occur when the normal sequence of codons is changed by the insertion or
deletion of one or more nucleotides. This is provided that the number of
nucleotides added or removed is not a multiple of three. In case only one
nucleotide is deleted from the sequence, then all of the codons after the
mutation will have a disrupted reading frame. This can result in the
incorporation of many incorrect amino acids into the protein. In contrast, if
three nucleotides are inserted or deleted, there will be no shift in the codon
reading frame. But there will be one extra or one missing amino acid in the
final protein. This can result in abnormal protein products.
2.4 ORIGINS OF SPONTANEOUS MUTATIONS

A) Definition and Sources
A spontaneous mutation occurs naturally in cells. These mutations occur
due to naturally occurring mutagens in the environment and also DNA
replication errors.
B) DNA Replication Errors and Polymerase Accuracy

Mistakes in DNA replication where an incorrect nucleotide is added will
lead to a mutation in the consequent round of DNA replication of the strand
with the incorrect nucleotide. The frequency at which a DNA polymerase
makes mistakes (inserts an incorrect base) will influence the spontaneous
mutation frequency and it has been observed that different polymerases vary
in their accuracy. One major factor affecting polymerase accuracy is the
presence of a “proofreading” 3'-5' exonuclease which will remove incorrectly
paired bases inserted by the polymerase. Mutator mutants have been isolated
in other organisms and have been shown to affect various components of
the DNA replication complex. Alterations in a number of these proteins are
likely to affect the accuracy of the system.
C) Base Alterations and Base Damage
The bases of DNA are subject to spontaneous structural alterations called
tautomerization. They are capable of existing in two forms between which
they interconvert. For example, guanine can exist in keto or enol forms.
The keto form is favored but the enol form can occur by shifting a proton
and some electrons. These forms are called tautomers or structural isomers.
The various tautomer forms of the bases have different pairing properties.
Thymine can also have an enol form; adenine and cytosine exist in amino
or imino forms. If during DNA replication, G is in the enol form, the
polymerase will add a T across from it instead of the normal C because the
base pairing rules are changed. The result is a G:C to A:T transition.
Tautomerization causes transition mutations only. 23
Environmental Cytotoxicity Another mutatgenic process occurring in cells is spontaneous base degradation.
and Genotoxicity
The deamination of cytosine to uracil happens at a significant rate in cells.
Deamination can be repaired by a specific repair process which detects uracil,
not normallypresent in DNA; otherwise the U will causeAto be inserted opposite
it and cause a C:G to T:Atransition when the DNAis replicated. Deamination of
methylcytosine to thymine can also occur. Methylcytosine occurs in the human
genome at the sequence 5’CpG3', which is normallyavoided in the coding regions
of genes. If the meC is deaminated to T, there is no repair system which can
recognize and remove it (because T is a normal base in DNA). This means that
wherever CpG occurs in genes it is a “hot spot” for mutation. Such a hot spot has
recently been found in the achondroplasia gene. A third type of spontaneous
DNA damage that occurs frequently is damage to the bases by free radicals of
oxygen. These arise in cells as a result of oxidative metabolism and also are
formed by physical agents such as radiation. An important oxidation product is
8-hydroxyguanine, which mispairs with adenine, resulting in G:C to T:A
transversions. Still another type of spontaneous DNA damage is alkylation, the
addition of alkyl (methyl, ethyl, occasionally propyl) groups to the bases or
backbone of DNA. Alkylation can occur through reaction of compounds such
as S-adenosyl methionine with DNA. Alkylated bases may be subject to
spontaneous breakdown or mispairing.
D) Spontaneous Frameshift Mutations

Streisinger observed in the 1960’s that frameshift mutations in bacteriophages
tended to occur in areas with “runs” of repeats of one nucleotide.
5' AGTCAATCCATGAAAAAATCAG 3'
3' TCAGTTAGGTACTTTTTTAGTC 5'
Frameshifts are the result of “slipped mispairing” between the template DNA
strand and the newly synthesized strand during DNA replication. In the
sequence above, a likely spot for frameshift mutations to occur would be in
the stretch of 6 A:T base pairs. Subsequent studies with genes from other
organisms, including humans, have shown that runs of repeated nucleotides
are hotspots for frameshift mutations.
2.5 MUTAGENS
A mutagen is a natural or human-made agent (physical or chemical) which can
alter the structure or sequence of DNA.
A) Chemical Mutagens
The first report of mutagenic action of a chemical was in 1942 by Charlotte
Auerbach, who showed that nitrogen mustard (component of poisonous
mustard gas used in World Wars I and II) could cause mutations in cells.
Since that time, many other mutagenic chemicals have been identified and
there is a huge industry and government bureaucracy dedicated to finding
them in food additives, industrial wastes, etc.
It is possible to distinguish chemical mutagens by their modes of action;

some of these cause mutations by mechanisms similar to those which arise
24
spontaneously while others are more like radiation (to be considered next) in Mutation
their effects.
Table 2.1 Chemical Mutagens and Their Mode of Action

Group of mutagen Name of Chemical Mode of action
1. AlkylatingAgents Ethyl methane Sulphonate AT GC
Transitions
Methyl Methane Sulphonate Transitions
Ethyl Ethane Sulphonate GC AT
T
Transitions
Ethylene Imines Transitions
2. Base Analogues 5 Bromo Uracil AT GC
Transitions
2 Amino Purine AT GC
Transitions
3. Acridine Dyes Acriflavin, Proflavin Deletion,
Addition and
Frameshifts.
4. Others Nitrous Acid AT GC
Transitions
Hydroxylamine GC AT
T
Transitions
Sodium Azide Transitions
1) Base Analogs
These chemicals structurally resemble purines and pyrimidines and may be

incorporated into DNA in place of the normal bases during DNA replication:
 bromouracil (BU) artificially created compound extensively used in

research. Resembles thymine (has Br atom instead of methyl group)
and will be incorporated into DNA and pair with A like thymine. It has
a higher likelihood for tautomerization to the enol form (BU*)
 aminopurine adenine analog which can pair with T or (less well) with
C; causes A:T to G:C or G:C to A:T transitions. Base analogs cause
transitions, as do spontaneous tautomerization events.
2) Chemicals which Alter Structure and Pairing Properties of Bases

There are many such mutagens; some well-known examples are:
 Nitrous Acid—formed by digestion of nitrites (preservatives) in foods.
It causes C to U, meC to T, and A to hypoxanthine deaminations.
Hypoxanthine in DNA pairs with C and causes transitions. Deamination
by nitrous acid, like spontaneous deamination, causes transitions.
 Nitrosoguanidine, Methyl Methanesulfonate, Ethyl

Methanesulfonate — chemical mutagens that react with bases and add
25
Environmental Cytotoxicity methyl or ethyl groups. Depending on the affected atom, the alkylated base
and Genotoxicity
may then degrade to yield a baseless site, which is mutagenic and
recombinogenic, or mispair to result in mutations upon DNA replication.
3) Imntercalating Agents
Acridine Orange, Proflavin, Ethidium Bromide (used in labs as dyes
and mutagens)
All are flat, multiple ring molecules which interact with bases of DNA and
insert between them. This insertion causes a “stretching” of the DNA duplex
and the DNA polymerase is “fooled” into inserting an extra base opposite
an intercalated molecule. The result is that intercalating agents cause
frameshifts.
4) Agents Altering DNA Structure

We are using this as a “catch-all” category which includes a variety of
different kinds of agents. These may be:
 large molecules which bind to bases in DNA and cause them to be
noncoding—we refer to these as “bulky” lesions (eg. NAAAF)
 agents causing intra- and inter-strand crosslinks (eg. psoralens—found
in some vegetables and used in treatments of some skin conditions)
 chemicals causing DNA strand breaks (eg. peroxides)
B) Radiation
Radiation was the first mutagenic agent known; its effects on genes were
first reported in the 1920’s. Radiation itself was discovered in 1890’s:
Roentgen discovered X-rays in 1895, Becquerel discovered radioactivity in
1896. Marie and Pierre Curie discovered radioactive elements in 1898. These
three discoveries and others led to atomic physics and the understanding of
electromagnetic radiation.
Table 2.2: Commonly used physical mutagens, their properties and mode
of action
Type of Radiation Main Properties Mode of action or changes

caused
1. X-rays S.I., penetrating and non- Induce mutations by forming

particulate free radicals and ions. Cause
addition, deletion, transitions
and transversions.
2. Gamma rays S.I., very penetration and Induce mutations by ejecting

non-particulate atoms from the tissues. Cause
all types of changes as above.
3. Alpha Particles D.I., particulate, less Act by ionization and

penetrating and positively excitation. Cause
charged. chromosomal and gene
mutations.
26
Mutation
4. Beta Rays S.I., particulate, more Act by ionization and
Particles penetrating than alpha excitation. Cause
particles and negatively chromosomal and gene
charged. mutations.
5. Fast and D.I., particulate, neutral Cause chromosomal breakage
Thermal particles, highly penetrating and gene mutations.
Neutrons
6. Ultra Violet Non- ionizing, low Cause chromosomal breakage
Rays penetrating and gene mutations.
1) Electromagnetic Spectrum
Visible light and other forms of radiation are all types of electromagnetic
radiation (consists of electric and magnetic waves). The wavelength varies
widely and is inversely proportional to the energy they contain. The longest
waves (AM radio) have the least energy while successively shorter waves
and increasing energy are seen with FM radio, TV, microwaves, infrared,
visible, ultraviolet (UV), X and gamma radiation. The portion which is
biologically significant is UV and higher energy radiation.
2) Ionizing Radiation
X- and gamma-rays are energetic. They produce reactive ions (charged atoms
or molecules) when they react with biological molecules; thus they are
referred to as ionizing radiation. This term also includes corpuscular
radiation. They include atomic and subatomic particles emitted by radioactive
elements. They are of two types, alpha- and beta-particles. UV radiation is
not ionizing but can react with DNA and other biological molecules and is
also important as a mutagen. The units for ionizing radiation of all types are
rems (roentgen equivalent man). 1 rem of any ionizing radiation produces
similar biological effects. The effects of different types of radiation differ. 1
rem of alpha particles has a much greater damaging effect than one rem of
gamma rays. Further, the energy type and total dose of radiation are also
important factors.
3) Sources of Radiation
Natural sources of radiation produce so-called background radiation. These
include cosmic rays from the sun and outer space, radioactive elements in
soil and terrestrial products (wood, stone) and in the atmosphere (radon).
One’s exposure due to background radiation varies with geographic location.
In addition diagnostic X-rays, radiations from nuclear testing and power
plants, and various other sources such as TV’s, smoke detectors, are also
mutagenic.
4) Biological Effects of Radiation

Ionizing radiation produces a range of damage to cells and organisms
primarily due to the production of free radicals of water (the hydroxyl or
OH radical). Free radicals possess unpaired electrons and are chemically
very reactive and will interact with DNA, proteins, lipids in cell membranes,
etc. Thus X-rays can cause DNA and protein damage causing organelle
failure, block cell division, or cell death. The rapidly dividing cell types are
the most affected by ionizing radiation. The severity of the effects depends 27
Environmental Cytotoxicity upon the dose received. This has been observed among the victims of atomic
and Genotoxicity
bomb explosions such as those in Hiroshima and Nagasaki. The dose-effects
can be as follows.
 Sublethal dose (100-250 rems): nausea and vomiting early; 1-2 week latent
period followed by malaise, anorexia, diarrhea, hair loss.
 Lethal dose (350-450 rems): nausea and vomiting early; 1 week latent period
followed byabove with more severe symptoms including internal bleeding; a
50% chance of death. Death is due to blood cell or gastrointestinal failure.
 Supralethal dose (>650 rems): nausea and vomiting early, followed byshock,
abdominal pain, diarrhea, fever and death within hours or days. Death is due
to heart or CNS damage.
For the affected tissues and organs, the number of destroyed cells and the
likelihood of their replacement determines the survival chances. The long
term effects include increased cancer risk and increased risk of mutations in
one’s offspring.
5) Genetic Effects of Radiation

Ionizing radiation produces a range of effects on DNA both through free
radical effects and direct action:
 breaks in one or both strands (rearrangements, deletions, chromosome
loss)
 damage to/loss of bases (mutations)
 crosslinking of DNA to itself or proteins
The genetic effects of radiation were reported in 1927 in Drosophila by
Muller and in 1928 in plants (barley) by Stadler. Both experiments showed
that the frequency of induced mutations is a function of X-ray dose. Their
experiments revealed that there was a linear relationship between X-ray
dose and induced mutation level, that there was no threshold or “safe” dose
of radiation and that all doses are significant, and finally, that “split dose”
experiments showed that the genetic effects of radiation are cumulative.
6) UV (Ultraviolet)
UV radiation is less energetic, and therefore non-ionizing, but its wavelengths
are preferentially absorbed by bases of DNA and by aromatic amino acids
of proteins, so it, too, has important biological and genetic effects. UV is
normally classified in terms of its wavelength: UV-C (180-290 nm) is
germicidal, most energetic and lethal. It is absorbed by the ozone layer. UV-
B (290-320 nm) is a major lethal/mutagenic fraction of sunlight. UV-A (320
nm—visible) has deleterious effects. The major lethal lesions are pyrimidine
dimers in DNA (produced by UV-B and UV-C). These are due to the
formation of a covalent bond between adjacent pyrimidines in one strand.
These dimmers block transcription and DNA replication and are lethal if
unrepaired. They can stimulate mutation and chromosome rearrangement
as well.
28
Mutation
2.6 DNA REPAIR SYSTEMS
DNA damage occurs spontaneously and as a result of certain environmental agents.
Most organisms have the ability to repair their DNA. The repair mechanisms are
given below.
 Damage Reversal: They are simple and enzymatic action restores normal
structure without breaking the backbone.
 Damage Removal: It involves cutting out and replacing a damaged or
inappropriate base or section of nucleotides.
 Damage Tolerance: It is a a way of coping with damage so that life can go
on.
Let us now see some examples of each type of repair, the mechanisms, the
consequences of mutations in each, in both model organisms and in humans.
A) Damage Reversal
1) Photoreactivation
This is one of the simplest and perhaps oldest repair systems: it consists of
a single enzyme which can split pyrimidine dimers (break the covalent bond)
in presence of light. The photolyase enzyme catalyzes this reaction; it is
found in many bacteria, lower eukaryotes, insects, and plants. It seems to be
absent in mammals (including humans). The gene is present in mammals
but may code for a protein with an accessory function in another type of
repair.
2) Ligation of Single Strand Breaks

