Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.

099-46

Journal of Dermatological Science 78 (2015) 26–33

Contents lists available at ScienceDirect

Journal of Dermatological Science

journal homepage: www.jdsjournal.com

The biological basis for poly-L-lactic acid-induced augmentation§

Philipp Stein a,*, Olga Vitavska b, Peter Kind c, Willi Hoppe d, Helmut Wieczorek b,
Nanna Y. Schürer a
a
Division of Dermatology, Department of Environmental Medicine and Health Theory, University of Osnabrück, Sedanstraße 115, 49090 Osnabrück, Germany
b
Division of Animal Physiology, Department of Biology/Chemistry, University of Osnabrück, Barbarastraße 11, 49076 Osnabrück, Germany
c
Institute for Dermatopathology, Kleiner Biergrund 31, 63065 Offenbach, Germany
d
Division of Biomedical Science, Department of Human Sciences, University of Osnabrück, Albrechtstraße 28, 49076 Osnabrück, Germany

A R T I C L E I N F O A B S T R A C T

Article history: Background: Granulomatous reactions to poly-L-lactic acid (PLLA)-based filler have been described
Received 2 October 2014 previously. Neither the biological background of these partly late-onset reactions or the desired
Received in revised form 29 December 2014 augmenting effect of PLLA has been studied to date. Histological studies have revealed foreign body
Accepted 20 January 2015
reactions and foreign body giant cell formation.
Objective: The aim of this study was to increase our knowledge about the biological mechanisms behind
Keywords: the augmenting effect of PLLA-based filler.
Poly-L-lactic acid
Methods: We characterised the cell infiltrate and collagen type of PLLA-treated tissue by immunofluo-
Filler
Macrophages
rescence staining. The expression of genes related to collagen metabolism was determined.
(Myo-)fibroblasts Results: CD68+ macrophages were found next to PLLA. CD90+ fibroblasts were found alongside. aSMA-
Collagen type III positive structures indicated myofibroblasts and neovascularisation. Substantial collagen type III
Collagen type I deposition was detected next to PLLA particles and collagen type I was found at the periphery of PLLA
encapsulations. mRNA expression for collagen type I and III transcripts, as well as for TGFb1 and TIMP1,
was upregulated significantly.
Conclusion: PLLA-induced augmentation is most likely based on capsule formation orchestrating
macrophages, (myo-)fibroblasts, and collagen type I and III fibres. We observed considerably slower
degradation of PLLA particles than described previously. Thus PLLA particles were still retrievable 28
months after subcutaneous application.
ß 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights
reserved.

1. Introduction injection techniques and product dilutions in order to optimise its

Poly-L-lactic acid (PLLA) has been marketed for more than 14
years in Europe. The FDA approved PLLA for the treatment of
HIV-associated facial lipoatrophy in 2004 and subsequently in
2009 for its aesthetic use for the treatment of age-related wrinkles.
Many studies have addressed its augmenting effect and discussed
§
This study was funded by Sanofi-Aventis from 2009 to 2011. This included all
materials, subjects and students fee. Sanofi offloaded its Dermik skincare business
to Valeant in 2011. Since 2011 the study was conducted independently. We
previously secured our rights to publish free and independently. The funding source
had no involvement in the collection, analysis and interpretation of data; in writing
of the report; and in the decision to submit the article for publication.
* Corresponding author. Tel.: +49 541 405 1824; fax: +49 5419692445.
E-mail address: pstein@uos.de (P. Stein).
benefits and minimise adverse reactions [1–4].
The effects of polylactic acid on tissues have been examined in
rodents [5–7]: the infiltration of lymphocytes and giant-cell-
forming macrophages has been documented and activated
fibroblasts were observed [8]. 14C-marked polylactic acid was
metabolised to CO2 and H2O and could not be retrieved from lymph
nodes or other organs [6,7].
Three months after PLLA-implantation into the forearm of one
individual, Lemperle and colleagues observed a fine capsule of
extracellular matrix (ECM) surrounding PLLA microspheres as well
as an infiltrate of macrophages and lymphocytes [9]. Six months
later PLLA microspheres were still surrounded by macrophages
and giant cells, while 9 months later they were invisible upon light
microscopy and were considered completely degraded. Nasolabial
tissue biopsies of a 55-year-old woman revealed the aggregation of
giant cells, histiocytes and collagen fibres 12 months after the last