X-rays and some chemicals like peroxides can cause breaks in backbone of
DNA. Simple breaks in one strand are rapidly repaired by DNA ligase.
Microbial mutants lacking ligase tend to have high levels of recombination
since DNA ends are very reactive. A human was found to have mutations in
both of her DNA ligase I genes. She had poor growth, immunodeficiency,
and sun sensitivity and died at a young age of lymphoma. The rare hereditary
disease Bloom syndrome is involved with DNA ligase deficiency and
patient’s cultured cells have high levels of chromosome aberrations and
spontaneous mutation.
B) Damage Removal
1) Base Excision Repair
The damaged or inappropriate base is removed from its sugar linkage and
replaced. These are glycosylase enzymes which cut the base-sugar bond.
For example: uracil glycosylase is an enzyme that removes uracil from DNA.
Uracil is not present in the DNA. It can occur when RNA primers are not
removed in DNA replication or if cytosine is deaminated. The enzyme
recognizes uracil and cuts the glyscosyl linkage to deoxyribose. The sugar
is then cleaved and a new base put in by DNA polymerase using the other
strand as a template. Mutants lacking uracil glycosylase have elevated
spontaneous mutation levels and are hyper-sensitive to killing and mutation
by nitrous acid.
29
Environmental Cytotoxicity 2) Mismatch Repair
and Genotoxicity
This process occurs after DNA replication as a last “spellcheck” on its
accuracy. In E. coli, it adds another 100-1000-fold accuracy to replication.
It is carried out by a group of proteins which can scan DNA and look for
incorrectly paired bases which will have aberrant dimensions in the double
helix. The incorrect nucleotide is removed as part of a short stretch and then
the DNA polymerase gets a second try to get the right sequence. In humans
mutations are found to be passed in the germline of families with some
types of inherited colon cancer.
3) Nucleotide Excision Repair (NER)

This system works on DNA damage and creates a block to DNA replication
and transcription. It recognizes a distortion in the double helix. The
mechanism consists of cleavage of the DNA strand containing the damage
by endonucleases on either side of damage followed by exonuclease removal
of a short segment containing the damaged region. DNA polymerase can
fill in the gaps that result. Mutants that are defective in NER have been
isolated in many organisms and are sensitive to killing and mutagenesis by
UV and chemicals which act like UV. Humans with the hereditary disease
xeroderma pigmentosum are sunlight-sensitive. They have very high risks
of skin cancers on sun-exposed areas of the body and have defects in genes
homologous to those required for NER in simple eukaryotes.
C) DNA Damage Tolerance

Not all DNA damage is or can be removed immediately. Some of them can
persist for a while. If a DNA replication fork encounters DNA damage such
as a pyrimidine dimer it will normally act as a block to further replication.
In eukaryotes, DNA replication initiates at multiple sites. It then may be
able to resume downstream of a dimer, leaving a “gap” of single-stranded
unreplicated DNA. The gap may be repaired by recombination with either
the other homolog or the sister chromatid which yields two intact daughter
molecules, one of which still contains the dimer.
1) Recombinational (Daughter-Strand Gap) Repair

This is a repair mechanism which promotes recombination to fix the
daughter-strand gap—not the dimer—and is a way to cope with the problems
of a non-coding lesion persisting in DNA. This type of recombinational
repair is generally accurate and requires a homolog or sister chromatid. The
products of the human breast cancer susceptibility genes BRCA1 and BRCA2
may be involved in recombinational repair together with homologs of the
yeast RAD51 and RAD52 genes.
A second type of recombinational repair which is used primarily to repair
broken DNA ends such as are caused by ionizing radiation and chemical
mutagens with similar action is the non-homologous end-joining reaction.
This repair system is also employed by B and T cells of the immune system
for genetic rearrangements needed for their function.
2) Mutagenic Repair (Trans-lesion Synthesis)
An alternative scenario for a DNA polymerase blocked at a dimer is to
change its specificity so that it can insert any nucleotide opposite the dimer
30 and continue replication. This can happen in bacteria.
Check Your Progress 2 Mutation

b) Check your progress with possible answers given at the end of the unit.
1. Write short notes on mutagens.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
2.7 LET US SUM UP

In this unit you have understood the definition of mutations. There are many
environmental factors that cause mutations and their effects. In certain cases
metabolites may cause mutations and the dose and type of living organism are
also some important factors. You have also learnt about the types of mutations
and how DNA repair mechanisms are also possible.
2.8 KEY WORDS

Mutation is any heritable change in the genetic material.
Mutagens bring about changes in the DNA, they are genotoxic agents.

READINGS
A. Sancar, “Mechanisms of DNA excision repair”, Science 266: 1954-1956,
1994.
D. Bootsma and J. H. J. Hoeijmakers, “Engagement with transcription”, Nature
363: 114-115, 1993.
“DNA repair works its way to the top”, E. Culotta and D. E. Koshland, Science
266: 1926-1929, 1994.
“DNA repair comes into its own”, Science 266: 728-730, 1994
E. C. Friedberg, “Xeroderma pigmentosum, Cockayne’s syndrome, helicases,
and DNA repair: what’s the relationship?”, Cell 71: 887-889, 1992.
“It was a very good year for DNA repair”, J. E. Cleaver, Cell 76: 1-4, 1994.
J. F. Crow, “How much do we know about spontaneous human mutation rates?”,
Environmental and Molecular Mutagenesis 21: 122-129, 1993
Mismatch repair, genetic stability, and cancer”, P. Modrich, Science 266: 1959-
1960, 1994.
31
Environmental Cytotoxicity “Molecule of the year: the DNA repair enzyme”, D. E. Koshland, Science 266: 1925,
and Genotoxicity
1994.
New colon cancer gene discovered”, J. Marx, Science 260: 751-752, 1993.
S. Buratowski, “DNA repair and transcription: the helicase connection”, Science 260:
37-38, 1993.
P. C. Hanawalt, “Transcription-coupled repair and human disease”, Science 266:
1957-1958, 1994.

1) Your answer should include the following points:
Mutation is any heritable change in the genetic material. It is significant in
higher organisms where mutations can occur both in the gametes (germline
mutations) and in body cells (somatic mutations).

Mutagens bring about changes in the DNA, they are genotoxic agents. They
can affect the transcription and replication of the DNA. In some cases this
can lead to cellular death. Deleterious mutation can result in aberrant,
impaired or loss of function for a particular gene, and accumulation of
mutations may lead to cancer. Mutagens may therefore be also carcinogens.
Certain mutagenic agents exert their mutagenic effect through their
metabolites. So such mutagens actually become carcinogenic dependending
on the metabolic processes of an organism. Also a compound shown to be
mutagenic in one organism may not necessarily be carcinogenic in another.
Different types of mutagens act on the DNA differently. Powerful mutagens
may result in chromosomal instability, causing chromosomal breakages and
rearrangement of the chromosomes such as translocation, deletion, and
inversion. Such mutagens are called clastogens.
A mutagen is a natural or human-made agent (physical or chemical) which
can alter the structure or sequence of DNA.
Chemical Mutagens
Base Analogs
Chemicals which Alter Structure and Pairing Properties of Bases
Intercalating Agents
Agents Altering DNA Structure
Radiation
32
Mutation
UNIT 3 TERATOGENESIS
Structure
3.0 Introduction
3.1 Objectives
3.2 Definition and Concepts
3.2.1 Definition
3.2.2 Principles in Teratology
3.2.3 Stage of Exposure to Teratogens
3.3 Sources of Teratogens and their Effects
3.4 Teratogenesis
3.4.1 Basic Principles in Teratogenesis
3.5 Let Us Sum Up
3.6 Key Words
3.0 INTRODUCTION
We have learnt about toxicants and toxins in the previous units and how they
exert deleterious effects on the organs. Some toxic substances can penetrate the
placental barrier and bring about birth defects with malformations in the
developing embryo and foetus. They can cause mental retardation, paralysis of
the limbs, congenital heart defects, cleft palate, visual and auditory disturbances.
There have been numerous reports which have shown that the drug Thalidomide
used to treat morning sickness in women caused teratogeny and birth defects in
the children born to these women. Bhopal gas tragedy and endosulfan pesticide
poisoning induced teratogeny among the human population. Let us now learn
about teratogens, some concepts in teratogeny and their mechanism of action.
3.1 OBJECTIVES
After reading this unit, you should be able to:
 define teratogens and teratogenesis;
 understand the principles underlying teratogenic effects;
 explain the various sources of teratogens and their effects; and
 describe the mechanism of teratogenesis.
3.2 DEFINITIONS AND CONCEPTS

Dear Learners, you will read about definitions and concepts in the following
sentences:
33
Environmental Cytotoxicity 3.2.1 Definitions
and Genotoxicity
Let us now learn about some definitions and terms commonly used in teratogeny.
a) Developmental toxicity: It is caused due to any morphological or functional
alteration caused by chemical or physical insult that interferes with normal
growth, homeostasis, development, differentiation, and/or behavior.
b) Teratology: It is a specialized area of embryology that focuses on the study
of the etiology of abnormal development. It is otherwise known as the study
of birth defects.
c) Teratogens: They are toxic agents, xenobiotics that cause malformations in
the developing foetus.
d) Malformation: This is referred to a primary structural defect resulting from
a localized error of morphogenesis.
e) Disruption: It is a particular abnormality that arises from disruption of normal
developmental processes. This is dependent on time and not on an agent.
f) Deformation: This refers to an alteration in shape or structure of previously
normally formed part.
g) Syndrome: It is a recognized pattern of malformations with a given etiology.
h) Congenital malformation: These are structural defects present at birth. They
may be gross or microscopic, on the surface of the body or within it, familiar
or sporadic, hereditary or nonhereditary, single or multiple. (Warkany, 1947)
Some examples of teratogens are therapeutic drugs, drugs of abuse, hormones

found in contraceptive agents, components found in cigarette, nicotine, alcohol,
heavy metals, viral agents and so on.
3.2.2 Principles in Teratology

Teratogens can be organ specific, dose specific and species specific. There are
six principles in teratology that was proposed by James Wilson in 1959. They
are given below.
1) The susceptibility of a foetus to teratogenesis depends on the genotype of
the embryo which interacts with adverse and toxic environmental factors.
2) Teratogenesis is related to the stage of development of the foetus when
exposed to the toxicant.
3) Teratogenic agents have well defined mechanisms for producing toxic
effects.
4) The type of the teratogenic compound is an important factor that determines
its path to the developing foetus.
5) Teratogenesis is mainly characterized by death, malformation, growth
retardation, and functional deficits.
6) The extent of altered development increases with increasing dose.
3.2.3 Stage of Exposure to Teratogens

In most cases the stage of exposure of the developing foetus or the stage of
34 pregnancy is important for the effects of teratogens. The process of embryogenesis
is highly complex. It involves: cell migrations, proliferation, differentiation and Teratogenesis
organogenesis. It can also be classified as: pre-implantation stage, implantation
to organogenesis stage, and the foetal to neonatal stage. The outcomes associated
with exposure during each of these stages differ. Exposure during the pre-
implantation stage causes embryonic lethality. Exposure to teratogens during
implantation to time of organogenesis leads to morphological defects. Exposure
to teratogens during the foetal to neonatal stage leads to functional disorders and
growth retardation. The most critical period is the time of organogenesis when
organs formation takes place.
1) Define a teratogen.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
2) What are the principles in teratology?
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
3.3 SOURCES OF TERATOGENS AND THEIR

EFFECTS
There are many sources of teratogens which can be harmful. They can be
therapeutic drugs, alcohol and even drugs of abuse. Let us learn some of them in
detail.
1) Therapeutic Drugs
a) Thalidomide: This is a sedative drug that was used in Europe from
1957 to 1961. The drug was actually used for insomnia (sleeping
disorders), nausea, vomiting and morning sickness associated with
pregnancy. It was widely used by women in Europe, Australia, Asia,
Africa, and America. Later on it was observed that the women who had
consumed this drug in the first trimester gave birth to children who had
abnormalities. The birth defects were amelia (absence of limbs),
phocomelia (severe shortening of limbs), absence of the auricles,
35
Environmental Cytotoxicity deafness, muscular defects of eye and face, malformations of the heart, bowel,
and Genotoxicity
uterus, and the gallbladder. The effect was disastrous with more than 10,000
affects. So finally the compound was withdrawn from the market in 1961.
b) Accutane (Isotetrinoin): This drug belongs to the retinoid group of drugs.

It is related to vitamin A. The drug is supposed to cure severe and painful
acne. The pregnant women who took this drug were reported to have
children with birth defects including facial deformities, heart defects,
and mental retardation.
c) Diethylstilbestrol: This drug is synthetic estrogen which inhibits

ovulation by affecting release of pituitary gonadotropins. It is used in
the treatment of hypogonadism.
d) Tetracycline: This antibiotic has the ability to go across the placental

barrier and constituents are deposited in the bones and teeth of the
growing foetus. It can cause yellow stained teeth and bone disorders.
e) Anticonvulsant agents: The therapeutic drug phenytoin causes foetal

hydantoin syndrome. It results in microcephaly, mental retardation and
intrauterine growth retardation.
f) Anti-neoplastic or chemotherapeutic agents: These drugs can stop the

rapidly dividing cells during foetal growth formation. So it should be
totally avoided during pregnancy.
2) Alcohol
Women who consume alcohol during pregnancy give birth to children with
mental and physical retardation. The foetal alcohol syndrome is also observed
when the foetus is exposed to alcohol in utero. The most critical period for
this defect is the first trimester. The babies born have small body size, low
birth weight, craniofacial defects, psychomotor defects, microcephaly (small
head), scoliosis, small eye openings, and other neurological problems. They
may also have visceral defects associated with the heart and kidney. Learning
disabilities may also be present.
3) Non Chemical Teratogens

There may be other non chemical agents also that can be teratogens. This
also can harm the developing foetus. For example Rubella virus that causes
german measles is hazardous and causes teratogenic effects. It was reported
as early as 1941 in Austria. The defects produced vary with thie stage of
gestation (pregnancy). Exposure to this virus during the first two months of
pregnancy causes heart and eye anomalies. Exposure during the third month
of gestation induced hearing anomalies in the growing foetus. Other
biological infectious teratogens include cytomegalovirus, varicella, herpes
simplex, toxoplasma, syphilis, human immunodeficiency virus (HIV).
4) Physical Agents
Some physical agents induce teratogenecity. They include: ionizing
radiations, hyperthermia and so on. Ionizing radiation can harm the growing
embryo. It results in cellular death and injury to chromosomes. Some women
exposed to the radiations in the Hiroshima atomic bombing during 10 – 18 weeks
36
of gestation had children with brain defects. In the same way x-rays can also Teratogenesis
cause risk to the developing foetus.
5) Environmental Toxicants
Some environmental toxicants like organic mercury compounds,
polychlorinated biphenyl, agricultural herbicides and industrial solvents are
reported to cause teratogenic effects. People affected by consumption of
organic methyl mercury contaminated fishes in Japan had children born with
birth defects.
6) Maternal Health Factors