http://dx.doi.org/10.1016/j.jdermsci.2015.01.012
0923-1811/ß 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.099-46
P. Stein et al. / Journal of Dermatological Science 78 (2015) 26–33
PLLA-injection and PLLA-free, collagen-enriched tissue 30 months
thereafter [10]. The authors assumed progressive dissolution of
PLLA microspheres and the concurrent stimulation of type I
collagen synthesis. PLLA-encapsulation led to the conclusion that
the observed augmentation is based on collagen synthesis [3].
Goldberg and colleagues analysed picro Sirius red stained PLLA-
treated tissue sections and quantitatively assessed collagen I and
III by digital microscopy. Type I but not type III collagen was
increased compared to untreated tissue [11].
Material encapsulation and inflammatory cell infiltration are
characteristic foreign body reactions (FBR) to biomaterials [12–
14]. Depending on the surface property of a given foreign material,
distinctive extracellular proteins may become attached. Hence
subcutaneous PLLA injections are accompanied by minimal injury,
and serum proteins extravasate. The combination and concentra-
tion of these proteins as well as their conformational changes
determine the attachment of cells [15]. Host proteins that are
absorbed onto the surface of biomaterial include albumin,
complement fragments, fibrinogen, fibronectin, immunoglobulin
G and vitronectin [16,17]. Fibrinogen, complement and vitronectin
are recognised by integrin receptors of macrophages and
neutrophils [18]. To stimulate inflammatory cell immigration,
mast cells degranulate and release histamine [19,20]. Furthermore,
monocytes and Th2 helper cells infiltrate the tissue. Monocytes
mature to macrophages, and release chemoattractants, guiding
even more macrophages to the foreign material [21]. Platelets and
subsequently macrophages produce platelet-derived growth
factor (PDGF) and transforming growth factor beta (TGFb),
supporting fibroblast immigration [22–24]. While TGFb seems
to be the key mediator for collagen synthesis and fibroblast
differentiation to alpha smooth muscle actin (aSMA)-rich myofi-
broblasts, their contractile form, PDGF promotes the proliferation
of myofibroblasts [25,26]. Macrophages fuse under the influence of
IL-4 and/or IL-13 to foreign body giant cells (FBGCs), if the foreign
material cannot be phagocytised [27,28]. Under alternatively
activated conditions macrophages produce profibrotic factors, like
TGFb1 and PDGF, which stimulate local fibroblasts to produce
extracellular matrix collagen, finally leading to the encapsulation
of foreign material [29].
The ECM consists mainly of collagen type I and III fibres,
building up a scaffold in which matrix-producing fibroblasts are
anchored via transmembrane integrin receptor binding. This
stretches the fibroblasts, providing cell integrity and ensuring
the balanced production of collagen, i.e. ECM and matrix-
degrading matrix metalloproteinases (MMPs). Besides MMPs,
fibroblasts can also release tissue inhibitors of matrix metallo-
proteinases (TIMPs).
In aged skin collagen fibres fragment, and fibroblasts lose their
stability and collapse. A reduction in collagen production and
increased MMP production consequently lead to laxity of the skin
[30].
To counteract this cascade, filler injections are increasingly
being given. In 2013 approximately 1.8 million injections of
hyaluronic acid derivatives were administered in the USA (increase
of 31.5% compared to 2012), along with approximately 160,000
injections of calcium hydroxylapatite (increase of 24.1% compared
Table 1
PLLA injection and biopsy time schedule. The first biopsy was taken prior to the first PLLA injection (baseline). PLLA was injected four times in three-month intervals. Two
weeks after each injection, either group A or B or C was biopsied. For long-term observation, further biopsies were taken in months 18 and 20. One female volunteered for a
fourth biopsy in month 38.
Month 0 0.5 3 3.5
PLLA injection X X
Biopsy Group A, B, C baseline Group A Group B
27
to 2012) and approximately 87,000 injections of PLLA (increase of
25.7% to 2012) (Cosmetic Surgery National Data Bank 2013). While
recent molecular and biochemical work has focused on the
mechanism of action of hyaluronic acid-based fillers [31,32], no
such data are available concerning PLLA-based fillers. To investi-
gate human tissue reactions to PLLA, a prospective study was
conducted on 21 volunteers in order to close the gap between the
missing molecular and biochemical knowledge and the observed
clinical effect of PLLA. The mRNA expression of genes related to
collagen metabolism was analysed by quantitative PCR, and the
respective expression of proteins was studied immunohistochemi-
cally.
2. Materials and methods
This single centre, prospective, randomised, in vivo study was
conducted at the University of Osnabrück, Germany according to
the ethical principles of the declaration of Helsinki and the
institutional ethical committee. Each volunteer gave informed
consent to participate in the study. Exclusion criteria included soft
tissue diseases, excessive UV light exposure, hormonal therapy,
nicotine abuse and the use of medication with a known effect on
soft tissue metabolism.
2.1. Study design
Twenty-one healthy postmenopausal women, aged 56.9  7.5,
with skin phototypes I–II, volunteered to participate in a 20-month
trial, during which they each received a total of 600 mg PLLA per
upper arm, for a total of 1200 mg PLLA per volunteer. Each 150 mg
vial was dissolved in 8 ml of distilled water plus 2 ml of xylocaine 2%
(total volume = 10 ml). Subcutaneous injections were performed
every 3 months to both ventral aspects of the upper arm (Table 1).
Volunteers were divided at random into three groups, characterised
by different biopsy time points. Prior to the first injection, a 3-mm-
deep punch biopsy was taken of the area to be treated. Each volunteer
was biopsied twice thereafter, i.e. 2 weeks after injections #1 and #4
(group A), 2 weeks after injection #2 and 8 months after the last
injection (group B), or 2 weeks after injection #3 and 10 months after
the last injection (group C). PLLA injections and further biopsies were
carried out adjacent to the initial biopsy scar, avoiding excision of scar
tissue. One half of each biopsy was snap frozen in liquid nitrogen for
further molecular biological analysis and the other half was fixed in
4% formaldehyde for light and fluorescence microscopy.
2.2. Histological analysis
Formalin-fixed tissues were embedded in paraffin and sec-
tioned. Some sections for brightfield microscopy were stained with
haematoxylin & eosin (H&E). PLLA particles were detected by
polarised light or differential interference contrast (DIC). For
immunofluorescence staining paraffin cross-sections were depar-
affinised in xylene and rehydrated in an ethanol dilution series.
Antigen retrieval treatment was performed for 15 min in boiling
sodium citrate buffer (10 mM sodium citrate, 0.05% Tween 20, pH
6.0 at room temperature) or in Tris-EDTA buffer (10 mM Tris,
6 6.5 10 10.5 18 20 38
X X
Group C Group A Group B Group C Volunteer #9
Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.099-46