Another important factor is the health of the mother during pregnancy.
Mothers who have diabetes can have an increased risk of having children
with congenital heart disease, renal, gastrointestinal, and central nervous
system anomalies. Women with phenylketonuria have an increased risk of
giving birth to children with mental retardation, low birth weight, and
congenital heart disease. Also genetic factors play important role in
teratogeny.
7) Drugs of Abuse
Drugs used for abuse are highly risky to the developing embryo.
a) Cocaine: Cocaine or benzoylmethylecgonine is a teratogen. It is an
alkaloid extracted from the plant Erythroxylum coca. Expsoure to this
drug causes gastrointestinal anomalies, cardiac problems, craniofacial
anomalies, tissue death due to disruption in blood supply to the
developing embryo. It can also cause limb anomalies.
b) Opioids: This can cause preterm deliveries, chorioamnionitis, neural

tube anomaly and foetal death.
c) Cannabis: This drug can cause low birth weight children and shorter
gestation periods.
d) Amphetamines: This can cause microcephaly, oral cleft defects and so

on.
e) Hallucinogens: They include phencyclidine, lysergic acid diethylamide

(LSD), and 3,4-methylenedioxymethamphetamine. Phencyclidine
causes microcephaly and intracranial abnormalities. LSD causes limb
defects and eye abnormalities.
8) Inhalants
They include industrial solvents, such as toluene; fuels; anesthetics; nitrous
oxide; and alkyl nitrites. Women may be exposed to these substances at the
industrial workplaces. Toluene causes preterm labor, intrauterine growth
retardation, microcephaly, craniofacial abnormalities, wide nasal bridge,
blunt fingertips and abnormal palmar creases.
These are some sources and effects of teratogens. You can see how much
damage they can do to the developing embryo. So during pregnancy utmost
care has to be taken by the mother and she should avoid drugs (both therapeutic
37
Environmental Cytotoxicity as well as of abuse) and non chemical agents. She should be careful about the
and Genotoxicity
food she eats, the water she drinks and the air she breathes as environmental
toxicants are also detrimental.
1) List the different sources of teratogens.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
2) Describe the effects caused by therapeutic drugs.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
3) Describe the effects caused by drugs of abuse and non chemical teratogens.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
3.4 TERATOGENESIS
We have seen the sources of teratogens and the effects caused by them. They are
present even in the environment as toxicants. These can induce embryotoxicity.
Teratogenicity refers to the manifestation of developmental toxicity representing
a particular case of embryo/foetotoxicity by inducing structural disorders in the
foetus.
38
3.4.1 Basic Principles in Teratogenesis Teratogenesis
The fundamental principles involved in teratogenesis include the following.

a) Critical stages of foetal development;
b) dosage of the drug, chemical, non chemical agent; and the
c) genotype (genetic constitution) of the embryo and mother are important factors.
Teratogens cause toxicity to the growing foetus. Broadly they can cause:
a) death of the developing foetus in utero;
b) malformation of foetus;
c) intrauterine growth retardation; and
d) functional defects in the newborn.

A teratogen can cause effects on different intracellular components during the various
stages of pregnancy. In general there can be four main levels or areas where the action
can take place. They are given below.
a) Teratogens can act on the intracellular compartment which is between the nucleus
and the cytoplasm.
b) Theycan act on the cell surface giving rise to structural and functional anomalies.
c) They can act on the extracellular matrix.
d) They can act on the foetal environment at the organismal level or in the foeto-
maternal relation.
These can further be divided into genetic and non-genetic types.
1) Intracellular Region
Genetic: They are known as ‘inborn errors of metabolism’. It was named by
Sir Archibald Garrod. In this mainly a mutant gene leads to deficiency of an
enzyme activity. So the metabolic pathway is blocked. An example is Hurler’s
syndrome due to deficiency of the lysosomal enzyme a-L-iduronidase, and
the accumulation of heparin sulfate and dermatan sulfate in the cells. The
excess metabolite accumulation in cells leads to growth retardation, mental
regression, skeletal defects, cardiac problems and hepatosplenomegaly
(Leroy & Crocker, 1966).
Non-genetic: In this the nucleocytoplasmic interactions are blocked by

inhibitors. The inhibitors prevent the process of reading genetic information.
Thereby they cause hereditary disorders. An example is Actinomycin D which
is reported to be teratogenic to early brain and causes severe eye defects
(Diethelm & Schowing, 1974). The drug Cycloheximidine stops both protein
synthesis and morphogenesis.
2) Extracellular Matrix
Teratogens can also affect the function of a tissue by interfering with the
production or maturation of this extracellular material.
Genetic: One example is Dermatosparaxis. It is a hereditary disease recently

39
Environmental Cytotoxicity detected in cattle with fragile skin with an inelastic dermal tissue. This is due to
and Genotoxicity
abnormal or insufficient production of collagen in the dermal connective tissue.
Similar defects were observed in patients suffering from Ehlers-Danlos syndrome
(Lichtenstein et al. 1973).
Non-genetic: The example of the antibiotics of tetracycline group comes

under these effects. They act on the extracellular compounds. The drug
tetracyclines get into the mineralizing tissues causing hypoplasia and growth
retardation. The action is well known on the bone mineral tissues.
3) Fetal Environment
Embryogenesis and foetal development is controlled by various factors. They
include maternal, placental and autogenous factors. They are the hormonal
factors, immune mechasisms and nutritional factors. Teratogens can cause
changes in the foetal environment even without crossing the placenta. These
agents can block the supply of nutrition or vital necessities to the growing
foetus. Thus they bring about birth anomalies.
Genetic: Hereditary disorders can cause teratogeny in foetus. The endocrine

disorders come under this category. An example is Pendred’s syndrome
characterized by congenital deafness and hypothyroidism.
Nongenetic: These include factors like nutritional deficiencies, placental

insufficiency, altered maternal endocrine status and immunization following
feto-maternal incompatibility. Brent in 1971 showed that rabbit antisera
when injected into pregnant rats caused congenital abnormalities in the
offspring. What was surprising is that the antibodies did not cross the
placenta. But they accumulated in the yolk-sac epithelium (structure present
in placenta of rodents and rabbits). It was in this region the immunoglobulins
impaired the placental function by disrupting the transport of nutrition to
the growing foetus. Azo dyes are also known to cause similar actions without
entering the foetus (Beck, 1967).
Counseling and proper care by qualified practitioners is very important for

pregnant women. Community based services, parenting education is also
very important.
3.5 LET US SUM UP

In this unit we have studied about the various teratogens and the effects of
teratogens. A congenital malformation can be anatomical or structural abnormality
observed at birth. These can be due to teratogenic agents like therapeutic drugs,
alchohol, drugs of abuse or even radiations. The health condition of the mother
is also very important for a healthy child to be born. The first two weeks of
pregnancy is important as most teratogens can destroy or kill the embryo at this
stage. During the period of organogenesis major organ defects are formed. Hence
understanding the action of teratogens and their mechanism of action is essential
to rule out and prevent these anomalies.
40
Teratogenesis
3.6 KEY WORDS
Teratology : It is a specialized area of embryology that focuses on the
study of the etiology of abnormal development. It is
otherwise known as the study of birth defects.
Teratogens : They are toxic agents, xenobiotics that cause

malformations in the developing foetus.
Toxicant : Any toxic material or substance is termed as a toxicant.

They are hazardous and poisonous. Toxicants are
generally man-made and artificial products introduced
into the environment due to human activity. They include
bisphenol, insecticides and a number of industrial
chemicals.
Toxins : These are produced naturally by living organisms. For

example, toxins from the mushroom plant and toxin
from the venom of snake are natural toxins.
Xenobiotic is referred to a foreign substance entering

the body. It is derived from the Greek word ‘xeno’
meaning ‘foreigner’.

READINGS
Abel, P. D., ed. Water Pollution Biology. London: Taylor and Francis, 1996.
Ballantyne, B., Marrs, T. and P. Turner, eds. General and Applied Toxicology,
college ed., New York: Macmillan, 1995.
Costa, D. L. Air pollution. In Casarett and Doull’s Toxicology: The Basic Science
of Poisons, 6th ed., C. D. Klaassen, ed. New York: McGraw-Hill, 2001,
pp. 979–1012.
Doull, J. Recommended limits for occupational exposure to chemicals. In Casarett
and Doull’s Toxicology: The Basic Science of Poisons, 6th ed., C. D.
Klaassen, ed. New York: McGraw-Hill, 2001, pp. 1155–1176.
Hodgson, E., and R. C. Smart, eds. Introduction to Biochemical Toxicology, 3rd
ed. New York: Wiley, 2001.
Hodgson, E., R. B. Mailman, and J. E. Chambers, eds. Dictionary of Toxicology, 2nd
ed. London: Macmillan, 1998.
Klaassen, C. D. ed. Casarett and Doull’s Toxicology: The Basic Science of Poisons,
6th ed. New York: McGraw-Hill, 2001.
Timbrell, J. A. Principles of Biochemical Toxicology, 3rd ed. London: Taylor and
Francis, 2000.
Wexler, P. Information Resources in Toxicology, 3rd ed. San Diego:Academic Press,
2000.
41
Environmental Cytotoxicity Holgate, S. T., J. M. Samet, H. Koren, and R. Maynard, eds. Air Pollution and
and Genotoxicity
Health. San Diego: Academic Press, 1999.
Hoffman, D. J., B. A. Rattner, G. A. Burton, and J. Cairns, eds. Handbook of
Ecotoxicology, 2nd ed. Boca Raton: Lewis, 2002.
Hood, R. D. Handbook of Developmental Toxicology. Boca Raton, FL: CRC Press,

1997.
Klaassen, C. D., ed. Casarett and Doull’s Toxicology: The Basic Science of
Poisons, 6th ed., New York: McGraw-Hill, 2001.
Korach, K. S. Reproductive and Developmental Toxicology. New York: Dekker,

1998.
Larson, S. J., P. D. Capel, and M. S. Majewski, eds. Pesticides in Surface Waters.

Chelsea, MI: Ann Arbor Press, 1998.
Thorne, P. S. Occupational toxicology. In Casarett and Doull’s Toxicology: The

Basic Science of Poisons, 6th ed., C. D. Klaassen, ed. New York: McGraw-
Hill, 2001, pp. 1123–1140.

Teratogens are toxic agents, xenobiotics that cause malformations in the
developing foetus. Some examples of teratogens are therapeutic drugs, drugs
of abuse, hormones found in contraceptive agents, components found in
cigarette, nicotine, alcohol, heavy metals, viral agents and so on.

Teratogens can be organ specific, dose specific and species specific. There
are six principles in teratology that was proposed by James Wilson in 1959.
They are given below.
 The susceptibility of a foetus to teratogenesis depends on the genotype
of the embryo which interacts with adverse and toxic environmental
factors.
 Teratogenesis is related to the stage of development of the foetus when
exposed to the toxicant.
 Teratogenic agents have well defined mechanisms for producing toxic
effects.
 The type of the teratogenic compound is an important factor that
determines its path to the developing foetus.
 Teratogenesis is mainly characterized by death, malformation, growth
retardation, and functional deficits.
 The extent of altered development increases with increasing dose.
42
Answers to Check Your Progress 2 Teratogenesis

There are many sources of teratogens which can be harmful. They can be
therapeutic drugs, alcohol and even drugs of abuse. Let us learn some of
them in detail.
1) Therapeutic drugs
2) Alcohol
3) Non chemical teratogens
4) Physical agents
5) Environmental toxicants
6) Maternal health factors
7) Drugs of abuse
8) Inhalants
These are some sources and effects of teratogens. You can see how much
damage they can do to the developing embryo. So during pregnancy utmost
care has to be taken by the mother and she should avoid drugs (both
therapeutic as well as of abuse) and non chemical agents. She should be
careful about the food she eats, the water she drinks and the air she breathes
as environmental toxicants are also detrimental.

 Thalidomide: This is a sedative drug that was used in Europe from
1957 to 1961. The drug was actually used for insomnia (sleeping
disorders), nausea, vomiting and morning sickness associated with
pregnancy. It was widely used by women in Europe, Australia, Asia,
Africa, and America. Later on it was observed that the women who
had consumed this drug in the first trimester gave birth to children
who had abnormalities. The birth defects were amelia (absence of
limbs), phocomelia (severe shortening of limbs), absence of the auricles,
deafness, muscular defects of eye and face, malformations of the heart,
bowel, uterus, and the gallbladder. The effect was disastrous with more
than 10,000 affects. So finally the compound was withdrawn from the
market in 1961.
 Accutane (Isotetrinoin): This drug belongs to the retinoid group of
drugs. It is related to vitamin A. The drug is supposed to cure severe
and painful acne. The pregnant women who took this drug were reported
to have children with birth defects including facial deformities, heart
defects, and mental retardation.
 Diethylstilbestrol: This drug is synthetic estrogen which inhibits
ovulation by affecting release of pituitary gonadotropins. It is used in
the treatment of hypogonadism.
 Tetracycline: This antibiotic has the ability to go across the placental
barrier and constituents are deposited in the bones and teeth of the
growing foetus. It can cause yellow stained teeth and bone disorders.
43
Environmental Cytotoxicity  Anticonvulsant agents: The therapeutic drug phenytoin causes foetal
and Genotoxicity
hydantoin syndrome. It results in microcephaly, mental retardation and
intrauterine growth retardation.
 Anti-neoplastic or chemotherapeutic agents: These drugs can stop the
rapidly dividing cells during foetal growth formation. So it should be
totally avoided during pregnancy.

Non Chemical Teratogens
 There may be other non chemical agents also that can be teratogens.
This also can harm the developing foetus. For example Rubella virus
that causes german measles is hazardous and causes teratogenic effects.
It was reported as early as 1941 in Austria. The defects produced vary
with thie stage of gestation (pregnancy). Exposure to this virus during
the first two months of pregnancy causes heart and eye anomalies.
Exposure during the third month of gestation induced hearing anomalies
in the growing foetus. Other biological infectious teratogens include
cytomegalovirus, varicella, herpes simplex, toxoplasma, syphilis,
human immunodeficiency virus (HIV).
Drugs of Abuse
 Drugs used for abuse are highly risky to the developing embryo.
 Cocaine: Cocaine or benzoylmethylecgonine is a teratogen. It is an

alkaloid extracted from the plant Erythroxylum coca. Expsoure to this
drug causes gastrointestinal anomalies, cardiac problems, craniofacial
anomalies, tissue death due to disruption in blood supply to the
developing embryo. It can also cause limb anomalies.
 Opioids: This can cause preterm deliveries, chorioamnionitis, neural

tube anomaly and foetal death.
 Cannabis: This drug can cause low birth weight children and shorter
gestation periods.
 Amphetamines: This can cause microcephaly, oral cleft defects and so

on.
 Hallucinogens: They include phencyclidine, lysergic acid diethylamide

(LSD), and 3,4-methylenedioxymethamphetamine. Phencyclidine
causes microcephaly and intracranial abnormalities. LSD causes limb
defects and eye abnormalities.
44
Teratogenesis
UNIT 4 CYTOTOXICITY AND
GENOTOXICITY PREVENTION
Structure
4.0 Introduction
4.1 Objectives
4.2 Cytotoxicity (Tissue Culture)
4.2.1 Qualitative Cytotoxicity Tests
4.2.2 Quantitative Cytotoxicity - MTT Assay
4.3 Genotoxicity
4.3.1 Prevention of Genotoxicity
4.4 In Vitro Toxicology Testing
4.5 In Vivo Testing
4.6 Bioassays
4.6.1 Principles of Bioassay
4.6.2 Purposes of Bioassay
4.6.3 Types of Bioassays
4.7 Biomarkers
4.7.1 Use of Biomarkers in Oncology
4.7.2 Types of Biomarkers
4.7.3 Use of Biomarkers in Drug Discovery
4.7.4 Biomarkers at Various Organizational Levels
4.7.5 Challenges in Biomarker Research
4.8 Biosensors
4.8.1 Applications of Biosensors
4.8.2 Why Biosensors for Environmental Monitoring?
4.8.3 Biosensors for Environmental Monitoring
4.8.4 Endocrine-effect Biosensors
4.8.5 Biochemical Oxygen Demand
4.9 Microorganisms
4.10 Molecular Strategies
4.11 Fluorescence Strategies
4.12 Chemiluminescence Strategies
4.13 Analytical Strategies
4.14 Electrochemical Methods
4.15 Let Us Sum Up
4.16 Key Words
4.18 Answers to Check Your Progress 45
and Genotoxicity 4.0 INTRODUCTION
In this unit we will discuss about the basic concepts surrounding cytotoxicity and
genotoxicty, how to access cytotoxic and genotoxic potential with the help of some
screening methods like in vitro and in vivo toxicology testing, bioassay, biomarkers,
biosensors, bacterial mutagenesis, gene mutation chromosome damage and DNA
damage and repair assays. The different screening methods have been discussed in an
elaborative manner explaining their purpose, principle, types, methods, advantages
and some of their limitations.
4.1 OBJECTIVES
After reading this unit you should be able to:
 define cytotoxicity and genotoxicity
 understand the basic concepts in cytotoxicity and genotoxicity, and
 explain assessment of cytotoxic and genotoxic potential using toxicologytesting.
4.2 CYTOTOXICITY (TISSUE CULTURE)

Cell culture assays are used to assess the biocompatibility of a material or extract
through the use of isolated cells in vitro. These techniques are useful in evaluating
the toxicity or irritancy potential of materials and chemicals. They provide an
excellent way to screen materials prior to in vivo tests.
4.2.1 Qualitative Cytotoxicity Tests

There are three qualitative cytotoxicity tests commonly used for medical devices.
The Direct Contact procedure is recommended for low density materials, such
as contact lens polymers. In this method, a piece of test material is placed directly
onto cells growing on culture medium. The cells are then incubated. During
incubation, leachable chemicals in the test material can diffuse into the culture
medium and contact the cell layer. Reactivity of the test sample is indicated by
malformation, degeneration and lysis of cells around the test material.
The Agar Diffusion assay is appropriate for high density materials, such as
elastomeric closures. In this method, a thin layer of nutrient-supplemented agar
is placed over the cultured cells. The test material (or an extract of the test material
dried on filter paper) is placed on top of the agar layer, and the cells are incubated.
A zone of malformed, degenerative or lysed cells under and around the test
material indicates cytotoxicity.
The MEM Elution assay uses different extracting media and extraction conditions
to test devices according to actual use conditions or to exaggerate those
conditions. Extracts can be titrated to yield a semi-quantitative measurement of
cytotoxicity. After preparation, the extracts are transferred onto a layer of cells
and incubated. Following incubation, the cells are examined microscopically
for malformation, degeneration and lysis of the cells. At least one type of
cytotoxicity test should be performed on each component of any device.
46
4.2.2 Quantitative Cytotoxicity - MTT Assay Cytotoxicity and Genotoxicity
Prevention
Recent regulatory additions (ANSI/AAMI/ISO 10993-5:2009) on biocompatibility
for devices state that the qualitative cytotoxicity tests (direct contact, mem elution,
agar diffusion) are appropriate for screening purposes, but that quantitative evaluation
is preferable.
Annex C of ISO 10993-5:2009 refers to the MTT cytotoxicity assay, which can
accurately quantify as few as 950 cells. The MTT is a colorimetric method that
measures the reduction of yellow 3-(4, 5-dimethylthiazol-2-yl)- 2,5-diphenyl
tetrazolium bromide by mitochondrial succinate dehydrogenase. Because the
cellular reduction is only catalyzed by living cells, it is possible to quantify the
percentage of living cells in a solution.
The MTT can be used to evaluate the cytotoxicity of:
 Extractable materials of medical devices
 Toxic compounds
 Toxins and environmental pollutants
 Potential anti-cancer drugs
 Antibodies to examine growth inhibiting potential
The major advantages of the MTT are its quantitative ability, that it can be done
on either extracts or by direct contact, and that the results are not subject to
analyst interpretation. Additionally, the MTT can be performed on 96-well
microplates in a standard reader allowing for fast screening of multiple samples.
MTT assay does not discriminate a specific cellular death mechanism - such as
apopotosis vs. induced cell death. Additionally, it may underestimate cellular
damage and only detect death at the last stages of the cellular dying process.
4.3 GENOTOXICITY
Genotoxicity is a very broad term and it means a test material that can damage
DNA and can in fact affect the integrity of the genome such as a test material
affecting the spindle apparatus or DNA chimeras or DNA repair. In some cases
this genotoxic damage is repaired by our onset systems. However in some cases
genotoxic damage means permanent changes in the DNA which we know as
mutations and then some of these mutations can lead to cancer to occur. Genotoxic
damage can be of multiple different types. It can affect the DNA directly or
indirectly. There are single and double stranded breaks in the DNA which can
lead to mutations and inversions of the chromosomes.
Cross linking of nucleotides can occur which results in DNA replication being
locked. In addition, DNA damage can lead to cancerous events such as in silent
(synonymous) mutation. Here C gets replaced by T but that doesn’t replace the
amino acid being translated. But nothing occurs in terms of mutation because of
protein. Missense (substitution), nonsense (termination) and frame shift do affect
the protein translation. Missense affects one amino acid base pair, nonsense
(termination) creates a STOP codon and that don’t keeps the protein so the protein
will not have the same function as it was previously before the mutation. A
frame shift point mutation adds a nucleotide and this has many downstream
effects on the protein translation so the protein would be severely affected with
frame shift mutation. 47
Environmental Cytotoxicity Cells in our cases can repair these types of damages but they are not 100% effective
and Genotoxicity
and when DNA damage becomes permanent it is a mutation. Damage occurring
from genotoxic events can be on the chromosomal level or aneuploidal level so
that is the gain or addition of chromosomes. Not all genotoxic substances are
mutagenic and not all mutagenic substances are carcinogenic. However if the
test material is genotoxic or mutagenic, there is a greater chance that it will be a
carcinogenic test material. Most regulatory agencies require mutagenicity testing.
They have their preferred methodology to access genotoxicity and mutagenicity.
Genotoxicity can lead to damage on DNA level, permutations, the chromosomal

level through inversions and aneuploidal level through the gain or loss of
chromosomes. Not one test can monitor all of these potential endpoints. Multiple
tests are needed to monitor genotoxic damage at the DNA, chromosomal and
aneuploidy. Consequently, many sophisticated techniques including Ames Assay,
in vitro and in vivo Toxicology Tests, and Comet Assay have been developed to
assess the chemicals’ potential to cause DNA damage that may lead to cancer.
4.3.1 Prevention of Genotoxicity

Genotoxic effects such as deletions, breaks and/or rearrangements can lead to
cancer if the damage does not immediately lead to cell death. Regions sensitive
to breakage, called fragile sites, may result from genotoxic agents (such as
pesticides). Some chemicals have the ability to induce fragile sites in regions of
the chromosome where oncogenes are present which could lead to carcinogenic
effects. In keeping with this finding, occupational exposure to some mixtures of
pesticides are positively correlated with increased genotoxic damage in the
exposed individuals. DNA damage is not uniform in its severity across populations
because Individuals vary in their ability to activate or detoxify genotoxic
substances, which leads to variability in the incidence of cancer among
individuals. The difference in ability to detoxify certain compounds is due to
individuals’ inherited polymorphisms of genes involved in the metabolism of
the chemical. Differences may also be attributed to individual variation in
efficiency of DNA repair mechanisms. The metabolism of some chemicals results
in the production of reactive oxygen species which is a possible mechanism of
genotoxicity. This is seen in the metabolism of arsenic which produces hydroxyl
radicals, which are known to cause genotoxic effects. Similarly, ROS have been
implicated in genotoxicity caused by particles and fibres. Genotoxicity of non-
fibrous and fibrous particles is characterized by high production of ROS from
inflammatory cells. Flavonoids have been reported to possess a wide range of
biochemical and pharmacological activities, both potentially detrimental and
protective. One of the effects of flavonoids is the ability to modulate the xenobiotic
metabolism. Various studies have indicated that a potential basis for protection
is interference with enzymes such as cytochrome p450 which plays an important
role in metabolic activation of wide range of carcinogens. Drugs presently being
used as anti mutagenic agents are busulfan, carmustine, etoposide etc. Plant-
derived polyphenolics and other chemicals with antioxidant properties have been
reported to inhibit the expression of genotoxic activity by pro-oxidant chemicals.
In vitro and in vivo studies with ionizing radiation suggest that hydroquinone
may have similar protective effects. Ellagic acid peracetate (EAPA), has
demonstrated time-dependent inhibition of liver microsomes catalysed AFB1-
epoxidation as measured by AFB1 binding to DNA. EAPA was more potent in
preventing bone marrow and lung cells from AFB1- induced genotoxicity. Non-
48
flavonoid compounds such as simple phenolics (C6), phenolic acids (C6-C1), cinnamic Cytotoxicity and Genotoxicity
Prevention
acid and related compounds (C6-C3) also showed anti mutagenic effects.
To assess genotoxic potential a battery of tests are used:
 In vitro tests:
 bacterial tests (e.g. Ames test); gene mutations
The Ames assay is the goal standard assay for analyzing DNA damage. It takes
advantage of five strains of prokaryotic bacteria that have point mutation in the
hystidine biosynthesis gene or tryptophan biosynthesis gene. So these bacterias
cannot produce amino acids.The bacteria will be exposed to the test maerial or
the suspected mutagen in the absence of amino acids. If the test material is
mutagenic, it may cause the mutation to revert back to the wow type so those
bacteria can produce hysidine or tryptophan on and on thus forming revertant
colonies.
 mammalian cell gene mutation assays
 in vitro chromosomal aberration test
 In vivo tests:
 e.g. bone marrow micronucleus test or chromosomal aberration test
 germ cell mutagenicity tests
 ability to cause genetic damage in germ cells
unit.
1) Explain Quantitative Cytotoxicity - MTT Assay.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
2) What do you mean by Genotoxicity.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
49
and Genotoxicity 4.4 IN VITRO TOXICOLOGY TESTING
The purpose of in vitro testing is to determine whether a substrate, product, or
environmental factor induces genetic damage. One technique is cytogenetic assays
using different mammalian cells. The types of aberrations detected in cells affected
by a genotoxic substance are chromatid and chromosome gaps, chromosome
breaks, chromatid deletions, fragmentation, translocation, complex
rearrangements, and many more. The clastogenic or aneugenic effects from the
genotoxic damage will cause an increase in frequency of structural or numerical
aberrations of the genetic material. This is similar to the micronucleus test and
chromosome aberration assay, which detect structural and numerical
chromosomal aberrations in mammalian cells. In a specific mammalian tissue,
one can perform a mouse lymphoma TK+/- assay to test for changes in the genetic
material. Gene mutations are commonly point mutations, altering only one base
within the genetic sequence to alter the ensuing transcript and amino acid
sequence; these point mutations include base substitutions, deletions, frame-
shifts, and rearrangements. Also, chromosomes’ integrity may be altered through
chromosome loss and clastogenic lesions causing multiple gene and multilocus
deletions. The specific type of damage is determined by the size of the colonies,
distinguishing between genetic mutations (mutagens) and chromosomal
aberrations (clastogens). Lastly, the SOS/umu assay test evaluates the ability of
a substance to induce DNA damage; it is based on the alterations in the induction
of the SOS response due to DNA damage. The benefits of this technique are that
it is a fast and simple method and convenient for numerous substances. These
techniques are performed on water and wastewater in the environment.
4.5 IN VIVO TESTING

The purpose for in vivo testing is to determine the potential of DNA damage that
can affect chromosomal structure or disturb the mitotic apparatus that changes
chromosome number; the factors that could influence the genotoxicity are ADME
and DNA repair. It can also detect genotoxic agents missed in in vitro tests. The
positive result of induced chromosomal damage is an increase in frequency of
micronucleated PCEs. A micronucleus is a small structure separate from the
nucleus containing nuclear DNA arisen from DNA fragments or whole
chromosomes that were not incorporated in the daughter cell during mitosis.
Causes for this structure are mitotic loss of acentric chromosomal fragments
(clastogenicity), mechanical problems from chromosomal breakage and exchange,
mitotic loss of chromosomes (aneugenicity), and apoptosis. The micronucleus
test in vivo is similar to the in vitro one because it tests for structural and numerical
chromosomal aberrations in mammalian cells, especially in rats’ blood cells.
4.6 BIOASSAYS
The goal of ecotoxicity is to understand how is to understand how chemicals
produce a damage in some organisms, in some organisms, which organisms will
be which organisms will be affected, and how this affected, and how this affects
the whole receptor environment the whole receptor environment Toxicity can be
defined as the degree to which a Toxicity can be defined as the degree to which
a chemical substance elicits a deleterious or adverse chemical substance elicits a
50
deleterious or adverse effect upon the biological system of an organism stem of an Cytotoxicity and Genotoxicity
Prevention
organism exposed to the substance over a designated time exposed to the substance
over a designated time period Aquatic toxicity, genotoxicity and estrogenicity are
different expressions of toxicity.
Bioassay or biological standardization is a type of scientific experiment. A bioassay

involves the use of live animal or plant or tissue to determine the biological activity of
a substance. Bioassays measure the response that follows the application of a stimulus
to a biological system. Bioassay is a typically conducted to measure the effects of a
substance on a living organism and or essential in the development of new drugs and
monitoring environmental pollutants. Both the procedures bywhich the potencyover
nature of a substance is estimated by studying its effects on living matter. A bioassay
can also be used to determine the concentration of a particular constitution of a mixture
that may cause harmful effects on organisms or the environment.
Bioassays are procedures that can determine the concentration or purity or biological
activityof a substance such as vitamin, human or plant growth by measuring the effect
on organisms, tissue, cells, enzyme or receptor.
Bioassays may be qualitative and quantitative. Qualitative bioassays can be used for
accessing the physical effects of a substance that may not be quantified such as seeds
fail to germinate or develop up normally. One such famous example is on castrated
chickens. This analysis found that by removing the testicles of a chicken, it would not
develop into a rooster because the endocrine signals necessary for this process were
not available.
Quantitative bioassays involve estimation of the dose response curve, however,

response curve changes with increase in dose. That dose response relation allows
estimation of the dose or concentration of the substance associated with the
specific biological response such as the LC-50. Quantitative bioassays are
typically analysed by using the methods of biostatistics
4.6.1 Principles of Bioassay