28 P. Stein et al. / Journal of Dermatological Science 78 (2015) 26–33
1 mM EDTA, 0.05% Tween 20, pH 9.0 at room temperature). After
that cross-sections were blocked with 2% bovine serum albumin
(BSA) in phosphate-buffered saline (PBS) (137 mM sodium
chloride, 10 mM phosphate, 2.7 mM potassium chloride, pH
7.3) and 0.1% Triton X-100 for 30 min. For immunofluorescence
staining primary mouse monoclonal antibodies to human
collagen type I (ab90395), human alpha smooth muscle actin
(ab7817), human CD68 (ab955), rabbit polyclonal antibody to
human collagen type III (ab7778) (all from Abcam, UK) and
sheep polyclonal antibody to human CD90/Thy-1 (R&D Systems,
Germany) were incubated in 2% BSA/0.1% Triton/PBS overnight
at 4 8C. After rinsing with PBS (with and without 0.1% Triton)
cross-sections were incubated for one hour at room temperature
with anti-mouse IgG Cy3 (Sigma-Aldrich, Germany), anti-sheep
Alexa Fluor 647 (Invitrogen, Germany) or anti-rabbit IgG Alexa
Fluor 647 (ab150075, Abcam, UK) in 2% BSA/0.1% Triton/PBS.
Nuclei were stained with 40 ,6-diamidino-2-phenylindole (DAPI).
Finally tissues were washed as before, and were mounted in
Vectashield mounting medium (Vector Laboratories, USA). The
cross-sections were analysed by one of Olympus microscopes
(BX60, IX70 or IX81 with a confocal laser scanning FV1000 unit)
using software such as Cellp, Metamorph and FV-ASW Version
3.0, respectively.
2.3. Gene expression
Tissues were homogenised and total RNA was isolated from
tissue samples using the RNeasy Fibrous Tissue Mini Kit
(Qiagen, Germany) according to the manufacturer’s instruc-
tions, including a DNase I digestion. Total RNA, checked for
purity and concentration, was quantified spectrophotometri-
cally using the Implen NanoPhotometer1 (Implen, Germany).
Reverse transcription was carried out in the ThermoScript RT-
PCR System (Invitrogen, Germany) using avian reverse tran-
scriptase with reduced RNase H activity, 200 ng RNA as
template, oligo (dT)20 primers and dNTP mix. The iCycler
realtime PCR system (Biorad, Germany) and Maxima SYBR
Green/Fluorescein qPCR Master Mix (Fermentas, Germany)
were used to quantify cDNA. Amplification was carried out in
25 ml triplicates for each sample containing 75 ng cDNA.
Primers (Table 2) were purchased from Eurofins MWG Operon
(Germany). Cycling conditions comprised an initial 10 min at
95 8C, followed by 35 cycles (95 8C for 30 s, 58 8C for 20 s and
72 8C for 30 s). Data were collected at the end of the extension
step. Product specificity was checked by melting curve
analysis. The results were normalised to the mRNA level of
the housekeeping gene RPLP0 [33] using q-Gene [34]. The
statistical significance between the expressions at different
time points was determined for each group by the Wilcoxon
test using SPSS1 (Version 22; IBM Corporation, Somers, NY,
USA).
Table 2
Primer sequences.
Gene Forward primer Reverse primer
RPLP0 GCGACCTGGAAGTCCAACTA TCCTTGGTGAACACAAAGCC
Col1A1 CAAAGTCTTCTGCAACATGG TCTGCTGGTCCATGTAGG
Col3A1 AAGGGGAGCTGGCTACTTC GAGTAGGAGCAGTTGGAGG
ACTA2 ACAATGAGCTTCGTGTTGCC AGGTAGTCAGTGAGATCTCG
TGFB1 GACATCAACGGGTTCACTAC GTCCAGGCTCCAAATGTAGG
TIMP1 AAAGGGTTCCAAGCCTTAGG AGGGAAACACTGTGCATTCC
DN AGCAAAGTTAGTCCTGGAGC GCAATGCGGATGTAGGA
PDGFB TGTCCAGGTGAGAAAGATCG TGCGTGTGCTTGAATTTCCG
CTGF AGTTTGAGCTTTCTGGCTGC CATGTCTCCGTACATCTTCC
3. Results
No dropouts were documented during this 20-month study. Six
of the 21 volunteers developed palpable patches of small nodules
in the PLLA-treated upper arms.
Biopsies of eight volunteers with a massive invasion of
lymphocytes and macrophages showed the latter forming FBGCs
on birefringent PLLA particles in the H&E stained tissue sections
(Fig. 1a and b). These findings are characteristic of FBR to polylactic
acid and PLLA, as previously described in rodents and humans
[8,9,35,36]. This reaction pattern was observed in every biopsy
with detectable PLLA particles. However, PLLA particles were
detected in the tissues of eight of the 21 volunteers (38%). In one
case, PLLA was detected after two PLLA injections, and in the
additional seven cases, after four injections. Biopsies from the
other 13 volunteers did not reveal any birefringent PLLA particles.
Thus even though subsequent biopsies were taken adjacent to the
baseline biopsy scar, PLLA was retrieved via punch biopsy in only
38% of treated cases. PLLA particles were detected in one biopsy 28
months after the last injection. Comparison of particle with those
collected 10 months after the last injection did not reveal any
significant change in shape or size.
To characterise the cell infiltrate, immunofluorescence staining
of PLLA-treated tissue was compared to that of untreated tissue.
Cell markers for macrophages (CD68), fibroblasts (CD90) and
myofibroblasts/endothelial cells (aSMA) were visualised using
specific antibodies. Twenty-eight months after the last PLLA
injection CD68+ cells were retrieved in direct conjunction with
PLLA particles in an inner cell layer (Fig. 2e). The alignment of
CD90+ cells was documented in an outer cell layer (Fig. 2f).
Furthermore, aSMA staining revealed plenty of myofibroblasts and
more vessels upon visual comparison with the control tissue
(Fig. 3a and b).
To examine whether PLLA injections have an impact on the gene
expression of collagen, its mRNA was analysed quantitatively.
Collagen type I mRNA expression is shown in Fig. 4a. The mean
normalised expression of untreated tissue in groups A, B and C
varied between 0.6 and 1.0. Two weeks after the first PLLA
injection, the mean normalised mRNA expression level increased
significantly up to 2.58 in group A. The following three biopsy time
points were exactly 2 weeks after the PLLA injections at 3-month
intervals. The mean normalised expression varied between
2.04 and 3.25 and was significantly upregulated. For long-term
observation biopsies were taken 8 months (group B) and 10
months (group C) after the last PLLA injection. In comparison to
untreated tissue the mean normalised collagen mRNA expression
was still elevated at 1.97 (group B) and significantly elevated at
2.05 (group C).
Fig. 4b represents the mRNA expression of collagen type III.
Untreated tissue exhibited normalised expression of between
0.08 and 0.14 in groups A, B and C. Two weeks after the first PLLA
injection the mean normalised mRNA expression level increased
significantly to 0.3 in group A. The following three biopsy time
points were exactly 2 weeks after the PLLA injections at 3-month
intervals. The mean normalised expression varied between
0.12 and 0.43 and was significantly increased in group A (0.43).
For long-term observation biopsies were taken 8 months (group B)
and 10 months (group C) after the last PLLA injection. In
comparison to untreated tissue the mean normalised collagen
mRNA expression was still elevated. Interestingly PLLA particles
were substantially encapsulated by collagen type III (Fig. 4h).
Collagen type I was not found in close proximity to the PLLA
particles or cellular infiltrate (Fig. 4g), but at the periphery of the
granulomatous reactions (Fig. 5).
We also measured the mRNA expression of TGFb1 and TIMP1,
platelet-derived growth factor subunit B (PDGFB), connective
Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.099-46