 To compare the test substance with the international standard preparation
of the same
 To find out how much test substance is required to produce same biological
effects
 Activity assayed should be the activity of interest
4.6.2 Purposes of Bioassay

 Measuring pharmacological activities of new substances.
 Test method employed in measuring the response of living animals to toxicity
of chemical contaminants.
 Investigating function of endogenous mediators.
 Determine concentration and potency of unknown substance.
 Improve and maintain standards of basic environmental conditions affecting
well-being of people.
 To determine specificity of compounds to be used
51
Environmental Cytotoxicity Bioassays can be performed in-vivo as well as in-vitro. In-vivo involves working on
and Genotoxicity
the intact animal whereas in-vitro involves experiment on an isolated tissue.
4.6.3 Types of Bioassays

1) Graded Assay- It is proportional to the dose and response may lie between no
response and maximum response. Graded Responses can be any type of
measured responses in isolated tissues in particular, but also in whole animals.
Such responses are infinitely graded and there are a large number of them.
Examples include contractions of muscle, blood pressure, blood sugar
concentrations, etc.
2) Matching Bioassay- It is the simplest type of bioassay. In this, response of

the test substance is taken first and the observed response is tried to match
with the standard response. Several responses of the standard drug are
recorded till a closed matching point of the test substance is observed. A
corresponding calculation is thus calculated. This assay is applied when the
sample size is too small. Since the assay does not involve the recording of
concentration response curve and the sensitivity of the preparation is not
taken into consideration, therefore, precision and reliability is not very good.
3) Interpolation Bioassay- This is a simplest form of graded response assay

and involves no statistical data and many calculations. In this assay the
dose response curve is first obtained from different doses of standard solution.
The concentration of unknown is then read from the standard graph.
Interpolation method of bioassay is less time consuming and yet reliable
when compared to matching type of bioassay. One of the main advantages
of this assay is that the sensitivity of the tissue is first determined by prior
plotting of a dose response curve with a known agonist as in the case with
acetylcholine. If the linearity of curve is good, one can do very accurate
estimate of the test substance unknown sample.
4) Bracketing Method- Bracketing bioassay is performed by selecting two

standard doses, which will give a close bracket on either side of the response
produced by the unknown. The working dose of standard is first determined
in the sensitive part of dose-response curve, that is, a dose that will
approximately produce 50% of the maximal concentration. The dose of the
standard drug is kept constant throughout the experiment, in order to have
some idea about the change in the sensitivity of tissue with time.
The standard drug is added at fixed intervals but alternating with the test so
that each response produced by a dose of test substance is bracketed by
responses produced by the dose of standard. The response of test substance
is bracketed between two responses of the standard. Close bracketing gives
more accurate results.
5) Three Point Bioassay- In three point bioassay, the DRC of standard & test
samples is first obtained from the responses due to graded doses. From the
DRC of standard, two standard doses are selected in such a way that they
have produced 25% & 50% of the maximal response respectively & are
designated as S1 & S2. The responses of these doses lie on the steepest &
straightest part (linear) of the curve. From the DRC of test sample one test
is selected such that it gives a response which lies in between the two standard
52
responses that is it gives a greater response than S1 & a smaller response than Cytotoxicity and Genotoxicity
Prevention
S2 & is designated as T.
After selecting the standard & test doses, the bioassay is performed by recording
the standard & test responses in randomized fashion as per Latin square design.
The pattern of addition of doses is S1, S2, T; S2, T, S1 & T, S1, S2 in 3
successive cycles. The mean values of height of contraction for all the 3 doses
are calculated and are used in plotting the graph so as to estimate the potency of
the test sample.
The precision and reliability of this method is much better than matching and
bracketing methods of bioassay& the sensitivityof the isolated tissue preparation
is assessed prior to testing the unknown sample.
Advantages: Quick and with more precision than a matching assay. There is a
possibilityof usingcertainstatisticalprocedures althoughnotwith muchconfidence.
Disadvantages: still an inherent lack of precision, no accuracy.
6) Four Point Bioassay- The classic 2X2 parallel assay involves being able to
measure parallelism where drugs acting through the same mechanism are
expected to produce parallel dose-response curves.
7) Seed Bioassay- Seeds are living organisms that may be harmed by chemicals.
The seed bioassay technology has been implied as decisive and lab scale
and method to assess the toxicity of any substance on profitable crops.
The seedling germination and seedling growth impressions under contrasting

concentrations of industrial derivation can give some perception about the
abolishing or toxicological impact of industrial effluents on plants. A lab-
scale bioassay of distillery effluent was conducted using few profitable cereal
crops in order to seed the feasibility of utilizing distillery effluent for crop
irrigation purposes.
8) Antimicrobial Assay- Standard and clinically isolated microorganism strains

were used for antimicrobial assays. A large number of human, animal and
plant disease are caused by pathogenic microbes. Infection due to fungi and
bacteria has been a major cause of death in higher organisms. The discovery
of antibiotic penicillin by Fleming is therefore considered to be one of most
important discoveries in the world. The microbial assay for antibiotics is a
method that uses microorganisms to determine the antimicrobial potency
of the antibiotics contained in medicine.
Historically many of the new antibiotics were isolated from natural sources
like soil microbes and plants. Many more were later synthesized and
introduced in clinical practices. Unfortunately human struggle against
pathogenic microbes is far from over due to many reasons. Most important
of them time to time discovery of new pathogens and remarkable abilities
of microbes to develop resistance against used antibiotic. The discovery
and development of new antimicrobial agent is therefore an ongoing process.
Remarkable diversity of chemicals present in biological samples has
tremendous potential in search of new antimicrobial agents.
53
Environmental Cytotoxicity 9) Antifungal Assay- Fungal infections have been reported to have dramatically
and Genotoxicity
increased in the past decade, and these often occur as systemic infections or
as co-infections with other diseases, such as AIDS or cancer, or in patients
who are immuno-compromised. There is considerable need to discover new
fungi-toxic compounds in view of the many plant and human fungal diseases.
Some of the common plant fungal diseases are potato late blight, tobacco
blue mould, hop downy mildew, Dutch elm disease, ergot of rye, cereal
rusts, corn blight and grape downy mildew. The human fungal diseases
include athlete’s foot, Aspergillosis, Actinomycosis, Histoplasmosis and
Corcidiomycosis. The rapid increase in fungal infections and the growing
number of new antifungal agents indicate an increasing need for rapid and
accurate methods for antifungal screening and susceptibility testing.
Some fungi can be beneficial to man since they attack harmful insects. The
two main methods includes
1) Cylinder Plate Method
2) Paper-disc Method
10) Antimitotic Assay- Antimitotic agents are defined as any applied stimulus
which produces a consistent change/deviation in the mitotic cycle. Inhibition
of cell division is a measure of the antimitotic activity of chemical
compounds. Antimitotic chemical compounds such as vinblastine and
podophyllotoxin have been shown to inhibit cell division of fertilized sea
urchin eggs and starfish oocytes. Normally the reaction should be reversible
with time, removal of stimulus or on the addition of an antagonist.
11) Bioassay for Drugs- Depending upon pharmacological action of various

drugs, different preparations may be used. Following chart gives different
preparations and the pharmacological activity for which a particular drug is
assayed. To estimate the emesis activity of digitalis the pigeon preparation
is used, guinea pig preparation is used to assay the cardiac arrest activity.
12) Environmental Bioassay- Environmental bioassays are generally a broad

range survey of toxicity. The toxicity identification and evaluation is
conducted to determine what the relevant toxicants are.
Although bioassays are beneficial in determining the biological activity

within an organism, they can often be time consuming and laborious.
13) Toxicity Bioassays- Bioassays are methods of developing toxicological

information on organisms whose physiology is considered similar to the
organisms of direct concern with low level of toxic chemical compounds in
an environmentally concerned chamber. Bioassays can provide a measure
of the whole-effect, produce for a complex mixture integrating different
factors, such as: pH, solubility, antagonism or synergism, bioavailability,
etc. The biological response induced by a substance in different test
organisms is diverse. The use of a battery of bioassays involving different
species at different trophic levels is an efficient and essential tool for
predicting environmental hazards to the aquatic ecosystem.
54
An ideal bioassay should be: Cytotoxicity and Genotoxicity
Prevention
Reliable and reproducible; Economical of time and resources;Able to yield statistically
robust data; Relevant, practicable and readily understood by the layman; Able to
utilize test organisms froma reliable stock; Simple to emulate; Regularlyintercalibrated;
With a clearly defined end-point; Sensitive to a wide range of pollutants.
unit.
1) Write short notes on Types of Bioassays.
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
2) Describe in vivo testing.

.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
.....................................................................................................................
4.7 BIOMARKERS
Definition
A biomarker is anything that can be measured as an indicator of biological process.
A biological process is something that can be normally happening in the body or
during the development of a disease or in our spines to a particular medicine in
a patient undergoing treatment.
4.7.1 Use of Biomarkers in Oncology
In oncology, biomarkers are used to provide information about a person’s risk of
developing cancer and to determine the prognosis once the cancer is diagnosed
and in some cases to predict how some patients may respond to particular
medications. For eg. Mutations in the so called PRCA genes are known to increase
a women’s risk of hereditary breast or ovarian cancer.
55
Environmental Cytotoxicity 4.7.2 Types of Biomarkers
and Genotoxicity
There are many different types of biomarkers which include things that are simple to
measure such as high blood pressure as an indicator of increased risk of stroke to
more complex genetic changes or mutations in the genes of tumour cells that can help
to identify a patient’s particular type of cancer.
In relation to the treatment of cancer, biomarkers fall into two main classes:
Prognostic and Predictive

1) Prognostic Biomarkers can provide us information about how the disease is
likely to progress regardless of the treatment a patient receives including how
long a patient is expected to live. These biomarkers can help to determine how
aggressively a patient needs to be treated. For eg. in chronic lymphocytic
leukaemia, the most common among leukaemia’s, about half of the patients
suffer from mutation of the so called immunoglobulin genes. Patients with
these mutations tend to live longer than those patients lacking the mutation.
2) Predictive Biomarkers on the other hand help to determine which patients
are more appropriate candidates to receive a certain medicine thereby
enabling the physicians to choose one treatment over another.
Sometimes biomarkers can be both prognostic and predictive thereby
providing information about how progressive a patient’s disease is as well
as the type of medicine they should receive.
4.7.3 Use of Biomarkers in Drug Discovery

Scientists are always exploring new ways and approaches to understand the basic
biology of cancer and to identify the biomarkers that will help identify the different
pathways that are critical for the growth of particular cancers.
Finding new biomarkers can be of great value in our efforts to determine which
pathways are important to target with new investigation or agents. For eg. work
on the Hedgehog signaling pathway has revealed that this pathway is activated
in basal cell carcinoma, a type of skin cancer.
4.7.4 Biomarkers at Various Organizational Levels

1) Molecular
 DNA adduct or integrity
 Binding to receptor alteration
 Alteration of cell structural elements
2) Biochemical
 Changes in gene expression
 Induction of enzymes and stress proteins
3) Physiological, bioenergetic and reproductive
e.g. Inhibition of growth, and/or reproductive outgrowth
4) Histopathological
e.g. Tissue damage; Imposex
56 5) Behavioural
4.7.5 Challenges in Biomarker Research Cytotoxicity and Genotoxicity
Prevention
Most cancers have common characteristics. There is no “one size fit all” solution
to biomarker discovery. Each drug and disease is different and unique. In order
to determine which patients should or should not receive a particular treatment,
biomarkers must be rigorously tested and validated in clinical studies. In a typically
sized clinical trial, it is easier to see statistically significant differences and how
a drug works in patients who do respond well compared to those who do not
respond there at all. However, for medicines that work well across different
patient’s subtypes, a much larger number of patients are required to reveal a
statistically significant finding if one even exists.
Biomarker research also needs to be interpreted carefully, so people are not

excluded from receiving potentially helpful medicines. For eg. as mentioned
earlier women who have a mutation in one of the PRCA genes have an increased
risk of developing hereditary breast or ovarian cancer. However, it is not that all
women with this mutation will develop breast or ovarian cancer and women
without these mutations cannot develop these diseases.
Currently there are no standard criteria’s to establish to identify those who should
be tested for PRCA mutations and additional studies are underway to determine
how the better use of these biomarkers can be done to access the risk for
developing these cancers. As always it is important to exercise caution when
interpreting research as applied to cancer treatment.
Despite the various challenges associated with discovering biomarkers and testing
their utility regarding clinical studies, biomarkers are currently a critical
component of cancer research. They are more important if they help us to improve
the care that the patients receive. Biomarkers possess the potential to develop
new medicines for cancer patients. The goal should be to match those patients
with the best possible treatments for their specific cancer.
4.8 BIOSENSORS
A biosensor is defined by IUPAC as a self-contained integrated device that is
capable of providing specific quantitative or semi quantitative analytical
information using a biological recognition element (biochemical receptor), which
is retained in direct spatial contact with a transduction element.
Biosensors provide us with detection systems for signaling a potential damage

in the environment (environmental signaling). These responses of early
recognition will prevent the eventual damage in the environmental matrices.
Once an ecosystem damage has occurred, the remedial action processes for
recovery could be expensive and pose certain logistical problems. Ideally, “early
warning signals” in ecosystems using sensing systems (biosensors) would not
only tell us the initial levels of damage, but these signals will also provide us
with answers for the development of control strategies and precautionary
measures.
4.8.1 Applications of Biosensors

Some of the major applications of biosensors are listed below:
57
Environmental Cytotoxicity  Monitoring glucose level in diabetes patients
and Genotoxicity
 Food analysis
 Environmental applications
 Protein engineering and drug discoveryapplications
 Wastewater treatment
4.8.2 Why Biosensors for Environmental Monitoring?