P. Stein et al. / Journal of Dermatological Science 78 (2015) 26–33 29

Fig. 1. Light microscopy of PLLA-treated tissue. Haematoxylin and eosin-stained human tissue from the upper arm representative of n = 8 individuals illustrates inflammatory
responses to PLLA (a, b). Birefringent PLLA particles were visualised by polarised light (b).

Fig. 2. Characterisation of inflammatory cell infiltrate. (a) PLLA particle is surrounded by capsule tissue visualised in DIC view. Immunofluorescence staining revealed CD68+
macrophages (red, e) in the first cell row and CD90+ fibroblasts (green, f) in the second cell row in close proximity to PLLA. Nuclei (blue, d) were visualised by 40 ,6-diamidino-2-
phenylindole (DAPI). All channels were merged in b, without DIC in c.

Fig. 3. aSMA positive structures in PLLA treated tissue. Immunofluorescence staining of PLLA-treated tissue (month 18) revealed aSMA+ (light blue) myofibroblasts (a, black
arrows) and a large number of aSMA+ endothelial cells in vessel-like structures (b, white arrows). Nuclei (blue) were visualised by 40 ,6-diamidino-2-phenylindole (DAPI).
Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.099-46

30 P. Stein et al. / Journal of Dermatological Science 78 (2015) 26–33

Fig. 4. Collagen encapsulation of PLLA particles. (a, b) mRNA expression of collagen type I and III is upregulated in PLLA-treated tissue. Basal gene expression of collagen type I
(a) and type III (b) prior to PLLA injection is represented by the first three bars (group A, B, C). The next four bars represent mRNA expression 2 weeks after each PLLA injection
for the indicated groups. The second last bar represents mRNA expression 8 months and the last bar 10 months after the last PLLA injection. Mean normalised expression is
illustrated as mean  SD from triplicates of seven individuals. *P < 0.05. (c) PLLA surrounded by capsule tissue visualised in DIC. Immunofluorescence staining revealed substantial
positive collagen type III staining (green, h) and no collagen type I (red, g). Nuclei (blue) were visualised by 40 ,6-diamidino-2-phenylindole (DAPI, f). All channels were merged in (d),
without DIC in (e).