With high specificityand sensitivity, biosensors provide an exceptional analytical system
for the monitoring of environmental pollutants. They are inexpensive and attractive
alternative to the conventional analytical techniques, which are capable of providing
real-time online monitoring. With the diverse effect of these pollutants on the biological
system, a number of biosensors have been developed and are still in progress.Among
toxic compounds, determination of heavy metals, phenolic compounds, mercury,
organophosphorus, and carbamate pesticides is the major concern, considering their
extensive contribution in increased pollutant level. In contrast to direct monitoring,
indirect monitoring of contaminants is gaining importance owing to its high sensitivity
and, thus, rapidlyexpanding its field. With further advancement in the miniaturization,
genetic engineering, and nanotechnology, a new trend is initiating in the biosensor
development race.
The need for disposable systems or tools for environmental monitoring has encouraged
the development of new technologies and more suitable methodologies, the ability to
monitor the increasing number of analytes of environmental relevance as quickly and
as cheaplyas possible, and even the possibilityof allowing on-site field monitoring. In
this respect, biosensors have demonstrated a great potential in recent years and thus
arise as proposed analytical tools for effective monitoring in these programs.
The main advantages offered by biosensors over conventional analytical techniques

are the possibility of portability, of miniaturisation and working on-site, and the ability
to measure pollutants in complex matrices with minimal sample preparation.Although
manyof the systems developed cannot compete with conventional analytical methods
in terms of accuracy and reproducibility, they can be used by regulatory authorities
and by industry to provide enough information for routine testing and screening of
samples.
4.8.3 Biosensors for Environmental Monitoring

Biosensors can be used as environmental quality monitoring tools in the assessment of
biological/ecological qualityelements or for the chemical monitoring of both inorganic
and organic prioritypollutants. Pollutants are usually classified into groups according
to their chemical structure but can also be divided into groups according to their mode
of action, such as endocrine disruption, cytotoxicity, carcinogenicity, mutagenicity, or
genotoxicity. The following sections describe the biosensors that have been developed
for environmental monitoring, considering first those that measure effects, such as
toxicity or endocrine activity, and second, biosensors that detect a compound or a
group of compounds based on the specific biorecognition of a molecule. Within the
latter, a wide variety of compounds of environmental concern or under suspicion are
considered.
Recombinant microorganisms that respond sensitively to a broad variety of chemicals

have been developed to serve as microbial toxicity biosensors. Most environmental
58
biosensors have focused on bacterial systems; eukariotic biosensors are rare. The Cytotoxicity and Genotoxicity
Prevention
mammalian cell, which is more complex than bacteria, can give a more sensitive
response than bacteria.
Sensors for other areas of ecotoxicology, such as genotoxicityand mutagenicity, have

also been developed and have been described as “biosensors for environmental
stresses”. They are often based on the interaction of compounds with nucleic acids or
genetically engineered microorganisms, which are designed to respond to stresses
such as toxicity. Genotoxicityis associated with different compounds, such as phenols,
chlorophenols, PCBs and PAHs, and constitutes an earlywarning screening parameter
for possible cancer-inducing pollution activity. Over the last decade, recombinant
technology has created new luminescent bacteria for application in diverse toxicity
and genotoxicity tests. An example of this is the green fluorescent protein-based
biosensor employed for detecting the activity of genotoxic compounds using
recombinant Escherichia coli strains.
4.8.4 Endocrine-effect Biosensors

The binding ability of the chemicals toward the Estrogen Receptor (ER) can be
measured in biosensors based on these natural receptors in order to screen or test
their potential environmental impact. Using the commonly used human estrogen
receptor, the SPR biosensor BIA core has been applied in the determination of
estrogens and xenoestrogens and in binding studies of target compounds.
Other optical biosensors based on recombinant cells to co-express human ER

have recently been developed for the determination of estrogenic activity in water
samples. In addition to optical biosensors, electrochemical and piezoelectric
biosensors, also based on estrogen receptors, have been developed.
4.8.5 Biochemical Oxygen Demand

Fast determination of BOD could be achieved with biosensor-based methods.
Most BOD sensors rely on the measurement of the bacterial respiration rate in
close proximity to a transducer, commonly the Clark type (an amperometric
sensor developed by Clark in 1956 for measuring dissolved oxygen). Some BOD
sensors have been developed and marketed by various manufacturers in both bio
film and bioreactor-type configurations.
BOD biosensor systems still present a series of limitations that restrict their
applications: the lack of standardisation and legislation in most countries,
complicated maintenance requirements, and insufficient resistance to various
toxic compounds.
Other BOD biosensors recently reported are those based on the photocatalysis of
the sample and on a novel microbial membrane.
4.9 MICROORGANISMS
DNA biosensors can be more specific than immunologically based detection
59
Environmental Cytotoxicity systems, and the sensitivity can be improved by combination with polymerase chain
and Genotoxicity
reaction (PCR) methods. Gene probes are alreadyfinding application in the detection
of disease-causing microorganisms in water supplies, food, or in plants, animal or
human tissues.
Organic Compounds
 Pesticides
Concern about toxicity, ubiquityand persistence of pesticides in the environment
has led the European Community to set limits on the concentration of pesticides
in different environmental waters. Enzymatic sensors, based on the inhibition of a
selected enzyme are the most extensively used biosensors for the determination
of these compounds. Based on the inhibition of acetyl cholinesterase (AChE)
and colin oxidase, various biosensors have been developed for the detection of
organophosphorous and carbamate pesticides. Diazinon and dichlorvos have
been detected at limits around 5 and 75 ìM, respectively, using a tyrosinase-
based oxygen sensor.
Photosynthesis inhibition is an interesting indicator that rapidly reflects the toxic

effect of certain pollutants. Taking advantage of this feature, some biosensors
based on Photosystem II (PSII) have been reported to be able to detect herbicides
in the environment. PSII-based biosensor allowed the detection of herbicides
such as atrazine, simazine, isoproturon and diuron at sub-ìg/L concentration levels.
Biosensors based on immunological detection have also been developed for

pesticides. RiverAnalyzer (RIANA) immunosensor are used for the determination
of pesticides such as atrazine, simazine, isoproturon, 2,4-D, alachlor and paraquat
in natural waters.Aportable SPR flow-through immunosensor has been applied
for the analysis of carbaryl in natural water samples.
 Hormones
Estrone, progesterone and testosterone, along with other organic pollutants,
have been determined with a fully automated optical immunosensor in water
samples, reaching limits of detection up to sub-ng/L.
PCBs Polychlorinated Biphenyls (PCBs)
They are ubiquitous environmental pollutants even though their production

was banned in several countries many years ago. Different biosensor
configurations have been designed to determine PCBs in the environment
such as a DNA biosensor with chronopotentiometric detection and various
immunosensors with fluorescence, SPR and electrochemical detection
principles.
 Dioxins
Dioxins are polychlorinated compounds released as by products in a number
of chemical processes involving chlorine. They are considered carcinogenic
and a potential threat to human health. The DRESSA biosensor based on
the binding of the dioxins to an aryl hydrocarbon receptor has been developed
in hepatome cells. The SPR biosensor for the determination of PCBs was
also employed in the determination of the dioxin 2,3,7,8- TCDD.
60
 Phenols Cytotoxicity and Genotoxicity
Prevention
Phenolic compounds, and especially chlorophenols, are significant
environmental pollutants because of their high toxicity and possible
accumulation in the environment. Chlorophenols have been detected with a flow-
injection chemiluminescence fibre-optic biosensor.
 Bisphenol A
Bisphenol A is a typical product of industrial societies produced in large
quantities worldwide. Although only weakly estrogenic, the determination
of bisphenol A in the environment is very important due to its extensive use
and environmental ubiquity. However, the first biosensors focused on
bisphenol A determination have only recently appeared. Some examples
are immunosensors based on bacterial magnetic particles, on surface plasmon
resonance and on total internal reflection fluorescence. Based on a tyrosinase-
carbon paste electrode, an optical biosensor for phenolic EDCs, including
bisphenol A, nonylphenol and diethylstilbestrol, has also been reported.
 Surfactants
An amperometric biosensor for detection of anionic surfactants was
constructed with Pseudomonas rathonis T (bearing a plasmid for surfactant
degradation) as the biological element. The limit of detection achieved for
sodium dodecyl sulfate (SDS) was 0.25–0.75 mg/L.
 Linear Alkylbenzene Sulfonates (LAS)

Residues of LAS are found in surface waters in the low ìg/L range, and
even though they are not severely toxic, they contribute to the permeation
of other pollutants into aquatic animals. A combination of two whole cell
biosensors was applied to river water samples for the determination of anionic
surfactants. The first biosensor was based on the detection of the dissolved
oxygen consumed in the degradation of LAS by immobilized LAS-degrading
bacteria, but the other sensor, which used T. cutaneum yeast, did not respond
to LAS.
 Alkylphenol Ethoxylates
Alkylphenol ethoxylates (APEs) belong to the group of non-ionic surfactants
whose detection has become more important due to their endocrine-
disrupting properties. In wastewater treatment processes and in the
environment, APEs degrade to alkylphenols (APs), which tend to be more
toxic and show greater estrogenic activity. An amperometric immunosensor
based on a carbon screen-printed electrode has been developed recently for
the determination of nonylphenol with a detection limit of 10 ìg/L.
 Alkanes, Aromatic Compounds

Water-soluble aromatic components of petroleum products (e.g., benzene,
toluene, ethylbenzene, and xylenes) are of particular concern for drinking-
water quality since they can persist in the environment. A green fluorescent
protein-based Pseudomonas fluorescens strain biosensor was constructed
and characterised for its potential to measure benzene, toluene, ethylbenzene,
and related compounds in aqueous solutions. The biosensor is based on a plasmid
carrying the toluene-benzene transcriptional activator.Another microbial whole-
61
Environmental Cytotoxicity cell biosensor, using Escherichia coli with the promoter luciferase luxAB gene,
and Genotoxicity
was developed for the determination of waterdissolved linear alkanes by
luminescence. The biosensor was used to detect the bioavailable concentration
of alkanes in heating oil-contaminated groundwater samples.
 Polycyclic Aromatic Hydrocarbons

Polycyclic aromatic hydrocarbons (PAHs) are very abundant and ubiquitous
carcinogenic compounds. Amperometric biosensors for naphthalene found
in contaminated soils were constructed using Sphingomonas yanoikuyae
B1 and a recombinant Escherichia coli-based biosensor for benzene
determination in air. A sol-derived array DNA biosensor with fluorescence
detection was fabricated to detect PAHs in water and serum samples.
 Antibiotics
Medical substances have been released into the environment with very little
attention so far. The presence of antibiotics in the environment is worrying
since they promote antibiotic resistance. The commercial biosensor
BIACORE 3000 was used to study the cross reactivity between two
sulphonamides: sulfamethazine and furosemide.
 Toxins
A great number of specific sensors for bacterial toxins and mycotoxins have
been developed for food and environmental control. A light-addressable
potentiometric immunosensor based on the commercial device (Threshold)
is developed for the analysis of saxitoxin and ricin. A portable fibre-optic
biosensor and an impedance-based immunosensor have been prepared to
determine staphylococcal enterotoxin B.
 Inorganic Compounds Metals

Biosensors based on urease inhibition are usually applied for the
determination of mercury and have been reported for the determination of
other heavy metals ions as well. Specific recombinant bacterial sensors have
been constructed for the selective determination of certain metals. They are
based on inducible promoters fused to reporter genes (for example, those
that code for bioluminescence proteins, such as luciferase) and are more
sensitive than both chemical analysis methods and nonspecific toxicity
biosensors. Recombinant luminescent bacterial sensors were used for the
determination of the bioavailable fractions of cadmium, zinc, mercury and
chromium in soil and available heavy metals in sediments and soil.
 Inorganic Phosphate
Inorganic phosphate in surface waters can be used as a measure of
eutrophication status of different water bodies, such as surface and sea waters.
Various enzymatic biosensors for phosphate determination have appeared
in the literature in recent years.
 Nitrate
Urban wastewater treatment regulations aim at reducing pollution, including
nitrate pollution, from sewage treatment works and industry. A biosensor
containing immobilized denitrifying bacteria was applied to the
62
determination of NO3 in tap water. Through the reduction of NO3 in a reaction Cytotoxicity and Genotoxicity
Prevention
chamber, N2O was formed and determined by a N2O microelectrode, which
was the sensing element of the biosensor. A whole-cell fluorescence biosensor
based on recombinant Escherichia coli allowed the determination of nitrate without
the interference of phosphate, chloride and nitrite. A conductimetric biosensor
for nitrate was developed using nitrate reductase immobilized on a thin film
electrode, reaching detection limits of 5 ìM.
Despite the huge number of biosensors developed so far, there is still a lack of
biosensing systems for an important group of emerging contaminants such as
phtalates and polybrominated compounds (used as flame retardants), veterinary
and human medicines and personal care products (pharmaceuticals, synthetic
fragrances, sunscreen agents). However, as the world becomes more concerned
about the impact that environmental contamination may have on public health
and ecosystems, the demand for rapid-detection biosensors will only increase,
and new applications of biosensor systems based on new technologies or targeting
new emerging contaminants are appearing constantly.
 Biosensors
Main Advantages
 Rapid and continuous measurement
 High specificity
 Very less usage of reagents required for calibration
 Cost effective
 Fast response time
 Ability to measure non-polar molecules that cannot be estimated by
other conventional devices
Biosensor Limitation
 Heat sterilization is not possible because of denaturation of biological
material
 Stability of biological material (such as enzyme, cell, antibody, tissue, etc.),
depends on the natural properties of the molecule that can be denaturalized
under environmental conditions (pH, temperature or ions)
 The cells in the biosensor can become intoxicated by other molecules that
are capable of diffusing through the membrane
Bacterial Mutagenesis Assays
Bacterial mutagenicity tests, specifically the Salmonella and E. coli reverse
mutation (Ames) test, are widely used and are usually required before a chemical,
drug, pesticide, or food additive can be registered for use. The tests are also
widely used for environmental monitoring to detect mutagens in air or water.
Their use is based on the showing that a positive result in the test was highlypredictive
for carcinogenesis.
TheAmes test is a widely employed method that uses bacteria to test whether a given
chemical can cause mutations in the DNAof the test organism. More formally, it is a
biological assay to access the mutagenic potential of chemical compounds.Apositive
test indicates that the chemical is mutagenic and therefore may act as a carcinogen
63
Environmental Cytotoxicity because cancer is often linked to mutation. The test serves as a quick and convenient
and Genotoxicity
assay to estimate the carcinogenic potential of a compound because standard
carcinogenic assays on mice and rats are time consuming and expensive. In this process,
a pathogenic mutant strain of Salmonella i.e. Salmonella typhimurium is used in which
Histidine has been mutated so also known as His- strain. These types of strain do not
have the ability to produce Hystidine amino acid on their own. Histidine deficient
media is taken for the strain growth and the chemical agent to be tested for
carcinogenicityis poured on the media alongwithSalmonella typhimuriumHis deficient
strain. Most of the chemical agents become more mutagenic when they are processed
in the liver so as to check the mutagenic effect of chemical agents on liver, liver extract
from mice is also added into the plate along with media. The culture plate is then
streaked and is kept at 37°C for 2 days. If the chemical agent is mutagenic, it can turn
the Hystidine gene into its active position which is His+. Now the bacteria are capable
of producing its own Histidine and they can grow easily in the plate. If the chemical
agent is not mutagenic, it will not convert the His- gene into His+ gene.
The disadvantage of this test is false positive results which can occur due to spontaneous
mutation. This can cause His- to change into His+ which will give a false impression
that the induced chemical agent is mutagenic. The way to differentiate between
spontaneous and chemical agent mutation is by checking the formation of colonies in
both the cases. In case of spontaneous mutation, the colonies are wide apart from
each other i.e. scattered which conveys that no mutation is involved in such a case
while in case of mutagenicitydue to chemical agent, the colonies thus formed are well
aggregated. If the plate does not show anycolonyand is clear it shows that the chemical
agent is not mutagenic.
Gene Mutation Chromosomme Damage Assays

Gene mutation assays measure mutagenicity-that is, the ability of a product to induce
point mutations in single genes or blocks of genes resulting from base pair substitutions,
frameshifts, and small deletions or insertions. These methods generallyrelyon reporter
genes, which may be endogenous (e.g. hprt, tk, aprt, Dlb-1 and Pig-a) or transgenes
(e.g. lac Z, lacl and gpt), based on the assumption that a product able to induce
mutations in a reporter gene can also provoke mutations in genes involved in the
initiation and progression of cancer, such as oncogenes (e.g., ras) and tumor suppressor
genes (e.g., p53).
Clastogenicity-the ability to induce structural chromosomal damage-is measured by
detecting gross chromosome abnormalities (e.g., chromatid breaks, and chromosome
rearrangements) with standard cytogenetic methods. Such changes are rarely
compatible with cell viabilityor with transmission to daughter cells. It is assumed that
if such abnormalities are detected, then more discrete stable rearrangements
(translocations or small deletions) are also generated. Changes in chromosome numbers
(aneuploidy) can also be associated with cancer and other human diseases.
The capacity of the different assays to detect relevant genetic changes, and specially
those associated with the risk of cancer, is controversial. Gene mutations and
chromosome damage are considered more relevant than primary DNA damage, and
it is generally accepted that only gene mutation and chromosome damage assays can
establish a genotoxic mode of action.
In vivo Genetic Toxicology Assays to Risk Assessment

In vivo genotoxicity assays are generallycombined with two in vitro genotoxicitytests
64
(a bacterial gene mutation assay and a chromosome damage assay using mammalian Cytotoxicity and Genotoxicity
Prevention
cells). This is because some genotoxic carcinogens provoke genetic damage in animals,
of a nature that cannot readily be detected in vitro. In vivo genetic toxicology assays
are part of the standard battery of regulatory tests required for the development and
registration of products like pharmaceuticals, food additives and pesticides. For other
products such as cosmetics and chemicals, in vivo genetic toxicology assays do not
necessarily belong to the minimal battery of regulatory tests.
For ethical reasons, animal testing of the latter products is mainly recommended (i) if
in vitro genetic toxicity tests are positive, or (2) in case of “high” or “moderate and
sustained” human exposure, or (3) when large amounts of the product are to be released
on the market and, potentially, in the environment. In this regulatory context, in vivo
genetic toxicity assays contribute to genotoxic hazard identification and to human risk
assessment, bypredicting carcinogenic activity and inheritable genetic changes.
One or more in vivo genetic toxicology assays maybe necessary when positive results
are obtained in vitro, in order to increase the weight of evidence and to better evaluate
the human risk. A major advantage of in vivo genetic toxicology assays over in vitro
tests is that they take into account not only intrinsic genotoxic potential, but also
toxicokinetic parameters such as bioavailability, absorption, tissue distribution,
metabolism (activation, detoxification, and excretion), and other factors that onlyexist
in vivo. Individually, theyare generallyconsidered less sensitive (more false-negatives)
but more specific (fewer false-positives) than in vitro assays. They are also thought to
be more relevant to human exposure, being less prone to experimental artifacts,
confounding factors, and irrelevant results. Consequently, a positive result in an in vivo
genetic toxicology assays are helpful for understanding and interpreting the results of
carcinogenicitystudies.
In the case of genotoxic carcinogens, gene mutations and chromosome damage are
generallynecessarybut not sufficient for carcinogenesis, because additional keyevents
such as cell proliferation are required for tumour formation. In other words, most
genotoxic compounds are carcinogens, especially those showing genotoxicityactivity
in vivo, but not all carcinogens exhibit genotoxic activity: some have other mechanisms
of action (e.g. hormone imbalance, enzymatic induction, cell proliferation, andinhibition
of apoptosis).
Importantly, genetic changes can also secondarilyoccur after exposure to nongenotoxic

carcinogens as a result of genetic instability. It is generally agreed that a no-effect dose
level can be determined for nongenotoxic carcinogens that act via well-understood
threshold mechanisms. This notion is not yet fullyaccepted for genotoxic carcinogens,
despite some evidence of thresholds in metabolic activation, repair, and other key
mechanisms involved in the formation of gene mutations and chromosome damage.
Therefore no dose below which no tumorigenic effect would occur can usually be
determined for genotoxic carcinogens, unless mechanistic studies demonstrate that
(a) the primarytarget is not DNA itself but other cell components such as proteins and
(b) DNA damage occurs secondarily.
For example, effects on components of the mitotic apparatus are responsible for
chromosome gain or loss (aneuploidy) as a result of mechanisms such as improper
attachment of chromosomes to the mitotic spindle, failed cytokinesis and an
abnormal number of mitotic spindle poles. In this case, the primary target is
generally not DNA but instead multiprotein complexes involved in chromosome
65
Environmental Cytotoxicity segregation. Thus, a no-effect level can be determined and a safety margin can be
and Genotoxicity
estimated compared with actual human exposure. Consequently, understanding the
mode of action is essential for risk assessment.
Numerous in vivo genotoxicity assays have been developed for research purposes.
The duration of treatment and the dose levels are the most important factors to
be considered because the doses evaluated during long-term treatment are
frequently lower because of more pronounced toxicity. When DNA lesions,
mutations, and damaged cells do not accumulate over time (because of efficient damage
repair or elimination of damaged cells by apoptosis or cell turnover), longer treatment
might result in lower sensitivity. When DNAlesions accumulate over time and damaged
cells are not eliminated (e.g., transgenic gene mutation assays in slowly proliferating
tissues), multiple administrations mayimprove assaysensitivity.
In vivo genetic toxicity end points can be evaluated after multiple administrations in
other toxicology studies- for example, 14 or 28 day general toxicity studies. After
more than 28 days (e.g., 3-month studies), confounding effects such as oxidative
stress, enzymatic induction, and preneoplastic lesions might be expected, leading to
the measurement of secondary rather than primary effects on DNA. Genotoxicity
findings obtained after long-termexposure should therefore be interpreted with caution.
DNA Damage and Repair Assays

DNA is the primary target following exposure to stimuli such as ultraviolet (UV)
radiation, DNA alkylators, certain environmental carcinogens, oxidative stress
and chemotherapeutic drugs. All these damaging factors produce lesions on DNA
and a base alteration promoting a break in the DNA helix. Double-strand breaks
(DSBs) are lethal to cells, as they affect both strands of DNA and promote the
loss of genetic information. DNA damage, which frequently occurs in eukaryotic
cells, may promote genomic instability and aid the development of disease,
including cancer. Following DNA damage, cellular responses are induced and
allow the cell to repair the damage or process the damage via a variety of
mechanisms. Therefore, DNA repair proteins are important biomarkers for
predicting the response of tumors to genotoxic stress and the prognosis of patients
with more accuracy. This highlights the importance of detecting and quantifying
DNA damage.
DNA lesions and the repair mechanisms that maintain the integrity of genomic
DNA are important in preventing carcinogenesis and its progression. Notably,
mutations in DNA repair mechanisms are associated with cancer predisposition
syndromes.Additionally, these mechanisms maintain the genomic integrity of cancer
cells. The majority of therapies established to treat cancer are genotoxic agents that
induce DNA damage, promoting cancer cells to undergo apoptotic death. Effective
methods currently exist to evaluate the diverse effects of genotoxic agents and the
underlying molecular mechanisms that repair DNA lesions.
There are a number of strategies that allow the investigation of these underlying
mechanisms and highlight their importance. These techniques may be separated
into two perspectives: Techniques for detecting DNA damage and techniques
for evaluating the underlying repair mechanisms.
The comet assay (single-cell gel electrophoresis) is a simple method for measuring
deoxyribonucleic acid (DNA) strand breaks in eukaryotic cells. Cells embedded in
66
agarose on a microscope slide are lysed with detergent and high salt to form nucleoids Cytotoxicity and Genotoxicity
Prevention
containing supercoiled loops of DNA linked to the nuclear matrix. Electrophoresis at
high pH results in structures resembling comets, observed byfluorescence microscopy;
the intensity of the comet tail relative to the head reflects the number of DNA breaks.
The likely basis for this is that loops containing a break lose their supercoiling and
become free to extend toward the anode.
The assay has applications in testing novel chemicals for genotoxicity, monitoring
environmental contamination with genotoxins, human biomonitoring and molecular
epidemiology, and fundamental research in DNA damage and repair. The sensitivity
and specificity of the assay are greatly enhanced if the nucleoids are incubated with
bacterial repair endonucleases that recognize specific kinds of damage in the DNA
and convert lesions to DNA breaks, increasing the amount of DNA in the comet tail.
DNA repair can be monitored byincubating cells after treatment with damaging agent
and measuring the damage remaining at intervals.Alternatively, the repair activity in a
cell extract can be measured byincubating it with nucleoids containing specific damage.
4.10 MOLECULAR STRATEGIES

1) Polymerase chain reaction (PCR) and agarose gel electrophoresis. Breaks
in DNA reduce the molecular weight of a single DNA strand, and this may be
caused by physical, chemical or enzymatic reagents. DNA breaks and lesions
may be detected by PCR or using agarose gel electrophoresis. PCR is one of the
most frequently used techniques for detecting DNA damage. DNA amplification
is stopped at the sites of damage via the blocking of the progression of Taq
polymerase, which results in a decrease in the quantity of PCR product and a
reduced number of DNA templates, which do not contain the Taq blocked lesions
as they are not amplified. This is considered to be a simple and reliable method
in which particular segments of DNA are specifically replicated and visualized
using agarose gels that resolve a range of DNA fragments (50-50,000 bp)
dependent on the agarose percentage.
DNA repair proteins that are used as molecular markers:

 Ku Protein: Ku is a heterodimer consisting of two subunits (70 and 80
kDa) that bind to a 470-kDa catalytic subunit termed the DNA-dependent
protein kinase, which is involved in repairing DNA DSBs.
 Phosphorylated Histone 2AX (ãH2AX) Protein: H2AX is a member of the

histone H2A family and it has been established that elevated phosphorylation
levels of H2AX on genomic DNA damage occur within 1-3 min of DNA damage.
The detection of ãH2AX protein phosphorylated at Serine-139 allows an
approach for detecting and quantifying DNA DSBs, as the number of Serine-
139-ãH2AX molecules is associated with the quantityof DNA damage, therefore
it may be used as a marker of DSBs.
 X ray Repair Cross Complementing 1 (XRCC1) Protein: The XRCC1

protein serves an important role in promoting efficient repair of DNA single-
strand breaks (SSBs) in mammalian cells. XRCC1 is able to interact with
multiple enzymatic components that are involved in the repair process,
including DNA ligase IIIa, DNA polymerase â, apurinic/apyrimidinic
endonuclease 1, polynucleotide kinase/phosphatase, poly(ADP-ribose)
polymerase 1 and 2, and 8-oxoguanine DNA glycosylase. 67
and Genotoxicity 4.11 FLUORESCENCE STRATEGIES
 Comet Assay: The comet assay, also known as single-cell gel electrophoresis,
is simple and is considered to be one of the gold standard methods for measuring
DNA strand breaks (single or double) in eukaryotic cells. In addition to being a
method for detecting DNA breaks, it is also possible to detect UV-induced
pyrimidine dimers, oxidized basesandalkylationdamage followingthe introduction
of lesion specific endonucleases.
 This technique identifies the head of the comet as a spherical mass of undamaged
DNA, and the damaged DNA (DNA loops around strand breaks) streams out
from the head as a tail. In the most frequently performed type of comet assay,
cells are embedded in agarose to immobilize the DNA and a lysis process is
performed usinga detergent and high salt. The comet assayhas a limited resolution
of 10-800 kb using standard conditions. Other variants of the comet assay are
also used to assess DNA damage and its detection.
 Alkaline Single Cell Gel Electrophoresis: This version of the comet assay
uses alkaline denaturation surrounding a DNA break to reveal the break
(single or double). This method enhances comet tails and extends the range
of DNA damage that is detected, but sensitivity has not been increased
compared to the use of lesion specific enzymes.
 Neutral Single Cell Gel Electrophoresis: This is a variant of the comet

assay that uses an alkaline treatment, after which the conditions are restored
to neutral, followed by gel electrophoresis in neutral or mild alkaline
conditions. This method is less sensitive but remains able to detect SSBs.
 Use of Lesion Specific Enzymes: The use of lesion-specific enzymes may

aid in the detection of other types of DNA damage, other than SSBs or
DSBs, including oxidized bases or pyrimidine dimers. The enzymes create
an apurinic/apyrimidic site by removing the damaged base; endonucleases
specifically detect oxidized pyrimidines, and formamidopyrimidine DNA
glycosylases detect 8-oxo-7,8-dihydroguanine and ring opened-purines.
 Bromodeoxyuridine Labelled DNA Comet Fluorescence in situ

Hybridization (FISH): This technique combines a comet assay and FISH,
and is effective in detecting damage and repair site specific breaks in DNA
regions in individual cells. This assay may be used to measure and
discriminate between SSBs or DSBs or modifications from DNA repair.
 Halo Assay: This technique is based on the intercalation of PI into the