tissue growth factor (CTGF), Decorin and aSMA. The mRNA
expression of TGFb1 is presented in Fig. 6a. Untreated tissue
exhibited normalised expression of between 0.03 and 0.04 in
groups A, B and C. The mean normalised expression of TGFb1
increased after the first (0.05) and the fourth and last injection
(0.13) significantly in comparison to untreated tissue and was even
higher 8 months after the last injection at 0.19. Ten months after
the last injection the mean normalised expression of TGFb1 was
still significant elevated, at 0.13. Like the mRNA expression of the
TGFb1 gene, that of the TIMP1 gene increased after the first (0.26)
and after the fourth and last injection of PLLA significantly (0.77;
untreated tissue: 0.10–0.15) (Fig. 6b). At 8 months (0.53) and 10
months (0.45) later, the mRNA expression was still significantly
elevated compared to the untreated tissue. Gene expression
analysis of PDGFB, CTGF, Decorin and aSMA revealed that, with the
exception of after the first injection, there were no changes
compared to untreated control tissue (Fig. S1). Interestingly the
expression of each mRNA was elevated 2 weeks after the first
injection, but not significantly.
Supplementary Fig. S1 related to this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.jdermsci.2015.
01.012.
Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.099-46

P. Stein et al. / Journal of Dermatological Science 78 (2015) 26–33 31

fibroblasts to proliferate and to synthesise collagen [29]. Specific

Fig. 5. Collagen type I in the periphery of PLLA particles. Immunofluorescence
staining of PLLA-treated tissue revealed collagen type I positive fibres (red) in
capsule periphery. Nuclei (blue) were visualised by 40 ,6-diamidino-2-phenylindole
(DAPI).
4. Discussion
PLLA is applied predominantly to the face. Clinical studies have
demonstrated successful augmentation of soft tissue volume [1–
4]. The mode of action underlying the augmenting effect has not
been studied to date. Here, foreign body granulomas with
numerous FBGCs, surrounding birefringent PLLA particles, were
visualised by light microscopy. FBR to foreign material involves
three successive events, namely protein absorption, cell recruit-
ment and fibrotic encapsulation [13]. The differentiation of
fibroblasts to myofibroblasts is a characteristic of the formation
of granulation tissue [37].
To confirm FBR to PLLA, we characterised the cell infiltrate of
PLLA-treated tissue by immunofluorescence and found CD68+ cells
in proximity to PLLA, and CD90+ cells further away. CD68 and CD90
are established markers for macrophages and fibroblasts respec-
tively. Higgins and colleagues detected F4/80+ (mouse equivalent
to CD68) macrophages in the first row of cells adjacent to nylon
meshes in mice i.e. at the implant/tissue interface, while Klinge and
colleagues found more than 80% of CD68+ cells in human explant
meshes [38,39]. Macrophages are the key cells in FBR, inducing
macrophage phenotypes have been described [40]. Here, the
dominant M2a subtype may have transformed to the later
dominant M2c type. M2a produces IL-10, the collagen precursor
polyamine, as well as PDGFB. They fuse to FBGC to encapsulate
foreign bodies (Fig. 1) [29,40]. IL-10 induces the M2c phenotype to
produce even more IL-10 and high amounts of TGFb1 inducing
fibrosis [40]. This hypothesis would not only explain the early up-
regulation of PDGFB mRNA expression (only after the first
injection), but also the late strong expression of TGFb1 mRNA
with respect to the early and consistently increased collagen type I
and type III mRNA expression.
Immunofluorescence staining of PLLA-treated tissue revealed
substantial deposition of collagen type III, which was adjacent to
the PLLA within the granuloma, while collagen type I fibres were
stained only in the periphery of the encapsulating tissue.
Significantly elevated mRNA expression of collagen type I and III
was noted immediately after the first PLLA injection and lasted up
to 10 months after the last treatment. Based on the finding that
mRNA and protein abundance correlate with a coefficient factor of
0.4–0.6 [41,42], we predict that collagen type I and III proteins are
most likely deposited in different areas of PLLA-treated tissue.
Capsule tissue that formed around silastic hydroxyapatite
stained positive for collagen type III, while in rabbits the capsule
tissue forming around titanium oxide and hydroxyapatite initially
stained positive for collagen type III, but the staining diminished
over time as collagen type I content increased [43,44]. In contrast, a
significant increase in the mean level of type I collagen was found
by Goldman in PLLA-treated tissue [45]. At first sight, this finding
contrasts with our findings; however, it is likely that tissue
samples from the periphery of the PLLA-encapsulating tissue were
examined in this previous study, and hence, PLLA particles were
not visible on the presented photomicrographs. This would in turn
support our collagen type I mRNA results and collagen type I
peripheral staining.
In our study, the mRNA expression of TGFb1 significantly
increased after the first, and again from the fourth, injection in
month 10 onward. This finding did not entirely meet general
expectations, hence the mediator of collagen synthesis would be
expected to be constantly elevated after the first PLLA injection,
similar to Higgins et al. and Li et al. It is also expected to be elevated

Fig. 6. Elevated mRNA expression of TGFb1 and TIMP1 10 months after the initial PLLA injection, and remarkably enhanced until month 20. Basal gene expression of TGFb1
(a) and TIMP1 (b) prior to PLLA injection is represented by the first three bars (group A, B, C). The next four bars represent mRNA expression 2 weeks after each PLLA injection
for the indicated groups. The second last bar represents mRNA expression 8 months and the last bar 10 months after the last PLLA injection. Mean normalised mRNA
expression is illustrated at different time points as mean  SD from triplicate samples of seven individuals. *P < 0.05.
Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.099-46
32 P. Stein et al. / Journal of Dermatological Science 78 (2015) 26–33
prior to collagen mRNA synthesis [38,46]. Most likely, TGFb1
mRNA expression was upregulated immediately after the first
PLLA injection prior to collagen mRNA synthesis within the first
two weeks after PLLA injection. At the time of the first biopsy, i.e.
two weeks after the PLLA injection, TGFb1 mRNA expression was
already decreasing. The strongly elevated TGFb1 mRNA expression
observed 10 months after the initial PLLA injection might reflect
the above-described M2a-M2c subtype transition.
TGFb1 stimulates fibroblasts to differentiate into myofibro-
blasts, which are characterised by aSMA [25]. aSMA-positive
structures revealed myofibroblasts close to PLLA particles, and
smooth muscle cells in the neovascularised granulation tissue
further away. Immunofluorescence staining of capsule tissue
formed around polyurethane-coated implants in rats revealed an
elevated collagen I content, aSMA-positive vascular structures and
myofibroblasts [46]. On day 55, collagen type I staining entirely
dominated the tissue and aSMA was not detectable. These findings
correspond with our observations.
PDGF serves as a chemoattractant and together with CTGF and
TGFb as a mitogen for fibroblasts [47]. PDGF also promotes
myofibroblast proliferation [26]. To determine whether PDGFB
and CTGF are upregulated after PLLA injections, their mRNA
expression was analysed accordingly. Interestingly the mRNA
expression of both cytokines was upregulated after the first injection
and then returned back to baseline (Fig. S1). The upregulation of
PDGFB and CTGF transcripts after the initial PLLA injection may
explain the elevated numbers of fibroblasts and myofibroblasts.
Correspondingly, an increased number of CTGF transcripts were
found in the capsule tissue surrounding implanted foreign bodies on
days 7, 21, and 48–55 [48]. Moreover, PDGFB and CTGF are powerful
collagen-inducing growth factors [49,50]. The chosen biopsy time
might explain their mRNA upregulation after the first PLLA injection.
Elevated PDGFB mRNA expression may be due to the earlier
dominant M2a subtype. Hence, the earlier dominant M2a subtype
expresses PDGFB, while the mRNA is upregulated (primarily) two
weeks after the first PLLA injection.
TGFb reduces the expression of MMP and enhances that of
TIMP [51]. The mRNA expression of TIMP1 corresponded to the
expression pattern of TGFb1, being significantly upregulated two
weeks and 10 months after the initial PLLA injection. Abundant
PLLA might not only continuously stimulate collagen synthesis, but
also that of TIMP1.
Polarised light microscopy revealed PLLA particles in punch
biopsies of 38% of PLLA-treated volunteers. FBR was observed in all
PLLA-positive tissues. Furthermore, even 28 months after the last
PLLA injection, an abundance of particles was detected in one
biopsy. These findings contrast with those of Lemperle et al. and
Vleggaar and Bauer [9,10], who showed the complete degradation
of particles nine months and 30 months, respectively, after PLLA
injection. A comparison of particle shape and size 28 months after
the last injection with that observed 10 months after the last
injection revealed no significant change in the particles shape or
size. Reszko and colleagues confirmed the presence of PLLA three
years after its injection [52]. It is thus likely that PLLA is degraded
more slowly than was reported previously.
Blind punch biopsies may not coincide with PLLA-injected
depots. Therefore, in the present study, PLLA injections were
administered next to the initial biopsy scar, which was used as a
marker for further consecutive biopsies. Even so, we only found
PLLA particles in the biopsies of one individual after the second
injection and after the fourth injection in the tissues of eight
individuals. Thus, despite these measures plus the accumulation
of PLLA depots over time, 62% of the biopsies did not contain
PLLA.
The biological mechanism generating the desired augmenting
effect is most likely mediated by macrophages and FBGCs that
recognise PLLA as a foreign body. They recruit and stimulate