DNA helix, which causes the DNA to become a supercoiled structure.
Following lysis, the nucleoids of individual cells appear as ‘halos’ that
correspond to DNA loops, which may be measured to determine the
chromatin fragility. The ‘halo’diameter is proportional with PI concentration
and is expressed as relaxed or rewound supercoils at low PI and high PI,
respectively.This method mayaid the studyof the effects of induced DNAdamage,
although it only detects alterations in the organization of DNA if the damage has
not been repaired, which occurs at radiation doses of 2 Gy. This assay has
limitations on its sensitivity, but the advantages are that it is able to measure the
DNA damage of a single cell and no labeling of DNA with radioactive precursors
68
is required. Cytotoxicity and Genotoxicity
Prevention
 Terminal Deoxynucleotidyl Transferase (TdT) dUTP Nick End Labeling
(TUNEL) Assay: The TUNEL assay detects SSBs or DSBs, as well as
levels of apoptosis via the visualization of DNA fragmentation. This assay
primarily uses the ability of the enzyme TdT to incorporate nucleotide
analogues conjugated with a fluorochrome onto the free 3' OH of a DNA
strand, therefore allowing the visualization of the nuclei that contain fragmented
DNA. Additionally, fluorescence may be detected using a fluorescent dye
conjugated antibody that recognizes biotin or digoxigenin-tagged nucleotides.
As the assayis able to detect the DNAfragments with fluorescence or radioactivity,
microscopytechniques, FCM, photo-multipliers and charge coupled device arrays
may be used to detect and quantify DNA damage caused by apoptosis.
 DNA Breakage Detection (DBD) FISH: FISH is a technique for the

visualization of nucleic acids that improves resolution, speed and safety
compared with older methods that use isotopic detection. This technology
also allowed for the development of simultaneous detection of multiple
targets, quantitative analyses and live-cell imaging. FISH is typically used
to locate and examine chromosomal, genetic and genomic aberrations that
are associated with the development and progression of disease. Therefore,
it has clinically important applications in cytogenetic and oncology, including
in identifying gene alterations in patients with cancer.
 FCM Annexin V Labelling: When DNA breakage occurs, it is important

to differentiate between necrosis, autolysis and apoptosis. FCM was
developed to detect apoptosis; this method allows for the measure of a large
number of cells, and is also used to detect DNA strand fragmentation,
chromosomal aberrations and chemical adducts in DNA.
 Radioimmunoassay (RIA): The RIA binding assay is used to measure the

concentration of antigens using specific antibodies. The target antigen is
synthesized with a radiolabel and without a label, and is subsequently bound
to specific antibodies. Standard curves may be obtained from this process
by mixing equal amounts of antibody and radiolabeled antigen, with increasing
concentrations of non-labeled antigen in a constant volume; unknown antigen is
similarly mixed with antibody and radiolabeled antigen, and the concentration
maybe subsequently determined. This assaymay be used to estimate the quantity
of 6-4 photoproducts and cyclobutane dimers in DNA.
4.12 CHEMILUMINESCENCE STRATEGIES

 Enzyme-Linked Immunosorbent Assay (ELISA): This is one of the most
commonly used immunological methods for the quantification of DNA
damage and consists of affixing an unknown quantity of antigen to a surface
and applying an unknown quantity of antibody to the surface so that the
antibody binds to the antigen. The antibody is linked to an enzyme that may be
quantified via the addition of an appropriate substrate (colored, fluorescent or
radioactive).
 ImmunohistochemicalAssay: This assayutilizes fixed cells that have previously

been treated with proteases and RNase. This process removes proteins and
69
Environmental Cytotoxicity RNA, and this ensures that cross-reaction with DNAdoes not occur. Asolution
and Genotoxicity
of PI is used to counter stain the cells. The resulting immunofluorescence allows
for visualizationof thenucleiinadduct-negative cells. Immunohistochemicalassays,
in addition to FISH, have served as a more effective screening and diagnostic
tool to detect alterations in certain metabolites, including the case ofALK gene in
non-small cell lung cancer.
 ImmunologicalAssay: This technique measures the presence of oxidative DNA

via the immunoslot-blot system, and uses chemiluminescent detection and
secondary antibodies that are conjugated to alkaline phosphatase enzymes and
radioactive iodine. This assayis effective, but is limited bythe cross-reactivityof
the antibodies with normal DNA bases.
4.13 ANALYTICALSTRATEGIES
 High Performance Liquid Chromatography (HPLC) Electro SprayTandem
Mass Spectrometry (MS): Oxidative stress and absorption of UV light by
nucleic acids has been established to be one of the causes of oxidative DNA
damage, which may promote cancer development. It is also possible to detect
tandemDNA lesions as dinucleoside monophosphates, and in addition to detecting
the type of DNA damage, HPLC-MS mayalso provide information on the location
and quantity of DNAdamage. Despite the advantage of accuracy, this assay has
the limitations of a high cost and the large amount of experience that is required
to accuratelyuse the technique to monitor the formation of low levels of oxidized
bases within cellular DNA. However, it remains the method of choice for
measuring modified DNA bases.
 Gas Chromatography Mass Spectrometry (GC MS): To understand diverse

cellular processes, including DNA damage, repair and its biological consequences,
it is important to characterize and quantify DNA lesions. MS provides structural
evidence for a biological or chemical analysis, and in combination with gas
chromatography, it enables measurements of more complex samples. GC-MS is
a technique capable of measuring numerous products of DNA damage, including
those of the sugar moiety and heterocyclic bases, as in HPLC-MS. The MS
analysis provides sensitive detection of a single DNA lesion in DNA with multiple
lesions or nucleobases following chemical or enzyme degradation of the nucleic
acids. Additionally, this technique measures the kinetics of a number of DNA
repair enzymes and is able to identify and quantify the expression levels of DNA
repair proteins in human tissues.
4.14 ELECTROCHEMICAL METHODS (EM)

It has been established that DNA may be damaged by reactive oxygen species and
the alterations in DNA that are formed are detected using electrochemical methods
based on the inherent sensitivity of DNA-mediated charge transport (CT). These
methods are also capable of detecting base pair mismatches and the majority of base
damage products. This methodology may detect DNA-mediated CT as a damage
detection mechanism for DNA repair enzymes.
The electrochemical method, electrocatalysis, has provided the basis for novel assays
to detect low levels of lesions and possible for use as an earlydiagnostic tool.Although
70 this is a method that provides sensitive, selective and low cost detection of DNA
damage, it has the limitation of not being able to recognize thymidine dimer lesions Cytotoxicity and Genotoxicity
Prevention
until they are connected with the distortion of DNA double helix.
The importance of the study of DNA damages and how damage may be restored
requires further study, as it has clinical implications in multifactorial diseases,
including cancer and diabetes. There are a number of methods available for the
detection, analysis and quantification of DNA lesions and it is important to identify
the advantages and disadvantages of each approach. The combination of these
methodologies may provide an overview of DNA lesion analysis and other
complementary information.
4.15 LET US SUM UP

In this unit we learnt about:
 Basic concepts of cytotoxicity and genotoxicity
 Different screening methods to test the cytotoxic and genotoxic potential
 Purpose, principle, applications, types, methods, advantages and limitations of
different assays and screening tests like in vitro and in vivo toxicology testing,
bioassay, biomarkers, biosensors, bacterial mutagenesis, gene mutation
chromosome damage and DNA damage and repair assays
4.16 KEY WORDS

Genotoxicity : is a very broad term and it means a test material that
can damage DNA and can in fact affect the integrity
of the genome such as a test material affecting the
spindle apparatus or DNA chimeras or DNA repair.
Antimitotic agents : are defined as any applied stimulus which produces

a consistent change/deviation in the mitotic cycle.
A biomarker : is anything that can be measured as an indicator of

biological process.Abiological process is something
that can be normallyhappening in the body or during
the development of a disease or in our spines to a
particular medicine in a patient undergoing treatment.

READINGS
“Molecule of the year: the DNA repair enzyme”, D. E. Koshland, Science 266: 1925,
1994.
New colon cancer gene discovered”, J. Marx, Science 260: 751-752, 1993.
S. Buratowski, “DNA repair and transcription: the helicase connection”, Science 260:
37-38, 1993.
P. C. Hanawalt, “Transcription-coupled repair and human disease”, Science 266:
1957-1958, 1994.
https://www.azosensors.com/article.aspx?ArticleID=402
71
Environmental Cytotoxicity https://pdfs.semanticscholar.org/f661/70f74da25527ba8ea91319b
and Genotoxicity
98913738f4a72.pdf
https://people.ifm.liu.se/frewi/Agora/Environmental%20biosensors.pdf
http://www.profpdhansen.de/Biosensors%20and%20Ecotoxicology%20-
%20Final.pdf
https://link.springer.com/chapter/10.1007/978-3-319-19018-1_4
https://www.ncbi.nlm.nih.gov/pubmed/15004294
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5452911/pdf/ol-13-06-3982.pdf
Cancer RiskAssessment: Chemical Carcinogenesis, Hazard Evaluation, and Risk

Quantification. Edited by Ching-Hung-Hsu and Todd Stedeford (2010),
John Wiley and Sons

The MTT can be used to evaluate the cytotoxicity of:
 Extractable materials of medical devices
 Toxic compounds
 Toxins and environmental pollutants
 Potential anti-cancer drugs
 Antibodies to examine growth inhibiting potential
Genotoxicity is a very broad term and it means a test material that can damage
DNA and can in fact affect the integrity of the genome such as a test material
affecting the spindle apparatus or DNA chimeras or DNA repair. In some
cases this genotoxic damage is repaired by our onset systems. However in
some cases genotoxic damage means permanent changes in the DNA which we
know as mutations and then some of these mutations can lead to cancer to occur.
Genotoxic damage can be of multiple different types. It can affect the DNA
directly or indirectly. There are single and double stranded breaks in the DNA
which can lead to mutations and inversions of the chromosomes.
 Graded Assay
 Matching Bioassay
 Interpolation Bioassay
 Bracketing Method
 Three Point Bioassay
72  Four Point Bioassay
 Seed Bioassay Cytotoxicity and Genotoxicity
Prevention
 Antimicrobial Assay
 Antifungal Assay
 Antimitotic Assay
 Bioassay for Drugs
 Environmental Bioassay
 Toxicity Bioassays
The purpose for in vivo testing is to determine the potential of DNA damage
that can affect chromosomal structure or disturb the mitotic apparatus that
changes chromosome number; the factors that could influence the
genotoxicity are ADME and DNA repair. It can also detect genotoxic agents
missed in in vitro tests. The positive result of induced chromosomal damage
is an increase in frequency of micronucleated PCEs. A micronucleus is a
small structure separate from the nucleus containing nuclear DNA arisen
from DNA fragments or whole chromosomes that were not incorporated in
the daughter cell during mitosis. Causes for this structure are mitotic loss of
acentric chromosomal fragments (clastogenicity), mechanical problems from
chromosomal breakage and exchange, mitotic loss of chromosomes
(aneugenicity), and apoptosis. The micronucleus test in vivo is similar to
the in vitro one because it tests for structural and numerical chromosomal
aberrations in mammalian cells, especially in rats’ blood cell.
73

Block-04 Environmental Cytotoxicity and Genotoxicity

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Block-04 Environmental Cytotoxicity and Genotoxicity

Uploaded by

Copyright:

Available Formats

ignou MEV-004

Tessa Media & Computers

BLOCK PREPARATION TEAM

COURSE COORDINATOR CONTENT EDITORS

Unit 1 deals with carcinogenicity. The terms such as pro-carcinogens, carcinogens

Marginal Remarks: In their 60s human beings face an exponentially increased

MR: carcinogenesis defines the initiation of a tumor, while oncogenesis defines

Carcinogens can be categorized in many ways. Weisburger in 1976 distinguished

1) Direct Action or Ultimate Carcinogens

Co-carcinogens are chemical substances that have a helper role in

1.3 CLASSES OF CARCINOGENS

Based on their cancer causing potential International Agency for Research on

Carcinogenic factors or carcinogens may also be classified as physical or

1.3.1 Physical Carcinogens

UV radiation exerts its effect on cells by induction of mutation, inhibition of

Non-radiation carcinogens Injury from stones in gall bladder or urinary tract,

1.3.2 Biological Carcinogens

Infection by a parasite Schistosoma haematobium, is associated with carcinoma

MR: DNA oncogenic viruses: DNA is the genetic material

1) Tick [] mark the correct option

1.4.1 Chemical Carcinogenicity

b) Acylating agents: They include acetyl imidazole and dimethyl carbamyl

ii) Indirect acting carcinogens/pro-carcinogens: These require prior metabolic

Promoter Carcinogens: These chemicals lack the intrinsic carcinogenic potential

Table 1.2: Characteristic features of Initiator and Promoter Carcinogens

S.No Feature Initiator Carcinogens Promoter Carcinogens

During the past three decades, researches have led to accumulation of an

Certain genetic alterations (point mutations) in cancer genes accumulate

ii) Aneuploidy Theory

iii) Epigenetic Theory

1.4.3 Mechanism of Action

Initiation of Carcinogenesis: It is the first step induced by initiator chemical

Promotion of Carcinogenesis: Promotion is the next sequential stage in chemical

Progression of Carcinogenesis: Progression of cancer is the stage when

1.5 LET US SUM UP

b) A cancerous cell possesses the ability of uncontrolled cell proliferation. It is

c) Agents/chemicals which can induce tumors are known as carcinogens.

d) International Agency for Research on Cancer (IARC) which is a part of

e) Carcinogens may also be classified as physical or biological factors. Physical

f) Carcinogenesis is a process of development of cancer. Cancer development is

1.6 KEY WORDS

1.7 REFERENCES AND SUGGESTED FURTHER

Weisburger JH. 1976. Environmental cancer. J.Occupat. Med. 18: 245–252.

1.8 ANSWERS TO CHECK YOUR PROGRESS

2) What are the effects of mutagens?

Gene mutations can be classified in two groups.

A) Base Pair (Nucleotide Pair) Substitutions

The consequences of base substitution mutations in protein coding regions

These mutations occur as a result of the insertion or deletion of one or more

2.4 ORIGINS OF SPONTANEOUS MUTATIONS

B) DNA Replication Errors and Polymerase Accuracy

D) Spontaneous Frameshift Mutations

5' AGTCAATCCATGAAAAAATCAG 3'

3' TCAGTTAGGTACTTTTTTAGTC 5'

It is possible to distinguish chemical mutagens by their modes of action;

Table 2.1 Chemical Mutagens and Their Mode of Action

These chemicals structurally resemble purines and pyrimidines and may be

 bromouracil (BU) artificially created compound extensively used in

2) Chemicals which Alter Structure and Pairing Properties of Bases

 Nitrosoguanidine, Methyl Methanesulfonate, Ethyl

4) Agents Altering DNA Structure

Type of Radiation Main Properties Mode of action or changes

1. X-rays S.I., penetrating and non- Induce mutations by forming