fibroblasts via TGFb1 to proliferate and differentiate into myofi-
broblasts. (Myo-)fibroblasts encapsulate PLLA particles with colla-
gen type III and deposit fibrotic collagen type I in the capsule
periphery. Hence PLLA is degraded in human tissue at a much slower
pace than previously assumed by several authors, and the use of
PLLA for augmentation should be given further consideration.
References
[1] Schierle CF, Casas LA. Nonsurgical rejuvenation of the aging face with in-
jectable poly-L-lactic acid for restoration of soft tissue volume. Aesthet Surg J
2011;31:95–109.
[2] Bartus C, William Hanke C, Daro-Kaftan E. A decade of experience with
injectable poly-L-lactic acid: a focus on safety. Dermatol Surg 2013;39:
698–705.
[3] Fitzgerald R, Vleggaar D. Facial volume restoration of the aging face with poly-
L-lactic acid. Dermatol Ther 2011;24:2–27.
[4] Palm MD, Woodhall KE, Butterwick KJ, Goldman MP. Cosmetic use of poly-L-
lactic acid: a retrospective study of 130 patients. Dermatol Surg 2010;36:
161–170.
[5] Cutright DE, Hunsuck EE. Tissue reaction to the biodegradable polylactic acid
suture. Oral Surg Oral Med Oral Pathol 1971;31:134–9.
[6] Brady JM, Cutright DE, Miller RA, Barristone GC. Resorption rate, route, route of
elimination, and ultrastructure of the implant site of polylactic acid in the
abdominal wall of the rat. J Biomed Mater Res 1973;7:155–66.
[7] Kulkarni RK, Pani KC, Neuman C, Leonard F. Polylactic acid for surgical
implants. Arch Surg 1966;93:839–43.
[8] Gogolewski S, Jovanovic M, Perren SM, Dillon JG, Hughes MK. Tissue response
and in vivo degradation of selected polyhydroxyacids: polylactides (PLA),
poly(3-hydroxybutyrate) (PHB), and poly(3-hydroxybutyrate-co-3-hydroxy-
valerate) (PHB/VA). J Biomed Mater Res 1993;27:1135–48.
[9] Lemperle G, Morhenn V, Charrier U. Human histology and persistence of
various injectable filler substances for soft tissue augmentation. Aesthetic
Plast Surg 2003;27:354–66. discussion 367.
[10] Vleggaar D, Bauer U. Facial enhancement and the European experience with
Sculptra (poly-L-lactic acid). J Drugs Dermatol 2004;3:542–7.
[11] Goldberg D, Guana A, Volk A, Daro-Kaftan E. Single-arm study for the charac-
terization of human tissue response to injectable poly-L-lactic acid. Dermatol
Surg 2013;39:915–22.
[12] Anderson JM, Rodriguez A, Chang DT. Foreign body reaction to biomaterials.
Semin Immunol 2008;20:86–100.
[13] Junge K, Binnebosel M, von Trotha KT, Rosch R, Klinge U, Neumann UP, et al.
Mesh biocompatibility: effects of cellular inflammation and tissue remodel-
ling. Langenbecks Arch Surg 2012;397:255–70.
[14] Amini AR, Wallace JS, Nukavarapu SP. Short-term and long-term effects of
orthopedic biodegradable implants. J Long Term Eff Med Implants 2011;21:
93–122.
[15] Wilson CJ, Clegg RE, Leavesley DI, Pearcy MJ. Mediation of biomaterial–cell
interactions by adsorbed proteins: a review. Tissue Eng 2005;11:1–18.
[16] Jenney CR, Anderson JM. Adsorbed serum proteins responsible for surface
dependent human macrophage behavior. J Biomed Mater Res 2000;49:
435–447.
[17] Tang L, Eaton JW. Fibrin(ogen) mediates acute inflammatory responses to
biomaterials. J Exp Med 1993;178:2147–56.
[18] Berton G, Lowell CA. Integrin signalling in neutrophils and macrophages. Cell
Signal 1999;11:621–35.
[19] Tang L, Jennings TA, Eaton JW. Mast cells mediate acute inflammatory
responses to implanted biomaterials. Proc Natl Acad Sci U S A 1998;95:
8841–6.
[20] Zdolsek J, Eaton JW, Tang L. Histamine release and fibrinogen adsorption
mediate acute inflammatory responses to biomaterial implants in humans. J
Transl Med 2007;5.
[21] Broughton 2nd G, Janis JE, Attinger CE. The basic science of wound healing.
Plast Reconstr Surg 2006;117:12S–34S.
[22] Heldin CH, Eriksson U, Ostman A. New members of the platelet-derived
growth factor family of mitogens. Arch Biochem Biophys 2002;398:
284–90.
[23] Postlethwaite AE, Keski-Oja J, Moses HL, Kang AH. Stimulation of the chemo-
tactic migration of human fibroblasts by transforming growth factor beta. J
Exp Med 1987;165:251–6.
[24] Assoian RK, Sporn MB. Type beta transforming growth factor in human
platelets: release during platelet degranulation and action on vascular smooth
muscle cells. J Cell Biol 1986;102:1217–23.
[25] Desmouliere A, Geinoz A, Gabbiani F, Gabbiani G. Transforming growth factor-
beta 1 induces alpha-smooth muscle actin expression in granulation tissue
myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol
1993;122:103–11.
[26] Bonner JC. Regulation of PDGF and its receptors in fibrotic diseases. Cytokine
Growth Factor Rev 2004;15:255–73.
[27] DeFife KM, Jenney CR, McNally AK, Colton E, Anderson JM. Interleukin-13
induces human monocyte/macrophage fusion and macrophage mannose
receptor expression. J Immunol 1997;158:3385–90.
Licensed to Andressa Thomazzoni - andressathomazzoni123@gmail.com - 046.377.099-46
P. Stein et al. / Journal of Dermatological Science 78 (2015) 26–33
[28] Helming L, Gordon S. Macrophage fusion induced by IL-4 alternative activation
is a multistage process involving multiple target molecules. Eur J Immunol
2007;37:33–42.
[29] Song E, Ouyang N, Horbelt M, Antus B, Wang M, Exton MS. Influence of
alternatively and classically activated macrophages on fibrogenic activities
of human fibroblasts. Cell Immunol 2000;204:19–28.
[30] Fisher GJ, Varani J, Voorhees JJ. Looking older: fibroblast collapse and thera-
peutic implications. Arch Dermatol 2008;144:666–72.
[31] Wang F, Garza LA, Kang S, Varani J, Orringer JS, Fisher GJ, et al. In vivo
stimulation of de novo collagen production caused by cross-linked hyaluronic
acid dermal filler injections in photodamaged human skin. Arch Dermatol
2007;143:155–63.
[32] Quan T, Wang F, Shao Y, Rittie L, Xia W, Orringer JS, et al. Enhancing structural
support of the dermal microenvironment activates fibroblasts, endothelial
cells, and keratinocytes in aged human skin in vivo. J Invest Dermatol
2013;133:658–67. http://dx.doi.org/10.1038/jid.2012.364.
[33] Akamine R, Yamamoto T, Watanabe M, Yamazaki N, Kataoka M, Ishikawa M,
et al. Usefulness of the 50 region of the cDNA encoding acidic ribosomal
phosphoprotein P0 conserved among rats, mice, and humans as a standard
probe for gene expression analysis in different tissues and animal species. J
Biochem Biophys Methods 2007;70:481–6.
[34] Simon P. Q-gene: processing quantitative real-time RT-PCR data. Bioinformat-
ics 2003;19:1439–40.
[35] Lemperle G, Morhenn VB, Pestonjamasp V, Gallo RL. Migration studies and
histology of injectable microspheres of different sizes in mice. Plast Reconstr
Surg 2004;113:1380–90.
[36] Zimmermann US, Clerici TJ. The histological aspects of fillers complications.
Semin Cutan Med Surg 2004;23:241–50.
[37] Gabbiani G, Le Lous M, Bailey AJ, Bazin S, Delaunay A. Collagen and myofi-
broblasts of granulation tissue. A chemical, ultrastructural and immunologic
study. Virchows Arch B Cell Pathol 1976;21:133–45.
[38] Higgins DM, Basaraba RJ, Hohnbaum AC, Lee EJ, Grainger DW, Gonzalez-
Juarrero M. Localized immunosuppressive environment in the foreign body
response to implanted biomaterials. Am J Pathol 2009;175:161–70.
[39] Klinge U, Dietz U, Fet N, Klosterhalfen B. Characterisation of the cellular
infiltrate in the foreign body granuloma of textile meshes with its impact
on collagen deposition. Hernia 2014;18(4):571–8.
33
[40] Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine
system in diverse forms of macrophage activation and polarization. Trends
Immunol 2004;25:677–86.
[41] Vogel C, Marcotte EM. Insights into the regulation of protein abundance from
proteomic and transcriptomic analyses. Nat Rev Genet 2012;13:227–32.
[42] Maier T, Guell M, Serrano L. Correlation of mRNA and protein in complex
biological samples. FEBS Lett 2009;583:3966–73.
[43] von Recum AF, Opitz H, Wu E. Collagen types I and III at the implant/tissue
interface. J Biomed Mater Res 1993;27:757–61.
[44] Tan XW, Beuerman RW, Shi ZL, Neoh KG, Tan D, Khor KA, et al. In vivo
evaluation of titanium oxide and hydroxyapatite as an artificial cornea skirt.
J Mater Sci Mater Med 2012;23:1063–72.
[45] Goldman MP. Cosmetic use of poly-L-lactic acid: my technique for success and
minimizing complications. Dermatol Surg 2011;37:688–93.
[46] Li AG, Quinn MJ, Siddiqui Y, Wood MD, Federiuk IF, Duman HM, et al. Elevation
of transforming growth factor beta (TGFbeta) and its downstream mediators
in Aubcutaneous foreign body capsule tissue. J Biomed Mater Res A
2007;82:498–508.
[47] Werner S, Grose R. Regulation of wound healing by growth factors and
cytokines. Physiol Rev 2003;83:835–70.
[48] Ward WK, Li AG, Siddiqui Y, Federiuk IF, Wang XJ. Increased expression of
Interleukin-13 and connective tissue growth factor, and their potential roles
during foreign body encapsulation of subcutaneous implants. J Biomater Sci
Polym Ed 2008;19:1065–72.
[49] Mazaheri MK, Schultz GS, Blalock TD, Caffee HH, Chin GA. Role of connective
tissue growth factor in breast implant elastomer capsular formation. Ann Plast
Surg 2003;50:263–8. discussion 268.
[50] Kim MS, Song HJ, Lee SH, Lee CK. Comparative study of various growth factors
and cytokines on type I collagen and hyaluronan production in human dermal
fibroblasts. J Cosmet Dermatol 2014;13:44–51.
[51] Hall MC, Young DA, Waters JG, Rowan AD, Chantry A, Edwards DR, et al. The
comparative role of activator protein 1 and Smad factors in the regulation of
Timp-1 and MMP-1 gene expression by transforming growth factor-beta 1. J
Biol Chem 2003;278:10304–13.
[52] Reszko AE, Sadick NS, Magro CM, Farber J. Late-onset subcutaneous
nodules after poly-L-lactic acid injection. Dermatol Surg 2009;35(Suppl. 1):
380–4.